DEFF Research Database (Denmark)
Ank, Nina; West, Hans; Bartholdy, C.
2006-01-01
Type III interferons (IFNs) (interleukin-28/29 or lambda interferon [IFN-lambda]) are cytokines with IFN-like activities. Here we show that several classes of viruses induce expression of IFN-lambda1 and -lambda2/3 in similar patterns. The IFN-lambdas were-unlike alpha/beta interferon (IFN......-alpha/beta)-induced directly by stimulation with IFN-alpha or -lambda, thus identifying type III IFNs as IFN-stimulated genes. In vitro assays revealed that IFN-lambdas have appreciable antiviral activity against encephalomyocarditis virus (EMCV) but limited activity against herpes simplex virus type 2 (HSV-2), whereas IFN......-alpha potently restricted both viruses. Using three murine models for generalized virus infections, we found that while recombinant IFN-alpha reduced the viral load after infection with EMCV, lymphocytic choriomeningitis virus (LCMV), and HSV-2, treatment with recombinant IFN-lambda in vivo did not affect viral...
DEFF Research Database (Denmark)
Ank, Nina; West, Hans; Bartholdy, Christina
2006-01-01
Type III interferons (IFNs) (interleukin-28/29 or lambda interferon [IFN-lambda]) are cytokines with IFN-like activities. Here we show that several classes of viruses induce expression of IFN-lambda1 and -lambda2/3 in similar patterns. The IFN-lambdas were-unlike alpha/beta interferon (IFN......-alpha/beta)-induced directly by stimulation with IFN-alpha or -lambda, thus identifying type III IFNs as IFN-stimulated genes. In vitro assays revealed that IFN-lambdas have appreciable antiviral activity against encephalomyocarditis virus (EMCV) but limited activity against herpes simplex virus type 2 (HSV-2), whereas IFN......-alpha potently restricted both viruses. Using three murine models for generalized virus infections, we found that while recombinant IFN-alpha reduced the viral load after infection with EMCV, lymphocytic choriomeningitis virus (LCMV), and HSV-2, treatment with recombinant IFN-lambda in vivo did not affect viral...
A Promising IFN-Deficient System to Manufacture IFN-Sensitive Influenza Vaccine Virus.
Chen, Can; Fan, Wenhui; Li, Jing; Zheng, Weinan; Zhang, Shuang; Yang, Limin; Liu, Di; Liu, Wenjun; Sun, Lei
2018-01-01
Interferon (IFN)-sensitive and replication-incompetent influenza viruses are likely to be the alternatives to inactivated and attenuated virus vaccines. Some IFN-sensitive influenza vaccine candidates with modified non-structural protein 1 (NS1) are highly attenuated in IFN-competent hosts but induce robust antiviral immune responses. However, little research has been done on the manufacturability of these IFN-sensitive vaccine viruses. Here, RIG-I-knockout 293T cells were used to package the IFN-sensitive influenza A/WSN/33 (H1N1) virus expressing the mutant NS1 R38A/K41A. We found that the packaging efficiency of the NS1 R38A/K41A virus in RIG-I-knockout 293T cells was much higher than that in 293T cells. Moreover, the NS1 R38A/K41A virus almost lost its IFN antagonist activity and could no longer replicate in A549, MDCK, and Vero cells after 3-6 passages. This indicated that the replication of NS1 R38A/K41A virus is limited in conventional cells. Therefore, we further established a stable Vero cell line expressing the wild-type (WT) NS1 of the WSN virus, based on the Tet-On 3G system. The NS1 R38A/K41A virus was able to steadily propagate in this IFN-deficient cell line for at least 20 passages. In a mouse model, the NS1 R38A/K41A virus showed more than a 4-log reduction in lung virus titers compared to the WT virus at 3 and 5 days post infection. Furthermore, we observed that the NS1 R38A/K41A virus triggered high-level of IFN-α/β production in lung tissues and was eliminated from the host in a relatively short period of time. Additionally, this virus induced high-titer neutralizing antibodies against the WT WSN, A/Puerto Rico/8/1934 (PR8), or A/California/04/2009 (CA04) viruses and provided 100% protection against the WT WSN virus. Thus, we found that the replication of the NS1 R38A/K41A virus was limited in IFN-competent cells and mice. We also presented a promising IFN-deficient system, involving a RIG-I-knockout 293T cell line to package the IFN
Matthaei, Markus; Budt, Matthias; Wolff, Thorsten
2013-01-01
The fatal transmissions of highly pathogenic avian influenza A viruses (IAV) of the H5N1 subtype to humans and high titer replication in the respiratory tract indicate that these pathogens can overcome the bird-to-human species barrier. While type I interferons (IFN-α/β) are well described to contribute to the species barrier of many zoonotic viruses, current data to the role of these antiviral cytokines during human H5N1 IAV infections is limited and contradictory. We hypothesized an important role for the IFN system in limiting productive infection of avian H5N1 strains in human cells. Hence, we examined IFN-α/β gene activation by different avian and human H5N1 isolates, if the IFN-α/β response restricts H5N1 growth and whether the different strains were equally capable to regulate the IFN-α/β system via their IFN-antagonistic NS1 proteins. Two human H5N1 isolates and a seasonal H3N2 strain propagated efficiently in human respiratory cells and induced little IFN-β, whereas three purely avian H5N1 strains were attenuated for replication and provoked higher IFN secretion. Replication of avian viruses was significantly enhanced on interferon-deficient cells, and exogenous IFN potently limited the growth of all strains in human cells. Moreover, IFN-α/β activation by all strains depended on retinoic acid-inducible gene I excluding principal differences in receptor activation between the different viruses. Interestingly, all H5N1 NS1 proteins suppressed IFN-α/β induction comparably well to the NS1 of seasonal IAV. Thus, our study shows that H5N1 strains are heterogeneous in their capacity to activate human cells in an NS1-independent manner. Our findings also suggest that H5N1 viruses need to acquire adaptive changes to circumvent strong IFN-α/β activation in human host cells. Since no single amino acid polymorphism could be associated with a respective high- or low induction phenotype we propose that the necessary adaptations to overcome the human IFN
Directory of Open Access Journals (Sweden)
Markus Matthaei
Full Text Available The fatal transmissions of highly pathogenic avian influenza A viruses (IAV of the H5N1 subtype to humans and high titer replication in the respiratory tract indicate that these pathogens can overcome the bird-to-human species barrier. While type I interferons (IFN-α/β are well described to contribute to the species barrier of many zoonotic viruses, current data to the role of these antiviral cytokines during human H5N1 IAV infections is limited and contradictory. We hypothesized an important role for the IFN system in limiting productive infection of avian H5N1 strains in human cells. Hence, we examined IFN-α/β gene activation by different avian and human H5N1 isolates, if the IFN-α/β response restricts H5N1 growth and whether the different strains were equally capable to regulate the IFN-α/β system via their IFN-antagonistic NS1 proteins. Two human H5N1 isolates and a seasonal H3N2 strain propagated efficiently in human respiratory cells and induced little IFN-β, whereas three purely avian H5N1 strains were attenuated for replication and provoked higher IFN secretion. Replication of avian viruses was significantly enhanced on interferon-deficient cells, and exogenous IFN potently limited the growth of all strains in human cells. Moreover, IFN-α/β activation by all strains depended on retinoic acid-inducible gene I excluding principal differences in receptor activation between the different viruses. Interestingly, all H5N1 NS1 proteins suppressed IFN-α/β induction comparably well to the NS1 of seasonal IAV. Thus, our study shows that H5N1 strains are heterogeneous in their capacity to activate human cells in an NS1-independent manner. Our findings also suggest that H5N1 viruses need to acquire adaptive changes to circumvent strong IFN-α/β activation in human host cells. Since no single amino acid polymorphism could be associated with a respective high- or low induction phenotype we propose that the necessary adaptations to
IFN-γ signaling to astrocytes protects from autoimmune mediated neurological disability.
Directory of Open Access Journals (Sweden)
Claudia Hindinger
Full Text Available Demyelination and axonal degeneration are determinants of progressive neurological disability in patients with multiple sclerosis (MS. Cells resident within the central nervous system (CNS are active participants in development, progression and subsequent control of autoimmune disease; however, their individual contributions are not well understood. Astrocytes, the most abundant CNS cell type, are highly sensitive to environmental cues and are implicated in both detrimental and protective outcomes during autoimmune demyelination. Experimental autoimmune encephalomyelitis (EAE was induced in transgenic mice expressing signaling defective dominant-negative interferon gamma (IFN-γ receptors on astrocytes to determine the influence of inflammation on astrocyte activity. Inhibition of IFN-γ signaling to astrocytes did not influence disease incidence, onset, initial progression of symptoms, blood brain barrier (BBB integrity or the composition of the acute CNS inflammatory response. Nevertheless, increased demyelination at peak acute disease in the absence of IFN-γ signaling to astrocytes correlated with sustained clinical symptoms. Following peak disease, diminished clinical remission, increased mortality and sustained astrocyte activation within the gray matter demonstrate a critical role of IFN-γ signaling to astrocytes in neuroprotection. Diminished disease remission was associated with escalating demyelination, axonal degeneration and sustained inflammation. The CNS infiltrating leukocyte composition was not altered; however, decreased IL-10 and IL-27 correlated with sustained disease. These data indicate that astrocytes play a critical role in limiting CNS autoimmune disease dependent upon a neuroprotective signaling pathway mediated by engagement of IFN-γ receptors.
Getting “Inside” Type I IFNs: Type I IFNs in Intracellular Bacterial Infections
Directory of Open Access Journals (Sweden)
Deann T. Snyder
2017-01-01
Full Text Available Type I interferons represent a unique and complex group of cytokines, serving many purposes during innate and adaptive immunity. Discovered in the context of viral infections, type I IFNs are now known to have myriad effects in infectious and autoimmune disease settings. Type I IFN signaling during bacterial infections is dependent on many factors including whether the infecting bacterium is intracellular or extracellular, as different signaling pathways are activated. As such, the repercussions of type I IFN induction can positively or negatively impact the disease outcome. This review focuses on type I IFN induction and downstream consequences during infection with the following intracellular bacteria: Chlamydia trachomatis, Listeria monocytogenes, Mycobacterium tuberculosis, Salmonella enterica serovar Typhimurium, Francisella tularensis, Brucella abortus, Legionella pneumophila, and Coxiella burnetii. Intracellular bacterial infections are unique because the bacteria must avoid, circumvent, and even co-opt microbial “sensing” mechanisms in order to reside and replicate within a host cell. Furthermore, life inside a host cell makes intracellular bacteria more difficult to target with antibiotics. Because type I IFNs are important immune effectors, modulating this pathway may improve disease outcomes. But first, it is critical to understand the context-dependent effects of the type I IFN pathway in intracellular bacterial infections.
De La Cruz-Rivera, Pamela C; Kanchwala, Mohammed; Liang, Hanquan; Kumar, Ashwani; Wang, Lin-Fa; Xing, Chao; Schoggins, John W
2018-01-01
Bats host a large number of zoonotic viruses, including several viruses that are highly pathogenic to other mammals. The mechanisms underlying this rich viral diversity are unknown, but they may be linked to unique immunological features that allow bats to act as asymptomatic viral reservoirs. Vertebrates respond to viral infection by inducing IFNs, which trigger antiviral defenses through IFN-stimulated gene (ISG) expression. Although the IFN system of several bats is characterized at the genomic level, less is known about bat IFN-mediated transcriptional responses. In this article, we show that IFN signaling in bat cells from the black flying fox ( Pteropus alecto ) consists of conserved and unique ISG expression profiles. In IFN-stimulated cells, bat ISGs comprise two unique temporal subclusters with similar early induction kinetics but distinct late-phase declines. In contrast, human ISGs lack this decline phase and remained elevated for longer periods. Notably, in unstimulated cells, bat ISGs were expressed more highly than their human counterparts. We also found that the antiviral effector 2-5A-dependent endoribonuclease, which is not an ISG in humans, is highly IFN inducible in black flying fox cells and contributes to cell-intrinsic control of viral infection. These studies reveal distinctive innate immune features that may underlie a unique virus-host relationship in bats. Copyright © 2017 by The American Association of Immunologists, Inc.
Zhao, Rong; Chen, Ni-Nan; Zhou, Xiao-Wei; Miao, Ping; Hu, Chao-Ying; Qian, Liu; Yu, Qi-Wen; Zhang, Ji-Ying; Nie, Hong; Chen, Xue-hua; Li, Pu; Xu, Rong; Xiao, Lian-Bo; Zhang, Xin; Liu, Jian-Ren; Zhang, Dong-Qing
2014-12-10
Although a variety of drugs have been used to treat the symptoms of rheumatoid arthritis (RA), none of them are able to cure the disease. Interferon β (IFN-β) has pleiotropic effects on RA, but whether it can be used to treat RA remains globally controversial. Thus, in this study we tested the effects of IFN-β on RA patients and on collagen antibody-induced arthritis (CAIA) model mice. The cytokine and auto-antibody expression profiles in the serum and synovial fluid (SF) from RA patients were assessed using enzyme-linked immunosorbent assay (ELISA) and compared with the results from osteoarthritis (OA) patients. Exogenous IFN-β was administered to RA patients and CAIA model mice, and the therapeutic effects were evaluated. Endogenous IFN-β expression in the joint bones of CAIA model mice was evaluated by quantitative real-time PCR (qRT-PCR). The effects of exogenous IFN-β on CAIA model mice were assessed using a clinical scoring system, hematoxylin eosin and safranin-O with fast green counterstain histology, molybdenum target X-ray, and tartrate-resistant acid phosphatase (TRAP) staining. The RANKL-RANK signaling pathway was analyzed using qRT-PCR. The RAW 264.7 cell line was differentiated into osteoclasts with RANKL stimulation and then treated with exogenous IFN-β. The expression of inflammatory cytokines (IFN-γ, IL-17, MMP-3, and RANKL) and auto-antibodies (CII antibodies, RF-IgM, and anti-CCP/GPI) were significantly higher in RA compared with OA patients. After IFN-β intervention, some clinical symptoms in RA patients were partially alleviated, and the expression of IFN-γ, IL-17, MMP-3, and OPG) returned to normal levels. In the CAIA model, the expression of endogenous IFN-β in the joint bones was decreased. After IFN-β administration, the arthritis scores were decreased; synovial inflammation, cartilage, and bone destruction were clearly attenuated; and the expression of c-Fos and NFATc1 were reduced, while RANKL and TRAF6 expression was
DEFF Research Database (Denmark)
Ross, Christian; Engler, Claus Bødker; Sander, Birgit
2002-01-01
We tested for development of binding and neutralizing antibodies to interferon-alpha (IFN-alpha) during IFN-alpha2a therapy of patients with age-related macular degeneration (AMD) of the eyes. Antibodies were investigated retrospectively in sera of 34 patients treated with 3 x 10(6) IU IFN-alpha2...
DEFF Research Database (Denmark)
Ross, Christian; Engler, Claus Bødker; Sander, Birgit
2002-01-01
We tested for development of binding and neutralizing antibodies to interferon-alpha (IFN-alpha) during IFN-alpha2a therapy of patients with age-related macular degeneration (AMD) of the eyes. Antibodies were investigated retrospectively in sera of 34 patients treated with 3 x 10(6) IU IFN-alpha2a...
Melanoma NOS1 expression promotes dysfunctional IFN signaling.
Liu, Qiuzhen; Tomei, Sara; Ascierto, Maria Libera; De Giorgi, Valeria; Bedognetti, Davide; Dai, Cuilian; Uccellini, Lorenzo; Spivey, Tara; Pos, Zoltan; Thomas, Jaime; Reinboth, Jennifer; Murtas, Daniela; Zhang, Qianbing; Chouchane, Lotfi; Weiss, Geoffrey R; Slingluff, Craig L; Lee, Peter P; Rosenberg, Steven A; Alter, Harvey; Yao, Kaitai; Wang, Ena; Marincola, Francesco M
2014-05-01
In multiple forms of cancer, constitutive activation of type I IFN signaling is a critical consequence of immune surveillance against cancer; however, PBMCs isolated from cancer patients exhibit depressed STAT1 phosphorylation in response to IFN-α, suggesting IFN signaling dysfunction. Here, we demonstrated in a coculture system that melanoma cells differentially impairs the IFN-α response in PBMCs and that the inhibitory potential of a particular melanoma cell correlates with NOS1 expression. Comparison of gene transcription and array comparative genomic hybridization (aCGH) between melanoma cells from different patients indicated that suppression of IFN-α signaling correlates with an amplification of the NOS1 locus within segment 12q22-24. Evaluation of NOS1 levels in melanomas and IFN responsiveness of purified PBMCs from patients indicated a negative correlation between NOS1 expression in melanomas and the responsiveness of PBMCs to IFN-α. Furthermore, in an explorative study, NOS1 expression in melanoma metastases was negatively associated with patient response to adoptive T cell therapy. This study provides a link between cancer cell phenotype and IFN signal dysfunction in circulating immune cells.
Exogenous HIV-1 Nef upsets the IFN-γ-induced impairment of human intestinal epithelial integrity.
Directory of Open Access Journals (Sweden)
Maria Giovanna Quaranta
Full Text Available The mucosal tissues play a central role in the transmission of HIV-1 infection as well as in the pathogenesis of AIDS. Despite several clinical studies reported intestinal dysfunction during HIV infection, the mechanisms underlying HIV-induced impairments of mucosal epithelial barrier are still unclear. It has been postulated that HIV-1 alters enterocytic function and HIV-1 proteins have been detected in several cell types of the intestinal mucosa. In the present study, we analyzed the effect of the accessory HIV-1 Nef protein on human epithelial cell line.We used unstimulated or IFN-γ-stimulated Caco-2 cells, as a model for homeostatic and inflamed gastrointestinal tracts, respectively. We investigated the effect of exogenous recombinant Nef on monolayer integrity analyzing its uptake, transepithelial electrical resistance, permeability to FITC-dextran and the expression of tight junction proteins. Moreover, we measured the induction of proinflammatory mediators. Exogenous Nef was taken up by Caco-2 cells, increased intestinal epithelial permeability and upset the IFN-γ-induced reduction of transepithelial resistance, interfering with tight junction protein expression. Moreover, Nef inhibited IFN-γ-induced apoptosis and up-regulated TNF-α, IL-6 and MIP-3α production by Caco-2 cells while down-regulated IL-10 production. The simultaneous exposure of Caco-2 cells to Nef and IFN-γ did not affect cytokine secretion respect to untreated cells. Finally, we found that Nef counteracted the IFN-γ induced arachidonic acid cascade.Our findings suggest that exogenous Nef, perturbing the IFN-γ-induced impairment of intestinal epithelial cells, could prolong cell survival, thus allowing for accumulation of viral particles. Our results may improve the understanding of AIDS pathogenesis, supporting the discovery of new therapeutic interventions.
International Nuclear Information System (INIS)
Vita, C.L.
1994-01-01
Contaminant mass flux by advective and diffusive transport is predicted for five containment barriers that use one or more clay liners, flexible membrane liners (FMLs), or liquid collection and removal systems (LCRS)s. Barriers are engineered systems intended to contain and isolate site contaminants from the environment. Barriers include liners, caps, and cutoff walls. Barriers may be used in contaminated-site cleanups (including CERCLA and RCRA), RCRA landfills, or other RCRA TSDFs. Concepts are provided for barrier performance assessment, including analysis and optimization, for meeting performance requirements and controlling risk at minimum cost. Concepts and results can help in planning, designing, or evaluating and communicating, the use or effectiveness of proposed or existing barriers for site cleanups or waste containment. 15 refs., 6 figs., 5 tabs
Directory of Open Access Journals (Sweden)
Nichole M Miller
2015-08-01
Full Text Available Multiple sclerosis (MS is an autoimmune disease of the central nervous system (CNS mediated by T helper (h1 and/or Th17 CD4 T cells that drive inflammatory lesion development along with demyelination and neuronal damage. Defects in immune regulatory mechanisms are thought to play a role in the pathogenesis of MS. While an early clinical trial indicated that IFN-γ administration was detrimental to MS, studies in the mouse model of MS, experimental autoimmune encephalomyelitis (EAE, indicated that IFN-γ exhibits a number of anti-inflammatory properties within the CNS. These mechanisms include inhibition of IL-17 production, induction of regulatory T cells, T cell apoptosis and regulation of chemokine production. Mice deficient in IFN-γ or its receptor were instrumental in deciphering the anti-inflammatory properties of IFN-γ in the CNS. In particular, they revealed that IFN-γ is a major regulator of neutrophil recruitment into the CNS, which by a variety of mechanisms including disruption of the blood-brain-barrier (BBB and production of reactive oxygen species are thought to contribute to the onset and progression of EAE. Neutrophils were also shown to be instrumental in EAE relapses. To date neutrophils have not been appreciated as a driver of MS, but more recently based largely on the strong EAE data this view is being reevaluated by some investigators in the field.
Contact inhibition and interferon (IFN)-modulated gene expression
Energy Technology Data Exchange (ETDEWEB)
Kulesh, D.A.
1986-01-01
The relationship between cell morphology, proliferation and contact inhibition was studied in normal and malignant human cells which varied in their sensitivity to contact inhibition. Their ability to proliferate was examined under conditions where the cells were constrained into different shapes. Cell proliferation was quantitated by labeling indices, which were inferred by autoradiography, and by total cell counts. The normal cells (JHU-1, IMR-90) were dependent on cell shape for proliferation capability while the transformed cells (RT4, HT1080) were shape-dependent for proliferation. Interferon (IFN) induced shape-dependent proliferation and contact inhibition in the transformed cells when used at subantiproliferative concentrations. This ability of B-IFN to confer a level of proliferation control which is characteristic of normal fibroblasts suggests a possible relationship between gene expression mediated by IFN and those genes involved in the maintenance of regulated cell proliferation. To evaluate this possibility, cDNA libraries were constructed from IFN-treated and untreated HT1080 cells. The resulting 10 IFN-induced and 11 IFN-repressed sequences were then differentially rescreened using /sup 32/P-cDNA probes. This screening resulted in the identification of at least four cDNA sequences which appeared to be proliferation regulated as well as IFN-modulated. These cloned, regulated cDNA sequences were then used as /sup 32/P-labeled probes to study both the gene expression at the mRNA level employing Northern blotting and slot blotting techniques.
1990-06-20
possibility that epithelial surfaces of the upper alimentary and/or respiratory mucosa exposed to lymphocytes treated with low concentrations of IFN or with IFN... Biotechnology Program Office of Naval Research Office of Naval Research 800 N. Quincy Street Code 1213 Arlington, VA 22217-5000 800 N. Quincy Street Arlington
Directory of Open Access Journals (Sweden)
Eleonora Lalle
Full Text Available IL-28B gene polymorphisms predict better therapeutic response and spontaneous clearance of HCV. Moreover, higher expression of IFN-lambda has been reported in patients with the rs12979860 CC favourable genotype. The study aim was to establish possible relationships between IL-28B rs12979860 genotypes and expression of IFN-alpha receptor-1 (IFNAR-1 in naïve HCV patients, and to explore the possible role of IFN-lambda.IFNAR-1 mRNA levels were measured in PBMC from naïve patients with chronic hepatitis C with different IL-28 genotypes. The ability of IFN-lambda to up-regulate the expression of IFNAR-1 was established in PBMC from healthy donors carrying different IL-28B genotypes.Lower IFNAR-1 mRNA levels were observed in PBMC from HCV-infected naïve patients as compared to healthy donors. In healthy donors, IFNAR-1 mRNA levels were independent from IL-28B genotype, while in HCV patients, an increasing gradient was observed in TT vs CT vs CC carriers. In the latter group, a direct correlation between IFNAR-1 and endogenous IL-28B expression was observed. Moreover, IFN-lambda up-regulated IFNAR-1 expression in normal PBMC in a time-and dose-dependent manner, with a more effective response in CC vs TT carriers.Endogenous levels of IFN-lambda may be responsible for partial restoration of IFNAR-1 expression in HCV patients with favourable IL-28 genotype. This, in turn, may confer to CC carriers a response advantage to either endogenous or exogenous IFN-alpha, representing the biological basis for the observed association between CC genotype and favourable outcome of either natural infection (clearance vs chronicization or IFN therapy.
DEFF Research Database (Denmark)
Stylianou, E; Aukrust, P; Bendtzen, K
2000-01-01
-infected patients had raised levels of both IP-10 and IFN-alpha compared with healthy controls (n = 19), with particularly high levels in advanced disease. HAART induced a marked decrease in levels of both IFN-alpha, neopterin and IP-10, though not to normal concentrations. In contrast, IFN-gamma levels were low...
DEFF Research Database (Denmark)
Chinnaswamy, Sreedhar; Wardzynska, Aleksandra; Pawelczyk, Malgorzata
2017-01-01
Lambda interferons (IFNLs) have immunomodulatory functions at epithelial barrier surfaces. IFN-λ4, a recent member of this family is expressed only in a subset of the population due to a frameshift-causing DNA polymorphism rs368234815. We examined the association of this polymorphism with atopy (...
Xu, Lei; Zhou, Xinying; Wang, Wenshi; Wang, Yijin; Yin, Yuebang; Laan, Luc J W van der; Sprengers, Dave; Metselaar, Herold J; Peppelenbosch, Maikel P; Pan, Qiuwei
2016-10-01
IFN regulatory factor 1 (IRF1) is one of the most important IFN-stimulated genes (ISGs) in cellular antiviral immunity. Although hepatitis E virus (HEV) is a leading cause of acute hepatitis worldwide, how ISGs counteract HEV infection is largely unknown. This study was conducted to investigate the effect of IRF1 on HEV replication. Multiple cell lines were used in 2 models that harbor HEV. In different HEV cell culture systems, IRF1 effectively inhibited HEV replication. IRF1 did not trigger IFN production, and chromatin immunoprecipitation sequencing data analysis revealed that IRF1 bound to the promoter region of signal transducers and activators of transcription 1 (STAT1). Functional assay confirmed that IRF1 could drive the transcription of STAT1, resulting in elevation of total and phosphorylated STAT1 proteins and further activating the transcription of a panel of downstream antiviral ISGs. By pharmacological inhibitors and RNAi-mediated gene-silencing approaches, we revealed that antiviral function of IRF1 is dependent on the JAK-STAT cascade. Furthermore, induction of ISGs and the anti-HEV effect of IRF1 overlapped that of IFNα, but was potentiated by ribavirin. We demonstrated that IRF1 effectively inhibits HEV replication through the activation of the JAK-STAT pathway, and the subsequent transcription of antiviral ISGs, but independent of IFN production.-Xu, L., Zhou, X., Wang, W., Wang, Y., Yin, Y., van der Laan, L. J. W., Sprengers, D., Metselaar, H. J., Peppelenbosch, M. P., Pan, Q. IFN regulatory factor 1 restricts hepatitis E virus replication by activating STAT1 to induce antiviral IFN-stimulated genes. © FASEB.
Directory of Open Access Journals (Sweden)
Bret Poat
2010-09-01
Full Text Available We have developed multiple stable cell lines containing subgenomic HCV RNA that are resistant to treatment with interferon alpha (IFN-α. Characterization of these IFN-α resistant replicon cells showed defects in the phosphorylation and nuclear translocation of STAT1 and STAT2 proteins due to a defective Jak-STAT pathway.In this study, we have developed an alternative strategy to overcome interferon resistance in a cell culture model by improving intracellular STAT1 signaling. An engineered STAT1-CC molecule with double cysteine substitutions in the Src-homology 2 (SH2 domains of STAT1 (at Ala-656 and Asn-658 efficiently phosphorylates and translocates to the nucleus of IFN-resistant cells in an IFN-γ dependent manner. Transfection of a plasmid clone containing STAT1-CC significantly activated the GAS promoter compared to wild type STAT1 and STAT3. The activity of the engineered STAT1-CC is dependent upon the phosphorylation of tyrosine residue 701, since the construct with a substituted phenylalanine residue at position 701 (STAT1-CC-Y701F failed to activate GAS promoter in the replicon cells. Intracellular expression of STAT1-CC protein showed phosphorylation and nuclear translocation in the resistant cell line after IFN-γ treatment. Transient transfection of STAT1-CC plasmid clone into an interferon resistant cell line resulted in inhibition of viral replication and viral clearance in an IFN-γ dependent manner. Furthermore, the resistant replicon cells transfected with STAT1-CC constructs significantly up regulated surface HLA-1 expression when compared to the wild type and Y to F mutant controls.These results suggest that modification of the SH2 domain of the STAT1 molecule allows for improved IFN-γ signaling through increased STAT1 phosphorylation, nuclear translocation, HLA-1 surface expression, and prolonged interferon antiviral gene activation.
Xu, Xiaoguang; Huang, Haiyan; Wang, Qiang; Cai, Ming; Qian, Yeyong; Han, Yong; Wang, Xinying; Gao, Yu; Yuan, Ming; Xu, Liang; Yao, Chen; Xiao, Li; Shi, Bingyi
2017-02-01
IFN-γ is a protypical proinflammatory cytokine that plays a central role in inflammation and acute graft rejection. Accumulating evidence indicates that IFN-γ can exert previously unexpected immunoregulatory activities. However, little is known about the role of IFN-γ secreted by Th1-like regulatory T cells in human kidney transplantation. To determine the function of IFN-γ in acute T cell-mediated renal allograft rejection (ACR), we examined serum cytokine expression profiles in ACR patients by human cytokine multiplex immunoassay and analyzed the cellular origins of IFN-γ in peripheral blood and renal allograft biopsies from ACR cases and controls by flow cytometry and immunohistochemistry, respectively. The results showed significant reduction in serum concentrations of Th1-inducing cytokines IL-12p70 and IFN-γ as well as Th2-related cytokine IL-4 in ACR patients compared with stable controls. However, levels of several Th1-, Th2- and Th17-related cytokines, such as IL-2, TNF-α, TNF-β, IL-12 (p40), IL-10, IL-15, IL-17, IL-21, and IL-23, as well as the frequencies of Th1 and Th17 cell, did not differ between ACR cases and stable controls. Moreover, we found the levels of IFN-γ were correlated with those of the anti-inflammatory factor, IL-1 receptor antagonist (IL-1Ra) in ACR. Notably, the Th1-like Treg cell-to-Foxp3 - Th1 cell ratio was significantly lower in ACR patients compared with that in stable controls. In graft biopsies from ACR patients, Treg cells and Th1-like Treg cells were less abundant than those without ACR. Our study indicates that IFN-γ secreted from Th1-like Treg cells negatively modulates ACR. Copyright © 2016 Elsevier GmbH. All rights reserved.
ISG15 Inhibits IFN-α-Resistant Liver Cancer Cell Growth
Directory of Open Access Journals (Sweden)
Xin-xing Wan
2013-01-01
Full Text Available Hepatocellular carcinoma (HCC is one of the most prevalent tumors worldwide. Interferon-α (IFN-α has been widely used in the treatment of HCC, but patients eventually develop resistance. ISG15 ubiquitin-like modifier (ISG15 is a ubiquitin-like protein transcriptionally regulated by IFN-α which shows antivirus and antitumor activities. However, the exact role of ISG15 is unknown. In the present study, we showed that IFN-α significantly induced ISG15 expression but failed to induce HepG2 cell apoptosis, whereas transient overexpression of ISG15 dramatically increased HepG2 cell apoptosis. ISG15 overexpression increased overall protein ubiquitination, which was not observed in cells with IFN-α-induced ISG15 expression, suggesting that IFN-α treatment not only induced the expression of ISG15 but also inhibited ISG15-mediated ubiquitination. The tumor suppressor p53 and p21 proteins are the key regulators of cell survival and death in response to stress signals such as DNA damage. We showed that p53 or p21 is only up regulated in HepG2 cells ectopically expressing ISG15, but not in the presence of IFN-α-induced ISG15. Our results suggest that ISG15 overexpression could be developed into a powerful gene-therapeutic tool for treating IFN-α-resistant HCC.
Lauw, F. N.; Simpson, A. J.; Prins, J. M.; van Deventer, S. J.; Chaowagul, W.; White, N. J.; van der Poll, T.
2000-01-01
Gamma interferon (IFN-gamma)-inducible protein 10 (IP-10) and monokine induced by IFN-gamma (Mig) are related CXC chemokines which bind to the CXCR3 receptor and specifically target activated T lymphocytes and natural killer (NK) cells. The production of IP-10 and Mig by various cell types in vitro
Directory of Open Access Journals (Sweden)
Lee AS
2017-10-01
Full Text Available Allister Sebastian Lee,1 Mieke L van Driel,2 Darrell HG Crawford3,4 1Faculty of Medicine, 2Primary Care Clinical Unit, Faculty of Medicine, 3School of Clinical Medicine, Faculty of Medicine, University of Queensland, 4Gallipoli Medical Research Foundation, Greenslopes Private Hospital, Brisbane, Australia Background: Chronic hepatitis C remains a major global health burden with serious long-term consequences if left untreated. Recently the treatment standard of care has shifted to new interferon (IFN-free drug regimens, which have been shown to be safe and effective. The aim of our study was to assess and compare medical resource utilization and costs of successfully treating patients with IFN-based and IFN-free therapies in Australia. Methods: We performed a retrospective chart review of 30 HCV-infected patients successfully treated with IFN-based therapy between 2013 and 2015. We also generated a model for a virtual group of 100 genotype 1 (GT1 and 100 genotype 3 (GT3 patients treated with IFN-free therapy derived from national guidelines and clinical trial data. Results: In comparison to virtual patients receiving IFN-free therapy, our IFN-treated patients on average had distinctively more liver clinic visits and blood tests. However, mean total cost per patient was $19,164 and $85,300 (AUD more for GT1 and GT3 patients receiving IFN-free therapy, respectively. This difference was largely accounted for by higher antiviral drug costs. Of our 30 patients treated with IFN, total mean cost per patient during the study period was $33,595. Conclusion: Resource utilization is lower with IFN-free treatment, which reflects the reduced need for patient monitoring and improved side-effect profile of these new drugs. However, total costs are still largely dominated by antiviral drug costs, representing a huge burden on national budgets. Our insight into resource utilization and costs associated with both types of treatment can serve as a reference for
Autophagy Facilitates IFN-γ-induced Jak2-STAT1 Activation and Cellular Inflammation*
Chang, Yu-Ping; Tsai, Cheng-Chieh; Huang, Wei-Ching; Wang, Chi-Yun; Chen, Chia-Ling; Lin, Yee-Shin; Kai, Jui-In; Hsieh, Chia-Yuan; Cheng, Yi-Lin; Choi, Pui-Ching; Chen, Shun-Hua; Chang, Shih-Ping; Liu, Hsiao-Sheng; Lin, Chiou-Feng
2010-01-01
Autophagy is regulated for IFN-γ-mediated antimicrobial efficacy; however, its molecular effects for IFN-γ signaling are largely unknown. Here, we show that autophagy facilitates IFN-γ-activated Jak2-STAT1. IFN-γ induces autophagy in wild-type but not in autophagy protein 5 (Atg5−/−)-deficient mouse embryonic fibroblasts (MEFs), and, autophagy-dependently, IFN-γ induces IFN regulatory factor 1 and cellular inflammatory responses. Pharmacologically inhibiting autophagy using 3-methyladenine, a known inhibitor of class III phosphatidylinositol 3-kinase, confirms these effects. Either Atg5−/− or Atg7−/− MEFs are, independent of changes in IFN-γ receptor expression, resistant to IFN-γ-activated Jak2-STAT1, which suggests that autophagy is important for IFN-γ signal transduction. Lentivirus-based short hairpin RNA for Atg5 knockdown confirmed the importance of autophagy for IFN-γ-activated STAT1. Without autophagy, reactive oxygen species increase and cause SHP2 (Src homology-2 domain-containing phosphatase 2)-regulated STAT1 inactivation. Inhibiting SHP2 reversed both cellular inflammation and the IFN-γ-induced activation of STAT1 in Atg5−/− MEFs. Our study provides evidence that there is a link between autophagy and both IFN-γ signaling and cellular inflammation and that autophagy, because it inhibits the expression of reactive oxygen species and SHP2, is pivotal for Jak2-STAT1 activation. PMID:20592027
Dhar, Jayeeta; Barik, Sailen
2016-12-01
Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.
Directory of Open Access Journals (Sweden)
Zhang Y
2015-07-01
demonstrated the largest difference between IFN-treated and observation patients. Outpatient service costs for IFN-treated patients were $32,414±$2,498, over three times greater than those for observation patients ($10,556±$1,128; P<0.0001.Conclusion: The majority of adjuvant melanoma patients in this study was treated with observation versus IFN treatment. Among those who attempted IFN treatment, most could not complete the recommended course of therapy. Health care costs were significantly greater for patients treated with IFN, with the greatest differences being for melanoma-related medical cost components. These findings illustrate the significant economic burden borne by adjuvant melanoma patients and their health insurers.Keywords: adjuvant melanoma, interferon, claims data, cost analysis
Interferon lambda (IFN-λ) efficiently blocks norovirus transmission in a mouse model.
Rocha-Pereira, Joana; Jacobs, Sophie; Noppen, Sam; Verbeken, Eric; Michiels, Thomas; Neyts, Johan
2018-01-01
Human noroviruses are highly efficient in person to person transmission thus associated with explosive outbreaks of acute gastroenteritis. Outbreak control is limited to disinfection and isolation measures. Strategies to control the spread of noroviruses should be developed and models to study norovirus transmission will greatly facilitate this. Here, a mouse-to-mouse transmission model, in which mice develop acute murine norovirus (MNV)-induced diarrhea, was used to explore the role of interferon lambda (IFN-λ) in the control of a norovirus infection. Sentinel AG129 mice [deficient in IFN-α/β and IFN-γ receptors] that were co-housed with MNV-infected mice shedding high amounts of virus in their stool, developed a MNV-infection with associated diarrhea. Inoculation of such sentinel mice with an IFN-λ expression plasmid resulted in the production of circulating IFN-λ and upregulation of the expression of IFN-stimulated genes (ISGs) of the gut. Injection of the IFN-λ-expressing plasmid to sentinels prevents MNV-induced disease upon exposure to MNV-infected mice, as well as MNV replication in the small intestine, the associated signs of inflammation and the mounting of a specific IgG-based immune response. This demonstrates that IFN-λ can alone mediate protection against transmission of norovirus. The development of a simple delivery method for IFN-λ could be explored as a strategy to control norovirus outbreaks and protect vulnerable populations such as the elderly and immunocompromised. Copyright © 2017. Published by Elsevier B.V.
IFN-beta inhibits T cell activation capacity of central nervous system APCs
DEFF Research Database (Denmark)
Teige, Ingrid; Liu, Yawei; Issazadeh-Navikas, Shohreh
2006-01-01
We have previously investigated the physiological effects of IFN-beta on chronic CNS inflammation and shown that IFN-beta(-/-) mice develop a more severe experimental autoimmune encephalomyelitis than their IFN-beta(+/-) littermates. This result was shown to be associated with a higher activation...... state of the glial cells and a higher T cell cytokine production in the CNS. Because this state suggested a down-regulatory effect of IFN-beta on CNS-specific APCs, these results were investigated further. We report that IFN-beta pretreatment of astrocytes and microglia (glial cells) indeed down......-modulate their capacity to activate autoreactive Th1 cells. First, we investigated the intrinsic ability of glial cells as APCs and report that glial cells prevent autoreactive Th1 cells expansion while maintaining Ag-specific T cell effector functions. However, when the glial cells are treated with IFN-beta before...
Yan, Shanshan; Shen, Hongbo; Lian, Qiaoshi; Jin, Wenlong; Zhang, Ronghua; Lin, Xuan; Gu, Wangpeng; Sun, Xiaoyu; Meng, Guangxun; Tian, Zhigang; Chen, Zheng W; Sun, Bing
2018-02-01
The nucleic acids of Mycobacterium tuberculosis can be detected by intracellular DNA sensors, such as cyclic GMP-AMP synthase and absent in melanoma 2 (AIM2), which results in the release of type I IFN and the proinflammatory cytokine IL-1β. However, whether cross-talk occurs between AIM2-IL-1β and cyclic GMP-AMP synthase-type I IFN signaling upon M. tuberculosis infection in vivo is unclear. In this article, we demonstrate that mycobacterial infection of AIM2 -/- mice reciprocally induces overreactive IFN-β and depressive IFN-γ responses, leading to higher infection burdens and more severe pathology. We also describe the underlying mechanism whereby activated apoptosis-associated speck-like protein interacts with a key adaptor, known as stimulator of IFN genes (STING), and inhibits the interaction between STING and downstream TANK-binding kinase 1 in bone marrow-derived macrophages and bone marrow-derived dendritic cells, consequently reducing the induction of type I IFN. Of note, apoptosis-associated speck-like protein expression is inversely correlated with IFN-β levels in PBMCs from tuberculosis patients. These data demonstrate that the AIM2-IL-1β signaling pathway negatively regulates the STING-type I IFN signaling pathway by impeding the association between STING and TANK-binding kinase 1, which protects the host from M. tuberculosis infection. This finding has potential clinical significance. Copyright © 2018 by The American Association of Immunologists, Inc.
Stat1-independent regulation of gene expression in response to IFN-γ
Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.
2001-01-01
Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994
We Can Still Be Friends: IFN-γ Breaks Up Macrophage Enhancers.
Novakovic, Boris; Wang, Cheng; Logie, Colin
2017-08-15
Interferon (IFN)-γ can prime macrophages for inflammatory responses by several mechanisms, including enhancer establishment and gene activation. In this issue of Immunity, Kang et al. (2017) provide insight into the mechanisms of IFN-γ-mediated gene repression as they show that IFN-γ promotes the disassembly of select active enhancers by interfering with enhancer-binding transcription factor MAF. Copyright © 2017 Elsevier Inc. All rights reserved.
Experimental Evaluation of the Transport Mechanisms of PoIFN-α in Caco-2 Cells
Directory of Open Access Journals (Sweden)
Xin Liu
2017-11-01
Full Text Available For the development of an efficient intestinal delivery system for Porcine interferon-α (PoIFN-α, the understanding of transport mechanisms of which in the intestinal cell is essential. In this study, we investigated the absorption mechanisms of PoIFN-α in intestine cells. Caco-2 cells and fluorescein isothiocyanate-labeled (FITC-PoIFN-α were used to explore the whole transport process, including endocytosis, intracellular trafficking, exocytosis, and transcytosis. Via various techniques, the transport pathways of PoIFN-α in Caco-2 cells and the mechanisms were clarified. Firstly, the endocytosis of PoIFN-α by Caco-2 cells was time, concentration and temperature dependence. And the lipid raft/caveolae endocytosis was the most likely endocytic pathway for PoIFN-α. Secondly, both Golgi apparatus and lysosome were involved in the intracellular trafficking of PoIFN-α. Thirdly, the treatment of indomethacin resulted in a significant decrease of exocytosis of PoIFN-α, indicating the participation of cyclooxygenase. Finally, to evaluate the efficiency of PoIFN-α transport, the transepithelial electrical resistance (TEER value was measured to investigate the tight junctional integrity of the cell monolayers. The fluorescence microscope results revealed that the transport of PoIFN-α across the Caco-2 cell monolayers was restricted. In conclusion, this study depicts a probable picture of PoIFN-α transport in Caco-2 cells characterized by non-specificity, partial energy-dependency and low transcytosis.
Biodistribution analysis of 125I-albumin-IFN-alpha2b fusion protein in rats
International Nuclear Information System (INIS)
Zhou Yaoyuan; Zhang Rongjun; Cai Gangming; Gu Xiaobo; Jiang Mengjun; Zhang Bo; Yang Min; Cao Guoxian; Yang Jianliang
2009-01-01
125 I-albumin-IFN-alpha2b was prepared with the methods of Ch-T and purified with PD-10 column. The radiochemical purity was measured with TCA (trichloroacetic acid) precipitation. The antiviral activities of 125 I-albumin-IFN-alpha2b and albumin-IFN-alpha2b were compared with WISH/VSV system in vitro. SD rats were injected with 125 I-albumin-IFN-alpha2b subcutaneously and sacrificed at 0.5, 2, 6, 24, 48, 90, 180 and 300 h post-injection. Selected organs were dissected, weighed and their radioactivity was measured using γ-counter. The accumulated radioactivity in the tissues was calculated in terms of percentage of injected dose per gram organ (%ID·g -1 ). The labeling yield was 82.72%. The radiochemical purity of 125 I-albumin-IFN-alpha2b was 95.53%, and its radioactivity was 0.26 MBq/μg. The antiviral bioactivities of albumin-IFN-alpha2b and 125 I-albumin- IFN-alpha2b did not change. Biodistribution analysis of 125 I-albumin-IFN-alpha2b in rats showed that concentrated 125 I-albumin-IFN-alpha2b in blood reached maximum at 6 h post injection, and eliminated slowly. No specific accumulation was seen in other tissues. 125 I-albumin-IFN-alpha2b could maintain in peripheral blood for a long time and it meant albumin-IFN-alpha2b would be an effective long-term interferon. (authors)
Wild type measles virus attenuation independent of type I IFN
Directory of Open Access Journals (Sweden)
Horvat Branka
2008-02-01
Full Text Available Abstract Background Measles virus attenuation has been historically performed by adaptation to cell culture. The current dogma is that attenuated virus strains induce more type I IFN and are more resistant to IFN-induced protection than wild type (wt. Results The adaptation of a measles virus isolate (G954-PBL by 13 passages in Vero cells induced a strong attenuation of this strain in vivo. The adapted virus (G954-V13 differs from its parental strain by only 5 amino acids (4 in P/V/C and 1 in the M gene. While a vaccine strain, Edmonston Zagreb, could replicate equally well in various primate cells, both G954 strains exhibited restriction to the specific cell type used initially for their propagation. Surprisingly, we observed that both G954 strains induced type I IFN, the wt strain inducing even more than the attenuated ones, particularly in human plasmacytoid Dendritic Cells. Type I IFN-induced protection from the infection of both G954 strains depended on the cell type analyzed, being less efficient in the cells used to grow the viral strain. Conclusion Thus, mutations in M and P/V/C proteins can critically affect MV pathogenicity, cellular tropism and lead to virus attenuation without interfering with the α/β IFN system.
Directory of Open Access Journals (Sweden)
Yang Ding
2016-09-01
Full Text Available Like mammals, fish possess an interferon regulatory factor 3 (IRF3/IRF7-dependent type I IFN responses, but the exact mechanism by which IRF3/IRF7 regulate the type I IFNs remains largely unknown. In this study, we identified two type I IFNs in the Perciforme fish large yellow croaker Larimichthys crocea, one of which belongs to the fish IFNd subgroup, and the other is assigned to a novel subgroup of group I IFNs in fish, tentatively termed IFNh. The two IFN genes are constitutively expressed in all examined tissues, but with varied expression levels. Both IFN genes can be rapidly induced in head kidney and spleen tissues by polyinosinic-polycytidylic acid. The recombinant IFNh was shown to be more potent to trigger a rapid induction of the antiviral genes MxA and PKR than the IFNd, suggesting that they may play distinct roles in regulating early antiviral immunity. Strikingly, IFNd, but not IFNh, could induce the gene expression of itself and IFNh through a positive feedback loop mediated by the IFNd-dependent activation of IRF3 and IRF7. Furthermore, our data demonstrate that the induction of IFNd can be enhanced by the dimeric formation of IRF3 and IRF7, while the IFNh expression mainly involves IRF3. Taken together, our findings demonstrate that the IFN responses are diverse in fish and are likely to be regulated by distinct mechanisms.
Control of HIV infection by IFN-α: implications for latency and a cure.
Bourke, Nollaig M; Napoletano, Silvia; Bannan, Ciaran; Ahmed, Suaad; Bergin, Colm; McKnight, Áine; Stevenson, Nigel J
2018-03-01
Viral infections, including HIV, trigger the production of type I interferons (IFNs), which in turn, activate a signalling cascade that ultimately culminates with the expression of anti-viral proteins. Mounting evidence suggests that type I IFNs, in particular IFN-α, play a pivotal role in limiting acute HIV infection. Highly active anti-retroviral treatment reduces viral load and increases life expectancy in HIV positive patients; however, it fails to fully eliminate latent HIV reservoirs. To revisit HIV as a curable disease, this article reviews a body of literature that highlights type I IFNs as mediators in the control of HIV infection, with particular focus on the anti-HIV restriction factors induced and/or activated by IFN-α. In addition, we discuss the relevance of type I IFN treatment in the context of HIV latency reversal, novel therapeutic intervention strategies and the potential for full HIV clearance.
IFN signaling: how a non-canonical model led to the development of IFN mimetics
Directory of Open Access Journals (Sweden)
Howard M Johnson
2013-07-01
Full Text Available The classical model of cytokine signaling dominates our view of specific gene activation by cytokines such as the interferons (IFNs. The importance of the model extends beyond cytokines and applies to hormones such as growth hormone (GH and insulin, and growth factors such as epidermal growth factor (EGF and fibroblast growth factor (FGF. According to this model, ligand activates the cell via interaction with the extracellular domain of the receptor. This results in activation of receptor or receptor-associated tyrosine kinases, primarily of the Janus kinase (JAK family, phosphorylation and dimerization of the STAT transcription factors, which dissociate from the receptor cytoplasmic domain and translocate to the nucleus. This view ascribes no further role to the ligand, JAK kinase, or receptor in either specific gene activation or the associated epigenetic events. The presence of dimeric STATs in the nucleus essentially explains it all. Our studies have resulted in the development of a non-canonical, more complex model of IFNγ signaling that is akin to that of steroid hormone/steroid receptor signaling. We have shown that ligand, receptor, activated JAKs and STATs are associated with specific gene activation, where the receptor subunit IFNGR1 functions as a co-transcription factor and the JAKs are involved in associated epigenetic events. We found that the type I IFN system functions similarly. The fact that GH receptor, insulin receptor, EGF receptor, and FGF receptor undergo nuclear translocation upon ligand binding suggests that they may also function similarly. The steroid hormone/steroid receptor nature of type I and II IFN signaling provides insight into the specificity of signaling by members of cytokine families. The non-canonical model could also provide better understanding to more complex cytokine families such as those of IL-2 and IL-12, whose members often use the same JAKs and STATs, but also have different functions and
Murray, Paul D.; McGavern, Dorian B.; Pease, Larry R.; Rodriguez, Moses
2017-01-01
IFN-γ is an anti-viral and immunomodulatory cytokine critical for resistance to multiple pathogens. Using mice with targeted disruption of the gene for IFN-γ, we previously demonstrated that this cytokine is critical for resistance to viral persistence and demyelination in the Theiler’s virus model of multiple sclerosis. During viral infections, IFN-γ is produced by natural killer (NK) cells, CD4+ and CD8+ T cells; however, the proportions of lymphocyte subsets responding to virus infection influences the contributions to IFN-γ-mediated protection. To determine the lymphocyte subsets that produce IFN-γ to maintain resistance, we used adoptive transfer strategies to generate mice with lymphocyte-specific deficiencies in IFN-γ-production. We demonstrate that IFN-γ production by both CD4+ and CD8+ T cell subsets is critical for resistance to Theiler’s murine encephalomyelitis virus (TMEV)-induced demyelination and neurological disease, and that CD4+ T cells make a greater contribution to IFN-γ-mediated protection. To determine the cellular targets of IFN-γ-mediated responses, we used adoptive transfer studies and bone marrow chimerism to generate mice in which either hematopoietic or somatic cells lacked the ability to express IFN-γ receptor. We demonstrate that IFN-γ receptor must be present on central nervous system glia, but not bone marrow-derived lymphocytes, in order to maintain resistance to TMEV-induced demyelination. PMID:11857334
Biologic consequences of Stat1-independent IFN signaling
Gil, M. Pilar; Bohn, Erwin; O'Guin, Andrew K.; Ramana, Chilakamarti V.; Levine, Beth; Stark, George R.; Virgin, Herbert W.; Schreiber, Robert D.
2001-01-01
Although Stat1 is required for many IFN-dependent responses, recent work has shown that IFNγ functions independently of Stat1 to affect the growth of tumor cells or immortalized fibroblasts. We now demonstrate that both IFNγ and IFNα/β regulate proliferative responses in cells of the mononuclear phagocyte lineage derived from Stat1-null mice. Using both representational difference analysis and gene arrays, we show that IFNγ exerts its Stat1-independent actions on mononuclear phagocytes by regulating the expression of many genes. This result was confirmed by monitoring changes in expression and function of the corresponding gene products. Regulation of the expression of these genes requires the IFNγ receptor and Jak1. The physiologic relevance of IFN-dependent, Stat1-independent signaling was demonstrated by monitoring antiviral responses in Stat1-null mice. Thus, the IFN receptors engage alternative Stat1-independent signaling pathways that have important physiological consequences. PMID:11390995
Nuclear reorganization barriers to electron transfer
International Nuclear Information System (INIS)
Sutin, N.; Brunschwig, B.S.; Creutz, C.; Winkler, J.R.
1988-01-01
The nuclear barrier to electron transfer arises from the need for reorganization of intramolecular and solvent internuclear distances prior to electron transfer. For reactions with relatively small driving force (''normal'' free-energy region) the nuclear factors and rates increase as intrinsic inner-shell and outer-shell barriers decrease; this is illustrated by data for transition metal complexes in their ground electronic states. By contrast, in the inverted free-energy region, rates and nuclear factors decrease with decreasing ''intrinsic'' barriers; this is illustrated by data for the decay of charge-transfer excited states. Several approaches to the evaluation of the outer-shell barrier are explored in an investigation of the distance dependence of the nuclear factor in intramolecular electron-transfer processes. 39 refs., 14 figs., 3 tabs
Loss of PTEN causes SHP2 activation, making lung cancer cells unresponsive to IFN-γ
Energy Technology Data Exchange (ETDEWEB)
Chen, Chia-Ling [Translational Research Center, Taipei Medical University, Taipei 110, Taiwan (China); Chiang, Tzu-Hui; Tseng, Po-Chun [Institute of Clinical Medicine, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Wang, Yu-Chih [Department of Microbiology and Immunology, School of Medicine, College of Medicine, Taipei Medical University, Taipei 110, Taiwan (China); Lin, Chiou-Feng, E-mail: cflin2014@tmu.edu.tw [Department of Microbiology and Immunology, School of Medicine, College of Medicine, Taipei Medical University, Taipei 110, Taiwan (China); Graduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taipei 110, Taiwan (China)
2015-10-23
Src homology-2 domain-containing phosphatase (SHP) 2, an oncogenic phosphatase, inhibits type II immune interferon (IFN)-γ signaling by subverting signal transducers and activators of transcription 1 tyrosine phosphorylation and activation. For cancer immunoediting, this study aimed to investigate the decrease of phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a tumor suppressor protein, leading to cellular impairment of IFN-γ signaling. In comparison with human lung adenocarcinoma A549 cells, the natural PTEN loss in another human lung adenocarcinoma line, PC14PE6/AS2 cells, presents reduced responsiveness in IFN-γ-induced IFN regulatory factor 1 activation and CD54 expression. Artificially silencing PTEN expression in A549 cells also caused cells to be unresponsive to IFN-γ without affecting IFN-γ receptor expression. IFN-γ-induced inhibition of cell proliferation and cytotoxicity were demonstrated in A549 cells but were defective in PC14PE6/AS2 cells and in PTEN-deficient A549 cells. Aberrant activation of SHP2 by ROS was specifically shown in PC14PE6/AS2 cells and PTEN-deficient A549 cells. Inhibiting ROS and SHP2 rescued cellular responses to IFN-γ-induced cytotoxicity and inhibition of cell proliferation in PC14PE6/AS2 cells. These results demonstrate that a decrease in PTEN facilitates ROS/SHP2 signaling, causing lung cancer cells to become unresponsive to IFN-γ. - Highlights: • This study demonstrates that PTEN decrease causes cellular unresponsive to IFN-γ. • Lung cancer cells with PTEN deficiency show unresponsive to IFN-γ signaling. • PTEN decrease inhibits IFN-γ-induced CD54, cell proliferation inhibition, and cytotoxicity. • ROS-mediated SHP2 activation makes PTEN-deficient cells unresponsive to IFN-γ.
DEFF Research Database (Denmark)
Hokland, M; Basse, P; Justesen, J
1989-01-01
IFN proteins are a family of lymphokines with anti-viral effects. Several other effects of IFNs have also been described, including enhancement of natural killer (NK) cell activity, enhancement of cytotoxic T-lymphocyte activity, and enhancement of the expression of major histocompatibility compl...... to the classical anti-viral mechanism. This concept proposes that the MHC-enhancing effect of IFNs is a vital part of the immunological defense against virus infections and an integral part of the anti-viral effects of IFN proteins. Udgivelsesdato: 1988-Nov...
DMPD: What is disrupting IFN-alpha's antiviral activity? [Dynamic Macrophage Pathway CSML Database
Lifescience Database Archive (English)
Full Text Available 15283983 What is disrupting IFN-alpha's antiviral activity? Mbow ML, Sarisky RT. Tr...ends Biotechnol. 2004 Aug;22(8):395-9. (.png) (.svg) (.html) (.csml) Show What is disrupting IFN-alpha's ant...iviral activity? PubmedID 15283983 Title What is disrupting IFN-alpha's antiviral activity? Authors Mbow ML,
IFN-β: A Contentious Player in Host–Pathogen Interaction in Tuberculosis
Sabir, Naveed; Hussain, Tariq; Shah, Syed Zahid Ali; Zhao, Deming; Zhou, Xiangmei
2017-01-01
Tuberculosis (TB) is a major health threat to the human population worldwide. The etiology of the disease is Mycobacterium tuberculosis (Mtb), a highly successful intracellular pathogen. It has the ability to manipulate the host immune response and to make the intracellular environment suitable for its survival. Many studies have addressed the interactions between the bacteria and the host immune cells as involving many immune mediators and other cellular players. Interferon-β (IFN-β) signaling is crucial for inducing the host innate immune response and it is an important determinant in the fate of mycobacterial infection. The role of IFN-β in protection against viral infections is well established and has been studied for decades, but its role in mycobacterial infections remains much more complicated and debatable. The involvement of IFN-β in immune evasion mechanisms adopted by Mtb has been an important area of investigation in recent years. These advances have widened our understanding of the pro-bacterial role of IFN-β in host–pathogen interactions. This pro-bacterial activity of IFN-β appears to be correlated with its anti-inflammatory characteristics, primarily by antagonizing the production and function of interleukin 1β (IL-1β) and interleukin 18 (IL-18) through increased interleukin 10 (IL-10) production and by inhibiting the nucleotide-binding domain and leucine-rich repeat protein-3 (NLRP3) inflammasome. Furthermore, it also fails to provoke a proper T helper 1 (Th1) response and reduces the expression of major histocompatibility complex II (MHC-II) and interferon-γ receptors (IFNGRs). Here we will review some studies to provide a paradigm for the induction, regulation, and role of IFN-β in mycobacterial infection. Indeed, recent studies suggest that IFN-β plays a role in Mtb survival in host cells and its downregulation may be a useful therapeutic strategy to control Mtb infection. PMID:29258190
Lubina-Dąbrowska, Natalia; Stepień, Adam; Sulkowski, Grzegorz; Dąbrowska-Bouta, Beata; Langfort, Józef; Chalimoniuk, Małgorzata
2017-08-01
The aim of this study was to investigate the effects of interferon (IFN)-β1a and IFN-β1b treatment on inflammatory factors and myelin protein levels in the brain cortex of the Lewis rat experimental autoimmune encephalomyelitis (EAE), animal model of multiple sclerosis. To induce EAE, rat were immunized with inoculums containing spinal cord guinea pig homogenized in phosphate-buffered saline and emulsified in Freund's complete adjuvant containing 110 µg of the appropriate antigen in 100 µl of an emulsion and additionally 4-mg/ml Mycobacterium tuberculosis (H37Ra). The rats were treated three times per week with subcutaneous applications of 300,000 units IFN-β1a or IFN-β1b. The treatments were started 8 days prior to immunization and continued until day 14 after immunization. The rats were killed on the 14th day of the experiment. EAE induced dramatic increase in interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-concentrations and inducible nitric oxide synthase (iNOS) expression in the brain, which closely corresponded to the course of neurological symptoms and the loss of weight. Both IFN-β1b and IFN-β1a treatments inhibited the pro-inflammatory cytokines (IL-6, IL-1β, TNF-α and IFN-γ), decreased the activation of astrocytes, increased the myelin protein level in the brain cortex, and improved the neurological status of EAE rats by different mechanisms; IFN-β1a reduced iNOS expression, at least in part, by the enhancement of IL-10, while IFN-β1b diminished IL-10 concentration and did not decrease EAE-induced iNOS expression.
Characterization of the bovine type I IFN locus: rearrangements, expansions, and novel subfamilies
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Type I interferons (IFN have major roles in the innate immune response to viruses, a function that is believed to have led to expansion in the number and complexity of their genes, although these genes have remained confined to single chromosomal region in all mammals so far examined. IFNB and IFNE define the limits of the locus, with all other Type I IFN genes except IFNK distributed between these boundaries, strongly suggesting that the locus has broadened as IFN genes duplicated and then evolved into a series of distinct families. Results The Type I IFN locus in Bos taurus has undergone significant rearrangement and expansion compared to mouse and human, however, with the constituent genes separated into two sub-loci separated by >700 kb. The IFNW family is greatly expanded, comprising 24 potentially functional genes and at least 8 pseudogenes. The IFNB (n = 6, represented in human and mouse by one copy, are also present as multiple copies in Bos taurus. The IFNT, which encode a non-virally inducible, ruminant-specific IFN secreted by the pre-implantation conceptus, are represented by three genes and two pseudogenes. The latter have sequences intermediate between IFNT and IFNW. A new Type I IFN family (IFNX of four members, one of which is a pseudogene, appears to have diverged from the IFNA lineage at least 83 million years ago, but is absent in all other sequenced genomes with the possible exception of the horse, a non-ruminant herbivore. Conclusion In summary, we have provided the first comprehensive annotation of the Type I IFN locus in Bos taurus, thereby providing an insight into the functional evolution of the Type I IFN in ruminants. The diversity and global spread of the ruminant species may have required an expansion of the Type I IFN locus and its constituent genes to provide broad anti-viral protection required for foraging and foregut fermentation.
Post-transcriptional regulation of macrophage ABCA1, an early response gene to IFN-γ
International Nuclear Information System (INIS)
Alfaro Leon, Martha Leticia; Evans, Glenn F.; Farmen, Mark W.; Zuckerman, Steven H.
2005-01-01
Interferon-γ (IFN-γ) down-regulates receptors associated with reverse cholesterol transport including ABCA1. In the present study, the kinetics and mechanism of ABCA1 down-regulation were determined in mouse peritoneal macrophages. IFN-γ decreased ABCA1 mRNA 1 h following IFN-γ addition and was maximally reduced by 3 h. Down-regulation was protein synthesis dependent and involved post-transcriptional processes. ABCA1 message had a T 1/2 of 115 min in actinomycin treated cells that was reduced to a T 1/2 of 37 min by IFN-γ. The decrease in message stability was also associated with a rapid loss of ABCA1 protein, significant 3 h following IFN-γ addition. The kinetics of ABCA1 message and protein decrease was consistent with the early IFN-γ-induced changes in Stat1 phosphorylation and nuclear translocation observed in these cells. Therefore, ABCA1 can be considered as an early response gene to macrophage activation by IFN-γ with down-regulation occurring by message destabilization
DEFF Research Database (Denmark)
Inácio, Ana R; Liu, Yawei; Clausen, Bettina H
2015-01-01
of infiltrating leukocytes in the brain 2 days after stroke. Concomitantly, in the blood of IFN-βKO mice, we found a higher percentage of total B cells but a similar percentage of mature and activated B cells, collectively indicating a higher proliferation rate. The additional differential regulation......BACKGROUND: Interferon (IFN)-β exerts anti-inflammatory effects, coupled to remarkable neurological improvements in multiple sclerosis, a neuroinflammatory condition of the central nervous system. Analogously, it has been hypothesized that IFN-β, by limiting inflammation, decreases neuronal death...... strength tests, and cerebral infarct volumes were given by lack of neuronal nuclei immunoreactivity. RESULTS: Here, we report alterations in local and systemic inflammation in IFN-β knockout (IFN-βKO) mice over 8 days after induction of focal cerebral ischemia. Notably, IFN-βKO mice showed a higher number...
Watanuki, Hironobu; Chakraborty, Gunimala; Korenaga, Hiroki; Kono, Tomoya; Shivappa, R B; Sakai, Masahiro
2009-10-15
Human interferon-alpha (huIFN-alpha) is an important immunomodulatory substance used in the treatment and prevention of numerous infectious and immune-related diseases in animals. However, the immunostimulatory effects of huIFN-alpha in fish remain to be investigated. In the current study, the immune responses of the carp species Cyprinus carpio L. to treatment with huIFN-alpha were analyzed via measurement of superoxide anion production, phagocytic activity and the expression of cytokine genes including interleukin-1beta, tumor necrosis factor-alpha and interleukin 10. Low doses of huIFN-alpha were administered orally once a day for 3 days, and sampling was carried out at 1, 3 and 5 days post-treatment. Our results indicate that a low dose of huIFN-alpha significantly increased phagocytic activity and superoxide anion production in the carp kidney. The huIFN-alpha-treated fish also displayed a significant upregulation in cytokine gene expression. The current study demonstrates the stimulatory effects of huIFN-alpha on the carp immune system and highlights the immunomodulatory role of huIFN-alpha in fish.
Resolution of PMA-Induced Skin Inflammation Involves Interaction of IFN-γ and ALOX15
Directory of Open Access Journals (Sweden)
Guojun Zhang
2013-01-01
Full Text Available Background. Acute inflammation and its timely resolution play important roles in the body’s responses to the environmental stimulation. Although IFN-γ is well known for the induction of inflammation, its role in the inflammation resolution is still poorly understood. Methodology and Principal Findings. In this study, we investigated the function of interferon gamma (IFN-γ during the resolution of PMA-induced skin inflammation in vivo. The results revealed that the expression levels of IL-6, TNF-α, and monocyte chemoattractant protein 1 (MCP-1 in skin decreased during the resolution stage of PMA-induced inflammation, while IFN-γ is still maintained at a relatively high level. Neutralization of endogenous IFN-γ led to accelerated reduction of epidermal thickness and decreased epithelial cell proliferation. Similarly, decreased infiltration of inflammatory cells (Gr1+ or CD11b+ cells and a significant reduction of proinflammatory cytokines were also observed upon the blockade of IFN-γ. Furthermore, neutralization of IFN-γ boosted ALOX15 expression of the skin during inflammation resolution. In accordance, application of lipoxin A4 (LXA4, a product of ALOX15 obtained a proresolution effect similar to neutralization of IFN-γ. These results demonstrated that through upregulating ALOX15-LXA4 pathway, blockage of IFN-γ can promote the resolution of PMA-induced skin inflammation.
Type I IFN-related NETosis in ataxia telangiectasia and Artemis deficiency.
Gul, Ersin; Sayar, Esra Hazar; Gungor, Bilgi; Eroglu, Fehime Kara; Surucu, Naz; Keles, Sevgi; Guner, Sukru Nail; Findik, Siddika; Alpdundar, Esin; Ayanoglu, Ihsan Cihan; Kayaoglu, Basak; Geckin, Busra Nur; Sanli, Hatice Asena; Kahraman, Tamer; Yakicier, Cengiz; Muftuoglu, Meltem; Oguz, Berna; Cagdas Ayvaz, Deniz Nazire; Gursel, Ihsan; Ozen, Seza; Reisli, Ismail; Gursel, Mayda
2017-11-16
Pathological inflammatory syndromes of unknown etiology are commonly observed in ataxia telangiectasia (AT) and Artemis deficiency. Similar inflammatory manifestations also exist in patients with STING-associated vasculopathy in infancy (SAVI). We sought to test the hypothesis that the inflammation-associated manifestations observed in patients with AT and Artemis deficiency stem from increased type I IFN signature leading to neutrophil-mediated pathological damage. Cytokine/protein signatures were determined by ELISA, cytometric bead array, or quantitative PCR. Stat1 phosphorylation levels were determined by flow cytometry. DNA species accumulating in the cytosol of patients' cells were quantified microscopically and flow cytometrically. Propensity of isolated polymorhonuclear granulocytes to form neutrophil extracellular traps (NETs) was determined using fluorescence microscopy and picogreen assay. Neutrophil reactive oxygen species levels and mitochondrial stress were assayed using fluorogenic probes, microscopy, and flow cytometry. Type I and III IFN signatures were elevated in plasma and peripheral blood cells of patients with AT, Artemis deficiency, and SAVI. Chronic IFN production stemmed from the accumulation of DNA in the cytoplasm of AT and Artemis-deficient cells. Neutrophils isolated from patients spontaneously produced NETs and displayed indicators of oxidative and mitochondrial stress, supportive of their NETotic tendencies. A similar phenomenon was also observed in neutrophils from healthy controls exposed to patient plasma samples or exogeneous IFN-α. Type I IFN-mediated neutrophil activation and NET formation may contribute to inflammatory manifestations observed in patients with AT, Artemis deficiency, and SAVI. Thus, neutrophils represent a promising target to manage inflammatory syndromes in diseases with active type I IFN signature. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights
Gene expression in IFN-g-activated murine macrophages
Directory of Open Access Journals (Sweden)
Pereira C.A.
2004-01-01
Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.
Critical role of IFN-gamma in CFA-mediated protection of NOD mice from diabetes development.
Mori, Yoshiko; Kodaka, Tetsuro; Kato, Takako; Kanagawa, Edith M; Kanagawa, Osami
2009-11-01
IFN-gamma signaling-deficient non-obese diabetic (NOD) mice develop diabetes with similar kinetics to those of wild-type NOD mice. However, the immunization of IFN-gamma signaling-deficient NOD mice with CFA failed to induce long-term protection, whereas wild-type NOD mice receiving CFA remained diabetes-free. CFA also failed to protect IFN-gamma receptor-deficient (IFN-gammaR(-/-)) NOD mice from the autoimmune rejection of transplanted islets, as it does in diabetic NOD mice, and from disease transfer by spleen cells from diabetic NOD mice. These data clearly show that the pro-inflammatory cytokine IFN-gamma is necessary for the CFA-mediated protection of NOD mice from diabetes. There is no difference in the T(h)1/T(h)17 balance between IFN-gammaR(-/-) NOD and wild-type NOD mice. There is also no difference in the total numbers and percentages of regulatory T (Treg) cells in the lymph node CD4(+) T-cell populations between IFN-gammaR(-/-) NOD and wild-type NOD mice. However, pathogenic T cells lacking IFN-gammaR are resistant to the suppressive effect of Treg cells, both in vivo and in vitro. Therefore, it is likely that CFA-mediated protection against diabetes development depends on a change in the balance between Treg cells and pathogenic T cells, and IFN-gamma signaling seems to control the susceptibility of pathogenic T cells to the inhibitory activity of Treg cells.
International Nuclear Information System (INIS)
Faltynek, C.R.; Princler, G.L.; Schwabe, M.; Shata, M.T.; Lewis, G.K.; Kamin-Lewis, R.M.
1990-01-01
The hybrid recombinant human interferon (IFN) rIFN-alpha A/D was radioiodinated. Specific binding of [125I]rIFN-alpha A/D was observed with both human and murine cell lines. The binding of [125I]rIFN-alpha A/D to human Daudi cells had similar characteristics to the previously described binding of [125I]rIFN-alpha A or -alpha 2. The following lines of evidence demonstrated that [125I]rIFN-alpha A/D bound with high affinity to the same receptor on murine cells as murine IFN-alpha and -beta: (i) the binding of [125I]rIFN-alpha A/D to murine LBRM cells was inhibited to a similar extent by natural murine IFN-alpha, natural murine IFN-beta, and rIFN-A/D; (ii) the Kd (approximately 2 X 10(-10) M) obtained from both competition experiments and saturation binding experiments with [125I]rIFN-alpha A/D was comparable to the previously reported Kd for the binding of natural murine IFN-alpha and -beta to other murine cell lines; (iii) the size of the cross-linked [125I]rIFN-alpha A/D receptor complex formed on murine LBRM cells was similar to the previously reported cross-linked complex formed after binding radioiodinated natural murine IFN-beta to other murine cell lines. Due to the current lack of readily available recombinant murine IFN-alpha or -beta for radiolabeling and the previously demonstrated biological activity of rIFN-alpha A/D on murine cells, [125I]rIFN-alpha A/D should prove to be a useful reagent for further studies of murine IFN receptors
Apoptotic-cell-derived membrane microparticles and IFN-α induce an inflammatory immune response.
Niessen, Anna; Heyder, Petra; Krienke, Stefan; Blank, Norbert; Tykocinski, Lars-Oliver; Lorenz, Hanns-Martin; Schiller, Martin
2015-07-15
A dysregulation in the clearance of apoptotic material is considered a major pathogenetic factor for the emergence of autoimmune diseases. Apoptotic-cell-derived membrane microparticles (AdMPs), which are released from the cell surface during apoptosis, have been implicated in the pathogenesis of autoimmunity. Also of importance are cytokines, such as interferon-α (IFN-α), which is known to be a major player in patients with systemic lupus erythematosus (SLE). This study investigates the combined effect of AdMPs and IFN-α on professional phagocytes. In the presence of IFN-α, phagocytosis of AdMPs by human monocytes was significantly increased in a dose-dependent manner. The combination of AdMPs and raised IFN-α concentrations resulted in an increase in the secretion of pro-inflammatory cytokines and an upregulation of surface molecule expression involved in antigen uptake. In addition, macrophage polarisation was shifted towards a more inflammatory type of cell. The synergism between IFN-α and AdMPs seemed to be mediated by an upregulation of phosphorylated STAT1. Our results indicate that IFN-α, together with AdMPs, amplify the initiation and maintenance of inflammation. This mechanism might especially play a crucial role in disorders with a defective clearance of apoptotic material. © 2015. Published by The Company of Biologists Ltd.
Evaluating pleural ADA, ADA2, IFN-γ and IGRA for diagnosing tuberculous pleurisy.
Keng, Li-Ta; Shu, Chin-Chung; Chen, Jason Yao-Ping; Liang, Sheng-Kai; Lin, Ching-Kai; Chang, Lih-Yu; Chang, Chia-Hao; Wang, Jann-Yuan; Yu, Chong-Jen; Lee, Li-Na
2013-10-01
Conventional methods for diagnosing tuberculous pleurisy (TB pleurisy) are either invasive or have a long turn-around-time. Performances of pleural adenosine deaminase (ADA), ADA2, interferon-gamma (IFN-γ), and interferon-gamma release assays (IGRA) as diagnostic tools for TB pleurisy were evaluated. Eighty-eight patients with lymphocyte-predominant pleural exudates between June 2010 and March 2011, including 31 with clinically diagnosed TB pleurisy, were prospectively studied. Pleural ADA and ADA2 activity were measured by colorimetric method, IFN-γ levels by enzyme-linked immuno-sorbent assay, and IGRA by enzyme-linked immuno-spot (T-SPOT.TB) assay. Pleural ADA, ADA2, and IFN-γ levels, but not the proportion of positive T-SPOT.TB assay, were significantly higher in patients with TB pleurisy than in those without TB pleurisy. The area under the receiver-operating-characteristic (ROC) curve was 0.920, 0.893, 0.875, and 0.544 for IFN-γ, ADA2, ADA, and T-SPOT.TB assay, respectively. The combination of ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL yielded a specificity of 100%. Pleural ADA, ADA2 and IFN-γ, but not T-SPOT.TB assay, are all sensitive and specific for TB pleurisy. In patients with lymphocyte-predominant pleural exudates, ADA ≥ 40 IU/L and IFN-γ ≥ 75 pg/mL in pleural effusion imply a very high probability of TB pleurisy. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Rodríguez, Teresa; Méndez, Rosa; Del Campo, Ana; Jiménez, Pilar; Aptsiauri, Natalia; Garrido, Federico; Ruiz-Cabello, Francisco
2007-01-01
The inability of cancer cells to present antigen on the cell surface via MHC class I molecules is one of the mechanisms by which tumor cells evade anti-tumor immunity. Alterations of Jak-STAT components of interferon (IFN)-mediated signaling can contribute to the mechanism of cell resistance to IFN, leading to lack of MHC class I inducibility. Hence, the identification of IFN-γ-resistant tumors may have prognostic and/or therapeutic relevance. In the present study, we investigated a mechanism of MHC class I inducibility in response to IFN-γ treatment in human melanoma cell lines. Basal and IFN-induced expression of HLA class I antigens was analyzed by means of indirect immunofluorescence flow cytometry, Western Blot, RT-PCR, and quantitative real-time RT-PCR (TaqMan ® Gene Expression Assays). In demethylation studies cells were cultured with 5-aza-2'-deoxycytidine. Electrophoretic Mobility Shift Assay (EMSA) was used to assay whether IRF-1 promoter binding activity is induced in IFN-γ-treated cells. Altered IFN-γ mediated HLA-class I induction was observed in two melanoma cells lines (ESTDAB-004 and ESTDAB-159) out of 57 studied, while treatment of these two cell lines with IFN-α led to normal induction of HLA class I antigen expression. Examination of STAT-1 in ESTDAB-004 after IFN-γ treatment demonstrated that the STAT-1 protein was expressed but not phosphorylated. Interestingly, IFN-α treatment induced normal STAT-1 phosphorylation and HLA class I expression. In contrast, the absence of response to IFN-γ in ESTDAB-159 was found to be associated with alterations in downstream components of the IFN-γ signaling pathway. We observed two distinct mechanisms of loss of IFN-γ inducibility of HLA class I antigens in two melanoma cell lines. Our findings suggest that loss of HLA class I induction in ESTDAB-004 cells results from a defect in the earliest steps of the IFN-γ signaling pathway due to absence of STAT-1 tyrosine-phosphorylation, while absence
Gliovascular and cytokine interactions modulate brain endothelial barrier in vitro.
