WorldWideScience

Sample records for ifn response elements

  1. The IFN Response in Bats Displays Distinctive IFN-Stimulated Gene Expression Kinetics with Atypical RNASEL Induction.

    Science.gov (United States)

    De La Cruz-Rivera, Pamela C; Kanchwala, Mohammed; Liang, Hanquan; Kumar, Ashwani; Wang, Lin-Fa; Xing, Chao; Schoggins, John W

    2018-01-01

    Bats host a large number of zoonotic viruses, including several viruses that are highly pathogenic to other mammals. The mechanisms underlying this rich viral diversity are unknown, but they may be linked to unique immunological features that allow bats to act as asymptomatic viral reservoirs. Vertebrates respond to viral infection by inducing IFNs, which trigger antiviral defenses through IFN-stimulated gene (ISG) expression. Although the IFN system of several bats is characterized at the genomic level, less is known about bat IFN-mediated transcriptional responses. In this article, we show that IFN signaling in bat cells from the black flying fox ( Pteropus alecto ) consists of conserved and unique ISG expression profiles. In IFN-stimulated cells, bat ISGs comprise two unique temporal subclusters with similar early induction kinetics but distinct late-phase declines. In contrast, human ISGs lack this decline phase and remained elevated for longer periods. Notably, in unstimulated cells, bat ISGs were expressed more highly than their human counterparts. We also found that the antiviral effector 2-5A-dependent endoribonuclease, which is not an ISG in humans, is highly IFN inducible in black flying fox cells and contributes to cell-intrinsic control of viral infection. These studies reveal distinctive innate immune features that may underlie a unique virus-host relationship in bats. Copyright © 2017 by The American Association of Immunologists, Inc.

  2. Stat1-independent regulation of gene expression in response to IFN

    Science.gov (United States)

    Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.

    2001-01-01

    Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994

  3. Post-transcriptional regulation of macrophage ABCA1, an early response gene to IFN

    International Nuclear Information System (INIS)

    Alfaro Leon, Martha Leticia; Evans, Glenn F.; Farmen, Mark W.; Zuckerman, Steven H.

    2005-01-01

    Interferon-γ (IFN-γ) down-regulates receptors associated with reverse cholesterol transport including ABCA1. In the present study, the kinetics and mechanism of ABCA1 down-regulation were determined in mouse peritoneal macrophages. IFN-γ decreased ABCA1 mRNA 1 h following IFN-γ addition and was maximally reduced by 3 h. Down-regulation was protein synthesis dependent and involved post-transcriptional processes. ABCA1 message had a T 1/2 of 115 min in actinomycin treated cells that was reduced to a T 1/2 of 37 min by IFN-γ. The decrease in message stability was also associated with a rapid loss of ABCA1 protein, significant 3 h following IFN-γ addition. The kinetics of ABCA1 message and protein decrease was consistent with the early IFN-γ-induced changes in Stat1 phosphorylation and nuclear translocation observed in these cells. Therefore, ABCA1 can be considered as an early response gene to macrophage activation by IFN-γ with down-regulation occurring by message destabilization

  4. Injury-Induced Type I IFN Signaling Regulates Inflammatory Responses in the Central Nervous System

    DEFF Research Database (Denmark)

    Khorooshi, Reza; Owens, Trevor

    2010-01-01

    Innate glial response is critical for the induction of inflammatory mediators and recruitment of leukocytes to sites of the injury in the CNS. We have examined the involvement of type I IFN signaling in the mouse hippocampus following sterile injury (transection of entorhinal afferents). Type I I...

  5. Role of IL-12 and IFN-γ in immune response to toxoplasma gondii infection

    International Nuclear Information System (INIS)

    Moawad, M.A.F.; ElGawish, M.A.M.

    2004-01-01

    Interlenkin 12 (IL-12) is a potent immunoregulatory molecule that is critically involved in a wide range of diseases. In several murine models of intracellular infection, endogenous IL-12 has been shown to be crucial for the generation of a protective Th1 response in a primary infection for a intracellular pathogens. Interferon-gamma (IFN-γ) is also an important mediator of cellular immunity against microbial pathogens and tumor cells due to its potent capacity to activate macrophages for enhanced cytotoxicity. The aim of the present study is to evaluate the immune response to toxoplasma gondii after primary inflection (infected groups and secondary infection (re-infected groups for over 19 weeks (the time of the experiment). the evaluation was assessed by measurements of levels of IL-12 and IFN-γ using ELISA technique in the sera of these infected rats. The results demonstrated that the primary immune response induced a fluctuation in the levels of IL-12 in the sera of infected rats, which reached maximum value of 122.6 ±1.4 pg/ml after 15 weeks of primary infection. While, in the challenged groups (secondary immune response, re-infected groups) the levels of IL-12 were generally lower than that of the primary immune response. On the other hand, IFN-γ levels increased significantly in the secondary immune response (re-infected groups) as compared to primary immune response 9 infected groups) In conclusion, the results suggest that IL-12 might have a role in the defense mechanism against intracellular infection with T-gondii especially in primary immune response than in the secondary immune response. This is in contrast to IFN-γ that takes the up-hand in secondary immune response to T-gondii infection

  6. Proteolysis of MDA5 and IPS-1 is not required for inhibition of the type I IFN response by poliovirus.

    Science.gov (United States)

    Kotla, Swathi; Gustin, Kurt E

    2015-10-06

    The type I interferon (IFN) response is a critical component of the innate immune response to infection by RNA viruses and is initiated via recognition of viral nucleic acids by RIG-like receptors (RLR). Engagement of these receptors in the cytoplasm initiates a signal transduction pathway leading to activation of the transcription factors NF-κB, ATF-2 and IRF-3 that coordinately upregulate transcription of type I IFN genes, such as that encoding IFN-β. In this study the impact of poliovirus infection on the type I interferon response has been examined. The type I IFN response was assessed by measuring IFN-β mRNA levels using qRT-PCR and normalizing to levels of β-actin mRNA. The status of host factors involved in activation of the type I IFN response was examined by immunoblot, immunofluorescence microcopy and qRT-PCR. The results show that poliovirus infection results in induction of very low levels of IFN-β mRNA despite clear activation of NF-κB and ATF-2. In contrast, analysis of IRF-3 revealed no transcriptional induction of an IRF-3-responsive promoter or homodimerization of IRF-3 indicating it is not activated in poliovirus-infected cells. Exposure of poliovirus-infected cells to poly(I:C) results in lower levels of IFN-β mRNA synthesis and IRF-3 activation compared to mock-infected cells. Analysis of MDA-5 and IPS-1 revealed that these components of the RLR pathway were largely intact at times when the type I IFN response was suppressed. Collectively, these results demonstrate that poliovirus infection actively suppresses the host type I interferon response by blocking activation of IRF-3 and suggests that this is not mediated by cleavage of MDA-5 or IPS-1.

  7. To achieve an earlier IFNresponse is not sufficient to control Mycobacterium tuberculosis infection in mice.

    Science.gov (United States)

    Vilaplana, Cristina; Prats, Clara; Marzo, Elena; Barril, Carles; Vegué, Marina; Diaz, Jorge; Valls, Joaquim; López, Daniel; Cardona, Pere-Joan

    2014-01-01

    The temporo-spatial relationship between the three organs (lung, spleen and lymph node) involved during the initial stages of Mycobacterium tuberculosis infection has been poorly studied. As such, we performed an experimental study to evaluate the bacillary load in each organ after aerosol or intravenous infection and developed a mathematical approach using the data obtained in order to extract conclusions. The results showed that higher bacillary doses result in an earlier IFNresponse, that a certain bacillary load (BL) needs to be reached to trigger the IFNresponse, and that control of the BL is not immediate after onset of the IFNresponse, which might be a consequence of the spatial dimension. This study may have an important impact when it comes to designing new vaccine candidates as it suggests that triggering an earlier IFNresponse might not guarantee good infection control, and therefore that additional properties should be considered for these candidates.

  8. The chicken TH1 response: potential therapeutic applications of ChIFN-γ.

    Science.gov (United States)

    Guo, Pengju; Thomas, Jesse D; Bruce, Matthew P; Hinton, Tracey M; Bean, Andrew G D; Lowenthal, John W

    2013-11-01

    The outcomes of viral infections are costly in terms of human and animal health and welfare worldwide. The observed increase in the virulence of some viruses and failure of many vaccines to stop these infections has lead to the apparent need to develop new anti-viral strategies. One approach to dealing with viral infection may be to employ the therapeutic administration of recombinant cytokines to act as 'immune boosters' to assist in augmenting the host response to virus. With this in mind, a greater understanding of the immune response, particularly cell mediated T-helper-1 (TH1) type responses, is imperative to the development of new anti-viral and vaccination strategies. Following the release of the chicken genome, a number of TH1-type cytokines have been identified, including chicken interleukin-12 (ChIL-12), ChIL-18 and interferon-γ ChIFN-γ), highlighting the nature of the TH1-type response in this non-mammalian vertebrate. To date a detailed analysis of the in vivo biological function of these cytokines has been somewhat hampered by access to large scale production techniques. This review describes the role of TH-1 cytokines in immune responses to viruses and explores their potential use in enhancing anti-viral treatment strategies in chickens. Furthermore, this review focuses on the example of ChIFN-γ treatment of Chicken Anemia Virus (CAV) infection. CAV causes amongst other things thymocyte depletion and thymus atrophy, as well as immunosuppression in chickens. However, due to vaccination, clinical disease appears less often, nevertheless, the subclinical form of the disease is often associated with secondary complicating infections due to an immunocompromised state. Since CAV-induced immunosuppression can cause a marked decrease in the immune response against other pathogens, understanding this aspect of the disease is critically important, as well as providing insights into developing new control approaches. With increasing emphasis on developing

  9. Clinical trials using IFN-α as a vaccine adjuvant: new strategies for the molecular monitoring of the immune response

    International Nuclear Information System (INIS)

    Belardelli, F.; Arico, E.; Marincola, F.; Wang, E.

    2009-01-01

    The main general objective of this project was to define immunotherapy protocols based on the new concept of using IFN-a as and immune adjuvant, developing innovative methodologies suitable for predicting and monitoring the immunological and clinical responses. Specific aim of developing new micro arrays technologies particularly suitable for a molecular tracking and prediction of the response to IFN of cytokine-treated patients

  10. MyD88 and STING signaling pathways are required for IRF3-mediated IFN-β induction in response to Brucella abortus infection.

    Directory of Open Access Journals (Sweden)

    Leonardo A de Almeida

    Full Text Available Type I interferons (IFNs are cytokines that orchestrate diverse immune responses to viral and bacterial infections. Although typically considered to be most important molecules in response to viruses, type I IFNs are also induced by most, if not all, bacterial pathogens. In this study, we addressed the role of type I IFN signaling during Brucella abortus infection, a facultative intracellular bacterial pathogen that causes abortion in domestic animals and undulant fever in humans. Herein, we have shown that B. abortus induced IFN-β in macrophages and splenocytes. Further, IFN-β induction by Brucella was mediated by IRF3 signaling pathway and activates IFN-stimulated genes via STAT1 phosphorylation. In addition, IFN-β expression induced by Brucella is independent of TLRs and TRIF signaling but MyD88-dependent, a pathway not yet described for Gram-negative bacteria. Furthermore, we have identified Brucella DNA as the major bacterial component to induce IFN-β and our study revealed that this molecule operates through a mechanism dependent on RNA polymerase III to be sensed probably by an unknown receptor via the adaptor molecule STING. Finally, we have demonstrated that IFN-αβR KO mice are more resistant to infection suggesting that type I IFN signaling is detrimental to host control of Brucella. This resistance phenotype is accompanied by increased IFN-γ and NO production by IFN-αβR KO spleen cells and reduced apoptosis.

  11. MyD88 and STING Signaling Pathways Are Required for IRF3-Mediated IFN-β Induction in Response to Brucella abortus Infection

    Science.gov (United States)

    de Almeida, Leonardo A.; Carvalho, Natalia B.; Oliveira, Fernanda S.; Lacerda, Thais L. S.; Vasconcelos, Anilton C.; Nogueira, Lucas; Bafica, Andre; Silva, Aristóbolo M.; Oliveira, Sergio C.

    2011-01-01

    Type I interferons (IFNs) are cytokines that orchestrate diverse immune responses to viral and bacterial infections. Although typically considered to be most important molecules in response to viruses, type I IFNs are also induced by most, if not all, bacterial pathogens. In this study, we addressed the role of type I IFN signaling during Brucella abortus infection, a facultative intracellular bacterial pathogen that causes abortion in domestic animals and undulant fever in humans. Herein, we have shown that B. abortus induced IFN-β in macrophages and splenocytes. Further, IFN-β induction by Brucella was mediated by IRF3 signaling pathway and activates IFN-stimulated genes via STAT1 phosphorylation. In addition, IFN-β expression induced by Brucella is independent of TLRs and TRIF signaling but MyD88-dependent, a pathway not yet described for Gram-negative bacteria. Furthermore, we have identified Brucella DNA as the major bacterial component to induce IFN-β and our study revealed that this molecule operates through a mechanism dependent on RNA polymerase III to be sensed probably by an unknown receptor via the adaptor molecule STING. Finally, we have demonstrated that IFN-αβR KO mice are more resistant to infection suggesting that type I IFN signaling is detrimental to host control of Brucella. This resistance phenotype is accompanied by increased IFN-γ and NO production by IFN-αβR KO spleen cells and reduced apoptosis. PMID:21829705

  12. Deficiency of the AIM2-ASC Signal Uncovers the STING-Driven Overreactive Response of Type I IFN and Reciprocal Depression of Protective IFN-γ Immunity in Mycobacterial Infection.

    Science.gov (United States)

    Yan, Shanshan; Shen, Hongbo; Lian, Qiaoshi; Jin, Wenlong; Zhang, Ronghua; Lin, Xuan; Gu, Wangpeng; Sun, Xiaoyu; Meng, Guangxun; Tian, Zhigang; Chen, Zheng W; Sun, Bing

    2018-02-01

    The nucleic acids of Mycobacterium tuberculosis can be detected by intracellular DNA sensors, such as cyclic GMP-AMP synthase and absent in melanoma 2 (AIM2), which results in the release of type I IFN and the proinflammatory cytokine IL-1β. However, whether cross-talk occurs between AIM2-IL-1β and cyclic GMP-AMP synthase-type I IFN signaling upon M. tuberculosis infection in vivo is unclear. In this article, we demonstrate that mycobacterial infection of AIM2 -/- mice reciprocally induces overreactive IFN-β and depressive IFNresponses, leading to higher infection burdens and more severe pathology. We also describe the underlying mechanism whereby activated apoptosis-associated speck-like protein interacts with a key adaptor, known as stimulator of IFN genes (STING), and inhibits the interaction between STING and downstream TANK-binding kinase 1 in bone marrow-derived macrophages and bone marrow-derived dendritic cells, consequently reducing the induction of type I IFN. Of note, apoptosis-associated speck-like protein expression is inversely correlated with IFN-β levels in PBMCs from tuberculosis patients. These data demonstrate that the AIM2-IL-1β signaling pathway negatively regulates the STING-type I IFN signaling pathway by impeding the association between STING and TANK-binding kinase 1, which protects the host from M. tuberculosis infection. This finding has potential clinical significance. Copyright © 2018 by The American Association of Immunologists, Inc.

  13. IFN-γ fails to overcome inhibition of selected macrophage activation events in response to pathogenic mycobacteria.

    Directory of Open Access Journals (Sweden)

    Shyamala Thirunavukkarasu

    Full Text Available According to most models of mycobacterial infection, inhibition of the pro-inflammatory macrophage immune responses contributes to the persistence of bacteria. Mycobacterium avium subsp. paratuberculosis (MAP is a highly successful pathogen in cattle and sheep and is also implicated as the causative agent of Crohn's disease in humans. Pathogenic mycobacteria such as MAP have developed multiple strategies to evade host defence mechanisms including interfering with the macrophages' capacity to respond to IFN-γ, a feature which might be lacking in non-pathogenic mycobacteria such as M. smegmatis. We hypothesized that pre-sensitisation of macrophages with the pro-inflammatory cytokine IFN-γ would help in overcoming the inhibitory effect of MAP or its antigens on macrophage inflammatory responses. Herein we have compared a series of macrophage activation parameters in response to MAP and M. smegmatis as well as mycobacterial antigens. While IFN-γ did overcome the inhibition in immune suppressive mechanisms in response to MAP antigen as well as M. smegmatis, we could not find a clear role for IFN-γ in overcoming the inhibition of macrophage inflammatory responses to the pathogenic mycobacterium, MAP. We demonstrate that suppression of macrophage defence mechanisms by pathogenic mycobacteria is unlikely to be overcome by prior sensitization with IFN-γ alone. This indicates that IFN-γ signaling pathway-independent mechanisms may exist for overcoming inhibition of macrophage effector functions in response to pathogenic mycobacteria. These findings have important implications in understanding the survival mechanisms of pathogenic mycobacteria directed towards finding better therapeutics and vaccination strategies.

  14. Upregulation of B7 molecules (CD80 and CD86) and exacerbated eosinophilic pulmonary inflammatory response in mice lacking the IFN-beta gene

    DEFF Research Database (Denmark)

    Matheu, Victor; Treschow, Alexandra; Navikas, Vaidrius

    2003-01-01

    . OBJECTIVE: We sought to define the differential role of endogenous IFN-beta in controlling the development of allergic inflammation. METHODS: We assessed whether deletion of the gene encoding IFN-beta (IFNB) with knockout mice participated in the development of allergic response in ovalbumin (OVA......BACKGROUND: IFN-beta has been shown to be effective as therapy for multiple sclerosis. Some reports attributed its beneficial effects to the capacity to induce a T(H)2 response. However, other studies have suggested that endogenous type I IFN might downregulate the allergic response in mice...

  15. Interferon-gamma (IFN-gamma) treatment decreases the inflammatory response in chronic Pseudomonas aeruginosa pneumonia in rats

    DEFF Research Database (Denmark)

    Johansen, H K; Hougen, H P; Rygaard, J

    1996-01-01

    In a rat model of chronic Pseudomonas aeruginosa lung infection mimicking cystic fibrosis (CF), we studied whether the inflammatory response could be altered by intraperitoneal treatment with recombinant rat interferon-gamma (rrIFN-gamma). Rats were treated either before or after intratracheal ch...

  16. TLR2-dependent inhibition of macrophage responses to IFN-gamma is mediated by distinct, gene-specific mechanisms.

    Directory of Open Access Journals (Sweden)

    Sarah A Benson

    2009-07-01

    Full Text Available Mycobacterium tuberculosis uses multiple mechanisms to avoid elimination by the immune system. We have previously shown that M. tuberculosis can inhibit selected macrophage responses to IFN-gamma through TLR2-dependent and -independent mechanisms. To specifically address the role of TLR2 signaling in mediating this inhibition, we stimulated macrophages with the specific TLR2/1 ligand Pam(3CSK(4 and assayed responses to IFN-gamma. Pam(3CSK(4 stimulation prior to IFN-gamma inhibited transcription of the unrelated IFN-gamma-inducible genes, CIITA and CXCL11. Surface expression of MHC class II and secretion of CXCL11 were greatly reduced as well, indicating that the reduction in transcripts had downstream effects. Inhibition of both genes required new protein synthesis. Using chromatin immunoprecipitation, we found that TLR2 stimulation inhibited IFN-gamma-induced RNA polymerase II binding to the CIITA and CXCL11 promoters. Furthermore, TATA binding protein was unable to bind the TATA box of the CXCL11 promoter, suggesting that assembly of transcriptional machinery was disrupted. However, TLR2 stimulation affected chromatin modifications differently at each of the inhibited promoters. Histone H3 and H4 acetylation was reduced at the CIITA promoter but unaffected at the CXCL11 promoter. In addition, NF-kappaB signaling was required for inhibition of CXCL11 transcription, but not for inhibition of CIITA. Taken together, these results indicate that TLR2-dependent inhibition of IFN-gamma-induced gene expression is mediated by distinct, gene-specific mechanisms that disrupt binding of the transcriptional machinery to the promoters.

  17. Endogenous IL-22 Plays a Dual Role in Arthritis: Regulation of Established Arthritis via IFNResponses

    Science.gov (United States)

    Justa, Shivali; Zhou, Xiaoqun; Sarkar, Sujata

    2014-01-01

    Objective IL-22 is elevated in patients with inflammatory arthritis and correlates with disease activity. IL-22 deficient mice have reduced incidence of arthritis. Recombinant IL-22 restrains progression of arthritis via increase in IL-10 responses when administered prior to onset of arthritis. These findings imply a possible dual role of IL-22 in inflammatory arthritis depending on the phase of arthritis. Experiments outlined here were designed to elucidate the contribution of endogenous IL-22 before and after the onset of arthritis. Methods Collagen induced arthritis (CIA) was induced in DBA1 or IFN-γ deficient mice following immunization with collagen and complete Freund's adjuvant. Anti-IL-22 antibody or isotype control were administered prior to or after onset of arthritis and disease progression assessed by clinical scoring and histopathology. IL-22, IL-17 and IFNresponses were measured by ELISA and flowcytometry. Anti-collagen antibody responses were analyzed by ELISA. Expression of IL-22R1 in CD4+ cells was elucidated by flowcytometry and real time PCR. Results Collagen specific IL-22 responses were expanded during arthritis and IL-22 producing cells were discrete from IL-17 or IFN-γ producing cells. Neutralization of IL-22 after onset of arthritis resulted in significant increase in Th1 responses and significantly reduced severity of arthritis. CD4+ cells from arthritic mice showed increased surface expression of IL-22R1. In vitro, CD4+T cells cultured with antigen presenting cells in the presence or absence of IL-22 suppressed or induced IFN-γ, respectively. The protective effect of anti-IL-22 was reversed in IFN-γ deficient mice. Moreover, administration of anti-IL-22 prior to onset of arthritis augmented arthritis severity. Conclusion We show for the first time that IL-22 plays a dual role: protective prior to the onset of arthritis and pathogenic after onset of arthritis. The pathogenic effect of IL-22 is dependent on suppression of IFN

  18. Apoptotic-cell-derived membrane microparticles and IFN-α induce an inflammatory immune response.

    Science.gov (United States)

    Niessen, Anna; Heyder, Petra; Krienke, Stefan; Blank, Norbert; Tykocinski, Lars-Oliver; Lorenz, Hanns-Martin; Schiller, Martin

    2015-07-15

    A dysregulation in the clearance of apoptotic material is considered a major pathogenetic factor for the emergence of autoimmune diseases. Apoptotic-cell-derived membrane microparticles (AdMPs), which are released from the cell surface during apoptosis, have been implicated in the pathogenesis of autoimmunity. Also of importance are cytokines, such as interferon-α (IFN-α), which is known to be a major player in patients with systemic lupus erythematosus (SLE). This study investigates the combined effect of AdMPs and IFN-α on professional phagocytes. In the presence of IFN-α, phagocytosis of AdMPs by human monocytes was significantly increased in a dose-dependent manner. The combination of AdMPs and raised IFN-α concentrations resulted in an increase in the secretion of pro-inflammatory cytokines and an upregulation of surface molecule expression involved in antigen uptake. In addition, macrophage polarisation was shifted towards a more inflammatory type of cell. The synergism between IFN-α and AdMPs seemed to be mediated by an upregulation of phosphorylated STAT1. Our results indicate that IFN-α, together with AdMPs, amplify the initiation and maintenance of inflammation. This mechanism might especially play a crucial role in disorders with a defective clearance of apoptotic material. © 2015. Published by The Company of Biologists Ltd.

  19. Melanoma cells treated with GGTI and IFN-gamma allow murine vaccination and enhance cytotoxic response against human melanoma cells.

    Directory of Open Access Journals (Sweden)

    Guillaume Sarrabayrouse

    Full Text Available BACKGROUND: Suboptimal activation of T lymphocytes by melanoma cells is often due to the defective expression of class I major histocompatibility antigens (MHC-I and costimulatory molecules. We have previously shown that geranylgeranyl transferase inhibition (done with GGTI-298 stimulates anti-melanoma immune response through MHC-I and costimulatory molecule expression in the B16F10 murine model [1]. METHODOLOGY/PRINCIPAL FINDINGS: In this study, it is shown that vaccination with mIFN-gand GGTI-298 pretreated B16F10 cells induces a protection against untreated tumor growth and pulmonary metastases implantation. Furthermore, using a human melanoma model (LB1319-MEL, we demonstrated that in vitro treatment with hIFN-gamma and GGTI-298 led to the up regulation of MHC-I and a costimulatory molecule CD86 and down regulation of an inhibitory molecule PD-1L. Co-culture experiments with peripheral blood mononuclear cells (PBMC revealed that modifications induced by hIFN-gamma and GGTI-298 on the selected melanoma cells, enables the stimulation of lymphocytes from HLA compatible healthy donors. Indeed, as compared with untreated melanoma cells, pretreatment with hIFN-gamma and GGTI-298 together rendered the melanoma cells more efficient at inducing the: i activation of CD8 T lymphocytes (CD8+/CD69+; ii proliferation of tumor-specific CD8 T cells (MelanA-MART1/TCR+; iii secretion of hIFN-gamma; and iv anti-melanoma specific cytotoxic cells. CONCLUSIONS/SIGNIFICANCE: These data indicate that pharmacological treatment of melanoma cell lines with IFN-gamma and GGTI-298 stimulates their immunogenicity and could be a novel approach to produce tumor cells suitable for vaccination and for stimulation of anti-melanoma effector cells.

  20. HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin

    Science.gov (United States)

    Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago

    2014-01-01

    AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN

  1. Mycobacterium tuberculosis decreases human macrophage IFNresponsiveness through miR-132 and miR-26a.

    Science.gov (United States)

    Ni, Bin; Rajaram, Murugesan V S; Lafuse, William P; Landes, Michelle B; Schlesinger, Larry S

    2014-11-01

    IFN-γ-activated macrophages play an essential role in controlling intracellular pathogens; however, macrophages also serve as the cellular home for the intracellular pathogen Mycobacterium tuberculosis. Based on previous evidence that M. tuberculosis can modulate host microRNA (miRNA) expression, we examined the miRNA expression profile of M. tuberculosis-infected primary human macrophages. We identified 31 differentially expressed miRNAs in primary human macrophages during M. tuberculosis infection by NanoString and confirmed our findings by quantitative real-time RT-PCR. In addition, we determined a role for two miRNAs upregulated upon M. tuberculosis infection, miR-132 and miR-26a, as negative regulators of transcriptional coactivator p300, a component of the IFN-γ signaling cascade. Knockdown expression of miR-132 and miR-26a increased p300 protein levels and improved transcriptional, translational, and functional responses to IFN-γ in human macrophages. Collectively, these data validate p300 as a target of miR-132 and miR-26a, and demonstrate a mechanism by which M. tuberculosis can limit macrophage responses to IFN-γ by altering host miRNA expression. Copyright © 2014 by The American Association of Immunologists, Inc.

  2. Enhanced Dendritic Cell-Mediated Antigen-Specific CD4+ T Cell Responses: IFN-Gamma Aids TLR Stimulation

    Directory of Open Access Journals (Sweden)

    Kuo-Ching Sheng

    2013-01-01

    Full Text Available Phenotypic maturation and T cell stimulation are two functional attributes of DCs critical for immune induction. The combination of antigens, including those from cancer, with Toll-like receptor (TLR ligands induces far superior cellular immune responses compared to antigen alone. In this study, IFN-gamma treatment of bone marrow-derived DC, followed by incubation with the TLR2, TLR4, or TLR9 agonists, enhanced DC activation compared to TLR ligation alone. Most notably, the upregulation of CD40 with LPS stimulation and CD86 with CpG stimulation was observed in in vitro cultures. Similarly, IFN-gamma coinjected with TLR ligands was able to promote DC activation in vivo, with DCs migrating from the site of immunization to the popliteal lymph nodes demonstrating increased expression of CD80 and CD86. The heightened DC activation translated to a drastic increase in T cell stimulatory capacity in both antigen independent and antigen dependent fashions. This is the first time that IFN-gamma has been shown to have a combined effect with TLR ligation to enhance DC activation and function. The results demonstrate the novel use of IFN-gamma together with TLR agonists to enhance antigen-specific T cell responses, for applications in the development of enhanced vaccines and drug targets against diseases including cancer.

  3. In Vivo Visualizing the IFNResponse Required for Tumor Growth Control in a Therapeutic Model of Polyadenylic-Polyuridylic Acid Administration.

    Science.gov (United States)

    Nocera, David Andrés; Roselli, Emiliano; Araya, Paula; Nuñez, Nicolás Gonzalo; Lienenklaus, Stefan; Jablonska, Jadwiga; Weiss, Siegfried; Gatti, Gerardo; Brinkmann, Melanie M; Kröger, Andrea; Morón, Gabriel; Maccioni, Mariana

    2016-03-15

    The crucial role that endogenously produced IFN-β plays in eliciting an immune response against cancer has recently started to be elucidated. Endogenous IFN-β has an important role in immune surveillance and control of tumor development. Accordingly, the role of TLR agonists as cancer therapeutic agents is being revisited via the strategy of intra/peritumoral injection with the idea of stimulating the production of endogenous type I IFN inside the tumor. Polyadenylic-polyuridylic acid (poly A:U) is a dsRNA mimetic explored empirically in cancer immunotherapy a long time ago with little knowledge regarding its mechanisms of action. In this work, we have in vivo visualized the IFN-β required for the antitumor immune response elicited in a therapeutic model of poly A:U administration. In this study, we have identified the role of host type I IFNs, cell populations that are sources of IFN-β in the tumor microenvironment, and other host requirements for tumor control in this model. One single peritumoral dose of poly A:U was sufficient to induce IFN-β, readily visualized in vivo. IFN-β production relied mainly on the activation of the transcription factor IFN regulatory factor 3 and the molecule UNC93B1, indicating that TLR3 is required for recognizing poly A:U. CD11c(+) cells were an important, but not the only source of IFN-β. Host type I IFN signaling was absolutely required for the reduced tumor growth, prolonged mice survival, and the strong antitumor-specific immune response elicited upon poly A:U administration. These findings add new perspectives to the use of IFN-β-inducing compounds in tumor therapy. Copyright © 2016 by The American Association of Immunologists, Inc.

  4. Role of IFN-gamma and IL-6 in a protective immune response to Yersinia enterocolitica in mice

    Directory of Open Access Journals (Sweden)

    Autenrieth Ingo B

    2008-09-01

    Full Text Available Abstract Background Yersinia outer protein (Yop H is a secreted virulence factor of Yersinia enterocolitica (Ye, which inhibits phagocytosis of Ye and contributes to the virulence of Ye in mice. The aim of this study was to address whether and how YopH affects the innate immune response to Ye in mice. Results For this purpose, mice were infected with wild type Ye (pYV+ or a YopH-deficient Ye mutant strain (ΔyopH. CD11b+ cells were isolated from the infected spleen and subjected to gene expression analysis using microarrays. Despite the attenuation of ΔyopH in vivo, by variation of infection doses we were able to achieve conditions that allow comparison of gene expression in pYV+ and ΔyopH infection, using either comparable infection courses or splenic bacterial burden. Gene expression analysis provided evidence that expression levels of several immune response genes, including IFN-γ and IL-6, are high after pYV+ infection but low after sublethal ΔyopH infection. In line with these findings, infection of IFN-γR-/- and IL-6-/- mice with pYV+ or ΔyopH revealed that these cytokines are not necessarily required for control of ΔyopH, but are essential for defense against infection with the more virulent pYV+. Consistently, IFN-γ pretreatment of bone marrow derived macrophages (BMDM strongly enhanced their ability in killing intracellular Ye bacteria. Conclusion In conclusion, this data suggests that IFN-γ-mediated effector mechanisms can partially compensate virulence exerted by YopH. These results shed new light on the protective role of IFN-γ in Ye wild type infections.

  5. Ceramide formation is involved in Lactobacillus acidophilus-induced IFN-beta response in dendritic cells

    DEFF Research Database (Denmark)

    Fuglsang, Eva; Henningsen, Louise; Frøkiær, Hanne

    of sphingomyelin to ceramide by acid sphingomyelinase (ASMase) at the outer leaflet of the PM is a key event in endocytosis of gram-positive Lactobacillus acidophilus (L. acidophilus) and the subsequent induction of IFN-beta in DCs and, as the gram-negative Escherichia coli (E. coli) does not induce appreciable...

  6. Inflammation in the CNS and Th17 Responses Are Inhibited by IFN-{gamma}-Induced IL-18 Binding Protein

    DEFF Research Database (Denmark)

    Millward, Jason M; Pedersen, Morten Løbner; Wheeler, Rachel D

    2010-01-01

    Inflammatory responses are essential for immune protection but may also cause pathology and must be regulated. Both Th1 and Th17 cells are implicated in the pathogenesis of autoimmune inflammatory diseases, such as multiple sclerosis. We show in this study that IL-18-binding protein (IL-18bp......), the endogenous inhibitor of the Th1-promoting cytokine IL-18, is upregulated by IFN-gamma in resident microglial cells in the CNS during multiple sclerosis-like disease in mice. Test of function by overexpression of IL-18bp in the CNS using a viral vector led to marked reduction in Th17 responses and robust...... inhibition of incidence, severity, and histopathology of disease, independently of IFN-gamma. The disease-limiting action of IL-18bp included suppression of APC-derived Th17-polarizing cytokines. IL-18bp thus acts as a sensor for IFN-gamma and can regulate both Th1 and Th17 responses in the CNS....

  7. Increased TNF-alpha/IFN-gamma/IL-2 and decreased TNF-alpha/IFN-gamma production by central memory T cells are associated with protective responses against bovine tuberculosis following BCG vaccination

    Directory of Open Access Journals (Sweden)

    Mayara Fernanda Maggioli

    2016-10-01

    Full Text Available Central memory T cells (Tcm and polyfunctional CD4 T cell responses contribute to vaccine-elicited protection with both human and bovine tuberculosis (TB; however, their combined role in protective immunity to TB is unclear. To address this question, we evaluated polyfunctional cytokine responses by CD4 T cell effector / memory populations from bacille Calmette Guerin (BCG vaccinated and non-vaccinated calves prior to and after aerosol challenge with virulent Mycobacterium bovis. Polyfunctional cytokine expression patterns in the response by Tcm, effector memory, and effector T cell subsets were similar between BCG-vaccinated and M. bovis-infected calves; only differing in magnitude (i.e., infected > vaccinated. BCG vaccination, however, did alter the kinetics of the ensuing response to virulent M. bovis infection. Early after challenge (three weeks post-infection, non-vaccinates had greater antigen-specific IFN-γ/TNF-α and lesser IFN-γ/TNF-α/IL-2 responses by Tcm cells than did vaccinated animals. Importantly, these differences were also associated with mycobacterial burden upon necropsy. Polyfunctional responses to ESAT-6:CFP10 (antigens not synthesized by BCG strains were detected in memory subsets, as well as in effector cells, as early as three weeks after challenge. These findings suggest that cell fate divergence may occur early after antigen priming in the response to bovine TB and that memory and effector T cells may expand concurrently during the initial phase of the immune response. In summary, robust IFN-γ/TNF-α response by Tcm cells is associated with greater mycobacterial burden while IFN-γ/TNF-α/IL-2 response by Tcm cells are indicative of a protective response to bovine TB.

  8. Reduced IFN-γ and IL-10 responses to paternal antigens during and after pregnancy in allergic women.

    Science.gov (United States)

    Persson, Marie; Ekerfelt, Christina; Ernerudh, Jan; Matthiesen, Leif; Abelius, Martina Sandberg; Jonsson, Yvonne; Berg, Göran; Jenmalm, Maria C

    2012-09-01

    Normal pregnancy and allergy are both characterized by a T helper (Th) 2 deviation. In the current study, we hypothesized that paternal antigen-induced cytokine responses during pregnancy would be deviated toward Th2 and an anti-inflammatory profile, and that the Th2 deviation would be more pronounced in allergic pregnant women. Blood samples were collected longitudinally on three occasions during pregnancy and two occasions post partum (pp). Of the 86 women initially included, 54 women had a normal pregnancy and completed the sampling procedures. Twelve women fulfilled the criteria for allergy (allergic symptoms and circulating immunoglobulin [Ig] E antibodies to inhalant allergens) and 20 were non-allergic (nonsensitized without symptoms). The levels of Th1- and Th2-associated cytokines and chemokines, the Th17 cytokine IL-17 and the anti-inflammatory cytokine IL-10 of the groups were compared. Paternal antigen-induced IL-4 and IL-10 responses increased between the first and the third trimester. Allergy was associated with decreased paternal antigen-induced IFN-γ and CXCL10 secretion in the nonpregnant state (one year pp) and also decreased IFN-γ/IL-4 and IFN-γ/IL-13 ratios during pregnancy. We also observed a decreased paternal antigen-induced IL-10 response in allergic compared with non-allergic women during pregnancy, along with a decreased IL-10/IL-13 ratio. In conclusion, our findings support the hypothesis of lower Th1 responses toward paternal antigens in allergic than in non-allergic women, but also indicate that allergy is associated with a lower capacity to induce anti-inflammatory IL-10 responses after paternal antigen stimulation during pregnancy. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  9. ORF7-encoded accessory protein 7a of feline infectious peritonitis virus as a counteragent against IFN-α-induced antiviral response.

    Science.gov (United States)

    Dedeurwaerder, Annelike; Olyslaegers, Dominique A J; Desmarets, Lowiese M B; Roukaerts, Inge D M; Theuns, Sebastiaan; Nauwynck, Hans J

    2014-02-01

    The type I IFN-mediated immune response is the first line of antiviral defence. Coronaviruses, like many other viruses, have evolved mechanisms to evade this innate response, ensuring their survival. Several coronavirus accessory genes play a central role in these pathways, but for feline coronaviruses this has never to our knowledge been studied. As it has been demonstrated previously that ORF7 is essential for efficient replication in vitro and virulence in vivo of feline infectious peritonitis virus (FIPV), the role of this ORF in the evasion of the IFN-α antiviral response was investigated. Deletion of ORF7 from FIPV strain 79-1146 (FIPV-Δ7) rendered the virus more susceptible to IFN-α treatment. Given that ORF7 encodes two proteins, 7a and 7b, it was further explored which of these proteins is active in this mechanism. Providing 7a protein in trans rescued the mutant FIPV-Δ7 from IFN sensitivity, which was not achieved by addition of 7b protein. Nevertheless, addition of protein 7a to FIPV-Δ3Δ7, a FIPV mutant deleted in both ORF3 and ORF7, could no longer increase the replication capacity of this mutant in the presence of IFN. These results indicate that FIPV 7a protein is a type I IFN antagonist and protects the virus from the antiviral state induced by IFN, but it needs the presence of ORF3-encoded proteins to exert its antagonistic function.

  10. IFN-γ, IL-4 and IL-13 modulate responsiveness of human airway smooth muscle cells to IL-13

    Directory of Open Access Journals (Sweden)

    Michoud Marie-Claire

    2008-12-01

    Full Text Available Abstract Background IL-13 is a critical mediator of allergic asthma and associated airway hyperresponsiveness. IL-13 acts through a receptor complex comprised of IL-13Rα1 and IL-4Rα subunits with subsequent activation of signal transducer and activator of transcription 6 (STAT6. The IL-13Rα2 receptor may act as a decoy receptor. In human airway smooth muscle (HASM cells, IL-13 enhances cellular proliferation, calcium responses to agonists and induces eotaxin production. We investigated the effects of pre-treatment with IL-4, IL-13 and IFN-γ on the responses of HASM cells to IL-13. Methods Cultured HASM were examined for expression of IL-13 receptor subunits using polymerase chain reaction, immunofluorescence microscopy and flow cytometry. Effects of cytokine pre-treatment on IL-13-induced cell responses were assessed by looking at STAT6 phosphorylation using Western blot, eotaxin secretion and calcium responses to histamine. Results IL-13Rα1, IL-4Rα and IL-13Rα2 subunits were expressed on HASM cells. IL-13 induced phosphorylation of STAT6 which reached a maximum by 30 minutes. Pre-treatment with IL-4, IL-13 and, to a lesser degree, IFN-γ reduced peak STAT6 phosphorylation in response to IL-13. IL-13, but not IFN-γ, pre-treatment abrogated IL-13-induced eotaxin secretion. Pre-treatment with IL-4 or IL-13 abrogated IL-13-induced augmentation of the calcium transient evoked by histamine. Cytokine pre-treatment did not affect expression of IL-13Rα1 and IL-4Rα but increased expression of IL-13Rα2. An anti-IL-13Rα2 neutralizing antibody did not prevent the cytokine pre-treatment effects on STAT6 phosphorylation. Cytokine pre-treatment increased SOCS-1, but not SOCS-3, mRNA expression which was not associated with significant increases in protein expression. Conclusion Pre-treatment with IL-4 and IL-13, but not IFN-γ, induced desensitization of the HASM cells to IL-13 as measured by eotaxin secretion and calcium transients to histamine

  11. Modulation of inflammasome-mediated pulmonary immune activation by type I IFNs protects bone marrow homeostasis during systemic responses to Pneumocystis lung infection.

    Science.gov (United States)

    Searles, Steve; Gauss, Katherine; Wilkison, Michelle; Hoyt, Teri R; Dobrinen, Erin; Meissner, Nicole

    2013-10-01

    Although acquired bone marrow failure (BMF) is considered a T cell-mediated autoimmune disease, possible innate immune defects as a cause for systemic immune deviations in response to otherwise innocuous infections have not been extensively explored. In this regard, we recently demonstrated an important role of type I IFNs in protecting hematopoiesis during systemic stress responses to the opportunistic fungal pathogen Pneumocystis in lymphocyte-deficient mice. Mice deficient in both lymphocytes and type I IFN receptor (IFrag(-/-) mice) develop rapidly progressing BMF due to accelerated bone marrow (BM) cell apoptosis associated with innate immune deviations in the BM in response to Pneumocystis lung infection. However, the communication pathway between lung and BM eliciting the induction of BMF in response to this strictly pulmonary infection has been unclear. In this study, we report that absence of an intact type I IFN system during Pneumocystis lung infection not only causes BMF in lymphocyte-deficient mice but also transient BM stress in lymphocyte-competent mice. This is associated with an exuberant systemic IFNresponse. IFN-γ neutralization prevented Pneumocystis lung infection-induced BM depression in type I IFN receptor-deficient mice and prolonged neutrophil survival time in BM from IFrag(-/-) mice. IL-1β and upstream regulators of IFN-γ, IL-12, and IL-18 were also upregulated in lung and serum of IFrag(-/-) mice. In conjunction, there was exuberant inflammasome-mediated caspase-1 activation in pulmonary innate immune cells required for processing of IL-18 and IL-1β. Thus, absence of type I IFN signaling during Pneumocystis lung infection may result in deregulation of inflammasome-mediated pulmonary immune activation, causing systemic immune deviations triggering BMF in this model.

  12. Highly Pathogenic H5N1 Influenza A Virus Strains Provoke Heterogeneous IFN-α/β Responses That Distinctively Affect Viral Propagation in Human Cells

    Science.gov (United States)

    Matthaei, Markus; Budt, Matthias; Wolff, Thorsten

    2013-01-01

    The fatal transmissions of highly pathogenic avian influenza A viruses (IAV) of the H5N1 subtype to humans and high titer replication in the respiratory tract indicate that these pathogens can overcome the bird-to-human species barrier. While type I interferons (IFN-α/β) are well described to contribute to the species barrier of many zoonotic viruses, current data to the role of these antiviral cytokines during human H5N1 IAV infections is limited and contradictory. We hypothesized an important role for the IFN system in limiting productive infection of avian H5N1 strains in human cells. Hence, we examined IFN-α/β gene activation by different avian and human H5N1 isolates, if the IFN-α/β response restricts H5N1 growth and whether the different strains were equally capable to regulate the IFN-α/β system via their IFN-antagonistic NS1 proteins. Two human H5N1 isolates and a seasonal H3N2 strain propagated efficiently in human respiratory cells and induced little IFN-β, whereas three purely avian H5N1 strains were attenuated for replication and provoked higher IFN secretion. Replication of avian viruses was significantly enhanced on interferon-deficient cells, and exogenous IFN potently limited the growth of all strains in human cells. Moreover, IFN-α/β activation by all strains depended on retinoic acid-inducible gene I excluding principal differences in receptor activation between the different viruses. Interestingly, all H5N1 NS1 proteins suppressed IFN-α/β induction comparably well to the NS1 of seasonal IAV. Thus, our study shows that H5N1 strains are heterogeneous in their capacity to activate human cells in an NS1-independent manner. Our findings also suggest that H5N1 viruses need to acquire adaptive changes to circumvent strong IFN-α/β activation in human host cells. Since no single amino acid polymorphism could be associated with a respective high- or low induction phenotype we propose that the necessary adaptations to overcome the human IFN

  13. Highly pathogenic H5N1 influenza A virus strains provoke heterogeneous IFN-α/β responses that distinctively affect viral propagation in human cells.

    Directory of Open Access Journals (Sweden)

    Markus Matthaei

    Full Text Available The fatal transmissions of highly pathogenic avian influenza A viruses (IAV of the H5N1 subtype to humans and high titer replication in the respiratory tract indicate that these pathogens can overcome the bird-to-human species barrier. While type I interferons (IFN-α/β are well described to contribute to the species barrier of many zoonotic viruses, current data to the role of these antiviral cytokines during human H5N1 IAV infections is limited and contradictory. We hypothesized an important role for the IFN system in limiting productive infection of avian H5N1 strains in human cells. Hence, we examined IFN-α/β gene activation by different avian and human H5N1 isolates, if the IFN-α/β response restricts H5N1 growth and whether the different strains were equally capable to regulate the IFN-α/β system via their IFN-antagonistic NS1 proteins. Two human H5N1 isolates and a seasonal H3N2 strain propagated efficiently in human respiratory cells and induced little IFN-β, whereas three purely avian H5N1 strains were attenuated for replication and provoked higher IFN secretion. Replication of avian viruses was significantly enhanced on interferon-deficient cells, and exogenous IFN potently limited the growth of all strains in human cells. Moreover, IFN-α/β activation by all strains depended on retinoic acid-inducible gene I excluding principal differences in receptor activation between the different viruses. Interestingly, all H5N1 NS1 proteins suppressed IFN-α/β induction comparably well to the NS1 of seasonal IAV. Thus, our study shows that H5N1 strains are heterogeneous in their capacity to activate human cells in an NS1-independent manner. Our findings also suggest that H5N1 viruses need to acquire adaptive changes to circumvent strong IFN-α/β activation in human host cells. Since no single amino acid polymorphism could be associated with a respective high- or low induction phenotype we propose that the necessary adaptations to

  14. Both CD4+ and CD8+ Lymphocytes Participate in the IFNResponse to Filamentous Hemagglutinin from Bordetella pertussis in Infants, Children, and Adults

    Directory of Open Access Journals (Sweden)

    Violette Dirix

    2012-01-01

    Full Text Available Infant CD4+ T-cell responses to bacterial infections or vaccines have been extensively studied, whereas studies on CD8+ T-cell responses focused mainly on viral and intracellular parasite infections. Here we investigated CD8+ T-cell responses upon Bordetella pertussis infection in infants, children, and adults and pertussis vaccination in infants. Filamentous hemagglutinin-specific IFN-γ secretion by circulating lymphocytes was blocked by anti-MHC-I or -MHC-II antibodies, suggesting that CD4+ and CD8+ T lymphocytes are involved in IFN-γ production. Flow cytometry analyses confirmed that both cell types synthesized antigen-specific IFN-γ, although CD4+ lymphocytes were the major source of this cytokine. IFN-γ synthesis by CD8+ cells was CD4+ T cell dependent, as evidenced by selective depletion experiments. Furthermore, IFN-γ synthesis by CD4+ cells was sometimes inhibited by CD8+ lymphocytes, suggesting the presence of CD8+ regulatory T cells. The role of this dual IFN-γ secretion by CD4+ and CD8+ T lymphocytes in pertussis remains to be investigated.

  15. Co-incubation with IL-18 potentiates antigen-specific IFNresponse in a whole-blood stimulation assay for measurement of cell-mediated immune responses in pigs experimentally infected with Lawsonia intracellularis

    DEFF Research Database (Denmark)

    Riber, Ulla; Boesen, Henriette Toft; Jakobsen, Jeanne Toft

    2011-01-01

    The whole-blood interferon-gamma (IFN-γ) assay is a quantitative in-vitro assay for a direct read out of Ag-specific cell-mediated immune (CMI) responses to infectious diseases. The IFN-γ assay is robust in severe intracellular infections like Brucella or mycobacteria, but more difficult to evalu......The whole-blood interferon-gamma (IFN-γ) assay is a quantitative in-vitro assay for a direct read out of Ag-specific cell-mediated immune (CMI) responses to infectious diseases. The IFN-γ assay is robust in severe intracellular infections like Brucella or mycobacteria, but more difficult...

  16. Characterisation of vaccine-induced, broadly cross-reactive IFN-γ secreting T cell responses that correlate with rapid protection against classical swine fever virus.

    Science.gov (United States)

    Graham, Simon P; Haines, Felicity J; Johns, Helen L; Sosan, Olubukola; La Rocca, S Anna; Lamp, Benjamin; Rümenapf, Till; Everett, Helen E; Crooke, Helen R

    2012-04-05

    Live attenuated C-strain classical swine fever viruses (CSFV) provide a rapid onset of protection, but the lack of a serological test that can differentiate vaccinated from infected animals limits their application in CSF outbreaks. Since immunity may precede antibody responses, we examined the kinetics and specificity of peripheral blood T cell responses from pigs vaccinated with a C-strain vaccine and challenged after five days with a genotypically divergent CSFV isolate. Vaccinated animals displayed virus-specific IFNresponses from day 3 post-challenge, whereas, unvaccinated challenge control animals failed to mount a detectable response. Both CD4(+) and cytotoxic CD8(+) T cells were identified as the cellular source of IFN-γ. IFNresponses showed extensive cross-reactivity when T cells were stimulated with CSFV isolates spanning the major genotypes. To determine the specificity of these responses, T cells were stimulated with recombinant CSFV proteins and a proteome-wide peptide library from a related virus, BVDV. Major cross-reactive peptides were mapped on the E2 and NS3 proteins. Finally, IFN-γ was shown to exert potent antiviral effects on CSFV in vitro. These data support the involvement of broadly cross-reactive T cell IFNresponses in the rapid protection conferred by the C-strain vaccine and this information should aid the development of the next generation of CSFV vaccines. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  17. IRF-3, IRF-5, and IRF-7 coordinately regulate the type I IFN response in myeloid dendritic cells downstream of MAVS signaling.

    Directory of Open Access Journals (Sweden)

    Helen M Lazear

    2013-01-01

    Full Text Available Although the transcription factors IRF-3 and IRF-7 are considered master regulators of type I interferon (IFN induction and IFN stimulated gene (ISG expression, Irf3(-/-×Irf7(-/- double knockout (DKO myeloid dendritic cells (mDC produce relatively normal levels of IFN-β after viral infection. We generated Irf3(-/-×Irf5(-/-×Irf7(-/- triple knockout (TKO mice to test whether IRF-5 was the source of the residual induction of IFN-β and ISGs in mDCs. In pathogenesis studies with two unrelated positive-sense RNA viruses (West Nile virus (WNV and murine norovirus, TKO mice succumbed at rates greater than DKO mice and equal to or approaching those of mice lacking the type I IFN receptor (Ifnar(-/-. In ex vivo studies, after WNV infection or exposure to Toll-like receptor agonists, TKO mDCs failed to produce IFN-β or express ISGs. In contrast, this response was sustained in TKO macrophages following WNV infection. To define IRF-regulated gene signatures, we performed microarray analysis on WNV-infected mDC from wild type (WT, DKO, TKO, or Ifnar(-/- mice, as well as from mice lacking the RIG-I like receptor adaptor protein MAVS. Whereas the gene induction pattern in DKO mDC was similar to WT cells, remarkably, almost no ISG induction was detected in TKO or Mavs(-/- mDC. The relative equivalence of TKO and Mavs(-/- responses suggested that MAVS dominantly regulates ISG induction in mDC. Moreover, we showed that MAVS-dependent induction of ISGs can occur through an IRF-5-dependent yet IRF-3 and IRF-7-independent pathway. Our results establish IRF-3, -5, and -7 as the key transcription factors responsible for mediating the type I IFN and ISG response in mDC during WNV infection and suggest a novel signaling link between MAVS and IRF-5.

  18. Comprehensive Antiretroviral Restriction Factor Profiling Reveals the Evolutionary Imprint of the ex Vivo and in Vivo IFNResponse in HTLV-1-Associated Neuroinflammation

    Directory of Open Access Journals (Sweden)

    Fabio E. Leal

    2018-05-01

    Full Text Available HTLV-1-Associated Myelopathy (HAM/TSP is a progressive neuroinflammatory disorder for which no disease-modifying treatment exists. Modest clinical benefit from type I interferons (IFN-α/β in HAM/TSP contrasts with its recently identified IFN-inducible gene signature. In addition, IFN-α treatment in vivo decreases proviral load and immune activation in HAM/TSP, whereas IFN-β therapy decreases tax mRNA and lymphoproliferation. We hypothesize this “IFN paradox” in HAM/TSP might be explained by both cell type- and gene-specific effects of type I IFN in HTLV-1-associated pathogenesis. Therefore, we analyzed ex vivo transcriptomes of CD4+ T cells, PBMCs and whole blood in healthy controls, HTLV-1-infected individuals, and HAM/TSP patients. First, we used a targeted approach, simultaneously quantifying HTLV-1 mRNA (HBZ, Tax, proviral load and 42 host genes with known antiretroviral (anti-HIV activity in purified CD4+ T cells. This revealed two major clusters (“antiviral/protective” vs. “proviral/deleterious”, as evidenced by significant negative (TRIM5/TRIM22/BST2 vs. positive correlation (ISG15/PAF1/CDKN1A with HTLV-1 viral markers and clinical status. Surprisingly, we found a significant inversion of antiretroviral activity of host restriction factors, as evidenced by opposite correlation to in vivo HIV-1 vs. HTLV-1 RNA levels. The anti-HTLV-1 effect of antiviral cluster genes was significantly correlated to their adaptive chimp/human evolution score, for both Tax mRNA and PVL. Six genes of the proposed antiviral cluster underwent lentivirus-driven purifying selection during primate evolution (TRIM5/TRIM22/BST2/APOBEC3F-G-H, underscoring the cross-retroviral evolutionary imprint. Secondly, we examined the genome-wide type I IFN response in HAM/TSP patients, following short-term ex vivo culture of PBMCs with either IFN-α or IFN-β. Microarray analysis evidenced 12 antiretroviral genes (including TRIM5α/TRIM22/BST2 were significantly

  19. Comprehensive Antiretroviral Restriction Factor Profiling Reveals the Evolutionary Imprint of the ex Vivo and in Vivo IFNResponse in HTLV-1-Associated Neuroinflammation.

    Science.gov (United States)

    Leal, Fabio E; Menezes, Soraya Maria; Costa, Emanuela A S; Brailey, Phillip M; Gama, Lucio; Segurado, Aluisio C; Kallas, Esper G; Nixon, Douglas F; Dierckx, Tim; Khouri, Ricardo; Vercauteren, Jurgen; Galvão-Castro, Bernardo; Saraiva Raposo, Rui Andre; Van Weyenbergh, Johan

    2018-01-01

    HTLV-1-Associated Myelopathy (HAM/TSP) is a progressive neuroinflammatory disorder for which no disease-modifying treatment exists. Modest clinical benefit from type I interferons (IFN-α/β) in HAM/TSP contrasts with its recently identified IFN-inducible gene signature. In addition, IFN-α treatment in vivo decreases proviral load and immune activation in HAM/TSP, whereas IFN-β therapy decreases tax mRNA and lymphoproliferation. We hypothesize this "IFN paradox" in HAM/TSP might be explained by both cell type- and gene-specific effects of type I IFN in HTLV-1-associated pathogenesis. Therefore, we analyzed ex vivo transcriptomes of CD4 + T cells, PBMCs and whole blood in healthy controls, HTLV-1-infected individuals, and HAM/TSP patients. First, we used a targeted approach, simultaneously quantifying HTLV-1 mRNA (HBZ, Tax), proviral load and 42 host genes with known antiretroviral (anti-HIV) activity in purified CD4 + T cells. This revealed two major clusters ("antiviral/protective" vs. "proviral/deleterious"), as evidenced by significant negative (TRIM5/TRIM22/BST2) vs. positive correlation (ISG15/PAF1/CDKN1A) with HTLV-1 viral markers and clinical status. Surprisingly, we found a significant inversion of antiretroviral activity of host restriction factors, as evidenced by opposite correlation to in vivo HIV-1 vs. HTLV-1 RNA levels. The anti-HTLV-1 effect of antiviral cluster genes was significantly correlated to their adaptive chimp/human evolution score, for both Tax mRNA and PVL. Six genes of the proposed antiviral cluster underwent lentivirus-driven purifying selection during primate evolution (TRIM5/TRIM22/BST2/APOBEC3F-G-H), underscoring the cross-retroviral evolutionary imprint. Secondly, we examined the genome-wide type I IFN response in HAM/TSP patients, following short-term ex vivo culture of PBMCs with either IFN-α or IFN-β. Microarray analysis evidenced 12 antiretroviral genes (including TRIM5α/TRIM22/BST2) were significantly up-regulated by IFN

  20. Incubation of whole blood at 39°C augments gamma interferon (IFN-γ)-induced protein 10 and IFNresponses to Mycobacterium tuberculosis antigens

    DEFF Research Database (Denmark)

    Aabye, Martine G; Ravn, Pernille; Johansen, Isik S

    2011-01-01

    A rarely challenged dogma in cell-mediated immune (CMI) assays is the incubation temperature, 37°C. Fever augments proinflammatory immune responses in vivo, and the aim of this study was to explore whether incubation at fever-range temperature could increase antigen-specific biomarker responses. We...

  1. Early IFN-gamma production after YF 17D vaccine virus immunization in mice and its association with adaptive immune responses.

    Directory of Open Access Journals (Sweden)

    Patrícia C C Neves

    Full Text Available Yellow Fever vaccine is one of the most efficacious human vaccines ever made. The vaccine (YF 17D virus induces polyvalent immune responses, with a mixed TH1/TH2 CD4(+ cell profile, which results in robust T CD8(+ responses and high titers of neutralizing antibody. In recent years, it has been suggested that early events after yellow fever vaccination are crucial to the development of adequate acquired immunity. We have previously shown that primary immunization of humans and monkeys with YF 17D virus vaccine resulted in the early synthesis of IFN-γ. Herein we have demonstrated, for the first time that early IFN-γ production after yellow fever vaccination is a feature also of murine infection and is much more pronounced in the C57BL/6 strain compared to the BALB/c strain. Likewise, in C57BL/6 strain, we have observed the highest CD8(+ T cells responses as well as higher titers of neutralizing antibodies and total anti-YF IgG. Regardless of this intense IFNresponse in mice, it was not possible to see higher titers of IgG2a in relation to IgG1 in both mice lineages. However, IgG2a titers were positively correlated to neutralizing antibodies levels, pointing to an important role of IFN-γ in eliciting high quality responses against YF 17D, therefore influencing the immunogenicity of this vaccine.

  2. IFNL4 ss469415590 Variant Is Associated with Treatment Response in Japanese HCV Genotype 1 Infected Individuals Treated with IFN-Including Regimens

    Directory of Open Access Journals (Sweden)

    Tatsuo Miyamura

    2014-01-01

    Full Text Available Aim. Eradication of hepatitis C virus (HCV is still challenging even if interferon- (IFN- free regimens with direct-acting antiviral agents (DAAs for HCV-infected individuals are available in clinical practice. IFNL4 is a newly described protein, associated with human antiviral defenses. We investigated whether IFNL4 ss469415590 variant has an effect on the prediction of treatment response in HCV-infected patients treated with IFN-including regimens. Patients and Methods. In all, 185 patients infected with HCV genotype 1 treated with peg-IFN plus ribavirin, with or without telaprevir, were genotyped for IFNL4 ss469415590. We retrospectively investigated whether the role of IFNL4 ss469415590 variant and other factors could predict sustained virological response (SVR in Japanese patients infected with HCV genotype 1. Results. There were 65.7%, 31.5%, and 2.8% patients in the IFNL4 ss469415590 TT/TT, TT/-G, and -G/-G groups, respectively. SVR rates were 82.1% or 49.3% in patients treated with peg-IFN plus ribavirin with or without telaprevir, respectively. IFNL4 ss469415590 variant and HCV viral loads or IFNL4 ss469415590 variant and early virological response were better predictors of SVR in patients treated with peg-IFN plus ribavirin with or without telaprevir, respectively. Conclusion. In the era of DAAs, measurement of IFNL4 ss469415590 variant could help the prediction of SVR in Japanese HCV genotype 1 infected individuals treated with IFN-including regimens.

  3. T-2 toxin impairment of enteric reovirus clearance in the mouse associated with suppressed immunoglobulin and IFNresponses

    International Nuclear Information System (INIS)

    Li Maoxiang; Cuff, Christopher F.; Pestka, James J.

    2006-01-01

    Trichothecenes are exquisitely toxic to the gastrointestinal (GI) tract and leukocytes and thus are likely to impair gut immunity. The purpose of this research was to test the hypothesis that the Type A trichothecene T-2 toxin interferes with the gut mucosal immune response to enteric reovirus infection. Mice were exposed i.p. first to 1.75 mg/kg bw T-2 and then 2 h later with 3 x 10 7 plaque-forming units of reovirus serotype 1, strain Lang (T1/L). As compared to vehicle-treated control, T-2-treated mice had dramatically elevated intestinal plaque-forming viral titers after 5 days and failed to completely clear the virus from intestine by 10 days. Levels of reovirus λ2 core spike (L2 gene) RNA in feces in T-2-treated mice were significantly higher at 1, 3, 5, and 7 days than controls. T-2 potentiated L2 mRNA expression in a dose-dependent manner with as little as 50 μg/kg of the toxin having a potentiative effect. T-2 exposure transiently suppressed induction of reovirus-specific IgA in feces (6 and 8 days) as well as specific IgA and IgG 2a in serum (5 days). This suppression corresponded to decreased secretion of reovirus-specific IgA and IgG 2a in Peyer's patch (PP) and lamina propria fragment cultures prepared 5 days after infection. T-2 suppressed IFNresponses in PP to reovirus at 3 and 7 days as compared to infected controls whereas IL-2 mRNA concentrations were unaffected. PP IL-6 mRNA levels were increased 2-fold 2 h after T-2 treatment, but no differences between infected T-2-exposed and infected vehicle-treated mice were detectable over the next 7 days. Overall, the results suggest that T-2 toxin increased both the extent of GI tract reovirus infection and fecal shedding which corresponded to both suppressed immunoglobulin and IFNresponses

  4. IL-18 potentiated whole blood IFN-γ assay can identify cell-mediated immune responses towards Lawsonia intracellularis in experimentally infected pigs

    DEFF Research Database (Denmark)

    Riber, Ulla; Jakobsen, Jeanne Toft; Hvass, Henriette Cordes

    Lawsonia intracellularis is an obligate intracellular bacteria causing proliferative enteropathy (PE) in pigs. The infection causes diarrhoea, retarded growth and sudden death in pigs and is one of the most economically important diseases in the swine industry worldwide. The infection is one...... indications that cell-mediated immune responses (CMI) are important for the protection against infections with L. intracellularis and in mice models IFN-γ has been shown to play a key role in the host defence against experimental infections . In L. intracellularis infected pigs, IFN-γ is only sparsely...

  5. Application of Mycobacterium Tuberculosis IFN-γresponses in Differential Diagnosis of Tuberculous Meningitis%结核杆菌IFN-γ在结核性脑膜炎鉴别诊断中的应用

    Institute of Scientific and Technical Information of China (English)

    林正豪; 曾剑锋; 刘国辉

    2013-01-01

    Objective To discuss clinical application of Mycobacterium tuberculosis antigen specific IFN-γresponses in antidiastole between tuberculous meningitis and cryptococal neoformans meningitis. Methods IFN-γresponses in peripheral blood of 13 patients with csf positive tuberculous meningitis , 15 patients with csf negative tuberculous meningitis and 11 patients with cryptococal neoformans meningitis were tested and then analyzed retrospectively. Results Positive IFN-γresponses were detected in 69.2%(9/13)of patients with csf positive tuberculous meningitis, 66.7%(10/15)of patients with csf negative tuberculous meningitis and 9.0%(1/11) of patients with cryptococal neoformans meningitis. IFN-γresponses in the three groups is statistically different(χ2=6.78,P=0.001). Through the comparison between the two two groups, IFN-γresponses positive rate between csf positive tuberculous meningitis patients and csf negative tuberculous meningitis patients is not statistically different(χ2=4.31,P=0.07). IFN-γresponses positive rate between csf positive tuberculous meningitis patients and cryptococal neoformans meningitis patients is statistically different(χ2=7.37,P=0.013). IFN-γresponses positive rate between csf negative tuberculous meningitis patients and cryptococal neoformans meningitis patients is statistically different(χ2=8.26,P=0.024).Conclusion IFN-γresponses in peripheral blood can be used as an assistant means to discriminate cryptococal neoformans meningitis from tuberculous meningitis.%  目的探讨外周血结核杆菌抗原特异性γ干扰素水平在结核性脑膜炎与隐球菌性脑膜炎鉴别诊断中的作用。方法回顾性分析本院13例菌阳结核性脑膜炎、15菌阴结核性脑膜炎及11例隐球菌性脑膜炎患者外周血结核杆菌抗原特异性γ干扰素水平差异。结果菌阳结核性脑膜炎患者外周血结核杆菌抗原特异性γ干扰素9例阳性,4例阴性,阳性率69.2%,菌阴结核性脑

  6. Neutrophils responsive to endogenous IFN-beta regulate tumor angiogenesis and growth in a mouse tumor model.

    Science.gov (United States)

    Jablonska, Jadwiga; Leschner, Sara; Westphal, Kathrin; Lienenklaus, Stefan; Weiss, Siegfried

    2010-04-01

    Angiogenesis is a hallmark of malignant neoplasias, as the formation of new blood vessels is required for tumors to acquire oxygen and nutrients essential for their continued growth and metastasis. However, the signaling pathways leading to tumor vascularization are not fully understood. Here, using a transplantable mouse tumor model, we have demonstrated that endogenous IFN-beta inhibits tumor angiogenesis through repression of genes encoding proangiogenic and homing factors in tumor-infiltrating neutrophils. We determined that IFN-beta-deficient mice injected with B16F10 melanoma or MCA205 fibrosarcoma cells developed faster-growing tumors with better-developed blood vessels than did syngeneic control mice. These tumors displayed enhanced infiltration by CD11b+Gr1+ neutrophils expressing elevated levels of the genes encoding the proangiogenic factors VEGF and MMP9 and the homing receptor CXCR4. They also expressed higher levels of the transcription factors c-myc and STAT3, known regulators of VEGF, MMP9, and CXCR4. In vitro, treatment of these tumor-infiltrating neutrophils with low levels of IFN-beta restored expression of proangiogenic factors to control levels. Moreover, depletion of these neutrophils inhibited tumor growth in both control and IFN-beta-deficient mice. We therefore suggest that constitutively produced endogenous IFN-beta is an important mediator of innate tumor surveillance. Further, we believe our data help to explain the therapeutic effect of IFN treatment during the early stages of cancer development.

  7. Correlation of antigen-specific IFNresponses of fresh blood samples from Mycobacterium avium subsp. paratuberculosis infected heifers with responses of day-old samples co-cultured with IL-12 or anti-IL-10 antibodies

    DEFF Research Database (Denmark)

    Mikkelsen, Heidi; Aagaard, Claus; Nielsen, Søren Saxmose

    2012-01-01

    Paratuberculosis is a chronic infection of the intestine of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP). Early stage MAP infection can be detected by measuring cell-mediated immune responses using the interferon gamma (IFN-γ) assay. Whole blood samples are cultured...... to enhance IFNresponses of cultures stimulated with Johnin purified protein derivative (PPDj). Here we examined the correlation of IFN-γ production in response to PPDj and 15 recombinant antigens in day-old blood samples from heifers 10–21 months of age from a MAP infected herd with addition of either...... overnight with specific MAP antigens followed by quantification of IFN-γ by ELISA. It is recommended that the time interval from sampling to culture does not exceed eight hours but addition of the co-stimulating cytokine interleukin 12 (IL-12) or anti-IL-10 antibodies to culture have been demonstrated...

  8. The level of PPD-specific IFN-gamma-producing CD4+ T cells in the blood predicts the in vivo response to PPD.

    Science.gov (United States)

    Martins, Marcia Valéria B S; Lima, Mônica Cristina B S; Duppre, Nadia C; Matos, Haroldo J; Spencer, John S; Brennan, Patrick J; Sarno, Euzenir N; Fonseca, Leila; Pereira, Geraldo M B; Pessolani, Maria Cristina V

    2007-05-01

    There are no reliable means for detecting subclinical mycobacterial infections. The recent sequencing of several mycobacterial genomes has now afforded new opportunities for the development of pathogen-specific diagnostic tests, critical in the context of leprosy and tuberculosis control. In the present study, we applied a multi-parametric flow cytometric analysis that allowed the investigation of T-cell functions in order to define immunological markers that measure previous exposure to mycobacteria. We compared the in vivo response to PPD, the gold standard skin test reagent for measuring previous exposure to Mycobacterium tuberculosis, with in vitro parameters of leukocyte activation in five PPD positive and five PPD negative healthy volunteers. PPD-stimulated peripheral leukocytes expressing CD4, CD69, cutaneous lymphocyte-associated antigen (CLA) and intracellular IFN-gamma were enumerated in whole blood and compared with the size of in vivo PPD-induced induration and IFN-gamma production levels as measured by ELISA in supernatants of PPD-stimulated peripheral blood mononuclear cells. The reactivity to the tuberculin skin test (TST) was associated with markedly increased frequencies of PPD-responsive activated (CD69+) and IFN-gamma-producing CD4+T cells. Detection of PPD-specific IFN-gamma producing leukocytes was restricted to CD4+T cells and a subset of these cells was shown to express the skin homing molecule CLA. Multiple linear regression modeling of responses to PPD showed the highest association between skin test indurations and frequencies of PPD-responsive IFN-gamma-producing CD4+CD69+ T cells. Our data show that the in vitro enumeration of antigen-specific IFN-gamma-producing CD4+ T cells can provide an alternative to the in vivo tuberculin test for the detection of latent Mycobacterium tuberculosis infection. Moreover, the measurement of these immunological parameters can be useful for the screening of new specific antigens defined by the genome

  9. Persistence of hepatocellular carcinoma risk in hepatitis C patients with a response to IFN and cirrhosis regression.

    Science.gov (United States)

    D'Ambrosio, Roberta; Aghemo, Alessio; Rumi, Maria Grazia; Degasperi, Elisabetta; Sangiovanni, Angelo; Maggioni, Marco; Fraquelli, Mirella; Perbellini, Riccardo; Rosenberg, William; Bedossa, Pierre; Colombo, Massimo; Lampertico, Pietro

    2018-01-27

    In patients with HCV-related cirrhosis, a sustained virological response may lead to cirrhosis regression. Whether histological changes translate into prevention of long-term complications, particularly hepatocellular carcinoma is still unknown. This was investigated in a cohort of histological cirrhotics who had been prospectively followed-up for 10 years after the achievement of a sustained virological response to IFN. In all, 38 sustained virological response cirrhotics who underwent a liver biopsy 5 years post-SVR were prospectively followed to assess the impact of cirrhosis regression on clinical endpoints. During a follow-up of 86 (30-96) months from liver biopsy, no patients developed clinical decompensation, whilst 5 (13%) developed hepatocellular carcinoma after 79 (7-88) months. The 8-year cumulative probability of hepatocellular carcinoma was 17%, without differences between patients with or without cirrhosis regression (19% [95% CI 6%-50%] vs 14% [95% CI 4%-44%], P = .88). Patients who developed or did not an hepatocellular carcinoma had similar rates of residual cirrhosis (P = 1.0), collagen content (P = .48), METAVIR activity (P = .34), portal inflammation (P = .06) and steatosis (P = .17). At baseline, patients who developed an hepatocellular carcinoma had higher γGT (HR 1.03, 95% CI 1.00-1.06; P = .014) and glucose (HR 1.02, 95% CI 1.00-1.02; P = .012) values; moreover, they had increased Forns Score (HR 12.8, 95% CI 1.14-143.9; P = .039), Lok Index (HR 6.24, 95% CI 1.03-37.6; P = .046) and PLF (HR 19.3, 95% CI 1.72-217.6; P = .016) values. One regressor died of lung cancer. The 8-year cumulative survival probability was 97%, independently on cirrhosis regression (96% vs 100%, P = 1.0) or hepatocellular carcinoma (100% vs 97%, P = 1.0). Post-SVR cirrhosis regression does not prevent hepatocellular carcinoma occurrence. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. In vivo IFN-γ secretion by NK cells in response to Salmonella typhimurium requires NLRC4 inflammasomes.

    Directory of Open Access Journals (Sweden)

    Andreas Kupz

    Full Text Available Natural killer (NK cells are a critical part of the innate immune defense against viral infections and for the control of tumors. Much less is known about how NK cells contribute to anti-bacterial immunity. NK cell-produced interferon gamma (IFN-γ contributes to the control of early exponential replication of bacterial pathogens, however the regulation of these events remains poorly resolved. Using a mouse model of invasive Salmonellosis, here we report that the activation of the intracellular danger sensor NLRC4 by Salmonella-derived flagellin within CD11c+ cells regulates early IFN-γ secretion by NK cells through the provision of interleukin 18 (IL-18, independently of Toll-like receptor (TLR-signaling. Although IL18-signalling deficient NK cells improved host protection during S. Typhimurium infection, this increased resistance was inferior to that provided by wild-type NK cells. These findings suggest that although NLRC4 inflammasome-driven secretion of IL18 serves as a potent activator of NK cell mediated IFN-γ secretion, IL18-independent NK cell-mediated mechanisms of IFN-γ secretion contribute to in vivo control of Salmonella replication.

  11. Radiotherapy plus cis-retinoic acid/interferon-α in cervical cancers: response and impact of cRA/IFN on tumor tissue oxygenation

    International Nuclear Information System (INIS)

    Haensgen, Gabriele; Koehler, Uwe; Dunst, Juergen

    1997-01-01

    Background: We have evaluated the impact of 13-cis-retinoic acid plus interferon in combination with radiotherapy on response and on tumor oxygenation in a phase II-study. Materials and methods: From June 1995 through April 1996, thirty-four patients with squamous cell carcinoma FIGO IIB (N=8) and IIIB (N=26) of the cervix who were scheduled for definitive radiotherapy with curative intent received additional treatment with 13-cis-retinoic acid (cRA, isotretinoin) plus interferon-α-2a (IFN-α-2a) as part of a phase-II-protocol at the Universities of Halle-Wittenberg (N=25), Leipzig (N=7) and Dresden (N=2). cRA/IFN-α-2a started 14 days prior to radiotherapy (1 mg per kilogramm body weight cRA orally daily plus 6x10 6 I.U. IFN-α-2a subcutaneously daily). After this induction period, standard radiotherapy was administered (external irradiation with 45Gy in 25 fractions of 1.8Gy plus HDR-brachytherapy with 5x7Gy). During radiotherapy, cRA/IFN-α-2a-treatment was continued with 50% of the daily doses. In 14 patients treated at the University of Halle-Wittenberg, tumor tissue pO 2 -measurements were performed prior to radiotherapy, at 20Gy, and at the end of radiotherapy with an Eppendorf-pO 2 -histograph. The oxygenation data of these patients were compared to 14 patients who had also pO 2 -measurements but had refused to participate in the cRA/IFN-α-2a-protocol and received radiotherapy alone during the same period. Results: All 8 patients with FIGO IIB tumors had a complete clinical remission 3 months after radiotherapy. In FIGO IIIB cancers, (19(26)) (73%) achieved a cCR, 5 (19%) had a PR and 2 died within six months after treatment due to intercurrent disease. The toxicity of cRA/IFN-α-2a was only mild to moderate (fever 43%, skin toxicity 36%, diarrhea 20%, elevation of liver enzymes 20%) with no grade (3(4)) toxicity. The 14 patients with cRA/IFN-α-2a-pretreatment prior to radiotherapy had significant higher median pO 2 -values in their tumors at the

  12. IFN-λ and microRNAs are important modulators of the pulmonary innate immune response against influenza A (H1N2) infection in pigs

    DEFF Research Database (Denmark)

    Brogaard, Louise; Larsen, Lars E.; Heegaard, Peter Mikael Helweg

    2018-01-01

    the expression of miRNAs and protein coding genes in the lungs of pigs 1, 3, and 14 days after challenge with swine IAV (H1N2). Through RT-qPCR we observed a 400-fold relative increase in IFN-lambda 3 gene expression on day 1 after challenge, and a strong interferon-mediated antiviral response was observed......The innate immune system is paramount in the response to and clearance of influenza A virus (IAV) infection in non-immune individuals. Known factors include type I and III interferons and antiviral pathogen recognition receptors, and the cascades of antiviral and pro- and anti-inflammatory gene...

  13. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  14. In vitro immunomodulation of a whole blood IFN-γ release assay enhances T cell responses in subjects with latent tuberculosis infection.

    Directory of Open Access Journals (Sweden)

    Rajiv L Gaur

    Full Text Available Activation of innate immunity via pathogen recognition receptors (PRR modulates adaptive immune responses. PRR ligands are being exploited as vaccine adjuvants and as therapeutics, but their utility in diagnostics has not been explored. Interferon-gamma (IFN-γ release assays (IGRAs are functional T cell assays used to diagnose latent tuberculosis infection (LTBI; however, novel approaches are needed to improve their sensitivity.In vitro immunomodulation of a whole blood IGRA (QuantiFERON®-TB GOLD In-Tube with Toll-like receptor agonists poly(I:C, LPS, and imiquimod was performed on blood from subjects with LTBI and negative controls.In vitro immunomodulation significantly enhanced the response of T cells stimulated with M. tuberculosis antigens from subjects with LTBI but not from uninfected controls. Immunomodulation of IGRA revealed T cell responses in subjects with LTBI whose T cells otherwise do not respond to in vitro stimulation with antigens alone. Similar to their in vivo functions, addition of poly(I:C and LPS to whole blood induced secretion of inflammatory cytokines and IFN-α and enhanced the surface expression of antigen presenting and costimulatory molecules on antigen presenting cells.In vitro immunomodulation of whole blood IGRA may be an effective strategy for enhancing the sensitivity of T cells for diagnosis of LTBI.

  15. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  16. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  17. An accessory to the 'Trinity': SR-As are essential pathogen sensors of extracellular dsRNA, mediating entry and leading to subsequent type I IFN responses.

    Directory of Open Access Journals (Sweden)

    Stephanie J DeWitte-Orr

    2010-03-01

    Full Text Available Extracellular RNA is becoming increasingly recognized as a signaling molecule. Virally derived double stranded (dsRNA released into the extracellular space during virus induced cell lysis acts as a powerful inducer of classical type I interferon (IFN responses; however, the receptor that mediates this response has not been identified. Class A scavenger receptors (SR-As are likely candidates due to their cell surface expression and ability to bind nucleic acids. In this study, we investigated a possible role for SR-As in mediating type I IFN responses induced by extracellular dsRNA in fibroblasts, a predominant producer of IFNbeta. Fibroblasts were found to express functional SR-As, even SR-A species thought to be macrophage specific. SR-A specific competitive ligands significantly blocked extracellular dsRNA binding, entry and subsequent interferon stimulated gene (ISG induction. Candidate SR-As were systematically investigated using RNAi and the most dramatic inhibition in responses was observed when all candidate SR-As were knocked down in unison. Partial inhibition of dsRNA induced antiviral responses was observed in vivo in SR-AI/II(-/- mice compared with WT controls. The role of SR-As in mediating extracellular dsRNA entry and subsequent induced antiviral responses was observed in both murine and human fibroblasts. SR-As appear to function as 'carriers', facilitating dsRNA entry and delivery to the established dsRNA sensing receptors, specifically TLR3, RIGI and MDA-5. Identifying SR-As as gatekeepers of the cell, mediating innate antiviral responses, represents a novel function for this receptor family and provides insight into how cells recognize danger signals associated with lytic virus infections. Furthermore, the implications of a cell surface receptor capable of recognizing extracellular RNA may exceed beyond viral immunity to mediating other important innate immune functions.

  18. Chlamydia trachomatis responds to heat shock, penicillin induced persistence, and IFN-gamma persistence by altering levels of the extracytoplasmic stress response protease HtrA

    Directory of Open Access Journals (Sweden)

    Mathews Sarah A

    2008-11-01

    Full Text Available Abstract Background Chlamydia trachomatis, an obligate intracellular human pathogen, is the most prevalent bacterial sexually transmitted infection worldwide and a leading cause of preventable blindness. HtrA is a virulence and stress response periplasmic serine protease and molecular chaperone found in many bacteria. Recombinant purified C. trachomatis HtrA has been previously shown to have both activities. This investigation examined the physiological role of Chlamydia trachomatis HtrA. Results The Chlamydia trachomatis htrA gene complemented the lethal high temperature phenotype of Escherichia coli htrA- (>42°C. HtrA levels were detected to increase by western blot and immunofluorescence during Chlamydia heat shock experiments. Confocal laser scanning microscopy revealed a likely periplasmic localisation of HtrA. During penicillin induced persistence of Chlamydia trachomatis, HtrA levels (as a ratio of LPS were initially less than control acute cultures (20 h post infection but increased to more than acute cultures at 44 h post infection. This was unlike IFN-γ persistence where lower levels of HtrA were observed, suggesting Chlamydia trachomatis IFN-γ persistence does not involve a broad stress response. Conclusion The heterologous heat shock protection for Escherichia coli, and increased HtrA during cell wall disruption via penicillin and heat shock, indicates an important role for HtrA during high protein stress conditions for Chlamydia trachomatis.

  19. Prevention of bone marrow cell apoptosis and regulation of hematopoiesis by type I IFNs during systemic responses to pneumocystis lung infection.

    Science.gov (United States)

    Taylor, David; Wilkison, Michelle; Voyich, Jovanka; Meissner, Nicole

    2011-05-15

    We recently demonstrated that lack of type I IFN signaling (IFNAR knockout) in lymphocyte-deficient mice (IFrag(-/-)) results in bone marrow (BM) failure after Pneumocystis lung infection, whereas lymphocyte-deficient mice with intact IFNAR (RAG(-/-)) had normal hematopoiesis. In the current work, we performed studies to define further the mechanisms involved in the induction of BM failure in this system. BM chimera experiments revealed that IFNAR expression was required on BM-derived but not stroma-derived cells to prevent BM failure. Signals elicited after day 7 postinfection appeared critical in determining BM cell fate. We observed caspase-8- and caspase-9-mediated apoptotic cell death, beginning with neutrophils. Death of myeloid precursors was associated with secondary oxidative stress, and decreasing colony-forming activity in BM cell cultures. Treatment with N-acetylcysteine could slow the progression of, but not prevent, BM failure. Type I IFN signaling has previously been shown to expand the neutrophil life span and regulate the expression of some antiapoptotic factors. Quantitative RT-PCR demonstrated reduced mRNA abundance for the antiapoptotic factors BCL-2, IAP2, MCL-1, and others in BM cells from IFrag(-/-) compared with that in BM cells from RAG(-/-) mice at day 7. mRNA and protein for the proapoptotic cytokine TNF-α was increased, whereas mRNA for the growth factors G-CSF and GM-CSF was reduced. In vivo anti-TNF-α treatment improved precursor cell survival and activity in culture. Thus, we propose that lack of type I IFN signaling results in decreased resistance to inflammation-induced proapoptotic stressors and impaired replenishment by precursors after systemic responses to Pneumocystis lung infection. Our finding may have implications in understanding mechanisms underlying regenerative BM depression/failure during complex immune deficiencies such as AIDS.

  20. γδ T lymphocytes from cystic fibrosis patients and healthy donors are high TNF-α and IFN-γ-producers in response to Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Martínez Natalia

    2003-09-01

    Full Text Available Abstract Background γδ T cells have an important immunoregulatory and effector function through cytokine release. They are involved in the responses to Gram-negative bacterium and in protection of lung epithelium integrity. On the other hand, they have been implicated in airway inflammation. Methods The aim of the present work was to study intracytoplasmic IL-2, IL-4, IFN-γ and TNF-α production by γδ and αβ T lymphocytes from cystic fibrosis patients and healthy donors in response to Pseudomonas aeruginosa (PA. Flow cytometric detection was performed after peripheral blood mononuclear cells (PBMC culture with a cytosolic extract from PA and restimulation with phorbol ester plus ionomycine. Proliferative responses, activation markers and receptor usage of γδ T cells were also evaluated. Results The highest production of cytokine was of TNF-α and IFN-γ, γδ being better producers than αβ. No differences were found between patients and controls. The Vγ9δ2 subset of γδ T cells was preferentially expanded. CD25 and CD45RO expression by the αβ T subset and PBMC proliferative response to PA were defective in cystic fibrosis lymphocytes. Conclusion Our results support the hypothesis that γδ T lymphocytes play an important role in the immune response to PA and in the chronic inflammatory lung reaction in cystic fibrosis patients. They do not confirm the involvement of a supressed Th1 cytokine response in the pathogenesis of this disease.

  1. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  2. Development of monoclonal antibodies (MAbs) to feline interferon (fIFN)-γ as tools to evaluate cellular immune responses to feline infectious peritonitis virus (FIPV).