Chaitanya, Ganta V; Cromer, Walter E; Wells, Shannon R; Jennings, Merilyn H; Couraud, P Olivier; Romero, Ignacio A; Weksler, Babette; Erdreich-Epstein, Anat; Mathis, J Michael; Minagar, Alireza; Alexander, J Steven
2011-11-23
The glio-vascular unit (G-unit) plays a prominent role in maintaining homeostasis of the blood-brain barrier (BBB) and disturbances in cells forming this unit may seriously dysregulate BBB. The direct and indirect effects of cytokines on cellular components of the BBB are not yet unclear. The present study compares the effects of cytokines and cytokine-treated astrocytes on brain endothelial barrier. 3-dimensional transwell co-cultures of brain endothelium and related-barrier forming cells with astrocytes were used to investigate gliovascular barrier responses to cytokines during pathological stresses. Gliovascular barrier was measured using trans-endothelial electrical resistance (TEER), a sensitive index of in vitro barrier integrity. We found that neither TNF-α, IL-1β or IFN-γ directly reduced barrier in human or mouse brain endothelial cells or ECV-304 barrier (independent of cell viability/metabolism), but found that astrocyte exposure to cytokines in co-culture significantly reduced endothelial (and ECV-304) barrier. These results indicate that the barrier established by human and mouse brain endothelial cells (and other cells) may respond positively to cytokines alone, but that during pathological conditions, cytokines dysregulate the barrier forming cells indirectly through astrocyte activation involving reorganization of junctions, matrix, focal adhesion or release of barrier modulating factors (e.g. oxidants, MMPs). © 2011 Chaitanya et al; licensee BioMed Central Ltd.
Pharmacogenomics of IFN-beta in multiple sclerosis: towards a personalized medicine approach
Vosslamber, Saskia; van Baarsen, Lisa G. M.; Verweij, Cornelis L.
2009-01-01
Multiple sclerosis (MS) is an inflammatory disease of the CNS. The clinical presentation of MS is heterogeneous. Interferons (IFNs) were the first agents to show clinical efficacy in the treatment of MS and prolonged treatment is still the best available therapy. Although IFN treatment ameliorates
Intracellular fate of recombinant human interferon-gamma (rIFN) in U937 cells
International Nuclear Information System (INIS)
Finbloom, D.S.
1986-01-01
After IFN binds to specific receptors on macrophages, both modulation of surface molecules and induction of microbicidal and tumoricidal activity occurs 24-48 hr later. Since the intracellular events required to insure these responses are poorly defined, the fate of radiolabeled rIFN in U937 cells was examined. Endocytosis was determined by exposing cells to pH 2.5 to allow rIFN to dissociate leaving only intracellular ligand. Degradation was measured as trichloroacetic acid soluble radioactivity in the media. Of the 4-5000 molecules of rIFN that specifically and saturably (at 300 U/ml) bound at 4 0 C, 40% dissociated during 15-30 min after cells were warmed to 37 0 C. However, if cells were continuously exposed at 37 0 C to lower levels of rIFN (60-100 U/ml), 30-40% of those molecules capable of binding to the cell at that concentration were internalized. Furthermore, 60% of the molecules were degraded during 3-4 hr of additional culture. Since exposure of cells to chloroquine and monensin resulted in only partial inhibition of degradation (75% and 43%, respectively), there may also be degradation within endosomes or on the cell following binding to its receptor. Soon thereafter, degradation products are measurable. Since many biological responses require prolonged incubation with the molecule, intracellular processing of IFN may be important for expression of these effects
Converse Barrier Certificate Theorem
DEFF Research Database (Denmark)
Wisniewski, Rafael; Sloth, Christoffer
2013-01-01
This paper presents a converse barrier certificate theorem for a generic dynamical system.We show that a barrier certificate exists for any safe dynamical system defined on a compact manifold. Other authors have developed a related result, by assuming that the dynamical system has no singular...... points in the considered subset of the state space. In this paper, we redefine the standard notion of safety to comply with generic dynamical systems with multiple singularities. Afterwards, we prove the converse barrier certificate theorem and illustrate the differences between ours and previous work...
Directory of Open Access Journals (Sweden)
Pascale Hermant
Full Text Available Type-I interferons (IFNs form a large family of cytokines that primarily act to control the early development of viral infections. Typical type-I IFN genes, such as those encoding IFN-α or IFN-β are upregulated by viral infection in many cell types. In contrast, the gene encoding IFN-ε was reported to be constitutively expressed by cells of the female reproductive tract and to contribute to the protection against vaginal infections with herpes simplex virus 2 and Chlamydia muridarum. Our data confirm the lack of induction of IFN-ε expression after viral infection and the constitutive expression of IFN-ε by cells of the female but also of the male reproductive organs. Interestingly, when expressed from transfected expression plasmids in 293T, HeLa or Neuro2A cells, the mouse and human IFN-ε precursors were inefficiently processed and secretion of IFN-ε was minimal. Analysis of chimeric constructs produced between IFN-ε and limitin (IFN-ζ showed that both the signal peptide and the mature moiety of IFN-ε contribute to poor processing of the precursor. Immunofluorescent detection of FLAG-tagged IFN-ε in transfected cells suggested that IFN-ε and chimeric proteins were defective for progression through the secretory pathway. IFN-ε did not, however, act intracellularly and impart an antiviral state to producing cells. Given the constitutive expression of IFN-ε in specialized cells and the poor processing of IFN-ε precursor in fibroblasts and cell lines, we hypothesize that IFN-ε secretion may require a co-factor specifically expressed in cells of the reproductive organs, that might secure the system against aberrant release of this IFN.
Association Between IFN-γ Gene Polymorphisms and IgA Nephropathy in a Chinese Han Population
Directory of Open Access Journals (Sweden)
Jie Gao
2017-04-01
Full Text Available Background/Aims: IFN-γ was reported to be involved in the development and progression of Immunoglobulin A nephropathy (IgAN, however, few studies have investigated the association between IFN-γ polymorphisms and IgAN. Therefore, we performed a case-control study to assess the association between IFN-γ polymorphisms and the risk of IgAN. Methods: Sequenom MassARRAY was used to genotype two SNPs (rs1861494 and rs2430561 in 351 patients with IgAN and 310 healthy controls. Associations were evaluated as odd ratios (OR with 95% confidence intervals (CI. Results: No association was found between IFN-γ rs1861494 and IgAN risk or clinical parameters. For rs2430561, the AA genotype was more common in patients with IgAN, compared with controls (AT vs. AA: OR = 0.57, P = 0.035. IFN-γ-rs2430561 T allele may be a protective factor for IgAN susceptibility (T vs. A: OR = 0.59, P = 0.04. Subgroup analysis based on clinical features revealed no significant association between rs2430561 polymorphism and clinical data such as gender, 24-h urine protein, blood pressure, Oxford classifcation and estimated glomerular fltration rate. IgAN patients had a higher IFN-γ serum level than healthy controls and patients with rs1861494 AA genotype had a higher IFN-γ serum level compared with those with AG/GG genotypes. Conclusions: IFN-γ polymorphisms may be involved in the development and progression of IgAN.
Ubiquilin 1 Promotes IFN-γ-Induced Xenophagy of Mycobacterium tuberculosis.
Directory of Open Access Journals (Sweden)
Erik T Sakowski
2015-07-01
Full Text Available The success of Mycobacterium tuberculosis (Mtb as a pathogen rests upon its ability to grow intracellularly in macrophages. Interferon-gamma (IFN-γ is critical in host defense against Mtb and stimulates macrophage clearance of Mtb through an autophagy pathway. Here we show that the host protein ubiquilin 1 (UBQLN1 promotes IFN-γ-mediated autophagic clearance of Mtb. Ubiquilin family members have previously been shown to recognize proteins that aggregate in neurodegenerative disorders. We find that UBQLN1 can interact with Mtb surface proteins and associates with the bacilli in vitro. In IFN-γ activated macrophages, UBQLN1 co-localizes with Mtb and promotes the anti-mycobacterial activity of IFN-γ. The association of UBQLN1 with Mtb depends upon the secreted bacterial protein, EsxA, which is involved in permeabilizing host phagosomes. In autophagy-deficient macrophages, UBQLN1 accumulates around Mtb, consistent with the idea that it marks bacilli that traffic through the autophagy pathway. Moreover, UBQLN1 promotes ubiquitin, p62, and LC3 accumulation around Mtb, acting independently of the E3 ligase parkin. In summary, we propose a model in which UBQLN1 recognizes Mtb and in turn recruits the autophagy machinery thereby promoting intracellular control of Mtb. Thus, polymorphisms in ubiquilins, which are known to influence susceptibility to neurodegenerative illnesses, might also play a role in host defense against Mtb.
Directory of Open Access Journals (Sweden)
Ramadori Giuliano
2008-05-01
Full Text Available Abstract Background and aim The mechanisms of transmigration of inflammatory cells through the sinusoids are still poorly understood. This study aims to identify in vitro conditions (cytokine treatment which may allow a better understanding of the changes in PECAM (platelet endothelial cell adhesion molecule-1-gene-expression observed in vivo. Methods and results In this study we show by immunohistochemistry, that there is an accumulation of ICAM-1 (intercellular cell adhesion molecule-1 and ED1 positive cells in necrotic areas of livers of CCl4-treated rats, whereas there are few PECAM-1 positive cells observable. After the administration of CCl4, we could detect an early rise of levels of IFN-γ followed by an enhanced TGF-β protein level. As shown by Northern blot analysis and surface protein expression analysed by flow cytometry, IFN-γ-treatment decreased PECAM-1-gene-expression in isolated SECs (sinusoidal endothelial cells and mononuclear phagocytes (MNPs in parallel with an increase in ICAM-1-gene-expression in a dose and time dependent manner. In contrast, TGF-β-treatment increased PECAM-1-expression. Additional administration of IFN-γ to CCl4-treated rats and observations in IFN-γ-/- mice confirmed the effect of IFN-γ on PECAM-1 and ICAM-1-expression observed in vitro and increased the number of ED1-expressing cells 12 h after administration of the toxin. Conclusion The early decrease of PECAM-1-expression and the parallel increase of ICAM-1-expression following CCl4-treatment is induced by elevated levels of IFN-γ in livers and may facilitate adhesion and transmigration of inflammatory cells. The up-regulation of PECAM-1-expression in SECs and MNPs after TGF-β-treatment suggests the involvement of PECAM-1 during the recovery after liver damage.
Lin, Chiou-Feng; Chien, Shun-Yi; Chen, Chia-Ling; Hsieh, Chia-Yuan; Tseng, Po-Chun; Wang, Yu-Chih
2016-02-01
Treatment of interferon-γ (IFN-γ) causes cell growth inhibition and cytotoxicity in lung epithelial malignancies. Regarding the induction of autophagy related to IFN-γ signaling, this study investigated the link between autophagy and IFN-γ cytotoxicity. In A549 human lung cancer cells, IFN-γ treatment induced concurrent apoptotic and nonapoptotic events. Unexpectedly, the nonapoptotic cells present mimic extracellular trap cell death (ETosis), which was regulated by caspase-3 and by autophagy induction through immunity-related GTPase family M protein 1 and activating transcription factor 6. Furthermore, IFN-γ signaling controlled mimic ETosis through a mechanism involving an autophagy- and Fas-associated protein with death domain-controlled caspase-8/-3 activation. Following caspase-mediated lamin degradation, IFN-γ caused DNA damage-associated ataxia telangiectasia and Rad3-related protein (ATR)/ataxia telangiectasia mutated (ATM)-regulated mimic ETosis. Upon ATR/ATM signaling, peptidyl arginine deiminase 4 (PAD4)-mediated histone 3 citrullination promoted mimic ETosis. Such IFN-γ-induced effects were defective in PC14PE6/AS2 human lung cancer cells, which were unsusceptible to IFN-γ-induced autophagy. Due to autophagy-based caspase cascade activation, IFN-γ triggers unconventional caspase-mediated DNA damage, followed by ATR/ATM-regulated PAD4-mediated histone citrullination during mimic ETosis in lung epithelial malignancy.
International Nuclear Information System (INIS)
Yang Wei; Li Xiuyi; Gong Shouliang; Sun Ting; Gong Pingsheng
2007-01-01
Objective: To construct the recombinant plasmid pIRESEgr-IFN γ and detect its expression in Lewis lung carcinoma induced by irradiation in vitro. Methods: The recombinant plasmid pIRESEgr-IFN γ containing Egr-1 promoter and IFN γ gene was constructed with gene recombinant technique. The plasmid was transferred into Lewis lung carcinoma by liposome in vitro. The correlations of dose- and time-effects in the expression of IFN γ gene induced by X-ray were detected by ELISA. Results: The identification with enzymes proved that Egr-1 promoter and IFN γ gene were inserted into vector pIRESlneo correctly. After X-ray irradiation with different doses, the expression of IFN γ in the supernatant of Lewis lung carcinoma transfected by pIRESEgr-IFN γ was significantly higher than that in 0 Gy group (P<0.001). After 5 Gy X-ray irradiation, the expression of IFN γ was the highest, being 4.39 times as much as that in 0 Gy group. The expression of IFN γ in the supernatant increased after 5 Gy X-ray irradiation, being 6.27 times as much as that in 0 h group 36 h after irradiation. Conclusion: The recombinant plasmid pIRESEgr-IFN γ is constructed successfully, and it has the property of enhancing the expression of IFN γ gene induced by irradiation. (authors)
DEFF Research Database (Denmark)
Millward, Jason M; Caruso, Maria; Campbell, Iain L
2007-01-01
Inflammation of the CNS, which occurs during multiple sclerosis and experimental autoimmune encephalomyelitis, is characterized by increased levels of IFN-gamma, a cytokine not normally expressed in the CNS. To investigate the role of IFN-gamma in CNS, we used intrathecal injection of a replication......-defective adenovirus encoding murine IFN-gamma (AdIFNgamma) to IFN-gamma-deficient (GKO) mice. This method resulted in stable, long-lived expression of IFN-gamma that could be detected in cerebrospinal fluid using ELISA and Luminex bead immunoassay. IFN-gamma induced expression in the CNS of message and protein...... was predominantly localized to meningeal and ependymal cells, and was also seen in astrocytes and microglia. IFN-gamma-induced chemokine expression did not lead to inflammation. However, when pertussis toxin was given i.p. to mice infected with the IFN-gamma vector, there was a dramatic increase in the number of T...
Directory of Open Access Journals (Sweden)
Nigel J Stevenson
Full Text Available The nucleoside analogue Ribavirin significantly increases patient response to IFN-α treatment of HCV, by directly inhibiting viral replication. Recent studies indicate that Ribavirin also regulates immunity and we propose that Ribavirin enhances specific interferon sensitive gene (ISG expression by amplifying the IFN-α-JAK/STAT pathway. We found that IFN-α-induced STAT1 and STAT3 phosphorylation was increased in hepatocytes co-treated with Ribavirin and IFN-α, compared to IFN-α alone. Ribavirin specifically enhanced IFN-α induced mRNA and protein of the anti-viral mediator MxA, which co-localised with HCV core protein. These novel findings indicate for the first time that Ribavirin, in addition to its viral incorporation, also enhances IFN-α-JAK/STAT signalling, leading to a novel MxA-mediated immuno-modulatory mechanism that may enhance IFN-α anti-viral activity against HCV.
Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria
2016-03-12
Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.
PAI-1 and IFN-γ in the regulation of innate immune homeostasis during sublethal yersiniosis.
Wang, Zheng; Zhao, Qi; Han, Yuxia; Zhang, Dongxia; Zhang, Liangyan; Luo, Deyan
2013-03-01
Plasminogen activator inhibitor type 1 (PAI-l), a key part of the fibrinolytic system, plays a critical host protective role during the acute phase of infection by regulating interferon(IFN)-γ release. IFN-γ regulates PAI-1 expression, which suggests an intricate interplay between PAI-1 and IFN-γ. Here, using the notion of a feedback loop, we report the complicated regulatory relationship between PAI-1 and IFN-γ. Mice were inoculated intravenously with 1×10(3) colony forming units of Yersinia enterocolitica; PAI-1 deficiency enhanced lethality (pimmune homeostasis. Copyright © 2012 Elsevier Inc. All rights reserved.
IFN-λ: A New Class of Interferon with Distinct Functions-Implications for Hepatitis C Virus Research
Directory of Open Access Journals (Sweden)
Bing Liu
2015-01-01
Full Text Available Pegylated interferon-α and ribavirin (PEG-IFN/RBV is widely used to treat chronic hepatitis C virus infection with notorious adverse reactions since the broad expression of IFN-α receptors on all nucleated cells. Accordingly, a Type III IFN with restricted receptors distribution is much safer as an alternative for HCV therapy. In addition, single nucleotide polymorphisms (SNPs near the human IFN-λ3 gene, IL-28B, correlate strongly with the ability to achieve a sustained virological response (SVR to therapy with pegylated IFN-α plus ribavirin in patients infected with chronic hepatitis C. Furthermore, we also discuss the most recent findings: IFN-λ4 predicts treatment outcomes of HCV infection. In consideration of the apparent limitations of current HCV therapy, especially high failure rate and universal side effects, prediction of treatment outcomes prior to the initiation of treatment and developing new alternative drugs are two important goals in HCV research.
Thyroid epithelial cell hyperplasia in IFN-gamma deficient NOD.H-2h4 mice.
Yu, Shiguang; Sharp, Gordon C; Braley-Mullen, Helen
2006-01-01
The role of inflammatory cells in thyroid epithelial cell (thyrocyte) hyperplasia is unknown. Here, we demonstrate that thyrocyte hyperplasia in IFN-gamma-/- NOD.H-2h4 mice has an autoimmune basis. After chronic exposure to increased dietary iodine, 60% of IFN-gamma-/- mice had severe thyrocyte hyperplasia with minimal or moderate lymphocyte infiltration, and thyroid dysfunction with reduced serum T4. All mice produced anti-thyroglobulin autoantibody. Some wild-type NOD.H-2h4 mice had isolated areas of thyrocyte hyperplasia with predominantly lymphocytic infiltration, whereas IL-4-/- and 50% of wild-type NOD.H-2h4 mice developed lymphocytic thyroiditis but no thyrocyte hyperplasia. Both thyroid infiltrating inflammatory cells and environmental factors (iodine) were required to induce thyrocyte hyperplasia. Splenocytes from IFN-gamma-/- mice with thyrocyte hyperplasia, but not splenocytes from naïve IFN-gamma-/- mice, induced hyperplasia in IFN-gamma-/- NOD.H-2h4.SCID mice. These results may provide clues for understanding the mechanisms underlying development of epithelial cell hyperplasia not only in thyroids but also in other tissues and organs.
Qian, Chongsheng; Wang, Yingying; Cai, Huili; Laroye, Caroline; De Carvalho Bittencourt, Marcelo; Clement, Laurence; Stoltz, Jean-François; Decot, Véronique; Reppel, Loïc; Bensoussan, Danièle
2016-01-01
Adoptive antiviral cellular immunotherapy by infusion of virus-specific T cells (VSTs) is becoming an alternative treatment for viral infection after hematopoietic stem cell transplantation. The T memory stem cell (TSCM) subset was recently described as exhibiting self-renewal and multipotency properties which are required for sustained efficacy in vivo. We wondered if such a crucial subset for immunotherapy was present in VSTs. We identified, by flow cytometry, TSCM in adenovirus (ADV)-specific interferon (IFN)-γ+ T cells before and after IFN-γ-based immunomagnetic selection, and analyzed the distribution of the main T-cell subsets in VSTs: naive T cells (TN), TSCM, T central memory cells (TCM), T effector memory cell (TEM), and effector T cells (TEFF). In this study all of the different T-cell subsets were observed in the blood sample from healthy donor ADV-VSTs, both before and after IFN-γ-based immunomagnetic selection. As the IFN-γ-based immunomagnetic selection system sorts mainly the most differentiated T-cell subsets, we observed that TEM was always the major T-cell subset of ADV-specific T cells after immunomagnetic isolation and especially after expansion in vitro. Comparing T-cell subpopulation profiles before and after in vitro expansion, we observed that in vitro cell culture with interleukin-2 resulted in a significant expansion of TN-like, TCM, TEM, and TEFF subsets in CD4IFN-γ T cells and of TCM and TEM subsets only in CD8IFN-γ T cells. We demonstrated the presence of all T-cell subsets in IFN-γ VSTs including the TSCM subpopulation, although this was weakly selected by the IFN-γ-based immunomagnetic selection system.
Characterization of monocyte-derived dendritic cells maturated with IFN-alpha
DEFF Research Database (Denmark)
Svane, I M; Nikolajsen, K; Walter, M R
2006-01-01
Dendritic cells (DC) are promising candidates for cancer immunotherapy. These cells can be generated from peripheral blood monocytes cultured with granulocyte macrophage-colony stimulating factor (GM-CSF) and interleukin-4 (IL-4). In order to obtain full functional capacity, maturation is required......, maturation with IFN-alpha has only a small effect on induction of autologous T-cell stimulatory capacity of the DC. However, an increase in DC allogeneic T-cell stimulatory capacity was observed. These data suggest that IFN-alpha has a potential as a maturation agent used in DC-based cancer vaccine trials...
Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.
Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G
2010-04-15
Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Di eFeng
2013-09-01
Full Text Available Patients with systemic lupus erythematosus (SLE and Sjögren's syndrome (SS display increased levels of type I IFN-induced genes. Plasmacytoid dendritic cells (PDCs are natural interferon producing cells and considered to be a primary source of IFN-α in these two diseases. Differential expression patterns of type I IFN inducible transcripts can be found in different immune cell subsets and in patients with both active and inactive autoimmune disease. A type I IFN gene signature generally consists of three groups of IFN-induced genes - those regulated in response to virus-induced type I IFN, those regulated by the IFN-induced mitogen-activated protein kinase/extracellular-regulated kinase (MAPK/ERK pathway, and those by the IFN-induced phosphoinositide-3 kinase (PI-3K pathway. These three groups of type I IFN-regulated genes control important cellular processes such as apoptosis, survival, adhesion, and chemotaxis, that when dysregulated, contribute to autoimmunity. With the recent generation of large datasets in the public domain from next-generation sequencing and DNA microarray experiments, one can perform detailed analyses of cell type-specific gene signatures as well as identify distinct transcription factors that differentially regulate these gene signatures. We have performed bioinformatics analysis of data in the public domain and experimental data from our lab to gain insight into the regulation of type I IFN gene expression. We have found that the genetic landscape of the IFNA and IFNB genes are occupied by transcription factors, such as insulators CTCF and cohesin, that negatively regulate transcription, as well as IRF5 and IRF7, that positively and distinctly regulate IFNA subtypes. A detailed understanding of the factors controlling type I IFN gene transcription will significantly aid in the identification and development of new therapeutic strategies targeting the IFN pathway in autoimmune disease.
IFN-γ protects from lethal IL-17 mediated viral encephalomyelitis independent of neutrophils
Directory of Open Access Journals (Sweden)
Savarin Carine
2012-05-01
Full Text Available Abstract Background The interplay between IFN-γ, IL-17 and neutrophils during CNS inflammatory disease is complex due to cross-regulatory factors affecting both positive and negative feedback loops. These interactions have hindered the ability to distinguish the relative contributions of neutrophils, Th1 and Th17 cell-derived effector molecules from secondary mediators to tissue damage and morbidity. Methods Encephalitis induced by a gliatropic murine coronavirus was used as a model to assess the direct contributions of neutrophils, IFN-γ and IL-17 to virus-induced mortality. CNS inflammatory conditions were selectively manipulated by adoptive transfer of virus-primed wild-type (WT or IFN-γ deficient (GKO memory CD4+ T cells into infected SCID mice, coupled with antibody-mediated neutrophil depletion and cytokine blockade. Results Transfer of GKO memory CD4+ T cells into infected SCID mice induced rapid mortality compared to recipients of WT memory CD4+ T cells, despite similar virus control and demyelination. In contrast to recipients of WT CD4+ T cells, extensive neutrophil infiltration and IL-17 expression within the CNS in recipients of GKO CD4+ T cells provided a model to directly assess their contribution(s to disease. Recipients of WT CD4+ T cells depleted of IFN-γ did not express IL-17 and were spared from mortality despite abundant CNS neutrophil infiltration, indicating that mortality was not mediated by excessive CNS neutrophil accumulation. By contrast, IL-17 depletion rescued recipients of GKO CD4+ T cells from rapid mortality without diminishing neutrophils or reducing GM-CSF, associated with pathogenic Th17 cells in CNS autoimmune models. Furthermore, co-transfer of WT and GKO CD4+ T cells prolonged survival in an IFN-γ dependent manner, although IL-17 transcription was not reduced. Conclusions These data demonstrate that IL-17 mediates detrimental clinical consequences in an IFN-γ-deprived environment, independent of
Role of IFN-gamma and LPS on Neuron/Glial Co-Cultures Infected by Neospora caninum
Directory of Open Access Journals (Sweden)
Erica Etelvina Viana De Jesus
2014-10-01
Full Text Available Neospora caninum causes cattle abortion and neurological symptoms in dogs. Although infection is usually asymptomatic, classical neurological symptoms of neosporosis may be associated with encephalitis. This parasite can grow in brain endothelial cells without markedly damages, but it can modulate the cellular environment to promote its survival in the brain. In previous studies, we described that IFN-γ decreased the parasite proliferation and down regulated nitric oxide production in astrocyte/microglia cultures. However, it remains unclear how glial cells respond to N. caninum in the presence of neurons. Therefore, we evaluated the effect of 300 IU/mL IFN-γ or 1.0 μg/mL of LPS on infected rat neuron/glial co-cultures. After 72 hours of infection, LPS did not affect the mitochondrial dehydrogenase activity. However, IFN-γ decreased this parameter by 15.5 and 12.0% in uninfected and infected cells, respectively. The number of tachyzoites decreased 54.1 and 44.3% in cells stimulated with IFN-γ and LPS, respectively. Infection or LPS treatment did not change NO production. On the other hand, IFN-γ induced increased nitrite release in 55.7%, but the infection reverted this induction. IL-10 levels increased only in infected cultures (treated or not, meanwhile PGE2 release was improved in IFN-γ/infected or LPS/infected cells. Although IFN-γ significantly reduced the neurite length in uninfected cultures (42.64%; p < 0.001, this inflammatory cytokine reverted the impairment of neurite outgrowth induced by the infection (81.39%. The results suggest a neuroprotective potential response of glia to N. caninum infection under IFN-γ stimulus. This observation contributes to understand the immune mediated mechanisms of neosporosis in CNS
Prencipe, Giusi; Caiello, Ivan; Pascarella, Antonia; Grom, Alexei A; Bracaglia, Claudia; Chatel, Laurence; Ferlin, Walter G; Marasco, Emiliano; Strippoli, Raffaele; de Min, Cristina; De Benedetti, Fabrizio
2018-04-01
The pathogenesis of macrophage activation syndrome (MAS) is not clearly understood: a large body of evidence supports the involvement of mechanisms similar to those implicated in the setting of primary hemophagocytic lymphohistiocytosis. We sought to investigate the pathogenic role of IFN-γ and the therapeutic efficacy of IFN-γ neutralization in an animal model of MAS. We used an MAS model established in mice transgenic for human IL-6 (IL-6TG mice) challenged with LPS (MAS mice). Levels of IFN-γ and IFN-γ-inducible chemokines were evaluated by using real-time PCR in the liver and spleen and by means of ELISA in plasma. IFN-γ neutralization was achieved by using the anti-IFN-γ antibody XMG1.2 in vivo. Mice with MAS showed a significant upregulation of the IFN-γ pathway, as demonstrated by increased mRNA levels of Ifng and higher levels of phospho-signal transducer and activator of transcription 1 in the liver and spleen and increased expression of the IFN-γ-inducible chemokines Cxcl9 and Cxcl10 in the liver and spleen, as well as in plasma. A marked increase in Il12a and Il12b expression was also found in livers and spleens of mice with MAS. In addition, mice with MAS had a significant increase in numbers of liver CD68 + macrophages. Mice with MAS treated with an anti-IFN-γ antibody showed a significant improvement in survival and body weight recovery associated with a significant amelioration of ferritin, fibrinogen, and alanine aminotransferase levels. In mice with MAS, treatment with the anti-IFN-γ antibody significantly decreased circulating levels of CXCL9, CXCL10, and downstream proinflammatory cytokines. The decrease in CXCL9 and CXCL10 levels paralleled the decrease in serum levels of proinflammatory cytokines and ferritin. These results provide evidence for a pathogenic role of IFN-γ in the setting of MAS. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Yamashita, Alex Shimura; das Neves, Rodrigo Xavier; Rosa-Neto, José Cesar; Lira, Fábio Dos Santos; Batista, Miguel Luís; Alcantara, Paulo Sérgio; Otoch, José Pinhata; Seelaender, Marília
2017-01-01
Cachexia is associated with increased morbidity and mortality in cancer. The White adipose tissue (WAT) synthesizes and releases several pro-inflammatory cytokines that play a role in cancer cachexia-related systemic inflammation. IFN-γ is a pleiotropic cytokine that regulates several immune and metabolic functions. To assess whether IFN-γ signalling in different WAT pads is modified along cancer-cachexia progression, we evaluated IFN-γ receptors expression (IFNGR1 and IFNGR2) and IFN-γ protein expression in a rodent model of cachexia (7, 10, and 14days after tumour implantation). IFN-γ protein expression was heterogeneously modulated in WAT, with increases in the mesenteric pad and decreased levels in the retroperitoneal depot along cachexia progression. Ifngr1 was up-regulated 7days after tumour cell injection in mesenteric and epididymal WAT, but the retroperitoneal depot showed reduced Ifngr1 gene expression. Ifngr2 gene expression was increased 7 and 14days after tumour inoculation in mesenteric WAT. The results provide evidence that changes in IFN-γ expression and signalling may be perceived at stages preceding refractory cachexia, and therefore, might be employed as a means to assess the early stage of the syndrome. Copyright © 2016 Elsevier Ltd. All rights reserved.
Immune cell-poor melanomas benefit from PD-1 blockade after targeted type I IFN activation.
Bald, Tobias; Landsberg, Jennifer; Lopez-Ramos, Dorys; Renn, Marcel; Glodde, Nicole; Jansen, Philipp; Gaffal, Evelyn; Steitz, Julia; Tolba, Rene; Kalinke, Ulrich; Limmer, Andreas; Jönsson, Göran; Hölzel, Michael; Tüting, Thomas
2014-06-01
Infiltration of human melanomas with cytotoxic immune cells correlates with spontaneous type I IFN activation and a favorable prognosis. Therapeutic blockade of immune-inhibitory receptors in patients with preexisting lymphocytic infiltrates prolongs survival, but new complementary strategies are needed to activate cellular antitumor immunity in immune cell-poor melanomas. Here, we show that primary melanomas in Hgf-Cdk4(R24C) mice, which imitate human immune cell-poor melanomas with a poor outcome, escape IFN-induced immune surveillance and editing. Peritumoral injections of immunostimulatory RNA initiated a cytotoxic inflammatory response in the tumor microenvironment and significantly impaired tumor growth. This critically required the coordinated induction of type I IFN responses by dendritic, myeloid, natural killer, and T cells. Importantly, antibody-mediated blockade of the IFN-induced immune-inhibitory interaction between PD-L1 and PD-1 receptors further prolonged the survival. These results highlight important interconnections between type I IFNs and immune-inhibitory receptors in melanoma pathogenesis, which serve as targets for combination immunotherapies. Using a genetically engineered mouse melanoma model, we demonstrate that targeted activation of the type I IFN system with immunostimulatory RNA in combination with blockade of immune-inhibitory receptors is a rational strategy to expose immune cell-poor tumors to cellular immune surveillance. ©2014 American Association for Cancer Research.
Directory of Open Access Journals (Sweden)
Chih-Peng Chang
Full Text Available Interferon-gamma (IFN-γ, a potent Th1 cytokine with multiple biological functions, can induce autophagy to enhance the clearance of the invading microorganism or cause cell death. We have reported that Concanavalin A (Con A can cause autophagic cell death in hepatocytes and induce both T cell-dependent and -independent acute hepatitis in immunocompetent and immunodeficient mice, respectively. Although IFN-γ is known to enhance liver injury in Con A-induced hepatitis, its role in autophagy-related hepatocyte death is not clear. In this study we report that IFN-γ can enhance Con A-induced autophagic flux and cell death in hepatoma cell lines. A necrotic cell death with increased lysosomal membrane permeabilization (LMP is observed in Con A-treated hepatoma cells in the presence of IFN-γ. Cathepsin B and L were released from lysosomes to cause cell death. Furthermore, IFN-γ induces immunity related GTPase family M member 1(IRGM1 translocation to lysosomes and prolongs its activity in Con A-treated hepatoma cells. Knockdown of IRGM1 inhibits the IFN-γ/Con A-induced LMP change and cell death. Furthermore, IFN-γ(-/- mice are resistant to Con A-induced autophagy-associated necrotic hepatocyte death. We conclude that IFN-γ enhances Con A-induced autophagic flux and causes an IRGM1-dependent lysosome-mediated necrotic cell death in hepatocytes.
Impaired IFN-α-mediated signal in dendritic cells differentiates active from latent tuberculosis.
Directory of Open Access Journals (Sweden)
Stefania Parlato
Full Text Available Individuals exposed to Mycobacterium tuberculosis (Mtb may be infected and remain for the entire life in this condition defined as latent tuberculosis infection (LTBI or develop active tuberculosis (TB. Among the multiple factors governing the outcome of the infection, dendritic cells (DCs play a major role in dictating antibacterial immunity. However, current knowledge on the role of the diverse components of human DCs in shaping specific T-cell response during Mtb infection is limited. In this study, we performed a comparative evaluation of peripheral blood circulating DC subsets as well as of monocyte-derived Interferon-α DCs (IFN-DCs from patients with active TB, subjects with LTBI and healthy donors (HD. The proportion of circulating myeloid BDCA3+ DCs (mDC2 and plasmacytoid CD123+ DCs (pDCs declined significantly in active TB patients compared to HD, whereas the same subsets displayed a remarkable activation in LTBI subjects. Simultaneously, the differentiation of IFN-DCs from active TB patients resulted profoundly impaired compared to those from LTBI and HD individuals. Importantly, the altered developmental trait of IFN-DCs from active TB patients was associated with down-modulation of IFN-linked genes, marked changes in molecular signaling conveying antigen (Ag presentation and full inability to induce Ag-specific T cell response. Thus, these data reveal an important role of IFN-α in determining the induction of Mtb-specific immunity.
The Scaffolding Protein IQGAP1 Interacts with NLRC3 and Inhibits Type I IFN Production.
Tocker, Aaron M; Durocher, Emily; Jacob, Kimberly D; Trieschman, Kate E; Talento, Suzanna M; Rechnitzer, Alma A; Roberts, David M; Davis, Beckley K
2017-10-15
Sensing of cytosolic nucleotides is a critical initial step in the elaboration of type I IFN. One of several upstream receptors, cyclic GMP-AMP synthase, binds to cytosolic DNA and generates dicyclic nucleotides that act as secondary messengers. These secondary messengers bind directly to stimulator of IFN genes (STING). STING recruits TNFR-associated NF-κB kinase-binding kinase 1 which acts as a critical node that allows for efficient activation of IFN regulatory factors to drive the antiviral transcriptome. NLRC3 is a recently characterized nucleotide-binding domain, leucine-rich repeat containing protein (NLR) that negatively regulates the type I IFN pathway by inhibiting subcellular redistribution and effective signaling of STING, thus blunting the transcription of type I IFNs. NLRC3 is predominantly expressed in lymphoid and myeloid cells. IQGAP1 was identified as a putative interacting partner of NLRC3 through yeast two-hybrid screening. In this article, we show that IQGAP1 associates with NLRC3 and can disrupt the NLRC3-STING interaction in the cytosol of human epithelial cells. Furthermore, knockdown of IQGAP1 in THP1 and HeLa cells causes significantly more IFN-β production in response to cytosolic nucleic acids. This result phenocopies NLRC3-deficient macrophages and fibroblasts and short hairpin RNA knockdown of NLRC3 in THP1 cells. Our findings suggest that IQGAP1 is a novel regulator of type I IFN production, possibly via interacting with NLRC3 in human monocytic and epithelial cells. Copyright © 2017 by The American Association of Immunologists, Inc.
IFN-γ regulates human dental pulp stem cells behavior via NF-κB and MAPK signaling
He, Xinyao; Jiang, Wenkai; Luo, Zhirong; Qu, Tiejun; Wang, Zhihua; Liu, Ningning; Zhang, Yaqing; Cooper, Paul R.; He, Wenxi
2017-01-01
During caries, dental pulp expresses a range of pro-inflammatory cytokines in response to the infectious challenge. Interferon gamma (IFN-γ) is a dimerized soluble cytokine, which is critical for immune responses. Previous study has demonstrated that IFN-γ at relative high concentration (100 ng/mL) treatment improved the impaired dentinogenic and immunosuppressive regulatory functions of disease-derived dental pulp stem cells (DPSCs). However, little is known about the regulatory effects of IFN-γ at relative low concentration on healthy DPSC behavior (including proliferation, migration, and multiple-potential differentiation). Here we demonstrate that IFN-γ at relatively low concentrations (0.5 ng/mL) promoted the proliferation and migration of DPSCs, but abrogated odonto/osteogenic differentiation. Additionally, we identified that NF-κB and MAPK signaling pathways are both involved in the process of IFN-γ-regulated odonto/osteogenic differentiation of DPSCs. DPSCs treated with IFN-γ and supplemented with pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) or SB203580 (a MAPK inhibitor) showed significantly improved potential for odonto/osteogenic differentiation of DPSCs both in vivo and in vitro. These data provide important insight into the regulatory effects of IFN-γ on the biological behavior of DPSCs and indicate a promising therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:28098169
IFN-γ regulates human dental pulp stem cells behavior via NF-κB and MAPK signaling.
He, Xinyao; Jiang, Wenkai; Luo, Zhirong; Qu, Tiejun; Wang, Zhihua; Liu, Ningning; Zhang, Yaqing; Cooper, Paul R; He, Wenxi
2017-01-18
During caries, dental pulp expresses a range of pro-inflammatory cytokines in response to the infectious challenge. Interferon gamma (IFN-γ) is a dimerized soluble cytokine, which is critical for immune responses. Previous study has demonstrated that IFN-γ at relative high concentration (100 ng/mL) treatment improved the impaired dentinogenic and immunosuppressive regulatory functions of disease-derived dental pulp stem cells (DPSCs). However, little is known about the regulatory effects of IFN-γ at relative low concentration on healthy DPSC behavior (including proliferation, migration, and multiple-potential differentiation). Here we demonstrate that IFN-γ at relatively low concentrations (0.5 ng/mL) promoted the proliferation and migration of DPSCs, but abrogated odonto/osteogenic differentiation. Additionally, we identified that NF-κB and MAPK signaling pathways are both involved in the process of IFN-γ-regulated odonto/osteogenic differentiation of DPSCs. DPSCs treated with IFN-γ and supplemented with pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) or SB203580 (a MAPK inhibitor) showed significantly improved potential for odonto/osteogenic differentiation of DPSCs both in vivo and in vitro. These data provide important insight into the regulatory effects of IFN-γ on the biological behavior of DPSCs and indicate a promising therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment.
Collaborative study for the validation of an improved HPLC assay for recombinant IFN-alfa-2.
Jönsson, K H; Daas, A; Buchheit, K H; Terao, E
2016-01-01
The current European Pharmacopoeia (Ph. Eur.) texts for Interferon (IFN)-alfa-2 include a nonspecific photometric protein assay using albumin as calibrator and a highly variable cell-based assay for the potency determination of the protective effects. A request was expressed by the Official Medicines Control Laboratories (OMCLs) for improved methods for the batch control of recombinant interferon alfa-2 bulk and market surveillance testing of finished products, including those formulated with Human Serum Albumin (HSA). A HPLC method was developed at the Medical Products Agency (MPA, Sweden) for the testing of IFN-alfa-2 products. An initial collaborative study run under the Biological Standardisation Programme (BSP; study code BSP039) revealed the need for minor changes to improve linearity of the calibration curves, assay reproducibility and robustness. The goal of the collaborative study, coded BSP071, was to transfer and further validate this improved HPLC method. Ten laboratories participated in the study. Four marketed IFN-alfa-2 preparations (one containing HSA) together with the Ph. Eur. Chemical Reference Substance (CRS) for IFN-alfa-2a and IFN-alfa-2b, and in-house reference standards from two manufacturers were used for the quantitative assay. The modified method was successfully transferred to all laboratories despite local variation in equipment. The resolution between the main and the oxidised forms of IFN-alfa-2 was improved compared to the results from the BSP039 study. The improved method even allowed partial resolution of an extra peak after the principal peak. Symmetry of the main IFN peak was acceptable for all samples in all laboratories. Calibration curves established with the Ph. Eur. IFN-alfa-2a and IFN-alfa-2b CRSs showed excellent linearity with intercepts close to the origin and coefficients of determination greater than 0.9995. Assay repeatability, intermediate precision and reproducibility varied with the tested sample within acceptable
Influence of type I IFN signaling on anti-MOG antibody-mediated demyelination
DEFF Research Database (Denmark)
Berg, Carsten Tue; Khorooshi, Reza M. H.; Asgari, Nasrin
2017-01-01
Background Antibodies with specificity for myelin oligodendrocyte glycoprotein (MOG) are implicated in multiple sclerosis and related diseases. The pathogenic importance of anti-MOG antibody in primary demyelinating pathology remains poorly characterized. Objective The objective of this study...... is to investigate whether administration of anti-MOG antibody would be sufficient for demyelination and to determine if type I interferon (IFN) signaling plays a similar role in anti-MOG antibody-mediated pathology, as has been shown for neuromyelitis optica-like pathology. Methods Purified IgG2a monoclonal anti...... demyelination in wild-type and IFNAR1-KO mice. Conclusions Anti-MOG antibody and complement was sufficient to induce callosal demyelination, and pathology was dependent on type I IFN. Induction of EAE in IFNAR1-KO mice overcame the dependence on type I IFN for anti-MOG and complement-mediated demyelination....
DEFF Research Database (Denmark)
Andersen, Stig Henrik; Vervelde, Lonneke; Sutton, Kate
2017-01-01
controls, one group was vaccinated intramuscularly twice with a commercial inactivated ND virus (NDV) vaccine, and the last group was vaccinated orally twice with a commercial live attenuated NDV vaccine. PBMC were ex vivo stimulated with ConA or with NDV antigen. The ICS assay was used to determine...... the phenotype and frequency of IFN-γ positive cells. ConA stimulation induced extensive IFN-γ production in both CD3+TCRγδ+ (γδ T cells) cells and CD3+TCRγδ− cells (αβ T cells), but no significant differences were observed between the experimental groups. Furthermore, a large proportion of the IFN-γ producing...... cells were CD3− indicating that other cells than classic T cells, secreted this cytokine. NDV antigen stimulation induced IFN-γ production but to a lower extent than ConA and with a large variation between individuals. The CD3+TCR1γδ−CD8α+ (CTL) population produced the highest NDV specific IFN...
Roles of IFN-γ and γδ T cells in protective immunity against blood-stage malaria
Directory of Open Access Journals (Sweden)
Shin-Ichi eInoue
2013-08-01
Full Text Available Malaria is caused by infection with Plasmodium parasites. Various studies with knockout mice have indicated that IFN-γ plays essential roles in protective immunity against blood-stage Plasmodium infection. However, after Plasmodium infection, increased IFN-γ production by various types of cells is involved not only in protective immunity, but also in immunopathology. Recent reports have shown that IFN-γ acts as a pro-inflammatory cytokine to induce not only the activation of macrophages, but also the generation of uncommon myelolymphoid progenitor cells after Plasmodium infection. However, the effects of IFN-γ on hematopoietic stem cells and progenitor cells are unclear. Therefore, the regulation of hematopoiesis by IFN-γ during Plasmodium infection remains to be clarified. Although there are conflicting reports concerning the significance of γδ T cells in protective immunity against Plasmodium infection, γδ T cells may respond to infection and produce IFN-γ as innate immune cells in the early phase of blood-stage malaria. Our recent studies have shown that γδ T cells express CD40 ligand and produce IFN-γ after Plasmodium infection, resulting in the enhancement of dendritic cell activation as part of the immune response to eliminate Plasmodium parasites. These data suggest that the function of γδ T cells is similar to that of NK cells. Although several reports suggest that γδ T cells have the potential to act as memory cells for various infections, it remains to be determined whether memory γδ T cells are generated by Plasmodium infection and whether memory γδ T cells can contribute to the host defense against re-infection with Plasmodium. Here, we summarize and discuss the effects of IFN-γ and the various functions of γδ T cells in blood-stage Plasmodium infection.
Zhang, Yugen; Yeruva, Laxmi; Marinov, Anthony; Prantner, Daniel; Wyrick, Priscilla B; Lupashin, Vladimir; Nagarajan, Uma M
2014-09-01
IFN-β has been implicated as an effector of oviduct pathology resulting from genital chlamydial infection in the mouse model. In this study, we investigated the role of cytosolic DNA and engagement of DNA sensors in IFN-β expression during chlamydial infection. We determined that three-prime repair exonuclease-1, a host 3' to 5' exonuclease, reduced IFN-β expression significantly during chlamydial infection using small interfering RNA and gene knockout fibroblasts, implicating cytosolic DNA as a ligand for this response. The DNA sensor cyclic GMP-AMP synthase (cGAS) has been shown to bind cytosolic DNA to generate cyclic GMP-AMP, which binds to the signaling adaptor stimulator of IFN genes (STING) to induce IFN-β expression. We determined that cGAS is required for IFN-β expression during chlamydial infection in multiple cell types. Interestingly, although infected cells deficient for STING or cGAS alone failed to induce IFN-β, coculture of cells depleted for either STING or cGAS rescued IFN-β expression. These data demonstrate that cyclic GMP-AMP produced in infected cGAS(+)STING(-) cells can migrate into adjacent cells via gap junctions to function in trans in cGAS(-)STING(+) cells. Furthermore, we observed cGAS localized in punctate regions on the cytosolic side of the chlamydial inclusion membrane in association with STING, indicating that chlamydial DNA is most likely recognized outside the inclusion as infection progresses. These novel findings provide evidence that cGAS-mediated DNA sensing directs IFN-β expression during Chlamydia trachomatis infection and suggest that effectors from infected cells can directly upregulate IFN-β expression in adjacent uninfected cells during in vivo infection, contributing to pathogenesis. Copyright © 2014 by The American Association of Immunologists, Inc.
Reproducibility of Interferon Gamma (IFN-γ) Release Assays. A Systematic Review
Tagmouti, Saloua; Slater, Madeline; Benedetti, Andrea; Kik, Sandra V.; Banaei, Niaz; Cattamanchi, Adithya; Metcalfe, John; Dowdy, David; van Zyl Smit, Richard; Dendukuri, Nandini
2014-01-01
Rationale: Interferon gamma (IFN-γ) release assays for latent tuberculosis infection result in a larger-than-expected number of conversions and reversions in occupational screening programs, and reproducibility of test results is a concern. Objectives: Knowledge of the relative contribution and extent of the individual sources of variability (immunological, preanalytical, or analytical) could help optimize testing protocols. Methods: We performed a systematic review of studies published by October 2013 on all potential sources of variability of commercial IFN-γ release assays (QuantiFERON-TB Gold In-Tube and T-SPOT.TB). The included studies assessed test variability under identical conditions and under different conditions (the latter both overall and stratified by individual sources of variability). Linear mixed effects models were used to estimate within-subject SD. Measurements and Main Results: We identified a total of 26 articles, including 7 studies analyzing variability under the same conditions, 10 studies analyzing variability with repeat testing over time under different conditions, and 19 studies reporting individual sources of variability. Most data were on QuantiFERON (only three studies on T-SPOT.TB). A considerable number of conversions and reversions were seen around the manufacturer-recommended cut-point. The estimated range of variability of IFN-γ response in QuantiFERON under identical conditions was ±0.47 IU/ml (coefficient of variation, 13%) and ±0.26 IU/ml (30%) for individuals with an initial IFN-γ response in the borderline range (0.25–0.80 IU/ml). The estimated range of variability in noncontrolled settings was substantially larger (±1.4 IU/ml; 60%). Blood volume inoculated into QuantiFERON tubes and preanalytic delay were identified as key sources of variability. Conclusions: This systematic review shows substantial variability with repeat IFN-γ release assays testing even under identical conditions, suggesting that reversions
Cell-specific type I IFN signatures in autoimmunity and viral infection: what makes the difference?
Directory of Open Access Journals (Sweden)
Chieko Kyogoku
Full Text Available Gene expression profiling of peripheral blood mononuclear cells (PBMCs has revealed a crucial role for type I interferon (IFN in the pathogenesis of systemic lupus erythematosus (SLE. However, it is unclear how particular leucocyte subsets contribute to the overall type I IFN signature of PBMCs and whole blood samples.Furthermore, a detailed analysis describing the differences in the IFN signature in autoimmune diseases from that observed after viral infection has not been performed to date. Therefore, in this study, the transcriptional responses in peripheral T helper cells (CD4(+ and monocyte subsets (CD16(- inflammatory and CD16(+ resident monocytes isolated from patients with SLE, healthy donors (ND immunised with the yellow fever vaccine YFV-17Dand untreated controls were compared by global gene expression profiling.It was striking that all of the transcripts that were regulated in response to viral exposure were also found to be differentially regulated in SLE, albeit with markedly lower fold-change values. In addition to this common IFN signature, a pathogenic IFN-associated gene signature was detected in the CD4(+ T cells and monocytes from the lupus patients. IL-10, IL-9 and IL-15-mediated JAK/STAT signalling was shown to be involved in the pathological amplification of IFN responses observed in SLE. Type I IFN signatures identified were successfully applied for the monitoring of interferon responses in PBMCs of an independent cohort of SLE patients and virus-infected individuals. Moreover, these cell-type specific gene signatures allowed a correct classification of PBMCs independent from their heterogenic cellular composition. In conclusion, our data show for the first time that monocytes and CD4 cells are sensitive biosensors to monitor type I interferon response signatures in autoimmunity and viral infection and how these transriptional responses are modulated in a cell- and disease-specific manner.
IFN-gamma shapes immune invasion of the central nervous system via regulation of chemokines
DEFF Research Database (Denmark)
Tran, E H; Prince, E N; Owens, T
2000-01-01
Dynamic interplay between cytokines and chemokines directs trafficking of leukocyte subpopulations to tissues in autoimmune inflammation. We have examined the role of IFN-gamma in directing chemokine production and leukocyte infiltration to the CNS in experimental autoimmune encephalomyelitis (EA......-gamma in EAE, acting on T cell proliferation and directing chemokine production, with profound implications for the onset and progression of disease.......). BALB/c and C57BL/6 mice are resistant to induction of EAE by immunization with myelin basic protein. However, IFN-gamma-deficient (BALB/c) and IFN-gammaR-deficient (C57BL/6) mice developed rapidly progressing lethal disease. Widespread demyelination and disseminated leukocytic infiltration of spinal...
Lin, Chiou-Feng; Chen, Chia-Ling; Chien, Shun-Yi; Tseng, Po-Chun; Wang, Yu-Chih; Tsai, Tsung-Ting
2016-01-01
We previously demonstrated that IFN-γ induces an autophagy-regulated mimic extracellular trap cell death (ETosis) in A549 human lung cancer cells. Regarding reactive oxygen species (ROS) are involved in ETosis, this study investigated the role of oxidative stress. After IFN-γ stimulation, a necrosis-like cell death mimic ETosis occurred accompanied by the inhibition of cell growth, aberrant nuclear staining, and nucleosome release. ROS were generated in a time-dependent manner with an increase in NADPH oxidase component protein expression. STAT1-mediated IFN regulatory factor-1 activation was essential for upregulating ROS production. By genetically silencing p47phox, IFN-γ-induced ROS and mimic ETosis were significantly attenuated. This mechanistic study indicated that ROS may mediate DNA damage followed by histone H3 citrullination. Furthermore, ROS promoted IFN-γ-induced mimic ETosis in cooperation with autophagy. These findings further demonstrate that ROS regulates IFN-γ-induced mimic ETosis in lung epithelial malignancy.
DEFF Research Database (Denmark)
Blauenfeldt, Thomas; Wagner, Dirk; Aabye, Martine Grosos
2016-01-01
accuracy of IP-10 release assay and IGRAs. RESULTS: We included 65 patients with confirmed pulmonary tuberculosis and 160 healthy controls from 6 European centres collaborating in the TBnet. In patients, IP-10 responses increased 1.07 (IQR 0.90-1.36) fold and IFN-γ responses decreased 0.88 (IQR 0......INTRODUCTION: Interferon-γ (IFN-γ) inducible protein 10kD (IP-10) and IFN-γ release assays (IGRAs) are immunodiagnostic tests aiming to identify the presence of specific cellular immune responses, interpreted as markers for latent infection with Mycobacterium tuberculosis. Incubation at higher...
Directory of Open Access Journals (Sweden)
María F. Quiroga
2004-10-01
Full Text Available La inmunidad protectora contra Mycobacterium leprae requiere IFN-g. Los pacientes con lepra tuberculoide producen localmente citoquinas Th1, mientras que los pacientes lepromatosos producen citoquinas Th2. La molécula linfocitaria activadora de señales (SLAM y la proteína asociada a SLAM (SAP participan en la diferenciación celular que conduce a producción de patrones específicos de citoquinas. A fin de investigar la vía SLAM/SAP en la infección por M. leprae, determinamos expresión de ARN mensajero (ARNm de SAP, IFN-g y SLAM en pacientes con lepra. Observamos que la expresión de SLAM correlacionó en forma directa con la expresión de IFN-g, mientras que la expresión de SAP correlacionó inversamente con la expresión de ambas proteínas. Así, nuestros resultados indican que SAP interferiría con las respuestas de citoquinas Th1 mientras que SLAM contribuiría con la respuesta Th1 en lepra, señalando a la vía SLAM/SAP como potencial blanco modulador de citoquinas en enfermedades con respuestas Th2 disfuncionales.Tuberculoid leprosy patients locally produce Th1 cytokines, while lepromatous patients produce Th2 cytokines. Signaling lymphocytic activation molecule (SLAM and the SLAM-associated protein (SAP participate in the differentiation process that leads to the production of specific patterns of cytokines by activated T cells. To investigate the SLAM/SAP pathway in M. leprae infection, we determined the expression of SAP, IFN-g and SLAM RNA messenger in leprosy patients. We found a direct correlation of SLAM expression with IFN-g expression, whereas the expression of SAP was inversely correlated with the expression of both SLAM and IFN-g. Therefore, our data indicate that SAP might interfere with Th1 cytokine responses while SLAM expression may contribute to Th1 responses in leprosy. This study further suggests that the SLAM/SAP pathway might be a focal point for therapeutic modulation of T cell cytokine responses in diseases
Bansal, Ruchi; Prakash, Jai; De Ruiter, Marieke; Poelstra, Klaas
2014-01-01
Hepatic stellate cells (HSCs), following transdifferentiation to myofibroblasts plays a key role in liver fibrosis. Therefore, attempts to attenuate this myofibroblastic phenotype would be a promising therapeutic approach. Interferon gamma (IFN gamma) is a potent anti-fibrotic cytokine, but its
Directory of Open Access Journals (Sweden)
Christine Lang
2012-01-01
Full Text Available Intracellular pathogens including the apicomplexan and opportunistic parasite Toxoplasma gondii profoundly modify their host cells in order to establish infection. We have shown previously that intracellular T. gondii inhibit up-regulation of regulatory and effector functions in murine macrophages (MΦ stimulated with interferon (IFN-γ, which is the cytokine crucial for controlling the parasites' replication. Using genome-wide transcriptome analysis we show herein that infection with T. gondii leads to global unresponsiveness of murine macrophages to IFN-γ. More than 61% and 89% of the transcripts, which were induced or repressed by IFN-γ in non-infected MΦ, respectively, were not altered after stimulation of T. gondii-infected cells with IFN-γ. These genes are involved in a variety of biological processes, which are mostly but not exclusively related to immune responses. Analyses of the underlying mechanisms revealed that IFN-γ-triggered nuclear translocation of STAT1 still occurred in Toxoplasma-infected MΦ. However, STAT1 bound aberrantly to oligonucleotides containing the IFN-γ-responsive gamma-activated site (GAS consensus sequence. Conversely, IFN-γ did not induce formation of active GAS-STAT1 complexes in nuclear extracts from infected MΦ. Mass spectrometry of protein complexes bound to GAS oligonucleotides showed that T. gondii-infected MΦ are unable to recruit non-muscle actin to IFN-γ-responsive DNA sequences, which appeared to be independent of stimulation with IFN-γ and of STAT1 binding. IFN-γ-induced recruitment of BRG-1 and acetylation of core histones at the IFN-γ-regulated CIITA promoter IV, but not β-actin was diminished by >90% in Toxoplasma-infected MΦ as compared to non-infected control cells. Remarkably, treatment with histone deacetylase inhibitors restored the ability of infected macrophages to express the IFN-γ regulated genes H2-A/E and CIITA. Taken together, these results indicate that Toxoplasma
Efecto de la maca roja (Lepidium meyenii sobre los niveles de IFN-γ en ratas ovariectomizadas
Directory of Open Access Journals (Sweden)
Johanna Leiva-Revilla
Full Text Available Objetivos. Comparar el efecto de diferentes dosis de maca roja sobre los niveles de interferón gamma (IFN-γ en ratas ovariectomizadas (OVX. Materiales y métodos. Ratas hembras adultas fueron divididas al azar en los siguientes seis grupos: Grupo 1: ratas pesudo-ovariectomizadas (PO; Grupo 2: ratas OVX; Grupo 3: ratas OVX tratadas con 4 ug/kg de estradiol, y Grupo 4, 5 y 6: ratas OVX tratadas con extractos de maca con 2,15, 4,3 y 8,6 mg polifenoles/kilogramo de peso corporal, respectivamente. Resultados. Las ratas OVX mostraron niveles bajos de IFN-γ en comparación con las ratas PO. El estradiol y la maca roja revirtieron el efecto de la ovariectomía sobre los niveles de IFN-γ. La maca roja presenta un incremento dosis-respuesta de los niveles de IFN-γ (r=0,57, p<0,05. Conclusiones. La administración de la maca roja incrementa los niveles de IFN-γ en ratas ovariectomizadas.
Coordinate induction of IFN-α and -γ by SARS-CoV also in the absence of virus replication
International Nuclear Information System (INIS)
Castilletti, Concetta; Bordi, Licia; Lalle, Eleonora; Rozera, Gabriella; Poccia, Fabrizio; Agrati, Chiara; Abbate, Isabella; Capobianchi, Maria R.
2005-01-01
Background:: Severe acute respiratory syndrome (SARS) is an emerging infection caused by a novel coronavirus known as SARS-CoV, characterized by an over-exuberant immune response with lung lymphomononuclear cells infiltration and proliferation that may account for tissue damage more than the direct effect of viral replication. This study is aimed at investigating the capability of SARS-CoV to activate IFN-α and -γ expression in lymphomonocytes (PBMC) from healthy donors, evaluating whether viral replication is necessary for this activation. Results:: SARS-CoV virus is able to induce both IFN-α and -γ mRNA accumulation and protein release in a dose-dependent manner, MOI 10 being the most effective. The time course curve indicated that IFN-α mRNA induction peaked at 24 h.p.i,. whereas IFN-γ mRNA was still increasing at 48 h.p.i. Released IFN (both types) reached a plateau after 24-48 h.p.i. and remained rather stable over a 5-day period. A transient peak of negative strand viral RNA was detected after 1-2 days of infection, but neither infectious virus progeny yield nor newly produced viral genomic RNA could be evidenced in infected cultures, even after prolonged observation time (up to 13 days). Cocultivation of PBMC with fixed SARS-CoV-infected Vero cells was even more efficient than exposure to live virus in eliciting IFN-α and -γ induction. A combination of IFN-α and -γ strongly inhibited SARS-CoV replication in Vero cells, while the single cytokines were much less effective. Conclusions:: This study provides evidence that SARS-CoV is able to induce in normal PBMC a coordinate induction of IFN-α and -γ gene expression. Virus replication is not necessary for IFN induction since efficient IFN expression could be obtained also by the cocultivation of normal PBMC with fixed SARS-CoV-infected cells. Concomitant activation of IFN-α and -γ gene expression by SARS-CoV in vivo may be relevant for the pathogenesis of the disease, both for the possible
Liao, Wupeng; Tan, W S Daniel; Wong, W S Fred
2016-06-01
LPS and IFN-γ alone or in combination have been implicated in the development of steroid resistance. Combined LPS/IFN-γ strongly upregulates IL-27 production, which has been linked to steroid-resistant airway hyperresponsiveness (AHR). Andrographolide, a bioactive molecule isolated from the plant Andrographis paniculata, has demonstrated anti-inflammatory and antioxidant properties. The present study investigated whether andrographolide could restore steroid sensitivity to block LPS/IFN-γ-induced IL-27 production and AHR via its antioxidative property. The mouse macrophage cell line Raw 264.7, mouse primary lung monocytes/macrophages, and BALB/c mice were treated with LPS/IFN-γ, in the presence and absence of dexamethasone and/or andrographolide. Levels of IL-27 in vitro and in vivo were examined and mouse AHR was assessed. Dexamethasone alone failed to inhibit LPS/IFN-γ-induced IL-27 production and AHR in mice. Andrographolide significantly restored the suppressive effect of dexamethasone on LPS/IFN-γ-induced IL-27 mRNA and protein levels in the macrophage cell line and primary lung monocytes/macrophages, mouse bronchoalveolar lavage fluid and lung tissues, and AHR in mice. LPS/IFN-γ markedly reduced the nuclear level of histone deacetylase (HDAC)2, an essential epigenetic enzyme that mediates steroid anti-inflammatory action. LPS/IFN-γ also decreased total HDAC activity but increased the total histone acetyltransferase/HDAC activity ratio in mouse lungs. Andrographolide significantly restored nuclear HDAC2 protein levels and total HDAC activity, and it diminished the total histone acetyltransferase/HDAC activity ratio in mouse lungs exposed to LPS/IFN-γ, possibly via suppression of PI3K/Akt/HDAC2 phosphorylation, and upregulation of the antioxidant transcription factor NF erythroid-2-related factor 2 level and DNA binding activity. Our data suggest that andrographolide may have therapeutic value in resensitizing steroid action in respiratory disorders
Directory of Open Access Journals (Sweden)
Kalyan C Nallaparaju
2011-03-01
Full Text Available Francisella tularensis is a Gram-negative facultative intracellular bacterium and the causative agent of the lethal disease tularemia. An outer membrane protein (FTT0918 of F. tularensis subsp. tularensis has been identified as a virulence factor. We generated a F. novicida (F. tularensis subsp. novicida FTN_0444 (homolog of FTT0918 fopC mutant to study the virulence-associated mechanism(s of FTT0918.The ΔfopC strain phenotype was characterized using immunological and biochemical assays. Attenuated virulence via the pulmonary route in wildtype C57BL/6 and BALB/c mice, as well as in knockout (KO mice, including MHC I, MHC II, and µmT (B cell deficient, but not in IFN-γ or IFN-γR KO mice was observed. Primary bone marrow derived macrophages (BMDM prepared from C57BL/6 mice treated with rIFN-γ exhibited greater inhibition of intracellular ΔfopC than wildtype U112 strain replication; whereas, IFN-γR KO macrophages showed no IFN-γ-dependent inhibition of ΔfopC replication. Moreover, phosphorylation of STAT1 was downregulated by the wildtype strain, but not the fopC mutant, in rIFN-γ treated macrophages. Addition of NG-monomethyl-L-arginine, an NOS inhibitor, led to an increase of ΔfopC replication to that seen in the BMDM unstimulated with rIFN-γ. Enzymatic screening of ΔfopC revealed aberrant acid phosphatase activity and localization. Furthermore, a greater abundance of different proteins in the culture supernatants of ΔfopC than that in the wildtype U112 strain was observed.F. novicida FopC protein facilitates evasion of IFN-γ-mediated immune defense(s by down-regulation of STAT1 phosphorylation and nitric oxide production, thereby promoting virulence. Additionally, the FopC protein also may play a role in maintaining outer membrane stability (integrity facilitating the activity and localization of acid phosphatases and other F. novicida cell components.
GuhaSarkar, Dwijit; Neiswender, James; Su, Qin; Gao, Guangping; Sena-Esteves, Miguel
2017-02-01
The highly invasive property of glioblastoma (GBM) cells and genetic heterogeneity are largely responsible for tumor recurrence after the current standard-of-care treatment and thus a direct cause of death. Previously, we have shown that intracranial interferon-beta (IFN-β) gene therapy by locally administered adeno-associated viral vectors (AAV) successfully treats noninvasive orthotopic glioblastoma models. Here, we extend these findings by testing this approach in invasive human GBM xenograft and syngeneic mouse models. First, we show that a single intracranial injection of AAV encoding human IFN-β eliminates invasive human GBM8 tumors and promotes long-term survival. Next, we screened five AAV-IFN-β vectors with different promoters to drive safe expression of mouse IFN-β in the brain in the context of syngeneic GL261 tumors. Two AAV-IFN-β vectors were excluded due to safety concerns, but therapeutic studies with the other three vectors showed extensive tumor cell death, activation of microglia surrounding the tumors, and a 56% increase in median survival of the animals treated with AAV/P2-Int-mIFN-β vector. We also assessed the therapeutic effect of combining AAV-IFN-β therapy with temozolomide (TMZ). As TMZ affects DNA replication, an event that is crucial for second-strand DNA synthesis of single-stranded AAV vectors before active transcription, we tested two TMZ treatment regimens. Treatment with TMZ prior to AAV-IFN-β abrogated any benefit from the latter, while the reverse order of treatment doubled the median survival compared to controls. These studies demonstrate the therapeutic potential of intracranial AAV-IFN-β therapy in a highly migratory GBM model as well as in a syngeneic mouse model and that combination with TMZ is likely to enhance its antitumor potency. © 2016 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Eriksen, Karsten W; Søndergaard, Henrik; Woetmann, Anders
2008-01-01
such as IFN-alpha and IL-2 have multiple and severe side effects. Accordingly, they are generally used at sub-optimal doses, which limit their clinical efficacy. Here we hypothesized that a combination of IFN-alpha and IL-21, a novel cytokine of the IL-2 family with anti-cancer effects, will increase the anti......-cancer efficacy at sub-optimal cytokine doses. We show that the combined stimulation of target-cells with IFN-alpha and IL-21 triggers an increased STAT3 activation whereas the activation of other STATs including STAT1/2 is unaffected. In parallel, the combined stimulation with IFN-alpha and IL-21 triggers...... a selective increase in MHC class I expression and NK- and CD8(+) T-cell-mediated cytotoxicity. In an experimental in vivo model of renal carcinoma, the combined treatment of IFN-alpha and IL-21 also produces a significant anti-cancer effect as judged by an inhibition of tumor growth and an increased survival...
Le Goffic, Ronan; Bouguyon, Edwige; Chevalier, Christophe; Vidic, Jasmina; Da Costa, Bruno; Leymarie, Olivier; Bourdieu, Christiane; Decamps, Laure; Dhorne-Pollet, Sophie; Delmas, Bernard
2010-10-15
The PB1-F2 protein of the influenza A virus (IAV) contributes to viral pathogenesis by a mechanism that is not well understood. PB1-F2 was shown to modulate apoptosis and to be targeted by the CD8(+) T cell response. In this study, we examined the downstream effects of PB1-F2 protein during IAV infection by measuring expression of the cellular genes in response to infection with wild-type WSN/33 and PB1-F2 knockout viruses in human lung epithelial cells. Wild-type virus infection resulted in a significant induction of genes involved in innate immunity. Knocking out the PB1-F2 gene strongly decreased the magnitude of expression of cellular genes implicated in antiviral response and MHC class I Ag presentation, suggesting that PB1-F2 exacerbates innate immune response. Biological network analysis revealed the IFN pathway as a link between PB1-F2 and deregulated genes. Using quantitative RT-PCR and IFN-β gene reporter assay, we determined that PB1-F2 mediates an upregulation of IFN-β expression that is dependent on NF-κB but not on AP-1 and IFN regulatory factor-3 transcription factors. Recombinant viruses knocked out for the PB1-F2 and/or the nonstructural viral protein 1 (the viral antagonist of the IFN response) genes provide further evidence that PB1-F2 increases IFN-β expression and that nonstructural viral protein 1 strongly antagonizes the effect of PB1-F2 on the innate response. Finally, we compared the effect of PB1-F2 variants taken from several IAV strains on IFN-β expression and found that PB1-F2-mediated IFN-β induction is significantly influenced by its amino acid sequence, demonstrating its importance in the host cell response triggered by IAV infection.
Directory of Open Access Journals (Sweden)
Leonardo A de Almeida
Full Text Available Type I interferons (IFNs are cytokines that orchestrate diverse immune responses to viral and bacterial infections. Although typically considered to be most important molecules in response to viruses, type I IFNs are also induced by most, if not all, bacterial pathogens. In this study, we addressed the role of type I IFN signaling during Brucella abortus infection, a facultative intracellular bacterial pathogen that causes abortion in domestic animals and undulant fever in humans. Herein, we have shown that B. abortus induced IFN-β in macrophages and splenocytes. Further, IFN-β induction by Brucella was mediated by IRF3 signaling pathway and activates IFN-stimulated genes via STAT1 phosphorylation. In addition, IFN-β expression induced by Brucella is independent of TLRs and TRIF signaling but MyD88-dependent, a pathway not yet described for Gram-negative bacteria. Furthermore, we have identified Brucella DNA as the major bacterial component to induce IFN-β and our study revealed that this molecule operates through a mechanism dependent on RNA polymerase III to be sensed probably by an unknown receptor via the adaptor molecule STING. Finally, we have demonstrated that IFN-αβR KO mice are more resistant to infection suggesting that type I IFN signaling is detrimental to host control of Brucella. This resistance phenotype is accompanied by increased IFN-γ and NO production by IFN-αβR KO spleen cells and reduced apoptosis.
de Almeida, Leonardo A.; Carvalho, Natalia B.; Oliveira, Fernanda S.; Lacerda, Thais L. S.; Vasconcelos, Anilton C.; Nogueira, Lucas; Bafica, Andre; Silva, Aristóbolo M.; Oliveira, Sergio C.
2011-01-01
Type I interferons (IFNs) are cytokines that orchestrate diverse immune responses to viral and bacterial infections. Although typically considered to be most important molecules in response to viruses, type I IFNs are also induced by most, if not all, bacterial pathogens. In this study, we addressed the role of type I IFN signaling during Brucella abortus infection, a facultative intracellular bacterial pathogen that causes abortion in domestic animals and undulant fever in humans. Herein, we have shown that B. abortus induced IFN-β in macrophages and splenocytes. Further, IFN-β induction by Brucella was mediated by IRF3 signaling pathway and activates IFN-stimulated genes via STAT1 phosphorylation. In addition, IFN-β expression induced by Brucella is independent of TLRs and TRIF signaling but MyD88-dependent, a pathway not yet described for Gram-negative bacteria. Furthermore, we have identified Brucella DNA as the major bacterial component to induce IFN-β and our study revealed that this molecule operates through a mechanism dependent on RNA polymerase III to be sensed probably by an unknown receptor via the adaptor molecule STING. Finally, we have demonstrated that IFN-αβR KO mice are more resistant to infection suggesting that type I IFN signaling is detrimental to host control of Brucella. This resistance phenotype is accompanied by increased IFN-γ and NO production by IFN-αβR KO spleen cells and reduced apoptosis. PMID:21829705
Directory of Open Access Journals (Sweden)
Louise Sjökvist Ottsjö
Full Text Available CD4+ T cells have been shown to be essential for vaccine-induced protection against Helicobacter pylori infection. However, the effector mechanisms leading to reductions in the gastric bacterial loads of vaccinated mice remain unclear. We have investigated the function of IFN-γ and IL-17A for vaccine-induced protection and inflammation (gastritis using IFN-γ-gene-knockout (IFN-γ-/- mice, after sublingual or intragastric immunization with H. pylori lysate antigens and cholera toxin. Bacteria were enumerated in the stomachs of mice and related to the gastritis score and cellular immune responses. We report that sublingually and intragastrically immunized IFN-γ-/- mice had significantly reduced bacterial loads similar to immunized wild-type mice compared to respective unimmunized infection controls. The reduction in bacterial loads in sublingually and intragastrically immunized IFN-γ-/- mice was associated with significantly higher levels of IL-17A in stomach extracts and lower gastritis scores compared with immunized wild-type mice. To study the role of IL-17A for vaccine-induced protection in sublingually immunized IFN-γ-/- mice, IL-17A was neutralized in vivo at the time of infection. Remarkably, the neutralization of IL-17A in sublingually immunized IFN-γ-/- mice completely abolished protection against H. pylori infection and the mild gastritis. In summary, our results suggest that IFN-γ responses in the stomach of sublingually immunized mice promote vaccine-induced gastritis, after infection with H. pylori but that IL-17A primarily functions to reduce the bacterial load.
Cytokine-induced depression during IFN-α treatment: the role of IL-6 and sleep quality
Prather, Aric A.; Rabinovitz, Mordechai; Pollock, Bruce G.; Lotrich, Francis E.
2009-01-01
Depressive symptoms, poor sleep quality, and systemic markers of inflammation (e.g. interleukin (IL)-6) are frequently associated. Interferon-alpha (IFN-α) therapy results in major depressive disorder (MDD) in some people, offering the possibility to elucidate the relationship of MDD to sleep and inflammation during treatment. In particular, delineating the temporal relations among these factors could help inform their causal relationships. To this end, a cohort of 95 non-depressed hepatitis C patients was followed prospectively for four consecutive months during IFN-α therapy. We found that higher pre-treatment levels of circulating IL-6 predicted incidence of MDD (X2(1)=7.7; psleep quality may be risk factors for IFN-α induced depression. Furthermore, these findings highlight the complex temporal relationships that exist among sleep, depression, and inflammation, and support the need for further prospective investigations to elucidate the dynamics that underlie depression during IFN-α treatment. PMID:19615438
Viral infection causes rapid sensitization to lipopolysaccharide: central role of IFN-alpha beta
DEFF Research Database (Denmark)
Nansen, A; Randrup Thomsen, A
2001-01-01
LPS is the major active agent in the pathogenesis of Gram-negative septic shock. In this report we have studied the influence of concurrent viral infection on the outcome of LPS-induced shock. We find that infection with vesicular stomatitis virus sensitizes mice to LPS at an early time point...... following infection. Treatment of mice with the chemical IFN inducer, polyinosinic:polycytidylic acid, has a similar effect. This hypersensitivity to LPS correlated with hyperproduction of TNF-alpha in vivo. The cellular and molecular mechanisms underlying this phenomenon were investigated using Ab......-depleted and gene-targeted mice. Our results revealed that while NK cell depletion and elimination of IFN-gamma partially protected against the sensitizing effects of vesicular stomatitis virus and polyinosinic:polycytidylic acid, the most striking effect was observed in IFN-alphabetaR-deficient mice. Thus...