    Science.gov (United States)

    Satoh, Ryoichi; Kaku, Ayumi; Satomura, Megumi; Kohori, Michiyo; Noura, Kanako; Furukawa, Tomoko; Kotake, Masako; Takano, Tomomi; Hohdatsu, Tsutomu

    2011-06-01

    Feline infectious peritonitis virus (FIPV) can cause a lethal disease in cats, feline infectious peritonitis (FIP). The antibody-dependent enhancement (ADE) of FIPV infection has been recognised in experimentally infected cats, and cellular immunity is considered to play an important role in preventing the onset of FIP. To evaluate the importance of cellular immunity for FIPV infection, monoclonal antibodies (MAbs) against feline interferon (fIFN)-γ were first created to establish fIFN-γ detection systems using the MAbs. Six anti-fIFN-γ MAbs were created. Then, the difference in epitope which those MAbs recognise was demonstrated by competitive enzyme-linked immunosorbent assay (ELISA) and IFN-γ neutralisation tests. Detection systems for fIFN-γ (sandwich ELISA, ELISpot assay, and two-colour flow cytometry) were established using anti-fIFN-γ MAbs that recognise different epitopes. In all tests, fIFN-γ production from peripheral blood mononuclear cells (PBMCs) obtained from cats experimentally infected with an FIPV isolate that did not develop the disease was significantly increased by heat-inactivated FIPV stimulation in comparison with medium alone. Especially, CD8(+)fIFN-γ(+) cells, but not CD4(+)fIFN-γ(+) cells, were increased. In contrast, fIFN-γ production from PBMCs isolated from cats that had developed FIP and specific pathogen-free (SPF) cats was not increased by heat-inactivated FIPV stimulation. These results suggest that cellular immunity plays an important role in preventing the development of FIP. Measurement of fIFN-γ production with the anti-fIFN-γ MAbs created in this study appeared to be useful in evaluating cellular immunity in cats. Copyright © 2011 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

  3. Herpesvirus Genome Recognition Induced Acetylation of Nuclear IFI16 Is Essential for Its Cytoplasmic Translocation, Inflammasome and IFNResponses.

    Directory of Open Access Journals (Sweden)

    Mairaj Ahmed Ansari

    2015-07-01

    Full Text Available The IL-1β and type I interferon-β (IFN-β molecules are important inflammatory cytokines elicited by the eukaryotic host as innate immune responses against invading pathogens and danger signals. Recently, a predominantly nuclear gamma-interferon-inducible protein 16 (IFI16 involved in transcriptional regulation has emerged as an innate DNA sensor which induced IL-1β and IFN-β production through inflammasome and STING activation, respectively. Herpesvirus (KSHV, EBV, and HSV-1 episomal dsDNA genome recognition by IFI16 leads to IFI16-ASC-procaspase-1 inflammasome association, cytoplasmic translocation and IL-1β production. Independent of ASC, HSV-1 genome recognition results in IFI16 interaction with STING in the cytoplasm to induce interferon-β production. However, the mechanisms of IFI16-inflammasome formation, cytoplasmic redistribution and STING activation are not known. Our studies here demonstrate that recognition of herpesvirus genomes in the nucleus by IFI16 leads into its interaction with histone acetyltransferase p300 and IFI16 acetylation resulting in IFI16-ASC interaction, inflammasome assembly, increased interaction with Ran-GTPase, cytoplasmic redistribution, caspase-1 activation, IL-1β production, and interaction with STING which results in IRF-3 phosphorylation, nuclear pIRF-3 localization and interferon-β production. ASC and STING knockdowns did not affect IFI16 acetylation indicating that this modification is upstream of inflammasome-assembly and STING-activation. Vaccinia virus replicating in the cytoplasm did not induce nuclear IFI16 acetylation and cytoplasmic translocation. IFI16 physically associates with KSHV and HSV-1 genomes as revealed by proximity ligation microscopy and chromatin-immunoprecipitation studies which is not hampered by the inhibition of acetylation, thus suggesting that acetylation of IFI16 is not required for its innate sensing of nuclear viral genomes. Collectively, these studies identify the

  4. Association of TNF-alpha (-308 A/G) and IFN-gamma (+874 A/T) gene polymorphisms in response to spontaneous and treatment induced viral clearance in HCV infected multitransfused thalassemic patients.

    Science.gov (United States)

    Biswas, Aritra; Gupta, Nabyendu; Gupta, Debanjali; Datta, Abira; Firdaus, Rushna; Chowdhury, Prosanto; Bhattacharyya, Maitreyee; Sadhukhan, Provash C

    2018-06-01

    Multitransfused thalassemic individuals are at high risk of developing transfusion transmitted Hepatitis C virus (HCV) infection. The aim of the study was to correlate the effects of host cytokine single nucleotide polymorphisms of TNF-α (-308 A/G) and IFN-γ (+874 A/T) in spontaneous or IFN induced treatment response in the HCV infected thalassemic individuals. A total of 427 HCV sero-reactive thalassemic individuals were processed for HCV viral genomic diversity and host gene polymorphisms analysis of TNF-α (-308 A/G) and IFN-γ (+874 A/T). Out of 427 HCV sero-reactive individuals, 69.09% were found to be HCV RNA positive with genotype 3 as the predominant infecting strain (94.29%). Study highlighted that, A allele was significantly associated with (p < .05) spontaneous clearance of HCV infection and G allele was correlated with viral persistence at TNF-α (-308) gene polymorphism. Whereas in case of IFN-γ (+874) SNPs, A allele was significantly responsible (p < .05) for spontaneous clearance than T allele. Our study also indicated that in relapsed cases, IFN-γ (+874) T allele is more responsible than A allele. Though no significant correlation was found at both TNF-α (-308) and IFN-γ (+874) gene polymorphism among SVR and relapsed thalassemic patients. A allele at both TNF-α (-308) and IFN-γ (+874) were strongly associated with spontaneous clearance among this population. But in case of SVR and relapsed cases no significant association was found. This cytokine gene polymorphisms pattern will help clinicians to take an informed decision about therapeutic management of HCV infected thalassemic individuals. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  6. Combination of pegylated IFN-α2b with imatinib increases molecular response rates in patients with low- or intermediate-risk chronic myeloid leukemia

    DEFF Research Database (Denmark)

    Simonsson, Bengt; Gedde-Dahl, Tobias; Markevärn, Berit

    2011-01-01

    Biologic and clinical observations suggest that combining imatinib with IFN-a may improve treatment outcome in chronic myeloid leukemia (CML). We randomized newly diagnosed chronic-phase CML patients with a low or intermediate Sokal risk score and in imatinib-induced complete hematologic remission......%) discontinued imatinib treatment (1 because of blastic transformation in imatinib arm). In addition, in the combination arm, 34 patients (61%) discontinued Peg-IFN-a2b, most because of toxicity. The MMR rate at 12 months was significantly higher in the imatinib plus Peg-IFN-a2b arm (82%) compared...... with the imatinib monotherapy arm (54%; intention-to-treat, P = .002). The MMR rate increased with the duration of Peg-IFN-a2b treatment ( 12-week MMR rate 91%). Thus, the addition of even relatively short periods of Peg-IFN-a2b to imatinib markedly increased the MMR rate at 12 months...

  7. Differential baseline and response profile to IFN-γ gene transduction of IL-6/IL-6 receptor-α secretion discriminate primary tumors versus bone marrow metastases of nasopharyngeal carcinomas in culture

    International Nuclear Information System (INIS)

    Chou, Andy Shau-Bin; Wang, Hsin-Yi; Chen, Hung-Chang; Tsai, Ming-Hsiu; Chuang, Cheng-Keng; Liao, Shuen-Kuei

    2009-01-01

    marginal levels of IFN-γ (8.4 ~ 10.5 pg/ml), could be enhanced to produce higher levels of IFN-γ (6.8- to 10.3-fold increase) after IFN-γ transduction. Unlike P-NPCs, BM-NPCs spontaneously released IFN-γ at moderate levels (83.8 ~ 100.7 pg/ml), which were enhanced by 1.3- to 2.2-fold in the spent media of their IFN-γ-transduced counterparts. Our results showed that cultured P-NPCs and BM-NPCs could be distinguished from one another on the basis of their differential baseline secretion pattern of IFN-γ, IL-6 and IL-6Rα, and their differential response profiles to IFN-γ gene transfer of the production of these three soluble molecules. These results suggest that the IL-6 and IFN-γ pathways in a background of genetic instability be involved in the acquisition of metastatic behaviour in BM-NPCs

  8. Type 1- and type 2-like lesional skin-derived Mycobacterium leprae-responsive T cell clones are characterized by coexpression of IFN-gamma/TNF-alpha and IL-4/IL-5/IL-13, respectively

    NARCIS (Netherlands)

    Verhagen, C. E.; van der Pouw Kraan, T. C.; Buffing, A. A.; Chand, M. A.; Faber, W. R.; Aarden, L. A.; Das, P. K.

    1998-01-01

    In an earlier study, we generated a large number of Mycobacterium leprae-responsive and M. leprae-nonresponsive T cell clones (TCC) from the lesional skin of immunologic unstable borderline leprosy patients. In that study, we divided TCC into type 1- and type 2-like on the basis of their IFN-gamma

  9. Protein pathway activation associated with sustained virologic response in patients with chronic hepatitis C treated with pegylated interferon (PEG-IFN) and ribavirin (RBV).

    Science.gov (United States)

    Younossi, Zobair M; Limongi, Dolores; Stepanova, Maria; Pierobon, Mariaelena; Afendy, Arian; Mehta, Rohini; Baranova, Ancha; Liotta, Lance; Petricoin, Emanuel

    2011-02-04

    Only half of chronic hepatitis C (CH-C) patients treated with pegylated interferon and ribavirin (PEG-IFN+RBV) achieve sustained virologic response) SVR. In addition to known factors, we postulated that activation of key protein signaling networks in the peripheral blood mononuclear cells (PBMCs) may contribute to SVR due to inherent patient-specific basal immune cell signaling architecture. In this study, we included 92 patients with CH-C. PBMCs were collected while patients were not receiving treatment and used for phosphoprotein-based network profiling. Patients received a full course of PEG-IFN+RBV with overall SVR of 55%. From PBMC, protein lysates were extracted and then used for Reverse Phase Protein Microarray (RPMA) analysis, which quantitatively measured the levels of cytokines and activation levels of 25 key protein signaling molecules involved in immune cell regulation and interferon alpha signaling. Regression models for predicting SVR were generated by stepwise bidirectional selection. Both clinical-laboratory and RPMA parameters were used as predictor variables. Model accuracies were estimated using 10-fold cross-validation. Our results show that by comparing patients who achieved SVR to those who did not, phosphorylation levels of 6 proteins [AKT(T308), JAK1(Y1022/1023), p70 S6 Kinase (S371), PKC zeta/lambda(T410/403), TYK2(Y1054/1055), ZAP-70(Y319)/Syk(Y352)] and overall levels of 6 unmodified proteins [IL2, IL10, IL4, IL5, TNF-alpha, CD5L] were significantly different (P < 0.05). For SVR, the model based on a combination of clinical and proteome parameters was developed, with an AUC = 0.914, sensitivity of 92.16%, and specificity of 85.0%. This model included the following parameters: viral genotype, previous treatment status, BMI, phosphorylated states of STAT2, AKT, LCK, and TYK2 kinases as well as steady state levels of IL4, IL5, and TNF-alpha. In conclusion, SVR could be predicted by a combination of clinical, cytokine, and protein signaling

  10. KIR3DS1/HLA-B Bw4-80Ile Genotype Is Correlated with the IFN-α Therapy Response in hepatitis B e antigen-Positive Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Wenting Li

    2017-10-01

    Full Text Available To date, several on-treatment-level virological and serological indices that may predict the response to interferon alpha (IFN-α have been reported. However, no effective predictors, such as drug–response genes, that can be detected before administration of anti-hepatitis B virus (HBV therapy with IFN-α, have been found. In the diverse range of chronic viral infection, genes that affect human immunity play important roles in understanding host and viral co-evolution. Killer-cell immunoglobulin-like receptors (KIRs, which are highly polymorphic at the allele and haplotype levels, participate in the antiviral function of natural killer (NK cells via fine-tuning inhibition and activation of NK-cell responses that occur when the NK cells interact with human leukocyte antigen (HLA class I molecules on target cells. For each individual, the pairing of KIR and HLA ligand is genetically determined. To investigate whether a particular KIR and HLA repertoire influences the risk of HBV infection and response to IFN-α treatment for chronic hepatitis B (CHB, we genotyped the KIRs and HLA ligands of 119 hepatitis B e antigen (HBeAg-positive CHB patients. These patients included 43 patients who achieved sustained response (SR induced by IFN-α treatment for 48 weeks, 76 patients who achieved no response (NR, and 96 healthy subjects as controls. SR was defined as HBeAg loss with HBV DNA < 2,000 IU/ml and alanine aminotransferase normalization at 24 weeks posttreatment (week 72. In this study, we showed that activating KIR genes were less prevalent in Han Chinese, especially in Han Chinese with CHB, than in Caucasians. Furthermore, the KIR3DS1 gene, in combination with HLA-B Bw4-80Ile, strongly influenced the therapeutic outcomes for CHB patients who were treated with IFN-α. The frequency of the combination of genes encoding KIR3DS1 and HLA-B Bw4-80Ile was higher in patients who had a sustained treatment response than in patients who had NR [35

  11. PRMT5-Mediated Methylation of NF-κB p65 at Arg174 Is Required for Endothelial CXCL11 Gene Induction in Response to TNF-α and IFN-γ Costimulation.

    Directory of Open Access Journals (Sweden)

    Daniel P Harris

    Full Text Available Inflammatory agonists differentially activate gene expression of the chemokine family of proteins in endothelial cells (EC. TNF is a weak inducer of the chemokine CXCL11, while TNF and IFN-γ costimulation results in potent CXCL11 induction. The molecular mechanisms underlying TNF plus IFN-γ-mediated CXCL11 induction are not fully understood. We have previously reported that the protein arginine methyltransferase PRMT5 catalyzes symmetrical dimethylation of the NF-κB subunit p65 in EC at multiple arginine residues. Methylation of Arg30 and Arg35 on p65 is critical for TNF induction of CXCL10 in EC. Here we show that PRMT5-mediated methylation of p65 at Arg174 is required for induction of CXCL11 when EC are costimulated with TNF and IFN-γ. Knockdown of PRMT5 by RNAi reduced CXCL11 mRNA and protein levels in costimulated cells. Reconstitution of p65 Arg174Ala or Arg174Lys mutants into EC that were depleted of endogenous p65 blunted TNF plus IFN-γ-mediated CXCL11 induction. Mass spectrometric analyses showed that p65 Arg174 arginine methylation is enhanced by TNF plus IFN-γ costimulation, and is catalyzed by PRMT5. Chromatin immunoprecipitation assays (ChIP demonstrated that PRMT5 is necessary for p65 association with the CXCL11 promoter in response to TNF plus IFN-γ. Further, reconstitution of p65 Arg174Lys mutant in EC abrogated this p65 association with the CXCL11 promoter. Finally, ChIP and Re-ChIP assays revealed that symmetrical dimethylarginine-containing proteins complexed with the CXCL11 promoter were diminished in p65 Arg174Lys-reconstituted EC stimulated with TNF and IFN-γ. In total, these results indicate that PRMT5-mediated p65 methylation at Arg174 is essential for TNF plus IFN-γ-mediated CXCL11 gene induction. We therefore suggest that the use of recently developed small molecule inhibitors of PRMT5 may present a therapeutic approach to moderating chronic inflammatory pathologies.

  12. Cytokine response to selected MTB antigens in Ghanaian TB patients, before and at 2 weeks of anti-TB therapy is characterized by high expression of IFN-γ and Granzyme B and inter- individual variation.

    Science.gov (United States)

    Mensah, Gloria Ivy; Addo, Kennedy Kwasi; Tetteh, John Amissah; Sowah, Sandra; Loescher, Thomas; Geldmacher, Christof; Jackson-Sillah, Dolly

    2014-09-10

    There has been a long held belief that patients with drug-susceptible TB are non-infectious after two weeks of therapy. Recent microbiological and epidemiological evidence has challenged this dogma, however, the nature of the Mtb-specific cellular immune response during this period has not been adequately investigated. This knowledge could be exploited in the development of immunological biomarkers of early treatment response. Cellular response to four Mtb infection phase-dependent antigens, ESAT-6/CFP-10 fusion protein and three DosR encoded proteins (Rv1733c, Rv2029c, Rv2628) were evaluated in a Ghanaian TB cohort (n=20) before and after 2 weeks of anti TB therapy. After 6-days in vitro stimulation, Peripheral blood mononuclear cell (PBMC) culture supernatant was harvested and the concentration of IFN-γ, Granzyme B, IL-10, IL-17, sIL2Rα and TNF-α were determined in a 6-plex Luminex assay. Frequencies of IFN-γ + CD4 and CD8 T cells were also determined in an intracellular cytokine assay. All antigens induced higher levels of IFN-γ, followed by Granzyme B, TNF-α and IL-17 and low levels of IL-10 and sIL-2R-α in PBMC before treatment and after 2 weeks of treatment. Median cytokine levels of IFN-γ, Granzyme B, IL-17 and sIL-2R-α increased during week two, but it was significant for only Rv1733-specific production of Granzyme B (P = 0. 013). The median frequency of antigen specific IFN-γ + CD4 T cells increased at week two; however, only the increase in the ESAT-6/CFP-10-specific response was significant (P = 0. 0008). In contrast, the median frequency of ESAT-6/CFP-10- specific IFN-γ + CD8 T cell responses declined during week two (P = 0. 0024). Additionally, wide inter-individual variation with three distinct patterns were observed; increase in all cytokine levels, decrease in all cytokine levels and fluctuating cytokine levels after 2 weeks of treatment. The second week of effective chemotherapy was characterized by a general increase in cytokine

  13. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  14. Melanoma NOS1 expression promotes dysfunctional IFN signaling.

    Science.gov (United States)

    Liu, Qiuzhen; Tomei, Sara; Ascierto, Maria Libera; De Giorgi, Valeria; Bedognetti, Davide; Dai, Cuilian; Uccellini, Lorenzo; Spivey, Tara; Pos, Zoltan; Thomas, Jaime; Reinboth, Jennifer; Murtas, Daniela; Zhang, Qianbing; Chouchane, Lotfi; Weiss, Geoffrey R; Slingluff, Craig L; Lee, Peter P; Rosenberg, Steven A; Alter, Harvey; Yao, Kaitai; Wang, Ena; Marincola, Francesco M

    2014-05-01

    In multiple forms of cancer, constitutive activation of type I IFN signaling is a critical consequence of immune surveillance against cancer; however, PBMCs isolated from cancer patients exhibit depressed STAT1 phosphorylation in response to IFN-α, suggesting IFN signaling dysfunction. Here, we demonstrated in a coculture system that melanoma cells differentially impairs the IFNresponse in PBMCs and that the inhibitory potential of a particular melanoma cell correlates with NOS1 expression. Comparison of gene transcription and array comparative genomic hybridization (aCGH) between melanoma cells from different patients indicated that suppression of IFN-α signaling correlates with an amplification of the NOS1 locus within segment 12q22-24. Evaluation of NOS1 levels in melanomas and IFN responsiveness of purified PBMCs from patients indicated a negative correlation between NOS1 expression in melanomas and the responsiveness of PBMCs to IFN-α. Furthermore, in an explorative study, NOS1 expression in melanoma metastases was negatively associated with patient response to adoptive T cell therapy. This study provides a link between cancer cell phenotype and IFN signal dysfunction in circulating immune cells.

  15. Combination of pegylated IFN-α2b with imatinib increases molecular response rates in patients with low- or intermediate-risk chronic myeloid leukemia

    DEFF Research Database (Denmark)

    Simonsson, Bengt; Gedde-Dahl, Tobias; Markevärn, Berit

    2011-01-01

    Biologic and clinical observations suggest that combining imatinib with IFN-α may improve treatment outcome in chronic myeloid leukemia (CML). We randomized newly diagnosed chronic-phase CML patients with a low or intermediate Sokal risk score and in imatinib-induced complete hematologic remissio...

  16. Increased TNF-alpha/IFN-gamma/IL-2 and decreased TNF-alpha/IFN-gamma production by central memory T cells are associated with protective responses against bovine tuberculosis following BCG vaccination

    Science.gov (United States)

    Central memory T cells (Tcm’s) and polyfunctional CD4 T responses contribute to vaccine-elicited protection with both human and bovine tuberculosis (TB); however, their combined role in protective immunity to TB is unclear. To address this question, we evaluated polyfunctional cytokine responses by ...

  17. Modulation of the allergen-induced human IgE response in Hu-SCID mice: inhibitory effect of human recombinant IFN-gamma and allergen-derived lipopeptide.

    Science.gov (United States)

    Duez, C; Gras-Masse, H; Hammad, H; Akoum, H; Didierlaurent, A; André, C; Tonnel, A B; Pestel, J

    2001-01-01

    We have previously established a model to study the in vivo human IgE response using humanized SCID mice. Allergic SCID mice were obtained following intraperitoneal injection with mononuclear cells from Dermatophagoides pteronyssinus (Dpt)-sensitive patients, and sensitization by Dpt allergen intraperitoneal injection (immunization) or Dpt aerosol (inhalation). Human serum IgE was measured in allergic SCID mice after administration of human recombinant IFN-gamma or the lipopeptide LP 52-71 (derived from peptide p52-71 from Der p 1, Dpt major allergen, coupled to a lipophilic moiety), during the immunization or the inhalation phase. IFN-gamma inhibited human IgE production when given at the time of immunization, but not during inhalation. This effect was long-lasting as Dpt aerosol, given one month after immunization and IFN-gamma administration, failed to increase IgE levels. Unlike Dpt or p52-71, LP 52-71 failed to induce human IgE production at day 14 and 21 after its injection, but did inhibit the development of the IgE response after a secondary Dpt-challenge. Moreover, LP 52-71 administration 14 days after Dpt inhalation decreased IgE levels, in contrast to peptide 52-71, which increased IgE levels. Thus, taken together these results indicate that the development of the human IgE response in allergic SCID mice can be modulated by modified allergen and a Th1 cytokine.

  18. CD107a Expression and IFN-γ Production as Markers for Evaluation of Cytotoxic CD3+ CD8+ T Cell Response to CMV Antigen in Women with Recurrent Spontaneous Abortion.

    Science.gov (United States)

    Tarokhian, Batoul; Sherkat, Roya; Nasr Esfahani, Mohamma Hossein; Adib, Minoo; Kiani Esfahani, Abbas; Ataei, Behrooz

    2014-01-01

    Some evidence has shown a relationship between primary human cytomegalovirus (CMV) infection and pregnancy loss. The impact of CMV infection reactivation during pregnancy on adverse pregnancy outcomes is not completely understood. It is proposed that altered immune response, and therefore, recurrence or reactivation of latent CMV infection may relate to recurrent spontaneous abortion (RSA); however, few data are available in this regard. To find out about any cell mediated defect and reactivation of latent CMV infection in women with RPL, cellular immunity to the virus has been evaluated by specific cytotoxic T lymphocyte (CTL) response to CMV. In a case control study, CTL CD107a expression and in- tercellular IFN-γ production in response to CMV pp65 antigen and staphylococcus enterotoxin B (SEB) in women with RSA were assessed by flow cytometric analysis. Forty-four cases with history of recurrent pregnancy and forty-four controls with history of successful pregnancies were included. The FACSCaliber flow cytometer were used for analysis. No significant difference was observed between CD107a expression and IFN-γ production in response to CMV PP65 antigen in RPL patients and control group. How- ever, the cytotoxic response to SEB antigen in patients with RPL was significantly lower than control group (p=0.042). The results of this study show that impaired CD107a expression and IFN-γ production as CTL response to CMV does not appear to be a major contrib- uting and immune incompetence factor in patients with RPL, but cytotoxic T cell response defect to other antigens requires to be assessed further in these patients.

  19. Development and Validation of a Novel Dual Luciferase Reporter Gene Assay to Quantify Ebola Virus VP24 Inhibition of IFN Signaling

    Directory of Open Access Journals (Sweden)

    Elisa Fanunza

    2018-02-01

    Full Text Available The interferon (IFN system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24 is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE. Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z′- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance.

  20. A Promising IFN-Deficient System to Manufacture IFN-Sensitive Influenza Vaccine Virus.

    Science.gov (United States)

    Chen, Can; Fan, Wenhui; Li, Jing; Zheng, Weinan; Zhang, Shuang; Yang, Limin; Liu, Di; Liu, Wenjun; Sun, Lei

    2018-01-01

    Interferon (IFN)-sensitive and replication-incompetent influenza viruses are likely to be the alternatives to inactivated and attenuated virus vaccines. Some IFN-sensitive influenza vaccine candidates with modified non-structural protein 1 (NS1) are highly attenuated in IFN-competent hosts but induce robust antiviral immune responses. However, little research has been done on the manufacturability of these IFN-sensitive vaccine viruses. Here, RIG-I-knockout 293T cells were used to package the IFN-sensitive influenza A/WSN/33 (H1N1) virus expressing the mutant NS1 R38A/K41A. We found that the packaging efficiency of the NS1 R38A/K41A virus in RIG-I-knockout 293T cells was much higher than that in 293T cells. Moreover, the NS1 R38A/K41A virus almost lost its IFN antagonist activity and could no longer replicate in A549, MDCK, and Vero cells after 3-6 passages. This indicated that the replication of NS1 R38A/K41A virus is limited in conventional cells. Therefore, we further established a stable Vero cell line expressing the wild-type (WT) NS1 of the WSN virus, based on the Tet-On 3G system. The NS1 R38A/K41A virus was able to steadily propagate in this IFN-deficient cell line for at least 20 passages. In a mouse model, the NS1 R38A/K41A virus showed more than a 4-log reduction in lung virus titers compared to the WT virus at 3 and 5 days post infection. Furthermore, we observed that the NS1 R38A/K41A virus triggered high-level of IFN-α/β production in lung tissues and was eliminated from the host in a relatively short period of time. Additionally, this virus induced high-titer neutralizing antibodies against the WT WSN, A/Puerto Rico/8/1934 (PR8), or A/California/04/2009 (CA04) viruses and provided 100% protection against the WT WSN virus. Thus, we found that the replication of the NS1 R38A/K41A virus was limited in IFN-competent cells and mice. We also presented a promising IFN-deficient system, involving a RIG-I-knockout 293T cell line to package the IFN

  1. Development of a novel, guinea pig-specific IFN-γ ELISPOT assay and characterization of guinea pig cytomegalovirus GP83-specific cellular immune responses following immunization with a modified vaccinia virus Ankara (MVA)-vectored GP83 vaccine.

    Science.gov (United States)

    Gillis, Peter A; Hernandez-Alvarado, Nelmary; Gnanandarajah, Josephine S; Wussow, Felix; Diamond, Don J; Schleiss, Mark R

    2014-06-30

    The guinea pig (Cavia porcellus) provides a useful animal model for studying the pathogenesis of many infectious diseases, and for preclinical evaluation of vaccines. However, guinea pig models are limited by the lack of immunological reagents required for characterization and quantification of antigen-specific T cell responses. To address this deficiency, an enzyme-linked immunospot (ELISPOT) assay for guinea pig interferon (IFN)-γ was developed to measure antigen/epitope-specific T cell responses to guinea pig cytomegalovirus (GPCMV) vaccines. Using splenocytes harvested from animals vaccinated with a modified vaccinia virus Ankara (MVA) vector encoding the GPCMV GP83 (homolog of human CMV pp65 [gpUL83]) protein, we were able to enumerate and map antigen-specific responses, both in vaccinated as well as GPCMV-infected animals, using a panel of GP83-specific peptides. Several potential immunodominant GP83-specific peptides were identified, including one epitope, LGIVHFFDN, that was noted in all guinea pigs that had a detectable CD8+ response to GP83. Development of a guinea pig IFN-γ ELISPOT should be useful in characterization of additional T cell-specific responses to GPCMV, as well as other pathogens. This information in turn can help focus future experimental evaluation of immunization strategies, both for GPCMV as well as for other vaccine-preventable illnesses studied in the guinea pig model. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Differential cellular recognition pattern to M. tuberculosis targets defined by IFN-γ and IL-17 production in blood from TB + patients from Honduras as compared to health care workers: TB and immune responses in patients from Honduras.

    Science.gov (United States)

    Alvarez-Corrales, Nancy; Ahmed, Raija K; Rodriguez, Carol A; Balaji, Kithiganahalli N; Rivera, Rebeca; Sompallae, Ramakrishna; Vudattu, Nalini K; Hoffner, Sven E; Zumla, Alimuddin; Pineda-Garcia, Lelany; Maeurer, Markus

    2013-03-06

    A better understanding of the quality of cellular immune responses directed against molecularly defined targets will guide the development of TB diagnostics and identification of molecularly defined, clinically relevant M.tb vaccine candidates. Recombinant proteins (n = 8) and peptide pools (n = 14) from M. tuberculosis (M.tb) targets were used to compare cellular immune responses defined by IFN-γ and IL-17 production using a Whole Blood Assay (WBA) in a cohort of 148 individuals, i.e. patients with TB + (n = 38), TB- individuals with other pulmonary diseases (n = 81) and individuals exposed to TB without evidence of clinical TB (health care workers, n = 29). M.tb antigens Rv2958c (glycosyltransferase), Rv2962c (mycolyltransferase), Rv1886c (Ag85B), Rv3804c (Ag85A), and the PPE family member Rv3347c were frequently recognized, defined by IFN-γ production, in blood from healthy individuals exposed to M.tb (health care workers). A different recognition pattern was found for IL-17 production in blood from M.tb exposed individuals responding to TB10.4 (Rv0288), Ag85B (Rv1886c) and the PPE family members Rv0978c and Rv1917c. The pattern of immune target recognition is different in regard to IFN-γ and IL-17 production to defined molecular M.tb targets in PBMCs from individuals frequently exposed to M.tb. The data represent the first mapping of cellular immune responses against M.tb targets in TB patients from Honduras.

  3. Differential cellular recognition pattern to M. tuberculosis targets defined by IFN-γ and IL-17 production in blood from TB + patients from Honduras as compared to health care workers: TB and immune responses in patients from Honduras

    Science.gov (United States)

    2013-01-01

    Background A better understanding of the quality of cellular immune responses directed against molecularly defined targets will guide the development of TB diagnostics and identification of molecularly defined, clinically relevant M.tb vaccine candidates. Methods Recombinant proteins (n = 8) and peptide pools (n = 14) from M. tuberculosis (M.tb) targets were used to compare cellular immune responses defined by IFN-γ and IL-17 production using a Whole Blood Assay (WBA) in a cohort of 148 individuals, i.e. patients with TB + (n = 38), TB- individuals with other pulmonary diseases (n = 81) and individuals exposed to TB without evidence of clinical TB (health care workers, n = 29). Results M.tb antigens Rv2958c (glycosyltransferase), Rv2962c (mycolyltransferase), Rv1886c (Ag85B), Rv3804c (Ag85A), and the PPE family member Rv3347c were frequently recognized, defined by IFN-γ production, in blood from healthy individuals exposed to M.tb (health care workers). A different recognition pattern was found for IL-17 production in blood from M.tb exposed individuals responding to TB10.4 (Rv0288), Ag85B (Rv1886c) and the PPE family members Rv0978c and Rv1917c. Conclusions The pattern of immune target recognition is different in regard to IFN-γ and IL-17 production to defined molecular M.tb targets in PBMCs from individuals frequently exposed to M.tb. The data represent the first mapping of cellular immune responses against M.tb targets in TB patients from Honduras. PMID:23497342

  4. Heterogeneity of HVR-1 quasispecies is predictive of early but not sustained virological response in genotype 1b-infected patients undergoing combined treatment with PEG- or STD-IFN plus RBV.

    Science.gov (United States)

    Abbate, I; Cappiello, G; Lo Iacono, O; Longo, R; Ferraro, D; Antonucci, G; Di Marco, V; Di Stefano, R; Craxì, A; Solmone, M C; Spanò, A; Ippolito, G; Capobianchi, M R

    2003-01-01

    ISDR mutation pattern and HVR-1 quasispecies were analyzed in HCV genotype 1b-infected patients treated with either PEG- or STD-IFN plus ribavirin, in order to find virological correlates of therapy outcome. ISDR region analysis, performed at baseline (T0) and at 4 weeks of therapy (T1), indicated that ISDR mutation pattern was not predictive of response to treatment. Moreover, no selection of putative resistant strains in the first month of therapy was observed. Viral load was not correlated with any parameter of HVR-1 heterogeneity. Among the HVR-1 heterogeneity parameters considered, complexity was inversely correlated to viral load decline at T1. In univariate analysis, complexity, proportion of non synonymous substitutions (NS) and NS/S ratio were lower in patients showing virological response at 6 months of treatment. Complexity was the only parameter independently associated with both decline of viral load at T1 and virological response after 6 months, even after adjustment for confounding variables. At the end of treatment or later, these correlations were lost. Evolution pattern of the HVR-1 quasispecies indicated a strong selective pressure in sustained responders, with complete substitution of pre-existing quasispecies, while minor changes occured in non responders. In relapsers both patterns were present at a similar rate. In conclusion, this study shows that HVR-1 heterogeneity may be involved in the early response to combined IFN-RBV therapy. The loss of correlation between viral heterogeneity and therapy outcome at 6 months of therapy, or later, suggests that other factors may play a role in maintaining sustained response to treatment.

  5. Autophagy Facilitates IFN-γ-induced Jak2-STAT1 Activation and Cellular Inflammation*

    Science.gov (United States)

    Chang, Yu-Ping; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Chen, Chia-Ling; Lin, Yee-Shin; Kai, Jui-In; Hsieh, Chia-Yuan; Cheng, Yi-Lin; Choi, Pui-Ching; Chen, Shun-Hua; Chang, Shih-Ping; Liu, Hsiao-Sheng; Lin, Chiou-Feng

    2010-01-01

    Autophagy is regulated for IFN-γ-mediated antimicrobial efficacy; however, its molecular effects for IFN-γ signaling are largely unknown. Here, we show that autophagy facilitates IFN-γ-activated Jak2-STAT1. IFN-γ induces autophagy in wild-type but not in autophagy protein 5 (Atg5−/−)-deficient mouse embryonic fibroblasts (MEFs), and, autophagy-dependently, IFN-γ induces IFN regulatory factor 1 and cellular inflammatory responses. Pharmacologically inhibiting autophagy using 3-methyladenine, a known inhibitor of class III phosphatidylinositol 3-kinase, confirms these effects. Either Atg5−/− or Atg7−/− MEFs are, independent of changes in IFN-γ receptor expression, resistant to IFN-γ-activated Jak2-STAT1, which suggests that autophagy is important for IFN-γ signal transduction. Lentivirus-based short hairpin RNA for Atg5 knockdown confirmed the importance of autophagy for IFN-γ-activated STAT1. Without autophagy, reactive oxygen species increase and cause SHP2 (Src homology-2 domain-containing phosphatase 2)-regulated STAT1 inactivation. Inhibiting SHP2 reversed both cellular inflammation and the IFN-γ-induced activation of STAT1 in Atg5−/− MEFs. Our study provides evidence that there is a link between autophagy and both IFN-γ signaling and cellular inflammation and that autophagy, because it inhibits the expression of reactive oxygen species and SHP2, is pivotal for Jak2-STAT1 activation. PMID:20592027

  6. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  7. Hierarchy Low CD4+/CD8+ T-Cell Counts and IFNResponses in HIV-1+ Individuals Correlate with Active TB and/or M.tb Co-Infection.

    Science.gov (United States)

    Shao, Lingyun; Zhang, Xinyun; Gao, Yan; Xu, Yunya; Zhang, Shu; Yu, Shenglei; Weng, Xinhua; Shen, Hongbo; Chen, Zheng W; Jiang, Weimin; Zhang, Wenhong

    2016-01-01

    Detailed studies of correlation between HIV-M.tb co-infection and hierarchy declines of CD8+/CD4+ T-cell counts and IFNresponses have not been done. We conducted case-control studies to address this issue. 164 HIV-1-infected individuals comprised of HIV-1+ATB, HIV-1+LTB and HIV-1+TB- groups were evaluated. Immune phenotyping and complete blood count (CBC) were employed to measure CD4+ and CD8+ T-cell counts; T.SPOT.TB and intracellular cytokine staining (ICS) were utilized to detect ESAT6, CFP10 or PPD-specific IFNresponses. There were significant differences in median CD4+ T-cell counts between HIV-1+ATB (164/μL), HIV-1+LTB (447/μL) and HIV-1+TB- (329/μL) groups. Hierarchy low CD4+ T-cell counts (500/μL) were correlated significantly with active TB but not M.tb co-infection. Interestingly, hierarchy low CD8+ T-cell counts were not only associated significantly with active TB but also with M.tb co-infection (PHierarchy low CD8+ T-cell counts and effector function in HIV-1-infected individuals are correlated with both M.tb co-infection and active TB. Hierarchy low CD4+ T-cell counts and Th1 effector function in HIV-1+ individuals are associated with increased frequencies of active TB, but not M.tb co-infection.

  8. Cellular sources and targets of IFN-γ-mediated protection against viral demyelination and neurological deficits

    Science.gov (United States)

    Murray, Paul D.; McGavern, Dorian B.; Pease, Larry R.; Rodriguez, Moses

    2017-01-01

    IFN-γ is an anti-viral and immunomodulatory cytokine critical for resistance to multiple pathogens. Using mice with targeted disruption of the gene for IFN-γ, we previously demonstrated that this cytokine is critical for resistance to viral persistence and demyelination in the Theiler’s virus model of multiple sclerosis. During viral infections, IFN-γ is produced by natural killer (NK) cells, CD4+ and CD8+ T cells; however, the proportions of lymphocyte subsets responding to virus infection influences the contributions to IFN-γ-mediated protection. To determine the lymphocyte subsets that produce IFN-γ to maintain resistance, we used adoptive transfer strategies to generate mice with lymphocyte-specific deficiencies in IFN-γ-production. We demonstrate that IFN-γ production by both CD4+ and CD8+ T cell subsets is critical for resistance to Theiler’s murine encephalomyelitis virus (TMEV)-induced demyelination and neurological disease, and that CD4+ T cells make a greater contribution to IFN-γ-mediated protection. To determine the cellular targets of IFN-γ-mediated responses, we used adoptive transfer studies and bone marrow chimerism to generate mice in which either hematopoietic or somatic cells lacked the ability to express IFN-γ receptor. We demonstrate that IFN-γ receptor must be present on central nervous system glia, but not bone marrow-derived lymphocytes, in order to maintain resistance to TMEV-induced demyelination. PMID:11857334

  9. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  10. Biologic consequences of Stat1-independent IFN signaling

    Science.gov (United States)

    Gil, M. Pilar; Bohn, Erwin; O'Guin, Andrew K.; Ramana, Chilakamarti V.; Levine, Beth; Stark, George R.; Virgin, Herbert W.; Schreiber, Robert D.

    2001-01-01

    Although Stat1 is required for many IFN-dependent responses, recent work has shown that IFNγ functions independently of Stat1 to affect the growth of tumor cells or immortalized fibroblasts. We now demonstrate that both IFNγ and IFNα/β regulate proliferative responses in cells of the mononuclear phagocyte lineage derived from Stat1-null mice. Using both representational difference analysis and gene arrays, we show that IFNγ exerts its Stat1-independent actions on mononuclear phagocytes by regulating the expression of many genes. This result was confirmed by monitoring changes in expression and function of the corresponding gene products. Regulation of the expression of these genes requires the IFNγ receptor and Jak1. The physiologic relevance of IFN-dependent, Stat1-independent signaling was demonstrated by monitoring antiviral responses in Stat1-null mice. Thus, the IFN receptors engage alternative Stat1-independent signaling pathways that have important physiological consequences. PMID:11390995

  11. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  12. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  13. A multi-subunit Chlamydia vaccine inducing neutralizing antibodies and strong IFN-γ(+) CMI responses protects against a genital infection in minipigs

    DEFF Research Database (Denmark)

    Bøje, Sarah; Olsen, Anja Weinreich; Erneholm, Karin

    2016-01-01

    Chlamydia is the most widespread sexually transmitted bacterial disease and a prophylactic vaccine is highly needed. Ideally, this vaccine is required to induce a combined response of Th1 cell-mediated immune (CMI) response in concert with neutralizing antibodies. Using a novel Göttingen minipig...... trachomatis SvD bacteria (UV-SvD/CAF01) or CAF01. The Hirep1+CTH93/CAF01 vaccine induced a strong CMI response against the vaccine antigens and high titers of antibodies, particularly against the VD4 region of MOMP. Sera from Hirep1+CTH93/CAF01 immunized pigs neutralized C. trachomatis SvD and SvF infectivity...

  14. Loss of PTEN causes SHP2 activation, making lung cancer cells unresponsive to IFN

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Chia-Ling [Translational Research Center, Taipei Medical University, Taipei 110, Taiwan (China); Chiang, Tzu-Hui; Tseng, Po-Chun [Institute of Clinical Medicine, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Wang, Yu-Chih [Department of Microbiology and Immunology, School of Medicine, College of Medicine, Taipei Medical University, Taipei 110, Taiwan (China); Lin, Chiou-Feng, E-mail: cflin2014@tmu.edu.tw [Department of Microbiology and Immunology, School of Medicine, College of Medicine, Taipei Medical University, Taipei 110, Taiwan (China); Graduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taipei 110, Taiwan (China)

    2015-10-23

    Src homology-2 domain-containing phosphatase (SHP) 2, an oncogenic phosphatase, inhibits type II immune interferon (IFN)-γ signaling by subverting signal transducers and activators of transcription 1 tyrosine phosphorylation and activation. For cancer immunoediting, this study aimed to investigate the decrease of phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a tumor suppressor protein, leading to cellular impairment of IFN-γ signaling. In comparison with human lung adenocarcinoma A549 cells, the natural PTEN loss in another human lung adenocarcinoma line, PC14PE6/AS2 cells, presents reduced responsiveness in IFN-γ-induced IFN regulatory factor 1 activation and CD54 expression. Artificially silencing PTEN expression in A549 cells also caused cells to be unresponsive to IFN-γ without affecting IFN-γ receptor expression. IFN-γ-induced inhibition of cell proliferation and cytotoxicity were demonstrated in A549 cells but were defective in PC14PE6/AS2 cells and in PTEN-deficient A549 cells. Aberrant activation of SHP2 by ROS was specifically shown in PC14PE6/AS2 cells and PTEN-deficient A549 cells. Inhibiting ROS and SHP2 rescued cellular responses to IFN-γ-induced cytotoxicity and inhibition of cell proliferation in PC14PE6/AS2 cells. These results demonstrate that a decrease in PTEN facilitates ROS/SHP2 signaling, causing lung cancer cells to become unresponsive to IFN-γ. - Highlights: • This study demonstrates that PTEN decrease causes cellular unresponsive to IFN-γ. • Lung cancer cells with PTEN deficiency show unresponsive to IFN-γ signaling. • PTEN decrease inhibits IFN-γ-induced CD54, cell proliferation inhibition, and cytotoxicity. • ROS-mediated SHP2 activation makes PTEN-deficient cells unresponsive to IFN-γ.

  15. We Can Still Be Friends: IFN-γ Breaks Up Macrophage Enhancers.

    Science.gov (United States)

    Novakovic, Boris; Wang, Cheng; Logie, Colin

    2017-08-15

    Interferon (IFN)-γ can prime macrophages for inflammatory responses by several mechanisms, including enhancer establishment and gene activation. In this issue of Immunity, Kang et al. (2017) provide insight into the mechanisms of IFN-γ-mediated gene repression as they show that IFN-γ promotes the disassembly of select active enhancers by interfering with enhancer-binding transcription factor MAF. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. A multi-subunit Chlamydia vaccine inducing neutralizing antibodies and strong IFN-γ(+) CMI responses protects against a genital infection in minipigs

    DEFF Research Database (Denmark)

    Bøje, Sarah; Olsen, Anja Weinreich; Erneholm, Karin

    2016-01-01

    Chlamydia is the most widespread sexually transmitted bacterial disease and a prophylactic vaccine is highly needed. Ideally, this vaccine is required to induce a combined response of Th1 cell-mediated immune (CMI) response in concert with neutralizing antibodies. Using a novel Göttingen minipig...... animal model, we evaluated the immunogenicity and efficacy of a multi-subunit vaccine formulated in the strong Th1-inducing adjuvant CAF01. We evaluated a mixture of two fusion proteins (Hirep1 and CTH93) designed to promote either neutralizing antibodies or cell-mediated immunity, respectively. Hirep1...