The role of Hsp0, CD-8 and IFN-γ in immunopathobiogenesis of periapical granuloma in dental caries
Directory of Open Access Journals (Sweden)
Risya Cilmiaty
2014-03-01
Full Text Available Background: The incidence of dental caries with periapical granulomas in Indonesia is quite high. However, the mechanism of the formation of periapical granulomas in dental caries caused by bacterial infection in immunopathobiogenesis cannot be explained completely. Thus, this explanation is necessary in order to be used as a basis for diagnostic, preventive and therapeutic measures. Purpose: This research was aimed to determine the role of Hsp60, CD-8 and IFN-γ in immunopatobiogenesis of periapical granuloma in dental caries. Methods: This research was an analytic observational study with cross sectional approach. Samples of this research were 36 teeth of patients with dental caries, consisting of 18 caries teeth with periapical granulomas and 18 caries teeth without periapical granulomas. The variables observed in this research were Hsp60, CD-8 and IFN-γ. Measurements were conducted by using immunohistochemical methods on periapical tissue. Results: The mean of Hsp60, CD-8 and IFN-γ in granuloma group was significantly higher than those in non granuloma group (p<0.05. The positive role of IFN-γ on the incidence of granulomas appeared to be more prominent. Conclusion: The study suggested that in immunopathobiogenesis of periapical granuloma in dental caries, Hsp60, CD-8 and IFN-γ played important roles, but the role of IFN-γ was found to be more prominent.Latar belakang: Angka kejadian gigi karies dengan granuloma periapikal di Indonesia cukup tinggi, Namun mekanisme terbentuknya granuloma periapikal pada gigi karies yang disebabkan oleh infeksi bakteri secara imunopatobiogenesis belum dapat dijelaskan secara tuntas. Adanya penjelasan ini diperlukan agar dapat digunakan sebagai dasar pengembangan diagnosis, langkah preventif dan terapinya. Tujuan: Penelitian ini bertujuan untuk mengetahui peran Hsp60, CD-8 dan IFN-γ dalam immunopatobiogenesis dari granuloma periapikal karies gigi. Metode: Penelitian ini merupakan penelitian observasional
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Modelo de detección de anticuerpos neutralizantes contra IFN-β mediante citometría de flujo
Directory of Open Access Journals (Sweden)
Juan Carlos Villa-Camacho
2012-12-01
Full Text Available Introducción. El interferón beta (IFN-β se usa para tratar la forma recaída-remisión de la esclerosis múltiple. Sin embargo, el uso de proteínas recombinantes como medicamentos puede generar la producción de anticuerpos, disminuyendo así la efectividad del tratamiento. Objetivo. Estandarizar una técnica de detección de anticuerpos neutralizantes contra IFN-β, mediante citometría de flujo. Materiales y métodos. Se cultivaron dos líneas tumorales humanas (U937 y K562 con IFN-β1a humano recombinante y mediante citometría de flujo se determinó la expresión de la proteína ISG15 intracelular. Los sueros se obtuvieron de un conejo Nueva Zelanda antes y después de la inmunización con 100.000 UI de IFN-β1a en adyuvante de Freund. Para la detección de anticuerpos neutralizantes, se estimularon células K562 con IFN-β1a preincubado con sueros de conejos a una dilución 1:20. Después de 24 horas de incubación se determinó la expresión de la proteína ISG15. Resultados. La expresión de ISG15 fue mayor en células K562 estimuladas. La intensidad media de fluorescencia para la ISG-15 entre células en ausencia IFN-β1a, mostró una mediana de 198 unidades arbitrarias (UA (p25-75= 173-231 UA y, en presencia de IFN-β1a, 430 UA (p25-75 =316-611,5, con una diferencia estadísticamente significativa (p=0,008. La presencia de anticuerpos anti-IFN-β1a en el suero del conejo inmunizado, hizo disminuir de forma acentuada la expresión de la ISG15 en células K562 cultivadas con IFN-β1a, en comparación con el control (mediana=3,040 UA Vs. 43,644 UA, respectivamente. Conclusiones. Este trabajo muestra la detección de anticuerpos neutralizantes contra IFN-β en conejos, utilizando la expresión de la proteína ISG15 por citometría de flujo. doi: http://dx.doi.org/10.7705/biomedica.v32i4.637
Functional characterization of duck LSm14A in IFN-β induction.
Hua, Kexin; Li, Huilin; Chen, Huanchun; Foda, Mohamed Frahat; Luo, Rui; Jin, Hui
2017-11-01
Human LSm14A is a key component of processing body (P-body) assembly that mediates interferon-β (IFN-β) production by sensing viral RNA or DNA. To the best of our knowledge, we are the first to report duck LSm14A (duLSm14A) cloning from duck embryo fibroblasts (DEFs). Full-length duLSm14A encoded 461 amino acids and was highly homologous with chicken and swan goose sequences. More interestingly, the duLSm14A mRNA was extensively expressed in all the studied tissues. In DEFs, duLSm14A was localized in the cytoplasm as P-body-like dots. Expression of duLSm14A induced IFN-β through the activation of interferon regulatory factor-1 and nuclear factor-κB in DEFs. Furthermore, knockdown of duLSm14A by small interfering RNA notably decreased poly(I:C)- or duck reovirus-induced IFN-β production. The present study results indicate that the duLSm14A is an essential sensor that mediates duck innate immunity against viral infections. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gottenberg, Jacques-Eric; Cagnard, Nicolas; Lucchesi, Carlo; Letourneur, Franck; Mistou, Sylvie; Lazure, Thierry; Jacques, Sebastien; Ba, Nathalie; Ittah, Marc; Lepajolec, Christine; Labetoulle, Marc; Ardizzone, Marc; Sibilia, Jean; Fournier, Catherine; Chiocchia, Gilles; Mariette, Xavier
2006-02-21
Gene expression analysis of target organs might help provide new insights into the pathogenesis of autoimmune diseases. We used global gene expression profiling of minor salivary glands to identify patterns of gene expression in patients with primary Sjögren's syndrome (pSS), a common and prototypic systemic autoimmune disease. Gene expression analysis allowed for differentiating most patients with pSS from controls. The expression of 23 genes in the IFN pathways, including two Toll-like receptors (TLR8 and TLR9), was significantly different between patients and controls. Furthermore, the increased expression of IFN-inducible genes, BAFF and IFN-induced transmembrane protein 1, was also demonstrated in ocular epithelial cells by quantitative RT-PCR. In vitro activation showed that these genes were effectively modulated by IFNs in salivary gland epithelial cells, the target cells of autoimmunity in pSS. The activation of IFN pathways led us to investigate whether plasmacytoid dendritic cells were recruited in salivary glands. These IFN-producing cells were detected by immunohistochemistry in all patients with pSS, whereas none was observed in controls. In conclusion, our results support the pathogenic interaction between the innate and adaptive immune system in pSS. The persistence of the IFN signature might be related to a vicious circle, in which the environment interacts with genetic factors to drive the stimulation of salivary TLRs.
Nocera, David Andrés; Roselli, Emiliano; Araya, Paula; Nuñez, Nicolás Gonzalo; Lienenklaus, Stefan; Jablonska, Jadwiga; Weiss, Siegfried; Gatti, Gerardo; Brinkmann, Melanie M; Kröger, Andrea; Morón, Gabriel; Maccioni, Mariana
2016-03-15
The crucial role that endogenously produced IFN-β plays in eliciting an immune response against cancer has recently started to be elucidated. Endogenous IFN-β has an important role in immune surveillance and control of tumor development. Accordingly, the role of TLR agonists as cancer therapeutic agents is being revisited via the strategy of intra/peritumoral injection with the idea of stimulating the production of endogenous type I IFN inside the tumor. Polyadenylic-polyuridylic acid (poly A:U) is a dsRNA mimetic explored empirically in cancer immunotherapy a long time ago with little knowledge regarding its mechanisms of action. In this work, we have in vivo visualized the IFN-β required for the antitumor immune response elicited in a therapeutic model of poly A:U administration. In this study, we have identified the role of host type I IFNs, cell populations that are sources of IFN-β in the tumor microenvironment, and other host requirements for tumor control in this model. One single peritumoral dose of poly A:U was sufficient to induce IFN-β, readily visualized in vivo. IFN-β production relied mainly on the activation of the transcription factor IFN regulatory factor 3 and the molecule UNC93B1, indicating that TLR3 is required for recognizing poly A:U. CD11c(+) cells were an important, but not the only source of IFN-β. Host type I IFN signaling was absolutely required for the reduced tumor growth, prolonged mice survival, and the strong antitumor-specific immune response elicited upon poly A:U administration. These findings add new perspectives to the use of IFN-β-inducing compounds in tumor therapy. Copyright © 2016 by The American Association of Immunologists, Inc.
Directory of Open Access Journals (Sweden)
Katrin Högner
2013-02-01
Full Text Available Influenza viruses (IV cause pneumonia in humans with progression to lung failure and fatal outcome. Dysregulated release of cytokines including type I interferons (IFNs has been attributed a crucial role in immune-mediated pulmonary injury during severe IV infection. Using ex vivo and in vivo IV infection models, we demonstrate that alveolar macrophage (AM-expressed IFN-β significantly contributes to IV-induced alveolar epithelial cell (AEC injury by autocrine induction of the pro-apoptotic factor TNF-related apoptosis-inducing ligand (TRAIL. Of note, TRAIL was highly upregulated in and released from AM of patients with pandemic H1N1 IV-induced acute lung injury. Elucidating the cell-specific underlying signalling pathways revealed that IV infection induced IFN-β release in AM in a protein kinase R- (PKR- and NF-κB-dependent way. Bone marrow chimeric mice lacking these signalling mediators in resident and lung-recruited AM and mice subjected to alveolar neutralization of IFN-β and TRAIL displayed reduced alveolar epithelial cell apoptosis and attenuated lung injury during severe IV pneumonia. Together, we demonstrate that macrophage-released type I IFNs, apart from their well-known anti-viral properties, contribute to IV-induced AEC damage and lung injury by autocrine induction of the pro-apoptotic factor TRAIL. Our data suggest that therapeutic targeting of the macrophage IFN-β-TRAIL axis might represent a promising strategy to attenuate IV-induced acute lung injury.
Jablonska, Jadwiga; Leschner, Sara; Westphal, Kathrin; Lienenklaus, Stefan; Weiss, Siegfried
2010-04-01
Angiogenesis is a hallmark of malignant neoplasias, as the formation of new blood vessels is required for tumors to acquire oxygen and nutrients essential for their continued growth and metastasis. However, the signaling pathways leading to tumor vascularization are not fully understood. Here, using a transplantable mouse tumor model, we have demonstrated that endogenous IFN-beta inhibits tumor angiogenesis through repression of genes encoding proangiogenic and homing factors in tumor-infiltrating neutrophils. We determined that IFN-beta-deficient mice injected with B16F10 melanoma or MCA205 fibrosarcoma cells developed faster-growing tumors with better-developed blood vessels than did syngeneic control mice. These tumors displayed enhanced infiltration by CD11b+Gr1+ neutrophils expressing elevated levels of the genes encoding the proangiogenic factors VEGF and MMP9 and the homing receptor CXCR4. They also expressed higher levels of the transcription factors c-myc and STAT3, known regulators of VEGF, MMP9, and CXCR4. In vitro, treatment of these tumor-infiltrating neutrophils with low levels of IFN-beta restored expression of proangiogenic factors to control levels. Moreover, depletion of these neutrophils inhibited tumor growth in both control and IFN-beta-deficient mice. We therefore suggest that constitutively produced endogenous IFN-beta is an important mediator of innate tumor surveillance. Further, we believe our data help to explain the therapeutic effect of IFN treatment during the early stages of cancer development.
Campbell, Michael C; Smith, Lunden T; Harvey, Jayla
2018-03-29
Despite its critical role in the defense against microbial infection and tumor development, little is known about the range of nucleotide and haplotype variation at IFN-γ, or the evolutionary forces that have shaped patterns of diversity at this locus. To address this gap in knowledge, we examined sequence data from the IFN-γ gene in 1461 individuals from 15 worldwide populations. Our analyses uncovered novel patterns of variation in distinct African populations, including an excess of high frequency-derived alleles, unusually long haplotype structure surrounding the IFN-γ gene, and a "star-like" genealogy of African-specific haplotypes carrying variants previously associated with infectious disease. We also inferred a deep time to coalescence of variation at IFN-γ (~ 0.8 million years ago) and ancient ages for common polymorphisms predating the evolution of modern humans. Taken together, these results are congruent with a model of positive selection on standing variation in African populations. Furthermore, we inferred that common variants in intron 3 of IFN-γ are the likely targets of selection. In addition, we observed a paucity of non-synonymous substitutions relative to synonymous changes in the exons of IFN-γ in African and non-African populations, suggestive of strong purifying selection. Therefore, we contend that positive and purifying selection have influenced levels of diversity in different regions of IFN-γ, implying that these distinct genic regions are, or have been, functionally important. Overall, this study provides additional insights into the evolutionary events that have contributed to the frequency and distribution of alleles having a role in human health and disease.
IFN-{gamma} enhances neurogenesis in wild-type mice and in a mouse model of Alzheimer's disease
DEFF Research Database (Denmark)
Baron, Rona; Nemirovsky, Anna; Harpaz, Idan
2008-01-01
the spatial learning and memory performance of the animals. In older mice, the effect of IFN-gamma is more pronounced in both wild-type mice and mice with Alzheimer's-like disease and is associated with neuroprotection. In addition, IFN-gamma reverses the increase in oligodendrogenesis observed in a mouse...... mechanisms can generate immunity to such deficits in neuronal repair. We demonstrate that in contrast to primarily innate immunity cytokines, such as interleukin-6 and tumor necrosis factor-alpha, the adaptive immunity cytokine IFN-gamma enhances neurogenesis in the dentate gyrus of adult mice and improves...
Nuclear export signal of PRRSV NSP1α is necessary for type I IFN inhibition
International Nuclear Information System (INIS)
Chen, Zhi; Liu, Shaoning; Sun, Wenbo; Chen, Lei; Yoo, Dongwan; Li, Feng; Ren, Sufang; Guo, Lihui; Cong, Xiaoyan; Li, Jun; Zhou, Shun; Wu, Jiaqiang
2016-01-01
The nonstructural protein 1α (NSP1α) of porcine reproductive and respiratory syndrome virus (PRRSV) is a nucleo-cytoplasmic protein that suppresses the production of type I interferon (IFN). In this study, we investigated the relationship between the subcellular distribution of NSP1α and its inhibition of type I IFN. NSP1α was found to contain the classical nuclear export signal (NES) and NSP1α nuclear export was CRM-1-mediated. NSP1α was shuttling between the nucleus and cytoplasm. We also showed that the nuclear export of NSP1α was necessary for its ability for type I IFN inhibition. NSP1α was also found to interact with CBP, which implies a possible mechanism of CBP degradation by NSP1α. Taken together, our results describe a novel mechanism of PRRSV NSP1α for type I IFN inhibition and suppression of the host innate antiviral response. - Highlights: •NSP1α contains the NES and NSP1α nuclear export was CRM-1-mediated. •NSP1α was shuttling between the nucleus and cytoplasm continuously. •The nuclear export of NSP1α was necessary for its ability for type I IFN inhibition. •NSP1α interacts with CBP, which implies the mechanism of CBP degradation by NSP1α.
Nuclear export signal of PRRSV NSP1α is necessary for type I IFN inhibition
Energy Technology Data Exchange (ETDEWEB)
Chen, Zhi [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); Liu, Shaoning [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); Shandong Institute of Veterinary Drug Quality Inspection, Shandong Key Laboratory for Quality Safety Monitoring and Risk Assessment of Animal Products, Huaicun Street No. 68, Jinan 250722, Shandong Province (China); Sun, Wenbo; Chen, Lei [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); Yoo, Dongwan [Department of Pathobiology, University of Illinois at Urbana-Champaign, 2001 South Lincoln Ave, Urbana, IL 61802 (United States); Li, Feng [Department of Biology and Microbiology, Department of Veterinary and Biomedical Sciences, South Dakota State University, Brookings, SD 57007 (United States); Ren, Sufang; Guo, Lihui; Cong, Xiaoyan; Li, Jun [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); Zhou, Shun [College of marine science and engineering, Qingdao Agricultural University, Changcheng Road No. 700, Qingdao 266109 (China); Wu, Jiaqiang, E-mail: wujiaqiang2000@sina.com [Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Sangyuan Road No. 8, Jinan 250100 (China); and others
2016-12-15
The nonstructural protein 1α (NSP1α) of porcine reproductive and respiratory syndrome virus (PRRSV) is a nucleo-cytoplasmic protein that suppresses the production of type I interferon (IFN). In this study, we investigated the relationship between the subcellular distribution of NSP1α and its inhibition of type I IFN. NSP1α was found to contain the classical nuclear export signal (NES) and NSP1α nuclear export was CRM-1-mediated. NSP1α was shuttling between the nucleus and cytoplasm. We also showed that the nuclear export of NSP1α was necessary for its ability for type I IFN inhibition. NSP1α was also found to interact with CBP, which implies a possible mechanism of CBP degradation by NSP1α. Taken together, our results describe a novel mechanism of PRRSV NSP1α for type I IFN inhibition and suppression of the host innate antiviral response. - Highlights: •NSP1α contains the NES and NSP1α nuclear export was CRM-1-mediated. •NSP1α was shuttling between the nucleus and cytoplasm continuously. •The nuclear export of NSP1α was necessary for its ability for type I IFN inhibition. •NSP1α interacts with CBP, which implies the mechanism of CBP degradation by NSP1α.
Directory of Open Access Journals (Sweden)
Shyamala Thirunavukkarasu
Full Text Available According to most models of mycobacterial infection, inhibition of the pro-inflammatory macrophage immune responses contributes to the persistence of bacteria. Mycobacterium avium subsp. paratuberculosis (MAP is a highly successful pathogen in cattle and sheep and is also implicated as the causative agent of Crohn's disease in humans. Pathogenic mycobacteria such as MAP have developed multiple strategies to evade host defence mechanisms including interfering with the macrophages' capacity to respond to IFN-γ, a feature which might be lacking in non-pathogenic mycobacteria such as M. smegmatis. We hypothesized that pre-sensitisation of macrophages with the pro-inflammatory cytokine IFN-γ would help in overcoming the inhibitory effect of MAP or its antigens on macrophage inflammatory responses. Herein we have compared a series of macrophage activation parameters in response to MAP and M. smegmatis as well as mycobacterial antigens. While IFN-γ did overcome the inhibition in immune suppressive mechanisms in response to MAP antigen as well as M. smegmatis, we could not find a clear role for IFN-γ in overcoming the inhibition of macrophage inflammatory responses to the pathogenic mycobacterium, MAP. We demonstrate that suppression of macrophage defence mechanisms by pathogenic mycobacteria is unlikely to be overcome by prior sensitization with IFN-γ alone. This indicates that IFN-γ signaling pathway-independent mechanisms may exist for overcoming inhibition of macrophage effector functions in response to pathogenic mycobacteria. These findings have important implications in understanding the survival mechanisms of pathogenic mycobacteria directed towards finding better therapeutics and vaccination strategies.
Gottenberg, Jacques-Eric; Cagnard, Nicolas; Lucchesi, Carlo; Letourneur, Franck; Mistou, Sylvie; Lazure, Thierry; Jacques, Sebastien; Ba, Nathalie; Ittah, Marc; Lepajolec, Christine; Labetoulle, Marc; Ardizzone, Marc; Sibilia, Jean; Fournier, Catherine; Chiocchia, Gilles; Mariette, Xavier
2006-01-01
Gene expression analysis of target organs might help provide new insights into the pathogenesis of autoimmune diseases. We used global gene expression profiling of minor salivary glands to identify patterns of gene expression in patients with primary Sjögren’s syndrome (pSS), a common and prototypic systemic autoimmune disease. Gene expression analysis allowed for differentiating most patients with pSS from controls. The expression of 23 genes in the IFN pathways, including two Toll-like receptors (TLR8 and TLR9), was significantly different between patients and controls. Furthermore, the increased expression of IFN-inducible genes, BAFF and IFN-induced transmembrane protein 1, was also demonstrated in ocular epithelial cells by quantitative RT-PCR. In vitro activation showed that these genes were effectively modulated by IFNs in salivary gland epithelial cells, the target cells of autoimmunity in pSS. The activation of IFN pathways led us to investigate whether plasmacytoid dendritic cells were recruited in salivary glands. These IFN-producing cells were detected by immunohistochemistry in all patients with pSS, whereas none was observed in controls. In conclusion, our results support the pathogenic interaction between the innate and adaptive immune system in pSS. The persistence of the IFN signature might be related to a vicious circle, in which the environment interacts with genetic factors to drive the stimulation of salivary TLRs. PMID:16477017
Directory of Open Access Journals (Sweden)
RuiCai Gu
2018-03-01
Full Text Available Background/Aims: Whether calcium/calmodulin-dependent protein kinase IV (CaMKIV plays a role in regulating immunologic features of muscle cells in inflammatory environment, as it does for immune cells, remains mostly unknown. In this study, we investigated the influence of endogenous CaMKIV on the immunological characteristics of myoblasts and myotubes received IFN-γ stimulation. Methods: C2C12 and murine myogenic precursor cells (MPCs were cultured and differentiated in vitro, in the presence of pro-inflammatory IFN-γ. CaMKIV shRNA lentivirus transfection was performed to knockdown CaMKIV gene in C2C12 cells. pEGFP-N1-CaMKIV plasmid was delivered into knockout cells for recovering intracellular CaMKIV gene level. CREB1 antagonist KG-501 was used to block CREB signal. qPCR, immunoblot analysis, or immunofluorescence was used to detect mRNA and protein levels of CaMKIV, immuno-molecules, or pro-inflammatory cytokines and chemokines. Co-stimulatory molecules expression was assessed by FACS analysis. Results: IFN-γ induces the expression or up-regulation of MHC-I/II and TLR3, and the up-regulation of CaMKIV level in muscle cells. In contrast, CaMKIV knockdown in myoblasts and myotubes leads to expression inhibition of the above immuno-molecules. As well, CaMKIV knockdown selectively inhibits pro-inflammatory cytokines/chemokines, and co-stimulatory molecules expression in IFN-γ treated myoblasts and myotubes. Finally, CaMKIV knockdown abolishes IFN-γ induced CREB pathway molecules accumulation in differentiated myotubes. Conclusions: CaMKIV can be induced to up-regulate in muscle cells under inflammatory condition, and positively mediates intrinsic immune behaviors of muscle cells triggered by IFN-γ.
Krause, Christopher D; Lavnikova, Natasha; Xie, Junxia; Mei, Erwen; Mirochnitchenko, Olga V; Jia, Yiwei; Hochstrasser, Robin M; Pestka, Sidney
2006-01-01
We previously demonstrated using noninvasive technologies that the interferon-gamma (IFN-gamma) receptor complex is preassembled (1). In this report we determined how the receptor complex is preassembled and how the ligand-mediated conformational changes occur. The interaction of Stat1 with IFN-gammaR1 results in a conformational change localized to IFN-gammaR1. Jak1 but not Jak2 is required for the two chains of the IFN-gamma receptor complex (IFN-gammaR1 and IFN-gammaR2) to interact; however, the presence of both Jak1 and Jak2 is required to see any ligand-dependant conformational change. Two IFN-gammaR2 chains interact through species-specific determinants in their extracellular domains. Finally, these determinants also participate in the interaction of IFN-gammaR2 with IFN-gammaR1. These results agree with a detailed model of the IFN-gamma receptor that requires the receptor chains to be pre-associated constitutively for the receptor to be active.
DEFF Research Database (Denmark)
Matheu, Victor; Treschow, Alexandra; Teige, Ingrid
2005-01-01
BACKGROUND: CpG oligodeoxynucleotides (CpG-ODN) are capable of inducing high amounts of type I IFNs with many immunomodulatory properties. Furthermore, type-I IFNs have been proposed to play a key role in mediating effects of CpG-ODN. The precise role of IFN-beta in the immunomodulatory effects o...
Directory of Open Access Journals (Sweden)
Junwen Zheng
2015-01-01
Full Text Available Respiratory syncytial virus (RSV infection upregulates genes of the suppressor of cytokine signaling (SOCS family, which utilize a feedback loop to inhibit type I interferon dependent antiviral signaling pathway. Here, we reconstituted RSV nonstructural (NS protein expression plasmids (pNS1, pNS2, and pNS1/2 and tested whether NS1 or NS2 would trigger SOCS1 and SOCS3 protein expression. These NS proteins inhibited interferon- (IFN- α signaling through a mechanism involving the induction of SOCS1 and SOCS3, which appeared to be different from autocrine IFN dependent. NS1 induced both SOCS1 and SOCS3 upregulation, while NS2 only induced SOCS1 expression. The induced expression of SOCS1 and SOCS3 preceded endogenous IFN-signaling activation and inhibited the IFN-inducible antiviral response as well as chemokine induction. Treatments with INF-α and NS proteins both induced SOCS1 expression; however, they had opposing effects on IFN-α-dependent antiviral gene expression. Our results indicate that NS1 and NS2, which induce the expression of SOCS1 or SOCS3, might represent an independent pathway of stimulating endogenous IFN signaling.
Barrier experiment: Shock initiation under complex loading
Energy Technology Data Exchange (ETDEWEB)
Menikoff, Ralph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2016-01-12
The barrier experiments are a variant of the gap test; a detonation wave in a donor HE impacts a barrier and drives a shock wave into an acceptor HE. The question we ask is: What is the trade-off between the barrier material and threshold barrier thickness to prevent the acceptor from detonating. This can be viewed from the perspective of shock initiation of the acceptor subject to a complex pressure drive condition. Here we consider key factors which affect whether or not the acceptor undergoes a shock-to-detonation transition. These include the following: shock impedance matches for the donor detonation wave into the barrier and then the barrier shock into the acceptor, the pressure gradient behind the donor detonation wave, and the curvature of detonation front in the donor. Numerical simulations are used to illustrate how these factors affect the reaction in the acceptor.
Programmed death-1 receptor suppresses γ-IFN producing NKT cells in human tuberculosis.
Singh, Amar; Dey, Aparajit Ballav; Mohan, Anant; Mitra, Dipendra Kumar
2014-05-01
IFN-γ biased Th1 effector immune response is crucial for containment of Mycobacterium tuberculosis infection. Various T cell subsets with regulatory function dictate the generation of Th1 like cells. NKT cells are a specialized T cell subset known to be activated early in immune response and control T cell response via release of immunoregulatory cytokines like IFN-γ, IL-4 and IL-10. M. tuberculosis, with abundance of its cell wall lipids may potently activate NKT cells resulting in cytokine production and PD-1 expression. In this study, among 49 treatment naive active pulmonary tuberculosis patients, we found a higher percentage of PD1(+) NKT cells correlating with sputum bacillary load. Furthermore, blocking PD-1 increased the number of IFN-γ producing NKT cells by inhibiting their apoptosis. Moreover, peripheral frequency of NKT cells declined with therapy suggesting their role in host T cell response. In this study, we concluded that PD-1 preferentially induces apoptosis of IFN-γ producing NKT cells while sparing NKT cells that produce IL-4. Such a polarized NKT cell function may impose a Th2 bias on the ensuing effector T cell response leading to inefficient clearance of M. tuberculosis. Inhibiting PD-1 may therefore alter the T cell response in favor of the host by rescuing type 1 NKT cells from apoptosis and boosting Th1 effector T cell functions against M. tuberculosis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Isa Ma'rufi
2017-10-01
Full Text Available Abstrak Masalah klinis kesehatan kerja pada pekerja penggilingan padi saat ini adalah penyakit saluran pernafasan. Penelitian ini bertujuan untuk menganalisis peningkatan CD8 dan IFN-γ pada Pneumonitis Hipersensitif (HP akibat pajanan debu penggilingan padi pada mencit (Musmusculus BALB/C. Penelitian yang dilakukan adalah penelitian eksperimental laboratoris dengan hewan coba mencit (Musmusculus BALB/C, rancangan penelitian yang digunakan adalah Randomized the post test only control group design. Mencit (Musmusculus BALB/C dipajan dengan debu penggilingan padi selama empat jam/hari selama tiga puluh hari dengan konsentrasi 0.50 mg/m3, 0.75 mg/m3, 1.00 mg/m3. Variabel bebas adalah debu penggilingan padi, sedangkan variabel tergantung adalah CD8 dan IFN-γ, serta gambaran histopatologis paru mencit, sedangkan variabel kendali adalah strain, berat badan, dan umur. Hasil penelitian menunjukkan bahwa terjadi peningkatan kadar CD8 antara kontrol dengan perlakuan, dan secara statistik ada perbedaan yang bermakna. Kemudian terjadi peningkatan IFN-γ dan secara statistik ada perbedaan yang bermakna antara kontrol dan perlakuan pada mencit (Musmusculus BALB/C. Hasil penelitian dapat digunakan sebagai dasar upaya pencegahan dan pemberian terapi penyakit HP lebih dini sehingga dapat meningkatkan kualitas paru. Kata Kunci: CD8, IFN-γ, debu penggilingan padi Abtract The purpose of this research was to analyze increase of CD8 and IFN-γ of Hypersensitivity Pneumonitis (HP as a result from the exposure of dust from paddy milling on mice (MusmusculusBALB/C. The research done was a laboratory experimental research with mice (MusMusculus as experimental animal. The research design used was the post only control group design using mice (MusMusculus Balb/c as experimental animal. Mice (Musmusculus Balb/c were exposed to dust from paddy milling for four (4 hours/day and it was done for thirty (30 days with the exposed
Directory of Open Access Journals (Sweden)
Michael A Ellison
Full Text Available The cytokine interferon-γ (IFN-γ is approved as a drug to treat chronic granulomatous disease (CGD and osteopetrosis and is also used in hyperimmunoglobulin E syndromes. Patients with CGD have defects in proteins of the NOX2 NADPH oxidase system. This leads to reduced production of microbicidal ROS by PMNs and recurrent life threatening infections. The goal of this study was to better understand how IFN-γ might support phagocyte function in these diseases, and to obtain information that might expand potential uses for IFN-γ. Neutrophils mature in the bone marrow and then enter the blood where they quickly undergo apoptotic cell death with a half-life of only 5-10 hours. Therefore we reasoned that IFN-γ might exert its effects on neutrophils via prolonged exposure to cells undergoing maturation in the marrow rather than by its brief exposure to short-lived circulating cells. To explore this possibility we made use of PLB-985 cells, a myeloblast-like myeloid cell line that can be differentiated into a mature, neutrophil-like state by treatment with various agents including DMSO. In initial studies we investigated transcription and protein expression in PLB-985 cells undergoing maturation in the presence or absence of IFN-γ. We observed IFN-γ induced differences in expression of genes known to be involved in classical aspects of neutrophil function (transmigration, chemotaxis, phagocytosis, killing and pattern recognition as well as genes involved in apoptosis and other mechanisms that regulating neutrophil number. We also observed differences for genes involved in the major histocompatibility complex I (MHCI and MHCII systems whose involvement in neutrophil function is controversial and not well defined. Finally, we observed significant changes in expression of genes encoding guanylate binding proteins (Gbps that are known to have roles in immunity but which have not as yet been linked to neutrophil function. We propose that changes in the
International Nuclear Information System (INIS)
Mizel, Ari; Mitchell, M. W.; Cohen, Marvin L.
2001-01-01
We propose a ground-state approach to realizing quantum computers. This scheme is time-independent and inherently defends against decoherence by possessing an energy barrier to excitation. We prove that our time-independent qubits can perform the same algorithms as their time-dependent counterparts. Advantages and disadvantages of the time-independent approach are described. A model involving quantum dots is provided for illustration
Kotla, Swathi; Gustin, Kurt E
2015-10-06
The type I interferon (IFN) response is a critical component of the innate immune response to infection by RNA viruses and is initiated via recognition of viral nucleic acids by RIG-like receptors (RLR). Engagement of these receptors in the cytoplasm initiates a signal transduction pathway leading to activation of the transcription factors NF-κB, ATF-2 and IRF-3 that coordinately upregulate transcription of type I IFN genes, such as that encoding IFN-β. In this study the impact of poliovirus infection on the type I interferon response has been examined. The type I IFN response was assessed by measuring IFN-β mRNA levels using qRT-PCR and normalizing to levels of β-actin mRNA. The status of host factors involved in activation of the type I IFN response was examined by immunoblot, immunofluorescence microcopy and qRT-PCR. The results show that poliovirus infection results in induction of very low levels of IFN-β mRNA despite clear activation of NF-κB and ATF-2. In contrast, analysis of IRF-3 revealed no transcriptional induction of an IRF-3-responsive promoter or homodimerization of IRF-3 indicating it is not activated in poliovirus-infected cells. Exposure of poliovirus-infected cells to poly(I:C) results in lower levels of IFN-β mRNA synthesis and IRF-3 activation compared to mock-infected cells. Analysis of MDA-5 and IPS-1 revealed that these components of the RLR pathway were largely intact at times when the type I IFN response was suppressed. Collectively, these results demonstrate that poliovirus infection actively suppresses the host type I interferon response by blocking activation of IRF-3 and suggests that this is not mediated by cleavage of MDA-5 or IPS-1.
Albertini, Silvia; Lo Cigno, Irene; Calati, Federica; De Andrea, Marco; Borgogna, Cinzia; Dell'Oste, Valentina; Landolfo, Santo; Gariglio, Marisa
2018-03-15
Although it is clear that high-risk human papillomaviruses (HPVs) can selectively infect keratinocytes and persist in the host, it still remains to be unequivocally determined whether they can escape antiviral innate immunity by interfering with pattern recognition receptor (PRR) signaling. In this study, we have assessed the innate immune response in monolayer and organotypic raft cultures of NIKS cells harboring multiple copies of episomal HPV18 (NIKSmcHPV18), which fully recapitulates the persistent state of infection. We show for the first time, to our knowledge, that NIKSmcHPV18, as well as HeLa cells (a cervical carcinoma-derived cell line harboring integrated HPV18 DNA), display marked downregulation of several PRRs, as well as other PRR downstream effectors, such as the adaptor protein stimulator of IFN genes and the transcription factors IRF1 and 7. Importantly, we provide evidence that downregulation of stimulator of IFN genes, cyclic GMP-AMP synthase, and retinoic acid-inducible gene I mRNA levels occurs at the transcriptional level through a novel epigenetic silencing mechanism, as documented by the accumulation of repressive heterochromatin markers seen at the promoter region of these genes. Furthermore, stimulation of NIKSmcHPV18 cells with salmon sperm DNA or poly(deoxyadenylic-deoxythymidylic) acid, two potent inducers of PRR signaling, only partially restored PRR protein expression. Accordingly, the production of IFN-β and IFN-λ 1 was significantly reduced in comparison with the parental NIKS cells, indicating that HPV18 exerts its immunosuppressive activity through downregulation of PRR signaling. Altogether, our findings indicate that high-risk human papillomaviruses have evolved broad-spectrum mechanisms that allow simultaneous depletion of multiple effectors of the innate immunity network, thereby creating an unreactive cellular milieu suitable for viral persistence. Copyright © 2018 by The American Association of Immunologists, Inc.
Liu, Ping; Woda, Marcia; Ennis, Francis A.; Libraty, Daniel H.
2013-01-01
Background The morbidity and mortality resulting from dengue hemorrhagic fever (DHF) are largely caused by endothelial barrier dysfunction and a unique vascular leakage syndrome. The mechanisms that lead to the location and timing of vascular leakage in DHF are poorly understood. We hypothesized that direct viral effects on endothelial responsiveness to inflammatory and angiogenesis mediators can explain the DHF vascular leakage syndrome. Methods We used an in vitro model of human endothelium to study the combined effects of dengue virus (DENV) type 2 (DENV2) infection and inflammatory mediators on paracellular macromolecule permeability over time. Results Over the initial 72 h after infection, DENV2 suppressed tumor necrosis factor (TNF)–α–mediated hyperpermeability in human umbilical vein endothelial cell (HUVEC) monolayers. This suppressive effect was mediated by type I interferon (IFN). By 1 week, TNF-α stimulation of DENV2-infected HUVECs synergistically increased cell cycling, angiogenic changes, and macromolecule permeability. This late effect could be prevented by the addition of exogenous type I IFN. Conclusions DENV infection of primary human endothelial cells differentially modulates TNF-α–driven angiogenesis and hyperpermeability over time. Type I IFN plays a central role in this process. Our findings suggest a rational model for the DHF vascular leakage syndrome. PMID:19530939
IPR Barriers in Collaboration between University and Engineering Industry in Sweden
Huang, Wenting
2011-01-01
This thesis examines the barriers, especially intellectual property rights concerned that inhibit industry academia collaboration. By analyzing Swedish firms in the engineering industry, I explore the influence of IPR barrier on firms’ benefits, short- and long-term respectively from university-industry interaction. Three hypotheses are suggested to investigate the relationship between IPR barriers, firm categories, short-term benefits and long-term benefits. The results illustrate different ...
Mucus as a Barrier to Drug Delivery
DEFF Research Database (Denmark)
Bøgh, Marie; Nielsen, Hanne Mørck
2015-01-01
Viscoelastic mucus lines all mucosal surfaces of the body and forms a potential barrier to mucosal drug delivery. Mucus is mainly composed of water and mucins; high-molecular weight glycoproteins forming an entangled network. Consequently, mucus forms a steric barrier and due to its negative charge...... barrier to drug delivery. Current knowledge of mucus characteristics and barrier properties, as achieved by state-of-the-art methodologies, is the topic of this MiniReview emphasizing the gastrointestinal mucus and an overall focus on oral drug delivery. Cell culture-based in vitro models are well......, studies of peptide and protein drug diffusion in and through mucus and studies of mucus-penetrating nanoparticles are included to illustrate the mucus as a potentially important barrier to obtain sufficient bioavailability of orally administered drugs, and thus an important parameter to address...
Directory of Open Access Journals (Sweden)
Sarah A Benson
2009-07-01
Full Text Available Mycobacterium tuberculosis uses multiple mechanisms to avoid elimination by the immune system. We have previously shown that M. tuberculosis can inhibit selected macrophage responses to IFN-gamma through TLR2-dependent and -independent mechanisms. To specifically address the role of TLR2 signaling in mediating this inhibition, we stimulated macrophages with the specific TLR2/1 ligand Pam(3CSK(4 and assayed responses to IFN-gamma. Pam(3CSK(4 stimulation prior to IFN-gamma inhibited transcription of the unrelated IFN-gamma-inducible genes, CIITA and CXCL11. Surface expression of MHC class II and secretion of CXCL11 were greatly reduced as well, indicating that the reduction in transcripts had downstream effects. Inhibition of both genes required new protein synthesis. Using chromatin immunoprecipitation, we found that TLR2 stimulation inhibited IFN-gamma-induced RNA polymerase II binding to the CIITA and CXCL11 promoters. Furthermore, TATA binding protein was unable to bind the TATA box of the CXCL11 promoter, suggesting that assembly of transcriptional machinery was disrupted. However, TLR2 stimulation affected chromatin modifications differently at each of the inhibited promoters. Histone H3 and H4 acetylation was reduced at the CIITA promoter but unaffected at the CXCL11 promoter. In addition, NF-kappaB signaling was required for inhibition of CXCL11 transcription, but not for inhibition of CIITA. Taken together, these results indicate that TLR2-dependent inhibition of IFN-gamma-induced gene expression is mediated by distinct, gene-specific mechanisms that disrupt binding of the transcriptional machinery to the promoters.
Paul-Samojedny, Monika; Owczarek, Aleksander; Suchanek, Renata; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan
2011-03-01
Schizophrenia is a multifactorial disease with changes affecting the immune system. Dysregulation of the cytokine network in schizophrenia has been well documented. Such changes may occur due to disturbances in cytokine levels that are linked to polymorphisms of cytokine genes. However, research in the role of cytokine gene polymorphisms in schizophrenia has been surprisingly scanty. The aim of this study was to identify, in a case control study, whether polymorphism of IFN-γ gene is a risk factor for the development of paranoid schizophrenia. To the best of our knowledge, this is the first study that examines the association between the IFN-γ gene polymorphism and psychopathological symptoms in patients with paranoid schizophrenia. Polymorphism of IFN-γ (+874T/A, rs 62559044) in schizophrenic patients (n=179), as well as healthy individuals (n=196), both Polish residents, was genotyped using AS-PCR method. Of note, when analyzing the results, we took into consideration the gender of studied individuals. Surprisingly, a single-nucleotide polymorphism in the first intron of the IFN-γ gene was found to be associated with paranoid schizophrenia in males, but not in females. The presence of allele A at position +874 in the IFN-γ gene correlates with 1.66-fold higher risk of paranoid schizophrenia development in males. Differences in the genotypes may have an important role in determining the level of I gene transcription. Because other polymorphisms have been demonstrated to influence IFN-γ transcription, further analysis is necessary to clarify the role of this gene in the pathogenesis of paranoid schizophrenia.
Evaluation of IL-4, IL-17, and IFN-γ Levels in PatientsWith Breast Cancer
Directory of Open Access Journals (Sweden)
Mina Rohani Borj
2017-03-01
Full Text Available Introduction: Tumor growth depends on intrinsic properties of malignant tumor and tumor microenvironment. Cytokines are secreted substances of the tumor microenvironment which are widely produced by tumor and immune cells. The aim of this research was to evaluate concentrations of interleukin 4 (IL-4, interleukin 7 (IL-17 and interferon gamma (IFN-γ in the breast cancer microenvironment. Methods: One hundred sixteen women between 18-73 years of age (61.15 ± 24.39 were enrolled in this study. Based on pathologic diagnostic assessment, patients were divided into 2 categories: those affected with benign breast tumor, and the subjects suffering from malignant breast tumors. Biopsy specimens were collected. Following homogenization, IFN-γ, IL-17, and IL-4 concentrations were determined in tumor tissues, adjacent tissues of the tumor, and blood serum samples of these 2 groups of patients by enzyme-linked immunosorbent assay (ELISA method. Results: Concentrations of IFN-γ, IL-17, and IL-4 were measured in tumor tissue samples, adjacent tissues of the tumor, and blood serum samples in both groups. Malignant breast tumor samples had significantly higher concentrations of IL-4 and IL-17 compared with benign breast tumor samples. And also the concentration of IFN-γ in adjacent tissues of the tumor and in blood serums in patients with malignant breast tumors was significantly higher than that in the benign breast tumor samples. However, there was no significant difference between the concentration of IFN-γ in neoplastic breast tumor tissues and that in the benign breast tumor tissues (P > 0. 05. Conclusion: Our data indicated that IL-17 and IL-4 cytokines but not IFN-γ had higher concentrations in the subjects with malignant tumor compared with those with benign tumor. The present findings indicated that the concentrations of IL-4 and IL-17 in tumor tissues may be associated with the severity of breast malignancy.
HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin
Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago
2014-01-01
AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN
DEFF Research Database (Denmark)
Liu, Yawei; Teige, Ingrid; Ericsson, Ida
2010-01-01
IFN-beta is anticipated to have an important function in mucosal tolerance, as it is one of the major cytokines produced by plasmacytoid dendritic cells, and has recently been suggested as central to the maintenance of mucosal homeostasis. Here, we have investigated whether oral tolerance is depe......, however this was not a prerequisite for establishment of oral tolerance.Immunology and Cell Biology advance online publication, 12 January 2010; doi:10.1038/icb.2009.111....
Jemli, Achraf; Eshili, Awatef; Trifa, Fatma; Mechri, Anouar; Zaafrane, Ferid; Gaha, Lotfi; Juckel, George; Tensaout, Besma Bel Hadj Jrad
2017-02-01
Since growing evidence suggests a significant role of chronic low-grade inflammation in the physiopathology of schizophrenia, we have hypothesized that functional genetic variant of the IFN gamma (IFN-γ; +874A/T; rs2430561) gene may be involved in the predisposition to schizophrenia. This research is based on a case-control study which aims to identify whether polymorphism of the IFN-γ gene is a risk factor for the development of schizophrenia. The RFLP-PCR genotyping of the IFN-γ gene was conducted on a Tunisian population composed of 218 patients and 162 controls. The IFN-γ (+874A/T) polymorphism analysis showed higher frequencies of minor homozygous genotype (TT) and allele (T) in all patients compared with controls (11.5 vs. 4.9%; p = 0.03, OR = 2.64 and 30.7 vs. 24.1%, p = 0.04, OR = 1.4, respectively). This correlation was confirmed for male but not for female patients. Also, the T allele was significantly more common among patients with paranoid schizophrenia when compared with controls (25.8 vs. 4.9%, p = 0.0001; OR = 6.7). Using the binary regression analysis to eliminate confounding factors as age and sex, only this last association remained significant (p = 0.03; OR = 1.76, CI = 1.05-2.93). In conclusion, our results showed a significant association between +874A/T polymorphism of IFN-γ and paranoid schizophrenia, suggesting that this single nucleotide polymorphism (SNP) or another at proximity could predispose to paranoid schizophrenia. Since the minor allele of this polymorphism was correlated with an increased expression of their product, our study validates the hypothesis of excessive pro-inflammatory cytokine in the physiopathology of paranoid schizophrenia.
The MEK1/2-ERK Pathway Inhibits Type I IFN Production in Plasmacytoid Dendritic Cells
Directory of Open Access Journals (Sweden)
Vaclav Janovec
2018-02-01
Full Text Available Recent studies have reported that the crosslinking of regulatory receptors (RRs, such as blood dendritic cell antigen 2 (BDCA-2 (CD303 or ILT7 (CD85g, of plasmacytoid dendritic cells (pDCs efficiently suppresses the production of type I interferons (IFN-I, α/β/ω and other cytokines in response to toll-like receptor 7 and 9 (TLR7/9 ligands. The exact mechanism of how this B cell receptor (BCR-like signaling blocks TLR7/9-mediated IFN-I production is unknown. Here, we stimulated BCR-like signaling by ligation of RRs with BDCA-2 and ILT7 mAbs, hepatitis C virus particles, or BST2 expressing cells. We compared BCR-like signaling in proliferating pDC cell line GEN2.2 and in primary pDCs from healthy donors, and addressed the question of whether pharmacological targeting of BCR-like signaling can antagonize RR-induced pDC inhibition. To this end, we tested the TLR9-mediated production of IFN-I and proinflammatory cytokines in pDCs exposed to a panel of inhibitors of signaling molecules involved in BCR-like, MAPK, NF-ĸB, and calcium signaling pathways. We found that MEK1/2 inhibitors, PD0325901 and U0126 potentiated TLR9-mediated production of IFN-I in GEN2.2 cells. More importantly, MEK1/2 inhibitors significantly increased the TLR9-mediated IFN-I production blocked in both GEN2.2 cells and primary pDCs upon stimulation of BCR-like or phorbol 12-myristate 13-acetate-induced protein kinase C (PKC signaling. Triggering of BCR-like and PKC signaling in pDCs resulted in an upregulation of the expression and phoshorylation of c-FOS, a downstream gene product of the MEK1/2-ERK pathway. We found that the total level of c-FOS was higher in proliferating GEN2.2 cells than in the resting primary pDCs. The PD0325901-facilitated restoration of the TLR9-mediated IFN-I production correlated with the abrogation of MEK1/2-ERK-c-FOS signaling. These results indicate that the MEK1/2-ERK pathway inhibits TLR9-mediated type I IFN production in pDCs and that
Research Article Polymorphism detection of promoter region of IFN ...
Indian Academy of Sciences (India)
MRT Pack 24 DVDs
Improving animal health is considered to be the basic goal of the animal breeding ..... Additionally, cytokines including TGF-β, IFN-y and TNF-α, IL-1α, IL- .... of lipopolysaccharide-binding protein in protection of mice against a ... Humoral Immune Response to Killed H5N1 HPAI Vaccine in a Red Jungle fowl Population.
DEFF Research Database (Denmark)
Fuglsang, Eva; Boye, Louise; Frøkiær, Hanne
2017-01-01
, and induced macropinocytosis in the bmDCs. Addition of SMase increased the phagocytosis of L. acidophilus and L. acidophilus-induced IL-12/IFN-β but showed no effect on the uptake of E. coli nor on E.coli induced IL-12/IFN-β production. Also, SMase did not affect Pam3CSK4-induced macropinocytosis of FITC......-dextran. Inhibition of both acid SMase and ceramidase by CPZ increased constitutive macropinocytosis of dextran and slightly increased L.acidophilus induced Il12/Ifn-β expression and E.coli induced Ifnβ expression. Our results confirm a role for ceramide in the L.acidophilus induced IL-12/IFN-β production but also...
The essential role of the sialic acid residues for IFN-β1a activity determined in vivo
DEFF Research Database (Denmark)
Olesen, Lasse Dissing; Andersen, Morten Thaysen
Recombinant human interferon-beta (rhIFN-β) is the leading therapeutic intervention shown to change the cause of relapsing remitting multiple sclerosis and both a non-glycosylated and a significantly more active glycosylated variant of rhIFN-β are used in treatment. This study investigates the ...
Vilaplana, Cristina; Prats, Clara; Marzo, Elena; Barril, Carles; Vegué, Marina; Diaz, Jorge; Valls, Joaquim; López, Daniel; Cardona, Pere-Joan
2014-01-01
The temporo-spatial relationship between the three organs (lung, spleen and lymph node) involved during the initial stages of Mycobacterium tuberculosis infection has been poorly studied. As such, we performed an experimental study to evaluate the bacillary load in each organ after aerosol or intravenous infection and developed a mathematical approach using the data obtained in order to extract conclusions. The results showed that higher bacillary doses result in an earlier IFN-γ response, that a certain bacillary load (BL) needs to be reached to trigger the IFN-γ response, and that control of the BL is not immediate after onset of the IFN-γ response, which might be a consequence of the spatial dimension. This study may have an important impact when it comes to designing new vaccine candidates as it suggests that triggering an earlier IFN-γ response might not guarantee good infection control, and therefore that additional properties should be considered for these candidates.
Directory of Open Access Journals (Sweden)
Mayara Fernanda Maggioli
2016-10-01
Full Text Available Central memory T cells (Tcm and polyfunctional CD4 T cell responses contribute to vaccine-elicited protection with both human and bovine tuberculosis (TB; however, their combined role in protective immunity to TB is unclear. To address this question, we evaluated polyfunctional cytokine responses by CD4 T cell effector / memory populations from bacille Calmette Guerin (BCG vaccinated and non-vaccinated calves prior to and after aerosol challenge with virulent Mycobacterium bovis. Polyfunctional cytokine expression patterns in the response by Tcm, effector memory, and effector T cell subsets were similar between BCG-vaccinated and M. bovis-infected calves; only differing in magnitude (i.e., infected > vaccinated. BCG vaccination, however, did alter the kinetics of the ensuing response to virulent M. bovis infection. Early after challenge (three weeks post-infection, non-vaccinates had greater antigen-specific IFN-γ/TNF-α and lesser IFN-γ/TNF-α/IL-2 responses by Tcm cells than did vaccinated animals. Importantly, these differences were also associated with mycobacterial burden upon necropsy. Polyfunctional responses to ESAT-6:CFP10 (antigens not synthesized by BCG strains were detected in memory subsets, as well as in effector cells, as early as three weeks after challenge. These findings suggest that cell fate divergence may occur early after antigen priming in the response to bovine TB and that memory and effector T cells may expand concurrently during the initial phase of the immune response. In summary, robust IFN-γ/TNF-α response by Tcm cells is associated with greater mycobacterial burden while IFN-γ/TNF-α/IL-2 response by Tcm cells are indicative of a protective response to bovine TB.
Aghai, Zubair H; Saslow, Judy G; Mody, Kartik; Eydelman, Riva; Bhat, Vishwanath; Stahl, Gary; Pyon, Kee; Bhandari, Vineet
2013-01-01
Interferon-gamma (IFN-γ) and interferon-inducible protein of 10 kDa (IP-10) are potent inflammatory mediators and contribute to acute lung injury in adults. Recently, a potential role for IFN-γ and IP-10 in the pathogenesis of bronchopulmonary dysplasia (BPD) has been reported in animal models. To study the association between IFN-γ and IP-10 in tracheal aspirate (TA) and the development of BPD in premature infants. TA samples collected within 48 hr after birth from 79 mechanically ventilated premature neonates [gestational age (GA) IP-10 was determined using a commercially available ELISA kit. Total protein in TA was measured by Bradford assay to correct for sampling related dilution. BPD was defined as the need of supplemental oxygen at 36 weeks postmenstrual age (PMA). Twenty infants (GA 26.4 ± 1.9w, BW 860 ± 201 g) survived without BPD at 36 weeks PMA and 59 infants (GA 25.5 ± 1.5w, BW 751 ± 163 g) died before 36 weeks PMA or developed BPD. The mean IFN-γ level was higher in infants who died or developed BPD (9.7 ± 2.8 vs. 3.1 ± 1.1 pg/ml, P = 0.03). Similarly, the mean IP-10 level was higher in infants who died or developed BPD (63.4 ± 17.5 pg/ml) compared to those who survived without BPD (18.5 ± 7.5 pg/ml, P = 0.02). Higher IFN-γ and IP-10 levels in TA samples are associated with the development of BPD or death in premature infants. Copyright © 2012 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Sishun Hu
Full Text Available We previously reported that the IFN-β secreted by Chlamydia muridarum-infected murine oviduct epithelial cells (OE cells was mostly dependent on the TLR3 signaling pathway. To further characterize the mechanisms of IFN-β synthesis during Chlamydia infection of OE cells in vitro, we utilized specific inhibitory drugs to clarify the roles of IRF3 and NF-κB on both early- and late-phase C. muridarum infections. Our results showed that the pathways involved in the early-phase of IFN-β production were distinct from that in the late-phase of IFN-β production. Disruption of IRF3 activation using an inhibitor of TBK-1 at early-phase Chlamydia infection had a significant impact on the overall synthesis of IFN-β; however, disruption of IRF3 activation at late times during infection had no effect. Interestingly, inhibition of NF-κB early during Chlamydia infection also had a negative effect on IFN-β production; however, its impact was not significant. Our data show that the transcription factor IRF7 was induced late during Chlamydia infection, which is indicative of a positive feedback mechanism of IFN-β synthesis late during infection. In contrast, IRF7 appears to play little or no role in the early synthesis of IFN-β during Chlamydia infection. Finally, we demonstrate that antibiotics that target chlamydial DNA replication are much more effective at reducing IFN-β synthesis during infection versus antibiotics that target chlamydial transcription. These results provide evidence that early- and late-phase IFN-β production have distinct signaling pathways in Chlamydia-infected OE cells, and suggest that Chlamydia DNA replication might provide a link to the currently unknown chlamydial PAMP for TLR3.
Satoh, Ryoichi; Kaku, Ayumi; Satomura, Megumi; Kohori, Michiyo; Noura, Kanako; Furukawa, Tomoko; Kotake, Masako; Takano, Tomomi; Hohdatsu, Tsutomu
2011-06-01
Feline infectious peritonitis virus (FIPV) can cause a lethal disease in cats, feline infectious peritonitis (FIP). The antibody-dependent enhancement (ADE) of FIPV infection has been recognised in experimentally infected cats, and cellular immunity is considered to play an important role in preventing the onset of FIP. To evaluate the importance of cellular immunity for FIPV infection, monoclonal antibodies (MAbs) against feline interferon (fIFN)-γ were first created to establish fIFN-γ detection systems using the MAbs. Six anti-fIFN-γ MAbs were created. Then, the difference in epitope which those MAbs recognise was demonstrated by competitive enzyme-linked immunosorbent assay (ELISA) and IFN-γ neutralisation tests. Detection systems for fIFN-γ (sandwich ELISA, ELISpot assay, and two-colour flow cytometry) were established using anti-fIFN-γ MAbs that recognise different epitopes. In all tests, fIFN-γ production from peripheral blood mononuclear cells (PBMCs) obtained from cats experimentally infected with an FIPV isolate that did not develop the disease was significantly increased by heat-inactivated FIPV stimulation in comparison with medium alone. Especially, CD8(+)fIFN-γ(+) cells, but not CD4(+)fIFN-γ(+) cells, were increased. In contrast, fIFN-γ production from PBMCs isolated from cats that had developed FIP and specific pathogen-free (SPF) cats was not increased by heat-inactivated FIPV stimulation. These results suggest that cellular immunity plays an important role in preventing the development of FIP. Measurement of fIFN-γ production with the anti-fIFN-γ MAbs created in this study appeared to be useful in evaluating cellular immunity in cats. Copyright © 2011 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Yang Yunyi; Zhang Li; Wang Juan; Zhao Hengfang; Dai Li; Liu Zi
2009-01-01
Objective: To investigate the effect of γ-IFN on the radiation-induced injury and fibrosis of the rabbit rectum after the fractionated irradiation to pelvic cavity. Methods: The animal model of radiation rectum injury was established. 52 New Zealand rabbits were divided into 3 groups as the normal control group, the conventional radiation group, and γ-IFN group. Except the normal control group, the pelvic cavity of the two other groups were irradiated with 6 MV X-rays. At 5 d post-irradiatio the γ-IFN group was administered with 250 000 U/kg of γ-IFN once a week, while the conventional radiation group with 5 ml of saline solution. The rabbits were executed after 4, 8, 12 and 16 weeks, and the recta in the irradiated field were taken out. HE dyeing, in-situ hybridization and immuno-histochemical methods were used to analyze the radiation-induced rectrum injury and fibrosis. Results: At 4, 8, and 12 weeks post-irradiation, the radiation rectum injury and fibrosis were significantly different between the conventional radiation group and γ-IFN group(P 0.05) . At 4, 8, 12 and 16 weeks post-irradiation, the expression of TGF-β1 mRNA in-situ hybridization in the γ-IFN group were significantly different compared to the conventional radiation group and the normal control group (P <0.05) . The immuno-histochemical results of Col III showed the significant difference among the γ-IFN group and both the normal control group and conventional radiation group ( P < 0.05). Conclusions: γ-IFN could reduce the radiation rectum injury, suppress the expression of TGF-β1 mRNA in the rectum mucosa, inhibit the expression of Col III, and delay the formation of radiation-induced fibrosis. (authors)
Ho, Yu-Hsuan; Lu, Yu-Chiu; Chang, Hung-Cheng; Lee, Shin-Yi; Tsai, Min-Fen; Huang, Yu-Ting; Hsu, Ting-Yuan
2014-01-01
A personalized probiotic microfluidic chip system has been established and used to screen the probiotics which had the highest value of IFN-γ/IL-10 or IL-10/IFN-γ among six probiotics, including L. paracasei BRAP01, L. acidophilus AD300, B. longum BA100, E. faecium BR0085, L. rhamnosus AD500, and L. reuteri BR101. One hundred volunteers were included and their PBMCs were collected and stimulated by the six probiotics. People who belonged to the IFN-γ group took the probiotics that exerted the highest ratio of IFN-γ/IL-10 and vice versa in IL-10 group. A significant increase in NK cytotoxicity of 69 volunteers in the IFN-γ group was observed compared to the IL-10 group (n = 21) and control group (n = 10). The result also showed that L. paracasei BRAP01 and L. acidophilus AD300 were the two dominant inducers in IFN-γ group which yielded higher value of IFN-γ/IL-10 than the other 4 probiotics, while L. reuteri BR101 was the most effective agent on the ratio of IL-10/IFN-γ in the IL-10 group. Our finding highlighted the concept of personalized probiotics and also provided a good foundation to investigate the probiotics with NK activity.
Directory of Open Access Journals (Sweden)
Mickael Vourc’h
2017-10-01
Full Text Available Pseudomonas aeruginosa (PA expresses the type III secretion system (T3SS and effector exoenzymes that interfere with intracellular pathways. Natural killer (NK cells play a key role in antibacterial immunity and their activation is highly dependent on IL-12 produced by myeloid cells. We studied PA and NK cell interactions and the role of IL-12 using human peripheral blood mononuclear cells, sorted human NK cells, and a human NK cell line (NK92. We used a wild-type (WT strain of PA (PAO1 or isogenic PA-deleted strains to delineate the role of T3SS and exoenzymes. Our hypotheses were tested in vivo in a PA-pneumonia mouse model. Human NK cells or NK92 cell line produced low levels of IFN-γ in response to PA without IL-12 stimulation, whereas PA significantly increased IFN-γ after IL-12 priming. The modulation of IFN-γ production by PA required bacteria-to-cell contact. Among T3SS effectors, exoenzyme T (ExoT upregulates IFN-γ production and control ERK activation. In vivo, ExoT also increases IFN-γ levels and the percentage of IFN-γ+ NK cells in lungs during PA pneumonia, confirming in vitro data. In conclusion, our results suggest that T3SS could modulate the production of IFN-γ by NK cells after PA infection through ERK activation.
Torelli, Francesca; Zander, Steffen; Ellerbrok, Heinz; Kochs, Georg; Ulrich, Rainer G; Klotz, Christian; Seeber, Frank
2018-02-12
Rodent species like Myodes glareolus and Microtus spp. are natural reservoirs for many zoonotic pathogens causing human diseases and are gaining increasing interest in the field of eco-immunology as candidate animal models. Despite their importance the lack of immunological reagents has hampered research in these animal species. Here we report the recombinant production and functional characterization of IFN-γ, a central mediator of host's innate and adaptive immune responses, from the bank vole M. glareolus. Soluble dimeric recMgIFN-γ was purified in high yield from Escherichia coli. Its activity on M. glareolus and Microtus arvalis kidney cell lines was assessed by immunofluorescent detection of nuclear translocation and phosphorylation of the transcription factor STAT1. RecMgIFN-γ also induced expression of an IFN-γ-regulated innate immunity gene. Inhibition of vesicular stomatitis virus replication in vole cells upon recMgIFN-γ treatment provided further evidence of its biological activity. Finally, we established a recMgIFN-γ-responsive bank vole reporter cell line that allows the sensitive titration of the cytokine activity via a bioluminescence reporter assay. Taken together, we report valuable tools for future investigations on the immune response against zoonotic pathogens in their natural animal hosts, which might foster the development of novel animal models.
Identification of IFN-gamma-producing CD4+ T cells following PMA stimulation
DEFF Research Database (Denmark)
Kemp, K; Bruunsgaard, H
2001-01-01
Treatment of T cells with phorbol esters, such as phorbol myristate acetate (PMA), induces downregulation of CD4, making unambiguous identification of this subset difficult. In this study, the kinetics of intracellular expression of interferon-gamma (IFN-gamma) and downmodulation of surface CD4...... were measured in peripheral blood mononuclear cells (PBMC) after PMA stimulation. The number of IFN-gamma-producing cells increased within a 4-h period while the fluorescence intensity of the CD4(+) cell population decreased, and the two phenomena were correlated (n = 9; p = 0.01). Our data suggest...... that intracellular staining of CD4 together with cytokine staining will make identification of CD4(+) cells possible and facilitate the procedure of intracellular staining of cytokines....
International Nuclear Information System (INIS)
Hatano, Ryo; Yamada, Kiyoshi; Iwamoto, Taku; Maeda, Nana; Emoto, Tetsuro; Shimizu, Makoto; Totsuka, Mamoru
2013-01-01
Highlights: •Small intestinal epithelial cells (sIECs). •sIECs are able to induce antigen specific proliferation of CD4 + IELs. •sIECs induce markedly enhanced IFN-γ secretion by CD4 + IELs. •Induction of enhanced IFN-γ secretion by sIECs is uniquely observed in CD4 + IELs. -- Abstract: Small intestinal epithelial cells (sIECs) express major histocompatibility complex class II molecules even in a normal condition, and are known to function as antigen presenting cells (APCs) at least in vitro. These findings raised the possibility that sIECs play an important role in inducing immune responses against luminal antigens, especially those of intestinal intraepithelial lymphocytes (IELs) and lamina propria lymphocytes (LPLs). We herein showed that antigenic stimulation with sIECs induced markedly greater secretion of interferon-gamma (IFN-γ) by CD4 + IELs, but not interleukin (IL)-4, IL-10 and IL-17 although the proliferative response was prominently lower than that with T cell-depleted splenic APCs. In contrast, no enhanced IFN-γ secretion by CD4 + LPLs and primed splenic CD4 + T cells was observed when stimulated with sIECs. Taken together, these results suggest that sIECs uniquely activate CD4 + IELs and induce remarkable IFN-γ secretion upon antigenic stimulation in vivo
What hinder the further development of wind power in China?—A socio-technical barrier study
International Nuclear Information System (INIS)
Zhao, Zhen-Yu; Chang, Rui-Dong; Chen, Yu-Long
2016-01-01
Promoting wind power is a long-term strategy of China to respond to both energy shortage and environmental pollution. Stimulated by various incentive policies, wind power generation in China has achieved tremendous growth, with the cumulative installed capacity being the largest worldwide for five consecutive years since 2010. However, obstructed by various barriers, wind power provides only 2.6% of national electricity generation in China, despite the strong support from the government. From a socio-technical transition perspective, this paper aims to systematically analyze the barriers hindering the further development of China's wind power. A wind power niche model is established to illustrate the complex interactions among actors in the wind power industry and electricity supply regime. Then, qualitative content analysis is adopted to process the related evidence and data, and four categories of socio-technical barriers are identified, including technology, governance, infrastructure and culture barriers. The study shows that various interrelated barriers form a blocking mechanism which prohibits the further development of wind power in China. Policy suggestions are proposed to eliminate the barriers and further empower the wind power niche. The lesson learned from China can offer useful references for other economies to promote wind power industries of their own. - Highlights: • Use wind power niche model to illustrate the interactions among actors in the industry. • Analyze technological, governance, infrastructural and cultural barriers. • Multidimensionality and interconnectedness of the barriers are illustrated. • Policy suggestions are proposed to deal with the wind power development barriers.
International Nuclear Information System (INIS)
Petersson, Stina; Bylander, Anna; Yhr, Maria; Enerbäck, Charlotta
2007-01-01
The aim of the present work was to explore signal transduction pathways used in the regulation of S100A7 (psoriasin). Members of the S100 gene family participate in many important cellular functions. Psoriasin, S100A8 (calgranulin A) and S100A9 (calgranulin B) are expressed in ductal carcinoma in situ (DCIS), as well as in the hyperproliferative skin disease, psoriasis. In the latter condition, a disturbance in the STAT pathway has recently been reported. This pathway is implicated in the regulation of IFN-gamma, widely recognized as a key cytokine in psoriasis. IFN-gamma also exerts anti-tumor action in a number of tumor cell types, including breast cancer. We therefore examined the effect of IFN-gamma and STAT-signaling on the psoriasin expression. We established a TAC2 mouse mammary epithelial cell line with tetracycline-inducible psoriasin expression (Tet-Off). Viability in cell culture was estimated using MTS assay. Protein and gene expression were evaluated by Western blotting and quantitative real-time PCR. Statistical analyses were assessed using a one-tailed, paired t-test. We report the downregulation of psoriasin by IFN-gamma in the MDA-MB-468 breast cancer cell line, as well as the downregulation of psoriasin induced by anoikis in cell lines derived from different epithelial tissues. In contrast, IFN-gamma had no suppressive effect on calgranulin A or calgranulin B. IFN-gamma is an important activator of the STAT1 pathway and we confirmed an active signaling pathway in the cell lines that responded to IFN-gamma treatment. In contrast, in the SUM190 breast carcinoma cell line, IFN-gamma did not suppress the expression of endogenous psoriasin. Moreover, a reduced phosphorylation of the STAT1 protein was observed. We showed that IFN-gamma treatment and the inhibition of the transcription factor NFkappaB had a synergistic effect on psoriasin levels. Finally, in TAC2 cells with tetracycline-induced psoriasin expression, we observed the increased viability of
Biologic consequences of Stat1-independent IFN signaling
Gil, M. Pilar; Bohn, Erwin; O'Guin, Andrew K.; Ramana, Chilakamarti V.; Levine, Beth; Stark, George R.; Virgin, Herbert W.; Schreiber, Robert D.
2001-01-01
Although Stat1 is required for many IFN-dependent responses, recent work has shown that IFNγ functions independently of Stat1 to affect the growth of tumor cells or immortalized fibroblasts. We now demonstrate that both IFNγ and IFNα/β regulate proliferative responses in cells of the mononuclear phagocyte lineage derived from Stat1-null mice. Using both representational difference analysis and gene arrays, we show that IFNγ exerts its Stat1-independent actions on m...
Does IFN-γ play a role on the pathogenesis of non-atopic asthma in Latin America children?
Directory of Open Access Journals (Sweden)
Figueiredo Camila Alexandrina
2012-12-01
Full Text Available Abstract In this work we explore differences in blood cells and cytokine profiles in children according to atopic status and asthma (atopic or non-atopic. The study involved measurement of Th1(IFN-γ and Th2 (IL-5 and IL-13 cytokines in Dermatophagoides pteronyssinus stimulated peripheral blood leukocytes, blood cell count, skin prick test and specific IgE against common aeroallergens. Atopic status was associated with eosinophilia and production of Th2 type cytokines. Atopic asthma was associated with eosinophilia and non-atopic asthma was associated with IFN-γ and elevated monocytes in blood. IFN-γ and monocytes might play a role in immunopathology of non-atopic asthma in Latin American children.
Does IFN-γ play a role on the pathogenesis of non-atopic asthma in Latin America children?
Figueiredo, Camila Alexandrina; Rodrigues, Laura Cunha; Alcantara-Neves, Neuza Maria; Cooper, Philip J; Amorim, Leila Denise; Silva, Nivea Bispo; Cruz, Alvaro A; Barreto, Mauricio Lima
2012-12-19
In this work we explore differences in blood cells and cytokine profiles in children according to atopic status and asthma (atopic or non-atopic). The study involved measurement of Th1(IFN-γ) and Th2 (IL-5 and IL-13) cytokines in Dermatophagoides pteronyssinus stimulated peripheral blood leukocytes, blood cell count, skin prick test and specific IgE against common aeroallergens. Atopic status was associated with eosinophilia and production of Th2 type cytokines. Atopic asthma was associated with eosinophilia and non-atopic asthma was associated with IFN-γ and elevated monocytes in blood. IFN-γ and monocytes might play a role in immunopathology of non-atopic asthma in Latin American children.
Chaudhary, Vidyanath; Zhang, Shuo; Yuen, Kit-San; Li, Chuan; Lui, Pak-Yin; Fung, Sin-Yee; Wang, Pei-Hui; Chan, Chi-Ping; Li, Dexin; Kok, Kin-Hang; Liang, Mifang; Jin, Dong-Yan
2015-11-01
Severe fever with thrombocytopenia syndrome virus (SFTSV) is an emerging tick-borne pathogen causing significant morbidity and mortality in Asia. NSs protein of SFTSV is known to perturb type I IFN induction and signalling, but the mechanism remains to be fully understood. Here, we showed the suppression of both type I and type III IFN signalling by SFTSV NSs protein is mediated through inhibition of STAT1 phosphorylation and activation. Infection with live SFTSV or expression of NSs potently suppressed IFN-stimulated genes but not NFkB activation. NSs was capable of counteracting the activity of IFN-α1, IFN-β, IFN-λ1 and IFN-λ2. Mechanistically, NSs associated with STAT1 and STAT2, mitigated IFN-β-induced phosphorylation of STAT1 at S727, and reduced the expression and activity of STAT1 protein in IFN-β-treated cells, resulting in the inhibition of STAT1 and STAT2 recruitment to IFNstimulated promoters. Taken together, SFTSV NSs protein is an IFN antagonist that suppresses phosphorylation and activation of STAT1.
Justa, Shivali; Zhou, Xiaoqun; Sarkar, Sujata
2014-01-01
Objective IL-22 is elevated in patients with inflammatory arthritis and correlates with disease activity. IL-22 deficient mice have reduced incidence of arthritis. Recombinant IL-22 restrains progression of arthritis via increase in IL-10 responses when administered prior to onset of arthritis. These findings imply a possible dual role of IL-22 in inflammatory arthritis depending on the phase of arthritis. Experiments outlined here were designed to elucidate the contribution of endogenous IL-22 before and after the onset of arthritis. Methods Collagen induced arthritis (CIA) was induced in DBA1 or IFN-γ deficient mice following immunization with collagen and complete Freund's adjuvant. Anti-IL-22 antibody or isotype control were administered prior to or after onset of arthritis and disease progression assessed by clinical scoring and histopathology. IL-22, IL-17 and IFN-γ responses were measured by ELISA and flowcytometry. Anti-collagen antibody responses were analyzed by ELISA. Expression of IL-22R1 in CD4+ cells was elucidated by flowcytometry and real time PCR. Results Collagen specific IL-22 responses were expanded during arthritis and IL-22 producing cells were discrete from IL-17 or IFN-γ producing cells. Neutralization of IL-22 after onset of arthritis resulted in significant increase in Th1 responses and significantly reduced severity of arthritis. CD4+ cells from arthritic mice showed increased surface expression of IL-22R1. In vitro, CD4+T cells cultured with antigen presenting cells in the presence or absence of IL-22 suppressed or induced IFN-γ, respectively. The protective effect of anti-IL-22 was reversed in IFN-γ deficient mice. Moreover, administration of anti-IL-22 prior to onset of arthritis augmented arthritis severity. Conclusion We show for the first time that IL-22 plays a dual role: protective prior to the onset of arthritis and pathogenic after onset of arthritis. The pathogenic effect of IL-22 is dependent on suppression of IFN
Weiss, N; Miller, F; Cazaubon, S; Couraud, P-O
2010-03-01
Over the last few years, the blood-brain barrier has come to be considered as the main limitation for the treatment of neurological diseases caused by inflammatory, tumor or neurodegenerative disorders. In the blood-brain barrier, the close intercellular contact between cerebral endothelial cells due to tight junctions prevents the passive diffusion of hydrophilic components from the bloodstream into the brain. Several specific transport systems (via transporters expressed on cerebral endothelial cells) are implicated in the delivery of nutriments, ions and vitamins to the brain; other transporters expressed on cerebral endothelial cells extrude endogenous substances or xenobiotics, which have crossed the cerebral endothelium, out of the brain and into the bloodstream. Recently, several strategies have been proposed to target the brain, (i) by by-passing the blood-brain barrier by central drug administration, (ii) by increasing permeability of the blood-brain barrier, (iii) by modulating the expression and/or the activity of efflux transporters, (iv) by using the physiological receptor-dependent blood-brain barrier transport, and (v) by creating new viral or chemical vectors to cross the blood-brain barrier. This review focuses on the illustration of these different approaches. Copyright (c) 2009 Elsevier Masson SAS. All rights reserved.