  17. Influence of IL28B polymorphisms on response to a lower-than-standard dose peg-IFN-α 2a for genotype 3 chronic hepatitis C in HIV-coinfected patients.

    Directory of Open Access Journals (Sweden)

    Luis F López-Cortés

    Full Text Available Data on which to base definitive recommendations on the doses and duration of therapy for genotype 3 HCV/HIV-coinfected patients are scarce. We evaluated the efficacy of a lower peginterferon-α 2a dose and a shorter duration of therapy than the current standard of care in genotype 3 HCV/HIV-coinfected patients.Pilot, open-label, single arm clinical trial which involved 58 Caucasian HCV/HIV-coinfected patients who received weekly 135 µg peginterferon-α 2a plus ribavirin 400 mg twice daily during 20 weeks after attaining undetectable viremia. The relationships between baseline patient-related variables, including IL28B genotype, plasma HCV-RNA, ribavirin dose/kg, peginterferon-α 2a and ribavirin levels with virological responses were analyzed. Only 4 patients showed lack of response and 5 patients dropped out due to adverse events related to the study medication. Overall, sustained virologic response (SVR rates were 58.3% by intention-to-treat and 71.4% by per protocol analysis, respectively. Among patients with rapid virologic response (RVR, SVR and relapses rates were 92.6% and 7.4%, respectively. No relationships were observed between viral responses and ribavirin dose/kg, peginterferon-α 2a concentrations, ribavirin levels or rs129679860 genotype.Weekly 135 µg pegIFN-α 2a could be as effective as the standard 180 µg dose, with a very low incidence of severe adverse events. A 24-week treatment duration appears to be appropriate in patients achieving RVR, but extending treatment up to just 20 weeks beyond negativization of viremia is associated with a high relapse rate in those patients not achieving RVR. There was no influence of IL28B genotype on the virological responses.ClinicalTrials.gov NCT00553930.

  18. Ribavirin enhances IFN-α signalling and MxA expression: a novel immune modulation mechanism during treatment of HCV.

    Directory of Open Access Journals (Sweden)

    Nigel J Stevenson

    Full Text Available The nucleoside analogue Ribavirin significantly increases patient response to IFN-α treatment of HCV, by directly inhibiting viral replication. Recent studies indicate that Ribavirin also regulates immunity and we propose that Ribavirin enhances specific interferon sensitive gene (ISG expression by amplifying the IFN-α-JAK/STAT pathway. We found that IFN-α-induced STAT1 and STAT3 phosphorylation was increased in hepatocytes co-treated with Ribavirin and IFN-α, compared to IFN-α alone. Ribavirin specifically enhanced IFN-α induced mRNA and protein of the anti-viral mediator MxA, which co-localised with HCV core protein. These novel findings indicate for the first time that Ribavirin, in addition to its viral incorporation, also enhances IFN-α-JAK/STAT signalling, leading to a novel MxA-mediated immuno-modulatory mechanism that may enhance IFN-α anti-viral activity against HCV.

  19. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  20. Astaxanthin, a Carotenoid, Stimulates Immune Responses by Enhancing IFN-γ and IL-2 Secretion in Primary Cultured Lymphocytes in Vitro and ex Vivo

    Science.gov (United States)

    Lin, Kuan-Hung; Lin, Kao-Chang; Lu, Wan-Jung; Thomas, Philip-Aloysius; Jayakumar, Thanasekaran; Sheu, Joen-Rong

    2015-01-01

    Astaxanthin, a potent antioxidant carotenoid, plays a major role in modulating the immune response. In this study, we examined the immunomodulatory effects of astaxanthin on cytokine production in primary cultured lymphocytes both in vitro and ex vivo. Direct administration of astaxanthin (70–300 nM) did not produce cytotoxicity in lipopolysaccharide (LPS, 100 µg/ mL)- or concanavalin A (Con A, 10 µg/ mL)-activated lymphocytes, whereas astaxanthin alone at 300 nM induced proliferation of splenic lymphocytes (p < 0.05) in vitro. Although astaxanthin, alone or with Con A, had no apparent effect on interferon (INF-γ) and interleukin (IL-2) production in primary cultured lymphocytes, it enhanced LPS-induced INF-γ production. In an ex vivo experiment, oral administration of astaxanthin (0.28, 1.4 and 7 mg/kg/day) for 14 days did not cause alterations in the body or spleen weights of mice and also was not toxic to lymphocyte cells derived from the mice. Moreover, treatment with astaxanthin significantly increased LPS-induced lymphocyte proliferation ex vivo but not Con A-stimulated lymphocyte proliferation ex vivo. Enzyme linked immunosorbent assay (ELISA) analysis revealed that administration of astaxanthin significantly enhanced INF-γ production in response to both LPS and Con A stimulation, whereas IL-2 production increased only in response to Con A stimulation. Also, astaxanthin treatment alone significantly increased IL-2 production in lymphocytes derived from mice, but did not significantly change production of INF-γ. These findings suggest that astaxanthin modulates lymphocytic immune responses in vitro, and that it partly exerts its ex vivo immunomodulatory effects by increasing INF-γ and IL-2 production without inducing cytotoxicity. PMID:26729100

  1. Lambda Interferon (IFN-gamma), a Type III IFN, is induced by viruses and IFNs and displays potent antiviral activity against select virus infections in vivo

    DEFF Research Database (Denmark)

    Ank, Nina; West, Hans; Bartholdy, C.

    2006-01-01

    Type III interferons (IFNs) (interleukin-28/29 or lambda interferon [IFN-lambda]) are cytokines with IFN-like activities. Here we show that several classes of viruses induce expression of IFN-lambda1 and -lambda2/3 in similar patterns. The IFN-lambdas were-unlike alpha/beta interferon (IFN......-alpha/beta)-induced directly by stimulation with IFN-alpha or -lambda, thus identifying type III IFNs as IFN-stimulated genes. In vitro assays revealed that IFN-lambdas have appreciable antiviral activity against encephalomyocarditis virus (EMCV) but limited activity against herpes simplex virus type 2 (HSV-2), whereas IFN......-alpha potently restricted both viruses. Using three murine models for generalized virus infections, we found that while recombinant IFN-alpha reduced the viral load after infection with EMCV, lymphocytic choriomeningitis virus (LCMV), and HSV-2, treatment with recombinant IFN-lambda in vivo did not affect viral...

  2. Lambda interferon (IFN-lambda), a type III IFN, is induced by viruses and IFNs and displays potent antiviral activity against select virus infections in vivo

    DEFF Research Database (Denmark)

    Ank, Nina; West, Hans; Bartholdy, Christina

    2006-01-01

    Type III interferons (IFNs) (interleukin-28/29 or lambda interferon [IFN-lambda]) are cytokines with IFN-like activities. Here we show that several classes of viruses induce expression of IFN-lambda1 and -lambda2/3 in similar patterns. The IFN-lambdas were-unlike alpha/beta interferon (IFN......-alpha/beta)-induced directly by stimulation with IFN-alpha or -lambda, thus identifying type III IFNs as IFN-stimulated genes. In vitro assays revealed that IFN-lambdas have appreciable antiviral activity against encephalomyocarditis virus (EMCV) but limited activity against herpes simplex virus type 2 (HSV-2), whereas IFN......-alpha potently restricted both viruses. Using three murine models for generalized virus infections, we found that while recombinant IFN-alpha reduced the viral load after infection with EMCV, lymphocytic choriomeningitis virus (LCMV), and HSV-2, treatment with recombinant IFN-lambda in vivo did not affect viral...

  3. Adaptive Immunity against Streptococcus pyogenes in Adults Involves Increased IFN-gamma and IgG3 Responses Compared with Children

    DEFF Research Database (Denmark)

    Mortensen, Rasmus; Nissen, Thomas Norrelykke; Blauenfeldt, Thomas

    2015-01-01

    Each year, millions of people are infected with Streptococcus pyogenes, leading to an estimated 500,000 annual deaths worldwide. For unknown reasons, school-aged children have substantially higher infection rates than adults. The goal for this study was to provide, to our knowledge, the first det...... cellular memory response in combination with IgG1/IgG3-dominated humoral immunity that increase with age. The significance of these data regarding both the increased GAS infection rate in children and the development of protective GAS vaccines is discussed.......Each year, millions of people are infected with Streptococcus pyogenes, leading to an estimated 500,000 annual deaths worldwide. For unknown reasons, school-aged children have substantially higher infection rates than adults. The goal for this study was to provide, to our knowledge, the first...... detailed characterization of the human adaptive immune response against S. pyogenes in both children and adults. We report that all adults in our study, as well as most children, showed immunity against the two conserved group A streptococci (GAS) Ags, streptococcal C5a peptidase and immunogenic secreted...

  4. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  5. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  6. Research Article Polymorphism detection of promoter region of IFN ...

    Indian Academy of Sciences (India)

    MRT Pack 24 DVDs

    Improving animal health is considered to be the basic goal of the animal breeding ..... Additionally, cytokines including TGF-β, IFN-y and TNF-α, IL-1α, IL- .... of lipopolysaccharide-binding protein in protection of mice against a ... Humoral Immune Response to Killed H5N1 HPAI Vaccine in a Red Jungle fowl Population.

  7. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  8. Identification of Two Subgroups of Type I IFNs in Perciforme Fish Large Yellow Croaker Larimichthys crocea Provides Novel Insights into Function and Regulation of Fish Type I IFNs

    Directory of Open Access Journals (Sweden)

    Yang Ding

    2016-09-01

    Full Text Available Like mammals, fish possess an interferon regulatory factor 3 (IRF3/IRF7-dependent type I IFN responses, but the exact mechanism by which IRF3/IRF7 regulate the type I IFNs remains largely unknown. In this study, we identified two type I IFNs in the Perciforme fish large yellow croaker Larimichthys crocea, one of which belongs to the fish IFNd subgroup, and the other is assigned to a novel subgroup of group I IFNs in fish, tentatively termed IFNh. The two IFN genes are constitutively expressed in all examined tissues, but with varied expression levels. Both IFN genes can be rapidly induced in head kidney and spleen tissues by polyinosinic-polycytidylic acid. The recombinant IFNh was shown to be more potent to trigger a rapid induction of the antiviral genes MxA and PKR than the IFNd, suggesting that they may play distinct roles in regulating early antiviral immunity. Strikingly, IFNd, but not IFNh, could induce the gene expression of itself and IFNh through a positive feedback loop mediated by the IFNd-dependent activation of IRF3 and IRF7. Furthermore, our data demonstrate that the induction of IFNd can be enhanced by the dimeric formation of IRF3 and IRF7, while the IFNh expression mainly involves IRF3. Taken together, our findings demonstrate that the IFN responses are diverse in fish and are likely to be regulated by distinct mechanisms.

  9. Biologic consequences of Stat1-independent IFN signaling

    OpenAIRE

    Gil, M. Pilar; Bohn, Erwin; O'Guin, Andrew K.; Ramana, Chilakamarti V.; Levine, Beth; Stark, George R.; Virgin, Herbert W.; Schreiber, Robert D.

    2001-01-01

    Although Stat1 is required for many IFN-dependent responses, recent work has shown that IFNγ functions independently of Stat1 to affect the growth of tumor cells or immortalized fibroblasts. We now demonstrate that both IFNγ and IFNα/β regulate proliferative responses in cells of the mononuclear phagocyte lineage derived from Stat1-null mice. Using both representational difference analysis and gene arrays, we show that IFNγ exerts its Stat1-independent actions on m...

  10. Thermostability of IFN-γ and IP-10 release assays for latent infection with Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Blauenfeldt, Thomas; Wagner, Dirk; Aabye, Martine Grosos

    2016-01-01

    accuracy of IP-10 release assay and IGRAs. RESULTS: We included 65 patients with confirmed pulmonary tuberculosis and 160 healthy controls from 6 European centres collaborating in the TBnet. In patients, IP-10 responses increased 1.07 (IQR 0.90-1.36) fold and IFNresponses decreased 0.88 (IQR 0......INTRODUCTION: Interferon-γ (IFN-γ) inducible protein 10kD (IP-10) and IFN-γ release assays (IGRAs) are immunodiagnostic tests aiming to identify the presence of specific cellular immune responses, interpreted as markers for latent infection with Mycobacterium tuberculosis. Incubation at higher...

  11. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  13. IFN-Alpha receptor-1 upregulation in PBMC from HCV naïve patients carrying cc genotype. possible role of IFN-lambda.

    Directory of Open Access Journals (Sweden)

    Eleonora Lalle

    Full Text Available IL-28B gene polymorphisms predict better therapeutic response and spontaneous clearance of HCV. Moreover, higher expression of IFN-lambda has been reported in patients with the rs12979860 CC favourable genotype. The study aim was to establish possible relationships between IL-28B rs12979860 genotypes and expression of IFN-alpha receptor-1 (IFNAR-1 in naïve HCV patients, and to explore the possible role of IFN-lambda.IFNAR-1 mRNA levels were measured in PBMC from naïve patients with chronic hepatitis C with different IL-28 genotypes. The ability of IFN-lambda to up-regulate the expression of IFNAR-1 was established in PBMC from healthy donors carrying different IL-28B genotypes.Lower IFNAR-1 mRNA levels were observed in PBMC from HCV-infected naïve patients as compared to healthy donors. In healthy donors, IFNAR-1 mRNA levels were independent from IL-28B genotype, while in HCV patients, an increasing gradient was observed in TT vs CT vs CC carriers. In the latter group, a direct correlation between IFNAR-1 and endogenous IL-28B expression was observed. Moreover, IFN-lambda up-regulated IFNAR-1 expression in normal PBMC in a time-and dose-dependent manner, with a more effective response in CC vs TT carriers.Endogenous levels of IFN-lambda may be responsible for partial restoration of IFNAR-1 expression in HCV patients with favourable IL-28 genotype. This, in turn, may confer to CC carriers a response advantage to either endogenous or exogenous IFN-alpha, representing the biological basis for the observed association between CC genotype and favourable outcome of either natural infection (clearance vs chronicization or IFN therapy.

  14. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  15. Resolution of PMA-Induced Skin Inflammation Involves Interaction of IFN-γ and ALOX15

    Directory of Open Access Journals (Sweden)

    Guojun Zhang

    2013-01-01

    Full Text Available Background. Acute inflammation and its timely resolution play important roles in the body’s responses to the environmental stimulation. Although IFN-γ is well known for the induction of inflammation, its role in the inflammation resolution is still poorly understood. Methodology and Principal Findings. In this study, we investigated the function of interferon gamma (IFN-γ during the resolution of PMA-induced skin inflammation in vivo. The results revealed that the expression levels of IL-6, TNF-α, and monocyte chemoattractant protein 1 (MCP-1 in skin decreased during the resolution stage of PMA-induced inflammation, while IFN-γ is still maintained at a relatively high level. Neutralization of endogenous IFN-γ led to accelerated reduction of epidermal thickness and decreased epithelial cell proliferation. Similarly, decreased infiltration of inflammatory cells (Gr1+ or CD11b+ cells and a significant reduction of proinflammatory cytokines were also observed upon the blockade of IFN-γ. Furthermore, neutralization of IFN-γ boosted ALOX15 expression of the skin during inflammation resolution. In accordance, application of lipoxin A4 (LXA4, a product of ALOX15 obtained a proresolution effect similar to neutralization of IFN-γ. These results demonstrated that through upregulating ALOX15-LXA4 pathway, blockage of IFN-γ can promote the resolution of PMA-induced skin inflammation.

  16. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  17. Characterization of the bovine type I IFN locus: rearrangements, expansions, and novel subfamilies

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Type I interferons (IFN have major roles in the innate immune response to viruses, a function that is believed to have led to expansion in the number and complexity of their genes, although these genes have remained confined to single chromosomal region in all mammals so far examined. IFNB and IFNE define the limits of the locus, with all other Type I IFN genes except IFNK distributed between these boundaries, strongly suggesting that the locus has broadened as IFN genes duplicated and then evolved into a series of distinct families. Results The Type I IFN locus in Bos taurus has undergone significant rearrangement and expansion compared to mouse and human, however, with the constituent genes separated into two sub-loci separated by >700 kb. The IFNW family is greatly expanded, comprising 24 potentially functional genes and at least 8 pseudogenes. The IFNB (n = 6, represented in human and mouse by one copy, are also present as multiple copies in Bos taurus. The IFNT, which encode a non-virally inducible, ruminant-specific IFN secreted by the pre-implantation conceptus, are represented by three genes and two pseudogenes. The latter have sequences intermediate between IFNT and IFNW. A new Type I IFN family (IFNX of four members, one of which is a pseudogene, appears to have diverged from the IFNA lineage at least 83 million years ago, but is absent in all other sequenced genomes with the possible exception of the horse, a non-ruminant herbivore. Conclusion In summary, we have provided the first comprehensive annotation of the Type I IFN locus in Bos taurus, thereby providing an insight into the functional evolution of the Type I IFN in ruminants. The diversity and global spread of the ruminant species may have required an expansion of the Type I IFN locus and its constituent genes to provide broad anti-viral protection required for foraging and foregut fermentation.

  18. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  19. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  20. Vaccinia Virus Protein C6 Inhibits Type I IFN Signalling in the Nucleus and Binds to the Transactivation Domain of STAT2.

    Directory of Open Access Journals (Sweden)

    Jennifer H Stuart

    2016-12-01

    Full Text Available The type I interferon (IFN response is a crucial innate immune signalling pathway required for defense against viral infection. Accordingly, the great majority of mammalian viruses possess means to inhibit this important host immune response. Here we show that vaccinia virus (VACV strain Western Reserve protein C6, is a dual function protein that inhibits the cellular response to type I IFNs in addition to its published function as an inhibitor of IRF-3 activation, thereby restricting type I IFN production from infected cells. Ectopic expression of C6 inhibits the induction of interferon stimulated genes (ISGs in response to IFNα treatment at both the mRNA and protein level. C6 inhibits the IFNα-induced Janus kinase/signal transducer and activator of transcription (JAK/STAT signalling pathway at a late stage, downstream of STAT1 and STAT2 phosphorylation, nuclear translocation and binding of the interferon stimulated gene factor 3 (ISGF3 complex to the interferon stimulated response element (ISRE. Mechanistically, C6 associates with the transactivation domain of STAT2 and this might explain how C6 inhibits the type I IFN signalling very late in the pathway. During virus infection C6 reduces ISRE-dependent gene expression despite the presence of the viral protein phosphatase VH1 that dephosphorylates STAT1 and STAT2. The ability of a cytoplasmic replicating virus to dampen the immune response within the nucleus, and the ability of viral immunomodulators such as C6 to inhibit multiple stages of the innate immune response by distinct mechanisms, emphasizes the intricacies of host-pathogen interactions and viral immune evasion.

  1. IFN-λ: A New Class of Interferon with Distinct Functions-Implications for Hepatitis C Virus Research

    Directory of Open Access Journals (Sweden)

    Bing Liu

    2015-01-01

    Full Text Available Pegylated interferon-α and ribavirin (PEG-IFN/RBV is widely used to treat chronic hepatitis C virus infection with notorious adverse reactions since the broad expression of IFN-α receptors on all nucleated cells. Accordingly, a Type III IFN with restricted receptors distribution is much safer as an alternative for HCV therapy. In addition, single nucleotide polymorphisms (SNPs near the human IFN-λ3 gene, IL-28B, correlate strongly with the ability to achieve a sustained virological response (SVR to therapy with pegylated IFN-α plus ribavirin in patients infected with chronic hepatitis C. Furthermore, we also discuss the most recent findings: IFN-λ4 predicts treatment outcomes of HCV infection. In consideration of the apparent limitations of current HCV therapy, especially high failure rate and universal side effects, prediction of treatment outcomes prior to the initiation of treatment and developing new alternative drugs are two important goals in HCV research.

  2. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  3. ISG15 Inhibits IFN-α-Resistant Liver Cancer Cell Growth

    Directory of Open Access Journals (Sweden)

    Xin-xing Wan

    2013-01-01

    Full Text Available Hepatocellular carcinoma (HCC is one of the most prevalent tumors worldwide. Interferon-α (IFN-α has been widely used in the treatment of HCC, but patients eventually develop resistance. ISG15 ubiquitin-like modifier (ISG15 is a ubiquitin-like protein transcriptionally regulated by IFN-α which shows antivirus and antitumor activities. However, the exact role of ISG15 is unknown. In the present study, we showed that IFN-α significantly induced ISG15 expression but failed to induce HepG2 cell apoptosis, whereas transient overexpression of ISG15 dramatically increased HepG2 cell apoptosis. ISG15 overexpression increased overall protein ubiquitination, which was not observed in cells with IFN-α-induced ISG15 expression, suggesting that IFN-α treatment not only induced the expression of ISG15 but also inhibited ISG15-mediated ubiquitination. The tumor suppressor p53 and p21 proteins are the key regulators of cell survival and death in response to stress signals such as DNA damage. We showed that p53 or p21 is only up regulated in HepG2 cells ectopically expressing ISG15, but not in the presence of IFN-α-induced ISG15. Our results suggest that ISG15 overexpression could be developed into a powerful gene-therapeutic tool for treating IFN-α-resistant HCC.

  4. Interferon lambda (IFN-λ) efficiently blocks norovirus transmission in a mouse model.

    Science.gov (United States)

    Rocha-Pereira, Joana; Jacobs, Sophie; Noppen, Sam; Verbeken, Eric; Michiels, Thomas; Neyts, Johan

    2018-01-01

    Human noroviruses are highly efficient in person to person transmission thus associated with explosive outbreaks of acute gastroenteritis. Outbreak control is limited to disinfection and isolation measures. Strategies to control the spread of noroviruses should be developed and models to study norovirus transmission will greatly facilitate this. Here, a mouse-to-mouse transmission model, in which mice develop acute murine norovirus (MNV)-induced diarrhea, was used to explore the role of interferon lambda (IFN-λ) in the control of a norovirus infection. Sentinel AG129 mice [deficient in IFN-α/β and IFN-γ receptors] that were co-housed with MNV-infected mice shedding high amounts of virus in their stool, developed a MNV-infection with associated diarrhea. Inoculation of such sentinel mice with an IFN-λ expression plasmid resulted in the production of circulating IFN-λ and upregulation of the expression of IFN-stimulated genes (ISGs) of the gut. Injection of the IFN-λ-expressing plasmid to sentinels prevents MNV-induced disease upon exposure to MNV-infected mice, as well as MNV replication in the small intestine, the associated signs of inflammation and the mounting of a specific IgG-based immune response. This demonstrates that IFN-λ can alone mediate protection against transmission of norovirus. The development of a simple delivery method for IFN-λ could be explored as a strategy to control norovirus outbreaks and protect vulnerable populations such as the elderly and immunocompromised. Copyright © 2017. Published by Elsevier B.V.

  5. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  6. Distinct mechanisms of loss of IFN-gamma mediated HLA class I inducibility in two melanoma cell lines

    International Nuclear Information System (INIS)

    Rodríguez, Teresa; Méndez, Rosa; Del Campo, Ana; Jiménez, Pilar; Aptsiauri, Natalia; Garrido, Federico; Ruiz-Cabello, Francisco

    2007-01-01

    The inability of cancer cells to present antigen on the cell surface via MHC class I molecules is one of the mechanisms by which tumor cells evade anti-tumor immunity. Alterations of Jak-STAT components of interferon (IFN)-mediated signaling can contribute to the mechanism of cell resistance to IFN, leading to lack of MHC class I inducibility. Hence, the identification of IFN-γ-resistant tumors may have prognostic and/or therapeutic relevance. In the present study, we investigated a mechanism of MHC class I inducibility in response to IFN-γ treatment in human melanoma cell lines. Basal and IFN-induced expression of HLA class I antigens was analyzed by means of indirect immunofluorescence flow cytometry, Western Blot, RT-PCR, and quantitative real-time RT-PCR (TaqMan ® Gene Expression Assays). In demethylation studies cells were cultured with 5-aza-2'-deoxycytidine. Electrophoretic Mobility Shift Assay (EMSA) was used to assay whether IRF-1 promoter binding activity is induced in IFN-γ-treated cells. Altered IFN-γ mediated HLA-class I induction was observed in two melanoma cells lines (ESTDAB-004 and ESTDAB-159) out of 57 studied, while treatment of these two cell lines with IFN-α led to normal induction of HLA class I antigen expression. Examination of STAT-1 in ESTDAB-004 after IFN-γ treatment demonstrated that the STAT-1 protein was expressed but not phosphorylated. Interestingly, IFN-α treatment induced normal STAT-1 phosphorylation and HLA class I expression. In contrast, the absence of response to IFN-γ in ESTDAB-159 was found to be associated with alterations in downstream components of the IFN-γ signaling pathway. We observed two distinct mechanisms of loss of IFN-γ inducibility of HLA class I antigens in two melanoma cell lines. Our findings suggest that loss of HLA class I induction in ESTDAB-004 cells results from a defect in the earliest steps of the IFN-γ signaling pathway due to absence of STAT-1 tyrosine-phosphorylation, while absence

  7. Bioinformatics analysis of the factors controlling type I IFN gene expression in autoimmune disease and virus-induced immunity

    Directory of Open Access Journals (Sweden)

    Di eFeng

    2013-09-01

    Full Text Available Patients with systemic lupus erythematosus (SLE and Sjögren's syndrome (SS display increased levels of type I IFN-induced genes. Plasmacytoid dendritic cells (PDCs are natural interferon producing cells and considered to be a primary source of IFN-α in these two diseases. Differential expression patterns of type I IFN inducible transcripts can be found in different immune cell subsets and in patients with both active and inactive autoimmune disease. A type I IFN gene signature generally consists of three groups of IFN-induced genes - those regulated in response to virus-induced type I IFN, those regulated by the IFN-induced mitogen-activated protein kinase/extracellular-regulated kinase (MAPK/ERK pathway, and those by the IFN-induced phosphoinositide-3 kinase (PI-3K pathway. These three groups of type I IFN-regulated genes control important cellular processes such as apoptosis, survival, adhesion, and chemotaxis, that when dysregulated, contribute to autoimmunity. With the recent generation of large datasets in the public domain from next-generation sequencing and DNA microarray experiments, one can perform detailed analyses of cell type-specific gene signatures as well as identify distinct transcription factors that differentially regulate these gene signatures. We have performed bioinformatics analysis of data in the public domain and experimental data from our lab to gain insight into the regulation of type I IFN gene expression. We have found that the genetic landscape of the IFNA and IFNB genes are occupied by transcription factors, such as insulators CTCF and cohesin, that negatively regulate transcription, as well as IRF5 and IRF7, that positively and distinctly regulate IFNA subtypes. A detailed understanding of the factors controlling type I IFN gene transcription will significantly aid in the identification and development of new therapeutic strategies targeting the IFN pathway in autoimmune disease.

  8. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  9. Cell-specific type I IFN signatures in autoimmunity and viral infection: what makes the difference?

    Directory of Open Access Journals (Sweden)

    Chieko Kyogoku

    Full Text Available Gene expression profiling of peripheral blood mononuclear cells (PBMCs has revealed a crucial role for type I interferon (IFN in the pathogenesis of systemic lupus erythematosus (SLE. However, it is unclear how particular leucocyte subsets contribute to the overall type I IFN signature of PBMCs and whole blood samples.Furthermore, a detailed analysis describing the differences in the IFN signature in autoimmune diseases from that observed after viral infection has not been performed to date. Therefore, in this study, the transcriptional responses in peripheral T helper cells (CD4(+ and monocyte subsets (CD16(- inflammatory and CD16(+ resident monocytes isolated from patients with SLE, healthy donors (ND immunised with the yellow fever vaccine YFV-17Dand untreated controls were compared by global gene expression profiling.It was striking that all of the transcripts that were regulated in response to viral exposure were also found to be differentially regulated in SLE, albeit with markedly lower fold-change values. In addition to this common IFN signature, a pathogenic IFN-associated gene signature was detected in the CD4(+ T cells and monocytes from the lupus patients. IL-10, IL-9 and IL-15-mediated JAK/STAT signalling was shown to be involved in the pathological amplification of IFN responses observed in SLE. Type I IFN signatures identified were successfully applied for the monitoring of interferon responses in PBMCs of an independent cohort of SLE patients and virus-infected individuals. Moreover, these cell-type specific gene signatures allowed a correct classification of PBMCs independent from their heterogenic cellular composition. In conclusion, our data show for the first time that monocytes and CD4 cells are sensitive biosensors to monitor type I interferon response signatures in autoimmunity and viral infection and how these transriptional responses are modulated in a cell- and disease-specific manner.

  10. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  11. Intracellular fate of recombinant human interferon-gamma (rIFN) in U937 cells

    International Nuclear Information System (INIS)

    Finbloom, D.S.

    1986-01-01

    After IFN binds to specific receptors on macrophages, both modulation of surface molecules and induction of microbicidal and tumoricidal activity occurs 24-48 hr later. Since the intracellular events required to insure these responses are poorly defined, the fate of radiolabeled rIFN in U937 cells was examined. Endocytosis was determined by exposing cells to pH 2.5 to allow rIFN to dissociate leaving only intracellular ligand. Degradation was measured as trichloroacetic acid soluble radioactivity in the media. Of the 4-5000 molecules of rIFN that specifically and saturably (at 300 U/ml) bound at 4 0 C, 40% dissociated during 15-30 min after cells were warmed to 37 0 C. However, if cells were continuously exposed at 37 0 C to lower levels of rIFN (60-100 U/ml), 30-40% of those molecules capable of binding to the cell at that concentration were internalized. Furthermore, 60% of the molecules were degraded during 3-4 hr of additional culture. Since exposure of cells to chloroquine and monensin resulted in only partial inhibition of degradation (75% and 43%, respectively), there may also be degradation within endosomes or on the cell following binding to its receptor. Soon thereafter, degradation products are measurable. Since many biological responses require prolonged incubation with the molecule, intracellular processing of IFN may be important for expression of these effects

  12. Immune cell-poor melanomas benefit from PD-1 blockade after targeted type I IFN activation.

    Science.gov (United States)

    Bald, Tobias; Landsberg, Jennifer; Lopez-Ramos, Dorys; Renn, Marcel; Glodde, Nicole; Jansen, Philipp; Gaffal, Evelyn; Steitz, Julia; Tolba, Rene; Kalinke, Ulrich; Limmer, Andreas; Jönsson, Göran; Hölzel, Michael; Tüting, Thomas

    2014-06-01

    Infiltration of human melanomas with cytotoxic immune cells correlates with spontaneous type I IFN activation and a favorable prognosis. Therapeutic blockade of immune-inhibitory receptors in patients with preexisting lymphocytic infiltrates prolongs survival, but new complementary strategies are needed to activate cellular antitumor immunity in immune cell-poor melanomas. Here, we show that primary melanomas in Hgf-Cdk4(R24C) mice, which imitate human immune cell-poor melanomas with a poor outcome, escape IFN-induced immune surveillance and editing. Peritumoral injections of immunostimulatory RNA initiated a cytotoxic inflammatory response in the tumor microenvironment and significantly impaired tumor growth. This critically required the coordinated induction of type I IFN responses by dendritic, myeloid, natural killer, and T cells. Importantly, antibody-mediated blockade of the IFN-induced immune-inhibitory interaction between PD-L1 and PD-1 receptors further prolonged the survival. These results highlight important interconnections between type I IFNs and immune-inhibitory receptors in melanoma pathogenesis, which serve as targets for combination immunotherapies. Using a genetically engineered mouse melanoma model, we demonstrate that targeted activation of the type I IFN system with immunostimulatory RNA in combination with blockade of immune-inhibitory receptors is a rational strategy to expose immune cell-poor tumors to cellular immune surveillance. ©2014 American Association for Cancer Research.

  13. Getting “Inside” Type I IFNs: Type I IFNs in Intracellular Bacterial Infections

    Directory of Open Access Journals (Sweden)

    Deann T. Snyder

    2017-01-01

    Full Text Available Type I interferons represent a unique and complex group of cytokines, serving many purposes during innate and adaptive immunity. Discovered in the context of viral infections, type I IFNs are now known to have myriad effects in infectious and autoimmune disease settings. Type I IFN signaling during bacterial infections is dependent on many factors including whether the infecting bacterium is intracellular or extracellular, as different signaling pathways are activated. As such, the repercussions of type I IFN induction can positively or negatively impact the disease outcome. This review focuses on type I IFN induction and downstream consequences during infection with the following intracellular bacteria: Chlamydia trachomatis, Listeria monocytogenes, Mycobacterium tuberculosis, Salmonella enterica serovar Typhimurium, Francisella tularensis, Brucella abortus, Legionella pneumophila, and Coxiella burnetii. Intracellular bacterial infections are unique because the bacteria must avoid, circumvent, and even co-opt microbial “sensing” mechanisms in order to reside and replicate within a host cell. Furthermore, life inside a host cell makes intracellular bacteria more difficult to target with antibiotics. Because type I IFNs are important immune effectors, modulating this pathway may improve disease outcomes. But first, it is critical to understand the context-dependent effects of the type I IFN pathway in intracellular bacterial infections.

  14. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  15. IFN-β: A Contentious Player in Host–Pathogen Interaction in Tuberculosis

    Science.gov (United States)

    Sabir, Naveed; Hussain, Tariq; Shah, Syed Zahid Ali; Zhao, Deming; Zhou, Xiangmei

    2017-01-01

    Tuberculosis (TB) is a major health threat to the human population worldwide. The etiology of the disease is Mycobacterium tuberculosis (Mtb), a highly successful intracellular pathogen. It has the ability to manipulate the host immune response and to make the intracellular environment suitable for its survival. Many studies have addressed the interactions between the bacteria and the host immune cells as involving many immune mediators and other cellular players. Interferon-β (IFN-β) signaling is crucial for inducing the host innate immune response and it is an important determinant in the fate of mycobacterial infection. The role of IFN-β in protection against viral infections is well established and has been studied for decades, but its role in mycobacterial infections remains much more complicated and debatable. The involvement of IFN-β in immune evasion mechanisms adopted by Mtb has been an important area of investigation in recent years. These advances have widened our understanding of the pro-bacterial role of IFN-β in host–pathogen interactions. This pro-bacterial activity of IFN-β appears to be correlated with its anti-inflammatory characteristics, primarily by antagonizing the production and function of interleukin 1β (IL-1β) and interleukin 18 (IL-18) through increased interleukin 10 (IL-10) production and by inhibiting the nucleotide-binding domain and leucine-rich repeat protein-3 (NLRP3) inflammasome. Furthermore, it also fails to provoke a proper T helper 1 (Th1) response and reduces the expression of major histocompatibility complex II (MHC-II) and interferon-γ receptors (IFNGRs). Here we will review some studies to provide a paradigm for the induction, regulation, and role of IFN-β in mycobacterial infection. Indeed, recent studies suggest that IFN-β plays a role in Mtb survival in host cells and its downregulation may be a useful therapeutic strategy to control Mtb infection. PMID:29258190

  16. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  17. Immunostimulatory effects of natural human interferon-alpha (huIFN-alpha) on carps Cyprinus carpio L.

    Science.gov (United States)

    Watanuki, Hironobu; Chakraborty, Gunimala; Korenaga, Hiroki; Kono, Tomoya; Shivappa, R B; Sakai, Masahiro

    2009-10-15

    Human interferon-alpha (huIFN-alpha) is an important immunomodulatory substance used in the treatment and prevention of numerous infectious and immune-related diseases in animals. However, the immunostimulatory effects of huIFN-alpha in fish remain to be investigated. In the current study, the immune responses of the carp species Cyprinus carpio L. to treatment with huIFN-alpha were analyzed via measurement of superoxide anion production, phagocytic activity and the expression of cytokine genes including interleukin-1beta, tumor necrosis factor-alpha and interleukin 10. Low doses of huIFN-alpha were administered orally once a day for 3 days, and sampling was carried out at 1, 3 and 5 days post-treatment. Our results indicate that a low dose of huIFN-alpha significantly increased phagocytic activity and superoxide anion production in the carp kidney. The huIFN-alpha-treated fish also displayed a significant upregulation in cytokine gene expression. The current study demonstrates the stimulatory effects of huIFN-alpha on the carp immune system and highlights the immunomodulatory role of huIFN-alpha in fish.

  18. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    Science.gov (United States)

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  19. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  20. Impaired IFN-α-mediated signal in dendritic cells differentiates active from latent tuberculosis.

    Directory of Open Access Journals (Sweden)

    Stefania Parlato

    Full Text Available Individuals exposed to Mycobacterium tuberculosis (Mtb may be infected and remain for the entire life in this condition defined as latent tuberculosis infection (LTBI or develop active tuberculosis (TB. Among the multiple factors governing the outcome of the infection, dendritic cells (DCs play a major role in dictating antibacterial immunity. However, current knowledge on the role of the diverse components of human DCs in shaping specific T-cell response during Mtb infection is limited. In this study, we performed a comparative evaluation of peripheral blood circulating DC subsets as well as of monocyte-derived Interferon-α DCs (IFN-DCs from patients with active TB, subjects with LTBI and healthy donors (HD. The proportion of circulating myeloid BDCA3+ DCs (mDC2 and plasmacytoid CD123+ DCs (pDCs declined significantly in active TB patients compared to HD, whereas the same subsets displayed a remarkable activation in LTBI subjects. Simultaneously, the differentiation of IFN-DCs from active TB patients resulted profoundly impaired compared to those from LTBI and HD individuals. Importantly, the altered developmental trait of IFN-DCs from active TB patients was associated with down-modulation of IFN-linked genes, marked changes in molecular signaling conveying antigen (Ag presentation and full inability to induce Ag-specific T cell response. Thus, these data reveal an important role of IFN-α in determining the induction of Mtb-specific immunity.

  1. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  3. The DNA sensor, cyclic GMP-AMP synthase, is essential for induction of IFN-β during Chlamydia trachomatis infection.

    Science.gov (United States)

    Zhang, Yugen; Yeruva, Laxmi; Marinov, Anthony; Prantner, Daniel; Wyrick, Priscilla B; Lupashin, Vladimir; Nagarajan, Uma M

    2014-09-01

    IFN-β has been implicated as an effector of oviduct pathology resulting from genital chlamydial infection in the mouse model. In this study, we investigated the role of cytosolic DNA and engagement of DNA sensors in IFN-β expression during chlamydial infection. We determined that three-prime repair exonuclease-1, a host 3' to 5' exonuclease, reduced IFN-β expression significantly during chlamydial infection using small interfering RNA and gene knockout fibroblasts, implicating cytosolic DNA as a ligand for this response. The DNA sensor cyclic GMP-AMP synthase (cGAS) has been shown to bind cytosolic DNA to generate cyclic GMP-AMP, which binds to the signaling adaptor stimulator of IFN genes (STING) to induce IFN-β expression. We determined that cGAS is required for IFN-β expression during chlamydial infection in multiple cell types. Interestingly, although infected cells deficient for STING or cGAS alone failed to induce IFN-β, coculture of cells depleted for either STING or cGAS rescued IFN-β expression. These data demonstrate that cyclic GMP-AMP produced in infected cGAS(+)STING(-) cells can migrate into adjacent cells via gap junctions to function in trans in cGAS(-)STING(+) cells. Furthermore, we observed cGAS localized in punctate regions on the cytosolic side of the chlamydial inclusion membrane in association with STING, indicating that chlamydial DNA is most likely recognized outside the inclusion as infection progresses. These novel findings provide evidence that cGAS-mediated DNA sensing directs IFN-β expression during Chlamydia trachomatis infection and suggest that effectors from infected cells can directly upregulate IFN-β expression in adjacent uninfected cells during in vivo infection, contributing to pathogenesis. Copyright © 2014 by The American Association of Immunologists, Inc.

  4. Influenza A virus protein PB1-F2 exacerbates IFN-beta expression of human respiratory epithelial cells.

    Science.gov (United States)

    Le Goffic, Ronan; Bouguyon, Edwige; Chevalier, Christophe; Vidic, Jasmina; Da Costa, Bruno; Leymarie, Olivier; Bourdieu, Christiane; Decamps, Laure; Dhorne-Pollet, Sophie; Delmas, Bernard

    2010-10-15

    The PB1-F2 protein of the influenza A virus (IAV) contributes to viral pathogenesis by a mechanism that is not well understood. PB1-F2 was shown to modulate apoptosis and to be targeted by the CD8(+) T cell response. In this study, we examined the downstream effects of PB1-F2 protein during IAV infection by measuring expression of the cellular genes in response to infection with wild-type WSN/33 and PB1-F2 knockout viruses in human lung epithelial cells. Wild-type virus infection resulted in a significant induction of genes involved in innate immunity. Knocking out the PB1-F2 gene strongly decreased the magnitude of expression of cellular genes implicated in antiviral response and MHC class I Ag presentation, suggesting that PB1-F2 exacerbates innate immune response. Biological network analysis revealed the IFN pathway as a link between PB1-F2 and deregulated genes. Using quantitative RT-PCR and IFN-β gene reporter assay, we determined that PB1-F2 mediates an upregulation of IFN-β expression that is dependent on NF-κB but not on AP-1 and IFN regulatory factor-3 transcription factors. Recombinant viruses knocked out for the PB1-F2 and/or the nonstructural viral protein 1 (the viral antagonist of the IFN response) genes provide further evidence that PB1-F2 increases IFN-β expression and that nonstructural viral protein 1 strongly antagonizes the effect of PB1-F2 on the innate response. Finally, we compared the effect of PB1-F2 variants taken from several IAV strains on IFN-β expression and found that PB1-F2-mediated IFN-β induction is significantly influenced by its amino acid sequence, demonstrating its importance in the host cell response triggered by IAV infection.

  5. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  6. Programmed death-1 receptor suppresses γ-IFN producing NKT cells in human tuberculosis.

    Science.gov (United States)

    Singh, Amar; Dey, Aparajit Ballav; Mohan, Anant; Mitra, Dipendra Kumar

    2014-05-01

    IFN-γ biased Th1 effector immune response is crucial for containment of Mycobacterium tuberculosis infection. Various T cell subsets with regulatory function dictate the generation of Th1 like cells. NKT cells are a specialized T cell subset known to be activated early in immune response and control T cell response via release of immunoregulatory cytokines like IFN-γ, IL-4 and IL-10. M. tuberculosis, with abundance of its cell wall lipids may potently activate NKT cells resulting in cytokine production and PD-1 expression. In this study, among 49 treatment naive active pulmonary tuberculosis patients, we found a higher percentage of PD1(+) NKT cells correlating with sputum bacillary load. Furthermore, blocking PD-1 increased the number of IFN-γ producing NKT cells by inhibiting their apoptosis. Moreover, peripheral frequency of NKT cells declined with therapy suggesting their role in host T cell response. In this study, we concluded that PD-1 preferentially induces apoptosis of IFN-γ producing NKT cells while sparing NKT cells that produce IL-4. Such a polarized NKT cell function may impose a Th2 bias on the ensuing effector T cell response leading to inefficient clearance of M. tuberculosis. Inhibiting PD-1 may therefore alter the T cell response in favor of the host by rescuing type 1 NKT cells from apoptosis and boosting Th1 effector T cell functions against M. tuberculosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. The Scaffolding Protein IQGAP1 Interacts with NLRC3 and Inhibits Type I IFN Production.