Local IFN-gamma therapy of HPV16-associated tumours
Czech Academy of Sciences Publication Activity Database
Mikyšková, Romana; Bieblová, Jana; Šímová, Jana; Indrová, Marie; Jandlová, Táňa; Vonka, V.; Šmahel, M.; Bubeník, Jan; Mendoza, Luis
2003-01-01
Roč. 49, č. 1 (2003), s. 26-32 ISSN 0015-5500 R&D Projects: GA MZd NC7148; GA MZd NC5900; GA ČR GA301/01/0985 Grant - others:GA CZ(CZ) Liga proti rakovině Institutional research plan: CEZ:AV0Z5052915 Keywords : MHC class I * IFN-gamma * HPV16 Subject RIV: FD - Oncology ; Hematology Impact factor: 0.527, year: 2003
Leal, Fabio E; Menezes, Soraya Maria; Costa, Emanuela A S; Brailey, Phillip M; Gama, Lucio; Segurado, Aluisio C; Kallas, Esper G; Nixon, Douglas F; Dierckx, Tim; Khouri, Ricardo; Vercauteren, Jurgen; Galvão-Castro, Bernardo; Saraiva Raposo, Rui Andre; Van Weyenbergh, Johan
2018-01-01
HTLV-1-Associated Myelopathy (HAM/TSP) is a progressive neuroinflammatory disorder for which no disease-modifying treatment exists. Modest clinical benefit from type I interferons (IFN-α/β) in HAM/TSP contrasts with its recently identified IFN-inducible gene signature. In addition, IFN-α treatment in vivo decreases proviral load and immune activation in HAM/TSP, whereas IFN-β therapy decreases tax mRNA and lymphoproliferation. We hypothesize this "IFN paradox" in HAM/TSP might be explained by both cell type- and gene-specific effects of type I IFN in HTLV-1-associated pathogenesis. Therefore, we analyzed ex vivo transcriptomes of CD4 + T cells, PBMCs and whole blood in healthy controls, HTLV-1-infected individuals, and HAM/TSP patients. First, we used a targeted approach, simultaneously quantifying HTLV-1 mRNA (HBZ, Tax), proviral load and 42 host genes with known antiretroviral (anti-HIV) activity in purified CD4 + T cells. This revealed two major clusters ("antiviral/protective" vs. "proviral/deleterious"), as evidenced by significant negative (TRIM5/TRIM22/BST2) vs. positive correlation (ISG15/PAF1/CDKN1A) with HTLV-1 viral markers and clinical status. Surprisingly, we found a significant inversion of antiretroviral activity of host restriction factors, as evidenced by opposite correlation to in vivo HIV-1 vs. HTLV-1 RNA levels. The anti-HTLV-1 effect of antiviral cluster genes was significantly correlated to their adaptive chimp/human evolution score, for both Tax mRNA and PVL. Six genes of the proposed antiviral cluster underwent lentivirus-driven purifying selection during primate evolution (TRIM5/TRIM22/BST2/APOBEC3F-G-H), underscoring the cross-retroviral evolutionary imprint. Secondly, we examined the genome-wide type I IFN response in HAM/TSP patients, following short-term ex vivo culture of PBMCs with either IFN-α or IFN-β. Microarray analysis evidenced 12 antiretroviral genes (including TRIM5α/TRIM22/BST2) were significantly up-regulated by IFN
Dedeurwaerder, Annelike; Olyslaegers, Dominique A J; Desmarets, Lowiese M B; Roukaerts, Inge D M; Theuns, Sebastiaan; Nauwynck, Hans J
2014-02-01
The type I IFN-mediated immune response is the first line of antiviral defence. Coronaviruses, like many other viruses, have evolved mechanisms to evade this innate response, ensuring their survival. Several coronavirus accessory genes play a central role in these pathways, but for feline coronaviruses this has never to our knowledge been studied. As it has been demonstrated previously that ORF7 is essential for efficient replication in vitro and virulence in vivo of feline infectious peritonitis virus (FIPV), the role of this ORF in the evasion of the IFN-α antiviral response was investigated. Deletion of ORF7 from FIPV strain 79-1146 (FIPV-Δ7) rendered the virus more susceptible to IFN-α treatment. Given that ORF7 encodes two proteins, 7a and 7b, it was further explored which of these proteins is active in this mechanism. Providing 7a protein in trans rescued the mutant FIPV-Δ7 from IFN sensitivity, which was not achieved by addition of 7b protein. Nevertheless, addition of protein 7a to FIPV-Δ3Δ7, a FIPV mutant deleted in both ORF3 and ORF7, could no longer increase the replication capacity of this mutant in the presence of IFN. These results indicate that FIPV 7a protein is a type I IFN antagonist and protects the virus from the antiviral state induced by IFN, but it needs the presence of ORF3-encoded proteins to exert its antagonistic function.
Directory of Open Access Journals (Sweden)
Elisa Fanunza
2018-02-01
Full Text Available The interferon (IFN system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24 is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE. Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z′- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance.
International Nuclear Information System (INIS)
Romanowski, W.; Braczkowski, R.; Nowakowska-Zajdel, E.; Muc-Wierzgon, M.; Zubelewicz-Szkodzinska, B.; Kosiewicz, J.; Korzonek, I.
2006-01-01
Introduction: Interferon a (IFN-a) is a cytokine with pleiotropic effects which, via different pathways, influences the secretion of certain cytokines and hormones. Growth hormone (GH) secreted from the pituitary has physiological effects on various target tissues. The question is how IFN-a administered in various types of disease influences GH secretion. This study investigated the acute effect of IFN-a on GH mRNA expression in the rat anterior pituitary. Objective: The aim of the study was to measure the cellular expression of GH mRNA by in situ hybridisation in the anterior pituitary after a single administration of IFN-a. Material and methods: Rats were administered an intraperitoneal injection of IFN-a or saline. The rat pituitaries were taken 2 and 4 hours after IFN/saline administration and kept frozen until in situ hybridisation histochemistry. A 31 - base 35S -labelled oligonucleotide probe complementary to part of the exonic mRNA sequence coding for GH mRNA was used. All control and experimental sections were hybridised in the same hybridisation reaction. Results: Acute administration of interferon a increased GH mRNA expression in the anterior pituitary in the 4-hour group in comparison with the control group, and there was no difference between the control group and the 2-hour rats. Conclusion: A single IFN-a administration was found to exert an influence on anterior pituitary GH mRNA expression. These observations may pave the way for presenting a possible new action of IFN-a. (author) GH mRNA, anterior pituitary, interferon
Impedance model for quantum-mechanical barrier problems
International Nuclear Information System (INIS)
Nelin, Evgenii A
2007-01-01
Application of the impedance model to typical quantum-mechanical barrier problems, including those for structures with resonant electron tunneling, is discussed. The efficiency of the approach is illustrated. The physical transparency and compactness of the model and its potential as a teaching and learning tool are discussed. (methodological notes)
Directory of Open Access Journals (Sweden)
Andreas Kupz
Full Text Available Natural killer (NK cells are a critical part of the innate immune defense against viral infections and for the control of tumors. Much less is known about how NK cells contribute to anti-bacterial immunity. NK cell-produced interferon gamma (IFN-γ contributes to the control of early exponential replication of bacterial pathogens, however the regulation of these events remains poorly resolved. Using a mouse model of invasive Salmonellosis, here we report that the activation of the intracellular danger sensor NLRC4 by Salmonella-derived flagellin within CD11c+ cells regulates early IFN-γ secretion by NK cells through the provision of interleukin 18 (IL-18, independently of Toll-like receptor (TLR-signaling. Although IL18-signalling deficient NK cells improved host protection during S. Typhimurium infection, this increased resistance was inferior to that provided by wild-type NK cells. These findings suggest that although NLRC4 inflammasome-driven secretion of IL18 serves as a potent activator of NK cell mediated IFN-γ secretion, IL18-independent NK cell-mediated mechanisms of IFN-γ secretion contribute to in vivo control of Salmonella replication.
Directory of Open Access Journals (Sweden)
Fabio E. Leal
2018-05-01
Full Text Available HTLV-1-Associated Myelopathy (HAM/TSP is a progressive neuroinflammatory disorder for which no disease-modifying treatment exists. Modest clinical benefit from type I interferons (IFN-α/β in HAM/TSP contrasts with its recently identified IFN-inducible gene signature. In addition, IFN-α treatment in vivo decreases proviral load and immune activation in HAM/TSP, whereas IFN-β therapy decreases tax mRNA and lymphoproliferation. We hypothesize this “IFN paradox” in HAM/TSP might be explained by both cell type- and gene-specific effects of type I IFN in HTLV-1-associated pathogenesis. Therefore, we analyzed ex vivo transcriptomes of CD4+ T cells, PBMCs and whole blood in healthy controls, HTLV-1-infected individuals, and HAM/TSP patients. First, we used a targeted approach, simultaneously quantifying HTLV-1 mRNA (HBZ, Tax, proviral load and 42 host genes with known antiretroviral (anti-HIV activity in purified CD4+ T cells. This revealed two major clusters (“antiviral/protective” vs. “proviral/deleterious”, as evidenced by significant negative (TRIM5/TRIM22/BST2 vs. positive correlation (ISG15/PAF1/CDKN1A with HTLV-1 viral markers and clinical status. Surprisingly, we found a significant inversion of antiretroviral activity of host restriction factors, as evidenced by opposite correlation to in vivo HIV-1 vs. HTLV-1 RNA levels. The anti-HTLV-1 effect of antiviral cluster genes was significantly correlated to their adaptive chimp/human evolution score, for both Tax mRNA and PVL. Six genes of the proposed antiviral cluster underwent lentivirus-driven purifying selection during primate evolution (TRIM5/TRIM22/BST2/APOBEC3F-G-H, underscoring the cross-retroviral evolutionary imprint. Secondly, we examined the genome-wide type I IFN response in HAM/TSP patients, following short-term ex vivo culture of PBMCs with either IFN-α or IFN-β. Microarray analysis evidenced 12 antiretroviral genes (including TRIM5α/TRIM22/BST2 were significantly
DEFF Research Database (Denmark)
Matheu, Victor; Treschow, Alexandra; Navikas, Vaidrius
2003-01-01
. OBJECTIVE: We sought to define the differential role of endogenous IFN-beta in controlling the development of allergic inflammation. METHODS: We assessed whether deletion of the gene encoding IFN-beta (IFNB) with knockout mice participated in the development of allergic response in ovalbumin (OVA......BACKGROUND: IFN-beta has been shown to be effective as therapy for multiple sclerosis. Some reports attributed its beneficial effects to the capacity to induce a T(H)2 response. However, other studies have suggested that endogenous type I IFN might downregulate the allergic response in mice...
Searles, Steve; Gauss, Katherine; Wilkison, Michelle; Hoyt, Teri R; Dobrinen, Erin; Meissner, Nicole
2013-10-01
Although acquired bone marrow failure (BMF) is considered a T cell-mediated autoimmune disease, possible innate immune defects as a cause for systemic immune deviations in response to otherwise innocuous infections have not been extensively explored. In this regard, we recently demonstrated an important role of type I IFNs in protecting hematopoiesis during systemic stress responses to the opportunistic fungal pathogen Pneumocystis in lymphocyte-deficient mice. Mice deficient in both lymphocytes and type I IFN receptor (IFrag(-/-) mice) develop rapidly progressing BMF due to accelerated bone marrow (BM) cell apoptosis associated with innate immune deviations in the BM in response to Pneumocystis lung infection. However, the communication pathway between lung and BM eliciting the induction of BMF in response to this strictly pulmonary infection has been unclear. In this study, we report that absence of an intact type I IFN system during Pneumocystis lung infection not only causes BMF in lymphocyte-deficient mice but also transient BM stress in lymphocyte-competent mice. This is associated with an exuberant systemic IFN-γ response. IFN-γ neutralization prevented Pneumocystis lung infection-induced BM depression in type I IFN receptor-deficient mice and prolonged neutrophil survival time in BM from IFrag(-/-) mice. IL-1β and upstream regulators of IFN-γ, IL-12, and IL-18 were also upregulated in lung and serum of IFrag(-/-) mice. In conjunction, there was exuberant inflammasome-mediated caspase-1 activation in pulmonary innate immune cells required for processing of IL-18 and IL-1β. Thus, absence of type I IFN signaling during Pneumocystis lung infection may result in deregulation of inflammasome-mediated pulmonary immune activation, causing systemic immune deviations triggering BMF in this model.
DEFF Research Database (Denmark)
Vihinen, Pia; Tervahartiala, Taina; Sorsa, Timo
2015-01-01
Matrix metalloproteinases (MMPs) are important enzymes in tissue turnover and various inflammatory processes. In this study, it was evaluated whether serum MMP-8 can predict the response to adjuvant interferon alfa-2b (IFN-α) therapy in patients with operated high-risk cutaneous melanoma. Pre......-treatment sera from 460 patients with stage IIB-IIIC melanoma were analyzed for MMP-8. The patients were randomized after surgery to adjuvant IFN-α for 12 or 24 months (n = 313) or observation only (n = 147). The median serum MMP-8 level was used to classify the patients into a low MMP-8 (n = 232) and a high MMP......-8 (n = 228) group. In the high MMP-8 subgroup, IFN-α therapy significantly improved relapse-free survival (RFS). RFS was 36.8 months in patients with high MMP-8 levels receiving IFN-α therapy, whereas RFS for those with high MMP-8 levels with observation only was 10.6 months (P = 0.027). Median...
Vitamin D Is Required for IFN-γ–Mediated Antimicrobial Activity of Human Macrophages
Fabri, Mario; Stenger, Steffen; Shin, Dong-Min; Yuk, Jae-Min; Liu, Philip T.; Realegeno, Susan; Lee, Hye-Mi; Krutzik, Stephan R.; Schenk, Mirjam; Sieling, Peter A.; Teles, Rosane; Montoya, Dennis; Iyer, Shankar S.; Bruns, Heiko; Lewinsohn, David M.; Hollis, Bruce W.; Hewison, Martin; Adams, John S.; Steinmeyer, Andreas; Zügel, Ulrich; Cheng, Genhong; Jo, Eun-Kyeong; Bloom, Barry R.; Modlin, Robert L.
2012-01-01
Control of tuberculosis worldwide depends on our understanding of human immune mechanisms, which combat the infection. Acquired T cell responses are critical for host defense against microbial pathogens, yet the mechanisms by which they act in humans remain unclear. We report that T cells, by the release of interferon-γ (IFN-γ), induce autophagy, phagosomal maturation, the production of antimicrobial peptides such as cathelicidin, and antimicrobial activity against Mycobacterium tuberculosis in human macrophages via a vitamin D–dependent pathway. IFN-γ induced the antimicrobial pathway in human macrophages cultured in vitamin D–sufficient sera, but not in sera from African-Americans that have lower amounts of vitamin D and who are more susceptible to tuberculosis. In vitro supplementation of vitamin D–deficient serum with 25-hydroxyvitamin D3 restored IFN-γ–induced antimicrobial peptide expression, autophagy, phagosome-lysosome fusion, and antimicrobial activity. These results suggest a mechanism in which vitamin D is required for acquired immunity to overcome the ability of intracellular pathogens to evade macrophage-mediated antimicrobial responses. The present findings underscore the importance of adequate amounts of vitamin D in all human populations for sustaining both innate and acquired immunity against infection. PMID:21998409
Directory of Open Access Journals (Sweden)
Kuo-Ching Sheng
2013-01-01
Full Text Available Phenotypic maturation and T cell stimulation are two functional attributes of DCs critical for immune induction. The combination of antigens, including those from cancer, with Toll-like receptor (TLR ligands induces far superior cellular immune responses compared to antigen alone. In this study, IFN-gamma treatment of bone marrow-derived DC, followed by incubation with the TLR2, TLR4, or TLR9 agonists, enhanced DC activation compared to TLR ligation alone. Most notably, the upregulation of CD40 with LPS stimulation and CD86 with CpG stimulation was observed in in vitro cultures. Similarly, IFN-gamma coinjected with TLR ligands was able to promote DC activation in vivo, with DCs migrating from the site of immunization to the popliteal lymph nodes demonstrating increased expression of CD80 and CD86. The heightened DC activation translated to a drastic increase in T cell stimulatory capacity in both antigen independent and antigen dependent fashions. This is the first time that IFN-gamma has been shown to have a combined effect with TLR ligation to enhance DC activation and function. The results demonstrate the novel use of IFN-gamma together with TLR agonists to enhance antigen-specific T cell responses, for applications in the development of enhanced vaccines and drug targets against diseases including cancer.
Callister, Steven M; Jobe, Dean A; Stuparic-Stancic, Aleksandra; Miyamasu, Misato; Boyle, Jeff; Dattwyler, Raymond J; Arnaboldi, Paul M
2016-05-15
Current serodiagnostics for Lyme disease lack sensitivity during early disease, and cannot determine treatment response. We evaluated an assay based on QuantiFERON technology utilizing peptide antigens derived from Borrelia burgdorferi to stimulate interferon-gamma (IFN-γ) release as an alternative to serodiagnosis for the laboratory detection of Lyme disease. Blood was obtained from patients with erythema migrans before (n = 29) and 2 months after (n = 27) antibiotic therapy. IFN-γ release was measured by enzyme-linked immunosorbent assay (ELISA) following overnight stimulation of whole blood with the peptide antigens, and compared to the results of standard serological assays (C6, ELISA, and Western blot). IFN-γ release was observed in pretreatment blood of 20 of 29 (69%) patients with Lyme disease. Following antibiotic treatment, IFN-γ was significantly reduced (P = .0002), and was detectable in only 4 of 20 (20%) initially positive patients. By contrast, anti-C6 antibodies were detected in pretreatment sera from 17 of 29 (59%) subjects, whereas only 5 of 29 (17%) patients had positive Western blot seroreactivity. Antibody responses persisted and expanded following treatment. Our findings suggest that measurement of IFN-γ after incubating blood with Borrelia antigens could be useful in the laboratory diagnosis of early Lyme disease. Also, after antibiotic treatment, this response appears to be short lived. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Quantitative detection of fusion protein rIFN-β-HSA by a sandwich ...
African Journals Online (AJOL)
user
2011-02-14
Feb 14, 2011 ... (Corning-Costar, NY, USA), urine microalbumin kits were purchased from ... regarded as the standard of rIFN-β-HSA and was stored at −80°C. ... and antibody concentration, sample incubating time and detecting. Zhu et al.
Directory of Open Access Journals (Sweden)
Barbier Eliane
2009-06-01
Full Text Available Abstract Background In murine models of malaria, an early proinflammatory response has been associated with the resolution of blood-stage infection. To dissect the protective immune mechanims that allow the control of parasitaemia, the early immune response of C57BL/6 mice induced during a non-lethal plasmodial infection was analysed. Methods Mice were infected with Plasmodium yoelii 265BY sporozoites, the natural invasive form of the parasite, in order to complete its full life cycle. The concentrations of three proinflammatory cytokines in the sera of mice were determined by ELISA at different time points of infection. The contribution of the liver and the spleen to this cytokinic response was evaluated and the cytokine-producing lymphocytes were identified by flow cytometry. The physiological relevance of these results was tested by monitoring parasitaemia in genetically deficient C57BL/6 mice or wild-type mice treated with anti-cytokine neutralizing antibody. Finally, the cytokinic response in sera of mice infected with parasitized-RBCs was analysed. Results The early immune response of C57BL/6 mice to sporozoite-induced malaria is characterized by a peak of IFN-γ in the serum at day 5 of infection and splenic CD4 T lymphocytes are the major producer of this cytokine at this time point. Somewhat unexpected, the parasitaemia is significantly lower in P. yoelii-infected mice in the absence of IFN-γ. More precisely, at early time points of infection, IFN-γ favours parasitaemia, whereas helping to clear efficiently the blood-stage parasites at later time points. Interestingly, the early IFN-γ burst is induced by the pre-erythrocytic stage. Conclusion These results challenge the current view regarding the role of IFN-γ on the control of parasite growth since they show that IFN-γ is not an essential mediator of protection in P. yoelii-infected C57BL/6 mice. Moreover, the mice parasitaemia is more efficiently controlled in the absence of an
Role of IFN-gamma and IL-6 in a protective immune response to Yersinia enterocolitica in mice
Directory of Open Access Journals (Sweden)
Autenrieth Ingo B
2008-09-01
Full Text Available Abstract Background Yersinia outer protein (Yop H is a secreted virulence factor of Yersinia enterocolitica (Ye, which inhibits phagocytosis of Ye and contributes to the virulence of Ye in mice. The aim of this study was to address whether and how YopH affects the innate immune response to Ye in mice. Results For this purpose, mice were infected with wild type Ye (pYV+ or a YopH-deficient Ye mutant strain (ΔyopH. CD11b+ cells were isolated from the infected spleen and subjected to gene expression analysis using microarrays. Despite the attenuation of ΔyopH in vivo, by variation of infection doses we were able to achieve conditions that allow comparison of gene expression in pYV+ and ΔyopH infection, using either comparable infection courses or splenic bacterial burden. Gene expression analysis provided evidence that expression levels of several immune response genes, including IFN-γ and IL-6, are high after pYV+ infection but low after sublethal ΔyopH infection. In line with these findings, infection of IFN-γR-/- and IL-6-/- mice with pYV+ or ΔyopH revealed that these cytokines are not necessarily required for control of ΔyopH, but are essential for defense against infection with the more virulent pYV+. Consistently, IFN-γ pretreatment of bone marrow derived macrophages (BMDM strongly enhanced their ability in killing intracellular Ye bacteria. Conclusion In conclusion, this data suggests that IFN-γ-mediated effector mechanisms can partially compensate virulence exerted by YopH. These results shed new light on the protective role of IFN-γ in Ye wild type infections.
Ni, Bin; Rajaram, Murugesan V S; Lafuse, William P; Landes, Michelle B; Schlesinger, Larry S
2014-11-01
IFN-γ-activated macrophages play an essential role in controlling intracellular pathogens; however, macrophages also serve as the cellular home for the intracellular pathogen Mycobacterium tuberculosis. Based on previous evidence that M. tuberculosis can modulate host microRNA (miRNA) expression, we examined the miRNA expression profile of M. tuberculosis-infected primary human macrophages. We identified 31 differentially expressed miRNAs in primary human macrophages during M. tuberculosis infection by NanoString and confirmed our findings by quantitative real-time RT-PCR. In addition, we determined a role for two miRNAs upregulated upon M. tuberculosis infection, miR-132 and miR-26a, as negative regulators of transcriptional coactivator p300, a component of the IFN-γ signaling cascade. Knockdown expression of miR-132 and miR-26a increased p300 protein levels and improved transcriptional, translational, and functional responses to IFN-γ in human macrophages. Collectively, these data validate p300 as a target of miR-132 and miR-26a, and demonstrate a mechanism by which M. tuberculosis can limit macrophage responses to IFN-γ by altering host miRNA expression. Copyright © 2014 by The American Association of Immunologists, Inc.
Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro
2002-09-01
Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.
Illustrator CC digital classroom
Smith, Jennifer
2013-01-01
A complete training package lets you learn Adobe Illustrator CC at your own speed Adobe Illustrator is the leading drawing and illustration software used to create artwork for a variety of media. This book-and-DVD package provides 13 self-paced lessons that get you up to speed on the latest version of Illustrator (Creative Cloud). Step-by-step instructions in the full-color book are supported by video tutorials on the DVD. Together, these tools will help you learn Adobe Illustrator basics, essential skills, and all the new capabilities in Illustrator CC-in no time. Includes step-by-step in
Directory of Open Access Journals (Sweden)
Abediankenari Saeid
2009-10-01
Full Text Available During antigen capture and processing, mature dendritic cells (DC express large amounts of peptide-MHC complexes and accessory molecules on their surface. We investigated the role of IFN-β in induction HLA-G expression on the monocyte derived DC and cytokine profile in diabetes type 1. We accomplished secretary pattern and total cytokine production of the Th1 cytokine (IL-2, γIFN and Th2 cytokines (IL-4, IL-10 before and after mixed leukocyte reaction (MLR of 30 diabetic patients and 30 normal subjects. In this study a significant increase of IL-10 and γIFN reduction after IFN-β Therapy in culture in presence of HLA-G bearing DC as compared to control were seen. It is seen that dendritic cell causes IL-10 production of T cell in vitro that reduce T cell activation from diabetes patients and normal subjects resulted to the production and expression of HLA-G on these cells from both groups. Using mixed leukocyte reaction, it was found that IFN-β-treated dendritic cell mediated the inhibition of autologous T cell activation via IL-10 production and level of HLA-G on dendritic cell may be correlated to disease activity in diabetes patients and it could also serve as a useful marker for disease progress and treatment.
Energy Technology Data Exchange (ETDEWEB)
Hatano, Ryo; Yamada, Kiyoshi; Iwamoto, Taku; Maeda, Nana; Emoto, Tetsuro; Shimizu, Makoto; Totsuka, Mamoru, E-mail: atotuka@mail.ecc.u-tokyo.ac.jp
2013-06-14
Highlights: •Small intestinal epithelial cells (sIECs). •sIECs are able to induce antigen specific proliferation of CD4{sup +} IELs. •sIECs induce markedly enhanced IFN-γ secretion by CD4{sup +} IELs. •Induction of enhanced IFN-γ secretion by sIECs is uniquely observed in CD4{sup +} IELs. -- Abstract: Small intestinal epithelial cells (sIECs) express major histocompatibility complex class II molecules even in a normal condition, and are known to function as antigen presenting cells (APCs) at least in vitro. These findings raised the possibility that sIECs play an important role in inducing immune responses against luminal antigens, especially those of intestinal intraepithelial lymphocytes (IELs) and lamina propria lymphocytes (LPLs). We herein showed that antigenic stimulation with sIECs induced markedly greater secretion of interferon-gamma (IFN-γ) by CD4{sup +} IELs, but not interleukin (IL)-4, IL-10 and IL-17 although the proliferative response was prominently lower than that with T cell-depleted splenic APCs. In contrast, no enhanced IFN-γ secretion by CD4{sup +} LPLs and primed splenic CD4{sup +} T cells was observed when stimulated with sIECs. Taken together, these results suggest that sIECs uniquely activate CD4{sup +} IELs and induce remarkable IFN-γ secretion upon antigenic stimulation in vivo.
DEFF Research Database (Denmark)
Riber, Ulla; Hansen, Mette Sif; Lauritsen, Klara Tølbøll
In a vaccine trial against Mycoplasma hyosynoviae infection, pigs were vaccinated with formalin fixed whole-cell-antigen formulated with adjuvant DDA/TDB (SSI). Placebo pigs received adjuvant with saline. Vaccinations were performed at five and eight weeks of age, followed by an intranasal M....... hyosynoviae challenge inoculation three weeks later. Vaccination induced both antibodies and a cell-mediated immune response (CMI) in vaccinated pigs compared to placebo pigs as shown by M. hyosynoviae antigen (Ag) specific IFN-γ response in an IL-18 potentiated whole-blood IFN-γ stimulation assay (mean IFN......-γ level 1936 pg/ml vs. 82 pg/ml (p=0.0001)). A central memory T cell phenotype with polyfunctional capacity to produce all three cytokines IFN-γ, TNF-α and IL-2 has recently been linked to development of vaccine induced protection in several infections. In a subset of seven vaccinated pigs and four...
Role of IL-12 and IFN-γ in immune response to toxoplasma gondii infection
International Nuclear Information System (INIS)
Moawad, M.A.F.; ElGawish, M.A.M.
2004-01-01
Interlenkin 12 (IL-12) is a potent immunoregulatory molecule that is critically involved in a wide range of diseases. In several murine models of intracellular infection, endogenous IL-12 has been shown to be crucial for the generation of a protective Th1 response in a primary infection for a intracellular pathogens. Interferon-gamma (IFN-γ) is also an important mediator of cellular immunity against microbial pathogens and tumor cells due to its potent capacity to activate macrophages for enhanced cytotoxicity. The aim of the present study is to evaluate the immune response to toxoplasma gondii after primary inflection (infected groups and secondary infection (re-infected groups for over 19 weeks (the time of the experiment). the evaluation was assessed by measurements of levels of IL-12 and IFN-γ using ELISA technique in the sera of these infected rats. The results demonstrated that the primary immune response induced a fluctuation in the levels of IL-12 in the sera of infected rats, which reached maximum value of 122.6 ±1.4 pg/ml after 15 weeks of primary infection. While, in the challenged groups (secondary immune response, re-infected groups) the levels of IL-12 were generally lower than that of the primary immune response. On the other hand, IFN-γ levels increased significantly in the secondary immune response (re-infected groups) as compared to primary immune response 9 infected groups) In conclusion, the results suggest that IL-12 might have a role in the defense mechanism against intracellular infection with T-gondii especially in primary immune response than in the secondary immune response. This is in contrast to IFN-γ that takes the up-hand in secondary immune response to T-gondii infection
Salinas-Carmona, Mario C; Zúñiga, Juan M; Pérez-Rivera, Luz I; Segoviano-Ramírez, Juan C; Vázquez-Marmolejo, Anna V
2009-05-01
Interferon-gamma (IFN-gamma) is a critical cytokine involved in control of different infections. Actinomycetoma is a chronic infectious disease mainly caused by the bacterium Nocardia brasiliensis, which destroys subcutaneous tissue, including bone. Currently, the mechanism of pathogenesis in N. brasiliensis infection is not known. Here, we demonstrate that N. brasiliensis induced an IFN-gamma response in serum after 24 h of infection, while, in infected tissue, positive cells to IFN-gamma appeared in 2 early peaks: the first was present only 3 h after infection, then transiently decreased; and the second peak appeared 12 h after infection and was independent of interleukin-10. Resident macrophages produced an immediate IFN-gamma response 1 h after in vitro infection, and spleen-positive cells began later. The phase of growth of N. brasiliensis affected cytokine production, and exposure of macrophages to Nocardia opsonized with either polyclonal anti-Nocardia antibodies or anti-P61 monoclonal antibody led to a suppression of cytokine production. Our report provides evidence that N. brasiliensis as an intracellular bacterium modulates macrophage cytokine production, which helps survival of the pathogen. Modulation of these cytokines may contribute to pathogenesis once this bacterium is inside the macrophage.
DEFF Research Database (Denmark)
Simonsson, Bengt; Gedde-Dahl, Tobias; Markevärn, Berit
2011-01-01
Biologic and clinical observations suggest that combining imatinib with IFN-a may improve treatment outcome in chronic myeloid leukemia (CML). We randomized newly diagnosed chronic-phase CML patients with a low or intermediate Sokal risk score and in imatinib-induced complete hematologic remission......%) discontinued imatinib treatment (1 because of blastic transformation in imatinib arm). In addition, in the combination arm, 34 patients (61%) discontinued Peg-IFN-a2b, most because of toxicity. The MMR rate at 12 months was significantly higher in the imatinib plus Peg-IFN-a2b arm (82%) compared...... with the imatinib monotherapy arm (54%; intention-to-treat, P = .002). The MMR rate increased with the duration of Peg-IFN-a2b treatment ( 12-week MMR rate 91%). Thus, the addition of even relatively short periods of Peg-IFN-a2b to imatinib markedly increased the MMR rate at 12 months...
Directory of Open Access Journals (Sweden)
Peihong Dai
2014-04-01
Full Text Available Modified vaccinia virus Ankara (MVA is an attenuated poxvirus that has been engineered as a vaccine against infectious agents and cancers. Our goal is to understand how MVA modulates innate immunity in dendritic cells (DCs, which can provide insights to vaccine design. In this study, using murine bone marrow-derived dendritic cells, we assessed type I interferon (IFN gene induction and protein secretion in response to MVA infection. We report that MVA infection elicits the production of type I IFN in murine conventional dendritic cells (cDCs, but not in plasmacytoid dendritic cells (pDCs. Transcription factors IRF3 (IFN regulatory factor 3 and IRF7, and the positive feedback loop mediated by IFNAR1 (IFN alpha/beta receptor 1, are required for the induction. MVA induction of type I IFN is fully dependent on STING (stimulator of IFN genes and the newly discovered cytosolic DNA sensor cGAS (cyclic guanosine monophosphate-adenosine monophosphate synthase. MVA infection of cDCs triggers phosphorylation of TBK1 (Tank-binding kinase 1 and IRF3, which is abolished in the absence of cGAS and STING. Furthermore, intravenous delivery of MVA induces type I IFN in wild-type mice, but not in mice lacking STING or IRF3. Treatment of cDCs with inhibitors of endosomal and lysosomal acidification or the lysosomal enzyme Cathepsin B attenuated MVA-induced type I IFN production, indicating that lysosomal enzymatic processing of virions is important for MVA sensing. Taken together, our results demonstrate a critical role of the cGAS/STING-mediated cytosolic DNA-sensing pathway for type I IFN induction in cDCs by MVA. We present evidence that vaccinia virulence factors E3 and N1 inhibit the activation of IRF3 and the induction of IFNB gene in MVA-infected cDCs.
Directory of Open Access Journals (Sweden)
Guillaume Sarrabayrouse
Full Text Available BACKGROUND: Suboptimal activation of T lymphocytes by melanoma cells is often due to the defective expression of class I major histocompatibility antigens (MHC-I and costimulatory molecules. We have previously shown that geranylgeranyl transferase inhibition (done with GGTI-298 stimulates anti-melanoma immune response through MHC-I and costimulatory molecule expression in the B16F10 murine model [1]. METHODOLOGY/PRINCIPAL FINDINGS: In this study, it is shown that vaccination with mIFN-gand GGTI-298 pretreated B16F10 cells induces a protection against untreated tumor growth and pulmonary metastases implantation. Furthermore, using a human melanoma model (LB1319-MEL, we demonstrated that in vitro treatment with hIFN-gamma and GGTI-298 led to the up regulation of MHC-I and a costimulatory molecule CD86 and down regulation of an inhibitory molecule PD-1L. Co-culture experiments with peripheral blood mononuclear cells (PBMC revealed that modifications induced by hIFN-gamma and GGTI-298 on the selected melanoma cells, enables the stimulation of lymphocytes from HLA compatible healthy donors. Indeed, as compared with untreated melanoma cells, pretreatment with hIFN-gamma and GGTI-298 together rendered the melanoma cells more efficient at inducing the: i activation of CD8 T lymphocytes (CD8+/CD69+; ii proliferation of tumor-specific CD8 T cells (MelanA-MART1/TCR+; iii secretion of hIFN-gamma; and iv anti-melanoma specific cytotoxic cells. CONCLUSIONS/SIGNIFICANCE: These data indicate that pharmacological treatment of melanoma cell lines with IFN-gamma and GGTI-298 stimulates their immunogenicity and could be a novel approach to produce tumor cells suitable for vaccination and for stimulation of anti-melanoma effector cells.
Directory of Open Access Journals (Sweden)
Violette Dirix
2012-01-01
Full Text Available Infant CD4+ T-cell responses to bacterial infections or vaccines have been extensively studied, whereas studies on CD8+ T-cell responses focused mainly on viral and intracellular parasite infections. Here we investigated CD8+ T-cell responses upon Bordetella pertussis infection in infants, children, and adults and pertussis vaccination in infants. Filamentous hemagglutinin-specific IFN-γ secretion by circulating lymphocytes was blocked by anti-MHC-I or -MHC-II antibodies, suggesting that CD4+ and CD8+ T lymphocytes are involved in IFN-γ production. Flow cytometry analyses confirmed that both cell types synthesized antigen-specific IFN-γ, although CD4+ lymphocytes were the major source of this cytokine. IFN-γ synthesis by CD8+ cells was CD4+ T cell dependent, as evidenced by selective depletion experiments. Furthermore, IFN-γ synthesis by CD4+ cells was sometimes inhibited by CD8+ lymphocytes, suggesting the presence of CD8+ regulatory T cells. The role of this dual IFN-γ secretion by CD4+ and CD8+ T lymphocytes in pertussis remains to be investigated.
DEFF Research Database (Denmark)
Bregenholt, S; Brimnes, J; Nissen, Mogens Holst
1999-01-01
To investigate the role of IFN-gamma in the immunopathogenesis of inflammatory bowel disease (IBD), severe combined immunodeficient (SCID) mice were transplanted with in vitro activated CD4+ T cells from either wild-type (WT) or IFN-gamma-deficient (IFN-gammaKO) BALB/c mice. In vitro, the two types...... of T cells displayed comparable proliferation rates and production of tumour necrosis factor-alpha (TNF-alpha), IL-2, IL-4 and IL-10 after concanavalin A (Con A) stimulation. When transplanted into SCID mice, WT CD4+ blasts induced a lethal IBD, whereas IFN-gammaKO blasts induced a less severe...... intestinal inflammation with moderate weight loss. Intracellular cytokine staining of lamina propria lymphocytes (LPL) revealed comparable fractions of CD4+ T cells positive for TNF-alpha, IL-2 and IL-10 in the two groups of transplanted SCID mice, whereas a two-to-three-fold increase in the fraction of IL-4...
Institute of Scientific and Technical Information of China (English)
林正豪; 曾剑锋; 刘国辉
2013-01-01
Objective To discuss clinical application of Mycobacterium tuberculosis antigen specific IFN-γresponses in antidiastole between tuberculous meningitis and cryptococal neoformans meningitis. Methods IFN-γresponses in peripheral blood of 13 patients with csf positive tuberculous meningitis , 15 patients with csf negative tuberculous meningitis and 11 patients with cryptococal neoformans meningitis were tested and then analyzed retrospectively. Results Positive IFN-γresponses were detected in 69.2%(9/13)of patients with csf positive tuberculous meningitis, 66.7%(10/15)of patients with csf negative tuberculous meningitis and 9.0%(1/11) of patients with cryptococal neoformans meningitis. IFN-γresponses in the three groups is statistically different(χ2=6.78,P=0.001). Through the comparison between the two two groups, IFN-γresponses positive rate between csf positive tuberculous meningitis patients and csf negative tuberculous meningitis patients is not statistically different(χ2=4.31,P=0.07). IFN-γresponses positive rate between csf positive tuberculous meningitis patients and cryptococal neoformans meningitis patients is statistically different(χ2=7.37,P=0.013). IFN-γresponses positive rate between csf negative tuberculous meningitis patients and cryptococal neoformans meningitis patients is statistically different(χ2=8.26,P=0.024).Conclusion IFN-γresponses in peripheral blood can be used as an assistant means to discriminate cryptococal neoformans meningitis from tuberculous meningitis.% 目的探讨外周血结核杆菌抗原特异性γ干扰素水平在结核性脑膜炎与隐球菌性脑膜炎鉴别诊断中的作用。方法回顾性分析本院13例菌阳结核性脑膜炎、15菌阴结核性脑膜炎及11例隐球菌性脑膜炎患者外周血结核杆菌抗原特异性γ干扰素水平差异。结果菌阳结核性脑膜炎患者外周血结核杆菌抗原特异性γ干扰素9例阳性,4例阴性,阳性率69.2%
He, Dengming; Tao, Shiqi; Guo, Shimin; Li, Maoshi; Wu, Junqiu; Huang, Hongfei; Guo, Xinwu; Yan, Guohua; Zhu, Peng; Wang, Yuming
2015-08-01
The toll-like receptor-interferon (TLR-IFN) signalling pathway plays a crucial role in HBV infection. Human leucocyte antigen (HLA) polymorphisms are associated with chronic HBV infection by genome wide association study (GWAS). We aimed to explore interaction between TLR-IFN and HLA gene polymorphisms in susceptibility of chronic HBV infection. In the Chinese Southwest Han population, 1191 chronic HBV infection patients and 273 HBV clearance were selected. A total of 39 single nucleotide polymorphism loci in 23 genes of the TLR-IFN pathway and four HLA polymorphism loci associated with chronic HBV infection identified by GWAS were selected for genotyping. SNPStats, QVALUE, and multifactor dimensionality reduction were used for statistical analysis. A significant association was seen in several of the TLR-IFN pathway genes, TLR9 rs352140 (OR = 0.70, P = 0.0088), IL1B rs16944 (OR = 0.67, P = 0.016), IL12B rs3212227 (OR = 1.38, P = 0.021), IFNGR1 rs3799488 (OR = 1.48, P = 0.0048), IFNGR2 rs1059293 (OR = 0.27, P = 0.011), MX1 rs467960 (OR = 0.68, P = 0.022), as well as four loci in HLA, rs3077 (OR = 0.55, P rs16944 (0.13%), rs1143623 and rs6613 (0.10%). The combination of rs9277535 in HLA and rs16944 in IL1B was the best model to predict chronic HBV infection (testing accuracy = 0.6040, P = 0.0010, cross-validation consistency = 10/10). TLR-IFN pathway gene polymorphisms are associated with chronic HBV infection. Interactions with polymorphisms in these genes may be one mechanism by which HLA polymorphisms influence susceptibility to chronic HBV infection, as specific single nucleotide polymorphism combinations are highly predictive of chronic HBV infection. © 2014 The Authors. Liver International Published by John Wiley & Sons Ltd.
Guarding the frontiers: the biology of type III interferons
DEFF Research Database (Denmark)
Wack, Andreas; Terczynska-Dyla, Ewa; Hartmann, Rune
2015-01-01
Type III interferons (IFNs) or IFN-λs regulate a similar set of genes as type I IFNs, but whereas type I IFNs act globally, IFN-λs primarily target mucosal epithelial cells and protect them against the frequent viral attacks that are typical for barrier tissues. IFN-λs thereby help to maintain...
CCR6 and NK1.1 distinguish between IL-17A and IFN-gamma-producing gammadelta effector T cells.
Haas, Jan D; González, Frano H Malinarich; Schmitz, Susanne; Chennupati, Vijaykumar; Föhse, Lisa; Kremmer, Elisabeth; Förster, Reinhold; Prinz, Immo
2009-12-01
Gammadelta T cells are a potent source of innate IL-17A and IFN-gamma, and they acquire the capacity to produce these cytokines within the thymus. However, the precise stages and required signals that guide this differentiation are unclear. Here we show that the CD24(low) CD44(high) effector gammadelta T cells of the adult thymus are segregated into two lineages by the mutually exclusive expression of CCR6 and NK1.1. Only CCR6+ gammadelta T cells produced IL-17A, while NK1.1+ gammadelta T cells were efficient producers of IFN-gamma but not of IL-17A. Their effector phenotype correlated with loss of CCR9 expression, particularly among the NK1.1+ gammadelta T cells. Accordingly, both gammadelta T-cell subsets were rare in gut-associated lymphoid tissues, but abundant in peripheral lymphoid tissues. There, they provided IL-17A and IFN-gamma in response to TCR-specific and TCR-independent stimuli. IL-12 and IL-18 induced IFN-gamma and IL-23 induced IL-17A production by NK1.1+ or CCR6+ gammadelta T cells, respectively. Importantly, we show that CCR6+ gammadelta T cells are more responsive to TCR stimulation than their NK1.1+ counterparts. In conclusion, our findings support the hypothesis that CCR6+ IL-17A-producing gammadelta T cells derive from less TCR-dependent selection events than IFN-gamma-producing NK1.1+ gammadelta T cells.
International Nuclear Information System (INIS)
Mou Xudong; Ren Hong; Xie Chuntao
2010-01-01
Objective: To study the significance of changes of serum IL-2, TNF-α and IFN-γ levels after treatment in patients with psoriasis. Methods: Serum levels of IL-2, TNF-α (with RIA) and IFN-γ (with ELISA) were measured both before and after treatment in 37 patients with psoriasis and 35 controls. Results: Before treatment, the serum IL-2 levels in patients were significantly lower than those in controls (P<0.01), while the serum TNF-α and IFN-γ levels were significantly higher (P<0.01). After treatment for 3 months, the levels though markedly corrected, were still significantly different from those in controls (P<0.05). Conclusion: The levels of serum IL-2, TNF-α and IFN-γ increased significantly in patients with psoriasis especially in those advanced cases. (authors)
Directory of Open Access Journals (Sweden)
Hanne Frøkiær
Full Text Available Many foods and food components boost the immune system, but little data are available regarding the mechanisms by which they do. Bacterial strains have disparate effects in stimulating the immune system. In dendritic cells, the gram-negative bacteria Escherichia coli upregulates proinflammatory cytokines, whereas gram-positive Lactobacillus acidophilus induces a robust interferon (IFN-β response. The immune-modulating effects of astragalus root and elderberry fruit extracts were examined in bone marrow-derived murine dendritic cells that were stimulated with L. acidophilus or E. coli. IFN-β and other cytokines were measured by ELISA and RT-PCR. Endocytosis of fluorescence-labeled dextran and L. acidophilus in the presence of elderberry fruit or astragalus root extract was evaluated in dendritic cells. Our results show that both extracts enhanced L. acidophilus-induced IFN-β production and slightly decreased the proinflammatory response to E. coli. The enhanced IFN-β production was associated with upregulation of toll-like receptor 3 and to a varying degree, the cytokines IL-12, IL-6, IL-1β and TNF-α. Both extracts increased endocytosis in immature dendritic cells, and only slightly influenced the viability of the cells. In conclusion, astragalus root and elderberry fruit extracts increase the IFN-β inducing activity of L. acidophilus in dendritic cells, suggesting that they may exert antiviral and immune-enhancing activity.
International Nuclear Information System (INIS)
Belardelli, F.; Arico, E.; Marincola, F.; Wang, E.
2009-01-01
The main general objective of this project was to define immunotherapy protocols based on the new concept of using IFN-a as and immune adjuvant, developing innovative methodologies suitable for predicting and monitoring the immunological and clinical responses. Specific aim of developing new micro arrays technologies particularly suitable for a molecular tracking and prediction of the response to IFN of cytokine-treated patients
HTLV-1 Tax protein recruitment into IKKε and TBK1 kinase complexes enhances IFN-I expression.
Diani, Erica; Avesani, Francesca; Bergamo, Elisa; Cremonese, Giorgia; Bertazzoni, Umberto; Romanelli, Maria Grazia
2015-02-01
The Tax protein expressed by human T-cell leukemia virus type 1 (HTLV-1) plays a pivotal role in the deregulation of cellular pathways involved in the immune response, inflammation, cell survival, and cancer. Many of these effects derive from Tax multiple interactions with host factors, including the subunits of the IKK-complex that are required for NF-κB activation. IKKɛ and TBK1 are two IKK-related kinases that allow the phosphorylation of interferon regulatory factors that trigger IFN type I gene expression. We observed that IKKɛ and TBK1 recruit Tax into cellular immunocomplexes. We also found that TRAF3, which regulates cell receptor signaling effectors, forms complexes with Tax. Transactivation analyses revealed that expression of Tax, in presence of IKKɛ and TBK1, enhances IFN-β promoter activity, whereas the activation of NF-κB promoter is not modified. We propose that Tax may be recruited into the TBK1/IKKɛ complexes as a scaffolding-adaptor protein that enhances IFN-I gene expression. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Zhou Hong; Hu Yan; Wei Guoyu; Liu Ya
2011-01-01
Objective: To explore the clinical evaluation of the changes of determination of serum IL-2, IL-4 and IFN-γ levels after treatment in pediatric patients with acute nephritis. Methods: Serum IL-2 (with RIA), IL-4, IFN-γ (with ELISA) levels were determined both before and after treatment in 32 pediatric patients with acute nephritis and 35 normal controls. Results: The serum IL-4, IFN-γ levels were significantly higher in the patients than those in controls before treatment (P 0.05). Serum IL-2 levels were negatively correlated with IL-4, IFN-γ levels (r=-0.5536, -0.6012, P<0.01). Conclusion: Interaction of the serum IL-2, IL-4 and IFN-γ also participated in the pathogenesis of acute nephritis in pediatric patients, monitoring the changes of their serum levels was helpful for the management of the diseases and provider important clinical value. (authors)
An, Jie; Woodward, Joshua J; Sasaki, Tomikazu; Minie, Mark; Elkon, Keith B
2015-05-01
Type I IFN is strongly implicated in the pathogenesis of systemic autoimmune diseases, such as lupus, and rare monogenic IFNopathies, including Aicardi-Goutières syndrome. Recently, a new DNA-activated pathway involving the enzyme cyclic GMP-AMP synthase (cGAS) was described and potentially linked to Aicardi-Goutières syndrome. To identify drugs that could potentially inhibit cGAS activity, we performed in silico screening of drug libraries. By computational analysis, we identified several antimalarial drugs (AMDs) that were predicted to interact with the cGAS/dsDNA complex. Our studies validated that several AMDs were effective inhibitors of IFN-β production and that they functioned by inhibiting dsDNA stimulation of cGAS. Because AMDs have been widely used in human diseases and have an excellent safety profile, our findings suggest new therapeutic strategies for the treatment of severe debilitating diseases associated with type I IFNs due to cGAS activation. Copyright © 2015 by The American Association of Immunologists, Inc.
Dynamic monitoring of serum IFN-γ, IL-2, and IL-6 contents in patients with Graves' disease
International Nuclear Information System (INIS)
Zou Jianwen; Li Weiguo
2006-01-01
Objective: To investigate the possible role of cytokines (IFN-γ, IL-2, IL-6) in the pathogenesis of Graves' disease. Methods: Serum FT 3 , FT 4 , TSH (with CLIA), IL-2, IL-6 (with RIA) and IFN-γ (with ELISA) contents were measured in the following subjects: (1) 42 patients with Graves' disease before any treatment, (2) 40 patients in remission after successful treatment with antithyroid drugs (ATD), (3) 25 patients in relapse (around 6 months after cessation of two years' ATD treatment, (4) 40 controls. Results: The serum IFN-γ and IL-6 contents in the patients before treatment and patients in relapse were significantly higher than those in the controls (P 3 , FT 4 levels while the serum IL-2 contents were linearly negatively correlated with FT 3 , FT 4 levels before treatment. Conclusion: Contents of these cytokines fluctuated dynamically along with the status of Graves' disease and might be related to the pathogenesis in some way. (authors)
Gargan, Siobhan; Ahmed, Suaad; Mahony, Rebecca; Bannan, Ciaran; Napoletano, Silvia; O'Farrelly, Cliona; Borrow, Persephone; Bergin, Colm; Stevenson, Nigel J
2018-04-01
Anti-retroviral therapy successfully suppresses HIV-1 infection, but fails to provide a cure. During infection Type 1 IFNs normally play an essential role in viral clearance, but in vivo IFN-α only has a modest impact on HIV-1 infection, suggesting its possible targeting by HIV. Here, we report that the HIV protein, Vif, inhibits effective IFN-α signalling via degradation of essential JAK/STAT pathway components. We found that STAT1 and STAT3 are specifically reduced in HEK293T cells expressing Vif and that full length, infectious HIV-1 IIIB strain promotes their degradation in a Vif-dependent manner. HIV-1 IIIB infection of myeloid ThP-1 cells also reduced the IFN-α-mediated induction of the anti-viral gene, ISG15, but not MxA, revealing a functional consequence of this HIV-1-mediated immune evasion strategy. Interestingly, while total STAT levels were not reduced upon in vitro IIIB infection of primary human PBMCs, IFN-α-mediated phosphorylation of STAT1 and STAT3 and ISG induction were starkly reduced, with removal of Vif (IIIBΔVif), partially restoring pSTATs, ISG15 and MxB induction. Similarly, pSTAT1 and pSTAT3 expression and IFN-α-induced ISG15 were reduced in PBMCs from HIV-infected patients, compared to healthy controls. Furthermore, IFN-α pre-treatment of a CEM T lymphoblast cells significantly inhibited HIV infection/replication (measured by cellular p24), only in the absence of Vif (IIIBΔVif), but was unable to suppress full length IIIB infection. When analysing the mechanism by which Vif might target the JAK/STAT pathway, we found Vif interacts with both STAT1 and STAT3, (but not STAT2), and its expression promotes ubiquitination and MG132-sensitive, proteosomal degradation of both proteins. Vif's Elongin-Cullin-SOCS-box binding motif enables the formation of an active E3 ligase complex, which we found to be required for Vif's degradation of STAT1 and STAT3. In fact, the E3 ligase scaffold proteins, Cul5 and Rbx2, were also found to be
Directory of Open Access Journals (Sweden)
Helen M Lazear
2013-01-01
Full Text Available Although the transcription factors IRF-3 and IRF-7 are considered master regulators of type I interferon (IFN induction and IFN stimulated gene (ISG expression, Irf3(-/-×Irf7(-/- double knockout (DKO myeloid dendritic cells (mDC produce relatively normal levels of IFN-β after viral infection. We generated Irf3(-/-×Irf5(-/-×Irf7(-/- triple knockout (TKO mice to test whether IRF-5 was the source of the residual induction of IFN-β and ISGs in mDCs. In pathogenesis studies with two unrelated positive-sense RNA viruses (West Nile virus (WNV and murine norovirus, TKO mice succumbed at rates greater than DKO mice and equal to or approaching those of mice lacking the type I IFN receptor (Ifnar(-/-. In ex vivo studies, after WNV infection or exposure to Toll-like receptor agonists, TKO mDCs failed to produce IFN-β or express ISGs. In contrast, this response was sustained in TKO macrophages following WNV infection. To define IRF-regulated gene signatures, we performed microarray analysis on WNV-infected mDC from wild type (WT, DKO, TKO, or Ifnar(-/- mice, as well as from mice lacking the RIG-I like receptor adaptor protein MAVS. Whereas the gene induction pattern in DKO mDC was similar to WT cells, remarkably, almost no ISG induction was detected in TKO or Mavs(-/- mDC. The relative equivalence of TKO and Mavs(-/- responses suggested that MAVS dominantly regulates ISG induction in mDC. Moreover, we showed that MAVS-dependent induction of ISGs can occur through an IRF-5-dependent yet IRF-3 and IRF-7-independent pathway. Our results establish IRF-3, -5, and -7 as the key transcription factors responsible for mediating the type I IFN and ISG response in mDC during WNV infection and suggest a novel signaling link between MAVS and IRF-5.
Directory of Open Access Journals (Sweden)
Zhongshuai Xin
Full Text Available Interferon-α (IFN-α is a natural choice for the treatment of hepatitis C, but half of the chronically infected individuals do not achieve sustained clearance of hepatitis C virus (HCV during treatment with IFN-α alone. The virus can impair IFN-α signaling and cellular factors that have an effect on the viral life cycles. We found that the protein PCBP2 is down-regulated in HCV-replicon containing cells (R1b. However, the effects and mechanisms of PCBP2 on HCV are unclear. To determine the effect of PCBP2 on HCV, overexpression and knockdown of PCBP2 were performed in R1b cells. Interestingly, we found that PCBP2 can facilitate the antiviral activity of IFN-α against HCV, although the RNA level of HCV was unaffected by either the overexpression or absence of PCBP2 in R1b cells. RIP-qRT-PCR and RNA half-life further revealed that PCBP2 stabilizes the mRNA of STAT1 and STAT2 through binding the 3'Untranslated Region (UTR of these two molecules, which are pivotal for the IFN-α anti-HCV effect. RNA pull-down assay confirmed that there were binding sites located in the C-rich tracts in the 3'UTR of their mRNAs. Stabilization of mRNA by PCBP2 leads to the increased protein expression of STAT1 and STAT2 and a consistent increase of phosphorylated STAT1 and STAT2. These effects, in turn, enhance the antiviral effect of IFN-α. These findings indicate that PCBP2 may play an important role in the IFN-α response against HCV and may benefit the HCV clinical therapy.
Directory of Open Access Journals (Sweden)
Tatsuo Miyamura
2014-01-01
Full Text Available Aim. Eradication of hepatitis C virus (HCV is still challenging even if interferon- (IFN- free regimens with direct-acting antiviral agents (DAAs for HCV-infected individuals are available in clinical practice. IFNL4 is a newly described protein, associated with human antiviral defenses. We investigated whether IFNL4 ss469415590 variant has an effect on the prediction of treatment response in HCV-infected patients treated with IFN-including regimens. Patients and Methods. In all, 185 patients infected with HCV genotype 1 treated with peg-IFN plus ribavirin, with or without telaprevir, were genotyped for IFNL4 ss469415590. We retrospectively investigated whether the role of IFNL4 ss469415590 variant and other factors could predict sustained virological response (SVR in Japanese patients infected with HCV genotype 1. Results. There were 65.7%, 31.5%, and 2.8% patients in the IFNL4 ss469415590 TT/TT, TT/-G, and -G/-G groups, respectively. SVR rates were 82.1% or 49.3% in patients treated with peg-IFN plus ribavirin with or without telaprevir, respectively. IFNL4 ss469415590 variant and HCV viral loads or IFNL4 ss469415590 variant and early virological response were better predictors of SVR in patients treated with peg-IFN plus ribavirin with or without telaprevir, respectively. Conclusion. In the era of DAAs, measurement of IFNL4 ss469415590 variant could help the prediction of SVR in Japanese HCV genotype 1 infected individuals treated with IFN-including regimens.
Knowledge Exchange and Management Research: Barriers and Potentials
DEFF Research Database (Denmark)
Bager, Torben
2018-01-01
Purpose: The growing involvement of management researchers in knowledge exchange activities and collaborative research does not seem to be reflected in a growing academic output. The purpose of this paper is to explore barriers for academic output from these activities as well as the potential...... for ‘interesting’ papers. Design/methodology/approach: The paper uses secondary data and statistics as well as an illustrative case study to trace knowledge exchange activities and barriers for academic output based on these activities. Findings: The paper identifies a number of barriers for the turning of data...... derived from knowledge exchange activities and Mode 2 research into academic papers such as low priority of case study research in leading management journals, a growing practice orientation in the research funding systems, methodological challenges due to limited researcher control, and disincentives...
Ab initio transport across bismuth selenide surface barriers
Narayan, Awadhesh
2014-11-24
© 2014 American Physical Society. We investigate the effect of potential barriers in the form of step edges on the scattering properties of Bi2Se3(111) topological surface states by means of large-scale ab initio transport simulations. Our results demonstrate the suppression of perfect backscattering, while all other scattering processes, which do not entail a complete spin and momentum reversal, are allowed. Furthermore, we find that the spin of the surface state develops an out-of-plane component as it traverses the barrier. Our calculations reveal the existence of quasibound states in the vicinity of the surface barriers, which appear in the form of an enhanced density of states in the energy window corresponding to the topological state. For double barriers we demonstrate the formation of quantum well states. To complement our first-principles results we construct a two-dimensional low-energy effective model and illustrate its shortcomings. Our findings are discussed in the context of a number of recent experimental works.
Ishii, H; Tanabe, S; Ueno, M; Kubo, T; Kayama, H; Serada, S; Fujimoto, M; Takeda, K; Naka, T; Yamashita, T
2013-01-01
Transfer of type-1 helper T-conditioned (Th1-conditioned) cells promotes functional recovery with enhanced axonal remodeling after spinal cord injury (SCI). This study explored the molecular mechanisms underlying the beneficial effects of pro-inflammatory Th1-conditioned cells after SCI. The effect of Th1-conditioned cells from interferon-γ (ifn-γ) knockout mice (ifn-γ−/− Th1 cells) on the recovery after SCI was reduced. Transfer of Th1-conditioned cells led to the activation of microglia (MG) and macrophages (MΦs), with interleukin 10 (IL-10) upregulation. This upregulation of IL-10 was reduced when ifn-γ−/− Th1 cells were transferred. Intrathecal neutralization of IL-10 in the spinal cord attenuated the effects of Th1-conditioned cells. Further, IL-10 is robustly secreted from Th1-conditioned cells in an ifn-γ-dependent manner. Th1-conditioned cells from interleukin 10 knockout (il-10−/−) mice had no effects on recovery from SCI. These findings demonstrate that ifn-γ-dependent secretion of IL-10 from Th1 cells, as well as native MG/MΦs, is required for the promotion of motor recovery after SCI. PMID:23828573
Directory of Open Access Journals (Sweden)
Patrícia Luciana Batista Domingos
2012-12-01
Full Text Available BACKGROUND: Leishmaniases are zoonoses considered a public health problem, representing a complex group of diseases with a broad clinical spectrum and epidemiological diversity. Leishmaniasis is caused by several species of protozoa of the genus Leishmania. The evolution of the pathology and the resolution of the leishmaniasis are dependent mainly on the Leishmania species involved, although the cytokine profile plays an important role in the development of the immune response. OBJECTIVES: The purpose of our study was to evaluate the immune response of patients affected by lesions of cutaneous leishmaniasis by immunostaining of the OX40, CD20, IFN-γ and IL-4 proteins. METHODS: The tissue samples were collected from indolent skin ulcers confirmed as cutaneous leishmaniasis of 41 patients aged between six and 90 years. The lesions were submitted to OX40, CD20, INF-γ and IL-4 immunolabeling. RESULTS: We observed a statistically significant higher expression of IFN-γ compared with IL-4 (p=0.009. Besides, OX40 had higher expression when compared with CD20 (pFUNDAMENTOS: As leishmanioses são zoonoses consideradas um problema de saúde pública, representando um grupo de doenças complexas, com uma diversidade de amplo espectro clínico e epidemiológico. A leishmaniose é uma doença causada por várias espécies de protozoários do gênero Leishmania spp. A evolução da patologia e a resolução da leishmaniose são dependentes principalmente da espécie de Leishmania envolvida; embora o perfil das citocinas tenha um importante papel no desenvolvimento da resposta imune. OBJETIVOS: Proporcionar mais conhecimentos sobre os eventos inflamatórios na leishmaniose tegumentar através da avaliação da imunoexpressão de OX40, CD20, IFN-γ e IL-4. MÉTODOS: Foram coletadas amostras de tecido de 41 pacientes, com idade variando entre 6 a 90 anos, com úlceras indolentes na pele confirmados através de exames de diagnóstico como leishmaniose
Interleukin-4 (IL-4) and Interferon-Gamma (IFN-gamma) in pregnant ...
African Journals Online (AJOL)
Background and Objective:- To assess if gestational factors affect the resistance of C57BL/6 mice to L. major infection, this study determined the levels of IL-4 and IFN-gamma in popliteal lymph node cells of pregnant C57BL/6 mice infected with L. major at 16 hours, 5 days-, 10 days- and 15 days- post plug by PCR, ELISA ...
The chicken TH1 response: potential therapeutic applications of ChIFN-γ.
Guo, Pengju; Thomas, Jesse D; Bruce, Matthew P; Hinton, Tracey M; Bean, Andrew G D; Lowenthal, John W
2013-11-01
The outcomes of viral infections are costly in terms of human and animal health and welfare worldwide. The observed increase in the virulence of some viruses and failure of many vaccines to stop these infections has lead to the apparent need to develop new anti-viral strategies. One approach to dealing with viral infection may be to employ the therapeutic administration of recombinant cytokines to act as 'immune boosters' to assist in augmenting the host response to virus. With this in mind, a greater understanding of the immune response, particularly cell mediated T-helper-1 (TH1) type responses, is imperative to the development of new anti-viral and vaccination strategies. Following the release of the chicken genome, a number of TH1-type cytokines have been identified, including chicken interleukin-12 (ChIL-12), ChIL-18 and interferon-γ ChIFN-γ), highlighting the nature of the TH1-type response in this non-mammalian vertebrate. To date a detailed analysis of the in vivo biological function of these cytokines has been somewhat hampered by access to large scale production techniques. This review describes the role of TH-1 cytokines in immune responses to viruses and explores their potential use in enhancing anti-viral treatment strategies in chickens. Furthermore, this review focuses on the example of ChIFN-γ treatment of Chicken Anemia Virus (CAV) infection. CAV causes amongst other things thymocyte depletion and thymus atrophy, as well as immunosuppression in chickens. However, due to vaccination, clinical disease appears less often, nevertheless, the subclinical form of the disease is often associated with secondary complicating infections due to an immunocompromised state. Since CAV-induced immunosuppression can cause a marked decrease in the immune response against other pathogens, understanding this aspect of the disease is critically important, as well as providing insights into developing new control approaches. With increasing emphasis on developing
Directory of Open Access Journals (Sweden)
Qiang Zou
2015-12-01
Full Text Available USP15 is a deubiquitinase that negatively regulates activation of naive CD4+ T cells and generation of IFN-γ-producing T helper 1 (Th1 cells. USP15 deficiency in mice promotes antitumor T cell responses in a transplantable cancer model; however, it has remained unclear how deregulated T cell activation impacts primary tumor development during the prolonged interplay between tumors and the immune system. Here, we find that the USP15-deficient mice are hypersensitive to methylcholantrene (MCA-induced fibrosarcomas. Excessive IFN-γ production in USP15-deficient mice promotes expression of the immunosuppressive molecule PD-L1 and the chemokine CXCL12, causing accumulation of T-bet+ regulatory T cells and CD11b+Gr-1+ myeloid-derived suppressor cells at tumor site. Mixed bone marrow adoptive transfer studies further reveals a T cell-intrinsic role for USP15 in regulating IFN-γ production and tumor development. These findings suggest that T cell intrinsic USP15 deficiency causes excessive production of IFN-γ, which promotes an immunosuppressive tumor microenvironment during MCA-induced primary tumorigenesis.
Directory of Open Access Journals (Sweden)
Ulrike Kaufmann
Full Text Available A major limitation of most animal models of autoimmune diseases is that they do not reproduce the chronic or relapsing-remitting pattern characteristic of many human autoimmune diseases. This problem has been overcome in our rat models of experimentally induced monophasic or relapsing-remitting autoimmune uveitis (EAU, which depend on the inducing antigen peptides from retinal S-Antigen (monophasic EAU or interphotoreceptor retinoid-binding protein (relapsing EAU. These models enable us to compare autoreactive and regulatory T cell populations. Intraocular, but not peripheral T cells differ in their cytokine profiles (IFN-γ, IL-17 and IL-10 at distinct time points during monophasic or relapsing EAU. Only intraocular T cells concomitantly produced IFN-γ, IL-17 and/or IL-10. Monophasic EAU presented rising numbers of cells expressing IFN-γ and IL-17 (Th1/Th17 and cells expressing IL-10 or Foxp3. During relapsing uveitis an increase of intraocular IFN-γ+ cells and a concomitant decrease of IL-17+ cells was detected, while IL-10+ populations remained stable. Foxp3+ cells and cells expressing IL-10, even in combination with IFN-γ or IL-17, increased during the resolution of monophasic EAU, suggesting a regulatory role for these T cells. In general, cells producing multiple cytokines increased in monophasic and decreased in relapsing EAU. The distinct appearance of certain intraocular populations with characteristics of regulatory cells points to a differential influence of the ocular environment on T cells that induce acute and monophasic or relapsing disease. Here we provide evidence that different autoantigens can elicit distinct and differently regulated immune responses. IFN-γ, but not IL-17 seems to be the key player in relapsing-remitting uveitis, as shown by increased, synchronized relapses after intraocular application of IFN-γ. We demonstrated dynamic changes of the cytokine pattern during monophasic and relapsing-remitting disease
International Nuclear Information System (INIS)
Haensgen, Gabriele; Koehler, Uwe; Dunst, Juergen
1997-01-01
Background: We have evaluated the impact of 13-cis-retinoic acid plus interferon in combination with radiotherapy on response and on tumor oxygenation in a phase II-study. Materials and methods: From June 1995 through April 1996, thirty-four patients with squamous cell carcinoma FIGO IIB (N=8) and IIIB (N=26) of the cervix who were scheduled for definitive radiotherapy with curative intent received additional treatment with 13-cis-retinoic acid (cRA, isotretinoin) plus interferon-α-2a (IFN-α-2a) as part of a phase-II-protocol at the Universities of Halle-Wittenberg (N=25), Leipzig (N=7) and Dresden (N=2). cRA/IFN-α-2a started 14 days prior to radiotherapy (1 mg per kilogramm body weight cRA orally daily plus 6x10 6 I.U. IFN-α-2a subcutaneously daily). After this induction period, standard radiotherapy was administered (external irradiation with 45Gy in 25 fractions of 1.8Gy plus HDR-brachytherapy with 5x7Gy). During radiotherapy, cRA/IFN-α-2a-treatment was continued with 50% of the daily doses. In 14 patients treated at the University of Halle-Wittenberg, tumor tissue pO 2 -measurements were performed prior to radiotherapy, at 20Gy, and at the end of radiotherapy with an Eppendorf-pO 2 -histograph. The oxygenation data of these patients were compared to 14 patients who had also pO 2 -measurements but had refused to participate in the cRA/IFN-α-2a-protocol and received radiotherapy alone during the same period. Results: All 8 patients with FIGO IIB tumors had a complete clinical remission 3 months after radiotherapy. In FIGO IIIB cancers, (19(26)) (73%) achieved a cCR, 5 (19%) had a PR and 2 died within six months after treatment due to intercurrent disease. The toxicity of cRA/IFN-α-2a was only mild to moderate (fever 43%, skin toxicity 36%, diarrhea 20%, elevation of liver enzymes 20%) with no grade (3(4)) toxicity. The 14 patients with cRA/IFN-α-2a-pretreatment prior to radiotherapy had significant higher median pO 2 -values in their tumors at the
Directory of Open Access Journals (Sweden)
Christelle Langevin
2017-05-01
Full Text Available Tripartite motif (TRIM proteins are involved in various cellular functions and constitute key factors of the antiviral innate immune response. TRIM proteins can bind viral particles directly, sending them to degradation by the proteasome, or ubiquitinate signaling molecules leading to upregulation of innate immunity. TRIM proteins are present in across metazoans but are particularly numerous in vertebrates where genes comprising a B30.2 domain have been often duplicated. In fish, a TRIM subset named finTRIM is highly diversified, with large gene numbers and clear signatures of positive selection in the B30.2 domain suggesting they may be involved in antiviral mechanisms. finTRIM provides a beautiful model to investigate the primordial implication of B30.2 TRIM subsets in the arsenal of vertebrate antiviral defenses. We show here that ftr83, a zebrafish fintrim gene mainly expressed in the gills, skin and pharynx, encodes a protein affording a potent antiviral activity. In vitro, overexpression of FTR83, but not of its close relative FTR82, induced IFN and IFN-stimulated gene expression and afforded protection against different enveloped and non-enveloped RNA viruses. The kinetics of IFN induction paralleled the development of the antiviral activity, which was abolished by a dominant negative IRF3 mutant. In the context of a viral infection, FTR83 potentiated the IFN response. Expression of chimeric proteins in which the B30.2 domain of FTR83 and the non-protective FTR82 had been exchanged, showed that IFN upregulation and antiviral activity requires both the Ring/BBox/Coiled coil domain (supporting E3 ubiquitin ligase and the B30.2 domain of FTR83. Finally, loss of function experiments in zebrafish embryos confirms that ftr83 mediates antiviral activity in vivo. Our results show that a member of the largest TRIM subset observed in fish upregulates type I IFN response and afford protection against viral infections, supporting that TRIMs are key
Hsieh, Chia-Yuan; Chen, Chia-Ling; Lin, Yee-Shin; Yeh, Trai-Ming; Tsai, Tsung-Ting; Hong, Ming-Yuan; Lin, Chiou-Feng
2014-10-01
IFN-γ mediates chemically induced skin inflammation; however, the mechanism by which IFN-γ-producing cells are recruited to the sites of inflammation remains undefined. Secretion of macrophage migration inhibitory factor (MIF), a proinflammatory cytokine, from damaged cells may promote immune cell recruitment. We hypothesized that MIF triggers an initial step in the chemotaxis of IFN-γ-producing cells in chemically induced skin inflammation. Using acute and chronic models of 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced skin inflammation in mouse ears, MIF expression was examined, and its role in this process was investigated pharmacologically. The cell populations targeted by MIF, their receptor expression patterns, and the effects of MIF on cell migration were examined. TPA directly caused cytotoxicity accompanied by MIF release in mouse ear epidermal keratinocytes, as well as in human keratinocytic HaCaT cells. Treatment with the MIF antagonist (S,R)-3-(4-hydroxyphenyl)-4,5-dihydro-5-isoxazole acetic acid methyl ester considerably attenuated TPA-induced ear swelling, leukocyte infiltration, epidermal cell proliferation, and dermal angiogenesis. Inhibition of MIF greatly diminished the dermal infiltration of IFN-γ(+) NKT cells, whereas the addition of exogenous TPA and MIF to NKT cells promoted their IFN-γ production and migration, respectively. MIF specifically triggered the chemotaxis of NKT cells via CD74 and CXCR2, and the resulting depletion of NKT cells abolished TPA-induced skin inflammation. In TPA-induced skin inflammation, MIF is released from damaged keratinocytes and then triggers the chemotaxis of CD74(+)CXCR2(+) NKT cells for IFN-γ production. Copyright © 2014 by The American Association of Immunologists, Inc.
Zielińska, Karolina A.; de Cauwer, Lode; Knoops, Sofie; Van der Molen, Kristof; Sneyers, Alexander; Thommis, Jonathan; De Souza, J. Brian; Opdenakker, Ghislain; De Bosscher, Karolien; Van den Steen, Philippe E.
2017-01-01
Malaria-associated acute respiratory distress syndrome (MA-ARDS) is an often lethal complication of malaria. Currently, no adequate therapy for this syndrome exists. Although glucocorticoids (GCs) have been used to improve clinical outcome of ARDS, their therapeutic benefits remain unclear. We previously developed a mouse model of MA-ARDS, in which dexamethasone treatment revealed GC resistance. In the present study, we investigated GC sensitivity of mouse microvascular lung endothelial cells stimulated with interferon-γ (IFN-γ) and Plasmodium berghei NK65 (PbNK65). Upon challenge with IFN-γ alone, dexamethasone inhibited the expression of CCL5 (RANTES) by 90% and both CCL2 (MCP-1) and CXCL10 (IP-10) by 50%. Accordingly, whole transcriptome analysis revealed that dexamethasone differentially affected several gene clusters and in particular inhibited a large cluster of IFN-γ-induced genes, including chemokines. In contrast, combined stimulation with IFN-γ and PbNK65 extract impaired inhibitory actions of GCs on chemokine release, without affecting the capacity of the GC receptor to accumulate in the nucleus. Subsequently, we investigated the effects of GCs on two signaling pathways activated by IFN-γ. Dexamethasone left phosphorylation and protein levels of signal transducer and activator of transcription 1 (STAT1) unhampered. In contrast, dexamethasone inhibited the IFN-γ-induced activation of two mitogen-activated protein kinases (MAPK), JNK, and p38. However, PbNK65 extract abolished the inhibitory effects of GCs on MAPK signaling, inducing GC resistance. These data provide novel insights into the mechanisms of GC actions in endothelial cells and show how malaria may impair the beneficial effects of GCs. PMID:29033931
Directory of Open Access Journals (Sweden)
Karolina A. Zielińska
2017-09-01
Full Text Available Malaria-associated acute respiratory distress syndrome (MA-ARDS is an often lethal complication of malaria. Currently, no adequate therapy for this syndrome exists. Although glucocorticoids (GCs have been used to improve clinical outcome of ARDS, their therapeutic benefits remain unclear. We previously developed a mouse model of MA-ARDS, in which dexamethasone treatment revealed GC resistance. In the present study, we investigated GC sensitivity of mouse microvascular lung endothelial cells stimulated with interferon-γ (IFN-γ and Plasmodium berghei NK65 (PbNK65. Upon challenge with IFN-γ alone, dexamethasone inhibited the expression of CCL5 (RANTES by 90% and both CCL2 (MCP-1 and CXCL10 (IP-10 by 50%. Accordingly, whole transcriptome analysis revealed that dexamethasone differentially affected several gene clusters and in particular inhibited a large cluster of IFN-γ-induced genes, including chemokines. In contrast, combined stimulation with IFN-γ and PbNK65 extract impaired inhibitory actions of GCs on chemokine release, without affecting the capacity of the GC receptor to accumulate in the nucleus. Subsequently, we investigated the effects of GCs on two signaling pathways activated by IFN-γ. Dexamethasone left phosphorylation and protein levels of signal transducer and activator of transcription 1 (STAT1 unhampered. In contrast, dexamethasone inhibited the IFN-γ-induced activation of two mitogen-activated protein kinases (MAPK, JNK, and p38. However, PbNK65 extract abolished the inhibitory effects of GCs on MAPK signaling, inducing GC resistance. These data provide novel insights into the mechanisms of GC actions in endothelial cells and show how malaria may impair the beneficial effects of GCs.
McNab, Finlay W; Ewbank, John; Rajsbaum, Ricardo; Stavropoulos, Evangelos; Martirosyan, Anna; Redford, Paul S; Wu, Xuemei; Graham, Christine M; Saraiva, Margarida; Tsichlis, Philip; Chaussabel, Damien; Ley, Steven C; O'Garra, Anne
2013-08-15
Tuberculosis, caused by Mycobacterium tuberculosis, remains a leading cause of mortality and morbidity worldwide, causing ≈ 1.4 million deaths per year. Key immune components for host protection during tuberculosis include the cytokines IL-12, IL-1, and TNF-α, as well as IFN-γ and CD4(+) Th1 cells. However, immune factors determining whether individuals control infection or progress to active tuberculosis are incompletely understood. Excess amounts of type I IFN have been linked to exacerbated disease during tuberculosis in mouse models and to active disease in patients, suggesting tight regulation of this family of cytokines is critical to host resistance. In addition, the immunosuppressive cytokine IL-10 is known to inhibit the immune response to M. tuberculosis in murine models through the negative regulation of key proinflammatory cytokines and the subsequent Th1 response. We show in this study, using a combination of transcriptomic analysis, genetics, and pharmacological inhibitors, that the TPL-2-ERK1/2 signaling pathway is important in mediating host resistance to tuberculosis through negative regulation of type I IFN production. The TPL-2-ERK1/2 signaling pathway regulated production by macrophages of several cytokines important in the immune response to M. tuberculosis as well as regulating induction of a large number of additional genes, many in a type I IFN-dependent manner. In the absence of TPL-2 in vivo, excess type I IFN promoted IL-10 production and exacerbated disease. These findings describe an important regulatory mechanism for controlling tuberculosis and reveal mechanisms by which type I IFN may promote susceptibility to this important disease.
DEFF Research Database (Denmark)
Nansen, A; Jensen, Teis; Christensen, Jan Pravsgaard
1999-01-01
To define the role of IFN-gamma in the control of acute infection with a noncytopathogenic virus, mice with targeted defects of the genes encoding IFN-gamma, perforin, or both were infected i.v. with two strains of lymphocytic choriomeningitis virus differing markedly in their capacity to spread...... in wild-type mice. Our results reveal that IFN-gamma is pivotal to T cell-mediated control of a rapidly invasive stain, whereas it is less important in the acute elimination of a slowly invasive strain. Moreover, the majority of mice infected with the rapidly invasive strain succumb to a wasting syndrome...... mediated by CD8+ effector cells. The primary effector mechanism underlying this disease is perforin-dependent lysis, but other mechanisms are also involved. Wasting disease can be prevented if naive CD8+ cells from mice transgenic for an MHC class I-restricted lymphocytic choriomeningitis virus...
Trends in Illustration: A digital approach to large format illustrations ...
African Journals Online (AJOL)
In view of this, this study uses Adobe Photoshop CS4, a digital draw and paint tool, to illustrate some of the notable folktales in Igbo oral tradition. Vector and Raster techniques of computer graphics will be employed and discussed. Basic information on digital illustration will also be enumerated in the project. This piece of ...
Directory of Open Access Journals (Sweden)
Yang Yu
Full Text Available BACKGROUND: IFN-γ is presently the only soluble immunological marker used to help diagnose latent Mycobacterium tuberculosis (M.tb infection. However, IFN-γ is not available to distinguish latent from active TB infection. Moreover, extrapulmonary tuberculosis, such as tuberculous pleurisy, cannot be properly diagnosed by IFN-γ release assay. As a result, other disease- or infection-related immunological biomarkers that would be more effective need to be screened and identified. METHODOLOGY: A panel of 41 soluble immunological molecules (17 cytokines and 24 chemokines was tested using Luminex liquid array-based multiplexed immunoassays. Samples, including plasma and pleural effusions, from healthy donors (HD, n = 12 or patients with latent tuberculosis infection (LTBI, n = 20, pulmonary tuberculosis (TB, n = 12, tuberculous pleurisy (TP, n = 15 or lung cancer (LC, n = 15 were collected and screened for soluble markers. Peripheral blood mononuclear cells (PBMCs and pleural fluid mononuclear cells (PFMCs were also isolated to investigate antigen-specific immune factors. PRINCIPAL FINDINGS: For the 41 examined factors, our results indicated that three patterns were closely associated with infection and disease. (1 Significantly elevated plasma levels of IL-2, IP-10, CXCL11 and CXCL12 were present in both patients with tuberculosis and in a sub-group participant with latent tuberculosis infection who showed a higher level of IFN-γ producing cells by ELISPOT assay compared with other latently infected individuals. (2 IL-6 and IL-9 were only significantly increased in plasma from active TB patients, and the two factors were consistently highly secreted after M.tb antigen stimulation. (3 When patients developed tuberculous pleurisy, CCL1, CCL21 and IL-6 were specifically increased in the pleural effusions. In particular, these three factors were consistently highly secreted by pleural fluid mononuclear cells following M
Directory of Open Access Journals (Sweden)
Ahmed A Mostafa
Full Text Available The coordinate regulation of HLA class II (HLA-II is controlled by the class II transactivator, CIITA, and is crucial for the development of anti-tumor immunity. HLA-II in breast carcinoma is associated with increased IFN-γ levels, reduced expression of the estrogen receptor (ER and reduced age at diagnosis. Here, we tested the hypothesis that estradiol (E₂ and ERα signaling contribute to the regulation of IFN-γ inducible HLA-II in breast cancer cells. Using a panel of established ER⁻ and ER⁺ breast cancer cell lines, we showed that E₂ attenuated HLA-DR in two ER⁺ lines (MCF-7 and BT-474, but not in T47D, while it augmented expression in ER⁻ lines, SK-BR-3 and MDA-MB-231. To further study the mechanism(s, we used paired transfectants: ERα⁺ MC2 (MDA-MB-231 c10A transfected with the wild type ERα gene and ERα⁻ VC5 (MDA-MB-231 c10A transfected with the empty vector, treated or not with E₂ and IFN-γ. HLA-II and CIITA were severely reduced in MC2 compared to VC5 and were further exacerbated by E₂ treatment. Reduced expression occurred at the level of the IFN-γ inducible CIITA promoter IV. The anti-estrogen ICI 182,780 and gene silencing with ESR1 siRNA reversed the E2 inhibitory effects, signifying an antagonistic role for activated ERα on CIITA pIV activity. Moreover, STAT1 signaling, necessary for CIITA pIV activation, and selected STAT1 regulated genes were variably downregulated by E₂ in transfected and endogenous ERα positive breast cancer cells, whereas STAT1 signaling was noticeably augmented in ERα⁻ breast cancer cells. Collectively, these results imply immune escape mechanisms in ERα⁺ breast cancer may be facilitated through an ERα suppressive mechanism on IFN-γ signaling.
Cucurbita ficifolia (Cucurbitaceae) modulates inflammatory cytokines and IFN-γ in obese mice.
Fortis-Barrera, Á; García-Macedo, R; Almanza-Perez, J C; Blancas-Flores, G; Zamilpa-Alvarez, A; Flores-Sáenz, J L; Cruz, M; Román-Ramos, R; Alarcón-Aguilar, F J
2017-02-01
This study investigated the effect of aqueous extract of Cucurbita ficifolia Bouché on systemic chronic inflammation in an obesity model induced by monosodium glutamate (MSG) via modulating the expression of adipokines (TNF-α, IL-6, resistin, and adiponectin) and immune-regulatory cytokines (IFN-γ and IL-10). Cucurbita ficifolia extract was administered daily by gavage to lean and MSG-obese mice for 30 days. At the end of treatment, cytokine mRNA expression in adipose tissue was determined by real-time polymerase chain reaction (PCR), and the protein levels of these cytokines were also quantified by enzyme-linked immunosorbent assay (ELISA). Cucurbita ficifolia extract decreased body mass and inflammation in MSG-obese mice by reducing the expression of TNF-α and IL-6; these decreases were parallel to significant reductions in protein levels. The extract also increased protein levels of IL-10 in lean mice and IFN-γ in both lean and MSG-obese mice. In conclusion, C. ficifolia extract modulates systemic chronic inflammation in MSG-obese mice and could have a beneficial effect on the adaptive immune system in obesity.
Analysis of IL-12 p40 subunit gene and IFN-γ G5644A polymorphisms in Idiopathic Pulmonary Fibrosis
Directory of Open Access Journals (Sweden)
Welsh Kenneth I
2003-06-01
Full Text Available Abstract Background Genes encoding cytokine mediators are prime candidates for genetic analysis in conditions with T-helper (Th cell disease driven imbalance. Idiopathic Pulmonary Fibrosis (IPF is a predominantly Th2 mediated disease associated with a paucity of interferon-gamma (IFN-γ. The paucity of IFN-γ may favor the development of progressive fibrosis in IPF. Interleukin-12 (IL-12 plays a key role in inducing IFN-γ production. The aim of the current study was to assess whether the 1188 (A/C 3'UTR single nucleotide polymorphism (SNP in the IL-12 p40 subunit gene which was recently found to be functional and the 5644 (G/A 3' UTR SNP of the IFN-γ gene were associated with susceptibility to IPF. Methods We investigated the allelic distribution in these loci in UK white Caucasoid subjects comprising 73 patients with IPF and 157 healthy controls. The SNPs were determined using the polymerase chain reaction in association with sequence-specific primers incorporating mismatches at the 3'-end. Results Our results showed that these polymorphisms were distributed similarly in the IPF and control groups Conclusion We conclude that these two potentially important candidate gene single nucleotide polymorphisms are not associated with susceptibility to IPF.
Directory of Open Access Journals (Sweden)
Geunwoong Noh
2013-01-01
Full Text Available Anaphylaxis induced by exercise after the intake of certain foods is referred to as food-dependent exercise-induced anaphylaxis (FDEIA. Only the preventive medication such as oral sodium cromoglycate and oral combined cetirizine-montelukast was tried in FDEIA. Specific oral tolerance induction (SOTI using IFN-gamma was tried in 2 cases of FDEIA for wheat. Merely, exercise accompanied every treatment just after the intake of allergenic foods during treatment. Patients acquired tolerance for wheat in both cases successfully. After treatment, two patients take wheat in their food living freely. Conclusively, SOTI using IFN-gamma was effective as the causative treatment for allergenic foods in FDEIA.
To change or not to change? That's the question... On MOOC-success, Barriers and Their Implications
Henderikx, Maartje; Kreijns, Karel; Kalz, Marco
2017-01-01
This explorative study aimed to get an understanding of MOOC-success as seen from the perspective of the MOOC-taker and the types of barriers which might stand in the way of this success. Data of two MOOCs was used to illustrate MOOC-success from two perspectives and barriers encountered. Following
Karaulov, A V; Shulzhenko, A E; Karsonova, A V
2017-07-01
We studied the expression of IFN-inducible genes OAS1 and Mx1 in lysates of peripheral blood mononuclear cells from patients suffering from recurrent Herpes simplex infections in comparison with healthy people. To induce the expression of the studied genes, blood mononuclears were incubated with recombinant IFN-α2b in concentrations of 1, 10, and 100 U/ml for 3 h and then the content of the studied transcripts was evaluated. Relative expression of OAS1 and Mx1 in patients with recurrent forms of Herpes simplex both during the acute stage and clinical remission did not differ significantly from that in healthy people after stimulation with IFN-α2b in a concentration of 1 U/ml and in higher concentrations (10 and 100 U/ml). It was concluded that intracellular signal transduction in IFN-α-activated cells in vitro was not disturbed in patients with recurrent forms of Herpes simplex infection. Thus, the reported phenomenon of IFN-signalling distortion by Herpes simplex virus proteins observed in experiments on model cell lines infected with Herpes simplex virus was not confirmed in our experiments on peripheral blood mononuclear cells from patients with Herpes simplex infection.
DEFF Research Database (Denmark)
Millward, Jason M; Pedersen, Morten Løbner; Wheeler, Rachel D
2010-01-01
Inflammatory responses are essential for immune protection but may also cause pathology and must be regulated. Both Th1 and Th17 cells are implicated in the pathogenesis of autoimmune inflammatory diseases, such as multiple sclerosis. We show in this study that IL-18-binding protein (IL-18bp......), the endogenous inhibitor of the Th1-promoting cytokine IL-18, is upregulated by IFN-gamma in resident microglial cells in the CNS during multiple sclerosis-like disease in mice. Test of function by overexpression of IL-18bp in the CNS using a viral vector led to marked reduction in Th17 responses and robust...... inhibition of incidence, severity, and histopathology of disease, independently of IFN-gamma. The disease-limiting action of IL-18bp included suppression of APC-derived Th17-polarizing cytokines. IL-18bp thus acts as a sensor for IFN-gamma and can regulate both Th1 and Th17 responses in the CNS....
Nomura, Masaru; Hodgkinson, Suzanne J; Tran, Giang T; Verma, Nirupama D; Robinson, Catherine; Plain, Karren M; Boyd, Rochelle; Hall, Bruce M
2017-06-01
CD4 + T cells that transfer alloantigen-specific transplant tolerance are short lived in culture unless stimulated with specific-donor alloantigen and lymphocyte derived cytokines. Here, we examined if IFN-γ maintained survival of tolerance transferring CD4 + T cells. Alloantigen-specific transplant tolerance was induced in DA rats with heterotopic adult PVG heart allografts by a short course of immunosuppression and these grafts functioned for >100days with no further immunosuppression. In previous studies, we found the CD4 + T cells from tolerant rats that transfer tolerance to an irradiated DA host grafted with a PVG heart, lose their tolerance transferring ability after 3days of culture, either with or without donor alloantigen, and effect rejection of specific-donor grafts. If cultures with specific-donor alloantigen are supplemented by supernatant from ConA activated lymphocytes the tolerance transferring cells survive, suggesting these cells depend on cytokines for their survival. In this study, we found addition of rIFN-γ to MLC with specific-donor alloantigen maintained the capacity of tolerant CD4 + T cells to transfer alloantigen-specific tolerance and their ability to suppress PVG allograft rejection mediated by co-administered naïve CD4 + T cells. IFN-γ suppressed the in vitro proliferation of tolerant CD4 + T cells. Tolerant CD4 + CD25 + T cells did not proliferate in MLC to PVG stimulator cells with no cytokine added, but did when IFN-γ was present. IFN-γ did not alter proliferation of tolerant CD4 + CD25 + T cells to third-party Lewis. Tolerant CD4 + CD25 + T cells' expression of IFN-γ receptor (IFNGR) was maintained in culture when IFN-γ was present. This study suggested that IFN-γ maintained tolerance mediating alloantigen-specific CD4 + CD25 + T cells. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ana V. Ibarra-Meneses
2017-05-01
Full Text Available New biomarkers are needed for monitoring the effectiveness of treatment for visceral leishmaniasis (VL. They might also improve the detection of the asymptomatic population in Leishmania-endemic areas. This paper examines the IL-2, IFN-γ, IFN-γ-induced protein 10 (IP-10, and monokine-induced-by-IFN-γ (MIG levels in whole blood—stimulated in vitro with soluble Leishmania antigen (SLA—taken from asymptomatic individuals and patients treated for VL living in a post-outbreak (Leishmania infantum area in Spain, and in an endemic (Leishmania donovani area of Bangladesh. IP-10 was found to be an accurate global marker of asymptomatic subjects with positive cellular/humoral tests, while MIG was found to be a better marker of contact with L. donovani than IL-2 but no for those with L. infantum. Determining IP-10, MIG, and IFN-γ levels proved useful in monitoring the cellular immune response following treatment for active disease caused by L. infantum.
Chen, Yueping; Zhang, Hao; Cheng, Yefei; Li, Yue; Wen, Chao; Zhou, Yanmin
2018-06-01
This study was conducted to investigate the protective effects of l-threonine (l-Thr) supplementation on growth performance, inflammatory responses and intestinal barrier function of young broilers challenged with lipopolysaccharide (LPS). A total of 144 1-d-old male chicks were allocated to one of three treatments: non-challenged broilers fed a basal diet (control group), LPS-challenged broilers fed a basal diet without l-Thr supplementation and LPS-challenged broilers fed a basal diet supplemented with 3·0 g/kg l-Thr. LPS challenge was performed intraperitoneally at 17, 19 and 21 d of age, whereas the control group received physiological saline injection. Compared with the control group, LPS challenge impaired growth performance of broilers, and l-Thr administration reversed LPS-induced increase in feed/gain ratio. LPS challenge elevated blood cell counts related to inflammation, and pro-inflammatory cytokine concentrations in serum (IL-1β and TNF-α), spleen (IL-1β and TNF-α) and intestinal mucosa (jejunal interferon-γ (IFN-γ) and ileal IL-1β). The concentrations of intestinal cytokines in LPS-challenged broilers were reduced by l-Thr supplementation. LPS administration increased circulating d-lactic acid concentration, whereas it reduced villus height, the ratio between villus height and crypt depth and goblet density in both jejunum and ileum. LPS-induced decreases in jejunal villus height, intestinal villus height:crypt depth ratio and ileal goblet cell density were reversed with l-Thr supplementation. Similarly, LPS-induced alterations in the intestinal mRNA abundances of genes related to intestinal inflammation and barrier function (jejunal toll-like receptor 4, IFN- γ and claudin-3, and ileal IL-1 β and zonula occludens-1) were normalised with l-Thr administration. It can be concluded that l-Thr supplementation could attenuate LPS-induced inflammatory responses and intestinal barrier damage of young broilers.
Day, Yuan-Ji; Huang, Liping; Ye, Hong; Li, Li; Linden, Joel; Okusa, Mark D
2006-03-01
A(2A) adenosine receptor (A(2A)R)-expressing bone marrow (BM)-derived cells contribute to the renal protective effect of A(2A) agonists in renal ischemia-reperfusion injury (IRI). We performed IRI in mice lacking T and B cells to determine whether A(2A)R expressed in CD4+ cells mediate protection from IRI. Rag-1 knockout (KO) mice were protected in comparison to wild-type (WT) mice when subjected to IRI. ATL146e, a selective A(2A) agonist, did not confer additional protection. IFN-gamma is an important early signal in IRI and is thought to contribute to reperfusion injury. Because IFN-gamma is produced by kidney cells and T cells we performed IRI in BM chimeras in which the BM of WT mice was reconstituted with BM from IFN-gamma KO mice (IFN-gamma KO-->WT chimera). We observed marked reduction in IRI in comparison to WT-->WT chimeras providing additional indirect support for the role of T cells. To confirm the role of CD4+ A(2A)R in mediating protection from IRI, Rag-1 KO mice were subjected to ischemia-reperfusion. The protection observed in Rag-1 KO mice was reversed in Rag-1 KO mice that were adoptively transferred WT CD4+ cells (WT CD4+-->Rag-1 KO) or A(2A) KO CD4+ cells (A(2A) KO CD4+-->Rag-1 KO). ATL146e reduced injury in WT CD4+-->Rag-1 KO mice but not in A(2A) KO CD4+-->Rag-1 KO mice. Rag-1 KO mice reconstituted with CD4+ cells derived from IFN-gamma KO mice (IFN-gamma CD4+-->Rag-1 KO) were protected from IRI; ATL146e conferred no additional protection. These studies demonstrate that CD4+ IFN-gamma contributes to IRI and that A(2A) agonists mediate protection from IRI through action on CD4+ cells.
Ikeda, Keigo; Hayakawa, Kunihiro; Fujishiro, Maki; Kawasaki, Mikiko; Hirai, Takuya; Tsushima, Hiroshi; Miyashita, Tomoko; Suzuki, Satoshi; Morimoto, Shinji; Tamura, Naoto; Takamori, Kenji; Ogawa, Hideoki; Sekigawa, Iwao
2017-08-22
We previously reported that JAK-STAT-pathway mediated regulation of IFN-regulatory factor genes could play an important role in SLE pathogenesis. Here, we evaluated the efficacy of the JAK inhibitor tofacitinib (TOFA) for controlling IFN signalling via the JAK-STAT pathway and as a therapeutic for SLE. We treated NZB/NZW F1 mice with TOFA and assessed alterations in their disease, pathological, and immunological conditions. Gene-expression results obtained from CD4 + T cells (SLE mice) and CD3 + T cells (human SLE patients) were measured by DNA microarray and qRT-PCR. TOFA treatment resulted in reduced levels of anti-dsDNA antibodies, decreased proteinuria, and amelioration of nephritis as compared with those observed in control animals. Moreover, we observed the rebalance in the populations of naïve CD4 + T cells and effector/memory cells in TOFA-treated mice; however, treatment with a combination of TOFA and dexamethasone (DEXA) elicited a stronger inhibitory effect toward the effector/memory cells than did TOFA or DEXA monotherapy. We also detected decreased expression of several IFN-signature genes Ifit3 and Isg15 in CD4 + from SLE-prone mice following TOFA and DEXA treatment, and IFIT3 in CD3 + T cells from human patients following immunosuppressant therapy including steroid, respectively. Modulation of type I IFN signalling via JAK-STAT inhibition may exert a beneficial effect in SLE patients, and our results suggest that TOFA could be utilised for the development of new SLE-specific therapeutic strategies.
Luyer, Misha D.; Buurman, Wim A.; Hadfoune, M.'hamed; Wolfs, T.; van't Veer, Cornelis; Jacobs, Jan A.; Dejong, Cornelis H.; Greve, Jan Willem M.
2007-01-01
OBJECTIVE: To investigate the role of bacterial DNA in development of an excessive inflammatory response and loss of gut barrier loss following systemic hypotension. SUMMARY BACKGROUND DATA: Bacterial infection may contribute to development of inflammatory complications following major surgery;
National Research Council Canada - National Science Library
Gupta, Vandana
2006-01-01
MIS is a member of the TGF family. The purpose of this study is to test the hypothesis that MIS and IFN-gamma might be more effective in the inhibition of breast cancer cell growth than either agent alone...
Energy Technology Data Exchange (ETDEWEB)
Kang, Heung Sik; Lee, Joon Woo [Seoul National Univ. Bundang Hospital, Seongnam, Kyonggi-do (Korea, Republic of). Dept. of Radiology; Kwon, Jong Won [Samsung Medical Center, Seoul (Korea, Republic of). Dept. of Radiology
2014-04-01
Offers a practical approach to image interpretation for spinal disorders. Includes numerous high-quality radiographic images and schematic illustrations. Will serve as a self-learning book covering daily routine cases from the basic to the advanced. Radiology Illustrated: Spine is an up-to-date, superbly illustrated reference in the style of a teaching file that has been designed specifically to be of value in clinical practice. Common, critical, and rare but distinctive spinal disorders are described succinctly with the aid of images highlighting important features and informative schematic illustrations. The first part of the book, on common spinal disorders, is for radiology residents and other clinicians who are embarking on the interpretation of spinal images. A range of key disorders are then presented, including infectious spondylitis, cervical trauma, spinal cord disorders, spinal tumors, congenital disorders, uncommon degenerative disorders, inflammatory arthritides, and vascular malformations. The third part is devoted to rare but clinically significant spinal disorders with characteristic imaging features, and the book closes by presenting practical tips that will assist in the interpretation of confusing cases.
Directory of Open Access Journals (Sweden)
Taha Salim
Full Text Available Macrophage produced inducible nitric oxide synthase (iNOS is known to play a critical role in the proinflammatory response against intracellular pathogens by promoting the generation of bactericidal reactive nitrogen species. Robust and timely production of nitric oxide (NO by iNOS and analogous production of reactive oxygen species are critical components of an effective immune response. In addition to pathogen associated lipopolysaccharides (LPS, iNOS gene expression is dependent on numerous proinflammatory cytokines in the cellular microenvironment of the macrophage, two of which include interferon gamma (IFN-γ and tumor necrosis factor alpha (TNF-α. To understand the synergistic effect of IFN-γ and TNF-α activation, and LPS stimulation on iNOS expression dynamics and NO production, we developed a systems biology based mathematical model. Using our model, we investigated the impact of pre-infection cytokine exposure, or priming, on the system. We explored the essentiality of IFN-γ priming to the robustness of initial proinflammatory response with respect to the ability of macrophages to produce reactive species needed for pathogen clearance. Results from our theoretical studies indicated that IFN-γ and subsequent activation of IRF1 are essential in consequential production of iNOS upon LPS stimulation. We showed that IFN-γ priming at low concentrations greatly increases the effector response of macrophages against intracellular pathogens. Ultimately the model demonstrated that although TNF-α contributed towards a more rapid response time, measured as time to reach maximum iNOS production, IFN-γ stimulation was significantly more significant in terms of the maximum expression of iNOS and the concentration of NO produced.
Salim, Taha; Sershen, Cheryl L; May, Elebeoba E
2016-01-01
Macrophage produced inducible nitric oxide synthase (iNOS) is known to play a critical role in the proinflammatory response against intracellular pathogens by promoting the generation of bactericidal reactive nitrogen species. Robust and timely production of nitric oxide (NO) by iNOS and analogous production of reactive oxygen species are critical components of an effective immune response. In addition to pathogen associated lipopolysaccharides (LPS), iNOS gene expression is dependent on numerous proinflammatory cytokines in the cellular microenvironment of the macrophage, two of which include interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α). To understand the synergistic effect of IFN-γ and TNF-α activation, and LPS stimulation on iNOS expression dynamics and NO production, we developed a systems biology based mathematical model. Using our model, we investigated the impact of pre-infection cytokine exposure, or priming, on the system. We explored the essentiality of IFN-γ priming to the robustness of initial proinflammatory response with respect to the ability of macrophages to produce reactive species needed for pathogen clearance. Results from our theoretical studies indicated that IFN-γ and subsequent activation of IRF1 are essential in consequential production of iNOS upon LPS stimulation. We showed that IFN-γ priming at low concentrations greatly increases the effector response of macrophages against intracellular pathogens. Ultimately the model demonstrated that although TNF-α contributed towards a more rapid response time, measured as time to reach maximum iNOS production, IFN-γ stimulation was significantly more significant in terms of the maximum expression of iNOS and the concentration of NO produced.
Directory of Open Access Journals (Sweden)
Carla Palma
Full Text Available BACKGROUND: Antigen-specific IFN-gamma producing CD4(+ T cells are the main mediators of protection against Mycobacterium tuberculosis infection both under natural conditions and following vaccination. However these cells are responsible for lung damage and poor vaccine efficacy when not tightly controlled. Discovering new tools to control nonprotective antigen-specific IFN-gamma production without affecting protective IFN-gamma is a challenge in tuberculosis research. METHODS AND FINDINGS: Immunization with DNA encoding Ag85B, a candidate vaccine antigen of Mycobacterium tuberculosis, elicited in mice a low but protective CD4(+ T cell-mediated IFN-gamma response, while in mice primed with DNA and boosted with Ag85B protein a massive increase in IFN-gamma response was associated with loss of protection. Both protective and non-protective Ag85B-immunization generated antigen-specific CD8(+ T cells which suppressed IFN-gamma-secreting CD4(+ T cells. However, ex vivo ligation of 4-1BB, a member of TNF-receptor super-family, reduced the massive, non-protective IFN-gamma responses by CD4(+ T cells in protein-boosted mice without affecting the low protective IFN-gamma-secretion in mice immunized with DNA. This selective inhibition was due to the induction of 4-1BB exclusively on CD8(+ T cells of DNA-primed and protein-boosted mice following Ag85B protein stimulation. The 4-1BB-mediated IFN-gamma inhibition did not require soluble IL-10, TGF-beta, XCL-1 and MIP-1beta. In vivo Ag85B stimulation induced 4-1BB expression on CD8(+ T cells and in vivo 4-1BB ligation reduced the activation, IFN-gamma production and expansion of Ag85B-specific CD4(+ T cells of DNA-primed and protein-boosted mice. CONCLUSION/SIGNIFICANCE: Antigen-specific suppressor CD8(+ T cells are elicited through immunization with the mycobacterial antigen Ag85B. Ligation of 4-1BB receptor further enhanced their suppressive activity on IFN-gamma-secreting CD4(+ T cells. The selective
[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].
Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan
2018-02-01
Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.
Directory of Open Access Journals (Sweden)
Eva-K Pauli
2008-11-01
Full Text Available The type I interferon (IFN system is a first line of defense against viral infections. Viruses have developed various mechanisms to counteract this response. So far, the interferon antagonistic activity of influenza A viruses was mainly observed on the level of IFNbeta gene induction via action of the viral non-structural protein 1 (NS1. Here we present data indicating that influenza A viruses not only suppress IFNbeta gene induction but also inhibit type I IFN signaling through a mechanism involving induction of the suppressor of cytokine signaling-3 (SOCS-3 protein. Our study was based on the observation that in cells that were infected with influenza A virus and subsequently stimulated with IFNalpha/beta, phosphorylation of the signal transducer and activator of transcription protein 1 (STAT1 was strongly reduced. This impaired STAT1 activation was not due to the action of viral proteins but rather appeared to be induced by accumulation of viral 5' triphosphate RNA in the cell. SOCS proteins are potent endogenous inhibitors of Janus kinase (JAK/STAT signaling. Closer examination revealed that SOCS-3 but not SOCS-1 mRNA levels increase in an RNA- and nuclear factor kappa B (NF-kappaB-dependent but type I IFN-independent manner early in the viral replication cycle. This direct viral induction of SOCS-3 mRNA and protein expression appears to be relevant for suppression of the antiviral response since in SOCS-3 deficient cells a sustained phosphorylation of STAT1 correlated with elevated expression of type I IFN-dependent genes. As a consequence, progeny virus titers were reduced in SOCS-3 deficient cells or in cells were SOCS-3 expression was knocked-down by siRNA. These data provide the first evidence that influenza A viruses suppress type I IFN signaling on the level of JAK/STAT activation. The inhibitory effect is at least in part due to the induction of SOCS-3 gene expression, which results in an impaired antiviral response.
Watanabe, Tomohiro; Asano, Naoki; Fichtner-Feigl, Stefan; Gorelick, Peter L.; Tsuji, Yoshihisa; Matsumoto, Yuko; Chiba, Tsutomu; Fuss, Ivan J.; Kitani, Atsushi; Strober, Warren
2010-01-01
Nucleotide-binding oligomerization domain 1 (NOD1) is an intracellular epithelial cell protein known to play a role in host defense at mucosal surfaces. Here we show that a ligand specific for NOD1, a peptide derived from peptidoglycan, initiates an unexpected signaling pathway in human epithelial cell lines that results in the production of type I IFN. Detailed analysis revealed the components of the signaling pathway. NOD1 binding to its ligand triggered activation of the serine-threonine kinase RICK, which was then able to bind TNF receptor–associated factor 3 (TRAF3). This in turn led to activation of TANK-binding kinase 1 (TBK1) and IκB kinase ε (IKKε) and the subsequent activation of IFN regulatory factor 7 (IRF7). IRF7 induced IFN-β production, which led to activation of a heterotrimeric transcription factor complex known as IFN-stimulated gene factor 3 (ISGF3) and the subsequent production of CXCL10 and additional type I IFN. In vivo studies showed that mice lacking the receptor for IFN-β or subjected to gene silencing of the ISGF3 component Stat1 exhibited decreased CXCL10 responses and increased susceptibility to Helicobacter pylori infection, phenotypes observed in NOD1-deficient mice. These studies thus establish that NOD1 can activate the ISGF3 signaling pathway that is usually associated with protection against viral infection to provide mice with robust type I IFN–mediated protection from H. pylori and possibly other mucosal infections. PMID:20389019
International Nuclear Information System (INIS)
Feng Yue
2008-01-01
Objective: To explore the changes of serum TNF-α, IFN-γ and T-cell subsets distribution pattern in pediatric patients with aplastic anemia. Methods: Serum TNF-α levels (with RIA), IFN-γ levels (with ELISA), peripheral blood T-cell subsets distribution pattern (with monoclonal antibody technique) were determined in 33 pediatric patients with aplastic anemia, as well as in 35 controls. Results: The serum levels of TNF-α and IFN-γ in the patients with aplastic anemia were significantly higher than those in the controls (P<0.01), while the CD3, CD4 percentages and CD4/CD8 ratio were significantly lower (P<0.01). Conclusion: Detection of changes of serum TNF-α, IFN-γ levels and T-cell subsets ratio was clinically useful for outcome prediction in pediatric patients with aplastic anemia. (authors)
Directory of Open Access Journals (Sweden)
Shahid Husain
Full Text Available We have recently demonstrated the characterization of human tyrosinase TCR bearing h3T-A2 transgenic mouse model, which exhibits spontaneous autoimmune vitiligo and retinal dysfunction. The purpose of current study was to determine the role of T cells and IFN-γ in retina dysfunction and retinal ganglion cell (RGC death using this model. RGC function was measured by pattern electroretinograms (ERGs in response to contrast reversal of patterned visual stimuli. RGCs were visualized by fluorogold retrograde-labeling. Expression of CD3, IFN-γ, GFAP, and caspases was measured by immunohistochemistry and Western blotting. All functional and structural changes were measured in 12-month-old h3T-A2 mice and compared with age-matched HLA-A2 wild-type mice. Both pattern-ERGs (42%, p = 0.03 and RGC numbers (37%, p = 0.0001 were reduced in h3T-A2 mice when compared with wild-type mice. The level of CD3 expression was increased in h3T-A2 mice (h3T-A2: 174 ± 27% vs. HLA-A2: 100%; p = 0.04. The levels of effector cytokine IFN-γ were also increased significantly in h3T-A2 mice (h3T-A2: 189 ± 11% vs. HLA-A2: 100%; p = 0.023. Both CD3 and IFN-γ immunostaining were increased in nerve fiber (NF and RGC layers of h3T-A2 mice. In addition, we have seen a robust increase in GFAP staining in h3T-A2 mice (mainly localized to NF layer, which was substantially reduced in IFN-γ ((-/- knockout h3T-A2 mice. We also have seen an up-regulation of caspase-3 and -9 in h3T-A2 mice. Based on our data we conclude that h3T-A2 transgenic mice exhibit visual defects that are mostly associated with the inner retinal layers and RGC function. This novel h3T-A2 transgenic mouse model provides opportunity to understand RGC pathology and test neuroprotective strategies to rescue RGCs.
An illustration of whole systems thinking.
Kalim, Kanwal; Carson, Ewart; Cramp, Derek
2006-08-01
The complexity of policy-making in the NHS is such that systemic, holistic thinking is needed if the current government's plans are to be realized. This paper describes systems thinking and illustrates its value in understanding the complexity of the diabetes National Service Framework (NSF); its role in identifying problems and barriers previously not predicted; and in reaching conclusions as to how it should be implemented. The approach adopted makes use of soft systems methodology (SSM) devised by Peter Checkland. This analysis reveals issues relating to human communication, information provision and resource allocation needing to be addressed. From this, desirable and feasible changes are explored as means of achieving a more effective NSF, examining possible changes from technical, organizational, economic and cultural perspectives. As well as testing current health policies and plans, SSM can be used to test the feasibility of new health policies. This is achieved by providing a greater understanding and appreciation of what is happening in the real world and how people work. Soft systems thinking is the best approach, given the complexity of health care. It is a flexible, cost-effective solution, which should be a prerequisite before any new health policy is launched.
Lack of Neuronal IFN-β-IFNAR Causes Lewy Body- and Parkinson's Disease-like Dementia
DEFF Research Database (Denmark)
Ejlerskov, Patrick; Hultberg, Jeanette Göransdotter; Wang, JunYang
2015-01-01
-causing mutant proteins. Mice lacking Ifnb function exhibited motor and cognitive learning impairments with accompanying α-synuclein-containing Lewy bodies in the brain, as well as a reduction in dopaminergic neurons and defective dopamine signaling in the nigrostriatal region. Lack of IFN-β signaling caused...
Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua
2018-01-01
Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance
Distinct Effects of Type I and III Interferons on Enteric Viruses
Directory of Open Access Journals (Sweden)
Harshad Ingle
2018-01-01
Full Text Available Interferons (IFNs are key host cytokines in the innate immune response to viral infection, and recent work has identified unique roles for IFN subtypes in regulating different aspects of infection. Currently emerging is a common theme that type III IFNs are critical in localized control of infection at mucosal barrier sites, while type I IFNs are important for broad systemic control of infections. The intestine is a particular site of interest for exploring these effects, as in addition to being the port of entry for a multitude of pathogens, it is a complex tissue with a variety of cell types as well as the presence of the intestinal microbiota. Here we focus on the roles of type I and III IFNs in control of enteric viruses, discussing what is known about signaling downstream from these cytokines, including induction of specific IFN-stimulated genes. We review viral strategies to evade IFN responses, effects of IFNs on the intestine, interactions between IFNs and the microbiota, and briefly discuss the role of IFNs in controlling viral infections at other barrier sites. Enhanced understanding of the coordinate roles of IFNs in control of viral infections may facilitate development of antiviral therapeutic strategies; here we highlight potential avenues for future exploration.
Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2015-09-01
Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier
Injury-Induced Type I IFN Signaling Regulates Inflammatory Responses in the Central Nervous System
DEFF Research Database (Denmark)
Khorooshi, Reza; Owens, Trevor
2010-01-01
Innate glial response is critical for the induction of inflammatory mediators and recruitment of leukocytes to sites of the injury in the CNS. We have examined the involvement of type I IFN signaling in the mouse hippocampus following sterile injury (transection of entorhinal afferents). Type I I...
Directory of Open Access Journals (Sweden)
Pierre Wallet
2017-10-01
Full Text Available Guanylate binding proteins (GBPs are interferon-inducible proteins involved in the cell-intrinsic immunity against numerous intracellular pathogens. The molecular mechanisms underlying the potent antibacterial activity of GBPs are still unclear. GBPs have been functionally linked to the NLRP3, the AIM2 and the caspase-11 inflammasomes. Two opposing models are currently proposed to explain the GBPs-inflammasome link: i GBPs would target intracellular bacteria or bacteria-containing vacuoles to increase cytosolic PAMPs release ii GBPs would directly facilitate inflammasome complex assembly. Using Francisella novicida infection, we investigated the functional interactions between GBPs and the inflammasome. GBPs, induced in a type I IFN-dependent manner, are required for the F. novicida-mediated AIM2-inflammasome pathway. Here, we demonstrate that GBPs action is not restricted to the AIM2 inflammasome, but controls in a hierarchical manner the activation of different inflammasomes complexes and apoptotic caspases. IFN-γ induces a quantitative switch in GBPs levels and redirects pyroptotic and apoptotic pathways under the control of GBPs. Furthermore, upon IFN-γ priming, F. novicida-infected macrophages restrict cytosolic bacterial replication in a GBP-dependent and inflammasome-independent manner. Finally, in a mouse model of tularemia, we demonstrate that the inflammasome and the GBPs are two key immune pathways functioning largely independently to control F. novicida infection. Altogether, our results indicate that GBPs are the master effectors of IFN-γ-mediated responses against F. novicida to control antibacterial immune responses in inflammasome-dependent and independent manners.
DEFF Research Database (Denmark)
Xia, Xiqiang; Govindan, Kannan; Zhu, Qinghua
2015-01-01
analyzes internal barriers met by automotive parts remanufacturers and evaluates causal barriers by a proposed model framework. This objective is illustrated by employing the Grey Decision Making Trial and Evaluation Laboratory (DEMATEL) approach. By virtue of these findings, remanufacturers can eradicate......Automotive industries have attracted attention from international sectors recently. This attention to the industry results in many innovative technologies being integrated in these manufacturing arenas. In developing countries such as the BRIC (Brazil, Russia, India, and China) countries...
Vulnerability of multiple-barrier systems
International Nuclear Information System (INIS)
Lind, N.C.
1996-01-01
'Vulnerability' is defined as the ratio of the probability of failure of a damaged system to the probability of failure of the undamaged system. This definition applies to all engineered systems and can be specialized to particular system types. Some disastrous failures (e.g., Chernobyl) have shown that systems can be highly vulnerable. open-quotes Defense in depthclose quotes is a powerful design principle, reducing vulnerability when the consequences of failure can be catastrophic. In the nuclear industry, defense in depth is widely used in radiation protection, reactor control, and shutdown systems. A multiple-barrier system is a simple example of a system that has defense in depth. The idea is that the system is not vulnerable. It cannot fail if one barrier fails because there is another to take its place. This idea is untenable in waste management, but a quantified vulnerability of a system can help owners, designers, and regulators decide how much defense in depth is desirable or enough. Many multiple-barrier systems can be modeled as systems of components physically in a series, each individually able to prevent failure. Components typically have bimodal distributions of the service time to failure, as illustrated by an example of application to a hypothetical nuclear fuel waste repository
Directory of Open Access Journals (Sweden)
N. A. Siddiqui
2011-06-01
Full Text Available Underground concrete barriers are frequently used to protect strategic structures like Nuclear power plants (NPP, deep under the soil against any possible high velocity missile impact. For a given range and type of missile (or projectile it is of paramount importance to examine the reliability of underground concrete barriers under expected uncertainties involved in the missile, concrete, and soil parameters. In this paper, a simple procedure for the reliability assessment of underground concrete barriers against normal missile impact has been presented using the First Order Reliability Method (FORM. The presented procedure is illustrated by applying it to a concrete barrier that lies at a certain depth in the soil. Some parametric studies are also conducted to obtain the design values which make the barrier as reliable as desired.
International Nuclear Information System (INIS)
Cheng Junmin; Zhou Xiujuan; Zhang Yuhong
2010-01-01
Objective: To explore the changes of serum IL-2, IL-4 and IFN-γ levels after treatment in patients with vitiligo. Methods: Serum IL-2 (with RIA) IL-4, IFN-γ (with ELISA) levels were examined in 37 patients with vitiligo both before and after treatment as well as in 35 controls. Results: Before treatment, serum IL-2 levels in the patients were significantly lower than those in controls (P < 0.01), while the serum IL-4, IFN-γ levels were significantly higher (P < 0.01). After treatment for 6 months, the values were greatly corrected, but remained significantly different from those in controls (P < 0.05). Conclusion: Vitiligo is a kind of auto-immune diseases with abnormal immuno-regulation. (authors)
Paquette, Jackie K; Ma, Ying; Fisher, Colleen; Li, Jinze; Lee, Sang Beum; Zachary, James F; Kim, Yong Soo; Teuscher, Cory; Weis, Janis J
2017-11-15
Previously, using a forward genetic approach, we identified differential expression of type I IFN as a positional candidate for an expression quantitative trait locus underlying Borrelia burgdorferi arthritis-associated locus 1 ( Bbaa1 ). In this study, we show that mAb blockade revealed a unique role for IFN-β in Lyme arthritis development in B6.C3- Bbaa1 mice. Genetic control of IFN-β expression was also identified in bone marrow-derived macrophages stimulated with B. burgdorferi , and it was responsible for feed-forward amplification of IFN-stimulated genes. Reciprocal radiation chimeras between B6.C3- Bbaa1 and C57BL/6 mice revealed that arthritis is initiated by radiation-sensitive cells, but orchestrated by radiation-resistant components of joint tissue. Advanced congenic lines were developed to reduce the physical size of the Bbaa1 interval, and confirmed the contribution of type I IFN genes to Lyme arthritis. RNA sequencing of resident CD45 - joint cells from advanced interval-specific recombinant congenic lines identified myostatin as uniquely upregulated in association with Bbaa1 arthritis development, and myostatin expression was linked to IFN-β production. Inhibition of myostatin in vivo suppressed Lyme arthritis in the reduced interval Bbaa1 congenic mice, formally implicating myostatin as a novel downstream mediator of the joint-specific inflammatory response to B. burgdorferi . Copyright © 2017 by The American Association of Immunologists, Inc.
Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity
Schoggins, John W.; MacDuff, Donna A.; Imanaka, Naoko; Gainey, Maria D.; Shrestha, Bimmi; Eitson, Jennifer L.; Mar, Katrina B.; Richardson, R. Blake; Ratushny, Alexander V.; Litvak, Vladimir; Dabelic, Rea; Manicassamy, Balaji; Aitchison, John D.; Aderem, Alan; Elliott, Richard M.; García-Sastre, Adolfo; Racaniello, Vincent; Snijder, Eric J.; Yokoyama, Wayne M.; Diamond, Michael S.; Virgin, Herbert W.; Rice, Charles M.
2014-01-01
The type I interferon (IFN) response protects cells from viral infection by inducing hundreds of interferon-stimulated genes (ISGs), some of which encode direct antiviral effectors. Recent screening studies have begun to catalogue ISGs with antiviral activity against several RNA and DNA viruses. However, antiviral ISG specificity across multiple distinct classes of viruses remains largely unexplored. Here we used an ectopic expression assay to screen a library of more than 350 human ISGs for effects on 14 viruses representing 7 families and 11 genera. We show that 47 genes inhibit one or more viruses, and 25 genes enhance virus infectivity. Comparative analysis reveals that the screened ISGs target positive-sense single-stranded RNA viruses more effectively than negative-sense single-stranded RNA viruses. Gene clustering highlights the cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS, also known as MB21D1) as a gene whose expression also broadly inhibits several RNA viruses. In vitro, lentiviral delivery of enzymatically active cGAS triggers a STING-dependent, IRF3-mediated antiviral program that functions independently of canonical IFN/STAT1 signalling. In vivo, genetic ablation of murine cGAS reveals its requirement in the antiviral response to two DNA viruses, and an unappreciated contribution to the innate control of an RNA virus. These studies uncover new paradigms for the preferential specificity of IFN-mediated antiviral pathways spanning several virus families.
Gallego-Marin, Carolina; Schrum, Jacob E; Andrade, Warrison A; Shaffer, Scott A; Giraldo, Lina F; Lasso, Alvaro M; Kurt-Jones, Evelyn A; Fitzgerald, Katherine A; Golenbock, Douglas T
2018-01-15
Innate immune receptors have a key role in the sensing of malaria and initiating immune responses. As a consequence of infection, systemic inflammation emerges and is directly related to signs and symptoms during acute disease. We have previously reported that plasmodial DNA is the primary driver of systemic inflammation in malaria, both within the phagolysosome and in the cytosol of effector cells. In this article, we demonstrate that Plasmodium falciparum genomic DNA delivered to the cytosol of human monocytes binds and activates cyclic GMP-AMP synthase (cGAS). Activated cGAS synthesizes 2'3'-cGAMP, which we subsequently can detect using liquid chromatography-tandem mass spectrometry. 2'3'-cGAMP acts as a second messenger for STING activation and triggers TBK1/IRF3 activation, resulting in type I IFN production in human cells. This induction of type I IFN was independent of IFI16. Access of DNA to the cytosolic compartment is mediated by hemozoin, because incubation of purified malaria pigment with DNase abrogated IFN-β induction. Collectively, these observations implicate cGAS as an important cytosolic sensor of P. falciparum genomic DNA and reveal the role of the cGAS/STING pathway in the induction of type I IFN in response to malaria parasites. Copyright © 2018 by The American Association of Immunologists, Inc.
He, Ling Feng; Wang, Yi Gang; Xiao, Tian; Zhang, Kang Jiang; Li, Gong Chu; Gu, Jin Fa; Chu, Liang; Tang, Wen Hao; Tan, Wen-Song; Liu, Xin Yuan
2009-12-28
Adeno-associated virus (AAV) has rapidly become a promising gene delivery vehicle for its excellent advantages of non-immunogenic, low pathogenicity and long-term gene expression in vivo. However, a major obstacle in development of effective AAV vector is the lack of tissue specificity, which caused low efficiency of AAV transfer to target cells. The application of human telomerase reverse transcriptase (hTERT) promoter is a prior targeting strategy for AAV in cancer gene therapy as hTERT activity is transcriptionally upregulated in most cancer cells. In the present work, we investigated whether AAV-mediated human interferon beta (IFN-beta) gene driven by hTERT promoter could specifically express in tumor cells and suppress tumor cell growth. Our data demonstrated that hTERT promoter-driven IFN-beta expression was the tumor-specific, decreased the cell viability of tumor cells but not normal cells, and induced tumor cell apoptosis via activation of caspase pathway and release of cytochrome c. AAV-mediated IFN-beta expression driven by hTERT promoter significantly suppressed the growth of colorectal cancer and lung cancer xenograft in mice and resulted in tumor cells death in vivo. These data suggested that AAVs in combination with hTERT-mediated IFN-beta expression could exert potential antitumor activity and provide a novel targeting approach to clinical gene therapy of varieties of cancers.
Directory of Open Access Journals (Sweden)
Xiao-Ting Liu
2014-08-01
Full Text Available Initial investigation for new active herbal extract with inhibiting activity on JAK/STAT signaling pathway revealed that the extract of Caulis Trachelospermi, which was separated by 80% alcohol extraction and subsequent HP-20 macroporous resin column chromatography, was founded to strongly inhibit IFN-γ-induced STAT1-responsive luciferase activity (IFN-γ/STAT1 with IC50 value of 2.43 μg/mL as well as inhibiting IL-6-induced STAT3-responsive luciferase activity (IL-6/STAT3 with IC50 value of 1.38 μg/mL. Subsequent study on its active components led to the isolation and identification of two new dibenzylbutyrolactone lignans named 4-demethyltraxillaside (1 and nortrachelogenin 4-O-β-d-glucopyranoside (2, together with six known compounds. The lignan compounds 1–4 together with other lignan compounds isolated in previous study were tested the activities on IFN-γ/STAT1 and IL-6/STAT3 pathways. The following result showed that the main components trachelogenin and arctigenin had corresponding activities on IFN-γ/STAT1 pathway with IC50 values of 3.14 μM and 9.46 μM as well as trachelogenin, arctigenin and matairesinol strongly inhibiting IL-6/STAT3 pathway with IC50 values of 3.63 μM, 6.47 μM and 2.92 μM, respectively.
Eriksson, Kristina; Svensson, Alexandra; Hait, Alon S; Schlüter, Kerstin; Tunbäck, Petra; Nordström, Inger; Padyukov, Leonid; Liljeqvist, Jan-Åke; Mogensen, Trine H; Paludan, Søren R
2017-10-15
IFN-γ-inducible protein 16 (IFI16) is an immunological DNA sensor proposed to act in the cyclic GMP-AMP synthase-stimulator of IFN genes pathway. Because mice do not have a clear ortholog of IFI16, this system is not suitable for genetic studies of IFI16. In this study, we have compared the dependency on IFI16, cyclic GMP-AMP synthase, and stimulator of IFN genes for type I IFN induction by a panel of pathogenic bacteria and DNA viruses. The IFN response induced by HSV-2 was particularly dependent on IFI16. In a cohort of patients with genital herpes and healthy controls, the minor G allele of the IFI16 single nucleotide polymorphism rs2276404 was associated with resistance to infection. Furthermore, the combination of this allele with the C allele of rs1417806 was significantly overrepresented in uninfected individuals. Cells from individuals with the protective GC haplotype expressed higher levels of IFI16 and induced more IFN-β upon HSV-2 infection. These data provide genetic evidence for a role for IFI16 in protection against genital herpes. Copyright © 2017 by The American Association of Immunologists, Inc.
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade
2006-12-15
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.
Creating a digital medical illustration.
Culley, Joanna
2016-01-01
This paper covers the steps required to complete a medical illustration in a digital format using Adobe Illustrator and Photoshop. The project example is the surgical procedure for the release of the glenohumeral joint for the condition known as 'frozen shoulder'. The purpose is to demonstrate one method which an artist can use within digital media to create a colour illustration such as the release of the glenohumeral joint. Included is a general overview as how to deal with the administration of a medical illustration commission through the experience of a professional freelance artist.
Limitations of Using IL-17A and IFN-γ-Induced Protein 10 to Detect Bovine Tuberculosis
Xin, Ting; Gao, Xintao; Yang, Hongjun; Li, Pingjun; Liang, Qianqian; Hou, Shaohua; Sui, Xiukun; Guo, Xiaoyu; Yuan, Weifeng; Zhu, Hongfei; Ding, Jiabo; Jia, Hong
2018-01-01
Bovine tuberculosis (bTB) is primarily caused by infection with Mycobacterium bovis, which belongs to the Mycobacterium tuberculosis complex. The airborne route is considered the most common for transmission of M. bovis, and more than 15% of cattle with bTB shed the Mycobacterium, which can be detect by nested PCR to amplify mycobacterial mpb70 from a nasal swab from a cow. To screen for cytokines fostering early and accurate detection of bTB, peripheral blood mononuclear cells were isolated from naturally M. bovis-infected, experimentally M. bovis 68002-infected, and uninfected cattle, then these cells were stimulated by PPD-B, CFP-10-ESAT-6 (CE), or phosphate-buffered saline (PBS) for 6 h. The levels of interferon gamma (IFN-γ), IFN-γ-induced protein 10 (IP-10), IL-6, IL-12, IL-17A, and tumor necrosis factor alpha mRNA were measured using real-time PCR. To explore the cytokines associated with different periods of M. bovis infection, cattle were divided into three groups: PCR-positive, PCR-negative, and uninfected using the tuberculin skin test, CFP-10/ESAT-6/TB10.4 protein cocktail-based skin test, IFN-γ release assay (IGRA), CFP-10/ESAT-6 (CE)-based IGRA, and nested PCR. The expression of IP-10, IL-17A, and IFN-γ proteins induced by PPD-B, CE, or PBS was detected by ELISA. The results showed that levels of PPD-B-stimulated IL-17A and IP-10 (mRNA and protein), and CE-induced IP-10 (mRNA and protein) were significantly higher in cattle naturally or experimentally infected with M. bovis than in those that were uninfected. The levels of PPD-B- or CE-induced IL-17A and IP-10 (protein) could be used to differentiate M. bovis-infected calves from uninfected ones for 6 to 30 weeks post-infection, whereas PPD-B- and CE-induced IP-10 and IL-17A mRNA expression could be used to differentiate M. bovis-infected calves from uninfected ones between 6 and 58 weeks post-infection. However, CE-induced IL-17A (protein) was not a reliable indicator of M. bovis infection
Interferon Lambda Genetics and Biology in Regulation of Viral Control
Directory of Open Access Journals (Sweden)
Emily A. Hemann
2017-12-01
Full Text Available Type III interferons, also known as interferon lambdas (IFNλs, are the most recent addition to the IFN family following their discovery in 2003. Initially, IFNλ was demonstrated to induce expression of interferon-stimulated genes and exert antiviral properties in a similar manner to type I IFNs. However, while IFNλ has been described to have largely overlapping expression and function with type I IFNs, it has become increasingly clear that type III IFNs also have distinct functions from type I IFNs. In contrast to type I IFNs, whose receptor is ubiquitously expressed, type III IFNs signal and function largely at barrier epithelial surfaces, such as the respiratory and gastrointestinal tracts, as well as the blood–brain barrier. In further support of unique functions for type III IFNs, single nucleotide polymorphisms in IFNL genes in humans are strongly associated with outcomes to viral infection. These biological linkages have also been more directly supported by studies in mice highlighting roles of IFNλ in promoting antiviral immune responses. In this review, we discuss the current understanding of type III IFNs, and how their functions are similar to, and different from, type I IFN in various immune cell subtypes and viral infections.
DEFF Research Database (Denmark)
Fuglsang, Eva; Henningsen, Louise; Frøkiær, Hanne
of sphingomyelin to ceramide by acid sphingomyelinase (ASMase) at the outer leaflet of the PM is a key event in endocytosis of gram-positive Lactobacillus acidophilus (L. acidophilus) and the subsequent induction of IFN-beta in DCs and, as the gram-negative Escherichia coli (E. coli) does not induce appreciable...
Martins, Marcia Valéria B S; Lima, Mônica Cristina B S; Duppre, Nadia C; Matos, Haroldo J; Spencer, John S; Brennan, Patrick J; Sarno, Euzenir N; Fonseca, Leila; Pereira, Geraldo M B; Pessolani, Maria Cristina V
2007-05-01
There are no reliable means for detecting subclinical mycobacterial infections. The recent sequencing of several mycobacterial genomes has now afforded new opportunities for the development of pathogen-specific diagnostic tests, critical in the context of leprosy and tuberculosis control. In the present study, we applied a multi-parametric flow cytometric analysis that allowed the investigation of T-cell functions in order to define immunological markers that measure previous exposure to mycobacteria. We compared the in vivo response to PPD, the gold standard skin test reagent for measuring previous exposure to Mycobacterium tuberculosis, with in vitro parameters of leukocyte activation in five PPD positive and five PPD negative healthy volunteers. PPD-stimulated peripheral leukocytes expressing CD4, CD69, cutaneous lymphocyte-associated antigen (CLA) and intracellular IFN-gamma were enumerated in whole blood and compared with the size of in vivo PPD-induced induration and IFN-gamma production levels as measured by ELISA in supernatants of PPD-stimulated peripheral blood mononuclear cells. The reactivity to the tuberculin skin test (TST) was associated with markedly increased frequencies of PPD-responsive activated (CD69+) and IFN-gamma-producing CD4+T cells. Detection of PPD-specific IFN-gamma producing leukocytes was restricted to CD4+T cells and a subset of these cells was shown to express the skin homing molecule CLA. Multiple linear regression modeling of responses to PPD showed the highest association between skin test indurations and frequencies of PPD-responsive IFN-gamma-producing CD4+CD69+ T cells. Our data show that the in vitro enumeration of antigen-specific IFN-gamma-producing CD4+ T cells can provide an alternative to the in vivo tuberculin test for the detection of latent Mycobacterium tuberculosis infection. Moreover, the measurement of these immunological parameters can be useful for the screening of new specific antigens defined by the genome
... as medical books, journals, magazines, pharma or biotech marketing, films, online video, exhibits, posters, wall charts, educational ... of the health career profession with strong communication skills, medical illustrators work closely with clients to interpret ...
Ramana, Chilakamarti V.; DeBerge, Matthew P.; Kumar, Aseem; Alia, Christopher S.; Durbin, Joan E.
2015-01-01
Influenza infection results in considerable pulmonary pathology, a significant component of which is mediated by CD8+ T cell effector functions. To isolate the specific contribution of CD8+ T cells to lung immunopathology, we utilized a nonviral murine model in which alveolar epithelial cells express an influenza antigen and injury is initiated by adoptive transfer of influenza-specific CD8+ T cells. We report that IFN-γ production by adoptively transferred influenza-specific CD8+ T cells is a significant contributor to acute lung injury following influenza antigen recognition, in isolation from its impact on viral clearance. CD8+ T cell production of IFN-γ enhanced lung epithelial cell expression of chemokines and the subsequent recruitment of inflammatory cells into the airways. Surprisingly, Stat1 deficiency in the adoptive-transfer recipients exacerbated the lung injury that was mediated by the transferred influenza-specific CD8+ T cells but was still dependent on IFN-γ production by these cells. Loss of Stat1 resulted in sustained activation of Stat3 signaling, dysregulated chemokine expression, and increased infiltration of the airways by inflammatory cells. Taken together, these data identify important roles for IFN-γ signaling and Stat1-independent IFN-γ signaling in regulating CD8+ T cell-mediated acute lung injury. This is the first study to demonstrate an anti-inflammatory effect of Stat1 on CD8+ T cell-mediated lung immunopathology without the complication of differences in viral load. PMID:25617378
Graham, Simon P; Haines, Felicity J; Johns, Helen L; Sosan, Olubukola; La Rocca, S Anna; Lamp, Benjamin; Rümenapf, Till; Everett, Helen E; Crooke, Helen R
2012-04-05
Live attenuated C-strain classical swine fever viruses (CSFV) provide a rapid onset of protection, but the lack of a serological test that can differentiate vaccinated from infected animals limits their application in CSF outbreaks. Since immunity may precede antibody responses, we examined the kinetics and specificity of peripheral blood T cell responses from pigs vaccinated with a C-strain vaccine and challenged after five days with a genotypically divergent CSFV isolate. Vaccinated animals displayed virus-specific IFN-γ responses from day 3 post-challenge, whereas, unvaccinated challenge control animals failed to mount a detectable response. Both CD4(+) and cytotoxic CD8(+) T cells were identified as the cellular source of IFN-γ. IFN-γ responses showed extensive cross-reactivity when T cells were stimulated with CSFV isolates spanning the major genotypes. To determine the specificity of these responses, T cells were stimulated with recombinant CSFV proteins and a proteome-wide peptide library from a related virus, BVDV. Major cross-reactive peptides were mapped on the E2 and NS3 proteins. Finally, IFN-γ was shown to exert potent antiviral effects on CSFV in vitro. These data support the involvement of broadly cross-reactive T cell IFN-γ responses in the rapid protection conferred by the C-strain vaccine and this information should aid the development of the next generation of CSFV vaccines. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.
Duck RIG-I CARD Domain Induces the Chicken IFN-β by Activating NF-κB
Directory of Open Access Journals (Sweden)
Yang Chen
2015-01-01
Full Text Available Retinoic acid-inducible gene I- (RIG-I- like receptors (RLRs have recently been identified as cytoplasmic sensors for viral RNA. RIG-I, a member of RLRs family, plays an important role in innate immunity. Although previous investigations have proved that RIG-I is absent in chickens, it remains largely unknown whether the chicken can respond to RIG-I ligand. In this study, the eukaryotic expression vectors encoding duRIG-I full length (duck RIG-I, containing all domains, duRIG-I N-terminal (containing the two caspase activation and recruitment domain, CARDs, and duRIG-I C-terminal (containing helicase and regulatory domains labeled with 6*His tags were constructed successfully and detected by western blotting. Luciferase reporter assay and enzyme-linked immunosorbent assay (ELISA detected the duRIG-I significantly activated NF-κB and induced the expression of IFN-β when polyinosinic-polycytidylic acid (poly[I:C], synthetic double-stranded RNA challenges chicken embryonic fibroblasts cells (DF1 cells, while the duRIG-I was inactive in the absence of poly[I:C]. Further analysis revealed that the CARDs (duRIG-I-N induced IFN-β production regardless of the presence of poly[I:C], while the CARD-lacking duRIG-I (duRIG-I-C was not capable of activating downstream signals. These results indicate that duRIG-I CARD domain plays an important role in the induction of IFN-β and provide a basis for further studying the function of RIG-I in avian innate immunity.
González-Hernández, Y; Pedraza-Sánchez, S; Blandón-Vijil, V; del Río-Navarro, B E; Vaughan, G; Moreno-Lafont, M; Escobar-Gutiérrez, A
2007-04-01
In humans, T cells expressing the CD161 molecule NKR-P1A constitute around 20% of the circulating CD3(+) cells and are potentially immunoregulatory in several diseases. Their role in asthma is not well known, but they could participate in asthma attacks. To determinate whether activation of CD161(+) T cells and their cytokine production correlate with clinical status of asthma, we analysed blood samples from asthma attack patients (AAP) and stable asthma patients (SAP) in comparison with healthy non-atopic controls (HC). There was a significant higher baseline expression of CD69 on T cells from AAP and the difference was more notorious on CD161(+) T cells; upregulation of CD69 was observed on both CD161(-) and CD161(+) T cells driven by Dermatophagoides pteronyssinus crude extract, whereas polyclonal stimulation with phorbol 12-myristate 13-acetate plus ionomycin predominantly induced IFN-gamma but no IL-4, IL-5 and IL-13 by CD161(+) T cells in all groups; upon polyclonal stimulation, there were more CD161(+) T cells producing IFN-gamma and less CD161(-) T cells producing this cytokine, contrasting with the opposite results observed in SAP and HC groups. Our results indicate that, during asthma attack, CD161(+) T cells are activated and are able to produce predominantly IFN-gamma but no Th2 cytokines. We hypothesize that during an asthma attack, IFN-gamma produced by CD161(+) T cells could help to reestablish the Th1/Th2 equilibrium. These observations may contribute to the understanding of the immune mechanisms involved in asthma attacks.
International Nuclear Information System (INIS)
Chou, Andy Shau-Bin; Wang, Hsin-Yi; Chen, Hung-Chang; Tsai, Ming-Hsiu; Chuang, Cheng-Keng; Liao, Shuen-Kuei
2009-01-01
Understanding of immunobiology of bone marrow metastases (designated BM-NPC) versus primary tumors (P-NPC) of the nasopharynx is far from complete. The aim of this study was to determine if there would be differences between cultured P-NPCs and BM-NPCs with respect to (i) constitutive IL-6 and the IL-6 receptor gp80 subunit (IL-6Rα) levels in the spent media of nontransduced cells, and (ii) IL-6 and IL-6Rα levels in the spent media of cells transduced with a retroviral vector containing the IFN-γ gene. A panel of NPC cell lines were transduced with the IFN-γ gene through a retroviral vector. Four clonal sublines were isolated via limiting dilution methods. Cytofluorometric analysis was performed for the detection of cell surface antigens of HLA class I, HLA class II and ICAM-1. ELISA was used to assay for IFN-γ, IL-6 and IL-6Rα in the spent media of cultured cell lines. Our results showed that in day 3 culture supernatants, low levels of soluble IL-6 were detected in 5/5 cultured tumors derived from P-NPCs, while much higher constitutive levels of IL-6 were detected in 3/3 metastasis-derived NPC cell lines including one originated from ascites; the difference was significant (p = 0.025). An inverse relationship was found between IL-6Rα and IL-6 in their release levels in cultured P-NPCs and metastasis-derived NPCs. In IFN-γ-transduced-P-NPCs, IL-6 production increased and yet IL-6Rα decreased substantially, as compared to nontransduced counterparts. At variance with P-NPC cells, the respective ongoing IL-6 and IL-6Rα release patterns of BM-NPC cells were not impeded as much following IFN-γ transduction. These observations were confirmed by extended kinetic studies with representative NPC cell lines and clonal sublines. The latter observation with the clonal sublines also indicates that selection for high IL-6 or low IL-6Rα producing subpopulations did not occur as a result of IFN-γ-transduction process. P-NPCs, which secreted constitutively only
Transport Properties of a Kinetic Model for Chemical Reactions without Barriers
International Nuclear Information System (INIS)
Alves, Giselle M.; Kremer, Gilberto M.; Soares, Ana Jacinta
2011-01-01
A kinetic model of the Boltzmann equation for chemical reactions without energy barrier is considered here with the aim of evaluating the reaction rate and characterizing the transport coefficient of shear viscosity for the reactive system. The Chapman-Enskog solution of the Boltzmann equation is used to compute the chemical reaction effects, in a flow regime for which the reaction process is close to the final equilibrium state. Some numerical results are provided illustrating that the considered chemical reaction without energy barrier can induce an appreciable influence on the reaction rate and on the transport coefficient of shear viscosity.
Bosma, W.E.; Theune, Mariet; van Hooijdonk, C.M.J.; Krahmer, E.; Maes, F.
In this paper we discuss and evaluate a method for automatic text illustration, applied to answers to medical questions. Our method for selecting illustrations is based on the idea that similarities between the answers and picture-related text (the picture’s caption or the section/paragraph that
A constrained approximation for nuclear barrier penetration and fission
International Nuclear Information System (INIS)
Tang, H.H.K.; Negele, J.W.; Massachusetts Inst. of Tech., Cambridge; Massachusetts Inst. of Tech., Cambridge
1983-01-01
An approximation to the time-dependent mean-field theory for barrier penetration by a nucleus is obtained in terms of constrained Hartree-Fock wave functions and a coherent velocity field. A discrete approximation to the continuum theory suitable for practical numerical calculations is presented and applied to three illustrative models. Potential application of the theory to the study of nuclear fission is discussed. (orig.)
Pérez, J E; Lacava, J A; Domínguez, M E; Rodríguez, R; Barbieri, M R; Romero Acuña, L A; Romero Acuña, J M; Langhi, M J; Amato, S; Marrone, N; Ortiz, E H; Leone, B A; Vallejo, C T; Machiavelli, M R; Romero, A O
1998-08-01
A phase II trial was carried out by the Grupo Oncologico Cooperativo del Sur (G.O.C.S.) to assess the efficacy and toxicity of a biochemical modulation of 5-fluorouracil (5-FU) by i.v. pretreatment with interferon (IFN)-alpha2b in patients with advanced colorectal carcinoma refractory to previous therapy with 5-FU modulated by methotrexate (MTX) or leucovorin (LV) or both. Between January 1993 and October 1995, 34 patients were entered on the study. The treatment was IFN-alpha2b 5 x 10(6)/m2 IU in a 1-h i.v. infusion, followed immediately by 5-FU 600 mg/m2 i.v. bolus injection. Courses were repeated weekly until observation of progressive disease or severe toxicity. One patient could not be assessed for response. Objective regression was observed in 2 of 33 patients (6%, 95% confidence interval, 0%-14%). No patient achieved a complete response. Two patients had partial responses (6%). No change was recorded in 14 patients (41%), and progressive disease occurred in 17 (52%). The median time to treatment failure was 3 months, and the median survival was 5 months. Toxicity was within acceptable limits. The main side effects were mucositis and diarrhea. Four episodes of grade 2 stomatitis were observed, causing dosage modifications. The most frequent toxic effects attributable to IFN-alpha2b were mild fatigue and fever. In conclusion, second-line therapy with i.v. IFN-alpha2b preceding 5-FU has shown an interesting profile of activity in a patient population with clearly unfavorable characteristics. From this perspective, further appropriately designed studies are needed to identify the greatest potential of IFN-alpha2b as a modulator of 5-FU.
Directory of Open Access Journals (Sweden)
T. M. Sokolova
2015-01-01
Full Text Available We have studied dose effects of several Interferon (IFN inducers, i.e., Genfaxon (beta-1 IFN, Cycloferon and Immunomax upon expression of six genes controlling the signaling in immune pathways (TLR3, TLR4, RIG1, IRF3, IPS, B2M, by means of real-time RT-PCR, being tested with blood cells from three humans. It is revealed that individual cell samples showed different sensitivity to these drugs, probably, due to constitutive levels of TLR3 and TLR4 gene expression and possible connections with their immune pathology. Genfaxon at a dose of 104 ME produced potent stimulation of TLR3, TLR4, IRF3 and B2M genes in two persons. Immunomax, at a dose 0,5 unit, exhibited same effect in one case only (with Epstein-Barr virus infection. Cycloferon stimulated gene expression at much lower levels than Genfaxon in any cases. We have shown a reverse correlation between sensitivity of the cells to Immunomax, and constitutive TLR3 and TLR4 expression. The stimulatory effects of Immunomax were maximal in a person with very low TLR3/4 gene expression. Immunomax boosted the genes from several signaling pathways, including TLR3, TLR4, but genes of RIG/IPS pathway showed higher activation. Cycloferon induced gene transcription of IRF3 and B2M-receptor to higher degree, than expression of TLR3 and TLR4 genes. Hence, our data concerning Genfaxon, Immunomax and Cycloferon confirm their IFN-inducing effects upon human blood cells. The RT-PCR-based evaluation of gene expression related to signaling immune pathways in blood cell populations will enable rapid and highly specific quantitation of IFN and IFN-inducer drugs activities, thus avoiding their biological testing in long-term cell cultures.
Directory of Open Access Journals (Sweden)
Patrícia C C Neves
Full Text Available Yellow Fever vaccine is one of the most efficacious human vaccines ever made. The vaccine (YF 17D virus induces polyvalent immune responses, with a mixed TH1/TH2 CD4(+ cell profile, which results in robust T CD8(+ responses and high titers of neutralizing antibody. In recent years, it has been suggested that early events after yellow fever vaccination are crucial to the development of adequate acquired immunity. We have previously shown that primary immunization of humans and monkeys with YF 17D virus vaccine resulted in the early synthesis of IFN-γ. Herein we have demonstrated, for the first time that early IFN-γ production after yellow fever vaccination is a feature also of murine infection and is much more pronounced in the C57BL/6 strain compared to the BALB/c strain. Likewise, in C57BL/6 strain, we have observed the highest CD8(+ T cells responses as well as higher titers of neutralizing antibodies and total anti-YF IgG. Regardless of this intense IFN-γ response in mice, it was not possible to see higher titers of IgG2a in relation to IgG1 in both mice lineages. However, IgG2a titers were positively correlated to neutralizing antibodies levels, pointing to an important role of IFN-γ in eliciting high quality responses against YF 17D, therefore influencing the immunogenicity of this vaccine.
Patin, Emmanuel C.; Jones, Adam V.; Thompson, Aiysha; Clement, Mathew; Liao, Chia-Te; Griffiths, James S.; Wallace, Leah E.; Bryant, Clare E.; Lang, Roland; Rosenstiel, Philip; Humphreys, Ian R.; Taylor, Philip R.
2016-01-01
Candida spp. elicit cytokine production downstream of various pathogen recognition receptors, including C-type lectin-like receptors, TLRs, and nucleotide oligomerization domain (NOD)–like receptors. IL-12 family members IL-12p70 and IL-23 are important for host immunity against Candida spp. In this article, we show that IL-27, another IL-12 family member, is produced by myeloid cells in response to selected Candida spp. We demonstrate a novel mechanism for Candida parapsilosis–mediated induction of IL-27 in a TLR7-, MyD88-, and NOD2-dependent manner. Our data revealed that IFN-β is induced by C. parapsilosis, which in turn signals through the IFN-α/β receptor and STAT1/2 to induce IL-27. Moreover, IL-27R (WSX-1)–deficient mice systemically infected with C. parapsilosis displayed enhanced pathogen clearance compared with wild-type mice. This was associated with increased levels of proinflammatory cytokines in the serum and increased IFN-γ and IL-17 responses in the spleens of IL-27R–deficient mice. Thus, our data define a novel link between C. parapsilosis, TLR7, NOD2, IFN-β, and IL-27, and we have identified an important role for IL-27 in the immune response against C. parapsilosis. Overall, these findings demonstrate an important mechanism for the suppression of protective immune responses during infection with C. parapsilosis, which has potential relevance for infections with other fungal pathogens. PMID:27259855
2012-01-01
Background Influenza A viruses are well characterized to antagonize type I IFN induction in infected mammalian cells. However, limited information is available for avian cells. It was hypothesised that avian influenza viruses (AIV) with distinct virulence may interact differently with the avian innate immune system. Therefore, the type I IFN responses induced by highly virulent and low virulent H5N1 AIV and reassortants thereof were analysed in chicken cells. Results The highly pathogenic (HP) AIV A/chicken/Yamaguchi/7/04 (H5N1) (Yama) did not induce type I IFN in infected chicken HD-11 macrophage-like cells. This contrasted with an NS1 mutant Yama virus (Yama-NS1A144V) and with the attenuated H5N1 AIV A/duck/Hokkaido/Vac-1/04 (Vac) carrying the haemagglutinin (HA) of the Yama virus (Vac-Yama/HA), that both induced type I IFN in these cells. The substitution of the NS segment from Yama with that from Vac in the Yama backbone resulted in induction of type I IFN secretion in HD-11 cells. However, vice versa, the Yama NS segment did not prevent type I IFN induction by the Vac-Yama/HA virus. This was different with the PB1/PB2/PA segment reassortant Yama and Vac-Yama/HA viruses. Whereas the Yama virus with the Vac PB1/PB2/PA segments induced type I IFN in HD-11 cells, the Vac-Yama/HA virus with the Yama PB1/PB2/PA segments did not. As reported for mammalian cells, the expression of H5N1 PB2 inhibited the activation of the IFN-β promoter in chicken DF-1 fibroblast cells. Importantly, the Yama PB2 was more potent at inhibiting the IFN-β promoter than the Vac PB2. Conclusions The present study demonstrates that the NS1 protein and the polymerase complex of the HPAIV Yama act in concert to antagonize chicken type I IFN secretion in HD-11 cells. PB2 alone can also exert a partial inhibitory effect on type I IFN induction. In conclusion, the control of type I IFN induction by H5N1 HPAIV represents a complex phenotype that involves a particular viral gene constellation
Directory of Open Access Journals (Sweden)
Henrick Schomacker
Full Text Available Interferons (IFNs play a crucial role in the antiviral immune response. Whereas the C proteins of wild-type human parainfluenza virus type 1 (WT HPIV1 inhibit both IFN-β induction and signaling, a HPIV1 mutant encoding a single amino acid substitution (F170S in the C proteins is unable to block either host response. Here, signaling downstream of the type 1 IFN receptor was examined in Vero cells to define at what stage WT HPIV1 can block, and F170S HPIV1 fails to block, IFN signaling. WT HPIV1 inhibited phosphorylation of both Stat1 and Stat2, and this inhibition was only slightly reduced for F170S HPIV1. Degradation of Stat1 or Stat2 was not observed. The HPIV1 C proteins were found to accumulate in the perinuclear space, often forming large granules, and co-localized with Stat1 and the cation-independent mannose 6-phosphate receptor (M6PR that is a marker for late endosomes. Upon stimulation with IFN-β, both the WT and F170S C proteins remained in the perinuclear space, but only the WT C proteins prevented Stat1 translocation to the nucleus. In addition, WT HPIV1 C proteins, but not F170S C proteins, co-immunoprecipitated both phosphorylated and unphosphorylated Stat1. Our findings suggest that the WT HPIV1 C proteins form a stable complex with Stat1 in perinuclear granules that co-localize with M6PR, and that this direct interaction between the WT HPIV1 C proteins and Stat1 is the basis for the ability of HPIV1 to inhibit IFN signaling. The F170S mutation in HPIV1 C did not prevent perinuclear co-localization with Stat1, but apparently weakened this interaction such that, upon IFN stimulation, Stat1 was translocated to the nucleus to induce an antiviral response.
Energy Technology Data Exchange (ETDEWEB)
Peng, Qianqian; Lan, Xi; Wang, Chen [State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046 (China); Ren, Yujie; Yue, Ningning [College of Life Sciences, Wuhan University, Wuhan 430072 (China); Wang, Junyong [State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046 (China); Zhong, Bo [College of Life Sciences, Wuhan University, Wuhan 430072 (China); Medical Research Institute, School of Medicine, Wuhan University, Wuhan 430071 (China); Zhu, Qiyun, E-mail: zhuqiyun@caas.cn [State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046 (China)
2017-07-15
Emerged porcine kobuvirus (PKV) has adversely affected the global swine industry since 2008, but the etiological biology of PKV is unclear. Screening PKV-encoded structural and non-structural proteins with a type I IFN-responsive luciferase reporter showed that PKV VP3 protein inhibited the IFN-β-triggered signaling pathway, resulting in the decrease of VSV-GFP replication. QPCR data showed that IFN-β downstream cytokine genes were suppressed without cell-type specificity as well. The results from biochemical experiments indicated that PKV VP3 associated with STAT2 and IRF9, and interfered with the formation of the STAT2-IRF9 and STAT2-STAT2 complex, impairing nuclear translocation of STAT2 and IRF9. Taken together, these data reveal a new mechanism for immune evasion of PKV. - Highlights: •PKV VP3 inhibits the IFN-β-triggered signaling pathway. •VP3 associates with STAT2 and IRF9. •VP3 blocks the STAT2-IRF9 nuclear translocation. •VP3 utilizes a novel strategy for innate immune evasion.
Zhou, Naibao; Fu, Zhijian; Li, Hao; Wang, Kaiguo
2017-01-01
Abstract Background: Ketamine has been used as an analgesic adjuvant with morphine in the treatment of refractory cancer pain recently. But both morphine and ketamine have been reported to produce a number of immunomodulatory effects. The current study was performed to assess whether the concentration of ketamine, as adjuvant analgesics for patient with refractory cancer pain, was related to its effect on T cells interleukin-2 (IL-2)/interferon-γ (IFN-γ) expression in vitro. Methods: Peripheral blood mononuclear cells (PBMCs) were isolated from venous blood of patients with refractory cancer pain over a Ficoll-Hypaque density gradient. T cells were isolated from by positive selection using anti-CD3 beads. T cells were then treated with vehicle (C group), morphine (200 ng/mL, M group), morphine (200 ng/mL), and different dose of ketamine (100, 200, 1000 ng/mL; MK1, MK5, MK10 group) for 24 hours before stimulation with anti-CD3 and anti-CD28. Then supernatant IL-2 and IFN-γ protein analysis, quantitative reverse transcription polymerase chain reaction (RT-PCR) for IL-2 and IFN-γ were done. Results: There were no significant difference of supernatant IL-2 and IFN-γ among C group, M group, and MK1 group, but the mRNA of M group and MK1 group were decreased compared with C group (P ketamine dose-dependently suppressed IL-2 and IFN-γ of activated T lymphocyte of patients with refractory cancer pain in vitro, but the inhibitory action of low dose ketamine could be neglected. PMID:28422864
Performance of intact and partially degraded concrete barriers in limiting fluid flow
International Nuclear Information System (INIS)
Walton, J.C.; Seitz, R.R.
1991-07-01
Concrete barriers will play a critical role in the long-term isolation of low-level radioactive wastes. Over time the barriers will degrade, and in many cases, the fundamental processes controlling performance of the barriers will be different for intact and degraded conditions. This document examines factors controlling fluid flow through intact and degraded concrete disposal facilities. Simplified models are presented fro predicting build up of fluid above a vault; fluid flow through and around intact vaults, through flaws in coatings/liners applied to a vault, and through cracks in a concrete vault; and the influence of different backfill materials around the outside of the vault. Example calculations are presented to illustrate the parameters and processes that influence fluid flow. 46 refs., 49 figs., 2 tabs
Bae, S I; Cheriyath, V; Jacobs, B S; Reu, F J; Borden, E C
2008-01-17
Human melanoma cell lines, SK-MEL-3 and SK-MEL-28, despite induction of the proapoptotic cytokine, Apo2L/TRAIL, did not undergo apoptosis in response to interferons (IFN-alpha2b or IFN-beta). Postulating that genes important for apoptosis induction by IFNs might be silenced by methylation, the DNA demethylating agent 5-aza-2'-deoxycytidine (5-AZAdC) was assessed. DR4 (TRAIL-R1) was identified as one of the genes reactivated by 5-AZAdC with a >3-fold increase in 8 of 10 melanoma cell lines. Pretreatment with 5-AZAdC sensitized SK-MEL-3 and SK-MEL-28 cells to apoptosis induced by IFN-alpha2b and IFN-beta; methylation-specific PCR and bisulfite sequencing confirmed demethylation of 5'CpG islands of DR4 and flow cytometry showed an increase in DR4 protein on the cell surface. In cells with reactivated DR4, neutralizing mAB to TRAIL reduced apoptosis in response to IFN-beta or Apo2L/TRAIL. To further confirm the role of DR4, it was expressed by retroviral vector in SK-MEL-3 and SK-MEL-28 cells with reversal of resistance to IFN-beta and Apo2L/TRAIL. Thus, reexpressing DR4 by 5-AZAdC or retroviral transfection in melanoma cell in which promoter methylation had suppressed its expression, potentiated apoptosis by IFN-alpha2b, IFN-beta and Apo2L/TRAIL. Reactivation of silenced proapoptotic genes by inhibitors of DNA methylation may enhance clinical response to IFNs or Apo2L/TRAIL.
Hagberg, Niklas; Joelsson, Martin; Leonard, Dag; Reid, Sarah; Eloranta, Maija-Leena; Mo, John; Nilsson, Magnus K; Syvänen, Ann-Christine; Bryceson, Yenan T; Rönnblom, Lars
2018-02-23
Genetic variants in the transcription factor STAT4 are associated with increased susceptibility to systemic lupus erythematosus (SLE) and a more severe disease phenotype. This study aimed to clarify how the SLE-associated intronic STAT4 risk allele rs7574865[T] affects the function of immune cells in SLE. Peripheral blood mononuclear cells (PBMCs) were isolated from 52 genotyped patients with SLE. Phosphorylation of STAT4 (pSTAT4) and STAT1 (pSTAT1) in response to interferon (IFN)-α, IFN-γ or interleukin (IL)-12, total levels of STAT4, STAT1 and T-bet, and frequency of IFN-γ + cells on IL-12 stimulation were determined by flow cytometry in subsets of immune cells before and after preactivation of cells with phytohaemagglutinin (PHA) and IL-2. Cellular responses and phenotypes were correlated to STAT4 risk allele carriership. Janus kinase inhibitors (JAKi) selective for TYK2 (TYK2i) or JAK2 (JAK2i) were evaluated for inhibition of IL-12 or IFN-γ-induced activation of SLE PBMCs. In resting PBMCs, the STAT4 risk allele was neither associated with total levels of STAT4 or STAT1, nor cytokine-induced pSTAT4 or pSTAT1. Following PHA/IL-2 activation, CD8 + T cells from STAT4 risk allele carriers displayed increased levels of STAT4 resulting in increased pSTAT4 in response to IL-12 and IFN-α, and an augmented IL-12-induced IFN-γ production in CD8 + and CD4 + T cells. The TYK2i and the JAK2i efficiently blocked IL-12 and IFN-γ-induced activation of PBMCs from STAT4 risk patients, respectively. T cells from patients with SLE carrying the STAT4 risk allele rs7574865[T] display an augmented response to IL-12 and IFN-α. This subset of patients may benefit from JAKi treatment. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Radiology illustrated. Gastrointestinal tract
International Nuclear Information System (INIS)
Choi, Byung Ihn
2015-01-01
Radiology Illustrated: Gastrointestinal Tract is the second of two volumes designed to provide clear and practical guidance on the diagnostic imaging of abdominal diseases. The book presents approximately 300 cases with 1500 carefully selected and categorized illustrations of gastrointestinal tract diseases, along with key text messages and tables that will help the reader easily to recall the relevant images as an aid to differential diagnosis., Essential points are summarized at the end of each text message to facilitate rapid review and learning. Additionally, brief descriptions of each clinical problem are provided, followed by case studies of both common and uncommon pathologies that illustrate the roles of the different imaging modalities, including ultrasound, radiography, computed tomography, and magnetic resonance imaging.
Radiology illustrated. Gastrointestinal tract
Energy Technology Data Exchange (ETDEWEB)
Choi, Byung Ihn (ed.) [Seoul National University Hospital (Korea, Republic of). Dept. of Radiology
2015-02-01
Radiology Illustrated: Gastrointestinal Tract is the second of two volumes designed to provide clear and practical guidance on the diagnostic imaging of abdominal diseases. The book presents approximately 300 cases with 1500 carefully selected and categorized illustrations of gastrointestinal tract diseases, along with key text messages and tables that will help the reader easily to recall the relevant images as an aid to differential diagnosis., Essential points are summarized at the end of each text message to facilitate rapid review and learning. Additionally, brief descriptions of each clinical problem are provided, followed by case studies of both common and uncommon pathologies that illustrate the roles of the different imaging modalities, including ultrasound, radiography, computed tomography, and magnetic resonance imaging.
Directory of Open Access Journals (Sweden)
Héla Saïdi
2016-02-01
Full Text Available Plasmacytoid dendritic cells (pDCs are innate sensors of viral infections and important mediators of antiviral innate immunity through their ability to produce large amounts of IFN-α. Moreover, Toll-like receptor 7 (TLR7 and 9 (TLR9 ligands, such as HIV and CpG respectively, turn pDCs into TRAIL-expressing killer pDCs able to lyse HIV-infected CD4+ T cells. NK cells can regulate antiviral immunity by modulating pDC functions, and pDC production of IFN-α as well as cell-cell contact is required to promote NK cell functions. Impaired pDC-NK cell crosstalk was reported in the setting of HIV-1 infection, but the impact of HIV-1 on TRAIL expression and innate antiviral immunity during this crosstalk is unknown. Here, we report that low concentrations of CCR5-tropic HIV-1Ba-L promote the release of pro-inflammatory cytokines such as IFN-α, TNF-α, IFN-γ and IL-12, and CCR5-interacting chemokines (MIP-1α and MIP-1β in NK-pDCs co-cultures. At high HIV-1BaL concentrations, the addition of NK cells did not promote the release of these mediators, suggesting that once efficiently triggered by the virus, pDCs could not integrate new activating signals delivered by NK cells. However, high HIV-1BaL concentrations were required to trigger IFN-α-mediated TRAIL expression at the surface of both pDCs and NK cells during their crosstalk. Interestingly, we identified the alarmin HMGB1, released at pDC-NK cell synapse, as an essential trigger for the secretion of IFN-α and IFN-related soluble mediators during the interplay of HIV-1 exposed pDCs with NK cells. Moreover, HMGB1 was found crucial for mTRAIL translocation to the plasma membrane of both pDCs and NK cells during their crosstalk following pDC exposure to HIV-1. Data from serum analyses of circulating HMGB1, HMGB1-specific antibodies, sTRAIL and IP-10 in a cohort of 67 HIV-1+ patients argue for the in vivo relevance of these observations. Altogether, these findings identify HMGB1 as a trigger for IFN
Saïdi, Héla; Bras, Marlène; Formaglio, Pauline; Melki, Marie-Thérèse; Charbit, Bruno; Herbeuval, Jean-Philippe; Gougeon, Marie-Lise
2016-02-01
Plasmacytoid dendritic cells (pDCs) are innate sensors of viral infections and important mediators of antiviral innate immunity through their ability to produce large amounts of IFN-α. Moreover, Toll-like receptor 7 (TLR7) and 9 (TLR9) ligands, such as HIV and CpG respectively, turn pDCs into TRAIL-expressing killer pDCs able to lyse HIV-infected CD4+ T cells. NK cells can regulate antiviral immunity by modulating pDC functions, and pDC production of IFN-α as well as cell-cell contact is required to promote NK cell functions. Impaired pDC-NK cell crosstalk was reported in the setting of HIV-1 infection, but the impact of HIV-1 on TRAIL expression and innate antiviral immunity during this crosstalk is unknown. Here, we report that low concentrations of CCR5-tropic HIV-1Ba-L promote the release of pro-inflammatory cytokines such as IFN-α, TNF-α, IFN-γ and IL-12, and CCR5-interacting chemokines (MIP-1α and MIP-1β) in NK-pDCs co-cultures. At high HIV-1BaL concentrations, the addition of NK cells did not promote the release of these mediators, suggesting that once efficiently triggered by the virus, pDCs could not integrate new activating signals delivered by NK cells. However, high HIV-1BaL concentrations were required to trigger IFN-α-mediated TRAIL expression at the surface of both pDCs and NK cells during their crosstalk. Interestingly, we identified the alarmin HMGB1, released at pDC-NK cell synapse, as an essential trigger for the secretion of IFN-α and IFN-related soluble mediators during the interplay of HIV-1 exposed pDCs with NK cells. Moreover, HMGB1 was found crucial for mTRAIL translocation to the plasma membrane of both pDCs and NK cells during their crosstalk following pDC exposure to HIV-1. Data from serum analyses of circulating HMGB1, HMGB1-specific antibodies, sTRAIL and IP-10 in a cohort of 67 HIV-1+ patients argue for the in vivo relevance of these observations. Altogether, these findings identify HMGB1 as a trigger for IFN
Düster, Mathis; Becker, Martina; Gnirck, Ann-Christin; Wunderlich, Malte; Panzer, Ulf; Turner, Jan-Eric
2018-04-19
Innate lymphoid cells (ILCs) are important regulators of the immune response and play a crucial role in the restoration of tissue homeostasis after injury. GATA-3 + IL-13- and IL-5-producing group 2 innate lymphoid cells (ILC2s) have been shown to promote tissue repair in barrier organs, but despite extensive research on ILCs in the recent years, their potential role in autoimmune diseases is still incompletely understood. In the present study, we investigate the role of ILC2s in the MRL/MpJ-Fas lpr (MRL-lpr) mouse model for severe organ manifestation of systemic lupus erythematosus (SLE). We show that in these MRL-lpr mice, progression of lupus nephritis is accompanied with a reduction of ILC2 abundance in the inflamed renal tissue. Proliferation/survival and cytokine production of kidney-residing ILC2s was suppressed by IFN-γ and, to a lesser extent, by IL-27 which were produced by activated T cells and myeloid cells in the nephritic kidney, respectively. Most importantly, restoration of ILC2 numbers by IL-33-mediated expansion ameliorated lupus nephritis and prevented mortality in MRL-lpr mice. In summary, we show here that development of SLE-like kidney inflammation leads to a downregulation of the renal ILC2 response and identify an ILC2-expanding therapy as a promising treatment approach for autoimmune diseases. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lifescience Database Archive (English)
Full Text Available Immunol. 2007 Feb;37(2):306-9. (.png) (.svg) (.html) (.csml) Show TLR pathways and IFN-regulatory factors: ...ng) SVG File (.svg) HTML File (.html) CSML File (.csml) Open .csml file with CIOPlayer Open .csml file with
Directory of Open Access Journals (Sweden)
Baca Chan
2017-05-01
Full Text Available The type I interferon (IFN response is imperative for the establishment of the early antiviral immune response. Here we report the identification of the first type I IFN antagonist encoded by murine cytomegalovirus (MCMV that shuts down signaling following pattern recognition receptor (PRR sensing. Screening of an MCMV open reading frame (ORF library identified M35 as a novel and strong negative modulator of IFNβ promoter induction following activation of both RNA and DNA cytoplasmic PRR. Additionally, M35 inhibits the proinflammatory cytokine response downstream of Toll-like receptors (TLR. Using a series of luciferase-based reporters with specific transcription factor binding sites, we determined that M35 targets NF-κB-, but not IRF-mediated, transcription. Expression of M35 upon retroviral transduction of immortalized bone marrow-derived macrophages (iBMDM led to reduced IFNβ transcription and secretion upon activation of stimulator of IFN genes (STING-dependent signaling. On the other hand, M35 does not antagonize interferon-stimulated gene (ISG 56 promoter induction or ISG transcription upon exogenous stimulation of the type I IFN receptor (IFNAR. M35 is present in the viral particle and, upon MCMV infection of fibroblasts, is immediately shuttled to the nucleus where it exerts its immunomodulatory effects. Deletion of M35 from the MCMV genome and hence from the viral particle resulted in elevated type I IFN transcription and secretion in vitro and in vivo. In the absence of M35, lower viral titers are observed during acute infection of the host, and productive infection in the salivary glands was not detected. In conclusion, the M35 protein is released by MCMV immediately upon infection in order to deftly inhibit the antiviral type I IFN response by targeting NF-κB-mediated transcription. The identification of this novel viral protein reinforces the importance of timely countermeasures in the complex relationship between virus and host.
A new era for IFN-α in the treatment of Philadelphia-negative chronic myeloproliferative neoplasms
DEFF Research Database (Denmark)
Hasselbalch, H.C.
2011-01-01
In recent years, several studies have shown that IFN-α2 is able to induce molecular remissions with undetectable JAK2V617F in a subset of patients with essential thrombocythemia (ET) and polycythemia vera (PV), even with normalization of the bone marrow and sustained molecular remissions after...
Chiantore, Maria Vincenza; Mangino, Giorgio; Iuliano, Marco; Zangrillo, Maria Simona; De Lillis, Ilaria; Vaccari, Gabriele; Accardi, Rosita; Tommasino, Massimo; Fiorucci, Gianna; Romeo, Giovanna
2017-01-01
Human Papilloma Viruses (HPVs) are the causative agents of cervical cancer although other types of cancers are associated with HPV infection. Type I Interferons can interfere with HPV E6- and/or E7-dependent transformation and can affect microRNA (miRNA) expression. Cancer cells show a specific pattern of miRNA expression and HPVs are able to modulate miRNAs expressed in infected cells. Keratinocytes transduced with E6 and E7 from mucosal HPV-16 or cutaneous HPV-38 (K16 and K38) were studied to analyze the involvement of HPV oncoproteins in the anti-proliferative activity of IFN-β. In view of our previous data showing senescence induction by the cytokine in K38 cells, we observe that IFN-β treatment leads to p53-indipendent apoptosis in K16 cells whereas induces senescence in K16 cells if E6 is silenced and p53 expression is restored. The levels of selected miRNAs, deregulated in K16 and K38 cells, can be modulated by IFN-β when E6 and E7 proteins of HPV-16, but not HPV-38, are expressed. Copyright © 2015 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Riber, Ulla; Boesen, Henriette Toft; Jakobsen, Jeanne Toft
2011-01-01
The whole-blood interferon-gamma (IFN-γ) assay is a quantitative in-vitro assay for a direct read out of Ag-specific cell-mediated immune (CMI) responses to infectious diseases. The IFN-γ assay is robust in severe intracellular infections like Brucella or mycobacteria, but more difficult to evalu......The whole-blood interferon-gamma (IFN-γ) assay is a quantitative in-vitro assay for a direct read out of Ag-specific cell-mediated immune (CMI) responses to infectious diseases. The IFN-γ assay is robust in severe intracellular infections like Brucella or mycobacteria, but more difficult...
DEFF Research Database (Denmark)
Johansen, H K; Hougen, H P; Rygaard, J
1996-01-01
In a rat model of chronic Pseudomonas aeruginosa lung infection mimicking cystic fibrosis (CF), we studied whether the inflammatory response could be altered by intraperitoneal treatment with recombinant rat interferon-gamma (rrIFN-gamma). Rats were treated either before or after intratracheal ch...
Human Behaviour Analysis of Barrier Deviations Using a Benefit-Cost-Deficit Model
Directory of Open Access Journals (Sweden)
Philippe Polet
2009-01-01
Full Text Available A Benefit-Cost-Deficit (BCD model is proposed for analyzing such intentional human errors as barrier removal, the deliberate nonrespect of the rules and instructions governing use of a given system. The proposed BCD model attempts to explain and predict barrier removal in terms of the benefits, costs, and potential deficits associated with this human behaviour. The results of an experimental study conducted on a railway simulator (TRANSPAL are used to illustrate the advantages of the BCD model. In this study, human operators were faced with barriers that they could choose to deactivate, or not. Their decisions were analyzed in an attempt to explain and predict their choices. The analysis highlights that operators make their decisions using a balance between several criteria. Though barriers are safety-related elements, the decision to remove them is not guided only by the safety criterion; it is also motivated by such criteria as productivity, workload, and quality. Results of prediction supported by the BCD demonstrate the predictability of barrier violation
Undefined role of mucus as a barrier in ocular drug delivery.
Ruponen, Marika; Urtti, Arto
2015-10-01
Mucus layer covers the ocular surface, and soluble mucins are also present in the tear fluid. After topical ocular drug administration, the drugs and formulations may interact with mucus layer that may act as a barrier in ocular drug delivery. In this mini-review, we illustrate the mucin composition of the ocular surface and discuss the influence of mucus layer on ocular drug absorption. Based on the current knowledge the role of mucus barrier in drug delivery is still undefined. Furthermore, interactions with mucus may prolong the retention of drug formulations on the ocular surface. Mucus may decrease or increase ocular bioavailability depending on the magnitude of its role as barrier or retention site, respectively. Mechanistic studies are needed to clarify the role of mucin in ocular drug delivery. Copyright © 2015 Elsevier B.V. All rights reserved.
Villar-Hernández, Raquel; Latorre, Irene; Mínguez, Sonia; Díaz, Jéssica; García-García, Esther; Muriel-Moreno, Beatriz; Lacoma, Alicia; Prat, Cristina; Olivé, Alex; Ruhwald, Morten; Mateo, Lourdes; Domínguez, José
2017-10-01
Biologic agents are used against rheumatic diseases, however, they increase the risk of developing severe infections and diseases such as tuberculosis. We aimed to determine the benefits of IP-10 detection to diagnose latent tuberculosis infection (LTBI) in patients with inflammatory rheumatic diseases on different immunosuppressive drug regimens, and compare these results with IFN-γ detection. We included 64 patients with inflammatory rheumatic diseases. We used QuantiFERON Gold In-Tube (QFN-G-IT) and T-SPOT.TB to detect IFN-γ production, and an in-house ELISA for IP-10 detection from the previous QFN-G-IT stimulated samples. We assessed the combined use of IFN-γ release assays (IGRAs) and IP-10 test, and analyzed the influence of immunotherapy on the tests performance. We obtained 34.9% positive results by T-SPOT.TB, 25.0% by QFN-G-IT and 31.3% by IP-10 test. The combined use of IGRAs and IP-10 detection increased significantly the amount of positive results (p 0.05). IP-10 and IFN-γ detection is comparable and their combined use could increase the number of positive results in the diagnosis of LTBI in rheumatic patients. The tested assays were not influenced by rheumatoid immunosuppressive therapy. Thus, IP-10 could be of use in the development of new and improved LTBI diagnostic tools. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Elisandra Grangeiro de Carvalho
Full Text Available The protective immunity of natural killer (NK cells against malarial infections is thought to be due to early production of type II interferon (IFN and possibly direct NK cell cytotoxicity. To better understand this mechanism, a microarray analysis was conducted on NK cells from healthy donors PBMCs that were co-cultured with P. falciparum 3D7-infected erythrocytes. A very similar pattern of gene expression was observed among all donors for each treatment in three replicas. Parasites particularly modulated genes involved in IFN-α/β signaling as well as molecules involved in the activation of interferon regulatory factors, pathways known to play a role in the antimicrobial immune response. This pattern of transcription was entirely different from that shown by NK cells treated with IL-12 and IL-18, in which IFN-γ- and TREM-1-related genes were over-expressed. These results suggest that P. falciparum parasites and the cytokines IL-12 and IL-18 have diverse imprints on the transcriptome of human primary NK cells. IFN-α-related genes are the prominent molecules induced by parasites on NK cells and arise as candidate biomarkers that merit to be further investigated as potential new tools in malaria control.
Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade
2006-01-01
Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306
DEFF Research Database (Denmark)
Riber, Ulla; Jakobsen, Jeanne Toft; Hvass, Henriette Cordes
Lawsonia intracellularis is an obligate intracellular bacteria causing proliferative enteropathy (PE) in pigs. The infection causes diarrhoea, retarded growth and sudden death in pigs and is one of the most economically important diseases in the swine industry worldwide. The infection is one...... indications that cell-mediated immune responses (CMI) are important for the protection against infections with L. intracellularis and in mice models IFN-γ has been shown to play a key role in the host defence against experimental infections . In L. intracellularis infected pigs, IFN-γ is only sparsely...
45 CFR 1170.13 - Illustrative examples.
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Illustrative examples. 1170.13 Section 1170.13... ASSISTED PROGRAMS OR ACTIVITIES Discrimination Prohibited § 1170.13 Illustrative examples. (a) The following examples will illustrate the application of the foregoing provisions to some of the activities...
Kim, Ji Hyung; Oh, Sae Jin; Ahn, Sehee; Chung, Doo Hyun
2014-07-01
A role for NKT cells has been implicated in sepsis, but the mechanism by which NKT cells contribute to sepsis remains unclear. Here, we examined WT and NKT-cell-deficient mice of C57BL/6 background during cecal ligation and puncture-induced sepsis. The levels of C5a, IFN-γ, and IL-10 were higher in the serum and peritoneal fluid of WT mice than in those of CD1d(-/-) mice, while the mortality rate was lower in CD1d(-/-) mice than in WT mice. C5a blockade decreased mortality of WT mice during sepsis, whereas it did not alter that of CD1d(-/-) mice. As assessed by intracellular staining, NKT cells expressed IFN-γ, while neutrophils expressed IL-10. Upon coculture, IL-10-deficient NKT cells enhanced IL-10 production by WT, but not IFN-γR-deficient, neutrophils. Meanwhile, CD1d(-/-) mice exhibited high CD55 expression on neutrophils during sepsis, whereas those cells from WT mice expressed minimal levels of CD55. Recombinant IL-10 administration into CD1d(-/-) mice reduced CD55 expression on neutrophils. Furthermore, adoptive transfer of sorted WT, but not IFN-γ-deficient, NKT cells into CD1d(-/-) mice suppressed CD55 expression on neutrophils, but increased IL-10 and C5a levels. Taken together, IFN-γ-producing NKT cells enhance C5a generation via IL-10-mediated inhibition of CD55 expression on neutrophils, thereby exacerbating sepsis. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bustamante, Jacinta; Boisson-Dupuis, Stéphanie; Abel, Laurent; Casanova, Jean-Laurent
2014-01-01
Mendelian susceptibility to mycobacterial disease (MSMD) is a rare condition characterized by predisposition to clinical disease caused by weakly virulent mycobacteria, such as BCG vaccines and environmental mycobacteria, in otherwise healthy individuals with no overt abnormalities in routine hematological and immunological tests. MSMD designation does not recapitulate all the clinical features, as patients are also prone to salmonellosis, candidiasis and tuberculosis, and more rarely to infections with other intramacrophagic bacteria, fungi, or parasites, and even, perhaps, a few viruses. Since 1996, nine MSMD-causing genes, including seven autosomal (IFNGR1, IFNGR2, STAT1, IL12B, IL12RB1, ISG15, and IRF8) and two X-linked (NEMO, CYBB) genes have been discovered. The high level of allelic heterogeneity has already led to the definition of 18 different disorders. The nine gene products are physiologically related, as all are involved in IFN-γ-dependent immunity. These disorders impair the production of (IL12B, IL12RB1, IRF8, ISG15, NEMO) or the response to (IFNGR1, IFNGR2, STAT1, IRF8, CYBB) IFN-γ. These defects account for only about half the known MSMD cases. Patients with MSMD-causing genetic defects may display other infectious diseases, or even remain asymptomatic. Most of these inborn errors do not show complete clinical penetrance for the case-definition phenotype of MSMD. We review here the genetic, immunological, and clinical features of patients with inborn errors of IFN-γ-dependent immunity. PMID:25453225
Gifford, Wendy A; Graham, Ian D; Davies, Barbara L
2013-07-01
Understanding the types of barriers that exist when implementing change can assist healthcare managers to tailor implementation strategies for optimal patient outcomes. The aim of this paper is to present an organising framework, the Barriers Assessment Taxonomy, for understanding barriers to nurses' use of clinical practice guideline recommendations. Barriers to recommendations are illustrated using the Barriers Assessment Taxonomy and insights discussed. As part of a pilot implementation study, semi-structured interviews (n = 26) were conducted to understand barriers to nurses' use of nine guideline recommendations for diabetic foot ulcers. Content analysis of verbatim transcripts included thematic coding and categorising barriers using the Barriers Assessment Taxonomy. Nineteen barriers were associated with nine recommendations, crossing five levels of the health care delivery system. The Barriers Assessment Taxonomy revealed that all recommendations had individual and organisational level barriers, with one recommendation having barriers at all levels. Individual level barriers were most frequent and lack of knowledge and skills was the only barrier that crossed all recommendations. The Barriers Assessment Taxonomy provides a framework for nursing managers to understand the complexity of barriers that exist, and can assist in choosing intervention strategies to support improved quality care and patient outcomes. © 2013 John Wiley & Sons Ltd.
Market and policy barriers for demand response providing ancillary services in U.S. markets
Energy Technology Data Exchange (ETDEWEB)
Cappers, Peter [Lawrence Berkeley National Laboratory (LBNL), Berkeley, CA (United States); MacDonald, Jason [Lawrence Berkeley National Laboratory (LBNL), Berkeley, CA (United States); Goldman, Charles [Lawrence Berkeley National Laboratory (LBNL), Berkeley, CA (United States)
2013-03-01
This study provides an examination of various market and policy barriers to demand response providing ancillary services in both ISO/RTO and non-ISO/RTO regions, especially at the program provider level. It is useful to classify barriers in order to create a holistic understanding and identify parties that could be responsible for their removal. This study develops a typology of barriers focusing on smaller customers that must rely on a program provider (i.e., electric investor owned utility or IOU, ARC) to create an aggregated DR resource in order to bring ancillary services to the balancing authority. The barriers were identified through examinations of regulatory structures, market environments, and product offerings; and discussions with industry stakeholders and regulators. In order to help illustrate the differences in barriers among various wholesale market designs and their constituent retail environments, four regions were chosen to use as case studies: Colorado, Texas, Wisconsin, and New Jersey.
Market and Policy Barriers for Demand Response Providing Ancillary Services in U.S. Markets
Energy Technology Data Exchange (ETDEWEB)
Cappers, Peter [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); MacDonald, Jason [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Goldman, Charles [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)
2013-03-01
In this study, we attempt to provide a comprehensive examination of various market and policy barriers to demand response providing ancillary services in both ISO/RTO and non-ISO/RTO regions, especially at the program provider level. It is useful to classify barriers in order to create a holistic understanding and identify parties that could be responsible for their removal. This study develops a typology of barriers focusing on smaller customers that must rely on a program provider (i.e., electric investor owned utility or IOU, ARC) to create an aggregated DR resource in order to bring ancillary services to the balancing authority.ii The barriers were identified through examinations of regulatory structures, market environments, and product offerings; and discussions with industry stakeholders and regulators. In order to help illustrate the differences in barriers among various wholesale market designs and their constituent retail environments, four regions were chosen to use as case studies: Colorado, Texas, Wisconsin, and New Jersey. We highlight the experience in each area as it relates to the identified barriers.
Using organizational influence processes to overcome IS implementation barriers
DEFF Research Database (Denmark)
Ngwenyama, Ojelanki; Nielsen, Peter Axel
2014-01-01
A fundamental tenet of the information systems (IS) discipline holds that: (a) a lack of formal power and influence over the organization targeted for change, (b) weak support from top management, and (c) organizational memories of prior failures are barriers to implementation success. Our research......, informed by organization influence, compellingly illustrates that such conditions do not necessarily doom a project to failure. In this paper, we present an analysis of how an IS implementation team designed and enacted a coordinated strategy of organizational influence to achieve implementation success...... despite these barriers. Our empirical analysis also found that technology implementation and change is largely an organizational influence process (OIP), and thus technical-rational approaches alone are inadequate for achieving success. Our findings offer managers important insights into how they can...
Ebi3 Prevents Trypanosoma cruzi-Induced Myocarditis by Dampening IFN-γ-Driven Inflammation
Directory of Open Access Journals (Sweden)
Tiago Silva Medina
2017-09-01
Full Text Available The identification of anti-inflammatory mediators can reveal important targetable molecules capable of counterbalancing Trypanosoma cruzi-induced myocarditis. Composed of Ebi3 and IL-27p28 subunits, IL-27 is produced by myeloid cells and is able to suppress inflammation by inducing IL-10-producing Tr1 cells, thus emerging as a potential candidate to ameliorate cardiac inflammation induced by T. cruzi. Although IL-27 has been extensively characterized as a suppressive cytokine that prevents liver immunopathogenesis after T. cruzi infection, the mechanisms underlying its effects on T. cruzi-induced myocarditis remain largely unknown. Here, wild-type (WT and Ebi3-deficient animals were intraperitoneally infected with trypomastigotes of T. cruzi Y strain and used to evaluate the potential anti-inflammatory properties of Ebi3 during T. cruzi infection. The survival rates of mice were daily recorded, the frequency of inflammatory cells was analyzed by flow cytometry and inflammatory mediators were measured by ELISA, real-time PCR and PCR array. We reported that T. cruzi-induced myocarditis was prevented by Ebi3. Stressors mainly recognized by TLR2 and TLR4 receptors on myeloid cells were essential to trigger IL-27p28 production. In addition, Ebi3 regulated IFN-γ-mediated myocarditis by promoting an anti-inflammatory environment through IL-10, which was most likely produced by Tr1 cells rather than classical regulatory T cells (Tregs, in the heart tissue of T. cruzi-infected animals. Furthermore, in vivo IFN-γ blockade ameliorated the host survival without compromising the parasite control in the bloodstream. In humans, IL-27p28 was correlated with cardiac protection during Chagas disease. Patients with mild clinical forms of the disease produced high levels of IL-27p28, whereas lower levels were found in those with severe forms. In addition, polymorphic sites at Ebi3 gene were associated with severe cardiomyopathy in patients with Chagas disease
Ebi3 Prevents Trypanosoma cruzi-Induced Myocarditis by Dampening IFN-γ-Driven Inflammation
Medina, Tiago Silva; Oliveira, Gabriela Gonçalves; Silva, Maria Cláudia; David, Bruna Araújo; Silva, Grace Kelly; Fonseca, Denise Morais; Sesti-Costa, Renata; Frade, Amanda Farage; Baron, Monique Andrade; Ianni, Barbara; Pereira, Alexandre Costa; Chevillard, Christophe; Cunha-Neto, Edécio; Marin-Neto, José Antonio; Silva, João Santana
2017-01-01
The identification of anti-inflammatory mediators can reveal important targetable molecules capable of counterbalancing Trypanosoma cruzi-induced myocarditis. Composed of Ebi3 and IL-27p28 subunits, IL-27 is produced by myeloid cells and is able to suppress inflammation by inducing IL-10-producing Tr1 cells, thus emerging as a potential candidate to ameliorate cardiac inflammation induced by T. cruzi. Although IL-27 has been extensively characterized as a suppressive cytokine that prevents liver immunopathogenesis after T. cruzi infection, the mechanisms underlying its effects on T. cruzi-induced myocarditis remain largely unknown. Here, wild-type (WT) and Ebi3-deficient animals were intraperitoneally infected with trypomastigotes of T. cruzi Y strain and used to evaluate the potential anti-inflammatory properties of Ebi3 during T. cruzi infection. The survival rates of mice were daily recorded, the frequency of inflammatory cells was analyzed by flow cytometry and inflammatory mediators were measured by ELISA, real-time PCR and PCR array. We reported that T. cruzi-induced myocarditis was prevented by Ebi3. Stressors mainly recognized by TLR2 and TLR4 receptors on myeloid cells were essential to trigger IL-27p28 production. In addition, Ebi3 regulated IFN-γ-mediated myocarditis by promoting an anti-inflammatory environment through IL-10, which was most likely produced by Tr1 cells rather than classical regulatory T cells (Tregs), in the heart tissue of T. cruzi-infected animals. Furthermore, in vivo IFN-γ blockade ameliorated the host survival without compromising the parasite control in the bloodstream. In humans, IL-27p28 was correlated with cardiac protection during Chagas disease. Patients with mild clinical forms of the disease produced high levels of IL-27p28, whereas lower levels were found in those with severe forms. In addition, polymorphic sites at Ebi3 gene were associated with severe cardiomyopathy in patients with Chagas disease. Collectively, we
Hoeksema, Marten A.; Scicluna, Brendon P.; Boshuizen, Marieke C. S.; van der Velden, Saskia; Neele, Annette E.; van den Bossche, Jan; Matlung, Hanke L.; van den Berg, Timo K.; Goossens, Pieter; de Winther, Menno P. J.
2015-01-01
Macrophages form a heterogeneous population of immune cells, which is critical for both the initiation and resolution of inflammation. They can be skewed to a proinflammatory subtype by the Th1 cytokine IFN-γ and further activated with TLR triggers, such as LPS. In this work, we investigated the
DEFF Research Database (Denmark)
Buus, Terkild Brink; Ødum, Niels; Geisler, Carsten
2017-01-01
-producing γδ T cells (γδNKT). Developmental progression towards both IFN-γ-producing subsets can be induced by TCR signalling, and each pathway results in thymic emigration at a different stage. Finally, we show that γδT1 cells are the predominating IFN-γ-producing subset developing in the adult thymus. Thus......, this study maps out three distinct development pathways that result in the programming of γδTn, γδT1 and γδNKT cells.......Murine γδ T cells include subsets that are programmed for distinct effector functions during their development in the thymus. Under pathological conditions, different γδ T cell subsets can be protective or can exacerbate a disease. Here we show that CD117, CD200 and CD371, together with other...
Directory of Open Access Journals (Sweden)
Guardasoni C.
2018-03-01
Full Text Available A Semi-Analytical method for pricing of Barrier Options (SABO is presented. The method is based on the foundations of Boundary Integral Methods which is recast here for the application to barrier option pricing in the Black-Scholes model with time-dependent interest rate, volatility and dividend yield. The validity of the numerical method is illustrated by several numerical examples and comparisons.
Biswas, Aritra; Gupta, Nabyendu; Gupta, Debanjali; Datta, Abira; Firdaus, Rushna; Chowdhury, Prosanto; Bhattacharyya, Maitreyee; Sadhukhan, Provash C
2018-06-01
Multitransfused thalassemic individuals are at high risk of developing transfusion transmitted Hepatitis C virus (HCV) infection. The aim of the study was to correlate the effects of host cytokine single nucleotide polymorphisms of TNF-α (-308 A/G) and IFN-γ (+874 A/T) in spontaneous or IFN induced treatment response in the HCV infected thalassemic individuals. A total of 427 HCV sero-reactive thalassemic individuals were processed for HCV viral genomic diversity and host gene polymorphisms analysis of TNF-α (-308 A/G) and IFN-γ (+874 A/T). Out of 427 HCV sero-reactive individuals, 69.09% were found to be HCV RNA positive with genotype 3 as the predominant infecting strain (94.29%). Study highlighted that, A allele was significantly associated with (p < .05) spontaneous clearance of HCV infection and G allele was correlated with viral persistence at TNF-α (-308) gene polymorphism. Whereas in case of IFN-γ (+874) SNPs, A allele was significantly responsible (p < .05) for spontaneous clearance than T allele. Our study also indicated that in relapsed cases, IFN-γ (+874) T allele is more responsible than A allele. Though no significant correlation was found at both TNF-α (-308) and IFN-γ (+874) gene polymorphism among SVR and relapsed thalassemic patients. A allele at both TNF-α (-308) and IFN-γ (+874) were strongly associated with spontaneous clearance among this population. But in case of SVR and relapsed cases no significant association was found. This cytokine gene polymorphisms pattern will help clinicians to take an informed decision about therapeutic management of HCV infected thalassemic individuals. Copyright © 2017 Elsevier Ltd. All rights reserved.
Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis
International Nuclear Information System (INIS)
Svenson, Ola
2000-02-01
The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses
Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis
Energy Technology Data Exchange (ETDEWEB)
Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology
2000-02-01
The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.
A spectral blanking-out controller for demonstration of information barrier technology
International Nuclear Information System (INIS)
Liu Suping; Gong Jian; Hu Guangchun; Zhang Jianhua
2006-01-01
Information barrier technology has become more and more important in the R and D of radiation fingerprint verification associated with classified items such as nuclear warheads, nuclear components and military-used nuclear materials. The function of information barriers is two-fold: one is to prevent the classified information from leaking out; the other is to provide creditable verification. To fulfill these two functions, the information barriers for a viable verification system (including all its hardware and software) must be designed on the basic principles of protecting classified information and the ability to authenticate. The Spectral Blanking-out Controller (SBC) is developed to illustrate the two functions of the information barriers and to explore some practice measures to meet the required design fundamentals. This paper briefs the task assigned to the SBC, the specific design concerns and the practical information barrier measures. The R and D of the SBC embodies the concepts of information barrier technology and has to conform to the basic guidelines: If a verification system is expected to possess strict information barriers, the design of the system must be integrative with due considerations given to the factors such as the efficiency of the verification technique, the possible measures to protect the classified information from directly or indirectly leaking out, the complete openness in all aspects of the system for the inspectors to authenticate the system for the sake of achieving certain degree of confidence on the verification results. (authors)
Kim, Ji Hyung; Chung, Doo Hyun
2011-02-01
Immune complex-induced acute lung injury (IC-ALI) has been implicated in various pulmonary disease states. However, the role of NKT cells in IC-ALI remains unknown. Therefore, we explored NKT cell functions in IC-ALI using chicken egg albumin and anti-chicken egg albumin IgG. The bronchoalveolar lavage fluid of CD1d(-/-) and Jα18(-/-) mice contained few Ly6G(+)CD11b(+) granulocytes, whereas levels in B6 mice were greater and were increased further by α-galactosyl ceramide. IFN-γ and MIP-1α production in the lungs was greater in B6 than CD1d(-/-) mice. Adoptive transfer of wild type (WT) but not IFN-γ-, MIP-1α-, or FcγR-deficient NKT cells into CD1d(-/-) mice caused recruitment of inflammatory cells to the lungs. Moreover, adoptive transfer of IFN-γR-deficient NKT cells enhanced MIP-1α production and cell recruitment in the lungs of CD1d(-/-) or CD1d(-/-)IFN-γ(-/-) mice, but to a lesser extent than WT NKT cells. This suggests that IFN-γ-producing NKT cells enhance MIP-1α production in both an autocrine and a paracrine manner. IFN-γ-deficient NKT cells induced less IL-1β and TNF-α production by alveolar macrophages and dendritic cells in CD1d(-/-) mice than did WT NKT cells. Taken together, these data suggest that CD1d-restricted IFN-γ-producing NKT cells promote IC-ALI by producing MIP-1α and enhancing proinflammatory cytokine production by alveolar macrophages and dendritic cells.
Pierkes, M; Bellinghausen, I; Hultsch, T; Metz, G; Knop, J; Saloga, J
1999-02-01
Recent studies provide evidence that venom immunotherapy (VIT) alters the pattern of cytokine production by inducing an allergen-specific T-cell shift in cytokine expression from TH2 (IL-4, IL-5) to TH1 (IFN-gamma) cytokines and also inducing the production of IL-10. This study was carried out to analyze whether these changes in cytokine production of T cells already observed 1 week after the initiation of VIT in subjects with wasp venom allergy also influence the reactivity of effector cells, such as mast cells and basophils. All subjects included in this study had a history of severe systemic allergic reactions to wasp stings and positive skin test responses with venom and venom-specific IgE in the sera. Peripheral blood leukocytes were isolated before and after the initiation of VIT (rush therapy reaching a maintenance dose of 100 microg venom injected subcutaneously within 1 week) and preincubated with or without addition of IL-10, IFN-gamma, IL-10 + IFN-gamma, anti-IL-10, or anti-IFN-gamma. After stimulation with wasp venom, histamine and sulfidoleukotriene release were assessed by ELISA and compared with spontaneous release and total histamine content. After the induction of VIT, venom-induced absolute and relative histamine and sulfidoleukotriene release were reduced. This was at least partially due to the induction of IFN-gamma and IL-10 production, because (1) neutralization of IL-10 and IFN-gamma by mAbs partially restored the release after the initiation of VIT and (2) the addition of exogenous IFN-gamma and IL-10 caused a statistically significant diminution of the venom-induced histamine and sulfidoleukotriene release before VIT. Depletion of CD2(+) T cells also restored the releasability after VIT. These data indicate that T cells (producing IL-10 and IFN-gamma after VIT) play a key role for the inhibition of histamine and sulfidoleukotriene release of effector cells.
Directory of Open Access Journals (Sweden)
Daniel P Harris
Full Text Available Inflammatory agonists differentially activate gene expression of the chemokine family of proteins in endothelial cells (EC. TNF is a weak inducer of the chemokine CXCL11, while TNF and IFN-γ costimulation results in potent CXCL11 induction. The molecular mechanisms underlying TNF plus IFN-γ-mediated CXCL11 induction are not fully understood. We have previously reported that the protein arginine methyltransferase PRMT5 catalyzes symmetrical dimethylation of the NF-κB subunit p65 in EC at multiple arginine residues. Methylation of Arg30 and Arg35 on p65 is critical for TNF induction of CXCL10 in EC. Here we show that PRMT5-mediated methylation of p65 at Arg174 is required for induction of CXCL11 when EC are costimulated with TNF and IFN-γ. Knockdown of PRMT5 by RNAi reduced CXCL11 mRNA and protein levels in costimulated cells. Reconstitution of p65 Arg174Ala or Arg174Lys mutants into EC that were depleted of endogenous p65 blunted TNF plus IFN-γ-mediated CXCL11 induction. Mass spectrometric analyses showed that p65 Arg174 arginine methylation is enhanced by TNF plus IFN-γ costimulation, and is catalyzed by PRMT5. Chromatin immunoprecipitation assays (ChIP demonstrated that PRMT5 is necessary for p65 association with the CXCL11 promoter in response to TNF plus IFN-γ. Further, reconstitution of p65 Arg174Lys mutant in EC abrogated this p65 association with the CXCL11 promoter. Finally, ChIP and Re-ChIP assays revealed that symmetrical dimethylarginine-containing proteins complexed with the CXCL11 promoter were diminished in p65 Arg174Lys-reconstituted EC stimulated with TNF and IFN-γ. In total, these results indicate that PRMT5-mediated p65 methylation at Arg174 is essential for TNF plus IFN-γ-mediated CXCL11 gene induction. We therefore suggest that the use of recently developed small molecule inhibitors of PRMT5 may present a therapeutic approach to moderating chronic inflammatory pathologies.
Gagnon, R; Akoum, A; Hébert, J
1993-04-01
The reciprocal effects of IL-4 and IFN-gamma on IgE synthesis have been well established. It has also been shown that these two lymphokines are secreted by different subsets of CD4+ T cells (TH1 and TH2), and that TH2 helper T lymphocytes could be involved in the pathophysiology of allergic diseases. But little is known about the effects of an allergen on the profile of lymphokine synthesis by human peripheral blood mononuclear cells (PBMCs) of allergic and nonallergic subjects. We studied the production of IL-4 and IFN-gamma by PBMCs of atopic and nonatopic donors after in vitro stimulation by the group 1 allergen from Lolium perenne pollen (Lol p I), during and out of the grass pollen season. On natural exposure to pollen, Lol p I-induced IL-4 production was observed only with atopic donors (6 of 8), whereas the synthesis of IFN-gamma was observed for all nonatopic donors (7 of 7) and most allergic patients (5 of 7). At the time of the study, higher amounts of IFN-gamma were produced by PBMCs of nonatopic donors than by PBMCs of atopic patients. Out of the pollen season the production of IL-4 was not observed either by atopic (n = 11) or by nonatopic subjects (n = 5). On the other hand, IFN-gamma was produced by PBMCs of most subjects (atopic, 10 of 11; nonatopic, 5 of 5), but at the time of the study no difference was observed between the two groups. These results show that Lol p I induces different profiles of IL-4 and IFN-gamma production by PBMCs of atopic and nonatopic subjects. In atopic subjects this profile of lymphokine synthesis is influenced by the natural exposure to pollen, which is in keeping with the seasonal rise of IgE antibodies.
Chen, Mao-Liang; Tsai, Tzung-Chieh; Wang, Lu-Kai; Lin, Yi-Yin; Tsai, Ya-Min; Lee, Ming-Cheng; Tsai, Fu-Ming
2012-08-01
Antipsychotic drugs (APDs) are widely used to alleviate a number of psychic disorders and may have immunomodulatory effects. However, the previous studies of cytokine and immune regulation in APDs are quite inconsistent. The aim of this study was to examine the in vitro effects of different ADPs on cytokine production by peripheral blood mononuclear cells (PBMCs). We examined the effects of risperidone, clozapine, and haloperidol on the production of phorbol myristate acetate and ionomycin-induced interferon-γ (IFN-γ)/interleukin (IL)-4 in PBMCs by using intracellular staining. Real-time quantitative PCR and Western blot were used to further examine the expression changes of some critical transcription factors related to T-cell differentiation in antipsychotic-treated PBMCs. Our results indicated that clozapine can suppress the stimulated production of IFN-γ by 30.62%, whereas haloperidol weakly enhances the expression of IFN-γ. Differences in IL-4 production or in the number of CD4+ T cells were not observed in cells treated with different APDs. Furthermore, clozapine and risperidone inhibited the T-bet mRNA and protein expression, which are critical to Th1 differentiation. Also, clozapine can enhance the expression of Signal Transducer and Activator of Transcription 6 and GATA3, which are critical for the differentiation of Th2 cells. The results suggested that clozapine and haloperidol may induce different immunomodulatory effects on the immune system.
Directory of Open Access Journals (Sweden)
Jiang Weimin
2009-05-01
Full Text Available Abstract Background An accurate test for Mycobacterium tuberculosis infection is urgently needed in immunosuppressed populations. The aim of this study was to investigate the diagnostic power of enzyme-linked immunospot (ELISPOT-based IFN-γ release assay in detecting active and latent tuberculosis in HIV-infected population in bacillus Calmette-Guerin (BCG-vaccinated area. A total of 100 HIV-infected individuals including 32 active tuberculosis patients were recruited. An ELISPOT-based IFN-γ release assay, T-SPOT.TB, was used to evaluate the M. tuberculosis ESAT-6 and CFP-10 specific IFN-γ response. Tuberculin skin test (TST was performed for all recruited subjects. Results The subjects were divided into group HIV+ATB (HIV-infected individuals with active tuberculosis, n = 32, group HIV+LTB (HIV-infected individuals with positive results of T-SPOT.TB assay, n = 46 and group HIV only (HIV-infected individuals with negative results of T-SPOT.TB assay and without evidence of tuberculosis infection, n = 22. In group HIV+ATB and HIV+LTB, T-SPOT.TB positive rate in subjects with TST P 85% in patients with TB treatment for less than 1 month and CD4+ T cells ≥200/μl, while for patients treated for more than 3 months and CD4+ T cells Conclusion ELISPOT-based IFN-γ release assay is more sensitive and rapid for the diagnosis of TB infection in Chinese HIV-infected individuals with history of BCG vaccination, and could be an effective tool for guiding preventive treatment with isoniazid in latently infected people and for TB control in China.
Professional representation and the free-lance medical illustrator.
Mount, K N; Daugherty, J
1994-01-01
We researched factors related to the success or failure in working relationships between free-lance medical illustrators and artist's representatives. In the fall of 1992, surveys were mailed to 230 medical illustrators; 105 (46%) completed surveys were returned. Respondents were divided into three categories: 1) medical illustrators currently represented, 2) medical illustrators previously represented, and 3) medical illustrators who had never been represented. Comparisons made among illustrators from the three groups included business practices, clientele, experience, and self-promotion techniques. These comparisons revealed notable differences and similarities between the three groups and were subsequently analyzed to identify the characteristics of medical illustrators who would benefit from professional representation.
How Barriers to Collaboration Prevent Progress in Demand for Knowledge
DEFF Research Database (Denmark)
Goduscheit, René Chester; Knudsen, Mette Præst
2015-01-01
(RTOs) as potential mediators of collaboration between SMEs and universities. On the basis of a unique sample consisting of 151 SMEs, RTOs and universities from seven countries, the differences across dyads of potential collaborations are identified. In particular, the article finds that both firms...... and universities with collaboration experience with the other partner in general perceive higher barriers than inexperienced firms or universities. In terms of the mediating role of RTOs, the article illustrates that universities perceive lower barriers when collaborating with RTOs than with SMEs. A similar...... tendency to a mediating role of RTOs can be found among the SMEs' perception of university collaboration. Finally, the analysis shows that the knowledge institutions perceive the SMEs as very important collaboration partners, but the same sense of importance is not shared by the SMEs regarding...
New World hantaviruses activate IFNlambda production in type I IFN-deficient vero E6 cells.
Directory of Open Access Journals (Sweden)
Joseph Prescott
Full Text Available Hantaviruses indigenous to the New World are the etiologic agents of hantavirus cardiopulmonary syndrome (HCPS. These viruses induce a strong interferon-stimulated gene (ISG response in human endothelial cells. African green monkey-derived Vero E6 cells are used to propagate hantaviruses as well as many other viruses. The utility of the Vero E6 cell line for virus production is thought to owe to their lack of genes encoding type I interferons (IFN, rendering them unable to mount an efficient innate immune response to virus infection. Interferon lambda, a more recently characterized type III IFN, is transcriptionally controlled much like the type I IFNs, and activates the innate immune system in a similar manner.We show that Vero E6 cells respond to hantavirus infection by secreting abundant IFNlambda. Three New World hantaviruses were similarly able to induce IFNlambda expression in this cell line. The IFNlambda contained within virus preparations generated with Vero E6 cells independently activates ISGs when used to infect several non-endothelial cell lines, whereas innate immune responses by endothelial cells are specifically due to viral infection. We show further that Sin Nombre virus replicates to high titer in human hepatoma cells (Huh7 without inducing ISGs.Herein we report that Vero E6 cells respond to viral infection with a highly active antiviral response, including secretion of abundant IFNlambda. This cytokine is biologically active, and when contained within viral preparations and presented to human epithelioid cell lines, results in the robust activation of innate immune responses. We also show that both Huh7 and A549 cell lines do not respond to hantavirus infection, confirming that the cytoplasmic RNA helicase pathways possessed by these cells are not involved in hantavirus recognition. We demonstrate that Vero E6 actively respond to virus infection and inhibiting IFNlambda production in these cells might increase their utility
Reduced IFN-γ and IL-10 responses to paternal antigens during and after pregnancy in allergic women.
Persson, Marie; Ekerfelt, Christina; Ernerudh, Jan; Matthiesen, Leif; Abelius, Martina Sandberg; Jonsson, Yvonne; Berg, Göran; Jenmalm, Maria C
2012-09-01
Normal pregnancy and allergy are both characterized by a T helper (Th) 2 deviation. In the current study, we hypothesized that paternal antigen-induced cytokine responses during pregnancy would be deviated toward Th2 and an anti-inflammatory profile, and that the Th2 deviation would be more pronounced in allergic pregnant women. Blood samples were collected longitudinally on three occasions during pregnancy and two occasions post partum (pp). Of the 86 women initially included, 54 women had a normal pregnancy and completed the sampling procedures. Twelve women fulfilled the criteria for allergy (allergic symptoms and circulating immunoglobulin [Ig] E antibodies to inhalant allergens) and 20 were non-allergic (nonsensitized without symptoms). The levels of Th1- and Th2-associated cytokines and chemokines, the Th17 cytokine IL-17 and the anti-inflammatory cytokine IL-10 of the groups were compared. Paternal antigen-induced IL-4 and IL-10 responses increased between the first and the third trimester. Allergy was associated with decreased paternal antigen-induced IFN-γ and CXCL10 secretion in the nonpregnant state (one year pp) and also decreased IFN-γ/IL-4 and IFN-γ/IL-13 ratios during pregnancy. We also observed a decreased paternal antigen-induced IL-10 response in allergic compared with non-allergic women during pregnancy, along with a decreased IL-10/IL-13 ratio. In conclusion, our findings support the hypothesis of lower Th1 responses toward paternal antigens in allergic than in non-allergic women, but also indicate that allergy is associated with a lower capacity to induce anti-inflammatory IL-10 responses after paternal antigen stimulation during pregnancy. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Erdenebileg Uyangaa
Full Text Available Type I interferon (IFN-I-dependent orchestrated mobilization of innate cells in inflamed tissues is believed to play a critical role in controlling replication and CNS-invasion of herpes simplex virus (HSV. However, the crucial regulators and cell populations that are affected by IFN-I to establish the early environment of innate cells in HSV-infected mucosal tissues are largely unknown. Here, we found that IFN-I signaling promoted the differentiation of CCL2-producing Ly-6Chi monocytes and IFN-γ/granzyme B-producing NK cells, whereas deficiency of IFN-I signaling induced Ly-6Clo monocytes producing CXCL1 and CXCL2. More interestingly, recruitment of Ly-6Chi monocytes preceded that of NK cells with the levels peaked at 24 h post-infection in IFN-I-dependent manner, which was kinetically associated with the CCL2-CCL3 cascade response. Early Ly-6Chi monocyte recruitment was governed by CCL2 produced from hematopoietic stem cell (HSC-derived leukocytes, whereas NK cell recruitment predominantly depended on CC chemokines produced by resident epithelial cells. Also, IFN-I signaling in HSC-derived leukocytes appeared to suppress Ly-6Ghi neutrophil recruitment to ameliorate immunopathology. Finally, tissue resident CD11bhiF4/80hi macrophages and CD11chiEpCAM+ dendritic cells appeared to produce initial CCL2 for migration-based self-amplification of early infiltrated Ly-6Chi monocytes upon stimulation by IFN-I produced from infected epithelial cells. Ultimately, these results decipher a detailed IFN-I-dependent pathway that establishes orchestrated mobilization of Ly-6Chi monocytes and NK cells through CCL2-CCL3 cascade response of HSC-derived leukocytes and epithelium-resident cells. Therefore, this cascade response of resident-to-hematopoietic-to-resident cells that drives cytokine-to-chemokine-to-cytokine production to recruit orchestrated innate cells is critical for attenuation of HSV replication in inflamed tissues.
The Blood-Brain Barrier: Connecting the Gut and the Brain
Banks, William A.
2008-01-01
The BBB prevents the unrestricted exchange of substances between the central nervous system (CNS) and the blood. The blood-brain barrier (BBB) also conveys information between the CNS and the gastrointestinal (GI) tract through several mechanisms. Here, we review three of those mechanisms. First, the BBB selectively transports some peptides and regulatory proteins in the blood-to-brain or the brain-to-blood direction. The ability of GI hormones to affect functions of the BBB, as illustrated b...
International Nuclear Information System (INIS)
Wang Yuhua; Ma Zhijun; Zhao Hong; Zhi Fenyong; Sun Zhijian
2010-01-01
To investigate the changes and pathogenic significance of serum interleukin-12p70(IL-12), interferon γ(IFN γ) and IL-4 in patients with hemorrhagic fever with renal syndrome (HFRS), 44 patients were divided into moderate group (20 cases) and severe group (24 cases) according to the severity of illness. The serum levels of IL-12 and IFN γ were detected by enzyme-linked immunosorbent assay, serum IL-4 was tested by radioimmunoassay, blood urea nitrogen (BUN) and platelet were measured by automatic biochemical analyzer and blood analyze. The results showed that the serum levels of IL-12 significantly increased during the first stages of HFRS compared with control group (0.56±0.10μg/L), with a peak value(1.42±1.10μg/L) in moderate group and a peak value (2.11±2.13μg/L) in severe group. The changes of serum IFN γ were same as that of IL-12, and its peak values (15.95±18.05μg/L in moderate group and 5.93±8.24μg/L in severe group) were much higher than that of control group (0.27±0.15μg/L, P<0 01). The serum IL-4 was in normal range with no changes. The changes curve of IL-12 was similar to that of BUN but was contrary to blood platelet count. The elevated serum levels of IL-12 and IFN γ with the imbalance of Th1/Th2 might be the main cause of systemic inflammatory response and involved in the pathogenesis of HFRS. The combination of reasonably symptomatic therapy with immunoregulator should be considered to accelerate recovery of immune function and homeostasis and to improve the prognosis of disease. (authors)
Directory of Open Access Journals (Sweden)
Tatsunari Kondoh
Full Text Available It has been proposed that some non-retroviral RNA virus genes are integrated into vertebrate genomes. Endogenous filovirus-like elements (EFLs have been discovered in some mammalian genomes. However, their potential roles in ebolavirus infection are unclear. A filovirus VP35-like element (mlEFL35 is found in the little brown bat (Myotis lucifugus genome. Putative mlEFL35-derived protein (mlEFL35p contains nearly full-length amino acid sequences corresponding to ebolavirus VP35. Ebola virus VP35 has been shown to bind double-stranded RNA, leading to inhibition of type I interferon (IFN production, and is also known as a viral polymerase cofactor that is essential for viral RNA transcription/replication. In this study, we transiently expressed mlEFL35p in human kidney cells and investigated its biological functions. We first found that mlEFL35p was coimmunoprecipitated with itself and ebolavirus VP35s but not with the viral nucleoprotein. Then the biological functions of mlEFL35p were analyzed by comparing it to ebolavirus VP35s. We found that the expression of mlEFL35p significantly inhibited human IFN-β promoter activity as well as VP35s. By contrast, expression of mlEFL35p did not support viral RNA transcription/replication and indeed slightly decrease the reporter gene expression in a minigenome assay. These results suggest that mlEFL35p potentially acts as an IFN antagonist but not a polymerase cofactor.
31 CFR 411.1 - Color illustrations authorized.
2010-07-01
... SERVICE, DEPARTMENT OF THE TREASURY COLOR ILLUSTRATIONS OF UNITED STATES CURRENCY § 411.1 Color... necessary plates or items for such printing or publishing, of color illustrations of U.S. currency provided... storage devices, and any other thing used in the making of the illustration that contain an image of the...
Directory of Open Access Journals (Sweden)
Dong Zheng
Full Text Available The outer membrane protein RagB is one of the major virulence factors of the periodontal pathogen Porphyromonas gingivalis (P. gingivalis. In order to induce protective immune response against P. gingivalis infection, an mGITRL gene-linked ragB DNA vaccine (pIRES-ragB-mGITRL was constructed. Six-week-old female BALB/c mice were immunized with pIRES-ragB-mGITRL through intramuscular injection and then challenged by subcutaneous injection in the abdomen with P. gingivalis. RagB-specific antibody-forming cells were evaluated by an Enzyme-linked immunosorbent spot, and specific antibody was determined by enzyme-linked immunosorbent assay. In addition, the frequencies of Tfh and IFN-γ(+ T cells in spleen were measured using flow cytometer, and the levels of IL-21 and IFN-γ mRNA or proteins were detected by real time RT-PCR or ELISA. The data showed that the mGITRL-linked ragB DNA vaccine induced higher levels of RagB-specific IgG in serum and RagB-specific antibody-forming cells in spleen. The frequencies of Tfh and IFN-γ(+ T cells were obviously expanded in mice immunized by pIRES-ragB-mGITRL compared with other groups (pIRES or pIRES-ragB . The levels of Tfh and IFN-γ(+ T cells associated cytokines were also significantly increased in pIRES-ragB-mGITRL group. Therefore, the mice immunized with ragB plus mGITRL showed the stronger resistant to P. gingivalis infection and a significant reduction of the lesion size caused by P. gingivalis infection comparing with other groups. Taken together, our findings demonstrated that intramuscular injection of DNA vaccine ragB together with mGITRL induced protective immune response dramatically by increasing Tfh and IFN-γ(+ T cells and antibody production to P. gingivalis.
Directory of Open Access Journals (Sweden)
Cyndi Chen
Full Text Available BACKGROUND: Both naturally arising Foxp3(+ and antigen-induced Foxp3(- regulatory T cells (Treg play a critical role in regulating immune responses, as well as in preventing autoimmune diseases and graft rejection. It is known that antigen-specific Treg are more potent than polyclonal Treg in suppressing pathogenic immune responses that cause autoimmunity and inflammation. However, difficulty in identifying and isolating a sufficient number of antigen-specific Treg has limited their use in research to elucidate the mechanisms underlying their regulatory function and their potential role in therapy. METHODOLOGY/PRINCIPAL FINDINGS: Using a novel class II MHC tetramer, we have isolated a population of CD4(+ Foxp3(- T cells specific for the autoantigen glutamic acid decarboxylase p286-300 peptide (NR286 T cells from diabetes-resistant non-obese resistant (NOR mice. These Foxp3(- NR286 T cells functioned as Treg that were able to suppress target T cell proliferation in vitro and inhibit type 1 diabetes in animals. Unexpected results from mechanistic studies in vitro showed that their regulatory function was dependent on not only IFN-gamma and nitric oxide, but also on cell contact with target cells. In addition, separating NR286 Treg from target T cells in transwell assays abolished both production of NO and suppression of target T cells, regardless of whether IFN-gamma was produced in cell cultures. Therefore, production of NO, not IFN-gamma, was cell contact dependent, suggesting that NO may function downstream of IFN-gamma in mediating regulatory function of NR286 Treg. CONCLUSIONS/SIGNIFICANCE: These studies identified a unique population of autoantigen-specific Foxp3(- Treg that can exert their regulatory function dependent on not only IFN-gamma and NO but also cell contact with target cells.
Velásquez, Sonia Y; García, Luis F; Opelz, Gerhard; Alvarez, Cristiam M; Süsal, Caner
2013-07-27
Membrane CD30 is an important costimulatory molecule for activated T lymphocytes, and serum level of soluble CD30 (sCD30) is considered a marker for predicting outcome in kidney transplantation. We investigated the kinetics of CD30 expression on CD4 and CD8 T-cell populations and the source of sCD30 during alloimmune responses in vitro. The effect of neutralizing antibodies against interferon (IFN)-γ and other cytokines on sCD30 release and the involvement of metalloproteinases ADAM10 and ADAM17/TACE that are responsible for sCD30 shedding were also assessed. Memory phenotypes and CD30 expression on allostimulated CD3 lymphocytes were evaluated in dialysis patients and matched controls. Allogeneic stimulation resulted in conversion of naive responder cells to central memory CD4 cells (PCD30 expression. Release of sCD30 was attributed mainly to central memory cells, and neutralization of IFN-γ (PsCD30 during allostimulation but did not alter the levels of ADAM10 and ADAM17/TACE. CD30 expression was modulated in dialysis patients in a similar way as in healthy controls. Allostimulation results in the up-regulation of the T-cell activation marker CD30 on CD4 as well as CD8 memory T cells and increased release of sCD30 from these cells in an IFN-γ- and IL-2-dependent manner. These results may explain clinical findings on the suitability of sCD30 and IFN-γ- and IL-2-producing T cells for immune monitoring of kidney transplant recipients before and after transplantation.
Directory of Open Access Journals (Sweden)
Jennifer H Stuart
2016-12-01
Full Text Available The type I interferon (IFN response is a crucial innate immune signalling pathway required for defense against viral infection. Accordingly, the great majority of mammalian viruses possess means to inhibit this important host immune response. Here we show that vaccinia virus (VACV strain Western Reserve protein C6, is a dual function protein that inhibits the cellular response to type I IFNs in addition to its published function as an inhibitor of IRF-3 activation, thereby restricting type I IFN production from infected cells. Ectopic expression of C6 inhibits the induction of interferon stimulated genes (ISGs in response to IFNα treatment at both the mRNA and protein level. C6 inhibits the IFNα-induced Janus kinase/signal transducer and activator of transcription (JAK/STAT signalling pathway at a late stage, downstream of STAT1 and STAT2 phosphorylation, nuclear translocation and binding of the interferon stimulated gene factor 3 (ISGF3 complex to the interferon stimulated response element (ISRE. Mechanistically, C6 associates with the transactivation domain of STAT2 and this might explain how C6 inhibits the type I IFN signalling very late in the pathway. During virus infection C6 reduces ISRE-dependent gene expression despite the presence of the viral protein phosphatase VH1 that dephosphorylates STAT1 and STAT2. The ability of a cytoplasmic replicating virus to dampen the immune response within the nucleus, and the ability of viral immunomodulators such as C6 to inhibit multiple stages of the innate immune response by distinct mechanisms, emphasizes the intricacies of host-pathogen interactions and viral immune evasion.
48 CFR 9904.401-60 - Illustrations.
2010-10-01
... Section 9904.401-60 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.401-60 Illustrations. (a) The following examples are illustrative...
48 CFR 9904.409-60 - Illustrations.
2010-10-01
... Section 9904.409-60 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.409-60 Illustrations. The following examples are illustrative of...
DEFF Research Database (Denmark)
Søndergaard, Jonas Nørskov; Laursen, Janne Marie; Rosholm, Lisbeth Buus
2014-01-01
) are some of the first cells to interact with Mtb and they play an essential role in development of protective immunity against Mtb. Given that Mtb-infected macrophages have difficulties in degrading Mtb, they need help from IFN-γ-producing CD4+ T cells propagated via IL-12p70-producing DCs. Here we report...... that Mtb modifies human DC plasticity by expanding a CD14+ DC subset with weak IL-12p70-producing capacity. The CD14+ Mtb-promoted subset was furthermore poor inducers of IFN-γ by naive CD4+ T cells, but instead prompted IL-17A-producing RORγT+ CD4+ T cells. Mtb-derived peptidoglycan and mannosylated...... conclude that Mtb exploits DC plasticity to reduce production of IL-12p70, and that this process is entirely divertible by exogenous IFN-γ. These data suggest that strategies to increase local IFN-γ production in the lungs of tuberculosis patients may boost host immunity toward Mtb....
Directory of Open Access Journals (Sweden)
Valeria Caneparo
2018-05-01
Full Text Available Absent in melanoma 2 (AIM2-like receptors (ALRs are a newly characterized class of pathogen recognition receptors (PRRs involved in cytosolic and nuclear pathogen DNA recognition. In recent years, two ALR family members, the interferon (IFN-inducible protein 16 (IFI16 and AIM2, have been linked to the pathogenesis of various autoimmune diseases, among which systemic lupus erythematosus (SLE has recently gained increasing attention. SLE patients are indeed often characterized by constitutively high serum IFN levels and increased expression of IFN-stimulated genes due to an abnormal response to pathogens and/or incorrect self-DNA recognition process. Consistently, we and others have shown that IFI16 is overexpressed in a wide range of autoimmune diseases where it triggers production of specific autoantibodies. In addition, evidence from mouse models supports a model whereby ALRs are required for IFN-mediated host response to both exogenous and endogenous DNA. Following interaction with cytoplasmic or nuclear nucleic acids, ALRs can form a functional inflammasome through association with the adaptor ASC [apoptosis-associated speck-like protein containing a caspase recruitment domain (CARD] and with procaspase-1. Importantly, inflammasome-mediated upregulation of IL-1β and IL-18 production positively correlates with SLE disease severity. Therefore, targeting ALR sensors and their downstream pathways represents a promising alternative therapeutic approach for SLE and other systemic autoimmune diseases.
IL-15 Superagonist–Mediated Immunotoxicity: Role of NK Cells and IFN-γ
Guo, Yin; Luan, Liming; Rabacal, Whitney; Bohannon, Julia K.; Fensterheim, Benjamin A.; Hernandez, Antonio
2015-01-01
IL-15 is currently undergoing clinical trials to assess its efficacy for treatment of advanced cancers. The combination of IL-15 with soluble IL-15Rα generates a complex termed IL-15 superagonist (IL-15 SA) that possesses greater biological activity than IL-15 alone. IL-15 SA is considered an attractive antitumor and antiviral agent because of its ability to selectively expand NK and memory CD8+ T (mCD8+ T) lymphocytes. However, the adverse consequences of IL-15 SA treatment have not been defined. In this study, the effect of IL-15 SA on physiologic and immunologic functions of mice was evaluated. IL-15 SA caused dose- and time-dependent hypothermia, weight loss, liver injury, and mortality. NK (especially the proinflammatory NK subset), NKT, and mCD8+ T cells were preferentially expanded in spleen and liver upon IL-15 SA treatment. IL-15 SA caused NK cell activation as indicated by increased CD69 expression and IFN-γ, perforin, and granzyme B production, whereas NKT and mCD8+ T cells showed minimal, if any, activation. Cell depletion and adoptive transfer studies showed that the systemic toxicity of IL-15 SA was mediated by hyperproliferation of activated NK cells. Production of the proinflammatory cytokine IFN-γ, but not TNF-α or perforin, was essential to IL-15 SA–induced immunotoxicity. The toxicity and immunological alterations shown in this study are comparable to those reported in recent clinical trials of IL-15 in patients with refractory cancers and advance current knowledge by providing mechanistic insights into IL-15 SA–mediated immunotoxicity. PMID:26216888
Radiology illustrated. Uroradiology. 2. ed.
International Nuclear Information System (INIS)
Kim, Seung Hyup
2012-01-01
Uroradiology is an up-to-date, image-oriented reference in the style of a teaching file that has been designed specifically to be of value in clinical practice. All aspects of the imaging of urologic diseases are covered, and case studies illustrate the findings obtained with the relevant imaging modalities in both common and uncommon conditions. Most chapters focus on a particular clinical problem, but normal findings, congenital anomalies, and interventions are also discussed and illustrated. In this second edition, the range and quality of the illustrations have been enhanced, and many schematic drawings have been added to help readers memorize characteristic imaging findings through pattern recognition. The accompanying text is concise and informative. Besides serving as an outstanding aid to differential diagnosis, this book will provide a user-friendly review tool for certification or recertification in radiology. (orig.)
48 CFR 9904.404-60 - Illustrations.
2010-10-01
... Section 9904.404-60 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.404-60 Illustrations. (a) Illustrations of costs which must be...
48 CFR 9904.402-60 - Illustrations.
2010-10-01
... Section 9904.402-60 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.402-60 Illustrations. (a) Illustrations of costs which are incurred...
Illustrations of the twin paradox
International Nuclear Information System (INIS)
Rebhan, E.
1985-01-01
In order to provide a more intuitive understanding of the twin paradox, several illustrations of this are presented. In one of these, each of the twins is equipped with a lamp whose monochromatic light can be observed by the other. In other illustrations the travelling twin uses an Einstein train instead of a space ship, all the cars of the train and all stations along the route of the train being equipped with clocks. (author)
DEFF Research Database (Denmark)
Riley, C.H.; Morten Krogh, Jensen; Brimnes, M.K.
2011-01-01
Recent reports have described complete or major molecular remission in patients with polycythemia vera after long-term treatment with the immunomodulatory agent IFN-α2. Accordingly, there are reasons to believe that the immune system is a key player in eradicating the JAK2 mutated clone in these ......Recent reports have described complete or major molecular remission in patients with polycythemia vera after long-term treatment with the immunomodulatory agent IFN-α2. Accordingly, there are reasons to believe that the immune system is a key player in eradicating the JAK2 mutated clone...
Greenstein, Gary; Carpentieri, Joseph R
2015-01-01
Guided bone regeneration (GBR) can be used to restore a defective alveolar ridge after extractions before or in combination with implant placement. It may also be employed after extractions to reduce crestal bone resorption and maximize bone fill of sockets. Resorbable or nonresorbable barriers (eg, expanded polytetrafluoroethylene [e-PTFE]) can be used when performing GBR procedures, but they need to be completely submerged to attain optimal results. Dense polytetrafluoroethylene (d-PTFE) is a type of nonresorbable barrier that circumvents the necessity to attain primary closure after placement of bone grafts, thereby reducing patient morbidity. This article addresses topics pertaining to d-PTFE utilization, including characteristics and advantages of d-PTFE barriers, time needed for osteoid tissue to become impervious to penetration by flap connective tissue, relevant clinical studies, and limitations of available data. Clinical photographs and radiographs of successfully treated cases are presented to illustrate the efficacy of d-PTFE barriers in regenerating defective bony plates after extractions.
Sprache als Barriere (Language as a Barrier)
Mattheier, Klaus
1974-01-01
The concept of language barrier has its derivations in the fields of dialectology, sociology and psychology. In contemporary usage however, the concept has two meanings i.e. regional-cultural barrier and socio-cultural barrier. (Text is in German.) (DS)
Directory of Open Access Journals (Sweden)
Edith Rojas-Anaya
2015-01-01
Full Text Available El objetivo de este estudio fue comparar el comportamiento de IFN- e IL-4 en ratones inoculados con proteína G recombinante del virus de la rabia, que se expresa en maíz transgénico o baculovirus. Para este pr opósito, grupos de ratones se inocularon de la siguiente manera: Grupo 1, vacuna contra el virus de la rabia inactivado vía im; Grupo 2, proteína G recombinante deri vada de plantas por vía oral; Grupo 3, proteína G expresada en baculovirus vía im; Grupo 4, proteína G expresada en baculovirus por vía oral; Grupo 5, maíz no tran sformado por vía oral. Los niveles de IFN- e IL-4 y los anticuerpos específicos se evaluaron cada 15 días. El desafío se realizó a los 60 días post inoculación (pi. Los grupos 1 y 3 promovieron un a mejor respuesta humoral. Por otro lado, los resultados demostraron que los mismos grupos mostraron los mejores niveles de IFN - en el día 10 pi; mientras que la IL-4 se detectó en el día 15 pi. Para el estudio de supervivencia, el 83 % de los ratones inmunizados con vacuna inactivada, maíz y los inoculados im con extractos de baculovirus sob revivieron la infección viral. La proteína G de la rabia recombinante expresada en baculovirus promovió IFN- y los anticuerpos de una manera similar a la vacuna de rabia inactivada. A pesar de esto los ratones alime ntados con maíz transgénico sobrevivieron al desafío en el mismo porcentaje que el grupo 3.
Wen, Jie; Zhou, Ying; Wang, Jun; Chen, Jie; Yan, Wenbo; Wu, Jin; Yan, Junkai; Zhou, Kejun; Xiao, Yongtao; Wang, Yang; Xia, Qiang; Cai, Wei
2017-06-01
Regulatory T cells (Tregs) and CD4 + T helper (Th) cells have important roles in bile duct injury of biliary atresia (BA). However, their impacts on liver fibrosis are undefined. Between 2013 and 2016, 146 patients with various stages of BA were enrolled in this study. Peripheral blood, liver biopsy and lymph node samples were collected. Flow cytometry, magnetic cell sorting and immunostaining were used to characterize lymphocytes from BA patients. Deficiency of Tregs was observed along with increased Th1, Th2 and Th17 frequencies in the peripheral blood and livers of BA patients. The levels of peripheral and intrahepatic Th1 cells positively correlated with the stage of liver fibrosis. Furthermore, Th1 cells were located in close proximity to activated hepatic stellate cells (HSCs) and areas of fibrosis in BA livers. In culture, Th1 cells accelerated the proliferation and secretion of profibrogenic markers of HSCs through the IFN-γ/STAT1 pathway. Of note, Tregs blocked the Th1-stimulated effects on HSCs by inhibiting Th1-induced activation of STAT1. Consistent with the results of in vitro study, intrahepatic IFN-γ/STAT1 levels increased in relation to the severity of liver fibrosis in BA patients, and the altered balance between MMP2 and TIMP1 expressions in livers may contribute to increased deposition of extracellular matrix and fibrosis. Finally, to identify the effects of Th1 cells on Tregs, we demonstrated that Th1 cells upregulated the proportion of aTreg cells by secreting IFN-γ cytokine. Thus, aberrant Th1 immune responses in BA promote the proliferation and secretion of HSCs through the IFN-γ/STAT1 pathway. The regulation of HSCs by the interactions between Tregs and Th1 cells might be part of the mechanism underlying progressive liver fibrosis and may be a suitable target for therapy.
Zhou, Naibao; Fu, Zhijian; Li, Hao; Wang, Kaiguo
2017-04-01
Ketamine has been used as an analgesic adjuvant with morphine in the treatment of refractory cancer pain recently. But both morphine and ketamine have been reported to produce a number of immunomodulatory effects. The current study was performed to assess whether the concentration of ketamine, as adjuvant analgesics for patient with refractory cancer pain, was related to its effect on T cells interleukin-2 (IL-2)/interferon-γ (IFN-γ) expression in vitro. Peripheral blood mononuclear cells (PBMCs) were isolated from venous blood of patients with refractory cancer pain over a Ficoll-Hypaque density gradient. T cells were isolated from by positive selection using anti-CD3 beads. T cells were then treated with vehicle (C group), morphine (200 ng/mL, M group), morphine (200 ng/mL), and different dose of ketamine (100, 200, 1000 ng/mL; MK1, MK5, MK10 group) for 24 hours before stimulation with anti-CD3 and anti-CD28. Then supernatant IL-2 and IFN-γ protein analysis, quantitative reverse transcription polymerase chain reaction (RT-PCR) for IL-2 and IFN-γ were done. There were no significant difference of supernatant IL-2 and IFN-γ among C group, M group, and MK1 group, but the mRNA of M group and MK1 group were decreased compared with C group (P ketamine dose-dependently suppressed IL-2 and IFN-γ of activated T lymphocyte of patients with refractory cancer pain in vitro, but the inhibitory action of low dose ketamine could be neglected.
"Illustrating the Machinery of Life": Viruses
Goodsell, David S.
2012-01-01
Data from electron microscopy, X-ray crystallography, and biophysical analysis are used to create illustrations of viruses in their cellular context. This report describes the scientific data and artistic methods used to create three illustrations: a depiction of the poliovirus lifecycle, budding of influenza virus from a cell surface, and a…
Lesional CD4+ IFN-γ+ cytotoxic T lymphocytes in IgG4-related dacryoadenitis and sialoadenitis
Maehara, Takashi; Mattoo, Hamid; Ohta, Miho; Mahajan, Vinay S; Moriyama, Masafumi; Yamauchi, Masaki; Drijvers, Jefte; Nakamura, Seiji; Stone, John H; Pillai, Shiv S
2017-01-01
Objectives IgG4-related disease (IgG4-RD) is a chronic, systemic, inflammatory condition of unknown aetiology. We have recently described clonally expanded circulating CD4+ cytotoxic T lymphocytes (CTLs) in IgG4-RD that infiltrate affected tissues where they secrete interleukin (IL)-1β and transforming growth factor -β1 (TGF-β1). In this study, we sought to examine the role of CD4+ CTLs in the pathogenesis of IgG4-related dacryoadenitis and sialoadenitis (IgG4-DS) and to determine whether these cells secrete interferon-gamma (IFN-γ) at lesional sites. Methods Salivary glands of 25 patients with IgG4-DS, 22 patients with Sjögren’s syndrome (SS), 12 patients with chronic sialoadenitis (CS) and 12 healthy controls were analysed in this study. Gene expression analysis was performed on submandibular glands (SMGs) from five patients with IgG4-DS, three with CS and three healthy controls. Infiltrating CD4+ CTLs were examined by quantitative multicolour imaging in tissue samples from 20 patients with IgG4-DS, 22 patients with SS, 9 patients with CS and 9 healthy controls. Results In IgG4-DS tissues, nine genes associated with CD4+ CTLs were overexpressed. The expression of granzyme A (GZMA) mRNA was significantly higher in samples from patients with IgG4-RD compared with corresponding tissues from SS and healthy controls. Quantitative imaging showed that infiltrating CD4+ GZMA+ CTLs were more abundant in patients with IgG4-DS than in the other groups. The ratio of CD4+GZMA+ CTLs in SMGs from patients with IgG4-DS correlated with serum IgG4 concentrations and the number of affected organs. A large fraction of CD4+GZMA+ CTLs in SMGs from patients with IgG4-DS secreted IFN-γ. Conclusions The pathogenesis of IgG4-DS is associated with tissue infiltration by CD4+GZMA+ CTLs that secrete IFN-γ. PMID:27358392
IFN-γ, IL-4 and IL-13 modulate responsiveness of human airway smooth muscle cells to IL-13
Directory of Open Access Journals (Sweden)
Michoud Marie-Claire
2008-12-01
Full Text Available Abstract Background IL-13 is a critical mediator of allergic asthma and associated airway hyperresponsiveness. IL-13 acts through a receptor complex comprised of IL-13Rα1 and IL-4Rα subunits with subsequent activation of signal transducer and activator of transcription 6 (STAT6. The IL-13Rα2 receptor may act as a decoy receptor. In human airway smooth muscle (HASM cells, IL-13 enhances cellular proliferation, calcium responses to agonists and induces eotaxin production. We investigated the effects of pre-treatment with IL-4, IL-13 and IFN-γ on the responses of HASM cells to IL-13. Methods Cultured HASM were examined for expression of IL-13 receptor subunits using polymerase chain reaction, immunofluorescence microscopy and flow cytometry. Effects of cytokine pre-treatment on IL-13-induced cell responses were assessed by looking at STAT6 phosphorylation using Western blot, eotaxin secretion and calcium responses to histamine. Results IL-13Rα1, IL-4Rα and IL-13Rα2 subunits were expressed on HASM cells. IL-13 induced phosphorylation of STAT6 which reached a maximum by 30 minutes. Pre-treatment with IL-4, IL-13 and, to a lesser degree, IFN-γ reduced peak STAT6 phosphorylation in response to IL-13. IL-13, but not IFN-γ, pre-treatment abrogated IL-13-induced eotaxin secretion. Pre-treatment with IL-4 or IL-13 abrogated IL-13-induced augmentation of the calcium transient evoked by histamine. Cytokine pre-treatment did not affect expression of IL-13Rα1 and IL-4Rα but increased expression of IL-13Rα2. An anti-IL-13Rα2 neutralizing antibody did not prevent the cytokine pre-treatment effects on STAT6 phosphorylation. Cytokine pre-treatment increased SOCS-1, but not SOCS-3, mRNA expression which was not associated with significant increases in protein expression. Conclusion Pre-treatment with IL-4 and IL-13, but not IFN-γ, induced desensitization of the HASM cells to IL-13 as measured by eotaxin secretion and calcium transients to histamine
Directory of Open Access Journals (Sweden)
Wenting Li
2017-10-01
Full Text Available To date, several on-treatment-level virological and serological indices that may predict the response to interferon alpha (IFN-α have been reported. However, no effective predictors, such as drug–response genes, that can be detected before administration of anti-hepatitis B virus (HBV therapy with IFN-α, have been found. In the diverse range of chronic viral infection, genes that affect human immunity play important roles in understanding host and viral co-evolution. Killer-cell immunoglobulin-like receptors (KIRs, which are highly polymorphic at the allele and haplotype levels, participate in the antiviral function of natural killer (NK cells via fine-tuning inhibition and activation of NK-cell responses that occur when the NK cells interact with human leukocyte antigen (HLA class I molecules on target cells. For each individual, the pairing of KIR and HLA ligand is genetically determined. To investigate whether a particular KIR and HLA repertoire influences the risk of HBV infection and response to IFN-α treatment for chronic hepatitis B (CHB, we genotyped the KIRs and HLA ligands of 119 hepatitis B e antigen (HBeAg-positive CHB patients. These patients included 43 patients who achieved sustained response (SR induced by IFN-α treatment for 48 weeks, 76 patients who achieved no response (NR, and 96 healthy subjects as controls. SR was defined as HBeAg loss with HBV DNA < 2,000 IU/ml and alanine aminotransferase normalization at 24 weeks posttreatment (week 72. In this study, we showed that activating KIR genes were less prevalent in Han Chinese, especially in Han Chinese with CHB, than in Caucasians. Furthermore, the KIR3DS1 gene, in combination with HLA-B Bw4-80Ile, strongly influenced the therapeutic outcomes for CHB patients who were treated with IFN-α. The frequency of the combination of genes encoding KIR3DS1 and HLA-B Bw4-80Ile was higher in patients who had a sustained treatment response than in patients who had NR [35
Filipič, Bratko; Gradišnik, Lidija; Rihar, Klemen; Šooš, Eugen; Pereyra, Adriana; Potokar, Jana
2015-12-01
Among royal jelly's (RJ) various biological activities, its possible antitumour activity deserves particular attention. The purpose of this study was to investigate the influence of RJ, its bioactive component 10-hydroxy-2-decenoic acid (10- HDA), and human interferon-alpha (HuIFN-αN3) on the proliferation of human colorectal adenocarcinoma cells (CaCo- 2), and ascertain their effect on intracellular glutathione (GSH) level and lipid peroxidation. We studied the antiproliferative (AP) activity of RJ [(0.1 g/10 mL phosphate buffer saline (PBS)], HuIFN-αN3 (1000 I.U. mL⁻¹), 10-HDA at 100.0 μmol L⁻¹, and their different combinations, in the ratio 1:1, 1:2, and 2:1 on CaCo-2 cells. The GSH level was measured by glutathione assay. The lipid peroxidation was measured by malondialdehyde (MDA) assay. Single RJ had a low AP activity: 2.0 (0.5 mg mL⁻¹). HuIFN-αN3 had an AP activity of 2.5 (208.33 I.U. mL⁻¹), while 10-HDA had an AP activity of 1.5 (37.5 μmol mL⁻¹). The highest AP activity of 3.8 was obtained when RJ and HuIFN-αN3 were applied at the ratio 2:1. In that combination the level of GSH was 24.9±2.4 nmol g⁻³ of proteins (vs. 70.2±3.2 nmol g⁻³ in the control) and the level of MDA was 72.3±3.1 nmol g⁻³ (vs. 23.6±9.1 nmol g⁻³ in the control). It is generally assumed that 10-HDA, an important constituent of RJ, together with HuIFN-αN3, is responsible for the inhibition of CaCo-2 cells proliferation in vitro. In our study, however, RJ and HuIFN-αN3 applied at 2:1 decreased the level of GSH the most and significantly increased lipid peroxidation via MDA in CaCo-2 cells. Future studies should show whether these GSH- and MDA-related activities of RJ, HuIFN-αN3, 10-HDA, and their combinations may decrease the tumorigenicity index and tumorigenic potential of various tumour cells in vitro.
Iwasa, Janet H
2016-04-01
Proficiency in art and illustration was once considered an essential skill for biologists, because text alone often could not suffice to describe observations of biological systems. With modern imaging technology, it is no longer necessary to illustrate what we can see by eye. However, in molecular and cellular biology, our understanding of biological processes is dependent on our ability to synthesize diverse data to generate a hypothesis. Creating visual models of these hypotheses is important for generating new ideas and for communicating to our peers and to the public. Here, I discuss the benefits of creating visual models in molecular and cellular biology and consider steps to enable researchers to become more effective visual communicators. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Fernanda N Morgado
Full Text Available Fungus of the Sporothrix schenckii complex can produce skin lesions in humans, commonly lymphocutaneous (LC and fixed (F forms of sporotrichosis. Some authors have suggested that clinical forms are influenced by differences in virulence and genetic profile of isolates. But little is known about the role of immune response in determining the clinical outcome of sporotrichosis. To verify the profile of systemic and in situ IFN-γ and IL-10 expression in sporotrichosis patients, and consequently to detect any difference between the two compartments and/or clinical presentation, we quantified the number of IFN-γ and IL-10 producer peripheral blood mononuclear cells stimulated with S. schenckii antigen (Ss-Ag by Elispot, and quantified cytokines expression by in situ immunohistochemistry in the same patient. Three groups were formed: 1- LC (n = 9; 2- F (n = 10; 3- healthy individuals (n = 14. All sporotrichosis patients produced high amounts of systemic IFN- γ when compared to uninfected individuals. No differences were observed between LC and F groups. Regarding in situ IL-10 expression, a difference between LC and F groups was observed: LC lesions presented higher amounts of IL-10 than F lesions differently from systemic IL-10 which showed similarities. Our data suggests that LC lesions present higher IL-10 expression which could be related to regulatory mechanisms for compensating the tissue injury, however favoring fungal persistence in the lesions. Surprisingly, there were no differences in systemic and in situ IFN- γ expression between CL and F patients, although it was significantly higher expressed in these patients than in healthy individuals.
Morgado, Fernanda N; Schubach, Armando O; Pimentel, Maria Inês; Lyra, Marcelo R; Vasconcellos, Érica C F; Valete-Rosalino, Claudia M; Conceição-Silva, Fátima
2016-01-01
Fungus of the Sporothrix schenckii complex can produce skin lesions in humans, commonly lymphocutaneous (LC) and fixed (F) forms of sporotrichosis. Some authors have suggested that clinical forms are influenced by differences in virulence and genetic profile of isolates. But little is known about the role of immune response in determining the clinical outcome of sporotrichosis. To verify the profile of systemic and in situ IFN-γ and IL-10 expression in sporotrichosis patients, and consequently to detect any difference between the two compartments and/or clinical presentation, we quantified the number of IFN-γ and IL-10 producer peripheral blood mononuclear cells stimulated with S. schenckii antigen (Ss-Ag) by Elispot, and quantified cytokines expression by in situ immunohistochemistry in the same patient. Three groups were formed: 1- LC (n = 9); 2- F (n = 10); 3- healthy individuals (n = 14). All sporotrichosis patients produced high amounts of systemic IFN- γ when compared to uninfected individuals. No differences were observed between LC and F groups. Regarding in situ IL-10 expression, a difference between LC and F groups was observed: LC lesions presented higher amounts of IL-10 than F lesions differently from systemic IL-10 which showed similarities. Our data suggests that LC lesions present higher IL-10 expression which could be related to regulatory mechanisms for compensating the tissue injury, however favoring fungal persistence in the lesions. Surprisingly, there were no differences in systemic and in situ IFN- γ expression between CL and F patients, although it was significantly higher expressed in these patients than in healthy individuals.
Morgado, Fernanda N.; Schubach, Armando O.; Pimentel, Maria Inês; Lyra, Marcelo R.; Vasconcellos, Érica C. F.; Valete-Rosalino, Claudia M.; Conceição-Silva, Fátima
2016-01-01
Fungus of the Sporothrix schenckii complex can produce skin lesions in humans, commonly lymphocutaneous (LC) and fixed (F) forms of sporotrichosis. Some authors have suggested that clinical forms are influenced by differences in virulence and genetic profile of isolates. But little is known about the role of immune response in determining the clinical outcome of sporotrichosis. To verify the profile of systemic and in situ IFN-γ and IL-10 expression in sporotrichosis patients, and consequently to detect any difference between the two compartments and/or clinical presentation, we quantified the number of IFN-γ and IL-10 producer peripheral blood mononuclear cells stimulated with S. schenckii antigen (Ss-Ag) by Elispot, and quantified cytokines expression by in situ immunohistochemistry in the same patient. Three groups were formed: 1- LC (n = 9); 2- F (n = 10); 3- healthy individuals (n = 14). All sporotrichosis patients produced high amounts of systemic IFN- γ when compared to uninfected individuals. No differences were observed between LC and F groups. Regarding in situ IL-10 expression, a difference between LC and F groups was observed: LC lesions presented higher amounts of IL-10 than F lesions differently from systemic IL-10 which showed similarities. Our data suggests that LC lesions present higher IL-10 expression which could be related to regulatory mechanisms for compensating the tissue injury, however favoring fungal persistence in the lesions. Surprisingly, there were no differences in systemic and in situ IFN- γ expression between CL and F patients, although it was significantly higher expressed in these patients than in healthy individuals. PMID:27622513
Roles of Illustrators in Visual Communication of Scientific Knowledge
Directory of Open Access Journals (Sweden)
Kana Okawa
2011-10-01
Full Text Available Scientific knowledge is the knowledge accumulated by systematic studies and organized by general principles. Visual, verbal, numeric, and other types of representation are used to communicate scientific knowledge. Scientific illustration is the visual representation of objects and concepts in order to record and to convey scientific knowledge(Ford, 1993. There are some discussions on scientific illustrations in history, philosophy and the sociology of science(Burri & Dumit, 2008, but little has been done on the creation of scientific illustrations by illustrators. This study focuses on the creation of scientific illustrations by illustrators. The purpose is to show how illustrators create the visual messages in communications of scientific knowledge. Through analysis of semi-structured interviews with 6 professional illustrators, creators and art directors, it is showed that illustrators select and edit scientific information, add non-scientific information, and organize information into one visual representation of scientific knowledge. The implication of this research will provide a new perspective to multisensory communication of scientific knowledge.
DEFF Research Database (Denmark)
Jinquan, T; Frydenberg, Jane; Mukaida, N
1995-01-01
receptors on the cells. This process can be augmented by IFN-gamma and TNF-alpha, and inhibited by IL-4, IL-10, and IL-13. In addition, we also document that on T lymphocytes there exist IL-8 receptors that can be up-regulated by IFN-gamma, TNF-alpha, and IL-2. Our results demonstrate that rhGRO-alpha gene...
Montoya, Maria; Edwards, Matthew J; Reid, Delyth M; Borrow, Persephone
2005-02-15
In this study, we report the dynamic changes in activation and functions that occur in spleen dendritic cell (sDC) subsets following infection of mice with a natural murine pathogen, lymphocytic choriomeningitis virus (LCMV). Within 24 h postinfection (pi), sDCs acquired the ability to stimulate naive LCMV-specific CD8+ T cells ex vivo. Conventional (CD11chigh CD8+ and CD4+) sDC subsets rapidly up-regulated expression of costimulatory molecules and began to produce proinflammatory cytokines. Their tendency to undergo apoptosis ex vivo simultaneously increased, and in vivo the number of conventional DCs in the spleen decreased markedly, dropping approximately 2-fold by day 3 pi. Conversely, the number of plasmacytoid (CD11clowB220+) DCs in the spleen increased, so that they constituted almost 40% of sDCs by day 3 pi. Type 1 IFN production was up-regulated in plasmacytoid DCs by 24 h pi. Analysis of DC activation and maturation in mice unable to respond to type 1 IFNs implicated these cytokines in driving infection-associated phenotypic activation of conventional DCs and their enhanced tendency to undergo apoptosis, but also indicated the existence of type 1 IFN-independent pathways for the functional maturation of DCs during LCMV infection.
Héla Saïdi; Marlène Bras; Pauline Formaglio; Marie-Thérèse Melki; Bruno Charbit; Jean-Philippe Herbeuval; Marie-Lise Gougeon
2016-01-01
Plasmacytoid dendritic cells (pDCs) are innate sensors of viral infections and important mediators of antiviral innate immunity through their ability to produce large amounts of IFN-?. Moreover, Toll-like receptor 7 (TLR7) and 9 (TLR9) ligands, such as HIV and CpG respectively, turn pDCs into TRAIL-expressing killer pDCs able to lyse HIV-infected CD4+ T cells. NK cells can regulate antiviral immunity by modulating pDC functions, and pDC production of IFN-? as well as cell?cell contact is requ...
Barrier mechanisms in the Drosophila blood-brain barrier
Directory of Open Access Journals (Sweden)
Samantha Jane Hindle
2014-12-01
Full Text Available The invertebrate blood-brain barrier field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through GPCR signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate blood-brain barrier has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many blood-brain barrier mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the blood-brain barrier can govern whole animal physiologies. This includes novel functions of blood-brain barrier gap junctions in orchestrating synchronized neuroblast proliferation, and of blood-brain barrier secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate blood-brain barrier anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.
Directory of Open Access Journals (Sweden)
Yang Liu
2012-02-01
Full Text Available Interferon regulatory factor 6 (IRF6 gene is a member of the IRF-family, and plays functionally diverse roles in the regulation of the immune system. In this report, the 13,720 bp porcine IRF6 genomic DNA structure was firstly identified with a putative IRF6 protein of 467 amino acids. Alignment and phylogenetic analysis of the porcine IRF6 amino acid sequences with their homologies to other species showed high identity (over 96%. Tissues expression of IRF6 mRNA was observed by RT-PCR, the results revealed IRF6 expressed widely in eight tissues. One SNP (HQ026023:1383 G>C in exon7 and two SNPs (HQ026023:130 G>A; 232 C>T in the 5 ′ promoter region of porcine IRF6 gene were demonstrated b y DNA sequencing analysis. A further analysis of SNP genotypes associated with immune traits including IFN-γ and IL10 concentrations in serum was carried out in three pig populations including Large White, Landraces and Songliao Black pig (a Chinese indigenous breed. The results showed that the SNP (HQ026023:1383 G>C was significantly associated with the level of IFN-γ (d 20 in serum (p = 0.038 and the ratio of IFN-γ to IL10 (d 20 in serum (p = 0.041; The other two SNPs (HQ026023:130 G>A; 232 C>T were highly significantly associated with IL10 level in serum both at the day 20 (p = 0.005; p = 0.001 and the day 35 (p = 0.004; p = 0.006. Identification of the porcine IRF6 gene will help our further understanding of the molecular basis of the IFN regulation pathway in the porcine immune response. All these results should indicate that the IRF6 gene can be regarded as a molecular marker associated with the IL10 level in serum and used for genetic selection in the pig breeding.
Alveolar macrophages and type I IFN in airway homeostasis and immunity.
Divangahi, Maziar; King, Irah L; Pernet, Erwan
2015-05-01
Globally, respiratory infections cause more than 4 million deaths per year, with influenza and tuberculosis (TB) in particular being major causes of mortality and morbidity. Although immune cell activation is critical for killing respiratory pathogens, this response must be tightly regulated to effectively control and eliminate invading microorganisms while minimizing immunopathology and maintaining pulmonary function. The distinct microenvironment of the lung is constantly patrolled by alveolar macrophages (Mφ), which are essential for tissue homeostasis, early pathogen recognition, initiation of the local immune response, and resolution of inflammation. Here, we focus on recent advances that have provided insight into the relation between pulmonary Mφ, type I interferon (IFN) signaling, and the delicate balance between protective and pathological immune responses in the lung. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Maureen Hoch Vieira Fernandes
2015-04-01
Full Text Available The purpose of this study was to evaluate the imunnostimulatory adjuvant capacity of water extract from brown propolis (WEBP when added to a vaccine against canine parvovirus (CPV and canine coronavirus (CCoV, regarding the production of IFN-γ. Mice were vaccinated with CPV and CCoV (3.0 x 106 TCID50 with or without 400 µg/dose of WEBP. Thirty days after the third dose, splenocytes were cultured to measure the expression levels of IFN-γ mRNA in the immunized animals. Increased levels of IFN-γ mRNA expression for CCoV were evidenced by RT-PCR, in the splenocytes of mice inoculated with the vaccine containing 400 μg/dose of WEBP, demonstrating the ability of propolis to stimulate cellular immune responses against the antigens of this virus. In contrast, the levels of IFN-γ to CPV were not influenced by the presence of WEBP.
International Nuclear Information System (INIS)
Luan Meiling; Liu Suhua; Chen Hongfang
1995-06-01
With low dose IL-2 of stimulation with carboxy-methyl-Pachymaran (CMP) and 60 Co irradiation, 37 patients with various malignant tumors were treated. Among these patients, there were 16 nasopharyngeal cancer, 4 esophageal cancer, 2 lung cancer, 6 non-Hodkin's lymphomas and 9 other cancer. The percentage of complete tumor remission was 51.4%; most partial remission was 46.8% and progression was 2.7%. Overall effectiveness rate was 97.3%, while 1 year survival rate was 86.2%, results indicated a possibility that combined therapy of IL-2 and 60 Co irradiation may be effective in treatment of malignant tumors. Experimental study showed that RGP, RCP, PsP, PAS and CMP can promote inductive ability to IFN-α as well as to IFN-γ. (2 tabs., 1 fig.)
Can Strategies Facilitate Learning from Illustrated Science Texts?
Iding, Marie K.
2000-01-01
Examines the effectiveness of schema training in illustration types and text-illustration relations for learning from college level physiology texts and discusses findings that are consistent with prior research on learning from illustrated materials and with dual coding theory. Considers future directions for strategy training research and…
Dudek, J.; Curien, D.; Dedes, I.; Mazurek, K.; Tagami, S.; Shimizu, Y. R.; Bhattacharjee, T.
2018-02-01
We formulate criteria for identification of the nuclear tetrahedral and octahedral symmetries and illustrate for the first time their possible realization in a rare earth nucleus 152Sm. We use realistic nuclear mean-field theory calculations with the phenomenological macroscopic-microscopic method, the Gogny-Hartree-Fock-Bogoliubov approach, and general point-group theory considerations to guide the experimental identification method as illustrated on published experimental data. Following group theory the examined symmetries imply the existence of exotic rotational bands on whose properties the spectroscopic identification criteria are based. These bands may contain simultaneously states of even and odd spins, of both parities and parity doublets at well-defined spins. In the exact-symmetry limit those bands involve no E 2 transitions. We show that coexistence of tetrahedral and octahedral deformations is essential when calculating the corresponding energy minima and surrounding barriers, and that it has a characteristic impact on the rotational bands. The symmetries in question imply the existence of long-lived shape isomers and, possibly, new waiting point nuclei—impacting the nucleosynthesis processes in astrophysics—and an existence of 16-fold degenerate particle-hole excitations. Specifically designed experiments which aim at strengthening the identification arguments are briefly discussed.
Kim, Dong-Young; Jung, Jung-A; Kim, Tae-Ho; Seo, Sang-Wan; Jung, Sung-Ki; Park, Cheung-Seog
2009-04-21
Uncariae rhynchophylla (UR) is an herb which has blood pressure lowering and anti-inflammatory effects and has been prescribed traditionally to treat stroke and vascular dementia. In the present study, we examined whether UR suppress Atopic dermatitis (AD)-like skin lesions in NC/Nga mice treated with 2, 4-dinitrofluorobenzene (DNFB) under SPF conditions. The effect of UR in DNFB- treated NC/Nga mice was determined by measuring the skin symptom severity, levels of serum IgE, and of the amounts of IL-4 and IFN-gamma secreted by activated T cells in draining lymph nodes. Oral administration of UR to DNFB-treated NC/Nga mice was found to inhibit ear thickness increases and the skin lesions induced by DNFB. IFN-gamma production by CD4+ T cells from the lymph nodes of DNFB-treated NC/Nga mice was significantly inhibited by UR treatment, although levels of IL-4 and total IgE in serum were not. UR may suppress the development of AD-like dermatitis in DNFB-treated NC/Nga mice by reducing IFN-gamma production.
The effects of revised barrier and dummy specification in the side impact test procedure or EuroNCAP
Energy Technology Data Exchange (ETDEWEB)
Waagmeester, C.D.; Versmissen, T.; Ratingen, M.R. van; Zuljar, R. [TNO Automotive, Crash Safety Center, Delft (Netherlands)
2001-07-01
In this paper the effects of potential changes to the side impact test in EuroNCAP are studied. Research in Europe has come to the point that enhanced alternatives will soon become available for the test tools used, in the form of the EUROSID-2 (ES-2), Q child dummies and the progressive MDB barrier. The objective of this study is to illustrate the effect that introduction of the new test tools could have in terms of injury outcome and rating for a typical mid-size family saloon vehicle. For this, a full-scale test, previously carried out as part of the EuroNCAP programme, has been repeated three times replacing the current barrier and/or dummies by the new alternatives. Even though these new tools are designed to meet the existing specifications, the comparison of old and new results show that the end result, i.e. the car rating, may be substantially influenced. For the car tested in this study, the added effect of dummy and barrier change would lower the rating from 14.56 to 11.62 points (91% to 73%). Some small, not critical, values measured with EUROSID-1 (V*C's) increased 500 to 600% by using the new tools. However, the car used in this study would still meet the ECE R95 criteria. Cars that are designed closer to the legislation limits may fail to comply. Comparing the 'New dummies - Old barrier' test with equivalent tests performed in the ES-2 evaluation program show a substantial variation in injury parameter results. Based on the four tests with one car type in this study it can be illustrated that the new barrier may show an undesired increase of crash test results. (orig.)
de Abreu Costa, Lucas; Henrique Fernandes Ottoni, Marcelo; Dos Santos, Michaelle Geralda; Meireles, Agnes Batista; Gomes de Almeida, Valéria; de Fátima Pereira, Wagner; Alves de Avelar-Freitas, Bethânia; Eustáquio Alvim Brito-Melo, Gustavo
2017-11-10
Dimethylsulfoxide (DMSO) is an amphipathic molecule composed of a polar domain characterized by the sulfinyl and two nonpolar methyl groups, for this reason it is able to solubilize polar and nonpolar substances and transpose hydrophobic barriers. DMSO is widely used to solubilize drugs of therapeutic applications and studies indicated that 10% v/v concentration did not modify culture viability when used to treat human peripheral blood mononuclear cells (PBMC). However, some DMSO concentrations could influence lymphocyte activation and present anti-inflammatory effects. Therefore, the objective of this study was to evaluate the effect of DMSO on lymphocyte activation parameters. Cell viability analysis, proliferation, and cytokine production were performed on PBMC from six healthy subjects by flow cytometry. The results indicated that 2.5% v/v DMSO concentrations did not modify lymphocytes viability. DMSO at 1% and 2% v/v concentrations reduced the relative proliferation index of lymphocytes and at 5% and 10% v/v concentrations reduced the percentage of total lymphocytes, cluster of differentiation 4⁺ (CD4⁺) T lymphocytes and CD8⁺ T lymphocytes interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α) and interleukin-2 (IL-2) producers. Thus, it was concluded that DMSO has an in vitro anti-inflammatory effect by reducing lymphocyte activation demonstrated with proliferation reduction and the decrease of cytokine production.
Directory of Open Access Journals (Sweden)
Diana Legarda
2016-06-01
Full Text Available Tumor necrosis factor (TNF induces necroptosis, a RIPK3/MLKL-dependent form of inflammatory cell death. In response to infection by Gram-negative bacteria, multiple receptors on macrophages, including TLR4, TNF, and type I IFN receptors, are concurrently activated, but it is unclear how they crosstalk to regulate necroptosis. We report that TLR4 activates CASPASE-8 to cleave and remove the deubiquitinase cylindromatosis (CYLD in a TRIF- and RIPK1-dependent manner to disable necroptosis in macrophages. Inhibiting CASPASE-8 leads to CYLD-dependent necroptosis caused by the TNF produced in response to TLR4 ligation. While lipopolysaccharides (LPS-induced necroptosis was abrogated in Tnf−/− macrophages, a soluble TNF antagonist was not able to do so in Tnf+/+ macrophages, indicating that necroptosis occurs in a cell-autonomous manner. Surprisingly, TNF-mediated auto-necroptosis of macrophages requires type I IFN, which primes the expression of key necroptosis-signaling molecules, including TNFR2 and MLKL. Thus, the TNF necroptosis pathway is regulated by both negative and positive crosstalk.
Connor, Thomas J; Starr, Neasa; O'Sullivan, Joan B; Harkin, Andrew
2008-08-15
Inflammation-mediated dysregulation of the kynurenine pathway has been implicated as a contributor to a number of major brain disorders. Consequently, we examined the impact of a systemic inflammatory challenge on kynurenine pathway enzyme expression in rat brain. Indoleamine 2,3-dioxygenase (IDO) expression was induced in cortex and hippocampus following systemic lipopolysaccharide (LPS) administration. Whilst IDO expression was paralleled by increased circulating interferon (IFN)-gamma concentrations, IFN-gamma expression in the brain was only modestly altered following LPS administration. In contrast, induction of IDO was associated with increased central tumour necrosis factor (TNF)-alpha and interleukin (IL)-6 expression. Similarly, in cultured glial cells LPS-induced IDO expression was accompanied by increased TNF-alpha and IL-6 expression, whereas IFN-gamma was not detectable. These findings indicate that IFN-gamma is not required for LPS-induced IDO expression in brain. A robust increase in kynurenine-3-monooxygenase (KMO) expression was observed in rat brain 24h post LPS, without any change in kynurenine aminotransferase II (KAT II) expression. In addition, we report that constitutive expression of KAT II is approximately 8-fold higher than KMO in cortex and 20-fold higher in hippocampus. Similarly, in glial cells constitutive expression of KAT II was approximately 16-fold higher than KMO, and expression of KMO but not KAT II was induced by LPS. These data are the first to demonstrate that a systemic inflammatory challenge stimulates KMO expression in brain; a situation that is likely to favour kynurenine metabolism in a neurotoxic direction. However, our observation that expression of KAT II is much higher than KMO in rat brain is likely to counteract potential neurotoxicity that could arise from KMO induction following an acute inflammation.
Radiology illustrated. Hepatobiliary and pancreatic radiology
International Nuclear Information System (INIS)
Choi, Byung Ihn
2014-01-01
Clear, practical guide to the diagnostic imaging of diseases of the liver, biliary tree, gallbladder, pancreas, and spleen. A wealth of carefully selected and categorized illustrations. Highlighted key points to facilitate rapid review. Aid to differential diagnosis. Radiology Illustrated: Hepatobiliary and Pancreatic Radiology is the first of two volumes that will serve as a clear, practical guide to the diagnostic imaging of abdominal diseases. This volume, devoted to diseases of the liver, biliary tree, gallbladder, pancreas, and spleen, covers congenital disorders, vascular diseases, benign and malignant tumors, and infectious conditions. Liver transplantation, evaluation of the therapeutic response of hepatocellular carcinoma, trauma, and post-treatment complications are also addressed. The book presents approximately 560 cases with more than 2100 carefully selected and categorized illustrations, along with key text messages and tables, that will allow the reader easily to recall the relevant images as an aid to differential diagnosis. At the end of each text message, key points are summarized to facilitate rapid review and learning. In addition, brief descriptions of each clinical problem are provided, followed by both common and uncommon case studies that illustrate the role of different imaging modalities, such as ultrasound, radiography, CT, and MRI.
Radiology illustrated. Hepatobiliary and pancreatic radiology
Energy Technology Data Exchange (ETDEWEB)
Choi, Byung Ihn (ed.) [Seoul National Univ. Hospital (Korea, Republic of). Dept. of Radiology
2014-04-01
Clear, practical guide to the diagnostic imaging of diseases of the liver, biliary tree, gallbladder, pancreas, and spleen. A wealth of carefully selected and categorized illustrations. Highlighted key points to facilitate rapid review. Aid to differential diagnosis. Radiology Illustrated: Hepatobiliary and Pancreatic Radiology is the first of two volumes that will serve as a clear, practical guide to the diagnostic imaging of abdominal diseases. This volume, devoted to diseases of the liver, biliary tree, gallbladder, pancreas, and spleen, covers congenital disorders, vascular diseases, benign and malignant tumors, and infectious conditions. Liver transplantation, evaluation of the therapeutic response of hepatocellular carcinoma, trauma, and post-treatment complications are also addressed. The book presents approximately 560 cases with more than 2100 carefully selected and categorized illustrations, along with key text messages and tables, that will allow the reader easily to recall the relevant images as an aid to differential diagnosis. At the end of each text message, key points are summarized to facilitate rapid review and learning. In addition, brief descriptions of each clinical problem are provided, followed by both common and uncommon case studies that illustrate the role of different imaging modalities, such as ultrasound, radiography, CT, and MRI.
Information barriers in the trilateral initiative: Conceptual description
International Nuclear Information System (INIS)
Whiteson, R.; MacArthur, D.W.
1998-01-01
In this paper the authors attempt to define the structure and requirements (both in hardware and software) of an information barrier (IB) for the trilateral initiative. This IB concept will be employed in the radiation measurement instrument(s) used for attribute verification of excess fissile materials offered for international safeguarding. In this paper, they will specifically not attempt to present a list of solutions to the problems, but instead, concentrate on generating a thorough discussion of the goals and problems themselves. In some cases they have presented potential solutions; these discussions are meant as illustrations of the types of systems required and are not intended as endorsements of any particular solution
Dickman, Floyd C.
1998-01-01
Used in picture-book illustration, such techniques as embroidery, applique, wood-block printing, batik, and quilting reflect cultural heritages and add richly textured images to this annotated list of titles for children from preschool through junior high. (Author)
Allergic Rhinitis and Its Relationship with IL-10, IL-17, TGF-β, IFN-γ, IL 22, and IL-35
Directory of Open Access Journals (Sweden)
P. Bayrak Degirmenci
2018-01-01
Full Text Available Background. We aimed in our study to research the role of new cytokines such as IL-35, IL-22, and IL-17 that may form a target for novel treatment approaches. Methods. IL-10, IL-17, TGF-β, IFN-γ, IL-22, and IL-35 serum levels of allergic rhinitis (AR patients were measured using ELISA method. Allergic sensitization was demonstrated by the skin prick test. Patients only with olive tree sensitivity were evaluated for seasonal AR (SAR. Patients only with mite sensitivity were included in the study for perennial AR (PAR. AR clinic severity was demonstrated by the nasal symptom scores (NSS. Results. In total, 65 AR patients (patient group, having 31 PAR and 34 SAR patients, and 31 healthy individuals (control group participated in the study. Cytokine levels between the patient group and the control group were compared; IL-17 (p=0.038, IL-22 (p=0.001, and TGF-β (p=0.031 were detected as high in the patient group, and IFN-γ (p<0.001 was detected as low in the patient group. When correlation analysis was made between age, gender, prick test result, NSS, AR duration, and cytokine levels in the patient group, a negative correlation was detected only between IFN-γ (p=0.032/r=−0.266 level and NSS. Conclusions. Accompanied by the literature information, these results made us think that T cell subgroups and cytokines have an important role in AR immunopathogenesis. It is thought that future studies to be conducted relating to this subject will form new targets in treatment.
Early-life gut bacteria associate with IL-4-, IL-10- and IFN-γ production at two years of age.
Directory of Open Access Journals (Sweden)
Maria A Johansson
Full Text Available Microbial exposure early in life influences immune maturation and potentially also the development of immune-mediated disease. Here we studied early-life gut colonization in relation to cytokine responses at two years of age. Fecal samples were collected from infants during the first two months of life. DNA was extracted from the fecal samples and Bifidobacterium (B. adolescentis, B. breve, B. bifidum, a group of lactobacilli (L. casei, L. paracasei and L. rhamnosus as well as Staphylococcus (S. aureus were detected with real time PCR. Peripheral mononuclear cells were stimulated with phytohaemagglutinin (PHA and numbers of IL-4-, IL-10- and IFN-γ secreting cells were evaluated using ELISpot. We further stimulated peripheral blood mononuclear cells with bacterial supernatants in vitro and assessed the IL-4-, IL-10- and IFN-γ inducing capacity by flow cytometry and ELISA. Early S. aureus colonization associated with higher numbers of IL-4- (p = 0.022 and IL-10 (p = 0.016 producing cells at two years of age. In contrast to colonization with S. aureus alone, co-colonization with lactobacilli associated with suppression of IL-4- (p = 0.004, IL-10- (p = 0.004 and IFN-γ (p = 0.034 secreting cells. In vitro stimulations of mononuclear cells with bacterial supernatants supported a suppressive role of L. rhamnosus GG on S. aureus-induced cytokine responses. We demonstrate that the early gut colonization pattern associates with the PHA-induced cytokine profile at two years of age and our in vitro findings support that specific bacterial species influence the T helper cell subsets. This suggests that dysbiosis in the early microbiota may modulate the risk of developing inflammatory conditions like allergy.
The use of transparent media in medical illustration.
Winn, W M
1978-03-01
Transparent media, such as watercolor, acrylic, and dyes, have been used by scientific illustrators for centuries. This article gives one artist's view of the highly complex medium. Materials, techniques, short cuts, and potential problem areas are discussed. Illustrations of specific techniques and a step-by-step development of a medical illustration is provided.
Preparing Colorful Astronomical Images and Illustrations
Levay, Z. G.; Frattare, L. M.
2001-12-01
We present techniques for using mainstream graphics software, specifically Adobe Photoshop and Illustrator, for producing composite color images and illustrations from astronomical data. These techniques have been used with numerous images from the Hubble Space Telescope to produce printed and web-based news, education and public presentation products as well as illustrations for technical publication. While Photoshop is not intended for quantitative analysis of full dynamic range data (as are IRAF or IDL, for example), we have had much success applying Photoshop's numerous, versatile tools to work with scaled images, masks, text and graphics in multiple semi-transparent layers and channels. These features, along with its user-oriented, visual interface, provide convenient tools to produce high-quality, full-color images and graphics for printed and on-line publication and presentation.
Curry, Leslie; Taylor, Lauren; Pallas, Sarah Wood; Cherlin, Emily; Pérez-Escamilla, Rafael; Bradley, Elizabeth H
2013-08-02
Use of depot medroxyprogesterone acetate (DMPA), often known by the brand name Depo-Provera, has increased globally, particularly in multiple low- and middle-income countries (LMICs). As a reproductive health technology that has scaled up in diverse contexts, DMPA is an exemplar product innovation with which to illustrate the utility of the AIDED model for scaling up family health innovations. We conducted a systematic review of the enabling factors and barriers to scaling up DMPA use in LMICs. We searched 11 electronic databases for academic literature published through January 2013 (n = 284 articles), and grey literature from major health organizations. We applied exclusion criteria to identify relevant articles from peer-reviewed (n = 10) and grey literature (n = 9), extracting data on scale up of DMPA in 13 countries. We then mapped the resulting factors to the five AIDED model components: ASSESS, INNOVATE, DEVELOP, ENGAGE, and DEVOLVE. The final sample of sources included studies representing variation in geographies and methodologies. We identified 15 enabling factors and 10 barriers to dissemination, diffusion, scale up, and/or sustainability of DMPA use. The greatest number of factors were mapped to the ASSESS, DEVELOP, and ENGAGE components. Findings offer early empirical support for the AIDED model, and provide insights into scale up of DMPA that may be relevant for other family planning product innovations.
Orr, Selinda J.; Burg, Ashley R.; Chan, Tim; Quigley, Laura; Jones, Gareth W.; Ford, Jill W.; Hodge, Deborah; Razzook, Catherine; Sarhan, Joseph; Jones, Yava L.; Whittaker, Gillian C.; Boelte, Kimberly C.; Lyakh, Lyudmila; Cardone, Marco; O'Connor, Geraldine M.; Tan, Cuiyan; Li, Hongchuan; Anderson, Stephen K.; Jones, Simon A.; Zhang, Weiguo; Taylor, Philip R.; Trinchieri, Giorgio; McVicar, Daniel W.
2013-01-01
Fungal pathogens elicit cytokine responses downstream of immunoreceptor tyrosine-based activation motif (ITAM)-coupled or hemiITAM-containing receptors and TLRs. The Linker for Activation of B cells/Non-T cell Activating Linker (LAB/NTAL) encoded by Lat2, is a known regulator of ITAM-coupled receptors and TLR-associated cytokine responses. Here we demonstrate that LAB is involved in anti-fungal immunity. We show that Lat2 −/− mice are more susceptible to C. albicans infection than wild type (WT) mice. Dendritic cells (DCs) express LAB and we show that it is basally phosphorylated by the growth factor M-CSF or following engagement of Dectin-2, but not Dectin-1. Our data revealed a unique mechanism whereby LAB controls basal and fungal/pathogen-associated molecular patterns (PAMP)-induced nuclear β-catenin levels. This in turn is important for controlling fungal/PAMP-induced cytokine production in DCs. C. albicans- and LPS-induced IL-12 and IL-23 production was blunted in Lat2−/− DCs. Accordingly, Lat2−/− DCs directed reduced Th1 polarization in vitro and Lat2 −/− mice displayed reduced Natural Killer (NK) and T cell-mediated IFN-γ production in vivo/ex vivo. Thus our data define a novel link between LAB and β-catenin nuclear accumulation in DCs that facilitates IFN-γ responses during anti-fungal immunity. In addition, these findings are likely to be relevant to other infectious diseases that require IL-12 family cytokines and an IFN-γ response for pathogen clearance. PMID:23675302
DEFF Research Database (Denmark)
Mikkelsen, Heidi; Aagaard, Claus; Nielsen, Søren Saxmose
2012-01-01
Paratuberculosis is a chronic infection of the intestine of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP). Early stage MAP infection can be detected by measuring cell-mediated immune responses using the interferon gamma (IFN-γ) assay. Whole blood samples are cultured...... to enhance IFN-γ responses of cultures stimulated with Johnin purified protein derivative (PPDj). Here we examined the correlation of IFN-γ production in response to PPDj and 15 recombinant antigens in day-old blood samples from heifers 10–21 months of age from a MAP infected herd with addition of either...... overnight with specific MAP antigens followed by quantification of IFN-γ by ELISA. It is recommended that the time interval from sampling to culture does not exceed eight hours but addition of the co-stimulating cytokine interleukin 12 (IL-12) or anti-IL-10 antibodies to culture have been demonstrated...
Pharmacogenetics in Europe: barriers and opportunities.
Gurwitz, D; Zika, E; Hopkins, M M; Gaisser, S; Ibarreta, D
2009-01-01
This paper reviews the current situation in the field of pharmacogenetics/pharmacogenomics (PGx) in Europe. High expectations surrounding the clinical application of PGx remain largely unmet, as only a limited number of such applications have actually reached the market and clinical practice. Thus, the potential impact of PGx-based diagnostics on healthcare and its socio-economic implications are still unclear. With the aim of shedding some light on these uncertainties, the Institute for Prospective Technological Studies (IPTS) of the European Commission's Joint Research Centre (JRC) has conducted a review of the 'state of the art' and a further analysis on the use of pharmacogenetics diagnostics for preventing toxic drug reactions and improving drug efficacy in Europe. The paper presents highlights from the JRC-IPTS studies and discusses possibilities for improving translation of PGx research in Europe by comparing some experiences in the USA. We also illustrate the related barriers for the clinical uptake of PGx in Europe with specific case-studies. Most of the barriers identified extend beyond the European context. This reflects the global problems of scarcity of data demonstrating proven clinical validity or utility and favorable cost-effectiveness studies to support the clinical application of PGx diagnostic tests in the clinical setting. Another key barrier is the lack of incentives for the private sector to invest in the development and licensing of PGx diagnostic tests for improving the safety and efficacy of out-of-patent drugs. It therefore seems that one key aspect where policy can affect the clinical uptake of PGx is via sustaining large-scale industry-academia collaborations for developing and proving the utility of PGx diagnostics. Copyright 2009 S. Karger AG, Basel.
Fernandez, Melissa Anne; Desroches, Sophie; Marquis, Marie; Turcotte, Mylène; Provencher, Véronique
2017-09-01
To identify facilitators and barriers that Health Canada's (HC) cross-sector partners experienced while implementing the Eat Well Campaign: Food Skills (EWC; 2013-2014) and describe how these experiences might differ according to distinct partner types. A qualitative study using hour-long semi-structured telephone interviews conducted with HC partners that were transcribed verbatim. Facilitators and barriers were identified inductively and analysed according partner types. Implementation of a national mass-media health education campaign. Twenty-one of HC's cross-sector partners (food retailers, media and health organizations) engaged in the EWC. Facilitators and barriers were grouped into seven major themes: operational elements, intervention factors, resources, collaborator traits, developer traits, partnership factors and target population factors. Four of these themes had dual roles as both facilitators and barriers (intervention factors, resources, collaborator traits and developer traits). Sub-themes identified as both facilitators and barriers illustrate the extent to which a facilitator can easily become a barrier. Partnership factors were unique facilitators, while operational and target population factors were unique barriers. Time was a barrier that was common to almost all partners regardless of partnership type. There appeared to be a greater degree of uniformity among facilitators, whereas barriers were more diverse and unique to the realities of specific types of partner. Collaborative planning will help public health organizations anticipate barriers unique to the realities of specific types of organizations. It will also prevent facilitators from becoming barriers. Advanced planning will help organizations manage time constraints and integrate activities, facilitating implementation.
Energy Technology Data Exchange (ETDEWEB)
Antonio, Raphaela N.; Rotunno Filho, Otto C. [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia. Lab. de Hidrologia e Estudos do Meio Ambiente]. E-mail: otto@hidro.ufrj.br; Ruperti Junior, Nerbe J.; Lavalle Filho, Paulo F. Heilbron [Comissao Nacional de Energia Nuclear (CNEN), Rio de Janeiro, RJ (Brazil)]. E-mail: nruperti@cnen.gov.br
2005-07-01
This work proposes a mathematical model for the performance assessment of a typical radioactive waste disposal facility based on the consideration of a multiple barrier concept. The Generalized Integral Transform Technique is employed to solve the Advection-Dispersion mass transfer equation under the assumption of saturated one-dimensional flow, to obtain solute concentrations at given times and locations within the medium. A test-case is chosen in order to illustrate the performance assessment of several configurations of a multi barrier system adopted for the containment of sand contaminated with Ra-226 within a trench. (author)
International Nuclear Information System (INIS)
Antonio, Raphaela N.; Rotunno Filho, Otto C.
2005-01-01
This work proposes a mathematical model for the performance assessment of a typical radioactive waste disposal facility based on the consideration of a multiple barrier concept. The Generalized Integral Transform Technique is employed to solve the Advection-Dispersion mass transfer equation under the assumption of saturated one-dimensional flow, to obtain solute concentrations at given times and locations within the medium. A test-case is chosen in order to illustrate the performance assessment of several configurations of a multi barrier system adopted for the containment of sand contaminated with Ra-226 within a trench. (author)
Barriers to adopting a healthy lifestyle: insight from postpartum women
Directory of Open Access Journals (Sweden)
Krause Katrina M
2009-08-01
Full Text Available Abstract Background Postpartum weight retention can contribute to obesity. There may be unique barriers to weight loss in this period. Findings Cases are presented for three postpartum women who declined to participate in a postpartum weight loss intervention. Despite their desire to engage in healthier behaviors, or partake in an intervention uniquely designed to promote healthy lifestyles for postpartum women, some find it too difficult to make such commitments. Barriers women face in adopting a healthier lifestyle in this period include 1 time availability; 2 prioritizing other competing life responsibilities above their own health; 3 support from family members, friends, and/or co-workers; and 4 lack of flexibility in the intervention structure. These illustrations describe their perspectives in the context of life balance, perceived health, and support, and reflect the multi-dimensional nature of their lives during the life cycle change of the postpartum period. Conclusion Postpartum women face difficult and complex challenges to prioritizing their health and their weight management.
Encouraging a 'Barrier-free Built Environment' in a Malaysian University
Directory of Open Access Journals (Sweden)
Hazreena Hussein
2005-12-01
Full Text Available A good pedestrian network around the campus should be accessible and friendly for all users including disabled persons. The environment should offer some activity nodes to ensure that the learning and working in campus is more pleasant. The paper will clarify the importance of collaborative development among various professionals and organisations in order to achieve a 'barrier-free built environment', focusing on the University of Malaya as a case study. It will share experience on the education of inclusive design for students who will become professionals and responsible in implementing the legislation relating to safety, accessibility and usability of the built environment. As the objective is the issue of educating relevant professionals, it will introduce methods in teaching professionals as a strategy to advocate a 'barrier-free built environment'. The paper will also illustrate the efforts done in encouraging the agenda which have been implemented around the case study.
Bordignon, Valentina; Palamara, Francesca; Cordiali-Fei, Paola; Vento, Antonella; Aiello, Arianna; Picardo, Mauro; Ensoli, Fabrizio; Cristaudo, Antonio
2008-01-01
Background Recent attempts to diminish nickel use in most industrial products have led to an increasing utilization of alternative metal compounds for destinations such as the alloys used in orthopaedics, jewellery and dentistry. The present study was undertaken with the aim to evaluate the potential for an allergic response to nickel, palladium and rhodium on the basis of antigen-specific induction of inflammatory/regulatory cytokines, and to characterize, according to the cytokine profiles, the nature of simultaneous positive patch tests elicited in vivo. Peripheral blood mononuclear cells (PBMC) from 40 patients with different patch test results were kept in short term cultures in the presence of optimized concentrations of NiSO4 × 6H2O, PdCl2 and Rh(CH3COO)2. The production of IFN-γ and IL-10 elicited by metal compounds were analyzed by the ELISpot assay. Results We found a specific IFN-γ response by PBMC upon in vitro stimulation with nickel or palladium in well recognized allergic individuals. All controls with a negative patch test to a metal salt showed an in vitro IL-10 response and not IFN-γ production when challenged with the same compound. Interestingly, all subjects with positive patch test to both nickel and palladium (group 3) showed an in vitro response characterized by the release of IFN-γ after nickel stimulation and production of IL-10 in response to palladium. Conclusion These results strongly suggest that the different cytokine profiles elicited in vitro reflect different immune responses which may lead to the control of the allergic responses or to symptomatic allergic contact dermatitis. The development of sensitive and specific in vitro assays based on the determination of the cytokine profiles in response to contact allergens may have important diagnostic and prognostic implications and may prove extremely useful in complementing the diagnostic limits of traditional patch testing. PMID:18482439
Directory of Open Access Journals (Sweden)
Ensoli Fabrizio
2008-05-01
Full Text Available Abstract Background Recent attempts to diminish nickel use in most industrial products have led to an increasing utilization of alternative metal compounds for destinations such as the alloys used in orthopaedics, jewellery and dentistry. The present study was undertaken with the aim to evaluate the potential for an allergic response to nickel, palladium and rhodium on the basis of antigen-specific induction of inflammatory/regulatory cytokines, and to characterize, according to the cytokine profiles, the nature of simultaneous positive patch tests elicited in vivo. Peripheral blood mononuclear cells (PBMC from 40 patients with different patch test results were kept in short term cultures in the presence of optimized concentrations of NiSO4 × 6H2O, PdCl2 and Rh(CH3COO2. The production of IFN-γ and IL-10 elicited by metal compounds were analyzed by the ELISpot assay. Results We found a specific IFN-γ response by PBMC upon in vitro stimulation with nickel or palladium in well recognized allergic individuals. All controls with a negative patch test to a metal salt showed an in vitro IL-10 response and not IFN-γ production when challenged with the same compound. Interestingly, all subjects with positive patch test to both nickel and palladium (group 3 showed an in vitro response characterized by the release of IFN-γ after nickel stimulation and production of IL-10 in response to palladium. Conclusion These results strongly suggest that the different cytokine profiles elicited in vitro reflect different immune responses which may lead to the control of the allergic responses or to symptomatic allergic contact dermatitis. The development of sensitive and specific in vitro assays based on the determination of the cytokine profiles in response to contact allergens may have important diagnostic and prognostic implications and may prove extremely useful in complementing the diagnostic limits of traditional patch testing.
Women in healthcare: barriers and enablers from a developing country perspective.
Tlaiss, Hayfaa A
2013-06-01
As the under-representation of women in management positions continues to persist globally, little is known about the experiences of women in the healthcare sector in the context of the developing Middle Eastern nations. In an attempt to address this knowledge gap, the current study explores some of the barriers that hinder and the enablers that foster women's career advancement in the healthcare sector. To meet its objectives, the current study uses a relational approach that integrates the macro socio-cultural, meso-organisational, and micro-individual levels of analysis. Guided by institutional theory as a theoretical framework and social constructionism as a philosophical stance, the current study adopts a qualitative research methodology. It capitalizes on in-depth, semi-structured, face-to-face interviews with women managers in different occupational fields, across the managerial hierarchy in the healthcare sector in Lebanon. Snowballing and purposeful sampling procedures were used, and the interviews were analysed using thematic analysis, focusing on identifying new, emerging themes. The results of the study confirm the salience of discriminatory cultural values, gendered social roles and expectations in Middle Eastern societies, and illustrate their role as barriers hindering women's career advancement. The results also portray the spillover effect of societal expectations and cultural gender stereotypes into the organisational realm, resulting in widely experienced attitudinal and structural organisational barriers. This study also illustrates how the enablers that facilitate and promote women's career progression unfold amidst the interplay between the macro and meso factors, lending credence to the role of women's agency at the individual micro level. Amongst the toll of barriers, Middle Eastern women navigate the patriarchy of their cultures and the discrimination inherent in their organisations by using their agency and persistence as they construct
Domínguez, Alazne; Álvarez, Antonia; Suárez-Merino, Blanca; Goñi-de-Cerio, Felipe
2014-03-01
The incidence in the central nervous system diseases has increased with a growing elderly population. Unfortunately, conventional treatments used to treat the mentioned diseases are frequently ineffective due to the presence of the blood brain barrier. To illustrate the blood-brain barrier properties that limit drug transport into the brain and the main strategies employed to treat neurologic disorders. The blood-brain barrier is mainly composed of a specialized microvascular endothelium and of glial cells. It constitutes a valuable tool to separate the central nervous system from the rest of the body. Nevertheless, it also represents an obstacle to the delivery of therapeutic drugs to the brain. To be effective, drugs must reach their target in the brain. On one hand, therapeutic agents could be designed to be able to cross the blood brain barrier. On the other hand, drug delivery systems could be employed to facilitate the therapeutic agents' entry into the central nervous system. In vivo models of neurological diseases, in addition to in vitro models of the blood brain barrier, have been widely employed for the evaluation of drugs utilized to treat central nervous system diseases.
2017-01-01
Illustration de couverture : Lyon, cathédrale Saint-Jean, culée de l’arc-boutant 2/3 : David (XIIIe siècle) surgissant de l’échafaudage (XXIe siècle). Photo Jean-Pierre Gobillot. Illustration de la quatrième de couverture : Lyon, cathédrale Saint-Jean, arcature extérieure de l’abside, chapiteau central. Dessin Ghislaine Macabéo. Photos Jean-Pierre Gobillot : fig. 1, 2, 10, 13, 14, 16, 23, 28, 29, 34, 35, 36, 37, 40, 41, 46, 54, 55, 56, 59, 60, 67, 76a, 78, 80, 82, 83, 88, 90, 97, 105, 106, 11...
International Nuclear Information System (INIS)
Neuwelt, E.A.; Specht, H.D.; Howieson, J.; Haines, J.E.; Bennett, M.J.; Hill, S.A.; Frenkel, E.P.
1983-01-01
Results of initial clinical trials of brain tumor chemotherapy after osmotic blood-brain barrier disruption are promising. In general, the procedure is well tolerated. The major complication has been seizures. In this report, data are presented which indicate that the etiology of these seizures is related to the use of contrast agent (meglumine iothalamate) to monitor barrier modification. A series of 19 patients underwent a total of 85 barrier modification procedures. Documentation of barrier disruption was monitored by contrast-enhanced computed tomographic (CT) scanning, radionuclide brain scanning, or a combination of both techniques. In 56 procedures (19 patients) monitored by enhanced CT, seizures occurred a total of 10 times in eight patients. Twenty-three barrier modification procedures (in nine of these 19 patients) documented by nuclear brain scans alone, however, resulted in only one focal motor seizure in each of two patients. In eight of the 19 patients who had seizures after barrier disruption and enhanced CT scan, four subsequently had repeat procedures monitored by radionuclide scan alone. In only one of these patients was further seizure activity noted; a single focal motor seizure was observed. Clearly, the radionuclide brain scan does not have the sensitivity and spatial resolution of enhanced CT, but at present it appears safer to monitor barrier modification by this method and to follow tumor growth between barrier modifications by enhanced CT. Four illustrative cases showing methods, problems, and promising results are presented
Directory of Open Access Journals (Sweden)
Darunee Hunwisai
2017-01-01
Full Text Available In this work, we considered two-person zero-sum games with fuzzy payoffs and matrix games with payoffs of trapezoidal intuitionistic fuzzy numbers (TrIFNs. The concepts of TrIFNs and their arithmetic operations were used. The cut-set based method for matrix game with payoffs of TrIFNs was also considered. Compute the interval-type value of any alfa-constrategies by simplex method for linear programming. The proposed method is illustrated with a numerical example.
Experimental Neuromyelitis Optica Induces a Type I Interferon Signature in the Spinal Cord
Kaufmann, Nathalie; Zeka, Bleranda; Schanda, Kathrin; Fujihara, Kazuo; Illes, Zsolt; Dahle, Charlotte; Reindl, Markus; Lassmann, Hans; Bradl, Monika
2016-01-01
Neuromyelitis optica (NMO) is an acute inflammatory disease of the central nervous system (CNS) which predominantly affects spinal cord and optic nerves. Most patients harbor pathogenic autoantibodies, the so-called NMO-IgGs, which are directed against the water channel aquaporin 4 (AQP4) on astrocytes. When these antibodies gain access to the CNS, they mediate astrocyte destruction by complement-dependent and by antibody-dependent cellular cytotoxicity. In contrast to multiple sclerosis (MS) patients who benefit from therapies involving type I interferons (I-IFN), NMO patients typically do not profit from such treatments. How is I-IFN involved in NMO pathogenesis? To address this question, we made gene expression profiles of spinal cords from Lewis rat models of experimental neuromyelitis optica (ENMO) and experimental autoimmune encephalomyelitis (EAE). We found an upregulation of I-IFN signature genes in EAE spinal cords, and a further upregulation of these genes in ENMO. To learn whether the local I-IFN signature is harmful or beneficial, we induced ENMO by transfer of CNS antigen-specific T cells and NMO-IgG, and treated the animals with I-IFN at the very onset of clinical symptoms, when the blood-brain barrier was open. With this treatment regimen, we could amplify possible effects of the I-IFN induced genes on the transmigration of infiltrating cells through the blood brain barrier, and on lesion formation and expansion, but could avoid effects of I-IFN on the differentiation of pathogenic T and B cells in the lymph nodes. We observed that I-IFN treated ENMO rats had spinal cord lesions with fewer T cells, macrophages/activated microglia and activated neutrophils, and less astrocyte damage than their vehicle treated counterparts, suggesting beneficial effects of I-IFN. PMID:26990978
Directory of Open Access Journals (Sweden)
Huang Jun
2012-09-01
Full Text Available Abstract Background Severe acute respiratory syndrome (SARS is an emerging infectious disease caused by the novel coronavirus SARS-CoV. The T cell epitopes of the SARS CoV spike protein are well known, but no systematic evaluation of the functional and structural roles of each residue has been reported for these antigenic epitopes. Analysis of the functional importance of side-chains by mutational study may exaggerate the effect by imposing a structural disturbance or an unusual steric, electrostatic or hydrophobic interaction. Results We demonstrated that N50 could induce significant IFN-gamma response from SARS-CoV S DNA immunized mice splenocytes by the means of ELISA, ELISPOT and FACS. Moreover, S366-374 was predicted to be an optimal epitope by bioinformatics tools: ANN, SMM, ARB and BIMAS, and confirmed by IFN-gamma response induced by a series of S358-374-derived peptides. Furthermore, each of S366-374 was replaced by alanine (A, lysine (K or aspartic acid (D, respectively. ANN was used to estimate the binding affinity of single S366-374 mutants to H-2 Kd. Y367 and L374 were predicated to possess the most important role in peptide binding. Additionally, these one residue mutated peptides were synthesized, and IFN-gamma production induced by G368, V369, A371, T372 and K373 mutated S366-374 were decreased obviously. Conclusions We demonstrated that S366-374 is an optimal H-2 Kd CTL epitope in the SARS CoV S protein. Moreover, Y367, S370, and L374 are anchors in the epitope, while C366, G368, V369, A371, T372, and K373 may directly interact with TCR on the surface of CD8-T cells.
Alharbi, Abdulrazaq M.
2016-05-06
Various methods and systems are provided for smart parking barriers. In one example, among others, a smart parking barrier system includes a movable parking barrier located at one end of a parking space, a barrier drive configured to control positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking space and a second position that allows access to the parking space. The parking controller can initiate movement of the movable parking barrier in response to a positive identification of an individual allowed to use the parking space. The parking controller can identify the individual through, e.g., a RFID tag, a mobile device (e.g., a remote control, smartphone, tablet, etc.), an access card, biometric information, or other appropriate identifier.
A decision model to allocate protective safety barriers and mitigate domino effects
International Nuclear Information System (INIS)
Janssens, Jochen; Talarico, Luca; Reniers, Genserik; Sörensen, Kenneth
2015-01-01
In this paper, we present a model to support decision-makers about where to locate safety barriers and mitigate the consequences of an accident triggering domino effects. Based on the features of an industrial area that may be affected by domino accidents, and knowing the characteristics of the safety barriers that can be installed to stall the fire propagation between installations, the decision model can help practitioners in their decision-making. The model can be effectively used to decide how to allocate a limited budget in terms of safety barriers. The goal is to maximize the time-to-failure of a chemical installation ensuring a worst case scenario approach. The model is mathematically stated and a flexible and effective solution approach, based on metaheuristics, is developed and tested on an illustrative case study representing a tank storage area of a chemical company. We show that a myopic optimization approach, which does not take into account knock-on effects possibly triggered by an accident, can lead to a distribution of safety barriers that are not effective in mitigating the consequences of a domino accident. Moreover, the optimal allocation of safety barriers, when domino effects are considered, may depend on the so-called cardinality of the domino effects. - Highlights: • A model to allocate safety barriers and mitigate domino effects is proposed. • The goal is to maximize the escalation time of the worst case scenario. • The model provides useful recommendations for decision makers. • A fast metaheuristic approach is proposed to solve such a complex problem. • Numerical simulations on a realistic case study are shown
Chaotic correlations in barrier billiards with arbitrary barriers
International Nuclear Information System (INIS)
Osbaldestin, A H; Adamson, L N C
2013-01-01
We study autocorrelation functions in symmetric barrier billiards for golden mean trajectories with arbitrary barriers. Renormalization analysis reveals the presence of a chaotic invariant set and thus that, for a typical barrier, there are chaotic correlations. The chaotic renormalization set is the analogue of the so-called orchid that arises in a generalized Harper equation. (paper)
Shi, Jun; Ge, Meili; Li, Xingxin; Shao, Yingqi; Yao, Jianfeng; Zheng, Yizhou
2014-01-01
Idiopathic aplastic anemia (AA) is an immune-mediated bone marrow failure syndrome. Immune abnormalities such as decreased lymphocyte counts, inverted CD4/CD8 T-cell ratio and increased IFN-γ-producing T cells have been found in AA. CD30, a surface protein belonging to the tumor necrosis factor receptor family and releasing from cell surface as a soluble form (sCD30) after activation, marks a subset of activated T cells secreting IFN-γ when exposed to allogeneic antigens. Our study found elevated BM plasma levels of sCD30 in patients with SAA, which were closely correlated with disease severity, including absolute lymphocyte count (ALC) and absolute netrophil count (ANC). We also noted that sCD30 levels were positively correlated with plasma IFN-γ levels and CD4/CD8 T-cell ratio in patients with SAA. In order to explain these phenomena, we stimulated T cells with alloantigen in vitro and found that CD30+ T cells were the major source of IFN-γ, and induced CD30+ T cells from patients with SAA produced significantly more IFN-γ than that from healthy individuals. In addition, increased proportion of CD8+ T cells in AA showed enhanced allogeneic response by the fact that they expressed more CD30 during allogeneic stimulation. sCD30 levels decreased in patients responded to immunosuppressive therapy. In conclusion, elevated BM plasma levels of sCD30 reflected the enhanced CD30+ T cell-mediated immune response in SAA. CD30 as a molecular marker that transiently expresses on IFN-γ-producing T cells, may participate in mediating bone marrow failure in AA, which also can facilitate our understanding of AA pathogenesis to identify new therapeutic targets. PMID:25383872
Martina C. Cornel; Carla G. van El
2017-01-01
More than 15 years after the publication of the sequence of the human genome, the resulting changes in health care have been modest. At the same time, some promising examples in genetic services become visible, which contribute to the prevention of chronic disease such as cancer. These are discussed to identify barriers and facilitating factors for the implementation of genetic services. Examples from oncogenetics illustrate a high risk of serious disease where prevention is possible, especia...
Quast, Stefan; Zhang, Wenji; Shive, Carey; Kovalovski, Damian; Ott, Patrick A; Herzog, Bernhard A; Boehm, Bernhard O; Tary-Lehmann, Magdalena; Karulin, Alexey Y; Lehmann, Paul V
2005-09-01
Cytokine assays are gaining increasing importance for human immune monitoring because they reliably detect antigen-specific T cells in primary PBMC, even at low clonal sizes. Double color ELISPOT assays permit the simultaneous visualization of cells producing two different cytokines. Permitting the simultaneous assessment of type 1 and 2 immunity and due to the limited numbers of PBMC available from human study subjects, double color assays should be particularly attractive for clinical trials. Since the performance of double color assays has not yet been validated, we set out to compare them to single color measurements. Testing the recall antigen-induced cytokine response of PBMC, we found that double color assays regularly provided lower numbers of IFN-gamma and IL-5 spots than single color measurements when IL-2 detection was part of the double color assay. We showed that the inhibitory effect resulted from IL-2 absorption and could be overcome by either antibody free preactivation cultures or by inclusion of anti-CD28 antibody. In contrast, the simultaneous detection of IL-2 did not affect the numbers of IL-4 spots. Therefore, unlike IL-2/IL-4 and IFN-gamma/IL-5 assays, IL-2/IFN-gamma, and IL-2/IL-5 assays require compensation for the IL-2 capture to provide accurate numbers for the frequencies of cytokine producing memory T cells.
Rushmer, Rosemary; Shucksmith, Janet
2018-01-01
In this paper the development of askFuse is used as a case study to illustrate contextual and system barriers to universities providing useful, usable and timely research evidence in response to local practice and policy partners' stated public health research needs. Entrenched systems (research excellence framework, academic career pathways,…
Directory of Open Access Journals (Sweden)
Michael Winkler
Full Text Available The interferon-induced host cell factor tetherin inhibits release of human immunodeficiency virus (HIV from the plasma membrane of infected cells and is counteracted by the HIV-1 protein Vpu. Influenza A virus (FLUAV also buds from the plasma membrane and is not inhibited by tetherin. Here, we investigated if FLUAV encodes a functional equivalent of Vpu for tetherin antagonism. We found that expression of the FLUAV protein NS1, which antagonizes the interferon (IFN response, did not block the tetherin-mediated restriction of HIV release, which was rescued by Vpu. Similarly, tetherin-mediated inhibition of HIV release was not rescued by FLUAV infection. In contrast, FLUAV infection induced tetherin expression on target cells in an IFN-dependent manner. These results suggest that FLUAV escapes the antiviral effects of tetherin without encoding a tetherin antagonist with Vpu-like activity.
Alharbi, Abdulrazaq M.
2016-01-01
positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking
THE ANALYSIS OF ILLUSTRATIONS IN THE FOURTH CLASS GEOGRAPHY TEXTBOOKS
Directory of Open Access Journals (Sweden)
IOANA CHIRCEV
2014-01-01
Full Text Available This study focuses on the analysis of the illustrations found in five different Geography textbooks in Romania. The analysis is based on several criteria: number, size, clarity, pedagogical usefulness. The following conclusions have been drawn: the illustrations are numerous; most of the illustrations are too small and unclear to be efficiently used in the teaching activity; the purpose of some materials is purely illustrative; some illustrations are overcharged with details, which prevent children from understanding them. Authors and publishing houses are advised to choose the illustrations in the fourth class Geography textbooks more carefully.
In the Artist's Studio with L'Illustration
Directory of Open Access Journals (Sweden)
Esner, Rachel
2013-03-01
Full Text Available This article explores the two series of visits to the artist's studio that appeared in the famed French illustrated magazine L'Illustration in the 1850s and in 1886. An in-depth examination of both the texts and images reveals the verbal and visual tropes used to characterize the artists and their spaces, linking these to broader notions of "the artist" – his moral characteristics, behaviors, and artistic practice – as well as to the politics of the art world and the (bourgeois ideology of L'Illustration. The aim is to uncover not only the language but also the mechanics of the "mediatization" of the image of the artist in this crucial period.
Li, Nan; Mruk, Dolores D; Mok, Ka-Wai; Li, Michelle W M; Wong, Chris K C; Lee, Will M; Han, Daishu; Silvestrini, Bruno; Cheng, C Yan
2016-04-01
Earlier studies have shown that rats treated with an acute dose of 1-(2,4-dichlorobenzyl)-1H-indazole-3-carbohydrazide (adjudin, a male contraceptive under development) causes permanent infertility due to irreversible blood-testis barrier (BTB) disruption even though the population of undifferentiated spermatogonia remains similar to normal rat testes, because spermatogonia fail to differentiate into spermatocytes to enter meiosis. Since other studies have illustrated the significance of connexin 43 (Cx43)-based gap junction in maintaining the homeostasis of BTB in the rat testis and the phenotypes of Sertoli cell-conditional Cx43 knockout mice share many of the similarities of the adjudin-treated rats, we sought to examine if overexpression of Cx43 in these adjudin-treated rats would reseal the disrupted BTB and reinitiate spermatogenesis. A full-length Cx43 cloned into mammalian expression vector pCI-neo was used to transfect testes of adjudin-treated ratsversusempty vector. It was found that overexpression of Cx43 indeed resealed the Sertoli cell tight junction-permeability barrier based on a functionalin vivoassay in tubules displaying signs of meiosis as noted by the presence of round spermatids. Thus, these findings suggest that overexpression of Cx43 reinitiated spermatogenesis at least through the steps of meiosis to generate round spermatids in testes of rats treated with an acute dose of adjudin that led to aspermatogenesis. It was also noted that the round spermatids underwent eventual degeneration with the formation of multinucleated cells following Cx43 overexpression due to the failure of spermiogenesis because no elongating/elongated spermatids were detected in any of the tubules examined. The mechanism by which overexpression of Cx43 reboots meiosis and rescues BTB function was also examined. In summary, overexpression of Cx43 in the testis with aspermatogenesis reboots meiosis and reseals toxicant-induced BTB disruption, even though it fails to
Velásquez, Lis N; Milillo, M Ayelén; Delpino, M Victoria; Trotta, Aldana; Fernández, Pablo; Pozner, Roberto G; Lang, Roland; Balboa, Luciana; Giambartolomei, Guillermo H; Barrionuevo, Paula
2017-03-01
Brucella abortus is an intracellular pathogen capable of surviving inside of macrophages. The success of B. abortus as a chronic pathogen relies on its ability to orchestrate different strategies to evade the adaptive CD4 + T cell responses that it elicits. Previously, we demonstrated that B. abortus inhibits the IFN-γ-induced surface expression of MHC class II (MHC-II) molecules on human monocytes, and this phenomenon correlated with a reduction in antigen presentation. However, the molecular mechanisms, whereby B. abortus is able to down-regulate the expression of MHC-II, remained to be elucidated. In this study, we demonstrated that B. abortus infection inhibits the IFN-γ-induced transcription of MHC-II, transactivator (CIITA) and MHC-II genes. Accordingly, we observed that the synthesis of MHC-II proteins was also diminished. B. abortus was not only able to reduce the expression of mature MHC-II, but it also inhibited the expression of invariant chain (Ii)-associated immature MHC-II molecules. Outer membrane protein 19 (Omp19), a prototypical B. abortus lipoprotein, diminished the expression of MHC-II and CIITA transcripts to the same extent as B. abortus infection. IL-6 contributes to these down-regulatory phenomena. In addition, B. abortus and its lipoproteins, through IL-6 secretion, induced the transcription of the negative regulators of IFN-γ signaling, suppressor of cytokine signaling (SOCS)-1 and -3, without interfering with STAT1 activation. Yet, B. abortus lipoproteins via IL-6 inhibit the expression of IFN regulatory factor 1 (IRF-1), a critical regulatory transcription factor for CIITA induction. Overall, these results indicate that B. abortus inhibits the expression of MHC-II molecules at very early points in their synthesis and in this way, may prevent recognition by T cells establishing a chronic infection. © Society for Leukocyte Biology.
Efecto de la maca roja (Lepidium meyenii) sobre los niveles de IFN-γ en ratas ovariectomizadas
Leiva-Revilla, Johanna; Laboratorio de Endocrinología y Reproducción, Facultad de Ciencias y Filosofía. Universidad Peruana Cayetano Heredia. Lima-Perú. Departamento de Ciencias Biológicas y Fisiológicas, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia. Lima-Perú.; Guerra-Castañon, Félix; Departamento de Ciencias Biológicas y Fisiológicas, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia. Lima-Perú. Facultad de Medicina, Universidad Peruana Cayetano Heredia. Lima-Perú.; Olcese-Mori, Paola; Laboratorio de Endocrinología y Reproducción, Facultad de Ciencias y Filosofía. Universidad Peruana Cayetano Heredia. Lima-Perú. Departamento de Ciencias Biológicas y Fisiológicas, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia. Lima-Perú.; Lozada, Iván; Laboratorio de Inmunología, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia. Lima-Perú. Departamento de Microbiología, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia. Lima-Perú.; Rubio, Julio; Laboratorio de Endocrinología y Reproducción, Facultad de Ciencias y Filosofía. Universidad Peruana Cayetano Heredia. Lima-Perú. Departamento de Ciencias Biológicas y Fisiológicas, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia. Lima-Perú. Instituto de Investigaciones de la Altura, Universidad Peruana Cayetano Heredia. Lima-Perú.; Gonzales, Carla; Laboratorio de Endocrinología y Reproducción, Facultad de Ciencias y Filosofía. Universidad Peruana Cayetano Heredia. Lima-Perú. Departamento de Ciencias Biológicas y Fisiológicas, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia. Lima-Perú. Instituto de Investigaciones de la Altura, Universidad Peruana Cayetano Heredia. Lima-Perú.; Gonzales, Gustavo F; Laboratorio de Endocrinología y Reproducción, Facultad de Ciencias y Filosofía. Universidad Peruana Cayetano Heredia. Lima-Perú. Departamento de Ciencias Biológicas y Fisiológicas, Facultad de Ciencias y Filosofía, Universidad Peruana Cayetano Heredia. Lima-Perú. Instituto de Investigaciones de la Altura, Universidad Peruana Cayetano Heredia. Lima-Perú.
2014-01-01
Objectives. Compare the effect of different doses of red maca on gamma interferon (IFN-γ) levels in ovariectomized rats (OVX). Materials and methods. Adult female rats were randomly divided into the following six groups: Group 1: pseudo-ovariectomized rats (PO); Group 2: OVX rats; Group 3: OVX rats treated with 4 ug/kg estradiol; and Group 4, 5 and 6: OVX rats treated with red maca extracts with 2.15, 4.3 and 8.6 mg polyphenols/body weight kilogram, respectively. Results. OVX rats showed low ...
Bringing Life to Illustration and Illustrating the World in Movement through Visual Literacy
DEFF Research Database (Denmark)
Carpe Pérez, Inmaculada Concepción; Pedersen, Hanne
2016-01-01
“If a picture is worth a thousand words” as Arthur Brisbane said, journalist of the New York Times in 1911 Fig.1 How many words would equal the hundreds of frames containing in an animation? In this equation as any other, illustration and animation are complex visual expressions, full of shapes c...
P. Barbosa; F. Herrera; S. Goeking; V. Nieto; M. Pena; S. Ortiz
2014-01-01
El Inventario Forestal Nacional de Colombia (IFN) incluye un programa de Aseguramiento de Calidad (AC) para garantizar la confiabilidad de todos los datos recogidos y generados en la etapa de muestreo. El objetivo de este programa; es proporcionar un marco que asegure que la información compilada acerca de los bosques es completa, exacta, imparcial y de calidad...
Stability of barrier buckets with zero RF-barrier separations
Energy Technology Data Exchange (ETDEWEB)
Ng, K.Y.; /Fermilab
2005-03-01
A barrier bucket with very small separation between the rf barriers (relative to the barrier widths) or even zero separation has its synchrotron tune decreasing rather slowly from a large value towards the boundary of the bucket. As a result, large area at the bucket edges can become unstable under the modulation of rf voltage and/or rf phase. In addition, chaotic regions may form near the bucket center and extend outward under increasing modulation. Application is made to those barrier buckets used in the process of momentum mining at the Fermilab Recycler Ring.
Adaptation illustrations: Chapter 4
Maria Janowiak; Patricia Butler; Chris Swanston; Matt St. Pierre; Linda. Parker
2012-01-01
In this chapter, we demonstrate how the Adaptation Workbook (Chapter 3) can be used with the Adaptation Strategies and Approaches (Chapter 2) to develop adaptation tactics for two real-world management issues. The two illustrations in this chapter are intended to provide helpful tips to managers completing the Adaptation Workbook, as well as to show how the anticipated...
International Nuclear Information System (INIS)
Satchler, G.R.; Nagarajan, M.A.; Lilley, J.S.; Thompson, I.J.
1987-01-01
We study the formal structure of the influence of channel coupling on near- and sub-barrier fusion. The reduction to a one-channel description is studied, with emphasis on the channel-coupling effects being manifest primarily as an energy dependence (the ''threshold anomaly'') of the real nuclear potential. The relation to the barrier penetration model is examined critically. The results of large-scale coupled-channel calculations are used as ''data'' to illustrate the discussion. Particular emphasis is placed on the importance of reproducing correctly the partial-wave (or ''spin'') distributions. The simple barrier penetration model is found to be adequate to exhibit the strong enhancements due to channel couplings when the threshold anomaly is taken into account, although there may be important corrections due to the long-ranged peripheral absorption, especially from Coulomb excitation. copyright 1987 Academic Press, Inc
Teunissen, Paul F. A.; Boshuizen, Marieke C.; Hollander, Maurits R.; Biesbroek, Paul S.; van der Hoeven, Nina W.; Mol, Jan-Quinten; Gijbels, Marion J.; van der Velden, Saskia; van der Pouw Kraan, Tineke C.; Horrevoets, Anton J.; de Winther, Menno P.; van Royen, Niels
2015-01-01
IFN-beta (IFNβ) signalling is increased in patients with insufficient coronary collateral growth (i.e. arteriogenesis) and IFNβ hampers arteriogenesis in mice. A downside of most pro-arteriogenic agents investigated in the past has been their pro-atherosclerotic properties, rendering them unsuitable
Huang, T J; MacAry, P A; Eynott, P; Moussavi, A; Daniel, K C; Askenase, P W; Kemeny, D M; Chung, K F
2001-01-01
Th2 T cell immune-driven inflammation plays an important role in allergic asthma. We studied the effect of counterbalancing Th1 T cells in an asthma model in Brown Norway rats that favors Th2 responses. Rats received i.v. transfers of syngeneic allergen-specific Th1 or Th2 cells, 24 h before aerosol exposure to allergen, and were studied 18-24 h later. Adoptive transfer of OVA-specific Th2 cells, but not Th1 cells, and OVA, but not BSA exposure, induced bronchial hyperresponsiveness (BHR) to acetylcholine and eosinophilia in a cell number-dependent manner. Importantly, cotransfer of OVA-specific Th1 cells dose-dependently reversed BHR and bronchoalveolar lavage (BAL) eosinophilia, but not mucosal eosinophilia. OVA-specific Th1 cells transferred alone induced mucosal eosinophilia, but neither BHR nor BAL eosinophilia. Th1 suppression of BHR and BAL eosinophilia was allergen specific, since cotransfer of BSA-specific Th1 cells with the OVA-specific Th2 cells was not inhibitory when OVA aerosol alone was used, but was suppressive with OVA and BSA challenge. Furthermore, recipients of Th1 cells alone had increased gene expression for IFN-gamma in the lungs, while those receiving Th2 cells alone showed increased IL-4 mRNA. Importantly, induction of these Th2 cytokines was inhibited in recipients of combined Th1 and Th2 cells. Anti-IFN-gamma treatment attenuated the down-regulatory effect of Th1 cells. Allergen-specific Th1 cells down-regulate efferent Th2 cytokine-dependent BHR and BAL eosinophilia in an asthma model via mechanisms that depend on IFN-gamma. Therapy designed to control the efferent phase of established asthma by augmenting down-regulatory Th1 counterbalancing mechanisms should be effective.
Interferon-alpha subtype 11 activates NK cells and enables control of retroviral infection.
Directory of Open Access Journals (Sweden)
Kathrin Gibbert
Full Text Available The innate immune response mediated by cells such as natural killer (NK cells is critical for the rapid containment of virus replication and spread during acute infection. Here, we show that subtype 11 of the type I interferon (IFN family greatly potentiates the antiviral activity of NK cells during retroviral infection. Treatment of mice with IFN-α11 during Friend retrovirus infection (FV significantly reduced viral loads and resulted in long-term protection from virus-induced leukemia. The effect of IFN-α11 on NK cells was direct and signaled through the type I IFN receptor. Furthermore, IFN-α11-mediated activation of NK cells enabled cytolytic killing of FV-infected target cells via the exocytosis pathway. Depletion and adoptive transfer experiments illustrated that NK cells played a major role in successful IFN-α11 therapy. Additional experiments with Mouse Cytomegalovirus infections demonstrated that the therapeutic effect of IFN-α11 is not restricted to retroviruses. The type I IFN subtypes 2 and 5, which bind the same receptor as IFN-α11, did not elicit similar antiviral effects. These results demonstrate a unique and subtype-specific activation of NK cells by IFN-α11.
DEFF Research Database (Denmark)
Kemp, K; Kemp, M; Kharazmi, A
1999-01-01
Peripheral blood mononuclear cells (PBMC) from patients who have recovered from visceral leishmaniasis often respond to Leishmania antigens in vitro by production of both IL-4, IFN-gamma and IL-10. In order to establish the cellular sources of these cytokines, we activated cells from individuals...... with a history of visceral leishmaniasis with Leishmania antigen for 6 days in culture, and identified cytokine production at the single-cell level by flow cytometry. The cytokines were only found in CD3+ cells and among these mainly within the CD4+ subset. The percentage of cytokine-producing cells was compared...... in Leishmania-activated PBMC cultures from the previous patients and from individuals living in a village where leishmaniasis does not occur. The percentage of IL-10- and IFN-gamma-containing cells was significantly higher in the previous patients than in the controls, indicating that Leishmania-specific T...
International Nuclear Information System (INIS)
Noaman, E.; Elgawish, M.A.M.
2002-01-01
The immune responds to ionizing radiation with distinct characteristics depending on the dose and dose rate. The prominent suppressive effect of lethal and sublethal doses of ionizing radiation on immunity and hemopoiesis constitutes the basis of the chief clinical manifestations of acute radiation syndrome. The present of research was conducted to evaluate the effects of new compounds synthesized by adding histidine, glutathione or methionine to germanium element on the levels of interferon-gamma (IFN-γ)and interleukin-12 (IL-12) in serum of female rats exposure. The results revealed that exposure to γ-irradiation decreased significantly the levels of IL-12 and I FN-γ 1 and 3 days post-treatment. On the other hand, histidine-germanate could stimulate the production of IL-12 three days post-irradiation while glutathione-germanate and methionine-germanate may be considered as IFN-γ inducer during the investigated periods
Duez, C; Gras-Masse, H; Hammad, H; Akoum, H; Didierlaurent, A; André, C; Tonnel, A B; Pestel, J
2001-01-01
We have previously established a model to study the in vivo human IgE response using humanized SCID mice. Allergic SCID mice were obtained following intraperitoneal injection with mononuclear cells from Dermatophagoides pteronyssinus (Dpt)-sensitive patients, and sensitization by Dpt allergen intraperitoneal injection (immunization) or Dpt aerosol (inhalation). Human serum IgE was measured in allergic SCID mice after administration of human recombinant IFN-gamma or the lipopeptide LP 52-71 (derived from peptide p52-71 from Der p 1, Dpt major allergen, coupled to a lipophilic moiety), during the immunization or the inhalation phase. IFN-gamma inhibited human IgE production when given at the time of immunization, but not during inhalation. This effect was long-lasting as Dpt aerosol, given one month after immunization and IFN-gamma administration, failed to increase IgE levels. Unlike Dpt or p52-71, LP 52-71 failed to induce human IgE production at day 14 and 21 after its injection, but did inhibit the development of the IgE response after a secondary Dpt-challenge. Moreover, LP 52-71 administration 14 days after Dpt inhalation decreased IgE levels, in contrast to peptide 52-71, which increased IgE levels. Thus, taken together these results indicate that the development of the human IgE response in allergic SCID mice can be modulated by modified allergen and a Th1 cytokine.
Directory of Open Access Journals (Sweden)
Yılmaz SOYSAL
2017-08-01
Full Text Available In this study, two academics’ who have been employed in a private university teaching barriers and accompanied attributional reasoning were examined in the context of their belief systems with regards to learning, teaching and knowledge. This study was conducted with a basic qualitative perspective. By means of qualitative data gathering and analysis, it was aimed at estimating how the relation between teaching barriers and attributional reasoning was influenced by pedagogical-epistemological belief systems of scholars. Qualitative data was collected through two different semi-structured interview protocols and gathered data was analyzed with an inductive and interpretivist manner. The scholars’ beliefs systems’ divergences (teacher-centered vs. learner-centered allowed to explore the presumable relation of barrier-attribution in the context of pedagogical-epistemological belief systems. It was found out that the scholar who has adopted the more learner-centered modes of teaching favors more internally-oriented, controllable and non-stable attributional styles in illustrating her barrier-attribution relation. In contrast, it was also detected that the scholar who has held more teacher-centered teaching beliefs is liable to make attributions to overly external, non-controllable and stable factors in illuminating her barrier-attribution relation. Major outcomes of the study are evaluated by means of psychological (i.e., attribution theory and instructional (pedagogical-epistemological beliefs lenses and suggestions are offered in the context of higher education.
Ding, Zhen; Fang, Liurong; Yuan, Shuangling; Zhao, Ling; Wang, Xunlei; Long, Siwen; Wang, Mohan; Wang, Dang; Foda, Mohamed Frahat; Xiao, Shaobo
2017-07-25
Coronaviruses (CoVs) are a huge threat to both humans and animals and have evolved elaborate mechanisms to antagonize interferons (IFNs). Nucleocapsid (N) protein is the most abundant viral protein in CoV-infected cells, and has been identified as an innate immunity antagonist in several CoVs, including mouse hepatitis virus (MHV) and severe acute respiratory syndrome (SARS)-CoV. However, the underlying molecular mechanism(s) remain unclear. In this study, we found that MHV N protein inhibited Sendai virus and poly(I:C)-induced IFN-β production by targeting a molecule upstream of retinoic acid-induced gene I (RIG-I) and melanoma differentiation gene 5 (MDA5). Further studies showed that both MHV and SARS-CoV N proteins directly interacted with protein activator of protein kinase R (PACT), a cellular dsRNA-binding protein that can bind to RIG-I and MDA5 to activate IFN production. The N-PACT interaction sequestered the association of PACT and RIG-I/MDA5, which in turn inhibited IFN-β production. However, the N proteins from porcine epidemic diarrhea virus (PEDV) and porcine reproductive and respiratory syndrome virus (PRRSV), which are also classified in the order Nidovirales, did not interact and counteract with PACT. Taken together, our present study confirms that both MHV and SARS-CoV N proteins can perturb the function of cellular PACT to circumvent the innate antiviral response. However, this strategy does not appear to be used by all CoVs N proteins.
Silencing of IFN-stimulated gene transcription is regulated by histone H1 and its chaperone TAF-I.
Kadota, Shinichi; Nagata, Kyosuke
2014-07-01
Chromatin structure and its alteration play critical roles in the regulation of transcription. However, the transcriptional silencing mechanism with regard to the chromatin structure at an unstimulated state of the interferon (IFN)-stimulated gene (ISG) remains unclear. Here we investigated the role of template activating factor-I (TAF-I, also known as SET) in ISG transcription. Knockdown (KD) of TAF-I increased ISG transcript and simultaneously reduced the histone H1 level on the ISG promoters during the early stages of transcription after IFN stimulation from the unstimulated state. The transcription factor levels on the ISG promoters were increased in TAF-I KD cells only during the early stages of transcription. Furthermore, histone H1 KD also increased ISG transcript. TAF-I and histone H1 double KD did not show the additive effect in ISG transcription, suggesting that TAF-I and histone H1 may act on the same regulatory pathway to control ISG transcription. In addition, TAF-I KD and histone H1 KD affected the chromatin structure near the ISG promoters. On the basis of these findings, we propose that TAF-I and its target histone H1 are key regulators of the chromatin structure at the ISG promoter to maintain the silent state of ISG transcription. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chen, Xu; Ye, Haiyan; Li, Shilin; Jiao, Baihai; Wu, Jianqin; Zeng, Peibin; Chen, Limin
2017-01-01
Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease caused by a novel bunyavirus (SFTS virus, SFTSV). At present there is still no specific antiviral treatment for SFTSV; To understand which cells support SFTSV life cycle and whether SFTSV infection activates host innate immunity, four different cell lines (Vero, Hela, Huh7.5.1, and Huh7.0) were infected with SFTSV. Intracellular/extracellular viral RNA and expression of IFNα, and IFNß were detected by real-time RT- PCR following infection. To confirm the role of non-structural protein (NSs) of SFTSV in exogenous IFNα-induced Jak/STAT signaling, p-STAT1 (Western Blot), ISRE activity (Luciferase assay) and ISG expression (real-time PCR) were examined following IFNα stimulation in the presence or absence of over-expression of NSs in Hela cells. Our study showed that all the four cell lines supported SFTSV life cycle and SFTSV activated host innate immunity to produce type I IFNs in Hela cells but not in Huh7.0, Huh7.5.1 or Vero cells. NSs inhibited exogenous IFNα-induced Jak/STAT signaling as shown by decreased p-STAT1 level, suppressed ISRE activity and down-regulated ISG expression. Suppression of the exogenous Type I IFN-induced Jak/STAT signaling by NSs might be one of the mechanisms of SFTSV to evade host immune surveillance.
Women in Healthcare: Barriers and Enablers from a Developing Country Perspective
Tlaiss, Hayfaa A.
2013-01-01
Background: As the under-representation of women in management positions continues to persist globally, little is known about the experiences of women in the healthcare sector in the context of the developing Middle Eastern nations. In an attempt to address this knowledge gap, the current study explores some of the barriers that hinder and the enablers that foster women’s career advancement in the healthcare sector. To meet its objectives, the current study uses a relational approach that integrates the macro socio-cultural, meso-organisational, and micro-individual levels of analysis. Methods: Guided by institutional theory as a theoretical framework and social constructionism as a philosophical stance, the current study adopts a qualitative research methodology. It capitalizes on in-depth, semi-structured, face-to-face interviews with women managers in different occupational fields, across the managerial hierarchy in the healthcare sector in Lebanon. Snowballing and purposeful sampling procedures were used, and the interviews were analysed using thematic analysis, focusing on identifying new, emerging themes. Results: The results of the study confirm the salience of discriminatory cultural values, gendered social roles and expectations in Middle Eastern societies, and illustrate their role as barriers hindering women’s career advancement. The results also portray the spillover effect of societal expectations and cultural gender stereotypes into the organisational realm, resulting in widely experienced attitudinal and structural organisational barriers. This study also illustrates how the enablers that facilitate and promote women’s career progression unfold amidst the interplay between the macro and meso factors, lending credence to the role of women’s agency at the individual micro level. Amongst the toll of barriers, Middle Eastern women navigate the patriarchy of their cultures and the discrimination inherent in their organisations by using their
Women in Healthcare: Barriers and Enablers from a Developing Country Perspective
Directory of Open Access Journals (Sweden)
Hayfaa A. Tlaiss
2013-05-01
Full Text Available Background: As the under-representation of women in management positions continues to persist globally, little is known about the experiences of women in the healthcare sector in the context of the developing Middle Eastern nations. In an attempt to address this knowledge gap, the current study explores some of the barriers that hinder and the enablers that foster women’s career advancement in the healthcare sector. To meet its objectives, the current study uses a relational approach that integrates the macro socio-cultural, meso-organisational, and micro-individual levels of analysis.Methods: Guided by institutional theory as a theoretical framework and social constructionism as a philosophical stance, the current study adopts a qualitative research methodology. It capitalizes on in-depth, semi-structured, face-to-face interviews with women managers in different occupational fields, across the managerial hierarchy in the healthcare sector in Lebanon. Snowballing and purposeful sampling procedures were used, and the interviews were analysed using thematic analysis, focusing on identifying new, emerging themes.Results: The results of the study confirm the salience of discriminatory cultural values, gendered social roles and expectations in Middle Eastern societies, and illustrate their role as barriers hindering women’s career advancement. The results also portray the spillover effect of societal expectations and cultural gender stereotypes into the organisational realm, resulting in widely experienced attitudinal and structural organisational barriers. This study also illustrates how the enablers that facilitate and promote women’s career progression unfold amidst the interplay between the macro and meso factors, lending credence to the role of women’s agency at the individual micro level. Amongst the toll of barriers, Middle Eastern women navigate the patriarchy of their cultures and the discrimination inherent in their organisations by
Directory of Open Access Journals (Sweden)
Laurie Lajoie
2017-11-01
Full Text Available Natural killer (NK cell effector functions include cytotoxicity and secretion of cytokines such as interferon-γ (IFN-γ. The immature CD56bright subset of human NK cells lacks expression of FcγRIIIa/CD16a, one of the low-affinity immunoglobulin G receptors, or exhibits low-density expression (CD56brightCD16−/dim and produces IFN-γ in response to cytokine stimulation, whereas the mature CD56dimCD16+ subset is the most cytotoxic one. A further differentiation/maturation of the latter subset according to the gradual loss of NKG2A and/or gain of KIR2DL (CD158a and CD158b has been demonstrated and the ability to produce IFN-γ in response to activating receptor (AR co-engagement is gradually acquired during terminal differentiation. In the course of flow cytometry analysis of CD56dim NK cells, we noted a substantial intraindividual heterogeneity of expression of FcγRIIIa. FcγRIIIa is unique among ARs: it does not require the co-engagement of other ARs to induce substantial cytotoxicity or cytokine synthesis in CD56dim cells. We, therefore, investigated whether individual differentiation/maturation of polyclonal CD56dim NK cells defined by expression of NKG2A/KIR2DL is related to FcγRIIIa expression and to the heterogeneity of NK cell responses upon FcγRIIIa engagement. When we analyzed unstimulated CD56dim cells by increasing level of FcγRIIIa expression, we found that the proportion of the more differentiated CD158a,h+ and/or CD158b,j+ cells and that of the less differentiated NKG2A+ cells gradually increased and decreased, respectively. FcγRIIIa engagement by using plate-bound murine anti-CD16 monoclonal antibody (mAb or rituximab or trastuzumab (two therapeutic mAbs, resulted in donor-dependent partial segregation of IFN-γ-producing and/or degranulating CD56dim cells. Importantly, the proportion of CD158a,h/b,j+ cells and that of NKG2A+ cells was increased and decreased, respectively, IFN-γ-producing cells, whereas these proportions
DEFF Research Database (Denmark)
Duijm, Nijs Jan
2008-01-01
Safety-barrier diagrams and the related so-called 'bow-tie' diagrams have become popular methods in risk analysis. This paper describes the syntax and principles for constructing consistent and valid safety-barrier diagrams. The relation of safety-barrier diagrams to other methods such as fault...... trees and Bayesian networks is discussed. A simple method for quantification of safety-barrier diagrams is proposed. It is concluded that safety-barrier diagrams provide a useful framework for an electronic data structure that integrates information from risk analysis with operational safety management....
DEFF Research Database (Denmark)
Duijm, Nijs Jan
2007-01-01
Safety-barrier diagrams and the related so-called "bow-tie" diagrams have become popular methods in risk analysis. This paper describes the syntax and principles for constructing consistent and valid safety-barrier diagrams. The relation with other methods such as fault trees and Bayesian networks...... are discussed. A simple method for quantification of safety-barrier diagrams is proposed, including situations where safety barriers depend on shared common elements. It is concluded that safety-barrier diagrams provide a useful framework for an electronic data structure that integrates information from risk...... analysis with operational safety management....
Energy Technology Data Exchange (ETDEWEB)
NONE
2013-07-15
IEA-RETD prepared a guidebook for policy makers and project developers, illustrating how to deal with possible negative side effects or barriers for deployment of renewable technologies, like visual or noise impacts, or increased local transport for biomass. Many good practices demonstrate that renewables can be integrated in the 'backyards' of modern societies. Some examples: stakeholder involvement, participation and compensation; clear spatial planning; and trustworthy legal procedures. Four case studies are also included.
Does IFN-γ play a role on the pathogenesis of non-atopic asthma in Latin America children?
Figueiredo Camila Alexandrina; Rodrigues Laura Cunha; Alcantara-Neves Neuza Maria; Cooper Philip J; Amorim Leila Denise; Silva Nivea Bispo; Cruz Alvaro A; Barreto Mauricio Lima
2012-01-01
Abstract In this work we explore differences in blood cells and cytokine profiles in children according to atopic status and asthma (atopic or non-atopic). The study involved measurement of Th1(IFN-γ) and Th2 (IL-5 and IL-13) cytokines in Dermatophagoides pteronyssinus stimulated peripheral blood leukocytes, blood cell count, skin prick test and specific IgE against common aeroallergens. Atopic status was associated with eosinophilia and production of Th2 type cytokines. Atopic asthma was a...
International Nuclear Information System (INIS)
Sena, P.A.
1986-01-01
The ground vehicle is one of the most effective tools available to an adversary force. Vehicles can be used to penetrate many types of perimeter barriers, transport equipment and personnel rapidly over long distances, and deliver large amounts of explosives directly to facilities in suicide missions. The function of a vehicle barrier system is to detain or disable a defined threat vehicle at a selected distance from a protected facility. Numerous facilities are installing, or planning to install, vehicle barrier systems and many of these facilities are requesting guidance to do so adequately. Therefore, vehicle barriers are being evaluated to determine their stopping capabilities so that systems can be designed that are both balanced and capable of providing a desired degree of protection. Equally important, many of the considerations that should be taken into account when establishing a vehicle barrier system have been identified. These considerations which pertain to site preparation, barrier selection, system integration and operation, and vehicle/barrier interaction, are discussed in this paper
Volume illustration of muscle from diffusion tensor images.
Chen, Wei; Yan, Zhicheng; Zhang, Song; Crow, John Allen; Ebert, David S; McLaughlin, Ronald M; Mullins, Katie B; Cooper, Robert; Ding, Zi'ang; Liao, Jun
2009-01-01
Medical illustration has demonstrated its effectiveness to depict salient anatomical features while hiding the irrelevant details. Current solutions are ineffective for visualizing fibrous structures such as muscle, because typical datasets (CT or MRI) do not contain directional details. In this paper, we introduce a new muscle illustration approach that leverages diffusion tensor imaging (DTI) data and example-based texture synthesis techniques. Beginning with a volumetric diffusion tensor image, we reformulate it into a scalar field and an auxiliary guidance vector field to represent the structure and orientation of a muscle bundle. A muscle mask derived from the input diffusion tensor image is used to classify the muscle structure. The guidance vector field is further refined to remove noise and clarify structure. To simulate the internal appearance of the muscle, we propose a new two-dimensional example based solid texture synthesis algorithm that builds a solid texture constrained by the guidance vector field. Illustrating the constructed scalar field and solid texture efficiently highlights the global appearance of the muscle as well as the local shape and structure of the muscle fibers in an illustrative fashion. We have applied the proposed approach to five example datasets (four pig hearts and a pig leg), demonstrating plausible illustration and expressiveness.
Barrier Island Activity to Illustrate Hands-On Science
Griffin, Suzanne H.
The department of Physics of the University of Glasgow was concerned about losing students after the end of the level 1 Physics course. The current research project started as an attempt to find out the reasons for this, but moved to investigate attitudes towards Physics at several stages during secondary school and attitudes towards science with primary pupils. Analyses of factors, which influence students' intentions towards studying Physics, were performed against the background of the Theory of Planned Behaviour, which interprets people's behaviour by considering three factors: attitude towards behaviour (advantages or disadvantages of being involved in the behaviour, e.g. studying Physics for Honours); subjective norm (approval or disapproval of important people towards engaging in the behaviour, e.g. parents, teacher, general norms of the society); perceived behavioural control (skills, knowledge, cooperation of others, abilities, efforts required to perform the behaviour). Analysis of these factors revealed some reasons for students' withdrawal from Physics after level 1 and pointed to factors which may facilitate students' persistence in the subject. A general analysis of level 1 and level 2 students' attitudes towards different aspects of the university Physics course revealed that the level 1 students' attitudes towards their university course of lectures and course of laboratories tended to be negatively polarised. Recommendations were suggested on the basis of the gathered evidence about how to make students' experience in university Physics more satisfactory for them. The data obtained from the separate analyses of females' and males' attitudes towards university Physics course have showed that attitudes of females and males were similar. The only significant difference between level 1 females and males was found to be the perceived behavioural control factor (students' attitudes towards course difficulty, attitudes towards work load in the course), which was significantly lower for females than for males. Special attention in this work was given to the problem of university Physics laboratory practice. Possibilities to improve students' attitudes towards laboratory work were discussed. This could be done through introduction of pre-lab (aimed to consolidate students' grasp of the necessary background for performing the experiment) and post-lab (aimed to provide students with opportunity to apply the theory they have learned and skills they have obtained from doing laboratory work to solve everyday problems). Examples of pre- and post-labs that were designed for the first term of the level 1 university Physics laboratory practice are given in the Appendix T. The project was extended from the university to the school area where cross-age analyses (measurements at one time with pupils of different age) of pupils' attitudes towards Science/Physics lessons were performed. Pupils from upper Primary P6/P7 up to Higher S5/S6 were involved in the research. These analyses have shown that patterns of Scottish pupils' attitudes towards Science/Physics lessons are not linear with age: attitudes of pupils who were self-selected towards the subject were not always more positive than attitudes of lower level pupils: primary school pupils' attitudes towards science lessons were significantly more positive than attitudes of secondary S2 pupils; pupils doing Standard Grade Physics course were similar in their evaluations of Physics lessons at both S3 and S4 levels; at Higher Grade Physics pupils' attitudes towards science lessons were significantly less positive than attitudes of Standard Grade Physics pupils. Pupils' attitudes towards Science/Physics lessons can be considered as a good indicator of pupils' reactions towards existing syllabuses in Science and Physics. Special attention in this study was devoted to the so-called "problem of girls in Physics". Separate analyses of boys' and girls' interests towards Physics topics revealed that although boys and girls are equally interested in certain areas of the subject, there are areas in Physics where boys and girls interests are significantly different. No differences were found in intensity of boys' and girls' interests towards suggested Physics topics at primary P6/P7 level, S3 and S5/S6 levels. At S2 and S4 levels a significant decline of girls' interests relative to boys interests was observed. S2 and S4 stages are decision making ones when pupils have the opportunity to select courses for the future. It was also revealed that the ratio of boys to girls in Physics once established at S2 level remains unchanged through the years of Standard Grade and Higher Grade Physics courses. This may indicate that if the number of girls in Physics is an issue for concern then attention should be paid to the primary and, especially early secondary years to attract girls to Physics. School Physics courses in Scotland revealed a high retention rate of girls in Physics. Analyses of preferred activities revealed that practical work is the most enjoyable activity in Science/Physics lessons for both girls and boys at every stage of schooling and studying the theory was found to be the least enjoyable activity at school for both genders at every age. The picture was almost the reverse with university Physics students.
Directory of Open Access Journals (Sweden)
Easton Marilyn J
2010-02-01
Full Text Available Abstract Background Simian Virus 40 (SV40 immortalization followed by treatment of cells with 3-methylcholanthrene (3-MC has been used to elicit tumors in athymic mice. 3-MC carcinogenesis has been thoroughly studied, however gene-level interactions between 3-MC and SV40 that could have produced the observed tumors have not been explored. The commercially-available human uroepithelial cell lines were either SV40-immortalized (HUC or SV40-immortalized and then 3-MC-transformed (HUC-TC. Results To characterize the SV40 - 3MC interaction, we compared human gene expression in these cell lines using a human cancer array and confirmed selected changes by RT-PCR. Many viral Large T Antigen (Tag expression-related changes occurred in HUC-TC, and it is concluded that SV40 and 3-MC may act synergistically to transform cells. Changes noted in IFP 9-27, 2'-5' OAS, IF 56, MxA and MxAB were typical of those that occur in response to viral exposure and are part of the innate immune response. Because interferon is crucial to innate immune host defenses and many gene changes were interferon-related, we explored cellular growth responses to exogenous IFN-γ and found that treatment impeded growth in tumor, but not immortalized HUC on days 4 - 7. Cellular metabolism however, was inhibited in both cell types. We conclude that IFN-γ metabolic responses were functional in both cell lines, but IFN-γ anti-proliferative responses functioned only in tumor cells. Conclusions Synergism of SV40 with 3-MC or other environmental carcinogens may be of concern as SV40 is now endemic in 2-5.9% of the U.S. population. In addition, SV40-immortalization is a generally-accepted method used in many research materials, but the possibility of off-target effects in studies carried out using these cells has not been considered. We hope that our work will stimulate further study of this important phenomenon.
Congenital diseases and syndromes. An illustrated radiological guide
Energy Technology Data Exchange (ETDEWEB)
Al-Tubaikh, Jarrah Ali [Universitaetsklinikum Muenchen, Klinikum Grosshadern (Germany). Inst. fuer Klinische Radiologie; Sabah Hospital (Kuwait). Dept. of Diagnostic Radiology; Reiser, Maximilian F. [Universitaetsklinikum Muenchen, Klinikum Grosshadern (Germany). Inst. fuer Klinische Radiologie
2009-07-01
Congenital Diseases and Syndromes - An Illustrated Radiological Guide is designed to serve the radiologist as an easy-to-use visual guide that illustrates the typical diagnostic radiological features of the most common congenital diseases and syndromes. The book is organised according to body system, with chapters focusing on the CNS, the head and neck, the chest and heart, the abdomen and pelvis, and the musculoskeletal system. A final chapter is devoted to phakomatosis. Each syndrome or disease is illustrated by multiple images as well as by high-quality digital medical illustrations depicting those radiological signs that are difficult to detect. The reader is thereby familiarised with the various congenital anomalies from the radiological point of view. In addition, etiology, diagnostic criteria, and main symptoms are described, and potential differential diagnoses highlighted. This book will be immensely useful for junior radiologists, radiology students, and doctors in any specialty who are interested in congenital malformations and syndromes. (orig.)
Congenital diseases and syndromes. An illustrated radiological guide
International Nuclear Information System (INIS)
Al-Tubaikh, Jarrah Ali; Sabah Hospital; Reiser, Maximilian F.
2009-01-01
Congenital Diseases and Syndromes - An Illustrated Radiological Guide is designed to serve the radiologist as an easy-to-use visual guide that illustrates the typical diagnostic radiological features of the most common congenital diseases and syndromes. The book is organised according to body system, with chapters focusing on the CNS, the head and neck, the chest and heart, the abdomen and pelvis, and the musculoskeletal system. A final chapter is devoted to phakomatosis. Each syndrome or disease is illustrated by multiple images as well as by high-quality digital medical illustrations depicting those radiological signs that are difficult to detect. The reader is thereby familiarised with the various congenital anomalies from the radiological point of view. In addition, etiology, diagnostic criteria, and main symptoms are described, and potential differential diagnoses highlighted. This book will be immensely useful for junior radiologists, radiology students, and doctors in any specialty who are interested in congenital malformations and syndromes. (orig.)
Radbin, Rayhaneh; Vahedi, Fatemeh; Chamani, JamshidKhan
2014-10-01
In recent years, water pollution has been converted to a challenging discussion in health area of human being. Heavy elements are one of the most important water pollutants and their negative adverse effects on body systems have been confirmed. In this study, investigation of effects of two heavy elements including lead (Pb) and copper (Cu) on expression of interlukin-4 (IL-4) and interferon-gamma (IFN-γ) as humoral and cellular immunity biomarkers, respectively, was aimed and PCR, real-time PCR and electrophoresis techniques were used. In this study, BALB/c mice were studied that had free access to drinking water which contained Cu or Pb salts. After 2 weeks, spleens of mice were removed, RNA extracted, and cDNA was prepared for RT-PCR. Then the expression of IL-4 and IFN-γ genes were assessed by real-time PCR. The expression of IFN-γ was up-regulated in both treated groups and the expression of IL-4 was only up-regulated in the group treated with Cu and down-regulated in the group treated with Pb. This study shows that the presence of heavy elements as drinking-water pollutants results in a disproportion of natural cytokines balances, and thus may result in a negative effect on immune system.
26 CFR 1.941-3 - Illustration of principles.
2010-04-01
... 26 Internal Revenue 10 2010-04-01 2010-04-01 false Illustration of principles. 1.941-3 Section 1.941-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES China Trade Act Corporations § 1.941-3 Illustration of principles. The application...
International Nuclear Information System (INIS)
Gharbieh, Heidar K.; Cota, Stela
2015-01-01
Narrow diameter borehole facilities (a few tens of centimeters), like the BOSS concept developed by the IAEA, provide a safe and cost effective disposal option for radioactive waste and particularly disused sources. The BOSS concept (borehole disposal of sealed radioactive sources) comprises a multi-barrier system of cement grout and stainless steel components. In order to predict the long-time performance of the cement barriers as an input of a future safety assessment under the specific hydrochemical and hydrological conditions, a non-linear degradation model was developed in this work. With the assistance of the program 'PHREEQC' it describes the change of the porosity and the hydraulic conductivity with time, which also let to conclusions concerning the change of the sorption capacity of the cement grout. This work includes the theoretical approach and illustrates the non-liner degradation by means of an exemplary water composition found in the saturated zone and the dimensions of the backfill made of cement grout representing a barrier of the BOSS borehole facility. (author)
Safety barriers on oil and gas platforms. Means to prevent hydrocarbon releases
Energy Technology Data Exchange (ETDEWEB)
Sklet, Snorre
2005-12-15
The main objective of the PhD project has been to develop concepts and methods that can be used to define, illustrate, analyse, and improve safety barriers in the operational phase of offshore oil and gas production platforms. The main contributions of this thesis are; Clarification of the term safety barrier with respect to definitions, classification, and relevant attributes for analysis of barrier performance Development and discussion of a representative set of hydrocarbon release scenarios Development and testing of a new method, BORA-Release, for qualitative and quantitative risk analysis of hydrocarbon releases Safety barriers are defined as physical and/or non-physical means planned to prevent, control, or mitigate undesired events or accidents. The means may range from a single technical unit or human actions, to a complex socio-technical system. It is useful to distinguish between barrier functions and barrier systems. Barrier functions describe the purpose of safety barriers or what the safety barriers shall do in order to prevent, control, or mitigate undesired events or accidents. Barrier systems describe how a barrier function is realized or executed. If the barrier system is functioning, the barrier function is performed. If a barrier function is performed successfully, it should have a direct and significant effect on the occurrence and/or consequences of an undesired event or accident. It is recommended to address the following attributes to characterize the performance of safety barriers; a) functionality/effectiveness, b) reliability/ availability, c) response time, d) robustness, and e) triggering event or condition. For some types of barriers, not all the attributes are relevant or necessary in order to describe the barrier performance. The presented hydrocarbon release scenarios include initiating events, barrier functions introduced to prevent hydrocarbon releases, and barrier systems realizing the barrier functions. Both technical and human
DEFF Research Database (Denmark)
Simonsson, Bengt; Gedde-Dahl, Tobias; Markevärn, Berit
2011-01-01
Biologic and clinical observations suggest that combining imatinib with IFN-α may improve treatment outcome in chronic myeloid leukemia (CML). We randomized newly diagnosed chronic-phase CML patients with a low or intermediate Sokal risk score and in imatinib-induced complete hematologic remissio...
International Nuclear Information System (INIS)
Berriman, A.C.; Butt, R.D.; Dasgupta, M.; Hinde, D.J.; Morton, C.R.; Newton, J.O.
1999-01-01
The fusion barrier is formed by the combination of the repulsive Coulomb and attractive nuclear forces. Recent research at the Australian National University has shown that when heavy nuclei collide, instead of a single fusion barrier, there is a set of fusion barriers. These arise due to intrinsic properties of the interacting nuclei such deformation, rotations and vibrations. Thus the range of barrier energies depends on the properties of both nuclei. The transfer of matter between nuclei, forming a neck, can also affect the fusion process. High precision data have been used to determine fusion barrier distributions for many nuclear reactions, leading to new insights into the fusion process
International Nuclear Information System (INIS)
Engelhardt, Netta; Wall, Aron C.
2014-01-01
We present a generic condition for Lorentzian manifolds to have a barrier that limits the reach of boundary-anchored extremal surfaces of arbitrary dimension. We show that any surface with nonpositive extrinsic curvature is a barrier, in the sense that extremal surfaces cannot be continuously deformed past it. Furthermore, the outermost barrier surface has nonnegative extrinsic curvature. Under certain conditions, we show that the existence of trapped surfaces implies a barrier, and conversely. In the context of AdS/CFT, these barriers imply that it is impossible to reconstruct the entire bulk using extremal surfaces. We comment on the implications for the firewall controversy
Taylor, David; Wilkison, Michelle; Voyich, Jovanka; Meissner, Nicole
2011-05-15
We recently demonstrated that lack of type I IFN signaling (IFNAR knockout) in lymphocyte-deficient mice (IFrag(-/-)) results in bone marrow (BM) failure after Pneumocystis lung infection, whereas lymphocyte-deficient mice with intact IFNAR (RAG(-/-)) had normal hematopoiesis. In the current work, we performed studies to define further the mechanisms involved in the induction of BM failure in this system. BM chimera experiments revealed that IFNAR expression was required on BM-derived but not stroma-derived cells to prevent BM failure. Signals elicited after day 7 postinfection appeared critical in determining BM cell fate. We observed caspase-8- and caspase-9-mediated apoptotic cell death, beginning with neutrophils. Death of myeloid precursors was associated with secondary oxidative stress, and decreasing colony-forming activity in BM cell cultures. Treatment with N-acetylcysteine could slow the progression of, but not prevent, BM failure. Type I IFN signaling has previously been shown to expand the neutrophil life span and regulate the expression of some antiapoptotic factors. Quantitative RT-PCR demonstrated reduced mRNA abundance for the antiapoptotic factors BCL-2, IAP2, MCL-1, and others in BM cells from IFrag(-/-) compared with that in BM cells from RAG(-/-) mice at day 7. mRNA and protein for the proapoptotic cytokine TNF-α was increased, whereas mRNA for the growth factors G-CSF and GM-CSF was reduced. In vivo anti-TNF-α treatment improved precursor cell survival and activity in culture. Thus, we propose that lack of type I IFN signaling results in decreased resistance to inflammation-induced proapoptotic stressors and impaired replenishment by precursors after systemic responses to Pneumocystis lung infection. Our finding may have implications in understanding mechanisms underlying regenerative BM depression/failure during complex immune deficiencies such as AIDS.
Nfkb1 inhibits LPS-induced IFN-β and IL-12 p40 production in macrophages by distinct mechanisms.
Directory of Open Access Journals (Sweden)
Xixing Zhao
Full Text Available Nfkb1-deficient murine macrophages express higher levels of IFN-β and IL-12 p40 following LPS stimulation than control macrophages, but the molecular basis for this phenomenon has not been completely defined. Nfkb1 encodes several gene products including the NF-κB subunit p50 and its precursor p105. p50 is derived from the N-terminal of 105, and p50 homodimers can exhibit suppressive activity when overexpressed. The C-terminal region of p105 is necessary for LPS-induced ERK activation and it has been suggested that ERK activity inhibits both IFN-β and IL-12 p40 following LPS stimulation. However, the contributions of p50 and the C-terminal domain of p105 in regulating endogenous IFN-β(Ifnb and IL-12 p40 (Il12b gene expression in macrophages following LPS stimulation have not been directly compared.We have used recombinant retroviruses to express p105, p50, and the C-terminal domain of p105 (p105ΔN in Nfkb1-deficient murine bone marrow-derived macrophages at near endogenous levels. We found that both p50 and p105ΔN inhibited expression of Ifnb, and that inhibition of Ifnb by p105ΔN depended on ERK activation, because a mutant of p105ΔN (p105ΔNS930A that lacks a key serine necessary to support ERK activation failed to inhibit. In contrast, only p105ΔN but not p50 inhibited Il12b expression. Surprisingly, p105ΔNS930A retained inhibitory activity for Il12b, indicating that ERK activation was not necessary for inhibition. The differential effects of p105ΔNS930A on Ifnb and Il12b expression inversely correlated with the function of one of its binding partners, c-Rel. This raised the possibility that p105ΔNS930A influences gene expression by interfering with the function of c-Rel.These results demonstrate that Nfkb1 exhibits multiple gene-specific inhibitory functions following TLR stimulation of murine macrophages.
DEFF Research Database (Denmark)
Nielsen, B; Hokland, P; Ellegaard, J
1989-01-01
Natural killer cell (NK) activity in peripheral blood (PB) was followed longitudinally for up to 2 yr after initiation of low-dose IFN-alpha-2b therapy in nine hairy cell leukemia (HCL) patients. A whole blood NK (WB-NK) assay was employed in order to measure the NK activity per unit blood. The p...
DEFF Research Database (Denmark)
Riley, Caroline Hasselbalch; Jensen, Morten Krogh; Brimnes, Marie Klinge
2011-01-01
Recent reports have described complete or major molecular remission in patients with polycythemia vera after long-term treatment with the immunomodulatory agent IFN-a2. Accordingly, there are reasons to believe that the immune system is a key player in eradicating the JAK2 mutated clone in these ......Recent reports have described complete or major molecular remission in patients with polycythemia vera after long-term treatment with the immunomodulatory agent IFN-a2. Accordingly, there are reasons to believe that the immune system is a key player in eradicating the JAK2 mutated clone...
Directory of Open Access Journals (Sweden)
Yoshihisa Yamano
Full Text Available BACKGROUND: Human T-lymphotropic virus type 1 (HTLV-1 is a human retrovirus associated with both HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP, which is a chronic neuroinflammatory disease, and adult T-cell leukemia (ATL. The pathogenesis of HAM/TSP is known to be as follows: HTLV-1-infected T cells trigger a hyperimmune response leading to neuroinflammation. However, the HTLV-1-infected T cell subset that plays a major role in the accelerated immune response has not yet been identified. PRINCIPAL FINDINGS: Here, we demonstrate that CD4(+CD25(+CCR4(+ T cells are the predominant viral reservoir, and their levels are increased in HAM/TSP patients. While CCR4 is known to be selectively expressed on T helper type 2 (Th2, Th17, and regulatory T (Treg cells in healthy individuals, we demonstrate that IFN-gamma production is extraordinarily increased and IL-4, IL-10, IL-17, and Foxp3 expression is decreased in the CD4(+CD25(+CCR4(+ T cells of HAM/TSP patients as compared to those in healthy individuals, and the alteration in function is specific to this cell subtype. Notably, the frequency of IFN-gamma-producing CD4(+CD25(+CCR4(+Foxp3(- T cells is dramatically increased in HAM/TSP patients, and this was found to be correlated with disease activity and severity. CONCLUSIONS: We have defined a unique T cell subset--IFN-gamma(+CCR4(+CD4(+CD25(+ T cells--that is abnormally increased and functionally altered in this retrovirus-associated inflammatory disorder of the central nervous system.
Roh, In Soon; Cho, Sungae; Eum, Seok-Yong; Cho, Sang-Nae
2013-05-01
Guinea pig is one of the most suitable animal models for Mycobacterium tuberculosis (M. tb) infection since it shows similarities to pulmonary infection in humans. Although guinea pig shows hematogenous spread of M. tb infection into the whole body, immunological studies have mainly focused on granulomatous tissues in lungs and spleens. In order to investigate the time-course of disease pathogenesis and immunological profiles in each infected organ, we performed the following approaches with guinea pigs experimentally infected with M. tb over a 22-week post-infection period. We examined body weight changes, M. tb growth curve, cytokine gene expression (IFN-γ and TNF-α), and histopathology in liver, spleen, lungs and lymph nodes of infected guinea pigs. The body weights of infected guinea pigs did not increase as much as uninfected ones and the number of M. tb bacilli in their organs increased except bronchotracheal lymph node during the experimental period. The gene expression of IFN-γ and TNF-α was induced between 3 and 6 weeks of infection; however, kinetic profiles of cytokine gene expression showed heterogeneity among organs over the study period. Histophathologically granulomatous lesions were developed in all four organs of infected guinea pigs. Although IFN-γ and TNF-α gene expression profiles showed heterogeneity, the granuloma formation was clearly observed in every organ regardless of whether the number of bacilli increased or decreased. However, this protective immunity was accompanied with severe tissue damage in all four organs, which may lead to the death of guinea pigs.
Pankow, Joel W; Jorgensen, Gary J; Terwilliger, Kent M; Glick, Stephen H; Isomaki, Nora; Harkonen, Kari; Turkulainen, Tommy
2015-04-21
A moisture barrier, device or product having a moisture barrier or a method of fabricating a moisture barrier having at least a polymer layer, and interfacial layer, and a barrier layer. The polymer layer may be fabricated from any suitable polymer including, but not limited to, fluoropolymers such as polyethylene terephthalate (PET) or polyethylene naphthalate (PEN), or ethylene-tetrafluoroethylene (ETFE). The interfacial layer may be formed by atomic layer deposition (ALD). In embodiments featuring an ALD interfacial layer, the deposited interfacial substance may be, but is not limited to, Al.sub.2O.sub.3, AlSiO.sub.x, TiO.sub.2, and an Al.sub.2O.sub.3/TiO.sub.2 laminate. The barrier layer associated with the interfacial layer may be deposited by plasma enhanced chemical vapor deposition (PECVD). The barrier layer may be a SiO.sub.xN.sub.y film.
Automatic Generation of Stippling Illustrations from two Photographs
Directory of Open Access Journals (Sweden)
Germán Arroyo
2012-05-01
This tool needs almost no user interaction. The user simply has to align both photographs and indicate the level of detail according to the distance. The rest is decided by our software. Whereas a professional illustrator needs more than 20 hours to finish a similar illustration, our software is able to do it in just few seconds.
Directory of Open Access Journals (Sweden)
Ceretto Monica
2007-06-01
Full Text Available Abstract Background Enhanced production of nitric oxide (NO following upmodulation of the inducible isoform of NO synthase (iNOS by haemozoin (HZ, inflammatory cytokines and LPS may provide protection against Plasmodium falciparum malaria by killing hepatic and blood forms of parasites and inhibiting the cytoadherence of parasitized erythrocytes (RBC to endothelial cells. Monocytes and macrophages are considered to contribute importantly to protective upregulation of iNOS and production of NO. Data obtained with murine phagocytes fed with human HZ and synthetic HZ (sHZ indicate that supplemental treatment of those cells with IFN-gamma elicited significant increases in protein and mRNA expression of iNOS and NO production, providing a potential mechanism linking HZ phagocytosis and increased production of NO. Purpose of this study was to analyse the effect of P. falciparum HZ and sHZ supplemental to treatment with IFN-gamma and/or a stimulatory cytokine-LPS mix on iNOS protein and mRNA expression in immuno-purified human monocytes. Methods Adherent immunopurified human monocytes (purity >85%, and murine phagocytic cell lines RAW 264.7, N11 and ANA1 were fed or not with P. falciparum HZ or sHZ and treated or not with IFN-gamma or a stimulatory cytokine-LPS mix. Production of NO was quantified in supernatants, iNOS protein and mRNA expression were measured after immunoprecipitation and Western blotting and quantitative RT-PCT, respectively. Results Phagocytosis of HZ/sHZ by human monocytes did not increase iNOS protein and mRNA expression and NO production either after stimulation by IFN-gamma or the cytokine-LPS mix. By contrast, in HZ/sHZ-laden murine macrophages, identical treatment with IFN-gamma and the cytokine-LPS mix elicited significant increases in protein and mRNA expression of iNOS and NOS metabolites production, in agreement with literature data. Conclusion Results indicate that human monocytes fed or not with HZ/sHZ were constantly
Directory of Open Access Journals (Sweden)
M. Piga
2011-09-01
Full Text Available Hepatitis C virus (HCV infection in the setting of Psoriatic Arthritis is an additional variable to be considered in the therapeutic approach to the disease because of the complications of an immunosuppressive treatment in the course of a chronic infection and the possible hepatotoxicity of many drugs conventionally used to treat psoriatic arthritis. The case reported explores the therapeutic options in a patient with IFN-α induced psoriatic arthritis, characterised by severe arthritis and psoriasis but also the concomitant presence of HCV chronic hepatitis, in light of the patient’s concerns
Directory of Open Access Journals (Sweden)
Mairaj Ahmed Ansari
2015-07-01
Full Text Available The IL-1β and type I interferon-β (IFN-β molecules are important inflammatory cytokines elicited by the eukaryotic host as innate immune responses against invading pathogens and danger signals. Recently, a predominantly nuclear gamma-interferon-inducible protein 16 (IFI16 involved in transcriptional regulation has emerged as an innate DNA sensor which induced IL-1β and IFN-β production through inflammasome and STING activation, respectively. Herpesvirus (KSHV, EBV, and HSV-1 episomal dsDNA genome recognition by IFI16 leads to IFI16-ASC-procaspase-1 inflammasome association, cytoplasmic translocation and IL-1β production. Independent of ASC, HSV-1 genome recognition results in IFI16 interaction with STING in the cytoplasm to induce interferon-β production. However, the mechanisms of IFI16-inflammasome formation, cytoplasmic redistribution and STING activation are not known. Our studies here demonstrate that recognition of herpesvirus genomes in the nucleus by IFI16 leads into its interaction with histone acetyltransferase p300 and IFI16 acetylation resulting in IFI16-ASC interaction, inflammasome assembly, increased interaction with Ran-GTPase, cytoplasmic redistribution, caspase-1 activation, IL-1β production, and interaction with STING which results in IRF-3 phosphorylation, nuclear pIRF-3 localization and interferon-β production. ASC and STING knockdowns did not affect IFI16 acetylation indicating that this modification is upstream of inflammasome-assembly and STING-activation. Vaccinia virus replicating in the cytoplasm did not induce nuclear IFI16 acetylation and cytoplasmic translocation. IFI16 physically associates with KSHV and HSV-1 genomes as revealed by proximity ligation microscopy and chromatin-immunoprecipitation studies which is not hampered by the inhibition of acetylation, thus suggesting that acetylation of IFI16 is not required for its innate sensing of nuclear viral genomes. Collectively, these studies identify the
Children’s Book Illustrations: Visual Language of Picture Books
Directory of Open Access Journals (Sweden)
Hladíková Hana
2014-01-01
Full Text Available High-quality picture books that merge text and illustration together in order to tell a story are eminent for healthy mental and social growth of children. This paper is to outline the benefits picture books bring to children between the ages three to eight, determine functions of its illustrative language, examine the process of its production, and point out a set of elements that, according to number of professional children's book illustrators, significantly contribute to the success of a picture book
Illustrating and Designing Quranic Imagery
Almenoar, Lubna
2009-01-01
Selected verses from Abdullah Yusuf Ali's English language translation of the meaning of the Quran have been used as a literary text to teach both descriptive and figurative imagery (including similes, metaphors and symbols) to students at the undergraduate level in an Islamic institution. The technique--Illustrating and Designing for teaching…
The Use of Pictorial Illustrations in African Language Dictionaries
Directory of Open Access Journals (Sweden)
Lilian Gangla-Birir
2011-10-01
Full Text Available
ABSTRACT: This article examines the use of pictorial illustrations in African language dictionar-ies, with particular reference to items generally included in dictionaries based on Stein's (1991 categories. It argues for the need to include more illustrations of cultural items specific to a par-ticular community and language group in dictionaries. A corpus analytic survey is done to deter-mine if African language dictionaries employ pictorial illustrations and, if so, which items are illus-trated. The results of this survey indicate that only a few African language dictionaries employ pictorial illustrations, even those that do correspond to Stein's categories. Of the dictionaries exam-ined, only one uses illustrations in the form of full-colour photographs, namely of different kinds of cattle, a very important cultural item within that specific community.
Keywords: PICTORIAL ILLUSTRATIONS, CULTURE, LEXICOGRAPHY, BILINGUAL DIC-TIONARY, MONOLINGUAL DICTIONARY, AFRICAN LANGUAGE
*****
OPSOMMING: Die gebruik van beeldillustrasies in Afrikataalwoordeboeke. Hierdie artikel ondersoek die gebruik van beeldillustrasies in Afrikataalwoordeboeke met spesiale verwysing na items wat gewoonlik in woordeboeke ingesluit word, gebaseer op Stein (1991 se kategorieë. Dit betoog vir die noodsaaklikheid om meer illustrasies van kulturele items eie aan 'n besondere gemeenskap of taalgroep in woordeboeke in te sluit. 'n Analitiese oorsig van 'n korpus is gedoen om te bepaal of Afrikataalwoordeboeke beeldillustrasies gebruik, en, indien wel, watter items geïllustreer word. Die resultate van hierdie oorsig toon aan dat slegs 'n paar Afrikataalwoor-deboeke beeldillustrasies gebruik, selfs dié wat met Stein se kategorieë ooreenstem. Van die woor-deboeke wat ondersoek is, gebruik net een illustrasies in die vorm van volkleurfoto's, naamlik van verskillende soorte beeste, 'n baie belangrike kulturele item binne daardie spesifieke gemeenskap
The illustrated A brief history of time
Hawking, Stephen
1996-01-01
This is Stephen Hawking's updated, expanded and illustrated edition of his celebrated work which includes the most recent developments in the field, many of which were forecast by him. At the same time, he explains his complex theories through a fresh visual dimension. Over one hunded and fifty stunning colour illustrations have been specially commissioned for this purpose to help the reader understand what have become popular mythic images of our century, but which nonetheless remain difficult, abstract ideas to grasp. It includes a new introduction written specially for this edition.
Models for estimation of service life of concrete barriers in low-level radioactive waste disposal
International Nuclear Information System (INIS)
Walton, J.C.; Plansky, L.E.; Smith, R.W.
1990-09-01
Concrete barriers will be used as intimate parts of systems for isolation of low level radioactive wastes subsequent to disposal. This work reviews mathematical models for estimating the degradation rate of concrete in typical service environments. The models considered cover sulfate attack, reinforcement corrosion, calcium hydroxide leaching, carbonation, freeze/thaw, and cracking. Additionally, fluid flow, mass transport, and geochemical properties of concrete are briefly reviewed. Example calculations included illustrate the types of predictions expected of the models. 79 refs., 24 figs., 6 tabs
Models for estimation of service life of concrete barriers in low-level radioactive waste disposal
Energy Technology Data Exchange (ETDEWEB)
Walton, J.C.; Plansky, L.E.; Smith, R.W. (EG and G Idaho, Inc., Idaho Falls, ID (USA))
1990-09-01
Concrete barriers will be used as intimate parts of systems for isolation of low level radioactive wastes subsequent to disposal. This work reviews mathematical models for estimating the degradation rate of concrete in typical service environments. The models considered cover sulfate attack, reinforcement corrosion, calcium hydroxide leaching, carbonation, freeze/thaw, and cracking. Additionally, fluid flow, mass transport, and geochemical properties of concrete are briefly reviewed. Example calculations included illustrate the types of predictions expected of the models. 79 refs., 24 figs., 6 tabs.
Thames barrier (flood protection barriers on the Thames)
International Nuclear Information System (INIS)
Ilkovic, J.
2005-01-01
In this paper the flood protection barriers on the Thames are presented. The flood protection system on the Thames in 1984 was commissioned. During two decades this barrier was used 54 times against to the high water and 34 times against storm-sewage. There is installed buttress type hydroelectric power plant
Developing hospital identity manuals: a reference tool for illustrators.
Schaffer, J A; Zimmerman, S B
1990-01-01
Because of an increase in hospital marketing efforts, medical illustrators may be asked to assist in developing and implementing hospital identity manuals, which specify the graphic standards for visual communications media. A checklist survey of existing identity manuals and a literature review were conducted by one of the authors, a medical illustrator, to help her to develop a manual for her hospital employer. This article documents the literature review, the study, and the identity manual development, and presents recommendations to help other medical illustrators who might become involved in similar assignments.
Malyar, Ivan V.; Gorin, Dmitry A.; Stetsyura, Svetlana V.
2013-01-01
In this report we present the analysis of I-V curves for MIS-structures like silicon substrate / nanodimensional polyelectrolyte layer / metal probe (contact) which is promising for biosensors, microfluidic chips, different devices of molecular electronics, such as OLEDs, solar cells, where polyelectrolyte layers can be used to modify semiconductor surface. The research is directed to investigate the contact phenomena which influence the resulting signal of devices mentioned above. The comparison of I-V characteristics of such structures measured by scanning tunnel microscopy (contactless technique) and using contact areas deposited by thermal evaporation onto the organic layer (the contact one) was carried out. The photoassisted I-V measurements and complex analysis based on Simmons and Schottky models allow one to extract the potential barriers and to observe the changes of charge transport in MIS-structures under illumination and after polyelectrolyte adsorption. The direct correlation between the thickness of the deposited polyelectrolyte layer and both equilibrium tunnel barrier and Schottky barrier height was observed for hybrid structures with polyethylenimine. The possibility of control over the I-V curves of hybrid structure and the height of the potential barriers (for different charge transports) by illumination was confirmed. Based on experimental data and complex analysis the band diagrams were plotted which illustrate the changes of potential barriers for MIS-structures due to the polyelectrolyte adsorption and under the illumination.
Kim, Hye Sung; Kim, Hyun Soo; Lee, Chang Woo; Chung, Doo Hyun
2010-04-15
The T cell Ig domain and mucin domain (TIM)1 protein expressed on the surface of Th2 cells regulates the immune response by modulating cytokine production. However, the functional roles of TIM1 have not been examined in NKT cells. Therefore, we investigated the immunologic effects of TIM1 on NKT cells. We found that mouse NK1.1(+)TCR-beta(+), alpha-galactosyl ceramide/CD1d dimer(+) NKT, and NKT hybridoma (DN32.D3) cells constitutively express TIM1 and TIM4 on their surface. Engagement of TIM1 on NKT cells by any of several anti-TIM1 mAbs suppressed the production of IFN-gamma in the presence of TCR stimulation in vitro and in vivo, whereas the effects of such engagement on Th2 cytokine production by the NKT cells varied with the particular anti-TIM1 Ab clone. Moreover, in DN32.D3 TIM4-knockdown NKT hybridoma cells, TIM1 engagement by rTIM1 or TIM4 enhanced IL-4 production while inhibiting IFN-gamma production in the presence of alpha-galactosyl ceramide stimulation. TIM1 engagement increased GATA-3 expression but reduced T-bet expression in NKT cells in the presence of TCR engagement. The adoptive transfer of NKT cells preincubated with anti-TIM1 mAbs into Jalpha18(-/-) mice aggravated bleomycin-induced pulmonary fibrosis by suppressing IFN-gamma production. Taken together, these results suggest that TIM1 costimulation on NKT cells enhances the cellular production of IL-4 while inhibiting the production of IFN-gamma. Thus, as a differential regulator of the immune response, TIM1 on NKT cells may be a useful therapeutic target for immune diseases.
Han, Nannan; Zhang, Zun; Jv, Houyu; Hu, Jingzhou; Ruan, Min; Zhang, Chenping
2018-06-05
The aim of the present study was to investigate whether tumor-derived supernatants down-regulate the immune function of plasmacytoid dendritic cells (pDCs) in oral cancer and the potential molecular mechanisms of this effect. Immunohistochemistry (IHC) and flow cytometry were used to detect tumor-infiltrating and peripheral blood pDCs. MTS and flow cytometry were employed to evaluate the immune response of CD4 + T cells. Real-time PCR and ELISA assays were used to identify TLR-7 and TLR-9 expression, IFN-α production and tumor-secreted soluble cytokines. The proportion of pDCs (0.121%±0.043%) was significantly higher in Oral squamous cell carcinoma (OSCC) samples than in normal tissue (0.023%±0.016%) (P = 0.021). TLR9 mRNA was significantly lower in tumor-infiltrating pDCs and positively correlated to low IFN-α production (r = 0.956; Poral cancer cells negatively regulated TLR9 mRNA expression and the subsequent IFN-α production of pDCs, which inhibited the immune response of CD4 + T cells. The neutralizing antibodies blocking assay showed that the specific inhibitory effect of pDC functionality was associated with the soluble fraction of the oral cancer environment, which is mainly mediated by IL-10 and TGF-β cooperation. Tumor-derived supernatants may impair the function of tumor-infiltrating pDCs, which subsequently decreases the immune response of CD4 + T cells in human oral cancer through TGF-β- and IL-10- dependent mechanisms. Careful manipulation of these impaired pDCs may help develop an important alternative immunotherapy for the treatment of oral cancer. Copyright © 2018 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
2016-01-01
Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...
Chuang, Emmeline; Aftosmes-Tobio, Alyssa; Blaine, Rachel E.; Giannetti, Mary; Land, Thomas; Davison, Kirsten K.
2015-01-01
Introduction The etiology of childhood obesity is multidimensional and includes individual, familial, organizational, and societal factors. Policymakers and researchers are promoting social–ecological approaches to obesity prevention that encompass multiple community sectors. Programs that successfully engage low-income families in making healthy choices are greatly needed, yet little is known about the extent to which stakeholders understand the complexity of barriers encountered by families. The objective of this study was to contextually frame barriers faced by low-income families reported by community stakeholders by using the Family Ecological Model (FEM). Methods From 2012 through 2013, we conducted semistructured interviews with 39 stakeholders from 2 communities in Massachusetts that were participating in a multisector intervention for childhood obesity prevention. Stakeholders represented schools; afterschool programs; health care; the Special Supplemental Nutrition Program for Women, Infants, and Children; and early care and education. Interviews were audio-recorded, transcribed, coded, and summarized. Results Stakeholder reports of the barriers experienced by low-income families had a strong degree of overlap with FEM and reflected awareness of the broader contextual factors (eg, availability of community resources, family culture, education) and social and emotional dynamics within families (eg, parent knowledge, social norms, distrust of health care providers, chronic life stressors) that could affect family adoption of healthy lifestyle behaviors. Furthermore, results illustrated a level of consistency in stakeholder awareness across multiple community sectors. Conclusion The congruity of stakeholder perspectives with those of low-income parents as summarized in FEM and across community sectors illustrates potential for synergizing the efforts necessary for multisector, multilevel community interventions for the prevention of childhood obesity. PMID
Selling pictures: the illustrated auction catalogue
Directory of Open Access Journals (Sweden)
Elizabeth Pergam
2014-12-01
Full Text Available This essay is based upon a survey of reproductions in auction catalogues – from their first appearance in the early eighteenth century until their more consistent use in the second decade of the twentieth century. Examining the role of these illustrations sheds light on how auctions functioned; it was not just the works of art that were traded, but knowledge about those works of art became currency to be exchanged. In contrast to the high end engravings and photographs of luxury illustrated art books, reproductions in auction catalogues – publications produced as ephemeral marketing tools – were of noticeably lower quality. This study of the status of reproductions, therefore, investigates the evolving understanding of art knowledge, both aesthetic and economic, and the interdependence of the market and connoisseurship.
Illustrations in Text: A Retentional Role.
Duchastel, Philippe C.
1981-01-01
Describes the results of a study of the retentional role of illustrations in a text and their effect on enhancing long-term memory with 15-year-old secondary school students. Seven references are listed. (CHC)
Geophysical characterization of subsurface barriers
International Nuclear Information System (INIS)
Borns, D.J.
1995-08-01
An option for controlling contaminant migration from plumes and buried waste sites is to construct a subsurface barrier of a low-permeability material. The successful application of subsurface barriers requires processes to verify the emplacement and effectiveness of barrier and to monitor the performance of a barrier after emplacement. Non destructive and remote sensing techniques, such as geophysical methods, are possible technologies to address these needs. The changes in mechanical, hydrologic and chemical properties associated with the emplacement of an engineered barrier will affect geophysical properties such a seismic velocity, electrical conductivity, and dielectric constant. Also, the barrier, once emplaced and interacting with the in situ geologic system, may affect the paths along which electrical current flows in the subsurface. These changes in properties and processes facilitate the detection and monitoring of the barrier. The approaches to characterizing and monitoring engineered barriers can be divided between (1) methods that directly image the barrier using the contrasts in physical properties between the barrier and the host soil or rock and (2) methods that reflect flow processes around or through the barrier. For example, seismic methods that delineate the changes in density and stiffness associated with the barrier represents a direct imaging method. Electrical self potential methods and flow probes based on heat flow methods represent techniques that can delineate the flow path or flow processes around and through a barrier
Douam, Florian; Soto Albrecht, Yentli E; Hrebikova, Gabriela; Sadimin, Evita; Davidson, Christian; Kotenko, Sergei V; Ploss, Alexander
2017-08-15
Yellow fever virus (YFV) is an arthropod-borne flavivirus, infecting ~200,000 people worldwide annually and causing about 30,000 deaths. The live attenuated vaccine strain, YFV-17D, has significantly contributed in controlling the global burden of yellow fever worldwide. However, the viral and host contributions to YFV-17D attenuation remain elusive. Type I interferon (IFN-α/β) signaling and type II interferon (IFN-γ) signaling have been shown to be mutually supportive in controlling YFV-17D infection despite distinct mechanisms of action in viral infection. However, it remains unclear how type III IFN (IFN-λ) integrates into this antiviral system. Here, we report that while wild-type (WT) and IFN-λ receptor knockout (λR -/- ) mice were largely resistant to YFV-17D, deficiency in type I IFN signaling resulted in robust infection. Although IFN-α/β receptor knockout (α/βR -/- ) mice survived the infection, mice with combined deficiencies in both type I signaling and type III IFN signaling were hypersusceptible to YFV-17D and succumbed to the infection. Mortality was associated with viral neuroinvasion and increased permeability of the blood-brain barrier (BBB). α/βR -/- λR -/- mice also exhibited distinct changes in the frequencies of multiple immune cell lineages, impaired T-cell activation, and severe perturbation of the proinflammatory cytokine balance. Taken together, our data highlight that type III IFN has critical immunomodulatory and neuroprotective functions that prevent viral neuroinvasion during active YFV-17D replication. Type III IFN thus likely represents a safeguard mechanism crucial for controlling YFV-17D infection and contributing to shaping vaccine immunogenicity. IMPORTANCE YFV-17D is a live attenuated flavivirus vaccine strain recognized as one of the most effective vaccines ever developed. However, the host and viral determinants governing YFV-17D attenuation and its potent immunogenicity are still unknown. Here, we analyzed the
Blocking germanium diffusion inside silicon dioxide using a co-implanted silicon barrier
Barba, D.; Wang, C.; Nélis, A.; Terwagne, G.; Rosei, F.
2018-04-01
We investigate the effect of co-implanting a silicon sublayer on the thermal diffusion of germanium ions implanted into SiO2 and the growth of Ge nanocrystals (Ge-ncs). High-resolution imaging obtained by transmission electron microscopy and energy dispersive spectroscopy measurements supported by Monte-Carlo calculations shows that the Si-enriched region acts as a diffusion barrier for Ge atoms. This barrier prevents Ge outgassing during thermal annealing at 1100 °C. Both the localization and the reduced size of Ge-ncs formed within the sample region co-implanted with Si are observed, as well as the nucleation of mixed Ge/Si nanocrystals containing structural point defects and stacking faults. Although it was found that the Si co-implantation affects the crystallinity of the formed Ge-ncs, this technique can be implemented to produce size-selective and depth-ordered nanostructured systems by controlling the spatial distribution of diffusing Ge. We illustrate this feature for Ge-ncs embedded within a single SiO2 monolayer, whose diameters were gradually increased from 1 nm to 5 nm over a depth of 100 nm.
Chronicles of progress : the illustrated newspapers of colonial Australia, 1853-1896
Dowling, Peter Andrew
2017-01-01
This thesis is a study of the imagery in the illustrated newspapers of colonial Australia over the period of their publication, 1853-1896. The distinguishing feature of these papers was that the illustrations were printed from engraved woodblocks. The thesis is pioneering in the sense that whilst historians have regularly used images from the papers to illustrate books on a wide variety of topics, no one has researched the illustrated newspapers as a primary source in their ...
Illustrations of vacuum polarization by solitons
International Nuclear Information System (INIS)
MacKenzie, R.; Wilczek, F.
1984-01-01
The value and limitations of the adiabatic method for calculating induced charges are discussed in a general way and illustrated in some simple models in 1+1 dimensions. The relevance of the size of solitons is emphasized
Cérbulo-Vázquez, Arturo; Valdés-Ramos, Roxana; Santos-Argumedo, Leopoldo
2003-01-01
The immune response exhibits quantitative and qualitative differences throughout human development. Both phenotypical and functional immaturity of newborn immune cellular components have been reported. We aimed to analyze possible differences in cellular activation assessed by expression of surface CD69 and cytokine production in mononuclear peripheral blood cells from premature (term (>37 weeks of gestation) neonates compared to adult donors. Ten persons from each group were selected; none was infected, immunodepressed, under medical treatment, or had any congenital abnormalities. Blood was obtained from umbilical cord of term and pre-term donors and vein punction of adults. All samples were collected in heparin and subsequently activated with PHA-L or PMA plus ionomycin at 37 degrees C for 4 h. After incubation, cells were labeled to determine CD69 expression on CD3+CD4+, CD3+CD8+, CD19+, and CD16+56+ subpopulations. Intracellular staining was performed to analyze IFN-gamma, IL-2, and CD69 in CD3+ cells. After staining, cells were analyzed by flow cytometry. We first found a substantially higher number of CD3+CD4+CD69+ cells in premature and term neonates than in adults. Secondly, percentage of CD3+CD8+, CD56+, and CD19+ cells expressing CD69 was similar among the three groups. Thirdly, expression of CD69 was higher in CD19+ cells than in CD16+56+ cells of all three groups. Regarding cytokine production, IFN-gamma was detected only in cells from adults and was consistent in all individuals analyzed. In sharp contrast, IL-2 and intracellular CD69 (iCD69) were detected in all three groups, with no significant differences among them. Induction of IL-2 and iCD69 showed that lack of response with IFN-gamma was restricted to pre-term and newborn populations. In summary, our results showed that a) CD69 is an early activation marker of both mononuclear umbilical cord and peripheral blood cells activated by a mitogenic stimulus, and b) newborn CD3+ cells probably lack
Directory of Open Access Journals (Sweden)
Yannick Glemarec
2016-01-01
Full Text Available Rapidly falling renewable technology costs and new business models mean that decentralized energy solutions hold great promise to accelerate universal sustainable energy access. Across developing countries, women are typically the primary household energy managers. Close to their customers, women entrepreneurs have the potential to lower customer acquisition and servicing costs and drive these new decentralized solutions. However, they remain under-represented in the industry. This paper attempts to understand the root causes of this gender gap. It formulates the research hypothesis that market transformation policies intended to reduce investment risks to accelerate energy access may not benefit men and women entrepreneurs equally because of the existing structural barriers that women face. To test this hypothesis, the paper conducts a gender sensitive investment barrier and risk analysis, overlaid onto an existing gender neutral taxonomy of investment barriers and risks for decentralized sustainable energy solutions. A key finding is that for women entrepreneurs, existing structural impediments to gender equality translate into additional investment barriers as well as increased likelihood of occurrence and severity of the financial impact of generic investment risks. The paper offers an illustrative theory of change to facilitate a dialogue on the specific interventions needed to address these gender differentiated risks locally. It concludes that market transformation efforts for universal sustainable energy access must include targeted policy measures to ensure equal benefits to men and women entrepreneurs, and optimize the use of public resources to catalyze private investment and reduce poverty.