    Science.gov (United States)

    Tocker, Aaron M; Durocher, Emily; Jacob, Kimberly D; Trieschman, Kate E; Talento, Suzanna M; Rechnitzer, Alma A; Roberts, David M; Davis, Beckley K

    2017-10-15

    Sensing of cytosolic nucleotides is a critical initial step in the elaboration of type I IFN. One of several upstream receptors, cyclic GMP-AMP synthase, binds to cytosolic DNA and generates dicyclic nucleotides that act as secondary messengers. These secondary messengers bind directly to stimulator of IFN genes (STING). STING recruits TNFR-associated NF-κB kinase-binding kinase 1 which acts as a critical node that allows for efficient activation of IFN regulatory factors to drive the antiviral transcriptome. NLRC3 is a recently characterized nucleotide-binding domain, leucine-rich repeat containing protein (NLR) that negatively regulates the type I IFN pathway by inhibiting subcellular redistribution and effective signaling of STING, thus blunting the transcription of type I IFNs. NLRC3 is predominantly expressed in lymphoid and myeloid cells. IQGAP1 was identified as a putative interacting partner of NLRC3 through yeast two-hybrid screening. In this article, we show that IQGAP1 associates with NLRC3 and can disrupt the NLRC3-STING interaction in the cytosol of human epithelial cells. Furthermore, knockdown of IQGAP1 in THP1 and HeLa cells causes significantly more IFN-β production in response to cytosolic nucleic acids. This result phenocopies NLRC3-deficient macrophages and fibroblasts and short hairpin RNA knockdown of NLRC3 in THP1 cells. Our findings suggest that IQGAP1 is a novel regulator of type I IFN production, possibly via interacting with NLRC3 in human monocytic and epithelial cells. Copyright © 2017 by The American Association of Immunologists, Inc.

  8. IFN-γ regulates human dental pulp stem cells behavior via NF-κB and MAPK signaling

    Science.gov (United States)

    He, Xinyao; Jiang, Wenkai; Luo, Zhirong; Qu, Tiejun; Wang, Zhihua; Liu, Ningning; Zhang, Yaqing; Cooper, Paul R.; He, Wenxi

    2017-01-01

    During caries, dental pulp expresses a range of pro-inflammatory cytokines in response to the infectious challenge. Interferon gamma (IFN-γ) is a dimerized soluble cytokine, which is critical for immune responses. Previous study has demonstrated that IFN-γ at relative high concentration (100 ng/mL) treatment improved the impaired dentinogenic and immunosuppressive regulatory functions of disease-derived dental pulp stem cells (DPSCs). However, little is known about the regulatory effects of IFN-γ at relative low concentration on healthy DPSC behavior (including proliferation, migration, and multiple-potential differentiation). Here we demonstrate that IFN-γ at relatively low concentrations (0.5 ng/mL) promoted the proliferation and migration of DPSCs, but abrogated odonto/osteogenic differentiation. Additionally, we identified that NF-κB and MAPK signaling pathways are both involved in the process of IFN-γ-regulated odonto/osteogenic differentiation of DPSCs. DPSCs treated with IFN-γ and supplemented with pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) or SB203580 (a MAPK inhibitor) showed significantly improved potential for odonto/osteogenic differentiation of DPSCs both in vivo and in vitro. These data provide important insight into the regulatory effects of IFN-γ on the biological behavior of DPSCs and indicate a promising therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:28098169

  9. IFN-γ regulates human dental pulp stem cells behavior via NF-κB and MAPK signaling.

    Science.gov (United States)

    He, Xinyao; Jiang, Wenkai; Luo, Zhirong; Qu, Tiejun; Wang, Zhihua; Liu, Ningning; Zhang, Yaqing; Cooper, Paul R; He, Wenxi

    2017-01-18

    During caries, dental pulp expresses a range of pro-inflammatory cytokines in response to the infectious challenge. Interferon gamma (IFN-γ) is a dimerized soluble cytokine, which is critical for immune responses. Previous study has demonstrated that IFN-γ at relative high concentration (100 ng/mL) treatment improved the impaired dentinogenic and immunosuppressive regulatory functions of disease-derived dental pulp stem cells (DPSCs). However, little is known about the regulatory effects of IFN-γ at relative low concentration on healthy DPSC behavior (including proliferation, migration, and multiple-potential differentiation). Here we demonstrate that IFN-γ at relatively low concentrations (0.5 ng/mL) promoted the proliferation and migration of DPSCs, but abrogated odonto/osteogenic differentiation. Additionally, we identified that NF-κB and MAPK signaling pathways are both involved in the process of IFN-γ-regulated odonto/osteogenic differentiation of DPSCs. DPSCs treated with IFN-γ and supplemented with pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) or SB203580 (a MAPK inhibitor) showed significantly improved potential for odonto/osteogenic differentiation of DPSCs both in vivo and in vitro. These data provide important insight into the regulatory effects of IFN-γ on the biological behavior of DPSCs and indicate a promising therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment.

  10. Nuclear export signal of PRRSV NSP1α is necessary for type I IFN inhibition

    International Nuclear Information System (INIS)

    Chen, Zhi; Liu, Shaoning; Sun, Wenbo; Chen, Lei; Yoo, Dongwan; Li, Feng; Ren, Sufang; Guo, Lihui; Cong, Xiaoyan; Li, Jun; Zhou, Shun; Wu, Jiaqiang

    2016-01-01

    The nonstructural protein 1α (NSP1α) of porcine reproductive and respiratory syndrome virus (PRRSV) is a nucleo-cytoplasmic protein that suppresses the production of type I interferon (IFN). In this study, we investigated the relationship between the subcellular distribution of NSP1α and its inhibition of type I IFN. NSP1α was found to contain the classical nuclear export signal (NES) and NSP1α nuclear export was CRM-1-mediated. NSP1α was shuttling between the nucleus and cytoplasm. We also showed that the nuclear export of NSP1α was necessary for its ability for type I IFN inhibition. NSP1α was also found to interact with CBP, which implies a possible mechanism of CBP degradation by NSP1α. Taken together, our results describe a novel mechanism of PRRSV NSP1α for type I IFN inhibition and suppression of the host innate antiviral response. - Highlights: •NSP1α contains the NES and NSP1α nuclear export was CRM-1-mediated. •NSP1α was shuttling between the nucleus and cytoplasm continuously. •The nuclear export of NSP1α was necessary for its ability for type I IFN inhibition. •NSP1α interacts with CBP, which implies the mechanism of CBP degradation by NSP1α.

  11. Nuclear export signal of PRRSV NSP1α is necessary for type I IFN inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Zhi [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); Liu, Shaoning [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); Shandong Institute of Veterinary Drug Quality Inspection, Shandong Key Laboratory for Quality Safety Monitoring and Risk Assessment of Animal Products, Huaicun Street No. 68, Jinan 250722, Shandong Province (China); Sun, Wenbo; Chen, Lei [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); Yoo, Dongwan [Department of Pathobiology, University of Illinois at Urbana-Champaign, 2001 South Lincoln Ave, Urbana, IL 61802 (United States); Li, Feng [Department of Biology and Microbiology, Department of Veterinary and Biomedical Sciences, South Dakota State University, Brookings, SD 57007 (United States); Ren, Sufang; Guo, Lihui; Cong, Xiaoyan; Li, Jun [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); Zhou, Shun [College of marine science and engineering, Qingdao Agricultural University, Changcheng Road No. 700, Qingdao 266109 (China); Wu, Jiaqiang, E-mail: wujiaqiang2000@sina.com [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); and others

    2016-12-15

    The nonstructural protein 1α (NSP1α) of porcine reproductive and respiratory syndrome virus (PRRSV) is a nucleo-cytoplasmic protein that suppresses the production of type I interferon (IFN). In this study, we investigated the relationship between the subcellular distribution of NSP1α and its inhibition of type I IFN. NSP1α was found to contain the classical nuclear export signal (NES) and NSP1α nuclear export was CRM-1-mediated. NSP1α was shuttling between the nucleus and cytoplasm. We also showed that the nuclear export of NSP1α was necessary for its ability for type I IFN inhibition. NSP1α was also found to interact with CBP, which implies a possible mechanism of CBP degradation by NSP1α. Taken together, our results describe a novel mechanism of PRRSV NSP1α for type I IFN inhibition and suppression of the host innate antiviral response. - Highlights: •NSP1α contains the NES and NSP1α nuclear export was CRM-1-mediated. •NSP1α was shuttling between the nucleus and cytoplasm continuously. •The nuclear export of NSP1α was necessary for its ability for type I IFN inhibition. •NSP1α interacts with CBP, which implies the mechanism of CBP degradation by NSP1α.

  12. IFN-γ signaling to astrocytes protects from autoimmune mediated neurological disability.

    Directory of Open Access Journals (Sweden)

    Claudia Hindinger

    Full Text Available Demyelination and axonal degeneration are determinants of progressive neurological disability in patients with multiple sclerosis (MS. Cells resident within the central nervous system (CNS are active participants in development, progression and subsequent control of autoimmune disease; however, their individual contributions are not well understood. Astrocytes, the most abundant CNS cell type, are highly sensitive to environmental cues and are implicated in both detrimental and protective outcomes during autoimmune demyelination. Experimental autoimmune encephalomyelitis (EAE was induced in transgenic mice expressing signaling defective dominant-negative interferon gamma (IFN-γ receptors on astrocytes to determine the influence of inflammation on astrocyte activity. Inhibition of IFN-γ signaling to astrocytes did not influence disease incidence, onset, initial progression of symptoms, blood brain barrier (BBB integrity or the composition of the acute CNS inflammatory response. Nevertheless, increased demyelination at peak acute disease in the absence of IFN-γ signaling to astrocytes correlated with sustained clinical symptoms. Following peak disease, diminished clinical remission, increased mortality and sustained astrocyte activation within the gray matter demonstrate a critical role of IFN-γ signaling to astrocytes in neuroprotection. Diminished disease remission was associated with escalating demyelination, axonal degeneration and sustained inflammation. The CNS infiltrating leukocyte composition was not altered; however, decreased IL-10 and IL-27 correlated with sustained disease. These data indicate that astrocytes play a critical role in limiting CNS autoimmune disease dependent upon a neuroprotective signaling pathway mediated by engagement of IFN-γ receptors.

  13. Unique nonstructural proteins of Pneumonia Virus of Mice (PVM) promote degradation of interferon (IFN) pathway components and IFN-stimulated gene proteins.

    Science.gov (United States)

    Dhar, Jayeeta; Barik, Sailen

    2016-12-01

    Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.

  14. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  15. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  16. Intracranial AAV-IFN-β gene therapy eliminates invasive xenograft glioblastoma and improves survival in orthotopic syngeneic murine model.

    Science.gov (United States)

    GuhaSarkar, Dwijit; Neiswender, James; Su, Qin; Gao, Guangping; Sena-Esteves, Miguel

    2017-02-01

    The highly invasive property of glioblastoma (GBM) cells and genetic heterogeneity are largely responsible for tumor recurrence after the current standard-of-care treatment and thus a direct cause of death. Previously, we have shown that intracranial interferon-beta (IFN-β) gene therapy by locally administered adeno-associated viral vectors (AAV) successfully treats noninvasive orthotopic glioblastoma models. Here, we extend these findings by testing this approach in invasive human GBM xenograft and syngeneic mouse models. First, we show that a single intracranial injection of AAV encoding human IFN-β eliminates invasive human GBM8 tumors and promotes long-term survival. Next, we screened five AAV-IFN-β vectors with different promoters to drive safe expression of mouse IFN-β in the brain in the context of syngeneic GL261 tumors. Two AAV-IFN-β vectors were excluded due to safety concerns, but therapeutic studies with the other three vectors showed extensive tumor cell death, activation of microglia surrounding the tumors, and a 56% increase in median survival of the animals treated with AAV/P2-Int-mIFN-β vector. We also assessed the therapeutic effect of combining AAV-IFN-β therapy with temozolomide (TMZ). As TMZ affects DNA replication, an event that is crucial for second-strand DNA synthesis of single-stranded AAV vectors before active transcription, we tested two TMZ treatment regimens. Treatment with TMZ prior to AAV-IFN-β abrogated any benefit from the latter, while the reverse order of treatment doubled the median survival compared to controls. These studies demonstrate the therapeutic potential of intracranial AAV-IFN-β therapy in a highly migratory GBM model as well as in a syngeneic mouse model and that combination with TMZ is likely to enhance its antitumor potency. © 2016 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

  17. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  18. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  19. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  20. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  1. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  2. Defining the Roles of IFN-γ and IL-17A in Inflammation and Protection against Helicobacter pylori Infection.

    Directory of Open Access Journals (Sweden)

    Louise Sjökvist Ottsjö

    Full Text Available CD4+ T cells have been shown to be essential for vaccine-induced protection against Helicobacter pylori infection. However, the effector mechanisms leading to reductions in the gastric bacterial loads of vaccinated mice remain unclear. We have investigated the function of IFN-γ and IL-17A for vaccine-induced protection and inflammation (gastritis using IFN-γ-gene-knockout (IFN-γ-/- mice, after sublingual or intragastric immunization with H. pylori lysate antigens and cholera toxin. Bacteria were enumerated in the stomachs of mice and related to the gastritis score and cellular immune responses. We report that sublingually and intragastrically immunized IFN-γ-/- mice had significantly reduced bacterial loads similar to immunized wild-type mice compared to respective unimmunized infection controls. The reduction in bacterial loads in sublingually and intragastrically immunized IFN-γ-/- mice was associated with significantly higher levels of IL-17A in stomach extracts and lower gastritis scores compared with immunized wild-type mice. To study the role of IL-17A for vaccine-induced protection in sublingually immunized IFN-γ-/- mice, IL-17A was neutralized in vivo at the time of infection. Remarkably, the neutralization of IL-17A in sublingually immunized IFN-γ-/- mice completely abolished protection against H. pylori infection and the mild gastritis. In summary, our results suggest that IFNresponses in the stomach of sublingually immunized mice promote vaccine-induced gastritis, after infection with H. pylori but that IL-17A primarily functions to reduce the bacterial load.

  3. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  4. The preventive effects of natural adjuvants, G2 and G2F on tracheal responsiveness and serum IL-4 and IFN-γ (th1/th2 balance in sensitized guinea pigs

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Boskabady

    2014-07-01

    Full Text Available OBJECTIVE:The effects of natural adjuvants on lung inflammation and tracheal responsiveness were examined in sensitized guinea pigs.METHODS:The responses of guinea pig tracheal chains and the serum levels of interleukin-4 and interferon-gamma were examined in control pigs and three other groups of guinea pigs: the sensitized group and two other sensitized groups treated with either adjuvant G2 or adjuvant G2F (n = 7 for each group. Sensitization of the animals was achieved by injection and inhalation of ovalbumin.RESULTS:The results showed that sensitized animals had increased tracheal responsiveness and increased serum levels of interleukin-4 and interferon-gamma compared to controls (p<0.05 to p<0.001. Treatments with either G2 or G2F prevented the increase in tracheal responsiveness and serum interleukin-4 (p<0.01 to p<0.001. However, the serum levels of interferon-gamma and the interleukin-4-to-interferon-gamma ratio was increased in the treated groups (p<0.001 for all cases.CONCLUSIONS:These results indicate important preventive effects of two natural adjuvants, particularly G2, on the changes in tracheal responsiveness, serum cytokines and the interleukin-4-to-interferon-gamma ratio (T helper 1/T helper 2 balance in sensitized guinea pigs.

  5. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  6. Systemic Activation of the IFN System by Exposure of Natural Epithelia to Physiologic (Low Dose) Levels of IFN

    Science.gov (United States)

    1990-06-20

    possibility that epithelial surfaces of the upper alimentary and/or respiratory mucosa exposed to lymphocytes treated with low concentrations of IFN or with IFN... Biotechnology Program Office of Naval Research Office of Naval Research 800 N. Quincy Street Code 1213 Arlington, VA 22217-5000 800 N. Quincy Street Arlington

  7. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  8. The Combination of Early and Rapid Type I IFN, IL-1α, and IL-1β Production Are Essential Mediators of RNA-Like Adjuvant Driven CD4+ Th1 Responses

    Science.gov (United States)

    Madera, Rachel F.; Wang, Jennifer P.; Libraty, Daniel H.

    2011-01-01

    There is a growing need for novel vaccine adjuvants that can provide safe and potent T-helper type 1 (Th1) activity. RNA-like immune response modifiers (IRMs) are candidate T-cell adjuvants that skew acquired immune responses towards a Th1 phenotype. We set out to delineate the essential signaling pathways by which the RNA-like IRMs, resiquimod (R-848) and polyinosinic:polycytidylic acid (poly I:C), augment CD4+ T-helper 1 (Th1) responses. Highly purified murine conventional dendritic cells (cDCs) and conventional CD4+ T-cells were co-cultured in allogeneic and MHC congenic mixed leukocyte reactions. The activation of CD4+ Th1 cells was examined utilizing cells from mice deficient in specific RNA-sensing pattern recognition receptors and signaling mediators. R-848 and poly I:C stimulation of Type I interferon production and signaling in cDCs was essential but not sufficient for driving CD4+ Th1 responses. The early and rapid production of IL-1α and IL-1β was equally critical for the optimal activation of Th1 CD4+ T-cells. R-848 activation of Toll-like receptor 7/MyD88-dependent signaling in cDCs led to a rapid upregulation of pro-IL-1α and pro-IL-1β production compared to poly I:C activation of MyD88-independent signaling pathways. The in vitro data show that CD4+ T-cell adjuvant activity of RNA-like IRMs is mediated by a critical combination of early and rapid Type I interferon, IL-1α and IL-1β production. These results provide important insights into the key signaling pathways responsible for RNA-like IRM CD4+ Th1 activation. A better understanding of the critical signaling pathways by which RNA-like IRMs stimulate CD4+ Th1 responses is relevant to the rational design of improved vaccine adjuvants. PMID:22206014

  9. The combination of early and rapid type I IFN, IL-1α, and IL-1β production are essential mediators of RNA-like adjuvant driven CD4+ Th1 responses.

    Directory of Open Access Journals (Sweden)

    Rachel F Madera

    Full Text Available There is a growing need for novel vaccine adjuvants that can provide safe and potent T-helper type 1 (Th1 activity. RNA-like immune response modifiers (IRMs are candidate T-cell adjuvants that skew acquired immune responses towards a Th1 phenotype. We set out to delineate the essential signaling pathways by which the RNA-like IRMs, resiquimod (R-848 and polyinosinic:polycytidylic acid (poly I:C, augment CD4+ T-helper 1 (Th1 responses. Highly purified murine conventional dendritic cells (cDCs and conventional CD4+ T-cells were co-cultured in allogeneic and MHC congenic mixed leukocyte reactions. The activation of CD4+ Th1 cells was examined utilizing cells from mice deficient in specific RNA-sensing pattern recognition receptors and signaling mediators. R-848 and poly I:C stimulation of Type I interferon production and signaling in cDCs was essential but not sufficient for driving CD4+ Th1 responses. The early and rapid production of IL-1α and IL-1β was equally critical for the optimal activation of Th1 CD4+ T-cells. R-848 activation of Toll-like receptor 7/MyD88-dependent signaling in cDCs led to a rapid upregulation of pro-IL-1α and pro-IL-1β production compared to poly I:C activation of MyD88-independent signaling pathways. The in vitro data show that CD4+ T-cell adjuvant activity of RNA-like IRMs is mediated by a critical combination of early and rapid Type I interferon, IL-1α and IL-1β production. These results provide important insights into the key signaling pathways responsible for RNA-like IRM CD4+ Th1 activation. A better understanding of the critical signaling pathways by which RNA-like IRMs stimulate CD4+ Th1 responses is relevant to the rational design of improved vaccine adjuvants.

  10. IFN signaling: how a non-canonical model led to the development of IFN mimetics

    Directory of Open Access Journals (Sweden)

    Howard M Johnson

    2013-07-01

    Full Text Available The classical model of cytokine signaling dominates our view of specific gene activation by cytokines such as the interferons (IFNs. The importance of the model extends beyond cytokines and applies to hormones such as growth hormone (GH and insulin, and growth factors such as epidermal growth factor (EGF and fibroblast growth factor (FGF. According to this model, ligand activates the cell via interaction with the extracellular domain of the receptor. This results in activation of receptor or receptor-associated tyrosine kinases, primarily of the Janus kinase (JAK family, phosphorylation and dimerization of the STAT transcription factors, which dissociate from the receptor cytoplasmic domain and translocate to the nucleus. This view ascribes no further role to the ligand, JAK kinase, or receptor in either specific gene activation or the associated epigenetic events. The presence of dimeric STATs in the nucleus essentially explains it all. Our studies have resulted in the development of a non-canonical, more complex model of IFNγ signaling that is akin to that of steroid hormone/steroid receptor signaling. We have shown that ligand, receptor, activated JAKs and STATs are associated with specific gene activation, where the receptor subunit IFNGR1 functions as a co-transcription factor and the JAKs are involved in associated epigenetic events. We found that the type I IFN system functions similarly. The fact that GH receptor, insulin receptor, EGF receptor, and FGF receptor undergo nuclear translocation upon ligand binding suggests that they may also function similarly. The steroid hormone/steroid receptor nature of type I and II IFN signaling provides insight into the specificity of signaling by members of cytokine families. The non-canonical model could also provide better understanding to more complex cytokine families such as those of IL-2 and IL-12, whose members often use the same JAKs and STATs, but also have different functions and

  11. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  12. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  13. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  14. Role of IFN-gamma and LPS on Neuron/Glial Co-Cultures Infected by Neospora caninum

    Directory of Open Access Journals (Sweden)

    Erica Etelvina Viana De Jesus

    2014-10-01

    Full Text Available Neospora caninum causes cattle abortion and neurological symptoms in dogs. Although infection is usually asymptomatic, classical neurological symptoms of neosporosis may be associated with encephalitis. This parasite can grow in brain endothelial cells without markedly damages, but it can modulate the cellular environment to promote its survival in the brain. In previous studies, we described that IFN-γ decreased the parasite proliferation and down regulated nitric oxide production in astrocyte/microglia cultures. However, it remains unclear how glial cells respond to N. caninum in the presence of neurons. Therefore, we evaluated the effect of 300 IU/mL IFN-γ or 1.0 μg/mL of LPS on infected rat neuron/glial co-cultures. After 72 hours of infection, LPS did not affect the mitochondrial dehydrogenase activity. However, IFN-γ decreased this parameter by 15.5 and 12.0% in uninfected and infected cells, respectively. The number of tachyzoites decreased 54.1 and 44.3% in cells stimulated with IFN-γ and LPS, respectively. Infection or LPS treatment did not change NO production. On the other hand, IFN-γ induced increased nitrite release in 55.7%, but the infection reverted this induction. IL-10 levels increased only in infected cultures (treated or not, meanwhile PGE2 release was improved in IFN-γ/infected or LPS/infected cells. Although IFN-γ significantly reduced the neurite length in uninfected cultures (42.64%; p < 0.001, this inflammatory cytokine reverted the impairment of neurite outgrowth induced by the infection (81.39%. The results suggest a neuroprotective potential response of glia to N. caninum infection under IFN-γ stimulus. This observation contributes to understand the immune mediated mechanisms of neosporosis in CNS

  15. Roles of IFN-γ and γδ T cells in protective immunity against blood-stage malaria

    Directory of Open Access Journals (Sweden)

    Shin-Ichi eInoue

    2013-08-01

    Full Text Available Malaria is caused by infection with Plasmodium parasites. Various studies with knockout mice have indicated that IFN-γ plays essential roles in protective immunity against blood-stage Plasmodium infection. However, after Plasmodium infection, increased IFN-γ production by various types of cells is involved not only in protective immunity, but also in immunopathology. Recent reports have shown that IFN-γ acts as a pro-inflammatory cytokine to induce not only the activation of macrophages, but also the generation of uncommon myelolymphoid progenitor cells after Plasmodium infection. However, the effects of IFN-γ on hematopoietic stem cells and progenitor cells are unclear. Therefore, the regulation of hematopoiesis by IFN-γ during Plasmodium infection remains to be clarified. Although there are conflicting reports concerning the significance of γδ T cells in protective immunity against Plasmodium infection, γδ T cells may respond to infection and produce IFN-γ as innate immune cells in the early phase of blood-stage malaria. Our recent studies have shown that γδ T cells express CD40 ligand and produce IFN-γ after Plasmodium infection, resulting in the enhancement of dendritic cell activation as part of the immune response to eliminate Plasmodium parasites. These data suggest that the function of γδ T cells is similar to that of NK cells. Although several reports suggest that γδ T cells have the potential to act as memory cells for various infections, it remains to be determined whether memory γδ T cells are generated by Plasmodium infection and whether memory γδ T cells can contribute to the host defense against re-infection with Plasmodium. Here, we summarize and discuss the effects of IFN-γ and the various functions of γδ T cells in blood-stage Plasmodium infection.

  16. Respiratory Syncytial Virus Nonstructural Proteins Upregulate SOCS1 and SOCS3 in the Different Manner from Endogenous IFN Signaling

    Directory of Open Access Journals (Sweden)

    Junwen Zheng

    2015-01-01

    Full Text Available Respiratory syncytial virus (RSV infection upregulates genes of the suppressor of cytokine signaling (SOCS family, which utilize a feedback loop to inhibit type I interferon dependent antiviral signaling pathway. Here, we reconstituted RSV nonstructural (NS protein expression plasmids (pNS1, pNS2, and pNS1/2 and tested whether NS1 or NS2 would trigger SOCS1 and SOCS3 protein expression. These NS proteins inhibited interferon- (IFN- α signaling through a mechanism involving the induction of SOCS1 and SOCS3, which appeared to be different from autocrine IFN dependent. NS1 induced both SOCS1 and SOCS3 upregulation, while NS2 only induced SOCS1 expression. The induced expression of SOCS1 and SOCS3 preceded endogenous IFN-signaling activation and inhibited the IFN-inducible antiviral response as well as chemokine induction. Treatments with INF-α and NS proteins both induced SOCS1 expression; however, they had opposing effects on IFN-α-dependent antiviral gene expression. Our results indicate that NS1 and NS2, which induce the expression of SOCS1 or SOCS3, might represent an independent pathway of stimulating endogenous IFN signaling.

  17. Contact inhibition and interferon (IFN)-modulated gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Kulesh, D.A.

    1986-01-01

    The relationship between cell morphology, proliferation and contact inhibition was studied in normal and malignant human cells which varied in their sensitivity to contact inhibition. Their ability to proliferate was examined under conditions where the cells were constrained into different shapes. Cell proliferation was quantitated by labeling indices, which were inferred by autoradiography, and by total cell counts. The normal cells (JHU-1, IMR-90) were dependent on cell shape for proliferation capability while the transformed cells (RT4, HT1080) were shape-dependent for proliferation. Interferon (IFN) induced shape-dependent proliferation and contact inhibition in the transformed cells when used at subantiproliferative concentrations. This ability of B-IFN to confer a level of proliferation control which is characteristic of normal fibroblasts suggests a possible relationship between gene expression mediated by IFN and those genes involved in the maintenance of regulated cell proliferation. To evaluate this possibility, cDNA libraries were constructed from IFN-treated and untreated HT1080 cells. The resulting 10 IFN-induced and 11 IFN-repressed sequences were then differentially rescreened using /sup 32/P-cDNA probes. This screening resulted in the identification of at least four cDNA sequences which appeared to be proliferation regulated as well as IFN-modulated. These cloned, regulated cDNA sequences were then used as /sup 32/P-labeled probes to study both the gene expression at the mRNA level employing Northern blotting and slot blotting techniques.

  18. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  19. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  20. Coordinate induction of IFN-α and -γ by SARS-CoV also in the absence of virus replication

    International Nuclear Information System (INIS)

    Castilletti, Concetta; Bordi, Licia; Lalle, Eleonora; Rozera, Gabriella; Poccia, Fabrizio; Agrati, Chiara; Abbate, Isabella; Capobianchi, Maria R.

    2005-01-01

    Background:: Severe acute respiratory syndrome (SARS) is an emerging infection caused by a novel coronavirus known as SARS-CoV, characterized by an over-exuberant immune response with lung lymphomononuclear cells infiltration and proliferation that may account for tissue damage more than the direct effect of viral replication. This study is aimed at investigating the capability of SARS-CoV to activate IFN-α and -γ expression in lymphomonocytes (PBMC) from healthy donors, evaluating whether viral replication is necessary for this activation. Results:: SARS-CoV virus is able to induce both IFN-α and -γ mRNA accumulation and protein release in a dose-dependent manner, MOI 10 being the most effective. The time course curve indicated that IFN-α mRNA induction peaked at 24 h.p.i,. whereas IFN-γ mRNA was still increasing at 48 h.p.i. Released IFN (both types) reached a plateau after 24-48 h.p.i. and remained rather stable over a 5-day period. A transient peak of negative strand viral RNA was detected after 1-2 days of infection, but neither infectious virus progeny yield nor newly produced viral genomic RNA could be evidenced in infected cultures, even after prolonged observation time (up to 13 days). Cocultivation of PBMC with fixed SARS-CoV-infected Vero cells was even more efficient than exposure to live virus in eliciting IFN-α and -γ induction. A combination of IFN-α and -γ strongly inhibited SARS-CoV replication in Vero cells, while the single cytokines were much less effective. Conclusions:: This study provides evidence that SARS-CoV is able to induce in normal PBMC a coordinate induction of IFN-α and -γ gene expression. Virus replication is not necessary for IFN induction since efficient IFN expression could be obtained also by the cocultivation of normal PBMC with fixed SARS-CoV-infected cells. Concomitant activation of IFN-α and -γ gene expression by SARS-CoV in vivo may be relevant for the pathogenesis of the disease, both for the possible

  1. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  2. Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle: a unique arrest of the hair cycle at the anagen phase accompanied by mitosis.

    Science.gov (United States)

    Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro

    2002-09-01

    Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.

  3. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  4. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  5. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  6. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  7. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  8. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  10. Detection of IFN-γ Secretion by T Cells Collected Before and After Successful Treatment of Early Lyme Disease.

    Science.gov (United States)

    Callister, Steven M; Jobe, Dean A; Stuparic-Stancic, Aleksandra; Miyamasu, Misato; Boyle, Jeff; Dattwyler, Raymond J; Arnaboldi, Paul M

    2016-05-15

    Current serodiagnostics for Lyme disease lack sensitivity during early disease, and cannot determine treatment response. We evaluated an assay based on QuantiFERON technology utilizing peptide antigens derived from Borrelia burgdorferi to stimulate interferon-gamma (IFN-γ) release as an alternative to serodiagnosis for the laboratory detection of Lyme disease. Blood was obtained from patients with erythema migrans before (n = 29) and 2 months after (n = 27) antibiotic therapy. IFN-γ release was measured by enzyme-linked immunosorbent assay (ELISA) following overnight stimulation of whole blood with the peptide antigens, and compared to the results of standard serological assays (C6, ELISA, and Western blot). IFN-γ release was observed in pretreatment blood of 20 of 29 (69%) patients with Lyme disease. Following antibiotic treatment, IFN-γ was significantly reduced (P = .0002), and was detectable in only 4 of 20 (20%) initially positive patients. By contrast, anti-C6 antibodies were detected in pretreatment sera from 17 of 29 (59%) subjects, whereas only 5 of 29 (17%) patients had positive Western blot seroreactivity. Antibody responses persisted and expanded following treatment. Our findings suggest that measurement of IFN-γ after incubating blood with Borrelia antigens could be useful in the laboratory diagnosis of early Lyme disease. Also, after antibiotic treatment, this response appears to be short lived. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  11. The MEK1/2-ERK Pathway Inhibits Type I IFN Production in Plasmacytoid Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Vaclav Janovec

    2018-02-01

    Full Text Available Recent studies have reported that the crosslinking of regulatory receptors (RRs, such as blood dendritic cell antigen 2 (BDCA-2 (CD303 or ILT7 (CD85g, of plasmacytoid dendritic cells (pDCs efficiently suppresses the production of type I interferons (IFN-I, α/β/ω and other cytokines in response to toll-like receptor 7 and 9 (TLR7/9 ligands. The exact mechanism of how this B cell receptor (BCR-like signaling blocks TLR7/9-mediated IFN-I production is unknown. Here, we stimulated BCR-like signaling by ligation of RRs with BDCA-2 and ILT7 mAbs, hepatitis C virus particles, or BST2 expressing cells. We compared BCR-like signaling in proliferating pDC cell line GEN2.2 and in primary pDCs from healthy donors, and addressed the question of whether pharmacological targeting of BCR-like signaling can antagonize RR-induced pDC inhibition. To this end, we tested the TLR9-mediated production of IFN-I and proinflammatory cytokines in pDCs exposed to a panel of inhibitors of signaling molecules involved in BCR-like, MAPK, NF-ĸB, and calcium signaling pathways. We found that MEK1/2 inhibitors, PD0325901 and U0126 potentiated TLR9-mediated production of IFN-I in GEN2.2 cells. More importantly, MEK1/2 inhibitors significantly increased the TLR9-mediated IFN-I production blocked in both GEN2.2 cells and primary pDCs upon stimulation of BCR-like or phorbol 12-myristate 13-acetate-induced protein kinase C (PKC signaling. Triggering of BCR-like and PKC signaling in pDCs resulted in an upregulation of the expression and phoshorylation of c-FOS, a downstream gene product of the MEK1/2-ERK pathway. We found that the total level of c-FOS was higher in proliferating GEN2.2 cells than in the resting primary pDCs. The PD0325901-facilitated restoration of the TLR9-mediated IFN-I production correlated with the abrogation of MEK1/2-ERK-c-FOS signaling. These results indicate that the MEK1/2-ERK pathway inhibits TLR9-mediated type I IFN production in pDCs and that

  12. IFN-γ protects from lethal IL-17 mediated viral encephalomyelitis independent of neutrophils

    Directory of Open Access Journals (Sweden)

    Savarin Carine

    2012-05-01

    extensive neutrophil accumulation or GM-CSF upregulation. The results also suggest that IFN-γ overrides the detrimental IL-17 effector responses via a mechanism downstream of transcriptional regulation.

  13. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  14. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  15. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  16. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  17. Impaired chromatin remodelling at STAT1-regulated promoters leads to global unresponsiveness of Toxoplasma gondii-infected macrophages to IFN-γ.

    Directory of Open Access Journals (Sweden)

    Christine Lang

    2012-01-01

    Full Text Available Intracellular pathogens including the apicomplexan and opportunistic parasite Toxoplasma gondii profoundly modify their host cells in order to establish infection. We have shown previously that intracellular T. gondii inhibit up-regulation of regulatory and effector functions in murine macrophages (MΦ stimulated with interferon (IFN-γ, which is the cytokine crucial for controlling the parasites' replication. Using genome-wide transcriptome analysis we show herein that infection with T. gondii leads to global unresponsiveness of murine macrophages to IFN-γ. More than 61% and 89% of the transcripts, which were induced or repressed by IFN-γ in non-infected MΦ, respectively, were not altered after stimulation of T. gondii-infected cells with IFN-γ. These genes are involved in a variety of biological processes, which are mostly but not exclusively related to immune responses. Analyses of the underlying mechanisms revealed that IFN-γ-triggered nuclear translocation of STAT1 still occurred in Toxoplasma-infected MΦ. However, STAT1 bound aberrantly to oligonucleotides containing the IFN-γ-responsive gamma-activated site (GAS consensus sequence. Conversely, IFN-γ did not induce formation of active GAS-STAT1 complexes in nuclear extracts from infected MΦ. Mass spectrometry of protein complexes bound to GAS oligonucleotides showed that T. gondii-infected MΦ are unable to recruit non-muscle actin to IFN-γ-responsive DNA sequences, which appeared to be independent of stimulation with IFN-γ and of STAT1 binding. IFN-γ-induced recruitment of BRG-1 and acetylation of core histones at the IFN-γ-regulated CIITA promoter IV, but not β-actin was diminished by >90% in Toxoplasma-infected MΦ as compared to non-infected control cells. Remarkably, treatment with histone deacetylase inhibitors restored the ability of infected macrophages to express the IFN-γ regulated genes H2-A/E and CIITA. Taken together, these results indicate that Toxoplasma

  18. Antigen presentation by small intestinal epithelial cells uniquely enhances IFN-γ secretion from CD4{sup +} intestinal intraepithelial lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hatano, Ryo; Yamada, Kiyoshi; Iwamoto, Taku; Maeda, Nana; Emoto, Tetsuro; Shimizu, Makoto; Totsuka, Mamoru, E-mail: atotuka@mail.ecc.u-tokyo.ac.jp

    2013-06-14

    Highlights: •Small intestinal epithelial cells (sIECs). •sIECs are able to induce antigen specific proliferation of CD4{sup +} IELs. •sIECs induce markedly enhanced IFN-γ secretion by CD4{sup +} IELs. •Induction of enhanced IFN-γ secretion by sIECs is uniquely observed in CD4{sup +} IELs. -- Abstract: Small intestinal epithelial cells (sIECs) express major histocompatibility complex class II molecules even in a normal condition, and are known to function as antigen presenting cells (APCs) at least in vitro. These findings raised the possibility that sIECs play an important role in inducing immune responses against luminal antigens, especially those of intestinal intraepithelial lymphocytes (IELs) and lamina propria lymphocytes (LPLs). We herein showed that antigenic stimulation with sIECs induced markedly greater secretion of interferon-gamma (IFN-γ) by CD4{sup +} IELs, but not interleukin (IL)-4, IL-10 and IL-17 although the proliferative response was prominently lower than that with T cell-depleted splenic APCs. In contrast, no enhanced IFN-γ secretion by CD4{sup +} LPLs and primed splenic CD4{sup +} T cells was observed when stimulated with sIECs. Taken together, these results suggest that sIECs uniquely activate CD4{sup +} IELs and induce remarkable IFN-γ secretion upon antigenic stimulation in vivo.

  19. Antigen presentation by small intestinal epithelial cells uniquely enhances IFN-γ secretion from CD4+ intestinal intraepithelial lymphocytes

    International Nuclear Information System (INIS)

    Hatano, Ryo; Yamada, Kiyoshi; Iwamoto, Taku; Maeda, Nana; Emoto, Tetsuro; Shimizu, Makoto; Totsuka, Mamoru

    2013-01-01

    Highlights: •Small intestinal epithelial cells (sIECs). •sIECs are able to induce antigen specific proliferation of CD4 + IELs. •sIECs induce markedly enhanced IFN-γ secretion by CD4 + IELs. •Induction of enhanced IFN-γ secretion by sIECs is uniquely observed in CD4 + IELs. -- Abstract: Small intestinal epithelial cells (sIECs) express major histocompatibility complex class II molecules even in a normal condition, and are known to function as antigen presenting cells (APCs) at least in vitro. These findings raised the possibility that sIECs play an important role in inducing immune responses against luminal antigens, especially those of intestinal intraepithelial lymphocytes (IELs) and lamina propria lymphocytes (LPLs). We herein showed that antigenic stimulation with sIECs induced markedly greater secretion of interferon-gamma (IFN-γ) by CD4 + IELs, but not interleukin (IL)-4, IL-10 and IL-17 although the proliferative response was prominently lower than that with T cell-depleted splenic APCs. In contrast, no enhanced IFN-γ secretion by CD4 + LPLs and primed splenic CD4 + T cells was observed when stimulated with sIECs. Taken together, these results suggest that sIECs uniquely activate CD4 + IELs and induce remarkable IFN-γ secretion upon antigenic stimulation in vivo

  20. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  1. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  2. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  3. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  4. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  6. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  7. Vitamin D Is Required for IFN-γ–Mediated Antimicrobial Activity of Human Macrophages

    Science.gov (United States)

    Fabri, Mario; Stenger, Steffen; Shin, Dong-Min; Yuk, Jae-Min; Liu, Philip T.; Realegeno, Susan; Lee, Hye-Mi; Krutzik, Stephan R.; Schenk, Mirjam; Sieling, Peter A.; Teles, Rosane; Montoya, Dennis; Iyer, Shankar S.; Bruns, Heiko; Lewinsohn, David M.; Hollis, Bruce W.; Hewison, Martin; Adams, John S.; Steinmeyer, Andreas; Zügel, Ulrich; Cheng, Genhong; Jo, Eun-Kyeong; Bloom, Barry R.; Modlin, Robert L.

    2012-01-01

    Control of tuberculosis worldwide depends on our understanding of human immune mechanisms, which combat the infection. Acquired T cell responses are critical for host defense against microbial pathogens, yet the mechanisms by which they act in humans remain unclear. We report that T cells, by the release of interferon-γ (IFN-γ), induce autophagy, phagosomal maturation, the production of antimicrobial peptides such as cathelicidin, and antimicrobial activity against Mycobacterium tuberculosis in human macrophages via a vitamin D–dependent pathway. IFN-γ induced the antimicrobial pathway in human macrophages cultured in vitamin D–sufficient sera, but not in sera from African-Americans that have lower amounts of vitamin D and who are more susceptible to tuberculosis. In vitro supplementation of vitamin D–deficient serum with 25-hydroxyvitamin D3 restored IFN-γ–induced antimicrobial peptide expression, autophagy, phagosome-lysosome fusion, and antimicrobial activity. These results suggest a mechanism in which vitamin D is required for acquired immunity to overcome the ability of intracellular pathogens to evade macrophage-mediated antimicrobial responses. The present findings underscore the importance of adequate amounts of vitamin D in all human populations for sustaining both innate and acquired immunity against infection. PMID:21998409

  8. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  9. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  10. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  11. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  12. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  13. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  14. Wild type measles virus attenuation independent of type I IFN

    Directory of Open Access Journals (Sweden)

    Horvat Branka

    2008-02-01

    Full Text Available Abstract Background Measles virus attenuation has been historically performed by adaptation to cell culture. The current dogma is that attenuated virus strains induce more type I IFN and are more resistant to IFN-induced protection than wild type (wt. Results The adaptation of a measles virus isolate (G954-PBL by 13 passages in Vero cells induced a strong attenuation of this strain in vivo. The adapted virus (G954-V13 differs from its parental strain by only 5 amino acids (4 in P/V/C and 1 in the M gene. While a vaccine strain, Edmonston Zagreb, could replicate equally well in various primate cells, both G954 strains exhibited restriction to the specific cell type used initially for their propagation. Surprisingly, we observed that both G954 strains induced type I IFN, the wt strain inducing even more than the attenuated ones, particularly in human plasmacytoid Dendritic Cells. Type I IFN-induced protection from the infection of both G954 strains depended on the cell type analyzed, being less efficient in the cells used to grow the viral strain. Conclusion Thus, mutations in M and P/V/C proteins can critically affect MV pathogenicity, cellular tropism and lead to virus attenuation without interfering with the α/β IFN system.

  15. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  16. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  17. IFN-γ and TNF-α producing CD4+ T-cells in the blood after Mycoplasma hyosynoviae challenge of vaccinated pigs

    DEFF Research Database (Denmark)

    Riber, Ulla; Hansen, Mette Sif; Lauritsen, Klara Tølbøll

    In a vaccine trial against Mycoplasma hyosynoviae infection, pigs were vaccinated with formalin fixed whole-cell-antigen formulated with adjuvant DDA/TDB (SSI). Placebo pigs received adjuvant with saline. Vaccinations were performed at five and eight weeks of age, followed by an intranasal M....... hyosynoviae challenge inoculation three weeks later. Vaccination induced both antibodies and a cell-mediated immune response (CMI) in vaccinated pigs compared to placebo pigs as shown by M. hyosynoviae antigen (Ag) specific IFNresponse in an IL-18 potentiated whole-blood IFN-γ stimulation assay (mean IFN......-γ level 1936 pg/ml vs. 82 pg/ml (p=0.0001)). A central memory T cell phenotype with polyfunctional capacity to produce all three cytokines IFN-γ, TNF-α and IL-2 has recently been linked to development of vaccine induced protection in several infections. In a subset of seven vaccinated pigs and four...

  18. Exoenzyme T Plays a Pivotal Role in the IFN-γ Production after Pseudomonas Challenge in IL-12 Primed Natural Killer Cells

    Directory of Open Access Journals (Sweden)

    Mickael Vourc’h

    2017-10-01

    Full Text Available Pseudomonas aeruginosa (PA expresses the type III secretion system (T3SS and effector exoenzymes that interfere with intracellular pathways. Natural killer (NK cells play a key role in antibacterial immunity and their activation is highly dependent on IL-12 produced by myeloid cells. We studied PA and NK cell interactions and the role of IL-12 using human peripheral blood mononuclear cells, sorted human NK cells, and a human NK cell line (NK92. We used a wild-type (WT strain of PA (PAO1 or isogenic PA-deleted strains to delineate the role of T3SS and exoenzymes. Our hypotheses were tested in vivo in a PA-pneumonia mouse model. Human NK cells or NK92 cell line produced low levels of IFN-γ in response to PA without IL-12 stimulation, whereas PA significantly increased IFN-γ after IL-12 priming. The modulation of IFN-γ production by PA required bacteria-to-cell contact. Among T3SS effectors, exoenzyme T (ExoT upregulates IFN-γ production and control ERK activation. In vivo, ExoT also increases IFN-γ levels and the percentage of IFN-γ+ NK cells in lungs during PA pneumonia, confirming in vitro data. In conclusion, our results suggest that T3SS could modulate the production of IFN-γ by NK cells after PA infection through ERK activation.

  19. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  20. IFN-alpha antibodies in patients with age-related macular degeneration treated with recombinant human IFN-alpha2a

    DEFF Research Database (Denmark)

    Ross, Christian; Engler, Claus Bødker; Sander, Birgit

    2002-01-01

    We tested for development of binding and neutralizing antibodies to interferon-alpha (IFN-alpha) during IFN-alpha2a therapy of patients with age-related macular degeneration (AMD) of the eyes. Antibodies were investigated retrospectively in sera of 34 patients treated with 3 x 10(6) IU IFN-alpha2...

  1. Interferons and interferon (IFN)-inducible protein 10 during highly active anti-retroviral therapy (HAART)-possible immunosuppressive role of IFN-alpha in HIV infection

    DEFF Research Database (Denmark)

    Stylianou, E; Aukrust, P; Bendtzen, K

    2000-01-01

    -infected patients had raised levels of both IP-10 and IFN-alpha compared with healthy controls (n = 19), with particularly high levels in advanced disease. HAART induced a marked decrease in levels of both IFN-alpha, neopterin and IP-10, though not to normal concentrations. In contrast, IFN-gamma levels were low...

  2. IFN-alpha antibodies in patients with age-related macular degeneration treated with recombinant human IFN-alpha2a

    DEFF Research Database (Denmark)

    Ross, Christian; Engler, Claus Bødker; Sander, Birgit

    2002-01-01

    We tested for development of binding and neutralizing antibodies to interferon-alpha (IFN-alpha) during IFN-alpha2a therapy of patients with age-related macular degeneration (AMD) of the eyes. Antibodies were investigated retrospectively in sera of 34 patients treated with 3 x 10(6) IU IFN-alpha2a...

  3. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  4. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  5. Differential Regulation of Interferon Responses by Ebola and Marburg Virus VP35 Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, Megan R.; Liu, Gai; Mire, Chad E.; Sureshchandra, Suhas; Luthra, Priya; Yen, Benjamin; Shabman, Reed S.; Leung, Daisy W.; Messaoudi, Ilhem; Geisbert, Thomas W.; Amarasinghe, Gaya K.; Basler, Christopher F.

    2016-02-11

    Suppression of innate immune responses during filoviral infection contributes to disease severity. Ebola (EBOV) and Marburg (MARV) viruses each encode a VP35 protein that suppresses RIG-I-like receptor signaling and interferon-α/β (IFN-α/β) production by several mechanisms, including direct binding to double stranded RNA (dsRNA). Here, we demonstrate that in cell culture, MARV infection results in a greater upregulation of IFN responses as compared to EBOV infection. This correlates with differences in the efficiencies by which EBOV and MARV VP35s antagonize RIG-I signaling. Furthermore, structural and biochemical studies suggest that differential recognition of RNA elements by the respective VP35 C-terminal IFN inhibitory domain (IID) rather than affinity for RNA by the respective VP35s is critical for this observation. Our studies reveal functional differences in EBOV versus MARV VP35 RNA binding that result in unexpected differences in the host response to deadly viral pathogens.

  6. Modified vaccinia virus Ankara triggers type I IFN production in murine conventional dendritic cells via a cGAS/STING-mediated cytosolic DNA-sensing pathway.

    Directory of Open Access Journals (Sweden)

    Peihong Dai

    2014-04-01

    Full Text Available Modified vaccinia virus Ankara (MVA is an attenuated poxvirus that has been engineered as a vaccine against infectious agents and cancers. Our goal is to understand how MVA modulates innate immunity in dendritic cells (DCs, which can provide insights to vaccine design. In this study, using murine bone marrow-derived dendritic cells, we assessed type I interferon (IFN gene induction and protein secretion in response to MVA infection. We report that MVA infection elicits the production of type I IFN in murine conventional dendritic cells (cDCs, but not in plasmacytoid dendritic cells (pDCs. Transcription factors IRF3 (IFN regulatory factor 3 and IRF7, and the positive feedback loop mediated by IFNAR1 (IFN alpha/beta receptor 1, are required for the induction. MVA induction of type I IFN is fully dependent on STING (stimulator of IFN genes and the newly discovered cytosolic DNA sensor cGAS (cyclic guanosine monophosphate-adenosine monophosphate synthase. MVA infection of cDCs triggers phosphorylation of TBK1 (Tank-binding kinase 1 and IRF3, which is abolished in the absence of cGAS and STING. Furthermore, intravenous delivery of MVA induces type I IFN in wild-type mice, but not in mice lacking STING or IRF3. Treatment of cDCs with inhibitors of endosomal and lysosomal acidification or the lysosomal enzyme Cathepsin B attenuated MVA-induced type I IFN production, indicating that lysosomal enzymatic processing of virions is important for MVA sensing. Taken together, our results demonstrate a critical role of the cGAS/STING-mediated cytosolic DNA-sensing pathway for type I IFN induction in cDCs by MVA. We present evidence that vaccinia virulence factors E3 and N1 inhibit the activation of IRF3 and the induction of IFNB gene in MVA-infected cDCs.

  7. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  8. Recombinant IFN-γ from the bank vole Myodes glareolus: a novel tool for research on rodent reservoirs of zoonotic pathogens.

    Science.gov (United States)

    Torelli, Francesca; Zander, Steffen; Ellerbrok, Heinz; Kochs, Georg; Ulrich, Rainer G; Klotz, Christian; Seeber, Frank

    2018-02-12

    Rodent species like Myodes glareolus and Microtus spp. are natural reservoirs for many zoonotic pathogens causing human diseases and are gaining increasing interest in the field of eco-immunology as candidate animal models. Despite their importance the lack of immunological reagents has hampered research in these animal species. Here we report the recombinant production and functional characterization of IFN-γ, a central mediator of host's innate and adaptive immune responses, from the bank vole M. glareolus. Soluble dimeric recMgIFN-γ was purified in high yield from Escherichia coli. Its activity on M. glareolus and Microtus arvalis kidney cell lines was assessed by immunofluorescent detection of nuclear translocation and phosphorylation of the transcription factor STAT1. RecMgIFN-γ also induced expression of an IFN-γ-regulated innate immunity gene. Inhibition of vesicular stomatitis virus replication in vole cells upon recMgIFN-γ treatment provided further evidence of its biological activity. Finally, we established a recMgIFN-γ-responsive bank vole reporter cell line that allows the sensitive titration of the cytokine activity via a bioluminescence reporter assay. Taken together, we report valuable tools for future investigations on the immune response against zoonotic pathogens in their natural animal hosts, which might foster the development of novel animal models.

  9. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  10. IFN regulatory factor 1 restricts hepatitis E virus replication by activating STAT1 to induce antiviral IFN-stimulated genes.

    Science.gov (United States)

    Xu, Lei; Zhou, Xinying; Wang, Wenshi; Wang, Yijin; Yin, Yuebang; Laan, Luc J W van der; Sprengers, Dave; Metselaar, Herold J; Peppelenbosch, Maikel P; Pan, Qiuwei

    2016-10-01

    IFN regulatory factor 1 (IRF1) is one of the most important IFN-stimulated genes (ISGs) in cellular antiviral immunity. Although hepatitis E virus (HEV) is a leading cause of acute hepatitis worldwide, how ISGs counteract HEV infection is largely unknown. This study was conducted to investigate the effect of IRF1 on HEV replication. Multiple cell lines were used in 2 models that harbor HEV. In different HEV cell culture systems, IRF1 effectively inhibited HEV replication. IRF1 did not trigger IFN production, and chromatin immunoprecipitation sequencing data analysis revealed that IRF1 bound to the promoter region of signal transducers and activators of transcription 1 (STAT1). Functional assay confirmed that IRF1 could drive the transcription of STAT1, resulting in elevation of total and phosphorylated STAT1 proteins and further activating the transcription of a panel of downstream antiviral ISGs. By pharmacological inhibitors and RNAi-mediated gene-silencing approaches, we revealed that antiviral function of IRF1 is dependent on the JAK-STAT cascade. Furthermore, induction of ISGs and the anti-HEV effect of IRF1 overlapped that of IFNα, but was potentiated by ribavirin. We demonstrated that IRF1 effectively inhibits HEV replication through the activation of the JAK-STAT pathway, and the subsequent transcription of antiviral ISGs, but independent of IFN production.-Xu, L., Zhou, X., Wang, W., Wang, Y., Yin, Y., van der Laan, L. J. W., Sprengers, D., Metselaar, H. J., Peppelenbosch, M. P., Pan, Q. IFN regulatory factor 1 restricts hepatitis E virus replication by activating STAT1 to induce antiviral IFN-stimulated genes. © FASEB.

  11. New World hantaviruses activate IFNlambda production in type I IFN-deficient vero E6 cells.

    Directory of Open Access Journals (Sweden)

    Joseph Prescott

    Full Text Available Hantaviruses indigenous to the New World are the etiologic agents of hantavirus cardiopulmonary syndrome (HCPS. These viruses induce a strong interferon-stimulated gene (ISG response in human endothelial cells. African green monkey-derived Vero E6 cells are used to propagate hantaviruses as well as many other viruses. The utility of the Vero E6 cell line for virus production is thought to owe to their lack of genes encoding type I interferons (IFN, rendering them unable to mount an efficient innate immune response to virus infection. Interferon lambda, a more recently characterized type III IFN, is transcriptionally controlled much like the type I IFNs, and activates the innate immune system in a similar manner.We show that Vero E6 cells respond to hantavirus infection by secreting abundant IFNlambda. Three New World hantaviruses were similarly able to induce IFNlambda expression in this cell line. The IFNlambda contained within virus preparations generated with Vero E6 cells independently activates ISGs when used to infect several non-endothelial cell lines, whereas innate immune responses by endothelial cells are specifically due to viral infection. We show further that Sin Nombre virus replicates to high titer in human hepatoma cells (Huh7 without inducing ISGs.Herein we report that Vero E6 cells respond to viral infection with a highly active antiviral response, including secretion of abundant IFNlambda. This cytokine is biologically active, and when contained within viral preparations and presented to human epithelioid cell lines, results in the robust activation of innate immune responses. We also show that both Huh7 and A549 cell lines do not respond to hantavirus infection, confirming that the cytoplasmic RNA helicase pathways possessed by these cells are not involved in hantavirus recognition. We demonstrate that Vero E6 actively respond to virus infection and inhibiting IFNlambda production in these cells might increase their utility

  12. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  13. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  14. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  16. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  17. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  18. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  19. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  20. Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review

    Science.gov (United States)

    Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini

    2014-01-01

    Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFNresponse in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFNresponse in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions

  1. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  2. Genetic Control of Lyme Arthritis by Borrelia burgdorferi Arthritis-Associated Locus 1 Is Dependent on Localized Differential Production of IFN-β and Requires Upregulation of Myostatin.

    Science.gov (United States)

    Paquette, Jackie K; Ma, Ying; Fisher, Colleen; Li, Jinze; Lee, Sang Beum; Zachary, James F; Kim, Yong Soo; Teuscher, Cory; Weis, Janis J

    2017-11-15

    Previously, using a forward genetic approach, we identified differential expression of type I IFN as a positional candidate for an expression quantitative trait locus underlying Borrelia burgdorferi arthritis-associated locus 1 ( Bbaa1 ). In this study, we show that mAb blockade revealed a unique role for IFN-β in Lyme arthritis development in B6.C3- Bbaa1 mice. Genetic control of IFN-β expression was also identified in bone marrow-derived macrophages stimulated with B. burgdorferi , and it was responsible for feed-forward amplification of IFN-stimulated genes. Reciprocal radiation chimeras between B6.C3- Bbaa1 and C57BL/6 mice revealed that arthritis is initiated by radiation-sensitive cells, but orchestrated by radiation-resistant components of joint tissue. Advanced congenic lines were developed to reduce the physical size of the Bbaa1 interval, and confirmed the contribution of type I IFN genes to Lyme arthritis. RNA sequencing of resident CD45 - joint cells from advanced interval-specific recombinant congenic lines identified myostatin as uniquely upregulated in association with Bbaa1 arthritis development, and myostatin expression was linked to IFN-β production. Inhibition of myostatin in vivo suppressed Lyme arthritis in the reduced interval Bbaa1 congenic mice, formally implicating myostatin as a novel downstream mediator of the joint-specific inflammatory response to B. burgdorferi . Copyright © 2017 by The American Association of Immunologists, Inc.

  3. Nocardia brasiliensis Modulates IFN-gamma, IL-10, and IL-12 cytokine production by macrophages from BALB/c Mice.

    Science.gov (United States)

    Salinas-Carmona, Mario C; Zúñiga, Juan M; Pérez-Rivera, Luz I; Segoviano-Ramírez, Juan C; Vázquez-Marmolejo, Anna V

    2009-05-01

    Interferon-gamma (IFN-gamma) is a critical cytokine involved in control of different infections. Actinomycetoma is a chronic infectious disease mainly caused by the bacterium Nocardia brasiliensis, which destroys subcutaneous tissue, including bone. Currently, the mechanism of pathogenesis in N. brasiliensis infection is not known. Here, we demonstrate that N. brasiliensis induced an IFN-gamma response in serum after 24 h of infection, while, in infected tissue, positive cells to IFN-gamma appeared in 2 early peaks: the first was present only 3 h after infection, then transiently decreased; and the second peak appeared 12 h after infection and was independent of interleukin-10. Resident macrophages produced an immediate IFN-gamma response 1 h after in vitro infection, and spleen-positive cells began later. The phase of growth of N. brasiliensis affected cytokine production, and exposure of macrophages to Nocardia opsonized with either polyclonal anti-Nocardia antibodies or anti-P61 monoclonal antibody led to a suppression of cytokine production. Our report provides evidence that N. brasiliensis as an intracellular bacterium modulates macrophage cytokine production, which helps survival of the pathogen. Modulation of these cytokines may contribute to pathogenesis once this bacterium is inside the macrophage.

  4. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  5. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  6. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  7. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  8. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  9. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  10. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  11. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  12. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  13. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  14. NOD1 contributes to mouse host defense against Helicobacter pylori via induction of type I IFN and activation of the ISGF3 signaling pathway

    Science.gov (United States)

    Watanabe, Tomohiro; Asano, Naoki; Fichtner-Feigl, Stefan; Gorelick, Peter L.; Tsuji, Yoshihisa; Matsumoto, Yuko; Chiba, Tsutomu; Fuss, Ivan J.; Kitani, Atsushi; Strober, Warren

    2010-01-01

    Nucleotide-binding oligomerization domain 1 (NOD1) is an intracellular epithelial cell protein known to play a role in host defense at mucosal surfaces. Here we show that a ligand specific for NOD1, a peptide derived from peptidoglycan, initiates an unexpected signaling pathway in human epithelial cell lines that results in the production of type I IFN. Detailed analysis revealed the components of the signaling pathway. NOD1 binding to its ligand triggered activation of the serine-threonine kinase RICK, which was then able to bind TNF receptor–associated factor 3 (TRAF3). This in turn led to activation of TANK-binding kinase 1 (TBK1) and IκB kinase ε (IKKε) and the subsequent activation of IFN regulatory factor 7 (IRF7). IRF7 induced IFN-β production, which led to activation of a heterotrimeric transcription factor complex known as IFN-stimulated gene factor 3 (ISGF3) and the subsequent production of CXCL10 and additional type I IFN. In vivo studies showed that mice lacking the receptor for IFN-β or subjected to gene silencing of the ISGF3 component Stat1 exhibited decreased CXCL10 responses and increased susceptibility to Helicobacter pylori infection, phenotypes observed in NOD1-deficient mice. These studies thus establish that NOD1 can activate the ISGF3 signaling pathway that is usually associated with protection against viral infection to provide mice with robust type I IFN–mediated protection from H. pylori and possibly other mucosal infections. PMID:20389019

  15. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  16. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  18. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  19. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  20. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  1. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  2. Benefit of adjuvant interferon alfa-2b (IFN-α) therapy in melanoma patients with high serum MMP-8 levels

    DEFF Research Database (Denmark)

    Vihinen, Pia; Tervahartiala, Taina; Sorsa, Timo

    2015-01-01

    Matrix metalloproteinases (MMPs) are important enzymes in tissue turnover and various inflammatory processes. In this study, it was evaluated whether serum MMP-8 can predict the response to adjuvant interferon alfa-2b (IFN-α) therapy in patients with operated high-risk cutaneous melanoma. Pre......-treatment sera from 460 patients with stage IIB-IIIC melanoma were analyzed for MMP-8. The patients were randomized after surgery to adjuvant IFN-α for 12 or 24 months (n = 313) or observation only (n = 147). The median serum MMP-8 level was used to classify the patients into a low MMP-8 (n = 232) and a high MMP......-8 (n = 228) group. In the high MMP-8 subgroup, IFN-α therapy significantly improved relapse-free survival (RFS). RFS was 36.8 months in patients with high MMP-8 levels receiving IFN-α therapy, whereas RFS for those with high MMP-8 levels with observation only was 10.6 months (P = 0.027). Median...

  3. Local IFN-gamma therapy of HPV16-associated tumours

    Czech Academy of Sciences Publication Activity Database

    Mikyšková, Romana; Bieblová, Jana; Šímová, Jana; Indrová, Marie; Jandlová, Táňa; Vonka, V.; Šmahel, M.; Bubeník, Jan; Mendoza, Luis

    2003-01-01

    Roč. 49, č. 1 (2003), s. 26-32 ISSN 0015-5500 R&D Projects: GA MZd NC7148; GA MZd NC5900; GA ČR GA301/01/0985 Grant - others:GA CZ(CZ) Liga proti rakovině Institutional research plan: CEZ:AV0Z5052915 Keywords : MHC class I * IFN-gamma * HPV16 Subject RIV: FD - Oncology ; Hematology Impact factor: 0.527, year: 2003

  4. Gene expression in IFN-g-activated murine macrophages

    Directory of Open Access Journals (Sweden)

    Pereira C.A.

    2004-01-01

    Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.

  5. Reversal of methylation silencing of Apo2L/TRAIL receptor 1 (DR4) expression overcomes resistance of SK-MEL-3 and SK-MEL-28 melanoma cells to interferons (IFNs) or Apo2L/TRAIL.

    Science.gov (United States)

    Bae, S I; Cheriyath, V; Jacobs, B S; Reu, F J; Borden, E C

    2008-01-17

    Human melanoma cell lines, SK-MEL-3 and SK-MEL-28, despite induction of the proapoptotic cytokine, Apo2L/TRAIL, did not undergo apoptosis in response to interferons (IFN-alpha2b or IFN-beta). Postulating that genes important for apoptosis induction by IFNs might be silenced by methylation, the DNA demethylating agent 5-aza-2'-deoxycytidine (5-AZAdC) was assessed. DR4 (TRAIL-R1) was identified as one of the genes reactivated by 5-AZAdC with a >3-fold increase in 8 of 10 melanoma cell lines. Pretreatment with 5-AZAdC sensitized SK-MEL-3 and SK-MEL-28 cells to apoptosis induced by IFN-alpha2b and IFN-beta; methylation-specific PCR and bisulfite sequencing confirmed demethylation of 5'CpG islands of DR4 and flow cytometry showed an increase in DR4 protein on the cell surface. In cells with reactivated DR4, neutralizing mAB to TRAIL reduced apoptosis in response to IFN-beta or Apo2L/TRAIL. To further confirm the role of DR4, it was expressed by retroviral vector in SK-MEL-3 and SK-MEL-28 cells with reversal of resistance to IFN-beta and Apo2L/TRAIL. Thus, reexpressing DR4 by 5-AZAdC or retroviral transfection in melanoma cell in which promoter methylation had suppressed its expression, potentiated apoptosis by IFN-alpha2b, IFN-beta and Apo2L/TRAIL. Reactivation of silenced proapoptotic genes by inhibitors of DNA methylation may enhance clinical response to IFNs or Apo2L/TRAIL.

  6. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  7. The C proteins of human parainfluenza virus type 1 block IFN signaling by binding and retaining Stat1 in perinuclear aggregates at the late endosome.

    Directory of Open Access Journals (Sweden)

    Henrick Schomacker

    Full Text Available Interferons (IFNs play a crucial role in the antiviral immune response. Whereas the C proteins of wild-type human parainfluenza virus type 1 (WT HPIV1 inhibit both IFN-β induction and signaling, a HPIV1 mutant encoding a single amino acid substitution (F170S in the C proteins is unable to block either host response. Here, signaling downstream of the type 1 IFN receptor was examined in Vero cells to define at what stage WT HPIV1 can block, and F170S HPIV1 fails to block, IFN signaling. WT HPIV1 inhibited phosphorylation of both Stat1 and Stat2, and this inhibition was only slightly reduced for F170S HPIV1. Degradation of Stat1 or Stat2 was not observed. The HPIV1 C proteins were found to accumulate in the perinuclear space, often forming large granules, and co-localized with Stat1 and the cation-independent mannose 6-phosphate receptor (M6PR that is a marker for late endosomes. Upon stimulation with IFN-β, both the WT and F170S C proteins remained in the perinuclear space, but only the WT C proteins prevented Stat1 translocation to the nucleus. In addition, WT HPIV1 C proteins, but not F170S C proteins, co-immunoprecipitated both phosphorylated and unphosphorylated Stat1. Our findings suggest that the WT HPIV1 C proteins form a stable complex with Stat1 in perinuclear granules that co-localize with M6PR, and that this direct interaction between the WT HPIV1 C proteins and Stat1 is the basis for the ability of HPIV1 to inhibit IFN signaling. The F170S mutation in HPIV1 C did not prevent perinuclear co-localization with Stat1, but apparently weakened this interaction such that, upon IFN stimulation, Stat1 was translocated to the nucleus to induce an antiviral response.

  8. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  9. DMPD: What is disrupting IFN-alpha's antiviral activity? [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15283983 What is disrupting IFN-alpha's antiviral activity? Mbow ML, Sarisky RT. Tr...ends Biotechnol. 2004 Aug;22(8):395-9. (.png) (.svg) (.html) (.csml) Show What is disrupting IFN-alpha's ant...iviral activity? PubmedID 15283983 Title What is disrupting IFN-alpha's antiviral activity? Authors Mbow ML,

  10. La proteína asociada a SLAM (SAP regula la expresión de IFN-g en lepra The SLAM-associated protein (SAP regulates IFN-g expression in leprosy

    Directory of Open Access Journals (Sweden)

    María F. Quiroga

    2004-10-01

    Full Text Available La inmunidad protectora contra Mycobacterium leprae requiere IFN-g. Los pacientes con lepra tuberculoide producen localmente citoquinas Th1, mientras que los pacientes lepromatosos producen citoquinas Th2. La molécula linfocitaria activadora de señales (SLAM y la proteína asociada a SLAM (SAP participan en la diferenciación celular que conduce a producción de patrones específicos de citoquinas. A fin de investigar la vía SLAM/SAP en la infección por M. leprae, determinamos expresión de ARN mensajero (ARNm de SAP, IFN-g y SLAM en pacientes con lepra. Observamos que la expresión de SLAM correlacionó en forma directa con la expresión de IFN-g, mientras que la expresión de SAP correlacionó inversamente con la expresión de ambas proteínas. Así, nuestros resultados indican que SAP interferiría con las respuestas de citoquinas Th1 mientras que SLAM contribuiría con la respuesta Th1 en lepra, señalando a la vía SLAM/SAP como potencial blanco modulador de citoquinas en enfermedades con respuestas Th2 disfuncionales.Tuberculoid leprosy patients locally produce Th1 cytokines, while lepromatous patients produce Th2 cytokines. Signaling lymphocytic activation molecule (SLAM and the SLAM-associated protein (SAP participate in the differentiation process that leads to the production of specific patterns of cytokines by activated T cells. To investigate the SLAM/SAP pathway in M. leprae infection, we determined the expression of SAP, IFN-g and SLAM RNA messenger in leprosy patients. We found a direct correlation of SLAM expression with IFN-g expression, whereas the expression of SAP was inversely correlated with the expression of both SLAM and IFN-g. Therefore, our data indicate that SAP might interfere with Th1 cytokine responses while SLAM expression may contribute to Th1 responses in leprosy. This study further suggests that the SLAM/SAP pathway might be a focal point for therapeutic modulation of T cell cytokine responses in diseases

  11. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  12. A Viral RNA Structural Element Alters Host Recognition of Nonself RNA

    Energy Technology Data Exchange (ETDEWEB)

    Hyde, J. L.; Gardner, C. L.; Kimura, T.; White, J. P.; Liu, G.; Trobaugh, D. W.; Huang, C.; Tonelli, M.; Paessler, S.; Takeda, K.; Klimstra, W. B.; Amarasinghe, G. K.; Diamond, M. S.

    2014-01-30

    Although interferon (IFN) signaling induces genes that limit viral infection, many pathogenic viruses overcome this host response. As an example, 2'-O methylation of the 5' cap of viral RNA subverts mammalian antiviral responses by evading restriction of Ifit1, an IFN-stimulated gene that regulates protein synthesis. However, alphaviruses replicate efficiently in cells expressing Ifit1 even though their genomic RNA has a 5' cap lacking 2'-O methylation. We show that pathogenic alphaviruses use secondary structural motifs within the 5' untranslated region (UTR) of their RNA to alter Ifit1 binding and function. Mutations within the 5'-UTR affecting RNA structural elements enabled restriction by or antagonism of Ifit1 in vitro and in vivo. These results identify an evasion mechanism by which viruses use RNA structural motifs to avoid immune restriction.

  13. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  14. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  15. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  16. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  17. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  18. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  19. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  20. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  1. Alveolar macrophages and type I IFN in airway homeostasis and immunity.

    Science.gov (United States)

    Divangahi, Maziar; King, Irah L; Pernet, Erwan

    2015-05-01

    Globally, respiratory infections cause more than 4 million deaths per year, with influenza and tuberculosis (TB) in particular being major causes of mortality and morbidity. Although immune cell activation is critical for killing respiratory pathogens, this response must be tightly regulated to effectively control and eliminate invading microorganisms while minimizing immunopathology and maintaining pulmonary function. The distinct microenvironment of the lung is constantly patrolled by alveolar macrophages (Mφ), which are essential for tissue homeostasis, early pathogen recognition, initiation of the local immune response, and resolution of inflammation. Here, we focus on recent advances that have provided insight into the relation between pulmonary Mφ, type I interferon (IFN) signaling, and the delicate balance between protective and pathological immune responses in the lung. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  3. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  4. Exogenous IFN-beta regulates the RANKL-c-Fos-IFN-beta signaling pathway in the collagen antibody-induced arthritis model.

    Science.gov (United States)

    Zhao, Rong; Chen, Ni-Nan; Zhou, Xiao-Wei; Miao, Ping; Hu, Chao-Ying; Qian, Liu; Yu, Qi-Wen; Zhang, Ji-Ying; Nie, Hong; Chen, Xue-hua; Li, Pu; Xu, Rong; Xiao, Lian-Bo; Zhang, Xin; Liu, Jian-Ren; Zhang, Dong-Qing

    2014-12-10

    Although a variety of drugs have been used to treat the symptoms of rheumatoid arthritis (RA), none of them are able to cure the disease. Interferon β (IFN-β) has pleiotropic effects on RA, but whether it can be used to treat RA remains globally controversial. Thus, in this study we tested the effects of IFN-β on RA patients and on collagen antibody-induced arthritis (CAIA) model mice. The cytokine and auto-antibody expression profiles in the serum and synovial fluid (SF) from RA patients were assessed using enzyme-linked immunosorbent assay (ELISA) and compared with the results from osteoarthritis (OA) patients. Exogenous IFN-β was administered to RA patients and CAIA model mice, and the therapeutic effects were evaluated. Endogenous IFN-β expression in the joint bones of CAIA model mice was evaluated by quantitative real-time PCR (qRT-PCR). The effects of exogenous IFN-β on CAIA model mice were assessed using a clinical scoring system, hematoxylin eosin and safranin-O with fast green counterstain histology, molybdenum target X-ray, and tartrate-resistant acid phosphatase (TRAP) staining. The RANKL-RANK signaling pathway was analyzed using qRT-PCR. The RAW 264.7 cell line was differentiated into osteoclasts with RANKL stimulation and then treated with exogenous IFN-β. The expression of inflammatory cytokines (IFN-γ, IL-17, MMP-3, and RANKL) and auto-antibodies (CII antibodies, RF-IgM, and anti-CCP/GPI) were significantly higher in RA compared with OA patients. After IFN-β intervention, some clinical symptoms in RA patients were partially alleviated, and the expression of IFN-γ, IL-17, MMP-3, and OPG) returned to normal levels. In the CAIA model, the expression of endogenous IFN-β in the joint bones was decreased. After IFN-β administration, the arthritis scores were decreased; synovial inflammation, cartilage, and bone destruction were clearly attenuated; and the expression of c-Fos and NFATc1 were reduced, while RANKL and TRAF6 expression was

  5. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  6. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  7. Experimental Evaluation of the Transport Mechanisms of PoIFN-α in Caco-2 Cells

    Directory of Open Access Journals (Sweden)

    Xin Liu

    2017-11-01

    Full Text Available For the development of an efficient intestinal delivery system for Porcine interferon-α (PoIFN-α, the understanding of transport mechanisms of which in the intestinal cell is essential. In this study, we investigated the absorption mechanisms of PoIFN-α in intestine cells. Caco-2 cells and fluorescein isothiocyanate-labeled (FITC-PoIFN-α were used to explore the whole transport process, including endocytosis, intracellular trafficking, exocytosis, and transcytosis. Via various techniques, the transport pathways of PoIFN-α in Caco-2 cells and the mechanisms were clarified. Firstly, the endocytosis of PoIFN-α by Caco-2 cells was time, concentration and temperature dependence. And the lipid raft/caveolae endocytosis was the most likely endocytic pathway for PoIFN-α. Secondly, both Golgi apparatus and lysosome were involved in the intracellular trafficking of PoIFN-α. Thirdly, the treatment of indomethacin resulted in a significant decrease of exocytosis of PoIFN-α, indicating the participation of cyclooxygenase. Finally, to evaluate the efficiency of PoIFN-α transport, the transepithelial electrical resistance (TEER value was measured to investigate the tight junctional integrity of the cell monolayers. The fluorescence microscope results revealed that the transport of PoIFN-α across the Caco-2 cell monolayers was restricted. In conclusion, this study depicts a probable picture of PoIFN-α transport in Caco-2 cells characterized by non-specificity, partial energy-dependency and low transcytosis.

  8. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  9. Investigating the Role of TNF-α and IFN-γ Activation on the Dynamics of iNOS Gene Expression in LPS Stimulated Macrophages.

    Directory of Open Access Journals (Sweden)

    Taha Salim

    Full Text Available Macrophage produced inducible nitric oxide synthase (iNOS is known to play a critical role in the proinflammatory response against intracellular pathogens by promoting the generation of bactericidal reactive nitrogen species. Robust and timely production of nitric oxide (NO by iNOS and analogous production of reactive oxygen species are critical components of an effective immune response. In addition to pathogen associated lipopolysaccharides (LPS, iNOS gene expression is dependent on numerous proinflammatory cytokines in the cellular microenvironment of the macrophage, two of which include interferon gamma (IFN-γ and tumor necrosis factor alpha (TNF-α. To understand the synergistic effect of IFN-γ and TNF-α activation, and LPS stimulation on iNOS expression dynamics and NO production, we developed a systems biology based mathematical model. Using our model, we investigated the impact of pre-infection cytokine exposure, or priming, on the system. We explored the essentiality of IFN-γ priming to the robustness of initial proinflammatory response with respect to the ability of macrophages to produce reactive species needed for pathogen clearance. Results from our theoretical studies indicated that IFN-γ and subsequent activation of IRF1 are essential in consequential production of iNOS upon LPS stimulation. We showed that IFN-γ priming at low concentrations greatly increases the effector response of macrophages against intracellular pathogens. Ultimately the model demonstrated that although TNF-α contributed towards a more rapid response time, measured as time to reach maximum iNOS production, IFN-γ stimulation was significantly more significant in terms of the maximum expression of iNOS and the concentration of NO produced.

  10. Investigating the Role of TNF-α and IFN-γ Activation on the Dynamics of iNOS Gene Expression in LPS Stimulated Macrophages.

    Science.gov (United States)

    Salim, Taha; Sershen, Cheryl L; May, Elebeoba E

    2016-01-01

    Macrophage produced inducible nitric oxide synthase (iNOS) is known to play a critical role in the proinflammatory response against intracellular pathogens by promoting the generation of bactericidal reactive nitrogen species. Robust and timely production of nitric oxide (NO) by iNOS and analogous production of reactive oxygen species are critical components of an effective immune response. In addition to pathogen associated lipopolysaccharides (LPS), iNOS gene expression is dependent on numerous proinflammatory cytokines in the cellular microenvironment of the macrophage, two of which include interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α). To understand the synergistic effect of IFN-γ and TNF-α activation, and LPS stimulation on iNOS expression dynamics and NO production, we developed a systems biology based mathematical model. Using our model, we investigated the impact of pre-infection cytokine exposure, or priming, on the system. We explored the essentiality of IFN-γ priming to the robustness of initial proinflammatory response with respect to the ability of macrophages to produce reactive species needed for pathogen clearance. Results from our theoretical studies indicated that IFN-γ and subsequent activation of IRF1 are essential in consequential production of iNOS upon LPS stimulation. We showed that IFN-γ priming at low concentrations greatly increases the effector response of macrophages against intracellular pathogens. Ultimately the model demonstrated that although TNF-α contributed towards a more rapid response time, measured as time to reach maximum iNOS production, IFN-γ stimulation was significantly more significant in terms of the maximum expression of iNOS and the concentration of NO produced.

  11. High IFN-alpha responses associated with depletion of lymphocytes and natural IFN-producing cells during classical swine fever

    NARCIS (Netherlands)

    Summerfield, A.; Alves, M.; Ruggli, N.; Bruin, de M.G.M.; McCullough, K.C.

    2006-01-01

    During the acute phase of the viral hemorrhagic disease, classical swine fever (CSF), a severe hematologic depletion in primary lymphoid organs and depletion of peripheral blood T and B lymphocytes are observed. The onset of these pathologic events is before viremia and independent of leukocyte

  12. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  13. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  14. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  15. Astragalus root and elderberry fruit extracts enhance the IFN-β stimulatory effects of Lactobacillus acidophilus in murine-derived dendritic cells.

    Directory of Open Access Journals (Sweden)

    Hanne Frøkiær

    Full Text Available Many foods and food components boost the immune system, but little data are available regarding the mechanisms by which they do. Bacterial strains have disparate effects in stimulating the immune system. In dendritic cells, the gram-negative bacteria Escherichia coli upregulates proinflammatory cytokines, whereas gram-positive Lactobacillus acidophilus induces a robust interferon (IFNresponse. The immune-modulating effects of astragalus root and elderberry fruit extracts were examined in bone marrow-derived murine dendritic cells that were stimulated with L. acidophilus or E. coli. IFN-β and other cytokines were measured by ELISA and RT-PCR. Endocytosis of fluorescence-labeled dextran and L. acidophilus in the presence of elderberry fruit or astragalus root extract was evaluated in dendritic cells. Our results show that both extracts enhanced L. acidophilus-induced IFN-β production and slightly decreased the proinflammatory response to E. coli. The enhanced IFN-β production was associated with upregulation of toll-like receptor 3 and to a varying degree, the cytokines IL-12, IL-6, IL-1β and TNF-α. Both extracts increased endocytosis in immature dendritic cells, and only slightly influenced the viability of the cells. In conclusion, astragalus root and elderberry fruit extracts increase the IFN-β inducing activity of L. acidophilus in dendritic cells, suggesting that they may exert antiviral and immune-enhancing activity.

  16. The CXC chemokines gamma interferon (IFN-gamma)-inducible protein 10 and monokine induced by IFN-gamma are released during severe melioidosis

    NARCIS (Netherlands)

    Lauw, F. N.; Simpson, A. J.; Prins, J. M.; van Deventer, S. J.; Chaowagul, W.; White, N. J.; van der Poll, T.

    2000-01-01

    Gamma interferon (IFN-gamma)-inducible protein 10 (IP-10) and monokine induced by IFN-gamma (Mig) are related CXC chemokines which bind to the CXCR3 receptor and specifically target activated T lymphocytes and natural killer (NK) cells. The production of IP-10 and Mig by various cell types in vitro

  17. The murine cytomegalovirus M35 protein antagonizes type I IFN induction downstream of pattern recognition receptors by targeting NF-κB mediated transcription.

    Directory of Open Access Journals (Sweden)

    Baca Chan

    2017-05-01

    Full Text Available The type I interferon (IFN response is imperative for the establishment of the early antiviral immune response. Here we report the identification of the first type I IFN antagonist encoded by murine cytomegalovirus (MCMV that shuts down signaling following pattern recognition receptor (PRR sensing. Screening of an MCMV open reading frame (ORF library identified M35 as a novel and strong negative modulator of IFNβ promoter induction following activation of both RNA and DNA cytoplasmic PRR. Additionally, M35 inhibits the proinflammatory cytokine response downstream of Toll-like receptors (TLR. Using a series of luciferase-based reporters with specific transcription factor binding sites, we determined that M35 targets NF-κB-, but not IRF-mediated, transcription. Expression of M35 upon retroviral transduction of immortalized bone marrow-derived macrophages (iBMDM led to reduced IFNβ transcription and secretion upon activation of stimulator of IFN genes (STING-dependent signaling. On the other hand, M35 does not antagonize interferon-stimulated gene (ISG 56 promoter induction or ISG transcription upon exogenous stimulation of the type I IFN receptor (IFNAR. M35 is present in the viral particle and, upon MCMV infection of fibroblasts, is immediately shuttled to the nucleus where it exerts its immunomodulatory effects. Deletion of M35 from the MCMV genome and hence from the viral particle resulted in elevated type I IFN transcription and secretion in vitro and in vivo. In the absence of M35, lower viral titers are observed during acute infection of the host, and productive infection in the salivary glands was not detected. In conclusion, the M35 protein is released by MCMV immediately upon infection in order to deftly inhibit the antiviral type I IFN response by targeting NF-κB-mediated transcription. The identification of this novel viral protein reinforces the importance of timely countermeasures in the complex relationship between virus and host.

  18. Role of 4-1BB receptor in the control played by CD8(+ T cells on IFN-gamma production by Mycobacterium tuberculosis antigen-specific CD4(+ T Cells.

    Directory of Open Access Journals (Sweden)

    Carla Palma

    Full Text Available BACKGROUND: Antigen-specific IFN-gamma producing CD4(+ T cells are the main mediators of protection against Mycobacterium tuberculosis infection both under natural conditions and following vaccination. However these cells are responsible for lung damage and poor vaccine efficacy when not tightly controlled. Discovering new tools to control nonprotective antigen-specific IFN-gamma production without affecting protective IFN-gamma is a challenge in tuberculosis research. METHODS AND FINDINGS: Immunization with DNA encoding Ag85B, a candidate vaccine antigen of Mycobacterium tuberculosis, elicited in mice a low but protective CD4(+ T cell-mediated IFN-gamma response, while in mice primed with DNA and boosted with Ag85B protein a massive increase in IFN-gamma response was associated with loss of protection. Both protective and non-protective Ag85B-immunization generated antigen-specific CD8(+ T cells which suppressed IFN-gamma-secreting CD4(+ T cells. However, ex vivo ligation of 4-1BB, a member of TNF-receptor super-family, reduced the massive, non-protective IFN-gamma responses by CD4(+ T cells in protein-boosted mice without affecting the low protective IFN-gamma-secretion in mice immunized with DNA. This selective inhibition was due to the induction of 4-1BB exclusively on CD8(+ T cells of DNA-primed and protein-boosted mice following Ag85B protein stimulation. The 4-1BB-mediated IFN-gamma inhibition did not require soluble IL-10, TGF-beta, XCL-1 and MIP-1beta. In vivo Ag85B stimulation induced 4-1BB expression on CD8(+ T cells and in vivo 4-1BB ligation reduced the activation, IFN-gamma production and expansion of Ag85B-specific CD4(+ T cells of DNA-primed and protein-boosted mice. CONCLUSION/SIGNIFICANCE: Antigen-specific suppressor CD8(+ T cells are elicited through immunization with the mycobacterial antigen Ag85B. Ligation of 4-1BB receptor further enhanced their suppressive activity on IFN-gamma-secreting CD4(+ T cells. The selective

  19. An early burst of IFN-γ induced by the pre-erythrocytic stage favours Plasmodium yoelii parasitaemia in B6 mice

    Directory of Open Access Journals (Sweden)

    Barbier Eliane

    2009-06-01

    Full Text Available Abstract Background In murine models of malaria, an early proinflammatory response has been associated with the resolution of blood-stage infection. To dissect the protective immune mechanims that allow the control of parasitaemia, the early immune response of C57BL/6 mice induced during a non-lethal plasmodial infection was analysed. Methods Mice were infected with Plasmodium yoelii 265BY sporozoites, the natural invasive form of the parasite, in order to complete its full life cycle. The concentrations of three proinflammatory cytokines in the sera of mice were determined by ELISA at different time points of infection. The contribution of the liver and the spleen to this cytokinic response was evaluated and the cytokine-producing lymphocytes were identified by flow cytometry. The physiological relevance of these results was tested by monitoring parasitaemia in genetically deficient C57BL/6 mice or wild-type mice treated with anti-cytokine neutralizing antibody. Finally, the cytokinic response in sera of mice infected with parasitized-RBCs was analysed. Results The early immune response of C57BL/6 mice to sporozoite-induced malaria is characterized by a peak of IFN-γ in the serum at day 5 of infection and splenic CD4 T lymphocytes are the major producer of this cytokine at this time point. Somewhat unexpected, the parasitaemia is significantly lower in P. yoelii-infected mice in the absence of IFN-γ. More precisely, at early time points of infection, IFN-γ favours parasitaemia, whereas helping to clear efficiently the blood-stage parasites at later time points. Interestingly, the early IFN-γ burst is induced by the pre-erythrocytic stage. Conclusion These results challenge the current view regarding the role of IFN-γ on the control of parasite growth since they show that IFN-γ is not an essential mediator of protection in P. yoelii-infected C57BL/6 mice. Moreover, the mice parasitaemia is more efficiently controlled in the absence of an

  20. PCBP2 enhances the antiviral activity of IFN-α against HCV by stabilizing the mRNA of STAT1 and STAT2.

    Directory of Open Access Journals (Sweden)

    Zhongshuai Xin

    Full Text Available Interferon-α (IFN-α is a natural choice for the treatment of hepatitis C, but half of the chronically infected individuals do not achieve sustained clearance of hepatitis C virus (HCV during treatment with IFN-α alone. The virus can impair IFN-α signaling and cellular factors that have an effect on the viral life cycles. We found that the protein PCBP2 is down-regulated in HCV-replicon containing cells (R1b. However, the effects and mechanisms of PCBP2 on HCV are unclear. To determine the effect of PCBP2 on HCV, overexpression and knockdown of PCBP2 were performed in R1b cells. Interestingly, we found that PCBP2 can facilitate the antiviral activity of IFN-α against HCV, although the RNA level of HCV was unaffected by either the overexpression or absence of PCBP2 in R1b cells. RIP-qRT-PCR and RNA half-life further revealed that PCBP2 stabilizes the mRNA of STAT1 and STAT2 through binding the 3'Untranslated Region (UTR of these two molecules, which are pivotal for the IFN-α anti-HCV effect. RNA pull-down assay confirmed that there were binding sites located in the C-rich tracts in the 3'UTR of their mRNAs. Stabilization of mRNA by PCBP2 leads to the increased protein expression of STAT1 and STAT2 and a consistent increase of phosphorylated STAT1 and STAT2. These effects, in turn, enhance the antiviral effect of IFN-α. These findings indicate that PCBP2 may play an important role in the IFNresponse against HCV and may benefit the HCV clinical therapy.

  1. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  2. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  3. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  4. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  5. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  6. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  7. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  8. Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity

    Science.gov (United States)

    Schoggins, John W.; MacDuff, Donna A.; Imanaka, Naoko; Gainey, Maria D.; Shrestha, Bimmi; Eitson, Jennifer L.; Mar, Katrina B.; Richardson, R. Blake; Ratushny, Alexander V.; Litvak, Vladimir; Dabelic, Rea; Manicassamy, Balaji; Aitchison, John D.; Aderem, Alan; Elliott, Richard M.; García-Sastre, Adolfo; Racaniello, Vincent; Snijder, Eric J.; Yokoyama, Wayne M.; Diamond, Michael S.; Virgin, Herbert W.; Rice, Charles M.

    2014-01-01

    The type I interferon (IFN) response protects cells from viral infection by inducing hundreds of interferon-stimulated genes (ISGs), some of which encode direct antiviral effectors. Recent screening studies have begun to catalogue ISGs with antiviral activity against several RNA and DNA viruses. However, antiviral ISG specificity across multiple distinct classes of viruses remains largely unexplored. Here we used an ectopic expression assay to screen a library of more than 350 human ISGs for effects on 14 viruses representing 7 families and 11 genera. We show that 47 genes inhibit one or more viruses, and 25 genes enhance virus infectivity. Comparative analysis reveals that the screened ISGs target positive-sense single-stranded RNA viruses more effectively than negative-sense single-stranded RNA viruses. Gene clustering highlights the cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS, also known as MB21D1) as a gene whose expression also broadly inhibits several RNA viruses. In vitro, lentiviral delivery of enzymatically active cGAS triggers a STING-dependent, IRF3-mediated antiviral program that functions independently of canonical IFN/STAT1 signalling. In vivo, genetic ablation of murine cGAS reveals its requirement in the antiviral response to two DNA viruses, and an unappreciated contribution to the innate control of an RNA virus. These studies uncover new paradigms for the preferential specificity of IFN-mediated antiviral pathways spanning several virus families.

  9. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  10. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  11. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  12. TPL-2-ERK1/2 signaling promotes host resistance against intracellular bacterial infection by negative regulation of type I IFN production.

    Science.gov (United States)

    McNab, Finlay W; Ewbank, John; Rajsbaum, Ricardo; Stavropoulos, Evangelos; Martirosyan, Anna; Redford, Paul S; Wu, Xuemei; Graham, Christine M; Saraiva, Margarida; Tsichlis, Philip; Chaussabel, Damien; Ley, Steven C; O'Garra, Anne

    2013-08-15

    Tuberculosis, caused by Mycobacterium tuberculosis, remains a leading cause of mortality and morbidity worldwide, causing ≈ 1.4 million deaths per year. Key immune components for host protection during tuberculosis include the cytokines IL-12, IL-1, and TNF-α, as well as IFN-γ and CD4(+) Th1 cells. However, immune factors determining whether individuals control infection or progress to active tuberculosis are incompletely understood. Excess amounts of type I IFN have been linked to exacerbated disease during tuberculosis in mouse models and to active disease in patients, suggesting tight regulation of this family of cytokines is critical to host resistance. In addition, the immunosuppressive cytokine IL-10 is known to inhibit the immune response to M. tuberculosis in murine models through the negative regulation of key proinflammatory cytokines and the subsequent Th1 response. We show in this study, using a combination of transcriptomic analysis, genetics, and pharmacological inhibitors, that the TPL-2-ERK1/2 signaling pathway is important in mediating host resistance to tuberculosis through negative regulation of type I IFN production. The TPL-2-ERK1/2 signaling pathway regulated production by macrophages of several cytokines important in the immune response to M. tuberculosis as well as regulating induction of a large number of additional genes, many in a type I IFN-dependent manner. In the absence of TPL-2 in vivo, excess type I IFN promoted IL-10 production and exacerbated disease. These findings describe an important regulatory mechanism for controlling tuberculosis and reveal mechanisms by which type I IFN may promote susceptibility to this important disease.

  13. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  14. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  15. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  16. A paradox of transcriptional and functional innate interferon responses of human intestinal enteroids to enteric virus infection

    Science.gov (United States)

    Saxena, Kapil; Simon, Lukas M.; Zeng, Xi-Lei; Blutt, Sarah E.; Crawford, Sue E.; Sastri, Narayan P.; Karandikar, Umesh C.; Ajami, Nadim J.; Zachos, Nicholas C.; Kovbasnjuk, Olga; Donowitz, Mark; Conner, Margaret E.; Shaw, Chad A.; Estes, Mary K.

    2017-01-01

    The intestinal epithelium can limit enteric pathogens by producing antiviral cytokines, such as IFNs. Type I IFN (IFN-α/β) and type III IFN (IFN-λ) function at the epithelial level, and their respective efficacies depend on the specific pathogen and site of infection. However, the roles of type I and type III IFN in restricting human enteric viruses are poorly characterized as a result of the difficulties in cultivating these viruses in vitro and directly obtaining control and infected small intestinal human tissue. We infected nontransformed human intestinal enteroid cultures from multiple individuals with human rotavirus (HRV) and assessed the host epithelial response by using RNA-sequencing and functional assays. The dominant transcriptional pathway induced by HRV infection is a type III IFN-regulated response. Early after HRV infection, low levels of type III IFN protein activate IFN-stimulated genes. However, this endogenous response does not restrict HRV replication because replication-competent HRV antagonizes the type III IFN response at pre- and posttranscriptional levels. In contrast, exogenous IFN treatment restricts HRV replication, with type I IFN being more potent than type III IFN, suggesting that extraepithelial sources of type I IFN may be the critical IFN for limiting enteric virus replication in the human intestine. PMID:28069942

  17. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  18. The STAT4 SLE risk allele rs7574865[T] is associated with increased IL-12-induced IFN-γ production in T cells from patients with SLE.

    Science.gov (United States)

    Hagberg, Niklas; Joelsson, Martin; Leonard, Dag; Reid, Sarah; Eloranta, Maija-Leena; Mo, John; Nilsson, Magnus K; Syvänen, Ann-Christine; Bryceson, Yenan T; Rönnblom, Lars

    2018-02-23

    Genetic variants in the transcription factor STAT4 are associated with increased susceptibility to systemic lupus erythematosus (SLE) and a more severe disease phenotype. This study aimed to clarify how the SLE-associated intronic STAT4 risk allele rs7574865[T] affects the function of immune cells in SLE. Peripheral blood mononuclear cells (PBMCs) were isolated from 52 genotyped patients with SLE. Phosphorylation of STAT4 (pSTAT4) and STAT1 (pSTAT1) in response to interferon (IFN)-α, IFN-γ or interleukin (IL)-12, total levels of STAT4, STAT1 and T-bet, and frequency of IFN-γ + cells on IL-12 stimulation were determined by flow cytometry in subsets of immune cells before and after preactivation of cells with phytohaemagglutinin (PHA) and IL-2. Cellular responses and phenotypes were correlated to STAT4 risk allele carriership. Janus kinase inhibitors (JAKi) selective for TYK2 (TYK2i) or JAK2 (JAK2i) were evaluated for inhibition of IL-12 or IFN-γ-induced activation of SLE PBMCs. In resting PBMCs, the STAT4 risk allele was neither associated with total levels of STAT4 or STAT1, nor cytokine-induced pSTAT4 or pSTAT1. Following PHA/IL-2 activation, CD8 + T cells from STAT4 risk allele carriers displayed increased levels of STAT4 resulting in increased pSTAT4 in response to IL-12 and IFN-α, and an augmented IL-12-induced IFN-γ production in CD8 + and CD4 + T cells. The TYK2i and the JAK2i efficiently blocked IL-12 and IFN-γ-induced activation of PBMCs from STAT4 risk patients, respectively. T cells from patients with SLE carrying the STAT4 risk allele rs7574865[T] display an augmented response to IL-12 and IFN-α. This subset of patients may benefit from JAKi treatment. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  19. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  1. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  2. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  3. IFN-beta inhibits T cell activation capacity of central nervous system APCs

    DEFF Research Database (Denmark)

    Teige, Ingrid; Liu, Yawei; Issazadeh-Navikas, Shohreh

    2006-01-01

    We have previously investigated the physiological effects of IFN-beta on chronic CNS inflammation and shown that IFN-beta(-/-) mice develop a more severe experimental autoimmune encephalomyelitis than their IFN-beta(+/-) littermates. This result was shown to be associated with a higher activation...... state of the glial cells and a higher T cell cytokine production in the CNS. Because this state suggested a down-regulatory effect of IFN-beta on CNS-specific APCs, these results were investigated further. We report that IFN-beta pretreatment of astrocytes and microglia (glial cells) indeed down......-modulate their capacity to activate autoreactive Th1 cells. First, we investigated the intrinsic ability of glial cells as APCs and report that glial cells prevent autoreactive Th1 cells expansion while maintaining Ag-specific T cell effector functions. However, when the glial cells are treated with IFN-beta before...

  4. Endogenous IFN-β signaling exerts anti-inflammatory actions in experimentally induced focal cerebral ischemia

    DEFF Research Database (Denmark)

    Inácio, Ana R; Liu, Yawei; Clausen, Bettina H

    2015-01-01

    of infiltrating leukocytes in the brain 2 days after stroke. Concomitantly, in the blood of IFN-βKO mice, we found a higher percentage of total B cells but a similar percentage of mature and activated B cells, collectively indicating a higher proliferation rate. The additional differential regulation......BACKGROUND: Interferon (IFN)-β exerts anti-inflammatory effects, coupled to remarkable neurological improvements in multiple sclerosis, a neuroinflammatory condition of the central nervous system. Analogously, it has been hypothesized that IFN-β, by limiting inflammation, decreases neuronal death...... strength tests, and cerebral infarct volumes were given by lack of neuronal nuclei immunoreactivity. RESULTS: Here, we report alterations in local and systemic inflammation in IFN-β knockout (IFN-βKO) mice over 8 days after induction of focal cerebral ischemia. Notably, IFN-βKO mice showed a higher number...

  5. Control of HIV infection by IFN-α: implications for latency and a cure.

    Science.gov (United States)

    Bourke, Nollaig M; Napoletano, Silvia; Bannan, Ciaran; Ahmed, Suaad; Bergin, Colm; McKnight, Áine; Stevenson, Nigel J

    2018-03-01

    Viral infections, including HIV, trigger the production of type I interferons (IFNs), which in turn, activate a signalling cascade that ultimately culminates with the expression of anti-viral proteins. Mounting evidence suggests that type I IFNs, in particular IFN-α, play a pivotal role in limiting acute HIV infection. Highly active anti-retroviral treatment reduces viral load and increases life expectancy in HIV positive patients; however, it fails to fully eliminate latent HIV reservoirs. To revisit HIV as a curable disease, this article reviews a body of literature that highlights type I IFNs as mediators in the control of HIV infection, with particular focus on the anti-HIV restriction factors induced and/or activated by IFN-α. In addition, we discuss the relevance of type I IFN treatment in the context of HIV latency reversal, novel therapeutic intervention strategies and the potential for full HIV clearance.

  6. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  7. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  8. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  9. IL-27 Induced by Select Candida spp. via TLR7/NOD2 Signaling and IFN-β Production Inhibits Fungal Clearance

    Science.gov (United States)

    Patin, Emmanuel C.; Jones, Adam V.; Thompson, Aiysha; Clement, Mathew; Liao, Chia-Te; Griffiths, James S.; Wallace, Leah E.; Bryant, Clare E.; Lang, Roland; Rosenstiel, Philip; Humphreys, Ian R.; Taylor, Philip R.

    2016-01-01

    Candida spp. elicit cytokine production downstream of various pathogen recognition receptors, including C-type lectin-like receptors, TLRs, and nucleotide oligomerization domain (NOD)–like receptors. IL-12 family members IL-12p70 and IL-23 are important for host immunity against Candida spp. In this article, we show that IL-27, another IL-12 family member, is produced by myeloid cells in response to selected Candida spp. We demonstrate a novel mechanism for Candida parapsilosis–mediated induction of IL-27 in a TLR7-, MyD88-, and NOD2-dependent manner. Our data revealed that IFN-β is induced by C. parapsilosis, which in turn signals through the IFN-α/β receptor and STAT1/2 to induce IL-27. Moreover, IL-27R (WSX-1)–deficient mice systemically infected with C. parapsilosis displayed enhanced pathogen clearance compared with wild-type mice. This was associated with increased levels of proinflammatory cytokines in the serum and increased IFN-γ and IL-17 responses in the spleens of IL-27R–deficient mice. Thus, our data define a novel link between C. parapsilosis, TLR7, NOD2, IFN-β, and IL-27, and we have identified an important role for IL-27 in the immune response against C. parapsilosis. Overall, these findings demonstrate an important mechanism for the suppression of protective immune responses during infection with C. parapsilosis, which has potential relevance for infections with other fungal pathogens. PMID:27259855

  10. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  11. HPV18 Persistence Impairs Basal and DNA Ligand-Mediated IFN-β and IFN-λ1 Production through Transcriptional Repression of Multiple Downstream Effectors of Pattern Recognition Receptor Signaling.

    Science.gov (United States)

    Albertini, Silvia; Lo Cigno, Irene; Calati, Federica; De Andrea, Marco; Borgogna, Cinzia; Dell'Oste, Valentina; Landolfo, Santo; Gariglio, Marisa

    2018-03-15

    Although it is clear that high-risk human papillomaviruses (HPVs) can selectively infect keratinocytes and persist in the host, it still remains to be unequivocally determined whether they can escape antiviral innate immunity by interfering with pattern recognition receptor (PRR) signaling. In this study, we have assessed the innate immune response in monolayer and organotypic raft cultures of NIKS cells harboring multiple copies of episomal HPV18 (NIKSmcHPV18), which fully recapitulates the persistent state of infection. We show for the first time, to our knowledge, that NIKSmcHPV18, as well as HeLa cells (a cervical carcinoma-derived cell line harboring integrated HPV18 DNA), display marked downregulation of several PRRs, as well as other PRR downstream effectors, such as the adaptor protein stimulator of IFN genes and the transcription factors IRF1 and 7. Importantly, we provide evidence that downregulation of stimulator of IFN genes, cyclic GMP-AMP synthase, and retinoic acid-inducible gene I mRNA levels occurs at the transcriptional level through a novel epigenetic silencing mechanism, as documented by the accumulation of repressive heterochromatin markers seen at the promoter region of these genes. Furthermore, stimulation of NIKSmcHPV18 cells with salmon sperm DNA or poly(deoxyadenylic-deoxythymidylic) acid, two potent inducers of PRR signaling, only partially restored PRR protein expression. Accordingly, the production of IFN-β and IFN-λ 1 was significantly reduced in comparison with the parental NIKS cells, indicating that HPV18 exerts its immunosuppressive activity through downregulation of PRR signaling. Altogether, our findings indicate that high-risk human papillomaviruses have evolved broad-spectrum mechanisms that allow simultaneous depletion of multiple effectors of the innate immunity network, thereby creating an unreactive cellular milieu suitable for viral persistence. Copyright © 2018 by The American Association of Immunologists, Inc.

  12. PAI-1 and IFN-γ in the regulation of innate immune homeostasis during sublethal yersiniosis.

    Science.gov (United States)

    Wang, Zheng; Zhao, Qi; Han, Yuxia; Zhang, Dongxia; Zhang, Liangyan; Luo, Deyan

    2013-03-01

    Plasminogen activator inhibitor type 1 (PAI-l), a key part of the fibrinolytic system, plays a critical host protective role during the acute phase of infection by regulating interferon(IFN)-γ release. IFN-γ regulates PAI-1 expression, which suggests an intricate interplay between PAI-1 and IFN-γ. Here, using the notion of a feedback loop, we report the complicated regulatory relationship between PAI-1 and IFN-γ. Mice were inoculated intravenously with 1×10(3) colony forming units of Yersinia enterocolitica; PAI-1 deficiency enhanced lethality (pimmune homeostasis. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. IFN-induced modulation of histocompatibility antigens on human cells. Background, mechanisms and perspectives

    DEFF Research Database (Denmark)

    Hokland, M; Basse, P; Justesen, J

    1989-01-01

    IFN proteins are a family of lymphokines with anti-viral effects. Several other effects of IFNs have also been described, including enhancement of natural killer (NK) cell activity, enhancement of cytotoxic T-lymphocyte activity, and enhancement of the expression of major histocompatibility compl...... to the classical anti-viral mechanism. This concept proposes that the MHC-enhancing effect of IFNs is a vital part of the immunological defense against virus infections and an integral part of the anti-viral effects of IFN proteins. Udgivelsesdato: 1988-Nov...

  14. Influenza A virus inhibits type I IFN signaling via NF-kappaB-dependent induction of SOCS-3 expression.

    Directory of Open Access Journals (Sweden)

    Eva-K Pauli

    2008-11-01

    Full Text Available The type I interferon (IFN system is a first line of defense against viral infections. Viruses have developed various mechanisms to counteract this response. So far, the interferon antagonistic activity of influenza A viruses was mainly observed on the level of IFNbeta gene induction via action of the viral non-structural protein 1 (NS1. Here we present data indicating that influenza A viruses not only suppress IFNbeta gene induction but also inhibit type I IFN signaling through a mechanism involving induction of the suppressor of cytokine signaling-3 (SOCS-3 protein. Our study was based on the observation that in cells that were infected with influenza A virus and subsequently stimulated with IFNalpha/beta, phosphorylation of the signal transducer and activator of transcription protein 1 (STAT1 was strongly reduced. This impaired STAT1 activation was not due to the action of viral proteins but rather appeared to be induced by accumulation of viral 5' triphosphate RNA in the cell. SOCS proteins are potent endogenous inhibitors of Janus kinase (JAK/STAT signaling. Closer examination revealed that SOCS-3 but not SOCS-1 mRNA levels increase in an RNA- and nuclear factor kappa B (NF-kappaB-dependent but type I IFN-independent manner early in the viral replication cycle. This direct viral induction of SOCS-3 mRNA and protein expression appears to be relevant for suppression of the antiviral response since in SOCS-3 deficient cells a sustained phosphorylation of STAT1 correlated with elevated expression of type I IFN-dependent genes. As a consequence, progeny virus titers were reduced in SOCS-3 deficient cells or in cells were SOCS-3 expression was knocked-down by siRNA. These data provide the first evidence that influenza A viruses suppress type I IFN signaling on the level of JAK/STAT activation. The inhibitory effect is at least in part due to the induction of SOCS-3 gene expression, which results in an impaired antiviral response.

  15. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  16. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  17. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. HTLV-1 Tax protein recruitment into IKKε and TBK1 kinase complexes enhances IFN-I expression.

    Science.gov (United States)

    Diani, Erica; Avesani, Francesca; Bergamo, Elisa; Cremonese, Giorgia; Bertazzoni, Umberto; Romanelli, Maria Grazia

    2015-02-01

    The Tax protein expressed by human T-cell leukemia virus type 1 (HTLV-1) plays a pivotal role in the deregulation of cellular pathways involved in the immune response, inflammation, cell survival, and cancer. Many of these effects derive from Tax multiple interactions with host factors, including the subunits of the IKK-complex that are required for NF-κB activation. IKKɛ and TBK1 are two IKK-related kinases that allow the phosphorylation of interferon regulatory factors that trigger IFN type I gene expression. We observed that IKKɛ and TBK1 recruit Tax into cellular immunocomplexes. We also found that TRAF3, which regulates cell receptor signaling effectors, forms complexes with Tax. Transactivation analyses revealed that expression of Tax, in presence of IKKɛ and TBK1, enhances IFN-β promoter activity, whereas the activation of NF-κB promoter is not modified. We propose that Tax may be recruited into the TBK1/IKKɛ complexes as a scaffolding-adaptor protein that enhances IFN-I gene expression. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Mendelian susceptibility to mycobacterial disease: genetic, immunological, and clinical features of inborn errors of IFN-γ immunity

    Science.gov (United States)

    Bustamante, Jacinta; Boisson-Dupuis, Stéphanie; Abel, Laurent; Casanova, Jean-Laurent

    2014-01-01

    Mendelian susceptibility to mycobacterial disease (MSMD) is a rare condition characterized by predisposition to clinical disease caused by weakly virulent mycobacteria, such as BCG vaccines and environmental mycobacteria, in otherwise healthy individuals with no overt abnormalities in routine hematological and immunological tests. MSMD designation does not recapitulate all the clinical features, as patients are also prone to salmonellosis, candidiasis and tuberculosis, and more rarely to infections with other intramacrophagic bacteria, fungi, or parasites, and even, perhaps, a few viruses. Since 1996, nine MSMD-causing genes, including seven autosomal (IFNGR1, IFNGR2, STAT1, IL12B, IL12RB1, ISG15, and IRF8) and two X-linked (NEMO, CYBB) genes have been discovered. The high level of allelic heterogeneity has already led to the definition of 18 different disorders. The nine gene products are physiologically related, as all are involved in IFN-γ-dependent immunity. These disorders impair the production of (IL12B, IL12RB1, IRF8, ISG15, NEMO) or the response to (IFNGR1, IFNGR2, STAT1, IRF8, CYBB) IFN-γ. These defects account for only about half the known MSMD cases. Patients with MSMD-causing genetic defects may display other infectious diseases, or even remain asymptomatic. Most of these inborn errors do not show complete clinical penetrance for the case-definition phenotype of MSMD. We review here the genetic, immunological, and clinical features of patients with inborn errors of IFN-γ-dependent immunity. PMID:25453225

  20. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  1. Putative endogenous filovirus VP35-like protein potentially functions as an IFN antagonist but not a polymerase cofactor.

    Directory of Open Access Journals (Sweden)

    Tatsunari Kondoh

    Full Text Available It has been proposed that some non-retroviral RNA virus genes are integrated into vertebrate genomes. Endogenous filovirus-like elements (EFLs have been discovered in some mammalian genomes. However, their potential roles in ebolavirus infection are unclear. A filovirus VP35-like element (mlEFL35 is found in the little brown bat (Myotis lucifugus genome. Putative mlEFL35-derived protein (mlEFL35p contains nearly full-length amino acid sequences corresponding to ebolavirus VP35. Ebola virus VP35 has been shown to bind double-stranded RNA, leading to inhibition of type I interferon (IFN production, and is also known as a viral polymerase cofactor that is essential for viral RNA transcription/replication. In this study, we transiently expressed mlEFL35p in human kidney cells and investigated its biological functions. We first found that mlEFL35p was coimmunoprecipitated with itself and ebolavirus VP35s but not with the viral nucleoprotein. Then the biological functions of mlEFL35p were analyzed by comparing it to ebolavirus VP35s. We found that the expression of mlEFL35p significantly inhibited human IFN-β promoter activity as well as VP35s. By contrast, expression of mlEFL35p did not support viral RNA transcription/replication and indeed slightly decrease the reporter gene expression in a minigenome assay. These results suggest that mlEFL35p potentially acts as an IFN antagonist but not a polymerase cofactor.

  2. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  4. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  5. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  6. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  7. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  8. IFN-γ-producing Th1-like regulatory T cells may limit acute cellular renal allograft rejection: Paradoxical post-transplantation effects of IFN-γ.

    Science.gov (United States)

    Xu, Xiaoguang; Huang, Haiyan; Wang, Qiang; Cai, Ming; Qian, Yeyong; Han, Yong; Wang, Xinying; Gao, Yu; Yuan, Ming; Xu, Liang; Yao, Chen; Xiao, Li; Shi, Bingyi

    2017-02-01

    IFN-γ is a protypical proinflammatory cytokine that plays a central role in inflammation and acute graft rejection. Accumulating evidence indicates that IFN-γ can exert previously unexpected immunoregulatory activities. However, little is known about the role of IFN-γ secreted by Th1-like regulatory T cells in human kidney transplantation. To determine the function of IFN-γ in acute T cell-mediated renal allograft rejection (ACR), we examined serum cytokine expression profiles in ACR patients by human cytokine multiplex immunoassay and analyzed the cellular origins of IFN-γ in peripheral blood and renal allograft biopsies from ACR cases and controls by flow cytometry and immunohistochemistry, respectively. The results showed significant reduction in serum concentrations of Th1-inducing cytokines IL-12p70 and IFN-γ as well as Th2-related cytokine IL-4 in ACR patients compared with stable controls. However, levels of several Th1-, Th2- and Th17-related cytokines, such as IL-2, TNF-α, TNF-β, IL-12 (p40), IL-10, IL-15, IL-17, IL-21, and IL-23, as well as the frequencies of Th1 and Th17 cell, did not differ between ACR cases and stable controls. Moreover, we found the levels of IFN-γ were correlated with those of the anti-inflammatory factor, IL-1 receptor antagonist (IL-1Ra) in ACR. Notably, the Th1-like Treg cell-to-Foxp3 - Th1 cell ratio was significantly lower in ACR patients compared with that in stable controls. In graft biopsies from ACR patients, Treg cells and Th1-like Treg cells were less abundant than those without ACR. Our study indicates that IFN-γ secreted from Th1-like Treg cells negatively modulates ACR. Copyright © 2016 Elsevier GmbH. All rights reserved.

  9. Biodistribution analysis of 125I-albumin-IFN-alpha2b fusion protein in rats

    International Nuclear Information System (INIS)

    Zhou Yaoyuan; Zhang Rongjun; Cai Gangming; Gu Xiaobo; Jiang Mengjun; Zhang Bo; Yang Min; Cao Guoxian; Yang Jianliang

    2009-01-01

    125 I-albumin-IFN-alpha2b was prepared with the methods of Ch-T and purified with PD-10 column. The radiochemical purity was measured with TCA (trichloroacetic acid) precipitation. The antiviral activities of 125 I-albumin-IFN-alpha2b and albumin-IFN-alpha2b were compared with WISH/VSV system in vitro. SD rats were injected with 125 I-albumin-IFN-alpha2b subcutaneously and sacrificed at 0.5, 2, 6, 24, 48, 90, 180 and 300 h post-injection. Selected organs were dissected, weighed and their radioactivity was measured using γ-counter. The accumulated radioactivity in the tissues was calculated in terms of percentage of injected dose per gram organ (%ID·g -1 ). The labeling yield was 82.72%. The radiochemical purity of 125 I-albumin-IFN-alpha2b was 95.53%, and its radioactivity was 0.26 MBq/μg. The antiviral bioactivities of albumin-IFN-alpha2b and 125 I-albumin- IFN-alpha2b did not change. Biodistribution analysis of 125 I-albumin-IFN-alpha2b in rats showed that concentrated 125 I-albumin-IFN-alpha2b in blood reached maximum at 6 h post injection, and eliminated slowly. No specific accumulation was seen in other tissues. 125 I-albumin-IFN-alpha2b could maintain in peripheral blood for a long time and it meant albumin-IFN-alpha2b would be an effective long-term interferon. (authors)

  10. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  11. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  12. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  13. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  14. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  15. Two Modes of the Axonal Interferon Response Limit Alphaherpesvirus Neuroinvasion

    Directory of Open Access Journals (Sweden)

    Ren Song

    2016-02-01

    Full Text Available Infection by alphaherpesviruses, including herpes simplex virus (HSV and pseudorabies virus (PRV, typically begins at epithelial surfaces and continues into the peripheral nervous system (PNS. Inflammatory responses are induced at the infected peripheral site prior to invasion of the PNS. When the peripheral tissue is first infected, only the innervating axons are exposed to this inflammatory milieu, which includes the interferons (IFNs. The fundamental question is how do PNS cell bodies respond to these distant, potentially damaging events experienced by axons. Using compartmented cultures that physically separate neuron axons from cell bodies, we found that pretreating isolated axons with beta interferon (IFN-β or gamma interferon (IFN-γ significantly diminished the number of herpes simplex virus 1 (HSV-1 and PRV particles moving in axons toward the cell bodies in a receptor-dependent manner. Exposing axons to IFN-β induced STAT1 phosphorylation (p-STAT1 only in axons, while exposure of axons to IFN-γ induced p-STAT1 accumulation in distant cell body nuclei. Blocking transcription in cell bodies eliminated antiviral effects induced by IFN-γ, but not those induced by IFN-β. Proteomic analysis of IFN-β- or IFN-γ-treated axons identified several differentially regulated proteins. Therefore, unlike treatment with IFN-γ, IFN-β induces a noncanonical, local antiviral response in axons. The activation of a local IFN response in axons represents a new paradigm for cytokine control of neuroinvasion.

  16. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  17. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  18. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  19. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  20. Highly pathogenic avian influenza virus H5N1 controls type I IFN induction in chicken macrophage HD-11 cells: a polygenic trait that involves NS1 and the polymerase complex

    Science.gov (United States)

    2012-01-01

    Background Influenza A viruses are well characterized to antagonize type I IFN induction in infected mammalian cells. However, limited information is available for avian cells. It was hypothesised that avian influenza viruses (AIV) with distinct virulence may interact differently with the avian innate immune system. Therefore, the type I IFN responses induced by highly virulent and low virulent H5N1 AIV and reassortants thereof were analysed in chicken cells. Results The highly pathogenic (HP) AIV A/chicken/Yamaguchi/7/04 (H5N1) (Yama) did not induce type I IFN in infected chicken HD-11 macrophage-like cells. This contrasted with an NS1 mutant Yama virus (Yama-NS1A144V) and with the attenuated H5N1 AIV A/duck/Hokkaido/Vac-1/04 (Vac) carrying the haemagglutinin (HA) of the Yama virus (Vac-Yama/HA), that both induced type I IFN in these cells. The substitution of the NS segment from Yama with that from Vac in the Yama backbone resulted in induction of type I IFN secretion in HD-11 cells. However, vice versa, the Yama NS segment did not prevent type I IFN induction by the Vac-Yama/HA virus. This was different with the PB1/PB2/PA segment reassortant Yama and Vac-Yama/HA viruses. Whereas the Yama virus with the Vac PB1/PB2/PA segments induced type I IFN in HD-11 cells, the Vac-Yama/HA virus with the Yama PB1/PB2/PA segments did not. As reported for mammalian cells, the expression of H5N1 PB2 inhibited the activation of the IFN-β promoter in chicken DF-1 fibroblast cells. Importantly, the Yama PB2 was more potent at inhibiting the IFN-β promoter than the Vac PB2. Conclusions The present study demonstrates that the NS1 protein and the polymerase complex of the HPAIV Yama act in concert to antagonize chicken type I IFN secretion in HD-11 cells. PB2 alone can also exert a partial inhibitory effect on type I IFN induction. In conclusion, the control of type I IFN induction by H5N1 HPAIV represents a complex phenotype that involves a particular viral gene constellation

  1. Pharmacogenomics of IFN-beta in multiple sclerosis: towards a personalized medicine approach

    NARCIS (Netherlands)

    Vosslamber, Saskia; van Baarsen, Lisa G. M.; Verweij, Cornelis L.

    2009-01-01

    Multiple sclerosis (MS) is an inflammatory disease of the CNS. The clinical presentation of MS is heterogeneous. Interferons (IFNs) were the first agents to show clinical efficacy in the treatment of MS and prolonged treatment is still the best available therapy. Although IFN treatment ameliorates

  2. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  3. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  4. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  5. Cyclic GMP-AMP Synthase Is the Cytosolic Sensor of Plasmodium falciparum Genomic DNA and Activates Type I IFN in Malaria.

    Science.gov (United States)

    Gallego-Marin, Carolina; Schrum, Jacob E; Andrade, Warrison A; Shaffer, Scott A; Giraldo, Lina F; Lasso, Alvaro M; Kurt-Jones, Evelyn A; Fitzgerald, Katherine A; Golenbock, Douglas T

    2018-01-15

    Innate immune receptors have a key role in the sensing of malaria and initiating immune responses. As a consequence of infection, systemic inflammation emerges and is directly related to signs and symptoms during acute disease. We have previously reported that plasmodial DNA is the primary driver of systemic inflammation in malaria, both within the phagolysosome and in the cytosol of effector cells. In this article, we demonstrate that Plasmodium falciparum genomic DNA delivered to the cytosol of human monocytes binds and activates cyclic GMP-AMP synthase (cGAS). Activated cGAS synthesizes 2'3'-cGAMP, which we subsequently can detect using liquid chromatography-tandem mass spectrometry. 2'3'-cGAMP acts as a second messenger for STING activation and triggers TBK1/IRF3 activation, resulting in type I IFN production in human cells. This induction of type I IFN was independent of IFI16. Access of DNA to the cytosolic compartment is mediated by hemozoin, because incubation of purified malaria pigment with DNase abrogated IFN-β induction. Collectively, these observations implicate cGAS as an important cytosolic sensor of P. falciparum genomic DNA and reveal the role of the cGAS/STING pathway in the induction of type I IFN in response to malaria parasites. Copyright © 2018 by The American Association of Immunologists, Inc.

  6. Active Components with Inhibitory Activities on IFN-γ/STAT1 and IL-6/STAT3 Signaling Pathways from Caulis Trachelospermi

    Directory of Open Access Journals (Sweden)

    Xiao-Ting Liu

    2014-08-01

    Full Text Available Initial investigation for new active herbal extract with inhibiting activity on JAK/STAT signaling pathway revealed that the extract of Caulis Trachelospermi, which was separated by 80% alcohol extraction and subsequent HP-20 macroporous resin column chromatography, was founded to strongly inhibit IFN-γ-induced STAT1-responsive luciferase activity (IFN-γ/STAT1 with IC50 value of 2.43 μg/mL as well as inhibiting IL-6-induced STAT3-responsive luciferase activity (IL-6/STAT3 with IC50 value of 1.38 μg/mL. Subsequent study on its active components led to the isolation and identification of two new dibenzylbutyrolactone lignans named 4-demethyltraxillaside (1 and nortrachelogenin 4-O-β-d-glucopyranoside (2, together with six known compounds. The lignan compounds 1–4 together with other lignan compounds isolated in previous study were tested the activities on IFN-γ/STAT1 and IL-6/STAT3 pathways. The following result showed that the main components trachelogenin and arctigenin had corresponding activities on IFN-γ/STAT1 pathway with IC50 values of 3.14 μM and 9.46 μM as well as trachelogenin, arctigenin and matairesinol strongly inhibiting IL-6/STAT3 pathway with IC50 values of 3.63 μM, 6.47 μM and 2.92 μM, respectively.

  7. The Absent in Melanoma 2-Like Receptor IFN-Inducible Protein 16 as an Inflammasome Regulator in Systemic Lupus Erythematosus: The Dark Side of Sensing Microbes

    Directory of Open Access Journals (Sweden)

    Valeria Caneparo

    2018-05-01

    Full Text Available Absent in melanoma 2 (AIM2-like receptors (ALRs are a newly characterized class of pathogen recognition receptors (PRRs involved in cytosolic and nuclear pathogen DNA recognition. In recent years, two ALR family members, the interferon (IFN-inducible protein 16 (IFI16 and AIM2, have been linked to the pathogenesis of various autoimmune diseases, among which systemic lupus erythematosus (SLE has recently gained increasing attention. SLE patients are indeed often characterized by constitutively high serum IFN levels and increased expression of IFN-stimulated genes due to an abnormal response to pathogens and/or incorrect self-DNA recognition process. Consistently, we and others have shown that IFI16 is overexpressed in a wide range of autoimmune diseases where it triggers production of specific autoantibodies. In addition, evidence from mouse models supports a model whereby ALRs are required for IFN-mediated host response to both exogenous and endogenous DNA. Following interaction with cytoplasmic or nuclear nucleic acids, ALRs can form a functional inflammasome through association with the adaptor ASC [apoptosis-associated speck-like protein containing a caspase recruitment domain (CARD] and with procaspase-1. Importantly, inflammasome-mediated upregulation of IL-1β and IL-18 production positively correlates with SLE disease severity. Therefore, targeting ALR sensors and their downstream pathways represents a promising alternative therapeutic approach for SLE and other systemic autoimmune diseases.

  8. The cost of successful antiviral therapy in hepatitis C patients: a comparison of IFN-free versus IFN-based regimens at an individual patient level in Australia

    Directory of Open Access Journals (Sweden)

    Lee AS

    2017-10-01

    Full Text Available Allister Sebastian Lee,1 Mieke L van Driel,2 Darrell HG Crawford3,4 1Faculty of Medicine, 2Primary Care Clinical Unit, Faculty of Medicine, 3School of Clinical Medicine, Faculty of Medicine, University of Queensland, 4Gallipoli Medical Research Foundation, Greenslopes Private Hospital, Brisbane, Australia Background: Chronic hepatitis C remains a major global health burden with serious long-term consequences if left untreated. Recently the treatment standard of care has shifted to new interferon (IFN-free drug regimens, which have been shown to be safe and effective. The aim of our study was to assess and compare medical resource utilization and costs of successfully treating patients with IFN-based and IFN-free therapies in Australia. Methods: We performed a retrospective chart review of 30 HCV-infected patients successfully treated with IFN-based therapy between 2013 and 2015. We also generated a model for a virtual group of 100 genotype 1 (GT1 and 100 genotype 3 (GT3 patients treated with IFN-free therapy derived from national guidelines and clinical trial data. Results: In comparison to virtual patients receiving IFN-free therapy, our IFN-treated patients on average had distinctively more liver clinic visits and blood tests. However, mean total cost per patient was $19,164 and $85,300 (AUD more for GT1 and GT3 patients receiving IFN-free therapy, respectively. This difference was largely accounted for by higher antiviral drug costs. Of our 30 patients treated with IFN, total mean cost per patient during the study period was $33,595. Conclusion: Resource utilization is lower with IFN-free treatment, which reflects the reduced need for patient monitoring and improved side-effect profile of these new drugs. However, total costs are still largely dominated by antiviral drug costs, representing a huge burden on national budgets. Our insight into resource utilization and costs associated with both types of treatment can serve as a reference for

  9. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  10. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  11. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  12. Interferon-gamma (IFN-γ-mediated retinal ganglion cell death in human tyrosinase T cell receptor transgenic mouse.

    Directory of Open Access Journals (Sweden)

    Shahid Husain

    Full Text Available We have recently demonstrated the characterization of human tyrosinase TCR bearing h3T-A2 transgenic mouse model, which exhibits spontaneous autoimmune vitiligo and retinal dysfunction. The purpose of current study was to determine the role of T cells and IFN-γ in retina dysfunction and retinal ganglion cell (RGC death using this model. RGC function was measured by pattern electroretinograms (ERGs in response to contrast reversal of patterned visual stimuli. RGCs were visualized by fluorogold retrograde-labeling. Expression of CD3, IFN-γ, GFAP, and caspases was measured by immunohistochemistry and Western blotting. All functional and structural changes were measured in 12-month-old h3T-A2 mice and compared with age-matched HLA-A2 wild-type mice. Both pattern-ERGs (42%, p = 0.03 and RGC numbers (37%, p = 0.0001 were reduced in h3T-A2 mice when compared with wild-type mice. The level of CD3 expression was increased in h3T-A2 mice (h3T-A2: 174 ± 27% vs. HLA-A2: 100%; p = 0.04. The levels of effector cytokine IFN-γ were also increased significantly in h3T-A2 mice (h3T-A2: 189 ± 11% vs. HLA-A2: 100%; p = 0.023. Both CD3 and IFN-γ immunostaining were increased in nerve fiber (NF and RGC layers of h3T-A2 mice. In addition, we have seen a robust increase in GFAP staining in h3T-A2 mice (mainly localized to NF layer, which was substantially reduced in IFN-γ ((-/- knockout h3T-A2 mice. We also have seen an up-regulation of caspase-3 and -9 in h3T-A2 mice. Based on our data we conclude that h3T-A2 transgenic mice exhibit visual defects that are mostly associated with the inner retinal layers and RGC function. This novel h3T-A2 transgenic mouse model provides opportunity to understand RGC pathology and test neuroprotective strategies to rescue RGCs.

  13. [Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

    Science.gov (United States)

    Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

    2018-02-01

    Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

  14. Biomodulation with sequential intravenous IFN-alpha2b and 5-fluorouracil as second-line treatment in patients with advanced colorectal cancer.

    Science.gov (United States)

    Pérez, J E; Lacava, J A; Domínguez, M E; Rodríguez, R; Barbieri, M R; Romero Acuña, L A; Romero Acuña, J M; Langhi, M J; Amato, S; Marrone, N; Ortiz, E H; Leone, B A; Vallejo, C T; Machiavelli, M R; Romero, A O

    1998-08-01

    A phase II trial was carried out by the Grupo Oncologico Cooperativo del Sur (G.O.C.S.) to assess the efficacy and toxicity of a biochemical modulation of 5-fluorouracil (5-FU) by i.v. pretreatment with interferon (IFN)-alpha2b in patients with advanced colorectal carcinoma refractory to previous therapy with 5-FU modulated by methotrexate (MTX) or leucovorin (LV) or both. Between January 1993 and October 1995, 34 patients were entered on the study. The treatment was IFN-alpha2b 5 x 10(6)/m2 IU in a 1-h i.v. infusion, followed immediately by 5-FU 600 mg/m2 i.v. bolus injection. Courses were repeated weekly until observation of progressive disease or severe toxicity. One patient could not be assessed for response. Objective regression was observed in 2 of 33 patients (6%, 95% confidence interval, 0%-14%). No patient achieved a complete response. Two patients had partial responses (6%). No change was recorded in 14 patients (41%), and progressive disease occurred in 17 (52%). The median time to treatment failure was 3 months, and the median survival was 5 months. Toxicity was within acceptable limits. The main side effects were mucositis and diarrhea. Four episodes of grade 2 stomatitis were observed, causing dosage modifications. The most frequent toxic effects attributable to IFN-alpha2b were mild fatigue and fever. In conclusion, second-line therapy with i.v. IFN-alpha2b preceding 5-FU has shown an interesting profile of activity in a patient population with clearly unfavorable characteristics. From this perspective, further appropriately designed studies are needed to identify the greatest potential of IFN-alpha2b as a modulator of 5-FU.

  15. SH2 modified STAT1 induces HLA-I expression and improves IFN-γ signaling in IFN-α resistant HCV replicon cells.

    Directory of Open Access Journals (Sweden)

    Bret Poat

    2010-09-01

    Full Text Available We have developed multiple stable cell lines containing subgenomic HCV RNA that are resistant to treatment with interferon alpha (IFN-α. Characterization of these IFN-α resistant replicon cells showed defects in the phosphorylation and nuclear translocation of STAT1 and STAT2 proteins due to a defective Jak-STAT pathway.In this study, we have developed an alternative strategy to overcome interferon resistance in a cell culture model by improving intracellular STAT1 signaling. An engineered STAT1-CC molecule with double cysteine substitutions in the Src-homology 2 (SH2 domains of STAT1 (at Ala-656 and Asn-658 efficiently phosphorylates and translocates to the nucleus of IFN-resistant cells in an IFN-γ dependent manner. Transfection of a plasmid clone containing STAT1-CC significantly activated the GAS promoter compared to wild type STAT1 and STAT3. The activity of the engineered STAT1-CC is dependent upon the phosphorylation of tyrosine residue 701, since the construct with a substituted phenylalanine residue at position 701 (STAT1-CC-Y701F failed to activate GAS promoter in the replicon cells. Intracellular expression of STAT1-CC protein showed phosphorylation and nuclear translocation in the resistant cell line after IFN-γ treatment. Transient transfection of STAT1-CC plasmid clone into an interferon resistant cell line resulted in inhibition of viral replication and viral clearance in an IFN-γ dependent manner. Furthermore, the resistant replicon cells transfected with STAT1-CC constructs significantly up regulated surface HLA-1 expression when compared to the wild type and Y to F mutant controls.These results suggest that modification of the SH2 domain of the STAT1 molecule allows for improved IFN-γ signaling through increased STAT1 phosphorylation, nuclear translocation, HLA-1 surface expression, and prolonged interferon antiviral gene activation.

  16. Nickel, palladium and rhodium induced IFN-gamma and IL-10 production as assessed by in vitro ELISpot-analysis in contact dermatitis patients

    Directory of Open Access Journals (Sweden)

    Ensoli Fabrizio

    2008-05-01

    Full Text Available Abstract Background Recent attempts to diminish nickel use in most industrial products have led to an increasing utilization of alternative metal compounds for destinations such as the alloys used in orthopaedics, jewellery and dentistry. The present study was undertaken with the aim to evaluate the potential for an allergic response to nickel, palladium and rhodium on the basis of antigen-specific induction of inflammatory/regulatory cytokines, and to characterize, according to the cytokine profiles, the nature of simultaneous positive patch tests elicited in vivo. Peripheral blood mononuclear cells (PBMC from 40 patients with different patch test results were kept in short term cultures in the presence of optimized concentrations of NiSO4 × 6H2O, PdCl2 and Rh(CH3COO2. The production of IFN-γ and IL-10 elicited by metal compounds were analyzed by the ELISpot assay. Results We found a specific IFNresponse by PBMC upon in vitro stimulation with nickel or palladium in well recognized allergic individuals. All controls with a negative patch test to a metal salt showed an in vitro IL-10 response and not IFN-γ production when challenged with the same compound. Interestingly, all subjects with positive patch test to both nickel and palladium (group 3 showed an in vitro response characterized by the release of IFN-γ after nickel stimulation and production of IL-10 in response to palladium. Conclusion These results strongly suggest that the different cytokine profiles elicited in vitro reflect different immune responses which may lead to the control of the allergic responses or to symptomatic allergic contact dermatitis. The development of sensitive and specific in vitro assays based on the determination of the cytokine profiles in response to contact allergens may have important diagnostic and prognostic implications and may prove extremely useful in complementing the diagnostic limits of traditional patch testing.

  17. Nickel, palladium and rhodium induced IFN-gamma and IL-10 production as assessed by in vitro ELISpot-analysis in contact dermatitis patients

    Science.gov (United States)

    Bordignon, Valentina; Palamara, Francesca; Cordiali-Fei, Paola; Vento, Antonella; Aiello, Arianna; Picardo, Mauro; Ensoli, Fabrizio; Cristaudo, Antonio

    2008-01-01

    Background Recent attempts to diminish nickel use in most industrial products have led to an increasing utilization of alternative metal compounds for destinations such as the alloys used in orthopaedics, jewellery and dentistry. The present study was undertaken with the aim to evaluate the potential for an allergic response to nickel, palladium and rhodium on the basis of antigen-specific induction of inflammatory/regulatory cytokines, and to characterize, according to the cytokine profiles, the nature of simultaneous positive patch tests elicited in vivo. Peripheral blood mononuclear cells (PBMC) from 40 patients with different patch test results were kept in short term cultures in the presence of optimized concentrations of NiSO4 × 6H2O, PdCl2 and Rh(CH3COO)2. The production of IFN-γ and IL-10 elicited by metal compounds were analyzed by the ELISpot assay. Results We found a specific IFNresponse by PBMC upon in vitro stimulation with nickel or palladium in well recognized allergic individuals. All controls with a negative patch test to a metal salt showed an in vitro IL-10 response and not IFN-γ production when challenged with the same compound. Interestingly, all subjects with positive patch test to both nickel and palladium (group 3) showed an in vitro response characterized by the release of IFN-γ after nickel stimulation and production of IL-10 in response to palladium. Conclusion These results strongly suggest that the different cytokine profiles elicited in vitro reflect different immune responses which may lead to the control of the allergic responses or to symptomatic allergic contact dermatitis. The development of sensitive and specific in vitro assays based on the determination of the cytokine profiles in response to contact allergens may have important diagnostic and prognostic implications and may prove extremely useful in complementing the diagnostic limits of traditional patch testing. PMID:18482439

  18. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  19. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  20. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  1. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  3. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  4. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  5. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  6. IFN-gamma-induced chemokines synergize with pertussis toxin to promote T cell entry to the central nervous system

    DEFF Research Database (Denmark)

    Millward, Jason M; Caruso, Maria; Campbell, Iain L

    2007-01-01

    Inflammation of the CNS, which occurs during multiple sclerosis and experimental autoimmune encephalomyelitis, is characterized by increased levels of IFN-gamma, a cytokine not normally expressed in the CNS. To investigate the role of IFN-gamma in CNS, we used intrathecal injection of a replication......-defective adenovirus encoding murine IFN-gamma (AdIFNgamma) to IFN-gamma-deficient (GKO) mice. This method resulted in stable, long-lived expression of IFN-gamma that could be detected in cerebrospinal fluid using ELISA and Luminex bead immunoassay. IFN-gamma induced expression in the CNS of message and protein...... was predominantly localized to meningeal and ependymal cells, and was also seen in astrocytes and microglia. IFN-gamma-induced chemokine expression did not lead to inflammation. However, when pertussis toxin was given i.p. to mice infected with the IFN-gamma vector, there was a dramatic increase in the number of T...

  7. Decreased release of histamine and sulfidoleukotrienes by human peripheral blood leukocytes after wasp venom immunotherapy is partially due to induction of IL-10 and IFN-gamma production of T cells.

    Science.gov (United States)

    Pierkes, M; Bellinghausen, I; Hultsch, T; Metz, G; Knop, J; Saloga, J

    1999-02-01

    Recent studies provide evidence that venom immunotherapy (VIT) alters the pattern of cytokine production by inducing an allergen-specific T-cell shift in cytokine expression from TH2 (IL-4, IL-5) to TH1 (IFN-gamma) cytokines and also inducing the production of IL-10. This study was carried out to analyze whether these changes in cytokine production of T cells already observed 1 week after the initiation of VIT in subjects with wasp venom allergy also influence the reactivity of effector cells, such as mast cells and basophils. All subjects included in this study had a history of severe systemic allergic reactions to wasp stings and positive skin test responses with venom and venom-specific IgE in the sera. Peripheral blood leukocytes were isolated before and after the initiation of VIT (rush therapy reaching a maintenance dose of 100 microg venom injected subcutaneously within 1 week) and preincubated with or without addition of IL-10, IFN-gamma, IL-10 + IFN-gamma, anti-IL-10, or anti-IFN-gamma. After stimulation with wasp venom, histamine and sulfidoleukotriene release were assessed by ELISA and compared with spontaneous release and total histamine content. After the induction of VIT, venom-induced absolute and relative histamine and sulfidoleukotriene release were reduced. This was at least partially due to the induction of IFN-gamma and IL-10 production, because (1) neutralization of IL-10 and IFN-gamma by mAbs partially restored the release after the initiation of VIT and (2) the addition of exogenous IFN-gamma and IL-10 caused a statistically significant diminution of the venom-induced histamine and sulfidoleukotriene release before VIT. Depletion of CD2(+) T cells also restored the releasability after VIT. These data indicate that T cells (producing IL-10 and IFN-gamma after VIT) play a key role for the inhibition of histamine and sulfidoleukotriene release of effector cells.

  8. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  9. Cutting Edge: Genetic Association between IFI16 Single Nucleotide Polymorphisms and Resistance to Genital Herpes Correlates with IFI16 Expression Levels and HSV-2-Induced IFN-β Expression.

    Science.gov (United States)

    Eriksson, Kristina; Svensson, Alexandra; Hait, Alon S; Schlüter, Kerstin; Tunbäck, Petra; Nordström, Inger; Padyukov, Leonid; Liljeqvist, Jan-Åke; Mogensen, Trine H; Paludan, Søren R

    2017-10-15

    IFN-γ-inducible protein 16 (IFI16) is an immunological DNA sensor proposed to act in the cyclic GMP-AMP synthase-stimulator of IFN genes pathway. Because mice do not have a clear ortholog of IFI16, this system is not suitable for genetic studies of IFI16. In this study, we have compared the dependency on IFI16, cyclic GMP-AMP synthase, and stimulator of IFN genes for type I IFN induction by a panel of pathogenic bacteria and DNA viruses. The IFN response induced by HSV-2 was particularly dependent on IFI16. In a cohort of patients with genital herpes and healthy controls, the minor G allele of the IFI16 single nucleotide polymorphism rs2276404 was associated with resistance to infection. Furthermore, the combination of this allele with the C allele of rs1417806 was significantly overrepresented in uninfected individuals. Cells from individuals with the protective GC haplotype expressed higher levels of IFI16 and induced more IFN-β upon HSV-2 infection. These data provide genetic evidence for a role for IFI16 in protection against genital herpes. Copyright © 2017 by The American Association of Immunologists, Inc.

  10. Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

    Science.gov (United States)

    Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

    2016-03-12

    Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

  11. CCR6 and NK1.1 distinguish between IL-17A and IFN-gamma-producing gammadelta effector T cells.

    Science.gov (United States)

    Haas, Jan D; González, Frano H Malinarich; Schmitz, Susanne; Chennupati, Vijaykumar; Föhse, Lisa; Kremmer, Elisabeth; Förster, Reinhold; Prinz, Immo

    2009-12-01

    Gammadelta T cells are a potent source of innate IL-17A and IFN-gamma, and they acquire the capacity to produce these cytokines within the thymus. However, the precise stages and required signals that guide this differentiation are unclear. Here we show that the CD24(low) CD44(high) effector gammadelta T cells of the adult thymus are segregated into two lineages by the mutually exclusive expression of CCR6 and NK1.1. Only CCR6+ gammadelta T cells produced IL-17A, while NK1.1+ gammadelta T cells were efficient producers of IFN-gamma but not of IL-17A. Their effector phenotype correlated with loss of CCR9 expression, particularly among the NK1.1+ gammadelta T cells. Accordingly, both gammadelta T-cell subsets were rare in gut-associated lymphoid tissues, but abundant in peripheral lymphoid tissues. There, they provided IL-17A and IFN-gamma in response to TCR-specific and TCR-independent stimuli. IL-12 and IL-18 induced IFN-gamma and IL-23 induced IL-17A production by NK1.1+ or CCR6+ gammadelta T cells, respectively. Importantly, we show that CCR6+ gammadelta T cells are more responsive to TCR stimulation than their NK1.1+ counterparts. In conclusion, our findings support the hypothesis that CCR6+ IL-17A-producing gammadelta T cells derive from less TCR-dependent selection events than IFN-gamma-producing NK1.1+ gammadelta T cells.

  12. Regulatory function of a novel population of mouse autoantigen-specific Foxp3 regulatory T cells depends on IFN-gamma, NO, and contact with target cells.

    Directory of Open Access Journals (Sweden)

    Cyndi Chen

    Full Text Available BACKGROUND: Both naturally arising Foxp3(+ and antigen-induced Foxp3(- regulatory T cells (Treg play a critical role in regulating immune responses, as well as in preventing autoimmune diseases and graft rejection. It is known that antigen-specific Treg are more potent than polyclonal Treg in suppressing pathogenic immune responses that cause autoimmunity and inflammation. However, difficulty in identifying and isolating a sufficient number of antigen-specific Treg has limited their use in research to elucidate the mechanisms underlying their regulatory function and their potential role in therapy. METHODOLOGY/PRINCIPAL FINDINGS: Using a novel class II MHC tetramer, we have isolated a population of CD4(+ Foxp3(- T cells specific for the autoantigen glutamic acid decarboxylase p286-300 peptide (NR286 T cells from diabetes-resistant non-obese resistant (NOR mice. These Foxp3(- NR286 T cells functioned as Treg that were able to suppress target T cell proliferation in vitro and inhibit type 1 diabetes in animals. Unexpected results from mechanistic studies in vitro showed that their regulatory function was dependent on not only IFN-gamma and nitric oxide, but also on cell contact with target cells. In addition, separating NR286 Treg from target T cells in transwell assays abolished both production of NO and suppression of target T cells, regardless of whether IFN-gamma was produced in cell cultures. Therefore, production of NO, not IFN-gamma, was cell contact dependent, suggesting that NO may function downstream of IFN-gamma in mediating regulatory function of NR286 Treg. CONCLUSIONS/SIGNIFICANCE: These studies identified a unique population of autoantigen-specific Foxp3(- Treg that can exert their regulatory function dependent on not only IFN-gamma and NO but also cell contact with target cells.

  13. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  14. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  15. Plasmodium falciparum-infected erythrocytes and IL-12/IL-18 induce diverse transcriptomes in human NK cells: IFN-α/β pathway versus TREM signaling.

    Directory of Open Access Journals (Sweden)

    Elisandra Grangeiro de Carvalho

    Full Text Available The protective immunity of natural killer (NK cells against malarial infections is thought to be due to early production of type II interferon (IFN and possibly direct NK cell cytotoxicity. To better understand this mechanism, a microarray analysis was conducted on NK cells from healthy donors PBMCs that were co-cultured with P. falciparum 3D7-infected erythrocytes. A very similar pattern of gene expression was observed among all donors for each treatment in three replicas. Parasites particularly modulated genes involved in IFN-α/β signaling as well as molecules involved in the activation of interferon regulatory factors, pathways known to play a role in the antimicrobial immune response. This pattern of transcription was entirely different from that shown by NK cells treated with IL-12 and IL-18, in which IFN-γ- and TREM-1-related genes were over-expressed. These results suggest that P. falciparum parasites and the cytokines IL-12 and IL-18 have diverse imprints on the transcriptome of human primary NK cells. IFN-α-related genes are the prominent molecules induced by parasites on NK cells and arise as candidate biomarkers that merit to be further investigated as potential new tools in malaria control.

  16. IFN-γ, IL-2, IP-10, and MIG as Biomarkers of Exposure to Leishmania spp., and of Cure in Human Visceral Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Ana V. Ibarra-Meneses

    2017-05-01

    Full Text Available New biomarkers are needed for monitoring the effectiveness of treatment for visceral leishmaniasis (VL. They might also improve the detection of the asymptomatic population in Leishmania-endemic areas. This paper examines the IL-2, IFN-γ, IFN-γ-induced protein 10 (IP-10, and monokine-induced-by-IFN-γ (MIG levels in whole blood—stimulated in vitro with soluble Leishmania antigen (SLA—taken from asymptomatic individuals and patients treated for VL living in a post-outbreak (Leishmania infantum area in Spain, and in an endemic (Leishmania donovani area of Bangladesh. IP-10 was found to be an accurate global marker of asymptomatic subjects with positive cellular/humoral tests, while MIG was found to be a better marker of contact with L. donovani than IL-2 but no for those with L. infantum. Determining IP-10, MIG, and IFN-γ levels proved useful in monitoring the cellular immune response following treatment for active disease caused by L. infantum.

  17. Kobuvirus VP3 protein restricts the IFN-β-triggered signaling pathway by inhibiting STAT2-IRF9 and STAT2-STAT2 complex formation

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Qianqian; Lan, Xi; Wang, Chen [State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046 (China); Ren, Yujie; Yue, Ningning [College of Life Sciences, Wuhan University, Wuhan 430072 (China); Wang, Junyong [State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046 (China); Zhong, Bo [College of Life Sciences, Wuhan University, Wuhan 430072 (China); Medical Research Institute, School of Medicine, Wuhan University, Wuhan 430071 (China); Zhu, Qiyun, E-mail: zhuqiyun@caas.cn [State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046 (China)

    2017-07-15

    Emerged porcine kobuvirus (PKV) has adversely affected the global swine industry since 2008, but the etiological biology of PKV is unclear. Screening PKV-encoded structural and non-structural proteins with a type I IFN-responsive luciferase reporter showed that PKV VP3 protein inhibited the IFN-β-triggered signaling pathway, resulting in the decrease of VSV-GFP replication. QPCR data showed that IFN-β downstream cytokine genes were suppressed without cell-type specificity as well. The results from biochemical experiments indicated that PKV VP3 associated with STAT2 and IRF9, and interfered with the formation of the STAT2-IRF9 and STAT2-STAT2 complex, impairing nuclear translocation of STAT2 and IRF9. Taken together, these data reveal a new mechanism for immune evasion of PKV. - Highlights: •PKV VP3 inhibits the IFN-β-triggered signaling pathway. •VP3 associates with STAT2 and IRF9. •VP3 blocks the STAT2-IRF9 nuclear translocation. •VP3 utilizes a novel strategy for innate immune evasion.

  18. T Cell Intrinsic USP15 Deficiency Promotes Excessive IFN-γ Production and an Immunosuppressive Tumor Microenvironment in MCA-Induced Fibrosarcoma

    Directory of Open Access Journals (Sweden)

    Qiang Zou

    2015-12-01

    Full Text Available USP15 is a deubiquitinase that negatively regulates activation of naive CD4+ T cells and generation of IFN-γ-producing T helper 1 (Th1 cells. USP15 deficiency in mice promotes antitumor T cell responses in a transplantable cancer model; however, it has remained unclear how deregulated T cell activation impacts primary tumor development during the prolonged interplay between tumors and the immune system. Here, we find that the USP15-deficient mice are hypersensitive to methylcholantrene (MCA-induced fibrosarcomas. Excessive IFN-γ production in USP15-deficient mice promotes expression of the immunosuppressive molecule PD-L1 and the chemokine CXCL12, causing accumulation of T-bet+ regulatory T cells and CD11b+Gr-1+ myeloid-derived suppressor cells at tumor site. Mixed bone marrow adoptive transfer studies further reveals a T cell-intrinsic role for USP15 in regulating IFN-γ production and tumor development. These findings suggest that T cell intrinsic USP15 deficiency causes excessive production of IFN-γ, which promotes an immunosuppressive tumor microenvironment during MCA-induced primary tumorigenesis.

  19. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  20. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  1. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  2. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  3. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  4. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  5. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  6. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  7. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  8. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  9. Immunomodulatory activities of some new synthesized compounds on serum IL-12 level and the production of IFN-gamma in irradiated female rats

    International Nuclear Information System (INIS)

    Noaman, E.; Elgawish, M.A.M.

    2002-01-01

    The immune responds to ionizing radiation with distinct characteristics depending on the dose and dose rate. The prominent suppressive effect of lethal and sublethal doses of ionizing radiation on immunity and hemopoiesis constitutes the basis of the chief clinical manifestations of acute radiation syndrome. The present of research was conducted to evaluate the effects of new compounds synthesized by adding histidine, glutathione or methionine to germanium element on the levels of interferon-gamma (IFN-γ)and interleukin-12 (IL-12) in serum of female rats exposure. The results revealed that exposure to γ-irradiation decreased significantly the levels of IL-12 and I FN-γ 1 and 3 days post-treatment. On the other hand, histidine-germanate could stimulate the production of IL-12 three days post-irradiation while glutathione-germanate and methionine-germanate may be considered as IFN-γ inducer during the investigated periods

  10. OX40+ T lymphocytes and IFN-γ are associated with American tegumentary leishmaniasis pathogenesis Linfócitos T OX40+ e IFN-γ estão associados com a patogênese da leishmaniose tegumentar americana

    Directory of Open Access Journals (Sweden)

    Patrícia Luciana Batista Domingos

    2012-12-01

    Full Text Available BACKGROUND: Leishmaniases are zoonoses considered a public health problem, representing a complex group of diseases with a broad clinical spectrum and epidemiological diversity. Leishmaniasis is caused by several species of protozoa of the genus Leishmania. The evolution of the pathology and the resolution of the leishmaniasis are dependent mainly on the Leishmania species involved, although the cytokine profile plays an important role in the development of the immune response. OBJECTIVES: The purpose of our study was to evaluate the immune response of patients affected by lesions of cutaneous leishmaniasis by immunostaining of the OX40, CD20, IFN-γ and IL-4 proteins. METHODS: The tissue samples were collected from indolent skin ulcers confirmed as cutaneous leishmaniasis of 41 patients aged between six and 90 years. The lesions were submitted to OX40, CD20, INF-γ and IL-4 immunolabeling. RESULTS: We observed a statistically significant higher expression of IFN-γ compared with IL-4 (p=0.009. Besides, OX40 had higher expression when compared with CD20 (pFUNDAMENTOS: As leishmanioses são zoonoses consideradas um problema de saúde pública, representando um grupo de doenças complexas, com uma diversidade de amplo espectro clínico e epidemiológico. A leishmaniose é uma doença causada por várias espécies de protozoários do gênero Leishmania spp. A evolução da patologia e a resolução da leishmaniose são dependentes principalmente da espécie de Leishmania envolvida; embora o perfil das citocinas tenha um importante papel no desenvolvimento da resposta imune. OBJETIVOS: Proporcionar mais conhecimentos sobre os eventos inflamatórios na leishmaniose tegumentar através da avaliação da imunoexpressão de OX40, CD20, IFN-γ e IL-4. MÉTODOS: Foram coletadas amostras de tecido de 41 pacientes, com idade variando entre 6 a 90 anos, com úlceras indolentes na pele confirmados através de exames de diagnóstico como leishmaniose

  11. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  12. Serum IFN neutralizing antibodies and neopterin levels in a cross-section of MS patients.

    Science.gov (United States)

    Cook, S D; Quinless, J R; Jotkowitz, A; Beaton, P

    2001-09-25

    To determine levels of serum interferon beta (IFNbeta) neutralizing antibody (NAb) and neopterin-an IFN biologic response marker-in patients with MS treated with Betaseron or Avonex. Controversy exists over the relative immunogenicity of IFNbeta-1a and IFNbeta-1b and the reasons for any such difference. To determine the role of patient profile and test methodology in IFNbeta, NAb levels need to be measured blindly and simultaneously in a predefined closely matched MS patient cohort. Serum NAb and neopterin levels were measured in closely matched patients on Avonex (n = 98) or Betaseron (n = 64). NAb were determined by Athena Diagnostics and serum neopterin levels by Covance Laboratories using a competitive binding radioimmunoassay. More patients taking Betaseron (22%) than Avonex (7%) had elevated titers of NAb (p = 0.008). Mean serum neopterin levels were lower in patients with high as compared to low NAb titers (p = 0.0002). No difference in mean neopterin levels was found comparing the total Betaseron group to the Avonex group; however, in the subset of patients with low NAb titers, mean neopterin levels were higher in the Betaseron than in the Avonex group (p = 0.027). A random cross-sectional sampling of patients on Avonex showed a decrease in neopterin levels over time between weekly doses. NAb are more commonly found with Betaseron than Avonex. More studies are needed to determine the correlation among serum neopterin levels, other biologic response markers, NAb, and disease activity in patients with MS being treated with IFNbeta.

  13. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  14. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  15. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  16. CYLD Proteolysis Protects Macrophages from TNF-Mediated Auto-necroptosis Induced by LPS and Licensed by Type I IFN

    Directory of Open Access Journals (Sweden)

    Diana Legarda

    2016-06-01

    Full Text Available Tumor necrosis factor (TNF induces necroptosis, a RIPK3/MLKL-dependent form of inflammatory cell death. In response to infection by Gram-negative bacteria, multiple receptors on macrophages, including TLR4, TNF, and type I IFN receptors, are concurrently activated, but it is unclear how they crosstalk to regulate necroptosis. We report that TLR4 activates CASPASE-8 to cleave and remove the deubiquitinase cylindromatosis (CYLD in a TRIF- and RIPK1-dependent manner to disable necroptosis in macrophages. Inhibiting CASPASE-8 leads to CYLD-dependent necroptosis caused by the TNF produced in response to TLR4 ligation. While lipopolysaccharides (LPS-induced necroptosis was abrogated in Tnf−/− macrophages, a soluble TNF antagonist was not able to do so in Tnf+/+ macrophages, indicating that necroptosis occurs in a cell-autonomous manner. Surprisingly, TNF-mediated auto-necroptosis of macrophages requires type I IFN, which primes the expression of key necroptosis-signaling molecules, including TNFR2 and MLKL. Thus, the TNF necroptosis pathway is regulated by both negative and positive crosstalk.

  17. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  18. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  19. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  20. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  1. Dynamics of intraocular IFN-γ, IL-17 and IL-10-producing cell populations during relapsing and monophasic rat experimental autoimmune uveitis.

    Directory of Open Access Journals (Sweden)

    Ulrike Kaufmann

    Full Text Available A major limitation of most animal models of autoimmune diseases is that they do not reproduce the chronic or relapsing-remitting pattern characteristic of many human autoimmune diseases. This problem has been overcome in our rat models of experimentally induced monophasic or relapsing-remitting autoimmune uveitis (EAU, which depend on the inducing antigen peptides from retinal S-Antigen (monophasic EAU or interphotoreceptor retinoid-binding protein (relapsing EAU. These models enable us to compare autoreactive and regulatory T cell populations. Intraocular, but not peripheral T cells differ in their cytokine profiles (IFN-γ, IL-17 and IL-10 at distinct time points during monophasic or relapsing EAU. Only intraocular T cells concomitantly produced IFN-γ, IL-17 and/or IL-10. Monophasic EAU presented rising numbers of cells expressing IFN-γ and IL-17 (Th1/Th17 and cells expressing IL-10 or Foxp3. During relapsing uveitis an increase of intraocular IFN-γ+ cells and a concomitant decrease of IL-17+ cells was detected, while IL-10+ populations remained stable. Foxp3+ cells and cells expressing IL-10, even in combination with IFN-γ or IL-17, increased during the resolution of monophasic EAU, suggesting a regulatory role for these T cells. In general, cells producing multiple cytokines increased in monophasic and decreased in relapsing EAU. The distinct appearance of certain intraocular populations with characteristics of regulatory cells points to a differential influence of the ocular environment on T cells that induce acute and monophasic or relapsing disease. Here we provide evidence that different autoantigens can elicit distinct and differently regulated immune responses. IFN-γ, but not IL-17 seems to be the key player in relapsing-remitting uveitis, as shown by increased, synchronized relapses after intraocular application of IFN-γ. We demonstrated dynamic changes of the cytokine pattern during monophasic and relapsing-remitting disease

  2. Mullerian Inhibiting Substances (MIS) Augments IFN-gamma Mediated Inhibition of Breast Cancer Cell Growth

    National Research Council Canada - National Science Library

    Gupta, Vandana

    2006-01-01

    MIS is a member of the TGF family. The purpose of this study is to test the hypothesis that MIS and IFN-gamma might be more effective in the inhibition of breast cancer cell growth than either agent alone...

  3. The interferon response circuit in antiviral host defense.

    Science.gov (United States)

    Haller, O; Weber, F

    2009-01-01

    Viruses have learned to multiply in the face of a powerful innate and adaptive immune response of the host. They have evolved multiple strategies to evade the interferon (IFN) system which would otherwise limit virus growth at an early stage of infection. IFNs induce the synthesis of a range of antiviral proteins which serve as cell-autonomous intrinsic restriction factors. For example, the dynamin-like MxA GTPase inhibits the multiplication of influenza and bunyaviruses (such as La Crosse virus, Hantaan virus, Rift Valley Fever virus, and Crimean-Congo hemorrhagic fever virus) by binding and sequestering the nucleocapsid protein into large perinuclear complexes. To overcome such intracellular restrictions, virulent viruses either inhibit IFN synthesis, bind and inactivate secreted IFN molecules, block IFN-activated signaling, or disturb the action of IFN-induced antiviral proteins. Many viruses produce specialized proteins to disarm the danger signal or express virulence genes that target members of the IFN regulatory factor family (IRFs) or components of the JAK-STAT signaling pathway. An alternative evasion strategy is based on extreme viral replication speed which out-competes the IFN response. The identification of viral proteins with IFN antagonistic functions has great implications for disease prevention and therapy. Virus mutants lacking IFN antagonistic properties represent safe yet highly immunogenic candidate vaccines. Furthermore, novel drugs intercepting viral IFN-antagonists could be used to disarm the viral intruders.

  4. White adipose tissue IFN-γ expression and signalling along the progression of rodent cancer cachexia.

    Science.gov (United States)

    Yamashita, Alex Shimura; das Neves, Rodrigo Xavier; Rosa-Neto, José Cesar; Lira, Fábio Dos Santos; Batista, Miguel Luís; Alcantara, Paulo Sérgio; Otoch, José Pinhata; Seelaender, Marília

    2017-01-01

    Cachexia is associated with increased morbidity and mortality in cancer. The White adipose tissue (WAT) synthesizes and releases several pro-inflammatory cytokines that play a role in cancer cachexia-related systemic inflammation. IFN-γ is a pleiotropic cytokine that regulates several immune and metabolic functions. To assess whether IFN-γ signalling in different WAT pads is modified along cancer-cachexia progression, we evaluated IFN-γ receptors expression (IFNGR1 and IFNGR2) and IFN-γ protein expression in a rodent model of cachexia (7, 10, and 14days after tumour implantation). IFN-γ protein expression was heterogeneously modulated in WAT, with increases in the mesenteric pad and decreased levels in the retroperitoneal depot along cachexia progression. Ifngr1 was up-regulated 7days after tumour cell injection in mesenteric and epididymal WAT, but the retroperitoneal depot showed reduced Ifngr1 gene expression. Ifngr2 gene expression was increased 7 and 14days after tumour inoculation in mesenteric WAT. The results provide evidence that changes in IFN-γ expression and signalling may be perceived at stages preceding refractory cachexia, and therefore, might be employed as a means to assess the early stage of the syndrome. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  6. Construction of recombinant plasmid pIRESEgr-IFN γ and its expression in Lewis lung carcinoma induced by irradiation

    International Nuclear Information System (INIS)

    Yang Wei; Li Xiuyi; Gong Shouliang; Sun Ting; Gong Pingsheng

    2007-01-01

    Objective: To construct the recombinant plasmid pIRESEgr-IFN γ and detect its expression in Lewis lung carcinoma induced by irradiation in vitro. Methods: The recombinant plasmid pIRESEgr-IFN γ containing Egr-1 promoter and IFN γ gene was constructed with gene recombinant technique. The plasmid was transferred into Lewis lung carcinoma by liposome in vitro. The correlations of dose- and time-effects in the expression of IFN γ gene induced by X-ray were detected by ELISA. Results: The identification with enzymes proved that Egr-1 promoter and IFN γ gene were inserted into vector pIRESlneo correctly. After X-ray irradiation with different doses, the expression of IFN γ in the supernatant of Lewis lung carcinoma transfected by pIRESEgr-IFN γ was significantly higher than that in 0 Gy group (P<0.001). After 5 Gy X-ray irradiation, the expression of IFN γ was the highest, being 4.39 times as much as that in 0 Gy group. The expression of IFN γ in the supernatant increased after 5 Gy X-ray irradiation, being 6.27 times as much as that in 0 h group 36 h after irradiation. Conclusion: The recombinant plasmid pIRESEgr-IFN γ is constructed successfully, and it has the property of enhancing the expression of IFN γ gene induced by irradiation. (authors)

  7. FTR83, a Member of the Large Fish-Specific finTRIM Family, Triggers IFN Pathway and Counters Viral Infection

    Directory of Open Access Journals (Sweden)

    Christelle Langevin

    2017-05-01

    Full Text Available Tripartite motif (TRIM proteins are involved in various cellular functions and constitute key factors of the antiviral innate immune response. TRIM proteins can bind viral particles directly, sending them to degradation by the proteasome, or ubiquitinate signaling molecules leading to upregulation of innate immunity. TRIM proteins are present in across metazoans but are particularly numerous in vertebrates where genes comprising a B30.2 domain have been often duplicated. In fish, a TRIM subset named finTRIM is highly diversified, with large gene numbers and clear signatures of positive selection in the B30.2 domain suggesting they may be involved in antiviral mechanisms. finTRIM provides a beautiful model to investigate the primordial implication of B30.2 TRIM subsets in the arsenal of vertebrate antiviral defenses. We show here that ftr83, a zebrafish fintrim gene mainly expressed in the gills, skin and pharynx, encodes a protein affording a potent antiviral activity. In vitro, overexpression of FTR83, but not of its close relative FTR82, induced IFN and IFN-stimulated gene expression and afforded protection against different enveloped and non-enveloped RNA viruses. The kinetics of IFN induction paralleled the development of the antiviral activity, which was abolished by a dominant negative IRF3 mutant. In the context of a viral infection, FTR83 potentiated the IFN response. Expression of chimeric proteins in which the B30.2 domain of FTR83 and the non-protective FTR82 had been exchanged, showed that IFN upregulation and antiviral activity requires both the Ring/BBox/Coiled coil domain (supporting E3 ubiquitin ligase and the B30.2 domain of FTR83. Finally, loss of function experiments in zebrafish embryos confirms that ftr83 mediates antiviral activity in vivo. Our results show that a member of the largest TRIM subset observed in fish upregulates type I IFN response and afford protection against viral infections, supporting that TRIMs are key

  8. Targeted Recombinant Fusion Proteins of IFN gamma and Mimetic IFN gamma with PDGF beta R Bicyclic Peptide Inhibits Liver Fibrogenesis In Vivo

    NARCIS (Netherlands)

    Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas

    2014-01-01

    Hepatic stellate cells (HSCs), following transdifferentiation to myofibroblasts plays a key role in liver fibrosis. Therefore, attempts to attenuate this myofibroblastic phenotype would be a promising therapeutic approach. Interferon gamma (IFN gamma) is a potent anti-fibrotic cytokine, but its

  9. Transformation of SV40-immortalized human uroepithelial cells by 3-methylcholanthrene increases IFN- and Large T Antigen-induced transcripts

    Directory of Open Access Journals (Sweden)

    Easton Marilyn J

    2010-02-01

    Full Text Available Abstract Background Simian Virus 40 (SV40 immortalization followed by treatment of cells with 3-methylcholanthrene (3-MC has been used to elicit tumors in athymic mice. 3-MC carcinogenesis has been thoroughly studied, however gene-level interactions between 3-MC and SV40 that could have produced the observed tumors have not been explored. The commercially-available human uroepithelial cell lines were either SV40-immortalized (HUC or SV40-immortalized and then 3-MC-transformed (HUC-TC. Results To characterize the SV40 - 3MC interaction, we compared human gene expression in these cell lines using a human cancer array and confirmed selected changes by RT-PCR. Many viral Large T Antigen (Tag expression-related changes occurred in HUC-TC, and it is concluded that SV40 and 3-MC may act synergistically to transform cells. Changes noted in IFP 9-27, 2'-5' OAS, IF 56, MxA and MxAB were typical of those that occur in response to viral exposure and are part of the innate immune response. Because interferon is crucial to innate immune host defenses and many gene changes were interferon-related, we explored cellular growth responses to exogenous IFN-γ and found that treatment impeded growth in tumor, but not immortalized HUC on days 4 - 7. Cellular metabolism however, was inhibited in both cell types. We conclude that IFN-γ metabolic responses were functional in both cell lines, but IFN-γ anti-proliferative responses functioned only in tumor cells. Conclusions Synergism of SV40 with 3-MC or other environmental carcinogens may be of concern as SV40 is now endemic in 2-5.9% of the U.S. population. In addition, SV40-immortalization is a generally-accepted method used in many research materials, but the possibility of off-target effects in studies carried out using these cells has not been considered. We hope that our work will stimulate further study of this important phenomenon.

  10. Distinct Upstream Role of Type I IFN Signaling in Hematopoietic Stem Cell-Derived and Epithelial Resident Cells for Concerted Recruitment of Ly-6Chi Monocytes and NK Cells via CCL2-CCL3 Cascade.

    Directory of Open Access Journals (Sweden)

    Erdenebileg Uyangaa

    Full Text Available Type I interferon (IFN-I-dependent orchestrated mobilization of innate cells in inflamed tissues is believed to play a critical role in controlling replication and CNS-invasion of herpes simplex virus (HSV. However, the crucial regulators and cell populations that are affected by IFN-I to establish the early environment of innate cells in HSV-infected mucosal tissues are largely unknown. Here, we found that IFN-I signaling promoted the differentiation of CCL2-producing Ly-6Chi monocytes and IFN-γ/granzyme B-producing NK cells, whereas deficiency of IFN-I signaling induced Ly-6Clo monocytes producing CXCL1 and CXCL2. More interestingly, recruitment of Ly-6Chi monocytes preceded that of NK cells with the levels peaked at 24 h post-infection in IFN-I-dependent manner, which was kinetically associated with the CCL2-CCL3 cascade response. Early Ly-6Chi monocyte recruitment was governed by CCL2 produced from hematopoietic stem cell (HSC-derived leukocytes, whereas NK cell recruitment predominantly depended on CC chemokines produced by resident epithelial cells. Also, IFN-I signaling in HSC-derived leukocytes appeared to suppress Ly-6Ghi neutrophil recruitment to ameliorate immunopathology. Finally, tissue resident CD11bhiF4/80hi macrophages and CD11chiEpCAM+ dendritic cells appeared to produce initial CCL2 for migration-based self-amplification of early infiltrated Ly-6Chi monocytes upon stimulation by IFN-I produced from infected epithelial cells. Ultimately, these results decipher a detailed IFN-I-dependent pathway that establishes orchestrated mobilization of Ly-6Chi monocytes and NK cells through CCL2-CCL3 cascade response of HSC-derived leukocytes and epithelium-resident cells. Therefore, this cascade response of resident-to-hematopoietic-to-resident cells that drives cytokine-to-chemokine-to-cytokine production to recruit orchestrated innate cells is critical for attenuation of HSV replication in inflamed tissues.

  11. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  12. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  13. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  14. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  15. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  16. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  17. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  18. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  19. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  20. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  2. Hepatitis E virus persists in the presence of a type III interferon response.

    Science.gov (United States)

    Yin, Xin; Li, Xinlei; Ambardekar, Charuta; Hu, Zhimin; Lhomme, Sébastien; Feng, Zongdi

    2017-05-01

    The RIG-I-like RNA helicase (RLR)-mediated interferon (IFN) response plays a pivotal role in the hepatic antiviral immunity. The hepatitis A virus (HAV) and the hepatitis C virus (HCV) counter this response by encoding a viral protease that cleaves the mitochondria antiviral signaling protein (MAVS), a common signaling adaptor for RLRs. However, a third hepatotropic RNA virus, the hepatitis E virus (HEV), does not appear to encode a functional protease yet persists in infected cells. We investigated HEV-induced IFN responses in human hepatoma cells and primary human hepatocytes. HEV infection resulted in persistent virus replication despite poor spread. This was companied by a type III IFN response that upregulated multiple IFN-stimulated genes (ISGs), but type I IFNs were barely detected. Blocking type III IFN production or signaling resulted in reduced ISG expression and enhanced HEV replication. Unlike HAV and HCV, HEV did not cleave MAVS; MAVS protein size, mitochondrial localization, and function remained unaltered in HEV-replicating cells. Depletion of MAVS or MDA5, and to a less extent RIG-I, also diminished IFN production and increased HEV replication. Furthermore, persistent activation of the JAK/STAT signaling rendered infected cells refractory to exogenous IFN treatment, and depletion of MAVS or the receptor for type III IFNs restored the IFN responsiveness. Collectively, these results indicate that unlike other hepatotropic RNA viruses, HEV does not target MAVS and its persistence is associated with continuous production of type III IFNs.

  3. Evaluating pleural ADA, ADA2, IFN-γ and IGRA for diagnosing tuberculous pleurisy.

    Science.gov (United States)

    Keng, Li-Ta; Shu, Chin-Chung; Chen, Jason Yao-Ping; Liang, Sheng-Kai; Lin, Ching-Kai; Chang, Lih-Yu; Chang, Chia-Hao; Wang, Jann-Yuan; Yu, Chong-Jen; Lee, Li-Na

    2013-10-01

    Conventional methods for diagnosing tuberculous pleurisy (TB pleurisy) are either invasive or have a long turn-around-time. Performances of pleural adenosine deaminase (ADA), ADA2, interferon-gamma (IFN-γ), and interferon-gamma release assays (IGRA) as diagnostic tools for TB pleurisy were evaluated. Eighty-eight patients with lymphocyte-predominant pleural exudates between June 2010 and March 2011, including 31 with clinically diagnosed TB pleurisy, were prospectively studied. Pleural ADA and ADA2 activity were measured by colorimetric method, IFN-γ levels by enzyme-linked immuno-sorbent assay, and IGRA by enzyme-linked immuno-spot (T-SPOT.TB) assay. Pleural ADA, ADA2, and IFN-γ levels, but not the proportion of positive T-SPOT.TB assay, were significantly higher in patients with TB pleurisy than in those without TB pleurisy. The area under the receiver-operating-characteristic (ROC) curve was 0.920, 0.893, 0.875, and 0.544 for IFN-γ, ADA2, ADA, and T-SPOT.TB assay, respectively. The combination of ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL yielded a specificity of 100%. Pleural ADA, ADA2 and IFN-γ, but not T-SPOT.TB assay, are all sensitive and specific for TB pleurisy. In patients with lymphocyte-predominant pleural exudates, ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL in pleural effusion imply a very high probability of TB pleurisy. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  4. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  5. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande