WorldWideScience

Sample records for identifying molecular entourages

  1. Diabetes education of patients and their entourage: out-of-hospital national study (EDUCATED 2).

    Science.gov (United States)

    Lapostolle, Frédéric; Hamdi, Nadia; Barghout, Majed; Soulat, Louis; Faucher, Anna; Lambert, Yves; Peschanski, Nicolas; Ricard-Hibon, Agnès; Chassery, Carine; Roti, Maryline; Bounes, Vincent; Debaty, Guillaume; Mokni, Tarak; Egmann, Gérald; Fort, Pierre-Arnaud; Boudenia, Karim; Alayrac, Laurent; Safraou, Mohamed; Galinski, Michel; Adnet, Frédéric

    2017-04-01

    To determine the contributing factors in the successful diabetes education of patients and their entourage. Prospective observational study conducted in a pre-hospital setting by 17 emergency services across France (September 2009-January 2011) included all insulin-treated patients (≥18 years) provided that at least one family member was present on scene. Data were collected from patients and their entourage: (1) personal details including language proficiency and educational attainment, (2) treatments, (3) diabetes-related data (log sheets, glucose meter, glucagon, glycated hemoglobin, prior hypoglycemic episodes); (4) care by diabetologist, general practitioner and/or visiting nurse. The main end points were ability to measure capillary blood sugar (patient) and awareness of hypoglycemia symptoms and ability to administer glucagon (entourage). Overall, 561 patients and 736 family members were included; 343 patients (61%) were experiencing a hypoglycemic episode (patients and 343 (50%) family members could measure capillary blood sugar. They could name a median of 2 [0-3‰] hypoglycemia symptoms although 217 (39%) patients and 262 (39%) family members could name no symptom. Few patients (33%) had glucagon available. In multivariate analyses, the main factor associated with better patient education was care by a diabetologist. Lack of an educational qualification and visits by a nurse were associated with poor patient education, and French mother tongue and care by a diabetologist with better education of the entourage. In France, diabetic patients and their entourage are inadequately educated. Their education benefits most from care by a diabetologist.

  2. Living like a king? The entourage of Odet de Foix, vicomte de Lautrec, governor of Milan.

    Directory of Open Access Journals (Sweden)

    Philippa Woodcock

    2015-11-01

    Full Text Available In the early sixteenth century, the de Foix family were both kin and intimate councillors to the Valois kings, Louis XII and François I. With a powerbase in Guyenne, the de Foix tried to use their connections at court to profit from the French conquest of Milan, 1499-1522. This paper will explore the career of one prominent family member, Odet de Foix, vicomte de Lautrec (1483-1528. Lautrec was a Marshal of France, who served in Italy as a soldier and governor. He was key to the royal entourage, amongst François I’s intimates at the Field of the Cloth of Gold. His sister, Françoise, was also the king’s mistress. The paper will examine Lautrec’s entourage from two aspects. Firstly, it asks how Lautrec established his entourage from his experience in Navarre and Italy and as a member of the royal retinue. It establishes the importance of familial and regional ties, but also demonstrates the important role played by men of talent. Secondly, it explores Lautrec's relationship to his entourage once governor of Milan. Were ties of blood, career or positions of Italian prestige the most important for a governor when he chose his intimates? Were compromises made with Italian traditions and elites to sustain his rule? Did he learn from the experience and failures of previous governors?  The article contributes to a gap in scholarship for the later period of French Milan from 1515-1522. It also adds to our knowledge of the behaviour and ambitions of early modern governors.

  3. [Not without my family! The importance of the entourage in primary care medicine with youth].

    Science.gov (United States)

    Devillé, Cédric; Narring, Françoise

    2016-06-08

    At the doctor's office primary care, symptomatology of young is often vague or nonspecific. Faced with such symptoms, via the analysis of a clinical case, significant in many clinical situations, we show the importance of considering the significant members of the entourage and invite them to the surgery. A therapeutic alliance better weaves between the youth and his doctor if the environment is taken into account and will lead to better therapeutic response.

  4. Taming THC: potential cannabis synergy and phytocannabinoid-terpenoid entourage effects

    Science.gov (United States)

    Russo, Ethan B

    2011-01-01

    Tetrahydrocannabinol (THC) has been the primary focus of cannabis research since 1964, when Raphael Mechoulam isolated and synthesized it. More recently, the synergistic contributions of cannabidiol to cannabis pharmacology and analgesia have been scientifically demonstrated. Other phytocannabinoids, including tetrahydrocannabivarin, cannabigerol and cannabichromene, exert additional effects of therapeutic interest. Innovative conventional plant breeding has yielded cannabis chemotypes expressing high titres of each component for future study. This review will explore another echelon of phytotherapeutic agents, the cannabis terpenoids: limonene, myrcene, α-pinene, linalool, β-caryophyllene, caryophyllene oxide, nerolidol and phytol. Terpenoids share a precursor with phytocannabinoids, and are all flavour and fragrance components common to human diets that have been designated Generally Recognized as Safe by the US Food and Drug Administration and other regulatory agencies. Terpenoids are quite potent, and affect animal and even human behaviour when inhaled from ambient air at serum levels in the single digits ng·mL−1. They display unique therapeutic effects that may contribute meaningfully to the entourage effects of cannabis-based medicinal extracts. Particular focus will be placed on phytocannabinoid-terpenoid interactions that could produce synergy with respect to treatment of pain, inflammation, depression, anxiety, addiction, epilepsy, cancer, fungal and bacterial infections (including methicillin-resistant Staphylococcus aureus). Scientific evidence is presented for non-cannabinoid plant components as putative antidotes to intoxicating effects of THC that could increase its therapeutic index. Methods for investigating entourage effects in future experiments will be proposed. Phytocannabinoid-terpenoid synergy, if proven, increases the likelihood that an extensive pipeline of new therapeutic products is possible from this venerable plant. LINKED ARTICLES

  5. Genomic analyses identify molecular subtypes of pancreatic cancer.

    Science.gov (United States)

    Bailey, Peter; Chang, David K; Nones, Katia; Johns, Amber L; Patch, Ann-Marie; Gingras, Marie-Claude; Miller, David K; Christ, Angelika N; Bruxner, Tim J C; Quinn, Michael C; Nourse, Craig; Murtaugh, L Charles; Harliwong, Ivon; Idrisoglu, Senel; Manning, Suzanne; Nourbakhsh, Ehsan; Wani, Shivangi; Fink, Lynn; Holmes, Oliver; Chin, Venessa; Anderson, Matthew J; Kazakoff, Stephen; Leonard, Conrad; Newell, Felicity; Waddell, Nick; Wood, Scott; Xu, Qinying; Wilson, Peter J; Cloonan, Nicole; Kassahn, Karin S; Taylor, Darrin; Quek, Kelly; Robertson, Alan; Pantano, Lorena; Mincarelli, Laura; Sanchez, Luis N; Evers, Lisa; Wu, Jianmin; Pinese, Mark; Cowley, Mark J; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chantrill, Lorraine A; Mawson, Amanda; Humphris, Jeremy; Chou, Angela; Pajic, Marina; Scarlett, Christopher J; Pinho, Andreia V; Giry-Laterriere, Marc; Rooman, Ilse; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Merrett, Neil D; Toon, Christopher W; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Moran-Jones, Kim; Jamieson, Nigel B; Graham, Janet S; Duthie, Fraser; Oien, Karin; Hair, Jane; Grützmann, Robert; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Corbo, Vincenzo; Bassi, Claudio; Rusev, Borislav; Capelli, Paola; Salvia, Roberto; Tortora, Giampaolo; Mukhopadhyay, Debabrata; Petersen, Gloria M; Munzy, Donna M; Fisher, William E; Karim, Saadia A; Eshleman, James R; Hruban, Ralph H; Pilarsky, Christian; Morton, Jennifer P; Sansom, Owen J; Scarpa, Aldo; Musgrove, Elizabeth A; Bailey, Ulla-Maja Hagbo; Hofmann, Oliver; Sutherland, Robert L; Wheeler, David A; Gill, Anthony J; Gibbs, Richard A; Pearson, John V; Waddell, Nicola; Biankin, Andrew V; Grimmond, Sean M

    2016-03-03

    Integrated genomic analysis of 456 pancreatic ductal adenocarcinomas identified 32 recurrently mutated genes that aggregate into 10 pathways: KRAS, TGF-β, WNT, NOTCH, ROBO/SLIT signalling, G1/S transition, SWI-SNF, chromatin modification, DNA repair and RNA processing. Expression analysis defined 4 subtypes: (1) squamous; (2) pancreatic progenitor; (3) immunogenic; and (4) aberrantly differentiated endocrine exocrine (ADEX) that correlate with histopathological characteristics. Squamous tumours are enriched for TP53 and KDM6A mutations, upregulation of the TP63∆N transcriptional network, hypermethylation of pancreatic endodermal cell-fate determining genes and have a poor prognosis. Pancreatic progenitor tumours preferentially express genes involved in early pancreatic development (FOXA2/3, PDX1 and MNX1). ADEX tumours displayed upregulation of genes that regulate networks involved in KRAS activation, exocrine (NR5A2 and RBPJL), and endocrine differentiation (NEUROD1 and NKX2-2). Immunogenic tumours contained upregulated immune networks including pathways involved in acquired immune suppression. These data infer differences in the molecular evolution of pancreatic cancer subtypes and identify opportunities for therapeutic development.

  6. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    Science.gov (United States)

    2011-01-01

    Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples). Four distinct clusters were identified by Principal Components Analysis (PCA) in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples) using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p INSS stage 4 and/or dead of disease, p < 0.05, Fisher's exact test). Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group's specific characteristics. PMID:21492432

  7. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    Directory of Open Access Journals (Sweden)

    Kogner Per

    2011-04-01

    Full Text Available Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB; Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples. Four distinct clusters were identified by Principal Components Analysis (PCA in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p ALK, BIRC5, and PHOX2B, and was significantly associated with higher tumour stage, poor outcome and poor survival compared to the Type 1-corresponding favourable group (INSS stage 4 and/or dead of disease, p Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group's specific characteristics.

  8. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    LENUS (Irish Health Repository)

    Abel, Frida

    2011-04-14

    Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples). Four distinct clusters were identified by Principal Components Analysis (PCA) in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples) using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p < 0.05, one-way ANOVA test). PCA clusters p1, p2, and p3 were found to correspond well to the postulated subtypes 1, 2A, and 2B, respectively. Remarkably, a fourth novel cluster was detected in all three independent data sets. This cluster comprised mainly 11q-deleted MNA-negative tumours with low expression of ALK, BIRC5, and PHOX2B, and was significantly associated with higher tumour stage, poor outcome and poor survival compared to the Type 1-corresponding favourable group (INSS stage 4 and\\/or dead of disease, p < 0.05, Fisher\\'s exact test). Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group\\'s specific characteristics.

  9. Identifying molecular targets of lifestyle modifications in colon cancer prevention

    Directory of Open Access Journals (Sweden)

    Molly Marie Derry

    2013-05-01

    Full Text Available One in four deaths in the United States is cancer-related, and colorectal cancer (CRC is the second leading cause of cancer-associated deaths. Screening strategies are utilized but have not reduced disease incidence or mortality. In this regard, there is an interest in cancer preventive strategies focusing on lifestyle intervention, where specific etiologic factors involved in cancer initiation, promotion, and progression could be targeted. For example, exposure to dietary carcinogens, such as nitrosamines and polycyclic aromatic hydrocarbons influences colon carcinogenesis. Furthermore, dietary deficiencies could alter sensitivity to genetic damage and influence carcinogen metabolism contributing to CRC. High alcohol consumption increases the risk of mutations including the fact that acetaldehyde, an ethanol metabolite, is classified as a group 1 carcinogen. Tobacco smoke exposure is also a risk factor for cancer development; ~20% of CRCs are associated with smoking. Additionally, obese patients have a higher risk of cancer development, which is further supported by the fact that physical activity decreases CRC risk by 55%. Similarly, chronic inflammatory conditions also increase the risk of CRC development. Moreover, the circadian clock alters digestion and regulates other biochemical, physiological and behavioral processes that could positively influence CRC. Taken together, colon carcinogenesis involves a number of etiological factors, and therefore, to create effective preventive strategies, molecular targets need to be identified and beleaguered prior to disease progression. With this in mind, the following is a comprehensive review identifying downstream target proteins of the above lifestyle risk factors, which are modulated during colon carcinogenesis and could be targeted for CRC prevention by novel agents including phytochemicals.

  10. Molecular profiling identifies prognostic markers of stage IA lung adenocarcinoma.

    Science.gov (United States)

    Zhang, Jie; Shao, Jinchen; Zhu, Lei; Zhao, Ruiying; Xing, Jie; Wang, Jun; Guo, Xiaohui; Tu, Shichun; Han, Baohui; Yu, Keke

    2017-09-26

    We previously showed that different pathologic subtypes were associated with different prognostic values in patients with stage IA lung adenocarcinoma (AC). We hypothesize that differential gene expression profiles of different subtypes may be valuable factors for prognosis in stage IA lung adenocarcinoma. We performed microarray gene expression profiling on tumor tissues micro-dissected from patients with acinar and solid predominant subtypes of stage IA lung adenocarcinoma. These patients had undergone a lobectomy and mediastinal lymph node dissection at the Shanghai Chest Hospital, Shanghai, China in 2012. No patient had preoperative treatment. We performed the Gene Set Enrichment Analysis (GSEA) analysis to look for gene expression signatures associated with tumor subtypes. The histologic subtypes of all patients were classified according to the 2015 WHO lung Adenocarcinoma classification. We found that patients with the solid predominant subtype are enriched for genes involved in RNA polymerase activity as well as inactivation of the p53 pathway. Further, we identified a list of genes that may serve as prognostic markers for stage IA lung adenocarcinoma. Validation in the TCGA database shows that these genes are correlated with survival, suggesting that they are novel prognostic factors for stage IA lung adenocarcinoma. In conclusion, we have uncovered novel prognostic factors for stage IA lung adenocarcinoma using gene expression profiling in combination with histopathology subtyping.

  11. Using Genetic Buffering Relationships Identified in Fission Yeast To Elucidate the Molecular Pathology of Tuberous Sclerosis

    Science.gov (United States)

    2016-07-01

    tsc1 and tsc2 loss of function mutations in Schizosaccharomyces pombe. Northeast Regional Yeast Meeting, June 16-17, University at Buffalo, The State...AWARD NUMBER: W81XWH-14-1-0169 TITLE: Using Genetic Buffering Relationships Identified in Fission Yeast To Elucidate the Molecular Pathology of...SUBTITLE Using Genetic Buffering Relationships Identified in Fission 5a. CONTRACT NUMBER W81XWH-14-1-0169 Yeast to Elucidate the Molecular Pathology

  12. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles

    Directory of Open Access Journals (Sweden)

    Farshad Farshidfar

    2017-03-01

    Full Text Available Cholangiocarcinoma (CCA is an aggressive malignancy of the bile ducts, with poor prognosis and limited treatment options. Here, we describe the integrated analysis of somatic mutations, RNA expression, copy number, and DNA methylation by The Cancer Genome Atlas of a set of predominantly intrahepatic CCA cases and propose a molecular classification scheme. We identified an IDH mutant-enriched subtype with distinct molecular features including low expression of chromatin modifiers, elevated expression of mitochondrial genes, and increased mitochondrial DNA copy number. Leveraging the multi-platform data, we observed that ARID1A exhibited DNA hypermethylation and decreased expression in the IDH mutant subtype. More broadly, we found that IDH mutations are associated with an expanded histological spectrum of liver tumors with molecular features that stratify with CCA. Our studies reveal insights into the molecular pathogenesis and heterogeneity of cholangiocarcinoma and provide classification information of potential therapeutic significance.

  13. Identifying molecular subtypes in human colon cancer using gene expression and DNA methylation microarray data

    OpenAIRE

    REN, ZHONGLU; WANG, WENHUI; LI, JINMING

    2015-01-01

    Identifying colon cancer subtypes based on molecular signatures may allow for a more rational, patient-specific approach to therapy in the future. Classifications using gene expression data have been attempted before with little concordance between the different studies carried out. In this study we aimed to uncover subtypes of colon cancer that have distinct biological characteristics and identify a set of novel biomarkers which could best reflect the clinical and/or biological characteristi...

  14. A Systems Biology Framework Identifies Molecular Underpinnings of Coronary Heart Disease

    Science.gov (United States)

    Huan, Tianxiao; Zhang, Bin; Wang, Zhi; Joehanes, Roby; Zhu, Jun; Johnson, Andrew D.; Ying, Saixia; Munson, Peter J.; Raghavachari, Nalini; Wang, Richard; Liu, Poching; Courchesne, Paul; Hwang, Shih-Jen; Assimes, Themistocles L.; McPherson, Ruth; Samani, Nilesh J.; Schunkert, Heribert; Meng, Qingying; Suver, Christine; O'Donnell, Christopher J.; Derry, Jonathan; Yang, Xia; Levy, Daniel

    2013-01-01

    Objective Genetic approaches have identified numerous loci associated with coronary heart disease (CHD). The molecular mechanisms underlying CHD gene-disease associations, however, remain unclear. We hypothesized that genetic variants with both strong and subtle effects drive gene subnetworks that in turn affect CHD. Approach and Results We surveyed CHD-associated molecular interactions by constructing coexpression networks using whole blood gene expression profiles from 188 CHD cases and 188 age- and sex-matched controls. 24 coexpression modules were identified including one case-specific and one control-specific differential module (DM). The DMs were enriched for genes involved in B-cell activation, immune response, and ion transport. By integrating the DMs with altered gene expression associated SNPs (eSNPs) and with results of GWAS of CHD and its risk factors, the control-specific DM was implicated as CHD-causal based on its significant enrichment for both CHD and lipid eSNPs. This causal DM was further integrated with tissue-specific Bayesian networks and protein-protein interaction networks to identify regulatory key driver (KD) genes. Multi-tissue KDs (SPIB and TNFRSF13C) and tissue-specific KDs (e.g. EBF1) were identified. Conclusions Our network-driven integrative analysis not only identified CHD-related genes, but also defined network structure that sheds light on the molecular interactions of genes associated with CHD risk. PMID:23539213

  15. Identifying the molecular functions of electron transport proteins using radial basis function networks and biochemical properties.

    Science.gov (United States)

    Le, Nguyen-Quoc-Khanh; Nguyen, Trinh-Trung-Duong; Ou, Yu-Yen

    2017-05-01

    The electron transport proteins have an important role in storing and transferring electrons in cellular respiration, which is the most proficient process through which cells gather energy from consumed food. According to the molecular functions, the electron transport chain components could be formed with five complexes with several different electron carriers and functions. Therefore, identifying the molecular functions in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. This work includes two phases for discriminating electron transport proteins from transport proteins and classifying categories of five complexes in electron transport proteins. In the first phase, the performances from PSSM with AAIndex feature set were successful in identifying electron transport proteins in transport proteins with achieved sensitivity of 73.2%, specificity of 94.1%, and accuracy of 91.3%, with MCC of 0.64 for independent data set. With the second phase, our method can approach a precise model for identifying of five complexes with different molecular functions in electron transport proteins. The PSSM with AAIndex properties in five complexes achieved MCC of 0.51, 0.47, 0.42, 0.74, and 1.00 for independent data set, respectively. We suggest that our study could be a power model for determining new proteins that belongs into which molecular function of electron transport proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. NEWLY IDENTIFIED EXTENDED GREEN OBJECTS (EGOs) FROM THE SPITZER GLIMPSE II SURVEY. II. MOLECULAR CLOUD ENVIRONMENTS

    Energy Technology Data Exchange (ETDEWEB)

    Chen Xi; Gan Conggui; Shen Zhiqiang [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, Shanghai 200030 (China); Ellingsen, Simon P.; Titmarsh, Anita [School of Mathematics and Physics, University of Tasmania, Hobart, Tasmania (Australia); He Jinhua, E-mail: chenxi@shao.ac.cn [Key Laboratory for the Structure and Evolution of Celestial Objects, Yunnan Astronomical Observatory/National Astronomical Observatory, Chinese Academy of Sciences, P.O. Box 110, Kunming 650011, Yunnan Province (China)

    2013-06-01

    We have undertaken a survey of molecular lines in the 3 mm band toward 57 young stellar objects using the Australia Telescope National Facility Mopra 22 m radio telescope. The target sources were young stellar objects with active outflows (extended green objects (EGOs)) newly identified from the GLIMPSE II survey. We observe a high detection rate (50%) of broad line wing emission in the HNC and CS thermal lines, which combined with the high detection rate of class I methanol masers toward these sources (reported in Paper I) further demonstrates that the GLIMPSE II EGOs are associated with outflows. The physical and kinematic characteristics derived from the 3 mm molecular lines for these newly identified EGOs are consistent with these sources being massive young stellar objects with ongoing outflow activity and rapid accretion. These findings support our previous investigations of the mid-infrared properties of these sources and their association with other star formation tracers (e.g., infrared dark clouds, methanol masers and millimeter dust sources) presented in Paper I. The high detection rate (64%) of the hot core tracer CH{sub 3}CN reveals that the majority of these new EGOs have evolved to the hot molecular core stage. Comparison of the observed molecular column densities with predictions from hot core chemistry models reveals that the newly identified EGOs from the GLIMPSE II survey are members of the youngest hot core population, with an evolutionary time scale of the order of 10{sup 3} yr.

  17. Probing molecular mechanisms of the Hsp90 chaperone: biophysical modeling identifies key regulators of functional dynamics.

    Directory of Open Access Journals (Sweden)

    Anshuman Dixit

    Full Text Available Deciphering functional mechanisms of the Hsp90 chaperone machinery is an important objective in cancer biology aiming to facilitate discovery of targeted anti-cancer therapies. Despite significant advances in understanding structure and function of molecular chaperones, organizing molecular principles that control the relationship between conformational diversity and functional mechanisms of the Hsp90 activity lack a sufficient quantitative characterization. We combined molecular dynamics simulations, principal component analysis, the energy landscape model and structure-functional analysis of Hsp90 regulatory interactions to systematically investigate functional dynamics of the molecular chaperone. This approach has identified a network of conserved regions common to the Hsp90 chaperones that could play a universal role in coordinating functional dynamics, principal collective motions and allosteric signaling of Hsp90. We have found that these functional motifs may be utilized by the molecular chaperone machinery to act collectively as central regulators of Hsp90 dynamics and activity, including the inter-domain communications, control of ATP hydrolysis, and protein client binding. These findings have provided support to a long-standing assertion that allosteric regulation and catalysis may have emerged via common evolutionary routes. The interaction networks regulating functional motions of Hsp90 may be determined by the inherent structural architecture of the molecular chaperone. At the same time, the thermodynamics-based "conformational selection" of functional states is likely to be activated based on the nature of the binding partner. This mechanistic model of Hsp90 dynamics and function is consistent with the notion that allosteric networks orchestrating cooperative protein motions can be formed by evolutionary conserved and sparsely connected residue clusters. Hence, allosteric signaling through a small network of distantly connected

  18. Cortical GABA markers identify a molecular subtype of psychotic and bipolar disorders.

    Science.gov (United States)

    Volk, D W; Sampson, A R; Zhang, Y; Edelson, J R; Lewis, D A

    2016-09-01

    Deficits in gamma aminobutyric acid (GABA) neuron-related markers, including the GABA-synthesizing enzyme GAD67, the calcium-binding protein parvalbumin, the neuropeptide somatostatin, and the transcription factor Lhx6, are most pronounced in a subset of schizophrenia subjects identified as having a 'low GABA marker' (LGM) molecular phenotype. Furthermore, schizophrenia shares degrees of genetic liability, clinical features and cortical circuitry abnormalities with schizoaffective disorder and bipolar disorder. Therefore, we determined the extent to which a similar LGM molecular phenotype may also exist in subjects with these disorders. Transcript levels for GAD67, parvalbumin, somatostatin, and Lhx6 were quantified using quantitative PCR in prefrontal cortex area 9 of 184 subjects with a diagnosis of schizophrenia (n = 39), schizoaffective disorder (n = 23) or bipolar disorder (n = 35), or with a confirmed absence of any psychiatric diagnoses (n = 87). A blinded clustering approach was employed to determine the presence of a LGM molecular phenotype across all subjects. Approximately 49% of the subjects with schizophrenia, 48% of the subjects with schizoaffective disorder, and 29% of the subjects with bipolar disorder, but only 5% of unaffected subjects, clustered in the cortical LGM molecular phenotype. These findings support the characterization of psychotic and bipolar disorders by cortical molecular phenotype which may help elucidate more pathophysiologically informed and personalized medications.

  19. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers

    OpenAIRE

    Taïbi, Khaled; Campo, Antonio D. del; Vilagrosa Carmona, Alberto; Bellés, José M.; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J.; López-Nicolás, José M.; Mulet, José M.

    2017-01-01

    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of pre...

  20. MicroRNA Expression Profiling Identifies Molecular Diagnostic Signatures for Anaplastic Large Cell Lymphoma

    DEFF Research Database (Denmark)

    Liu, Cuiling; Iqbal, Javeed; Teruya-Feldstein, Julie

    2013-01-01

    distinct clustering of ALCL, PTCL-NOS, and the AITL subtype of PTCL. Cases of ALK(+) ALCL and ALK(-) ALCL were interspersed in unsupervised analysis, suggesting a close relationship at the molecular level. We identified an miRNA signature of 7 miRNAs (5 upregulated: miR-512-3p, miR-886-5p, miR-886-3p, mi...

  1. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers

    OpenAIRE

    Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E.M.

    2016-01-01

    Background The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequ...

  2. Molecular subtypes of osteosarcoma identified by reducing tumor heterogeneity through an interspecies comparative approach

    Science.gov (United States)

    Scott, Milcah C.; Sarver, Aaron L.; Gavin, Katherine J.; Thayanithy, Venugopal; Getzy, David M.; Newman, Robert A.; Cutter, Gary R.; Lindblad-Toh, Kerstin; Kisseberth, William C.; Hunter, Lawrence E.; Subramanian, Subbaya; Breen, Matthew; Modiano, Jaime F.

    2011-01-01

    The heterogeneous and chaotic nature of osteosarcoma has confounded accurate molecular classification, prognosis, and prediction for this tumor. The occurrence of spontaneous osteosarcoma is largely confined to humans and dogs. While the clinical features are remarkably similar in both species, the organization of dogs into defined breeds provides a more homogeneous genetic background that may increase the likelihood to uncover molecular subtypes for this complex disease. We thus hypothesized that molecular profiles derived from canine osteosarcoma would aid in molecular subclassification of this disease when applied to humans. To test the hypothesis, we performed genome wide gene expression profiling in a cohort of dogs with osteosarcoma, primarily from high-risk breeds. To further reduce inter-sample heterogeneity, we assessed tumor-intrinsic properties through use of an extensive panel of osteosarcoma-derived cell lines. We observed strong differential gene expression that segregated samples into two groups with differential survival probabilities. Groupings were characterized by the inversely correlated expression of genes associated with G2/M transition and DNA damage checkpoint and microenvironment-interaction categories. This signature was preserved in data from whole tumor samples of three independent dog osteosarcoma cohorts, with stratification into the two expected groups. Significantly, this restricted signature partially overlapped a previously defined, predictive signature for soft tissue sarcomas, and it unmasked orthologous molecular subtypes and their corresponding natural histories in five independent data sets from human patients with osteosarcoma. Our results indicate that the narrower genetic diversity of dogs can be utilized to group complex human osteosarcoma into biologically and clinically relevant molecular subtypes. This in turn may enhance prognosis and prediction, and identify relevant therapeutic targets. PMID:21621658

  3. Comparing hair-morphology and molecular methods to identify fecal samples from Neotropical felids.

    Directory of Open Access Journals (Sweden)

    Carlos C Alberts

    Full Text Available To avoid certain problems encountered with more-traditional and invasive methods in behavioral-ecology studies of mammalian predators, such as felids, molecular approaches have been employed to identify feces found in the field. However, this method requires a complete molecular biology laboratory, and usually also requires very fresh fecal samples to avoid DNA degradation. Both conditions are normally absent in the field. To address these difficulties, identification based on morphological characters (length, color, banding, scales and medullar patterns of hairs found in feces could be employed as an alternative. In this study we constructed a morphological identification key for guard hairs of eight Neotropical felids (jaguar, oncilla, Geoffroy's cat, margay, ocelot, Pampas cat, puma and jaguarundi and compared its efficiency to that of a molecular identification method, using the ATP6 region as a marker. For this molecular approach, we simulated some field conditions by postponing sample-conservation procedures. A blind test of the identification key obtained a nearly 70% overall success rate, which we considered equivalent to or better than the results of some molecular methods (probably due to DNA degradation found in other studies. The jaguar, puma and jaguarundi could be unequivocally discriminated from any other Neotropical felid. On a scale ranging from inadequate to excellent, the key proved poor only for the margay, with only 30% of its hairs successfully identified using this key; and have intermediate success rates for the remaining species, the oncilla, Geoffroy's cat, ocelot and Pampas cat, were intermediate. Complementary information about the known distributions of felid populations may be necessary to substantially improve the results obtained with the key. Our own molecular results were even better, since all blind-tested samples were correctly identified. Part of these identifications were made from samples kept in suboptimal

  4. Quantitative proteomics identify molecular targets that are crucial in larval settlement and metamorphosis of bugula neritina

    KAUST Repository

    Zhang, Huoming

    2011-01-07

    The marine invertebrate Bugula neritina has a biphasic life cycle that consists of a swimming larval stage and a sessile juvenile and adult stage. The attachment of larvae to the substratum and their subsequent metamorphosis have crucial ecological consequences. Despite many studies on this species, little is known about the molecular mechanism of these processes. Here, we report a comparative study of swimming larvae and metamorphosing individuals at 4 and 24 h postattachment using label-free quantitative proteomics. We identified more than 1100 proteins at each stage, 61 of which were differentially expressed. Specifically, proteins involved in energy metabolism and structural molecules were generally down-regulated, whereas proteins involved in transcription and translation, the extracellular matrix, and calcification were strongly up-regulated during metamorphosis. Many tightly regulated novel proteins were also identified. Subsequent analysis of the temporal and spatial expressions of some of the proteins and an assay of their functions indicated that they may have key roles in metamorphosis of B. neritina. These findings not only provide molecular evidence with which to elucidate the substantial changes in morphology and physiology that occur during larval attachment and metamorphosis but also identify potential targets for antifouling treatment. © 2011 American Chemical Society.

  5. Identifying molecular subtypes in human colon cancer using gene expression and DNA methylation microarray data.

    Science.gov (United States)

    Ren, Zhonglu; Wang, Wenhui; Li, Jinming

    2016-02-01

    Identifying colon cancer subtypes based on molecular signatures may allow for a more rational, patient-specific approach to therapy in the future. Classifications using gene expression data have been attempted before with little concordance between the different studies carried out. In this study we aimed to uncover subtypes of colon cancer that have distinct biological characteristics and identify a set of novel biomarkers which could best reflect the clinical and/or biological characteristics of each subtype. Clustering analysis and discriminant analysis were utilized to discover the subtypes in two different molecular levels on 153 colon cancer samples from The Cancer Genome Atlas (TCGA) Data Portal. At gene expression level, we identified two major subtypes, ECL1 (expression cluster 1) and ECL2 (expression cluster 2) and a list of signature genes. Due to the heterogeneity of colon cancer, the subtype ECL1 can be further subdivided into three nested subclasses, and HOTAIR were found upregulated in subclass 2. At DNA methylation level, we uncovered three major subtypes, MCL1 (methylation cluster 1), MCL2 (methylation cluster 2) and MCL3 (methylation cluster 3). We found only three subtypes of CpG island methylator phenotype (CIMP) in colon cancer instead of the four subtypes in the previous reports, and we found no sufficient evidence to subdivide MCL3 into two distinct subgroups.

  6. Using molecular tools to identify the geographical origin of a case of human brucellosis.

    Science.gov (United States)

    Muchowski, J K; Koylass, M S; Dainty, A C; Stack, J A; Perrett, L; Whatmore, A M; Perrier, C; Chircop, S; Demicoli, N; Gatt, A B; Caruana, P A; Gopaul, K K

    2015-10-01

    Although Malta is historically linked with the zoonosis brucellosis, there had not been a case of the disease in either the human or livestock population for several years. However, in July 2013 a case of human brucellosis was identified on the island. To determine whether this recent case originated in Malta, four isolates from this case were subjected to molecular analysis. Molecular profiles generated using multilocus sequence analysis and multilocus variable number tandem repeat for the recent human case isolates and 11 Brucella melitensis strains of known Maltese origin were compared with others held on in-house and global databases. While the 11 isolates of Maltese origin formed a distinct cluster, the recent human isolation was not associated with these strains but instead clustered with isolates originating from the Horn of Africa. These data was congruent with epidemiological trace-back showed that the individual had travelled to Malta from Eritrea. This work highlights the potential of using molecular typing data to aid in epidemiological trace-back of Brucella isolations and assist in monitoring of the effectiveness of brucellosis control schemes.

  7. Molecular defects identified by whole exome sequencing in a child with Fanconi anemia.

    Science.gov (United States)

    Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua

    2013-11-10

    Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.

  8. Comprehensive expression profiling of tumor cell lines identifies molecular signatures of melanoma progression.

    Directory of Open Access Journals (Sweden)

    Byungwoo Ryu

    2007-07-01

    Full Text Available Gene expression profiling has revolutionized our ability to molecularly classify primary human tumors and significantly enhanced the development of novel tumor markers and therapies; however, progress in the diagnosis and treatment of melanoma over the past 3 decades has been limited, and there is currently no approved therapy that significantly extends lifespan in patients with advanced disease. Profiling studies of melanoma to date have been inconsistent due to the heterogeneous nature of this malignancy and the limited availability of informative tissue specimens from early stages of disease.In order to gain an improved understanding of the molecular basis of melanoma progression, we have compared gene expression profiles from a series of melanoma cell lines representing discrete stages of malignant progression that recapitulate critical characteristics of the primary lesions from which they were derived. Here we describe the unsupervised hierarchical clustering of profiling data from melanoma cell lines and melanocytes. This clustering identifies two distinctive molecular subclasses of melanoma segregating aggressive metastatic tumor cell lines from less-aggressive primary tumor cell lines. Further analysis of expression signatures associated with melanoma progression using functional annotations categorized these transcripts into three classes of genes: 1 Upregulation of activators of cell cycle progression, DNA replication and repair (CDCA2, NCAPH, NCAPG, NCAPG2, PBK, NUSAP1, BIRC5, ESCO2, HELLS, MELK, GINS1, GINS4, RAD54L, TYMS, and DHFR, 2 Loss of genes associated with cellular adhesion and melanocyte differentiation (CDH3, CDH1, c-KIT, PAX3, CITED1/MSG-1, TYR, MELANA, MC1R, and OCA2, 3 Upregulation of genes associated with resistance to apoptosis (BIRC5/survivin. While these broad classes of transcripts have previously been implicated in the progression of melanoma and other malignancies, the specific genes identified within each class

  9. Dissecting molecular stress networks: identifying nodes of divergence between life-history phenotypes.

    Science.gov (United States)

    Schwartz, Tonia S; Bronikowski, Anne M

    2013-02-01

    The complex molecular network that underlies physiological stress response is comprised of nodes (proteins, metabolites, mRNAs, etc.) whose connections span cells, tissues and organs. Variable nodes are points in the network upon which natural selection may act. Thus, identifying variable nodes will reveal how this molecular stress network may evolve among populations in different habitats and how it might impact life-history evolution. Here, we use physiological and genetic assays to test whether laboratory-born juveniles from natural populations of garter snakes (Thamnophis elegans), which have diverged in their life-history phenotypes, vary concomitantly at candidate nodes of the stress response network, (i) under unstressed conditions and (ii) in response to an induced stress. We found that two common measures of stress (plasma corticosterone and liver gene expression of heat shock proteins) increased under stress in both life-history phenotypes. In contrast, the phenotypes diverged at four nodes both under unstressed conditions and in response to stress: circulating levels of reactive oxygen species (superoxide, H(2)O(2)); liver gene expression of GPX1 and erythrocyte DNA damage. Additionally, allele frequencies for SOD2 diverge from neutral markers, suggesting diversifying selection on SOD2 alleles. This study supports the hypothesis that these life-history phenotypes have diverged at the molecular level in how they respond to stress, particularly in nodes regulating oxidative stress. Furthermore, the differences between the life-history phenotypes were more pronounced in females. We discuss the responses to stress in the context of the associated life-history phenotype and the evolutionary pressures thought to be responsible for divergence between the phenotypes. © 2012 Blackwell Publishing Ltd.

  10. Gene expression analysis to identify molecular correlates of pre- and post-conditioning derived neuroprotection.

    Science.gov (United States)

    Prasad, Shiv S; Russell, Marsha; Nowakowska, Margeryta; Williams, Andrew; Yauk, Carole

    2012-06-01

    Mild ischaemic exposures before or after severe injurious ischaemia that elicit neuroprotective responses are referred to as preconditioning and post-conditioning. The corresponding molecular mechanisms of neuroprotection are not completely understood. Identification of the genes and associated pathways of corresponding neuroprotection would provide insight into neuronal survival, potential therapeutic approaches and assessments of therapies for stroke. The objectives of this study were to use global gene expression approach to infer the molecular mechanisms in pre- and post-conditioning-derived neuroprotection in cortical neurons following oxygen and glucose deprivation (OGD) in vitro and then to apply these findings to predict corresponding functional pathways. To this end, microarray analysis was applied to rat cortical neurons with or without the pre- and post-conditioning treatments at 3-h post-reperfusion, and differentially expressed transcripts were subjected to statistical, hierarchical clustering and pathway analyses. The expression patterns of 3,431 genes altered under all conditions of ischaemia (with and without pre- or post-conditioning). We identified 1,595 genes that were commonly regulated within both the pre- and post-conditioning treatments. Cluster analysis revealed that transcription profiles clustered tightly within controls, non-conditioned OGD and neuroprotected groups. Two clusters defining neuroprotective conditions associated with up- and downregulated genes were evident. The five most upregulated genes within the neuroprotective clusters were Tagln, Nes, Ptrf, Vim and Adamts9, and the five most downregulated genes were Slc7a3, Bex1, Brunol4, Nrxn3 and Cpne4. Pathway analysis revealed that the intracellular and second messenger signalling pathways in addition to cell death were predominantly associated with downregulated pre- and post-conditioning associated genes, suggesting that modulation of cell death and signal transduction pathways

  11. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    International Nuclear Information System (INIS)

    Bukkuru, S.; Bhardwaj, U.; Warrier, M.; Rao, A.D.P.; Valsakumar, M.C.

    2017-01-01

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values “r” to the lattice constant “a” lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods. - Highlights: • Max-Space Clustering (MSC) method is developed to identify interstitials in crystals. • MSC provides a structured way to identify the temperature dependent cut-off radius. • It is compared with widely used sphere methods and found to be better. • MSC coupled with graph tree optimization can be used to obtain diffusion trajectory. • Cascade simulations of Fe, W are carried out and results are compared with various methods.

  12. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Bukkuru, S., E-mail: srinivasaraobukkuru@gmail.com [Dept. of Nuclear Physics, Andhra University, Visakhapatnam 530003 (India); Bhardwaj, U., E-mail: haptork@gmail.com [Computational Analysis Division, BARC, Visakhapatnam 530012, Andhra Pradesh (India); Warrier, M., E-mail: manoj.warrier@gmail.com [Computational Analysis Division, BARC, Visakhapatnam 530012, Andhra Pradesh (India); Rao, A.D.P., E-mail: adp_rao_99@yahoo.com [Dept. of Nuclear Physics, Andhra University, Visakhapatnam 530003 (India); Valsakumar, M.C., E-mail: mc.valsakumar@gmail.com [IIT Palakkad, Kozhippara P.O., Palakkad 678557, Kerala (India)

    2017-02-15

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values “r” to the lattice constant “a” lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods. - Highlights: • Max-Space Clustering (MSC) method is developed to identify interstitials in crystals. • MSC provides a structured way to identify the temperature dependent cut-off radius. • It is compared with widely used sphere methods and found to be better. • MSC coupled with graph tree optimization can be used to obtain diffusion trajectory. • Cascade simulations of Fe, W are carried out and results are compared with various methods.

  13. Duodenoscope-Related Outbreak of a Carbapenem-Resistant Klebsiella pneumoniae Identified Using Advanced Molecular Diagnostics.

    Science.gov (United States)

    Humphries, Romney M; Yang, Shuan; Kim, Stephen; Muthusamy, Venkatara Raman; Russell, Dana; Trout, Alisa M; Zaroda, Teresa; Cheng, Quen J; Aldrovandi, Grace; Uslan, Daniel Zachary; Hemarajata, Peera; Rubin, Zachary Aaron

    2017-10-01

    Carbapenem-resistant Klebsiella pneumoniae infections are increasingly prevalent in North American hospitals. We describe an outbreak of carbapenem-resistant K. pneumoniae containing the blaOXA-232 gene transmitted by contaminated duodenoscopes during endoscopic retrograde cholangiopancreatography (ERCP) procedures. An outbreak investigation was performed when 9 patients with blaOXA-232 carbapenem-resistant K. pneumoniae infections were identified at a tertiary care hospital. The investigation included 2 case-control studies, review of duodenoscope reprocessing procedures, and culture of devices. Carbapenem-resistant Enterobacteriacieae (CRE) isolates were evaluated with polymerase chain reaction analysis for carbapenemase genes, and isolates with the blaOXA-232 gene were subjected to whole-genome sequencing and chromosome single-nucleotide polymorphism analysis. On recognition of ERCP as a key risk factor for infection, targeted patient notification and CRE screening cultures were performed. Molecular testing ultimately identified 17 patients with blaOxa-232 carbapenem-resistant K. pneumoniae isolates, including 9 with infections, 7 asymptomatic carriers who had undergone ERCP, and 1 additional patient who had been hospitalized in India and was probably the initial carrier. Two case-control studies established a point-source outbreak associated with 2 specific duodenoscopes. A field investigation of the use, reprocessing, and storage of deuodenoscopes did not identify deviations from US Food and Drug Administration or manufacturer recommendations for reprocessing. This outbreak demonstrated the previously underappreciated potential for duodenoscopes to transmit disease, even after undergoing high-level disinfection according to manufacturers' guidelines.

  14. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    Science.gov (United States)

    Bukkuru, S.; Bhardwaj, U.; Warrier, M.; Rao, A. D. P.; Valsakumar, M. C.

    2017-02-01

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values "r" to the lattice constant "a" lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods.

  15. A mouse model of alcoholic liver fibrosis-associated acute kidney injury identifies key molecular pathways

    International Nuclear Information System (INIS)

    Furuya, Shinji; Chappell, Grace A.; Iwata, Yasuhiro; Uehara, Takeki; Kato, Yuki; Kono, Hiroshi; Bataller, Ramon; Rusyn, Ivan

    2016-01-01

    Clinical data strongly indicate that acute kidney injury (AKI) is a critical complication in alcoholic hepatitis, an acute-on-chronic form of liver failure in patients with advanced alcoholic fibrosis. Development of targeted therapies for AKI in this setting is hampered by the lack of an animal model. To enable research into molecular drivers and novel therapies for fibrosis- and alcohol-associated AKI, we aimed to combine carbon tetrachloride (CCl 4 )-induced fibrosis with chronic intra-gastric alcohol feeding. Male C57BL/6J mice were administered a low dose of CCl 4 (0.2 ml/kg 2 × week/6 weeks) followed by alcohol intragastrically (up to 25 g/kg/day for 3 weeks) and with continued CCl 4 . We observed that combined treatment with CCl 4 and alcohol resulted in severe liver injury, more pronounced than using each treatment alone. Importantly, severe kidney injury was evident only in the combined treatment group. This mouse model reproduced distinct pathological features consistent with AKI in human alcoholic hepatitis. Transcriptomic analysis of kidneys revealed profound effects in the combined treatment group, with enrichment for damage-associated pathways, such as apoptosis, inflammation, immune-response and hypoxia. Interestingly, Havcr1 and Lcn2, biomarkers of AKI, were markedly up-regulated. Overall, this study established a novel mouse model of fibrosis- and alcohol-associated AKI and identified key mechanistic pathways. - Highlights: • Acute kidney injury (AKI) is a critical complication in alcoholic hepatitis • We developed a novel mouse model of fibrosis- and alcohol-associated AKI • This model reproduces key molecular and pathological features of human AKI • This animal model can help identify new targeted therapies for alcoholic hepatitis

  16. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers.

    Science.gov (United States)

    Taïbi, Khaled; Del Campo, Antonio D; Vilagrosa, Alberto; Bellés, José M; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J; López-Nicolás, José M; Mulet, José M

    2017-01-01

    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of predicting the ability of formerly uncharacterized seedlings to cope with drought stress. Gas-exchange, water potential, photosynthetic pigments, soluble sugars, free amino acids, glutathione and proteomic analyses were carried out on control and drought-stressed seedlings in greenhouse conditions. Gas-exchange determinations were also assessed in field-planted seedlings in order to validate the greenhouse experimental conditions. Drought-tolerant seed sources presented higher values of photosynthetic rates, water use efficiency, photosynthetic pigments and soluble carbohydrates concentrations. We observed the same pattern of variation of photosynthesis rate and maximal efficiency of PSII in field. Interestingly drought-tolerant seed sources exhibited increased levels of glutathione, methionine and cysteine. The proteomic profile of drought tolerant seedlings identified two heat shock proteins and an enzyme related to methionine biosynthesis that were not present in drought sensitive seedlings, pointing to the synthesis of sulfur amino acids as a limiting factor for drought tolerance in Pinus halepensis . Our results established physiological and molecular traits useful as distinctive markers to predict drought tolerance in Pinus halepensis provenances that could be reliably used in reforestation programs in drought prone areas.

  17. A mouse model of alcoholic liver fibrosis-associated acute kidney injury identifies key molecular pathways

    Energy Technology Data Exchange (ETDEWEB)

    Furuya, Shinji; Chappell, Grace A.; Iwata, Yasuhiro [Department of Veterinary Integrative Biosciences, Texas A& M University, College Station, TX (United States); Uehara, Takeki; Kato, Yuki [Laboratory of Veterinary Pathology, Osaka Prefecture University, Osaka (Japan); Kono, Hiroshi [First Department of Surgery, University of Yamanashi, Yamanashi (Japan); Bataller, Ramon [Division of Gastroenterology & Hepatology, Department of Medicine, University of North Carolina, Chapel Hill, NC (United States); Rusyn, Ivan, E-mail: irusyn@tamu.edu [Department of Veterinary Integrative Biosciences, Texas A& M University, College Station, TX (United States)

    2016-11-01

    Clinical data strongly indicate that acute kidney injury (AKI) is a critical complication in alcoholic hepatitis, an acute-on-chronic form of liver failure in patients with advanced alcoholic fibrosis. Development of targeted therapies for AKI in this setting is hampered by the lack of an animal model. To enable research into molecular drivers and novel therapies for fibrosis- and alcohol-associated AKI, we aimed to combine carbon tetrachloride (CCl{sub 4})-induced fibrosis with chronic intra-gastric alcohol feeding. Male C57BL/6J mice were administered a low dose of CCl{sub 4} (0.2 ml/kg 2 × week/6 weeks) followed by alcohol intragastrically (up to 25 g/kg/day for 3 weeks) and with continued CCl{sub 4}. We observed that combined treatment with CCl{sub 4} and alcohol resulted in severe liver injury, more pronounced than using each treatment alone. Importantly, severe kidney injury was evident only in the combined treatment group. This mouse model reproduced distinct pathological features consistent with AKI in human alcoholic hepatitis. Transcriptomic analysis of kidneys revealed profound effects in the combined treatment group, with enrichment for damage-associated pathways, such as apoptosis, inflammation, immune-response and hypoxia. Interestingly, Havcr1 and Lcn2, biomarkers of AKI, were markedly up-regulated. Overall, this study established a novel mouse model of fibrosis- and alcohol-associated AKI and identified key mechanistic pathways. - Highlights: • Acute kidney injury (AKI) is a critical complication in alcoholic hepatitis • We developed a novel mouse model of fibrosis- and alcohol-associated AKI • This model reproduces key molecular and pathological features of human AKI • This animal model can help identify new targeted therapies for alcoholic hepatitis.

  18. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers

    Directory of Open Access Journals (Sweden)

    Khaled Taïbi

    2017-07-01

    Full Text Available Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of predicting the ability of formerly uncharacterized seedlings to cope with drought stress. Gas-exchange, water potential, photosynthetic pigments, soluble sugars, free amino acids, glutathione and proteomic analyses were carried out on control and drought-stressed seedlings in greenhouse conditions. Gas-exchange determinations were also assessed in field-planted seedlings in order to validate the greenhouse experimental conditions. Drought-tolerant seed sources presented higher values of photosynthetic rates, water use efficiency, photosynthetic pigments and soluble carbohydrates concentrations. We observed the same pattern of variation of photosynthesis rate and maximal efficiency of PSII in field. Interestingly drought-tolerant seed sources exhibited increased levels of glutathione, methionine and cysteine. The proteomic profile of drought tolerant seedlings identified two heat shock proteins and an enzyme related to methionine biosynthesis that were not present in drought sensitive seedlings, pointing to the synthesis of sulfur amino acids as a limiting factor for drought tolerance in Pinus halepensis. Our results established physiological and molecular traits useful as distinctive markers to predict drought tolerance in Pinus halepensis provenances that could be reliably used in reforestation programs in drought prone areas.

  19. Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

    Science.gov (United States)

    Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

    2007-10-01

    AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

  20. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers.

    Science.gov (United States)

    Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E M

    2016-10-08

    The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequencing, different barcodes can be inserted at each fragment end to either increase the number of multiplexed samples in the library or to use one of the barcodes as UMI. Alternatively, UMIs can be combined with the sample barcodes into composite barcodes, or with standard Illumina® indexing. Subsequent analysis must take read duplicates and sample identity into account, by identifying UMIs. Existing tools do not support these complex barcoding configurations and custom code development is frequently required. Here, we present Je, a suite of tools that accommodates complex barcoding strategies, extracts UMIs and filters read duplicates taking UMIs into account. Using Je on publicly available scRNA-seq and iCLIP data containing UMIs, the number of unique reads increased by up to 36 %, compared to when UMIs are ignored. Je is implemented in JAVA and uses the Picard API. Code, executables and documentation are freely available at http://gbcs.embl.de/Je . Je can also be easily installed in Galaxy through the Galaxy toolshed.

  1. Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing.

    Science.gov (United States)

    Hong, Jungeui; Gresham, David

    2017-11-01

    Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

  2. Molecular markers for identifying a new selected variety of Pacific white shrimp Litopenaeus vannamei

    Science.gov (United States)

    Yu, Yang; Zhang, Xiaojun; Liu, Jingwen; Li, Fuhua; Huang, Hao; Li, Yijun; Liu, Xiaolin; Xiang, Jianhai

    2015-01-01

    Selective breeding of the Pacific white shrimp Litopenaeus vannamei during the last decade has produced new varieties exhibiting high growth rates and disease resistance. However, the identification of new varieties of shrimps from their phenotypic characters is difficult. This study introduces a new approach for identifying varieties of shrimps using molecular markers of microsatellites and mitochondrial control region sequences. The method was employed to identify a new selected variety, Kehai No. 1 (KH-1), from three representative stocks (control group): Zhengda; Tongwei; and a stock collected from Fujian Province, which is now cultured in mainland China. By pooled genotyping of KH-1 and the control group, five microsatellites showing differences between KH-1 and the control group were screened out. Individual genotyping data confirmed the results from pooled genotyping. The genotyping data for the five microsatellites were applied to the assignment analysis of the KH-1 group and the control group using the partial Bayesian assignment method in GENECLASS2. By sequencing the mitochondrial control regions of individuals from the KH-1 and control group, four haplotypes were observed in the KH-1 group, whereas 14 haplotypes were obtained in the control group. By combining the microsatellite assignment analysis with mitochondrial control region analysis, the average accuracy of identification of individuals in the KH-1 group and control group reached 89%. The five selected microsatellite loci and mitochondrial control region sequences were highly polymorphic and could be used to distinguish new selected varieties of L. vannamei from other populations cultured in China.

  3. Cartography of Pathway Signal Perturbations Identifies Distinct Molecular Pathomechanisms in Malignant and Chronic Lung Diseases

    Science.gov (United States)

    Arakelyan, Arsen; Nersisyan, Lilit; Petrek, Martin; Löffler-Wirth, Henry; Binder, Hans

    2016-01-01

    Lung diseases are described by a wide variety of developmental mechanisms and clinical manifestations. Accurate classification and diagnosis of lung diseases are the bases for development of effective treatments. While extensive studies are conducted toward characterization of various lung diseases at molecular level, no systematic approach has been developed so far. Here we have applied a methodology for pathway-centered mining of high throughput gene expression data to describe a wide range of lung diseases in the light of shared and specific pathway activity profiles. We have applied an algorithm combining a Pathway Signal Flow (PSF) algorithm for estimation of pathway activity deregulation states in lung diseases and malignancies, and a Self Organizing Maps algorithm for classification and clustering of the pathway activity profiles. The analysis results allowed clearly distinguish between cancer and non-cancer lung diseases. Lung cancers were characterized by pathways implicated in cell proliferation, metabolism, while non-malignant lung diseases were characterized by deregulations in pathways involved in immune/inflammatory response and fibrotic tissue remodeling. In contrast to lung malignancies, chronic lung diseases had relatively heterogeneous pathway deregulation profiles. We identified three groups of interstitial lung diseases and showed that the development of characteristic pathological processes, such as fibrosis, can be initiated by deregulations in different signaling pathways. In conclusion, this paper describes the pathobiology of lung diseases from systems viewpoint using pathway centered high-dimensional data mining approach. Our results contribute largely to current understanding of pathological events in lung cancers and non-malignant lung diseases. Moreover, this paper provides new insight into molecular mechanisms of a number of interstitial lung diseases that have been studied to a lesser extent. PMID:27200087

  4. Molecular genetic studies in Saudi population; identified variants from GWAS and meta-analysis in stroke.

    Science.gov (United States)

    Alharbi, Khalid Khalaf; Ali Khan, Imran; Alotaibi, Mohammad Abdullah; Saud Aloyaid, Abdullah; Al-Basheer, Haifa Abdulaziz; Alghamdi, Naelah Abdullah; Al-Baradie, Raid Saleem; Al-Sulaiman, A M

    2018-01-01

    Stroke is a multifactorial and heterogeneous disorder, correlates with heritability and considered as one of the major diseases. The prior reports performed the variable models such as genome-wide association studies (GWAS), replication, case-control, cross-sectional and meta-analysis studies and still, we lack diagnostic marker in the global world. There are limited studies were carried out in Saudi population, and we aim to investigate the molecular association of single nucleotide polymorphisms (SNPs) identified through GWAS and meta-analysis studies in stroke patients in the Saudi population. In this case-control study, we have opted gender equality of 207 cases and 207 controls from the capital city of Saudi Arabia in King Saud University Hospital. The peripheral blood (5 ml) sample will be collected in two different vacutainers, and three mL of the coagulated blood will be used for lipid analysis (biochemical tests) and two mL will be used for DNA analysis (molecular tests). Genomic DNA will be extracted with the collected blood samples, and specific primers will be designed for the opted SNPs ( SORT1 -rs646218 and OLR1 -rs11053646 polymorphisms) and PCR-RFLP will be performed and randomly DNA sequencing will be carried out to cross check the results. The rs646218 and rs11053646 polymorphisms were significantly associated with allele, genotype and dominant models with and without crude odds ratios (OR's) and Multiple logistic regression analysis (p Saudi population. The current results were in the association with the prior study results documented through GWAS and meta-analysis association. However, other ethnic population studies should be performed to rule out in the human hereditary diseases.

  5. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia.

    Science.gov (United States)

    van Uitert, Miranda; Moerland, Perry D; Enquobahrie, Daniel A; Laivuori, Hannele; van der Post, Joris A M; Ris-Stalpers, Carrie; Afink, Gijs B

    2015-01-01

    Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia gene expression signature, we performed a meta-analysis on the original data of 11 placenta RNA microarray experiments, representing 139 normotensive and 116 preeclamptic pregnancies. Microarray data were pre-processed and analyzed using standardized bioinformatics and statistical procedures and the effect sizes were combined using an inverse-variance random-effects model. Interactions between genes in the resulting gene expression signature were identified by pathway analysis (Ingenuity Pathway Analysis, Gene Set Enrichment Analysis, Graphite) and protein-protein associations (STRING). This approach has resulted in a comprehensive list of differentially expressed genes that led to a 388-gene meta-signature of preeclamptic placenta. Pathway analysis highlights the involvement of the previously identified hypoxia/HIF1A pathway in the establishment of the preeclamptic gene expression profile, while analysis of protein interaction networks indicates CREBBP/EP300 as a novel element central to the preeclamptic placental transcriptome. In addition, there is an apparent high incidence of preeclampsia in women carrying a child with a mutation in CREBBP/EP300 (Rubinstein-Taybi Syndrome). The 388-gene preeclampsia meta-signature offers a vital starting point for further studies into the relevance of these genes (in particular CREBBP/EP300) and their concomitant pathways as biomarkers or functional molecules in preeclampsia. This will result in a better understanding of the molecular basis of this disease and opens up the opportunity to develop rational therapies targeting the placental dysfunction causal to preeclampsia.

  6. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia.

    Directory of Open Access Journals (Sweden)

    Miranda van Uitert

    Full Text Available Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia gene expression signature, we performed a meta-analysis on the original data of 11 placenta RNA microarray experiments, representing 139 normotensive and 116 preeclamptic pregnancies. Microarray data were pre-processed and analyzed using standardized bioinformatics and statistical procedures and the effect sizes were combined using an inverse-variance random-effects model. Interactions between genes in the resulting gene expression signature were identified by pathway analysis (Ingenuity Pathway Analysis, Gene Set Enrichment Analysis, Graphite and protein-protein associations (STRING. This approach has resulted in a comprehensive list of differentially expressed genes that led to a 388-gene meta-signature of preeclamptic placenta. Pathway analysis highlights the involvement of the previously identified hypoxia/HIF1A pathway in the establishment of the preeclamptic gene expression profile, while analysis of protein interaction networks indicates CREBBP/EP300 as a novel element central to the preeclamptic placental transcriptome. In addition, there is an apparent high incidence of preeclampsia in women carrying a child with a mutation in CREBBP/EP300 (Rubinstein-Taybi Syndrome. The 388-gene preeclampsia meta-signature offers a vital starting point for further studies into the relevance of these genes (in particular CREBBP/EP300 and their concomitant pathways as biomarkers or functional molecules in preeclampsia. This will result in a better understanding of the molecular basis of this disease and opens up the opportunity to develop rational therapies targeting the placental dysfunction causal to preeclampsia.

  7. Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy-

    Science.gov (United States)

    Ishitani, Y.

    2017-12-01

    Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.

  8. Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations.

    Science.gov (United States)

    Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J

    2014-07-01

    Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts

  9. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life

    Directory of Open Access Journals (Sweden)

    Reusch Thorsten BH

    2011-01-01

    Full Text Available Abstract Background Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L. Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. Results In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. Conclusions These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  10. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life.

    Science.gov (United States)

    Wissler, Lothar; Codoñer, Francisco M; Gu, Jenny; Reusch, Thorsten B H; Olsen, Jeanine L; Procaccini, Gabriele; Bornberg-Bauer, Erich

    2011-01-12

    Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs) of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L.) Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica) and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  11. LUMINOSITY FUNCTIONS OF SPITZER-IDENTIFIED PROTOSTARS IN NINE NEARBY MOLECULAR CLOUDS

    Energy Technology Data Exchange (ETDEWEB)

    Kryukova, E.; Megeath, S. T.; Allen, T. S. [Department of Physics and Astronomy, University of Toledo, Toledo, OH (United States); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA (United States); Pipher, J. [Department of Physics and Astronomy, University of Rochester, Rochester, NY (United States); Allen, L. E. [National Optical Astronomy Observatories, Tucson, AZ (United States); Myers, P. C. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States); Muzerolle, J. [Space Telescope Science Institute, Baltimore, MD (United States)

    2012-08-15

    We identify protostars in Spitzer surveys of nine star-forming (SF) molecular clouds within 1 kpc: Serpens, Perseus, Ophiuchus, Chamaeleon, Lupus, Taurus, Orion, Cep OB3, and Mon R2, which combined host over 700 protostar candidates. These clouds encompass a variety of SF environments, including both low-mass and high-mass SF regions, as well as dense clusters and regions of sparsely distributed star formation. Our diverse cloud sample allows us to compare protostar luminosity functions in these varied environments. We combine near- and mid-infrared photometry from the Two Micron All Sky Survey and Spitzer to create 1-24 {mu}m spectral energy distributions (SEDs). Using protostars from the c2d survey with well-determined bolometric luminosities, we derive a relationship between bolometric luminosity, mid-IR luminosity (integrated from 1-24 {mu}m), and SED slope. Estimations of the bolometric luminosities for protostar candidates are combined to create luminosity functions for each cloud. Contamination due to edge-on disks, reddened Class II sources, and galaxies is estimated and removed from the luminosity functions. We find that luminosity functions for high-mass SF clouds (Orion, Mon R2, and Cep OB3) peak near 1 L{sub Sun} and show a tail extending toward luminosities above 100 L{sub Sun }. The luminosity functions of the low-mass SF clouds (Serpens, Perseus, Ophiuchus, Taurus, Lupus, and Chamaeleon) do not exhibit a common peak, however the combined luminosity function of these regions peaks below 1 L{sub Sun }. Finally, we examine the luminosity functions as a function of the local surface density of young stellar objects. In the Orion molecular clouds, we find a significant difference between the luminosity functions of protostars in regions of high and low stellar density, the former of which is biased toward more luminous sources. This may be the result of primordial mass segregation, although this interpretation is not unique. We compare our luminosity

  12. LUMINOSITY FUNCTIONS OF SPITZER-IDENTIFIED PROTOSTARS IN NINE NEARBY MOLECULAR CLOUDS

    International Nuclear Information System (INIS)

    Kryukova, E.; Megeath, S. T.; Allen, T. S.; Gutermuth, R. A.; Pipher, J.; Allen, L. E.; Myers, P. C.; Muzerolle, J.

    2012-01-01

    We identify protostars in Spitzer surveys of nine star-forming (SF) molecular clouds within 1 kpc: Serpens, Perseus, Ophiuchus, Chamaeleon, Lupus, Taurus, Orion, Cep OB3, and Mon R2, which combined host over 700 protostar candidates. These clouds encompass a variety of SF environments, including both low-mass and high-mass SF regions, as well as dense clusters and regions of sparsely distributed star formation. Our diverse cloud sample allows us to compare protostar luminosity functions in these varied environments. We combine near- and mid-infrared photometry from the Two Micron All Sky Survey and Spitzer to create 1-24 μm spectral energy distributions (SEDs). Using protostars from the c2d survey with well-determined bolometric luminosities, we derive a relationship between bolometric luminosity, mid-IR luminosity (integrated from 1-24 μm), and SED slope. Estimations of the bolometric luminosities for protostar candidates are combined to create luminosity functions for each cloud. Contamination due to edge-on disks, reddened Class II sources, and galaxies is estimated and removed from the luminosity functions. We find that luminosity functions for high-mass SF clouds (Orion, Mon R2, and Cep OB3) peak near 1 L ☉ and show a tail extending toward luminosities above 100 L ☉ . The luminosity functions of the low-mass SF clouds (Serpens, Perseus, Ophiuchus, Taurus, Lupus, and Chamaeleon) do not exhibit a common peak, however the combined luminosity function of these regions peaks below 1 L ☉ . Finally, we examine the luminosity functions as a function of the local surface density of young stellar objects. In the Orion molecular clouds, we find a significant difference between the luminosity functions of protostars in regions of high and low stellar density, the former of which is biased toward more luminous sources. This may be the result of primordial mass segregation, although this interpretation is not unique. We compare our luminosity functions to those

  13. Molecular evolution of rbcL in three gymnosperm families: identifying adaptive and coevolutionary patterns

    LENUS (Irish Health Repository)

    Sen, Lin

    2011-06-03

    Abstract Background The chloroplast-localized ribulose-1, 5-biphosphate carboxylase\\/oxygenase (Rubisco), the primary enzyme responsible for autotrophy, is instrumental in the continual adaptation of plants to variations in the concentrations of CO2. The large subunit (LSU) of Rubisco is encoded by the chloroplast rbcL gene. Although adaptive processes have been previously identified at this gene, characterizing the relationships between the mutational dynamics at the protein level may yield clues on the biological meaning of such adaptive processes. The role of such coevolutionary dynamics in the continual fine-tuning of RbcL remains obscure. Results We used the timescale and phylogenetic analyses to investigate and search for processes of adaptive evolution in rbcL gene in three gymnosperm families, namely Podocarpaceae, Taxaceae and Cephalotaxaceae. To understand the relationships between regions identified as having evolved under adaptive evolution, we performed coevolutionary analyses using the software CAPS. Importantly, adaptive processes were identified at amino acid sites located on the contact regions among the Rubisco subunits and on the interface between Rubisco and its activase. Adaptive amino acid replacements at these regions may have optimized the holoenzyme activity. This hypothesis was pinpointed by evidence originated from our analysis of coevolution that supported the correlated evolution between Rubisco and its activase. Interestingly, the correlated adaptive processes between both these proteins have paralleled the geological variation history of the concentration of atmospheric CO2. Conclusions The gene rbcL has experienced bursts of adaptations in response to the changing concentration of CO2 in the atmosphere. These adaptations have emerged as a result of a continuous dynamic of mutations, many of which may have involved innovation of functional Rubisco features. Analysis of the protein structure and the functional implications of such

  14. Comparative metatranscriptomics identifies molecular bases for the physiological responses of phytoplankton to varying iron availability.

    Science.gov (United States)

    Marchetti, Adrian; Schruth, David M; Durkin, Colleen A; Parker, Micaela S; Kodner, Robin B; Berthiaume, Chris T; Morales, Rhonda; Allen, Andrew E; Armbrust, E Virginia

    2012-02-07

    In vast expanses of the oceans, growth of large phytoplankton such as diatoms is limited by iron availability. Diatoms respond almost immediately to the delivery of iron and rapidly compose the majority of phytoplankton biomass. The molecular bases underlying the subsistence of diatoms in iron-poor waters and the plankton community dynamics that follow iron resupply remain largely unknown. Here we use comparative metatranscriptomics to identify changes in gene expression associated with iron-stimulated growth of diatoms and other eukaryotic plankton. A microcosm iron-enrichment experiment using mixed-layer waters from the northeastern Pacific Ocean resulted in increased proportions of diatom transcripts and reduced proportions of transcripts from most other taxa within 98 h after iron addition. Hundreds of diatom genes were differentially expressed in the iron-enriched community compared with the iron-limited community; transcripts of diatom genes required for synthesis of photosynthesis and chlorophyll components, nitrate assimilation and the urea cycle, and synthesis of carbohydrate storage compounds were significantly overrepresented. Transcripts of genes encoding rhodopsins in eukaryotic phytoplankton were significantly underrepresented following iron enrichment, suggesting rhodopsins help cells cope with low-iron conditions. Oceanic diatoms appear to display a distinctive transcriptional response to iron enrichment that allows chemical reduction of available nitrogen and carbon sources along with a continued dependence on iron-free photosynthetic proteins rather than substituting for iron-containing functional equivalents present within their gene repertoire. This ability of diatoms to divert their newly acquired iron toward nitrate assimilation may underlie why diatoms consistently dominate iron enrichments in high-nitrate, low-chlorophyll regions.

  15. A systems biology strategy to identify molecular mechanisms of action and protein indicators of traumatic brain injury.

    Science.gov (United States)

    Yu, Chenggang; Boutté, Angela; Yu, Xueping; Dutta, Bhaskar; Feala, Jacob D; Schmid, Kara; Dave, Jitendra; Tawa, Gregory J; Wallqvist, Anders; Reifman, Jaques

    2015-02-01

    The multifactorial nature of traumatic brain injury (TBI), especially the complex secondary tissue injury involving intertwined networks of molecular pathways that mediate cellular behavior, has confounded attempts to elucidate the pathology underlying the progression of TBI. Here, systems biology strategies are exploited to identify novel molecular mechanisms and protein indicators of brain injury. To this end, we performed a meta-analysis of four distinct high-throughput gene expression studies involving different animal models of TBI. By using canonical pathways and a large human protein-interaction network as a scaffold, we separately overlaid the gene expression data from each study to identify molecular signatures that were conserved across the different studies. At 24 hr after injury, the significantly activated molecular signatures were nonspecific to TBI, whereas the significantly suppressed molecular signatures were specific to the nervous system. In particular, we identified a suppressed subnetwork consisting of 58 highly interacting, coregulated proteins associated with synaptic function. We selected three proteins from this subnetwork, postsynaptic density protein 95, nitric oxide synthase 1, and disrupted in schizophrenia 1, and hypothesized that their abundance would be significantly reduced after TBI. In a penetrating ballistic-like brain injury rat model of severe TBI, Western blot analysis confirmed our hypothesis. In addition, our analysis recovered 12 previously identified protein biomarkers of TBI. The results suggest that systems biology may provide an efficient, high-yield approach to generate testable hypotheses that can be experimentally validated to identify novel mechanisms of action and molecular indicators of TBI. © 2014 The Authors. Journal of Neuroscience Research Published by Wiley Periodicals, Inc.

  16. A suite of molecular markers for identifying species, detecting introgression and describing population structure in spadefoot toads (Spea spp.).

    Science.gov (United States)

    Pfennig, Karin S; Allenby, Ashley; Martin, Ryan A; Monroy, Anaïs; Jones, Corbin D

    2012-09-01

    Two congeneric species of spadefoot toad, Spea multiplicata and Spea bombifrons, have been the focus of hybridization studies since the 1970s. Because complex hybrids are not readily distinguished phenotypically, genetic markers are needed to identify introgressed individuals. We therefore developed a set of molecular markers (amplified fragment length polymorphism, polymerase chain reaction-restriction fragment length polymorphism and single nucleotide polymorphism) for identifying pure-species, F1 hybrids and more complex introgressed types. To do so, we tested a series of markers across both species and known hybrids using populations in both allopatry and sympatry. We retained those markers that differentiated the two pure-species and also consistently identified known species hybrids. These markers are well suited for identifying hybrids between these species. Moreover, those markers that show variation within each species can be used in conjunction with existing molecular markers in studies of population structure and gene flow. © 2012 Blackwell Publishing Ltd.

  17. Galleria mellonella model identifies highly virulent strains among all major molecular types of Cryptococcus gattii.

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    Full Text Available Cryptococcosis is mainly caused by Cryptococcus neoformans. However, the number of cases due to C. gattii is increasing, affecting mainly immunocompetent hosts. C. gattii is divided into four major molecular types, VGI to VGIV, which differ in their host range, epidemiology, antifungal susceptibility and geographic distribution. Besides studies on the Vancouver Island outbreak strains, which showed that the subtype VGIIa is highly virulent compared to the subtype VGIIb, little is known about the virulence of the other major molecular types. To elucidate the virulence potential of the major molecular types of C. gattii, Galleria mellonella larvae were inoculated with ten globally selected strains per molecular type. Survival rates were recorded and known virulence factors were studied. One VGII, one VGIII and one VGIV strain were more virulent (p 0.05, 21 (five VGI, five VGII, four VGIII and seven VGIV were less virulent (p <0.05 while one strain of each molecular type were avirulent. Cell and capsule size of all strains increased markedly during larvae infection (p <0.001. No differences in growth rate at 37°C were observed. Melanin synthesis was directly related with the level of virulence: more virulent strains produced more melanin than less virulent strains (p <0.05. The results indicate that all C. gattii major molecular types exhibit a range of virulence, with some strains having the potential to be more virulent. The study highlights the necessity to further investigate the genetic background of more and less virulent strains in order to recognize critical features, other than the known virulence factors (capsule, melanin and growth at mammalian body temperature, that maybe crucial for the development and progression of cryptococcosis.

  18. Whole-genome sequencing and comprehensive molecular profiling identify new driver mutations in gastric cancer

    NARCIS (Netherlands)

    Wang, Kai; Yuen, Siu Tsan; Xu, Jiangchun; Lee, Siu Po; Yan, Helen H N; Shi, Stephanie T; Siu, Hoi Cheong; Deng, Shibing; Chu, Kent Man; Law, Simon; Chan, Kok Hoe; Chan, Annie S Y; Tsui, Wai Yin; Ho, Siu Lun; Chan, Anthony K W; Man, Jonathan L K; Foglizzo, Valentina; Ng, Man Kin; Chan, April S; Ching, Yick Pang; Cheng, Grace H W; Xie, Tao; Fernandez, Julio; Li, Vivian S W; Clevers, Hans; Rejto, Paul A; Mao, Mao; Leung, Suet Yi

    Gastric cancer is a heterogeneous disease with diverse molecular and histological subtypes. We performed whole-genome sequencing in 100 tumor-normal pairs, along with DNA copy number, gene expression and methylation profiling, for integrative genomic analysis. We found subtype-specific genetic and

  19. New technique of identifying the hierarchy of dynamic domains in proteins using a method of molecular dynamics simulations

    Directory of Open Access Journals (Sweden)

    Yesylevskyy S. O.

    2010-04-01

    Full Text Available Aim. Despite a large number of existing domain identification techniques there is no universally accepted method, which identifies the hierarchy of dynamic domains using the data of molecular dynamics (MD simulations. The goal of this work is to develop such technique. Methods. The dynamic domains are identified by eliminating systematic motions from MD trajectories recursively in a model-free manner. Results. The technique called the Hierarchical Domain-Wise Alignment (HDWA to identify hierarchically organized dynamic domains in proteins using the MD trajectories has been developed. Conclusion. A new method of domain identification in proteins is proposed

  20. Molecular Imaging to Identify Tumor Recurrence following Chemoradiation in a Hostile Surgical Environment

    Directory of Open Access Journals (Sweden)

    Olugbenga T. Okusanya

    2015-01-01

    Full Text Available Surgical biopsy of potential tumor recurrence is a common challenge facing oncologists, surgeons, and cancer patients. Imaging modalities have limited ability to accurately detect recurrent cancer in fields affected by previous surgery, chemotherapy, or radiation. However, definitive tissue diagnosis is often needed to initiate treatment and to direct therapy. We sought to determine if a targeted fluorescent intraoperative molecular imaging technique could be applied in a clinical setting to assist a surgical biopsy in a “hostile” field. We describe the use of a folate-fluorescein conjugate to direct the biopsy of a suspected recurrent lung adenocarcinoma invading the mediastinum that had been previously treated with chemoradiation. We found that intraoperative imaging allowed the identification of small viable tumor deposits that were otherwise indistinguishable from scar and necrosis. Our operative observations were confirmed by histology, fluorescence microscopy, and immunohistochemistry. Our results demonstrate one possible application and clinical value of intraoperative molecular imaging.

  1. Utilizing Endoscopic Ultrasound-Guided Fine Needle Aspiration in Identifying Molecular Targets for Pancreatic Cancer

    OpenAIRE

    Onyekachi Henry Ogbonna; Muhammad Wasif Saif

    2013-01-01

    Pancreatic cancer remains a devastating disease, with poor survival rates and high recurrence rates with current treatmentregimens. Over the years we have come to understand the complex biology of this cancer, involving cross-talking signalingpathways that proffers resistance to current therapy. Several molecularly targeted agents remain in development. At the2013 American Society of Clinical Oncology (ASCO) Annual Meeting, an abstract (#4051) was presented which exploredusing endoscopic ultr...

  2. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Hrabcová, M.; Pecková, Hana; Patra, Sneha; Kodádková, Alena; Jurajda, Pavel; Tyml, Tomáš; Holzer, Astrid S.

    2014-01-01

    Roč. 44, č. 8 (2014), s. 565-577 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GPP506/11/P724; GA ČR GBP505/12/G112; GA AV ČR(CZ) M200961205 Institutional support: RVO:60077344 ; RVO:68081766 Keywords : Buddenbrockia * Tetracapsuloides * diversity * phylogeny * Bryozoa * fish * cryptic * worm Subject RIV: EB - Genetics ; Molecular Biology; EG - Zoology (UBO-W) Impact factor: 3.872, year: 2014

  3. More on contamination: the use of asymmetric molecular behavior to identify authentic ancient human DNA

    DEFF Research Database (Denmark)

    Malmström, Helena; Svensson, Emma M; Gilbert, M Thomas P

    2007-01-01

    concerning the authenticity of such data. Although several methods have been developed to the purpose of authenticating ancient DNA (aDNA) results, while they are useful in faunal research, most of the methods have proven complicated to apply to ancient human DNA. Here, we investigate in detail...... the reliability of one of the proposed criteria, that of appropriate molecular behavior. Using real-time polymerase chain reaction (PCR) and pyrosequencing, we have quantified the relative levels of authentic aDNA and contaminant human DNA sequences recovered from archaeological dog and cattle remains. In doing...

  4. Cancer in silico drug discovery: a systems biology tool for identifying candidate drugs to target specific molecular tumor subtypes.

    Science.gov (United States)

    San Lucas, F Anthony; Fowler, Jerry; Chang, Kyle; Kopetz, Scott; Vilar, Eduardo; Scheet, Paul

    2014-12-01

    Large-scale cancer datasets such as The Cancer Genome Atlas (TCGA) allow researchers to profile tumors based on a wide range of clinical and molecular characteristics. Subsequently, TCGA-derived gene expression profiles can be analyzed with the Connectivity Map (CMap) to find candidate drugs to target tumors with specific clinical phenotypes or molecular characteristics. This represents a powerful computational approach for candidate drug identification, but due to the complexity of TCGA and technology differences between CMap and TCGA experiments, such analyses are challenging to conduct and reproduce. We present Cancer in silico Drug Discovery (CiDD; scheet.org/software), a computational drug discovery platform that addresses these challenges. CiDD integrates data from TCGA, CMap, and Cancer Cell Line Encyclopedia (CCLE) to perform computational drug discovery experiments, generating hypotheses for the following three general problems: (i) determining whether specific clinical phenotypes or molecular characteristics are associated with unique gene expression signatures; (ii) finding candidate drugs to repress these expression signatures; and (iii) identifying cell lines that resemble the tumors being studied for subsequent in vitro experiments. The primary input to CiDD is a clinical or molecular characteristic. The output is a biologically annotated list of candidate drugs and a list of cell lines for in vitro experimentation. We applied CiDD to identify candidate drugs to treat colorectal cancers harboring mutations in BRAF. CiDD identified EGFR and proteasome inhibitors, while proposing five cell lines for in vitro testing. CiDD facilitates phenotype-driven, systematic drug discovery based on clinical and molecular data from TCGA. ©2014 American Association for Cancer Research.

  5. Early and long-standing rheumatoid arthritis: distinct molecular signatures identified by gene-expression profiling in synovia

    Science.gov (United States)

    Lequerré, Thierry; Bansard, Carine; Vittecoq, Olivier; Derambure, Céline; Hiron, Martine; Daveau, Maryvonne; Tron, François; Ayral, Xavier; Biga, Norman; Auquit-Auckbur, Isabelle; Chiocchia, Gilles; Le Loët, Xavier; Salier, Jean-Philippe

    2009-01-01

    Introduction Rheumatoid arthritis (RA) is a heterogeneous disease and its underlying molecular mechanisms are still poorly understood. Because previous microarray studies have only focused on long-standing (LS) RA compared to osteoarthritis, we aimed to compare the molecular profiles of early and LS RA versus control synovia. Methods Synovial biopsies were obtained by arthroscopy from 15 patients (4 early untreated RA, 4 treated LS RA and 7 controls, who had traumatic or mechanical lesions). Extracted mRNAs were used for large-scale gene-expression profiling. The different gene-expression combinations identified by comparison of profiles of early, LS RA and healthy synovia were linked to the biological processes involved in each situation. Results Three combinations of 719, 116 and 52 transcripts discriminated, respectively, early from LS RA, and early or LS RA from healthy synovia. We identified several gene clusters and distinct molecular signatures specifically expressed during early or LS RA, thereby suggesting the involvement of different pathophysiological mechanisms during the course of RA. Conclusions Early and LS RA have distinct molecular signatures with different biological processes participating at different times during the course of the disease. These results suggest that better knowledge of the main biological processes involved at a given RA stage might help to choose the most appropriate treatment. PMID:19563633

  6. RNA sequencing of Populus x canadensis roots identifies key molecular mechanisms underlying physiological adaption to excess zinc.

    Directory of Open Access Journals (Sweden)

    Andrea Ariani

    Full Text Available Populus x canadensis clone I-214 exhibits a general indicator phenotype in response to excess Zn, and a higher metal uptake in roots than in shoots with a reduced translocation to aerial parts under hydroponic conditions. This physiological adaptation seems mainly regulated by roots, although the molecular mechanisms that underlie these processes are still poorly understood. Here, differential expression analysis using RNA-sequencing technology was used to identify the molecular mechanisms involved in the response to excess Zn in root. In order to maximize specificity of detection of differentially expressed (DE genes, we consider the intersection of genes identified by three distinct statistical approaches (61 up- and 19 down-regulated and validate them by RT-qPCR, yielding an agreement of 93% between the two experimental techniques. Gene Ontology (GO terms related to oxidation-reduction processes, transport and cellular iron ion homeostasis were enriched among DE genes, highlighting the importance of metal homeostasis in adaptation to excess Zn by P. x canadensis clone I-214. We identified the up-regulation of two Populus metal transporters (ZIP2 and NRAMP1 probably involved in metal uptake, and the down-regulation of a NAS4 gene involved in metal translocation. We identified also four Fe-homeostasis transcription factors (two bHLH38 genes, FIT and BTS that were differentially expressed, probably for reducing Zn-induced Fe-deficiency. In particular, we suggest that the down-regulation of FIT transcription factor could be a mechanism to cope with Zn-induced Fe-deficiency in Populus. These results provide insight into the molecular mechanisms involved in adaption to excess Zn in Populus spp., but could also constitute a starting point for the identification and characterization of molecular markers or biotechnological targets for possible improvement of phytoremediation performances of poplar trees.

  7. Molecular diagnostics to identify fungal plant pathogens – A review of current methods

    OpenAIRE

    Bernreiter, Andreas

    2017-01-01

    La siguiente revisión ofrece una visión amplia de los métodos actuales utilizados para la identificación de hongos fitopatógenos. Además, se presentan estudios previos centrados en patógenos relevantes para el Ecuador y una breve discusión sobre el futuro del diagnóstico en fitopatología. En la actualidad, las herramientas de diagnóstico que aplican biología molecular se basan en la tecnología de reacción en cadena de la polimerasa (PCR). Se presenta una selección de tecnologías basadas en PC...

  8. Using combined morphological, allometric and molecular approaches to identify species of the genus Raillietiella (Pentastomida.

    Directory of Open Access Journals (Sweden)

    Crystal Kelehear

    Full Text Available Taxonomic studies of parasites can be severely compromised if the host species affects parasite morphology; an uncritical analysis might recognize multiple taxa simply because of phenotypically plastic responses of parasite morphology to host physiology. Pentastomids of the genus Raillietiella are endoparasitic crustaceans primarily infecting the respiratory system of carnivorous reptiles, but also recorded from bufonid anurans. The delineation of pentastomids at the generic level is clear, but the taxonomic status of many species is not. We collected raillietiellids from lungs of the invasive cane toad (Rhinella marina, the invasive Asian house gecko (Hemidactylus frenatus, and a native tree frog (Litoria caerulea in tropical Australia, and employed a combination of genetic analyses, and traditional and novel morphological methods to clarify their identity. Conventional analyses of parasite morphology (which focus on raw values of morphological traits revealed two discrete clusters in terms of pentastome hook size, implying two different species of pentastomes: one from toads and a tree frog (Raillietiella indica and another from lizards (Raillietiella frenatus. However, these clusters disappeared in allometric analyses that took pentastome body size into account, suggesting that only a single pentastome taxon may be involved. Our molecular data revealed no genetic differences between parasites in toads versus lizards, confirming that there was only one species: R. frenatus. This pentastome (previously known only from lizards clearly is also capable of maturing in anurans. Our analyses show that the morphological features used in pentastomid taxonomy change as the parasite transitions through developmental stages in the definitive host. To facilitate valid descriptions of new species of pentastomes, future taxonomic work should include both morphological measurements (incorporating quantitative measures of body size and hook bluntness and

  9. ApoE4-specific Misfolded Intermediate Identified by Molecular Dynamics Simulations.

    Directory of Open Access Journals (Sweden)

    Benfeard Williams

    2015-10-01

    Full Text Available The increased risk of developing Alzheimer's disease (AD is associated with the APOE gene, which encodes for three variants of Apolipoprotein E, namely E2, E3, E4, differing only by two amino acids at positions 112 and 158. ApoE4 is known to be the strongest risk factor for AD onset, while ApoE3 and ApoE2 are considered to be the AD-neutral and AD-protective isoforms, respectively. It has been hypothesized that the ApoE isoforms may contribute to the development of AD by modifying the homeostasis of ApoE physiological partners and AD-related proteins in an isoform-specific fashion. Here we find that, despite the high sequence similarity among the three ApoE variants, only ApoE4 exhibits a misfolded intermediate state characterized by isoform-specific domain-domain interactions in molecular dynamics simulations. The existence of an ApoE4-specific intermediate state can contribute to the onset of AD by altering multiple cellular pathways involved in ApoE-dependent lipid transport efficiency or in AD-related protein aggregation and clearance. We present what we believe to be the first structural model of an ApoE4 misfolded intermediate state, which may serve to elucidate the molecular mechanism underlying the role of ApoE4 in AD pathogenesis. The knowledge of the structure for the ApoE4 folding intermediate provides a new platform for the rational design of alternative therapeutic strategies to fight AD.

  10. Molecular markers for tolerance of European ash (Fraxinus excelsior) to dieback disease identified using Associative Transcriptomics

    DEFF Research Database (Denmark)

    Harper, Andrea L.; McKinney, Lea Vig; Nielsen, Lene Rostgaard

    2016-01-01

    panel scored for disease symptoms and identified markers strongly associated with canopy damage in infected trees. Using these markers we predicted phenotypes in a test panel of unrelated trees, successfully identifying individuals with a low level of susceptibility to the disease. Co......Tree disease epidemics are a global problem, impacting food security, biodiversity and national economies. The potential for conservation and breeding in trees is hampered by complex genomes and long lifecycles, with most species lacking genomic resources. The European Ash tree Fraxinus excelsior...

  11. Molecular Epidemiology Identifies HIV Transmission Networks Associated With Younger Age and Heterosexual Exposure Among Korean Individuals

    OpenAIRE

    Chin, Bum Sik; Chaillon, Antoine; Mehta, Sanjay R.; Wertheim, Joel O.; Kim, Gayeon; Shin, Hyoung-Shik; Smith, Davey M.

    2016-01-01

    To evaluate if HIV transmission networks could be elucidated from data collected in a short time frame, 131 HIV-1 pol sequences were analyzed which were generated from treatment-naïve Korean individuals who were sequentially identified over 1 year. A transmission linkage was inferred when there was a genetic distance

  12. Molecular docking and NMR binding studies to identify novel inhibitors of human phosphomevalonate kinase

    Energy Technology Data Exchange (ETDEWEB)

    Boonsri, Pornthip [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States); Department of Chemistry, NANOTEC Center of Nanotechnology, National Nanotechnology Center, Faculty of Science, Kasetsart University, Bangkok 10900 (Thailand); Neumann, Terrence S.; Olson, Andrew L.; Cai, Sheng [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States); Herdendorf, Timothy J.; Miziorko, Henry M. [Division of Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Hannongbua, Supa [Department of Chemistry, NANOTEC Center of Nanotechnology, National Nanotechnology Center, Faculty of Science, Kasetsart University, Bangkok 10900 (Thailand); Sem, Daniel S., E-mail: daniel.sem@cuw.edu [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Natural and synthetic inhibitors of human phosphomevalonate kinase identified. Black-Right-Pointing-Pointer Virtual screening yielded a hit rate of 15%, with inhibitor K{sub d}'s of 10-60 {mu}M. Black-Right-Pointing-Pointer NMR studies indicate significant protein conformational changes upon binding. -- Abstract: Phosphomevalonate kinase (PMK) phosphorylates mevalonate-5-phosphate (M5P) in the mevalonate pathway, which is the sole source of isoprenoids and steroids in humans. We have identified new PMK inhibitors with virtual screening, using autodock. Promising hits were verified and their affinity measured using NMR-based {sup 1}H-{sup 15}N heteronuclear single quantum coherence (HSQC) chemical shift perturbation and fluorescence titrations. Chemical shift changes were monitored, plotted, and fitted to obtain dissociation constants (K{sub d}). Tight binding compounds with K{sub d}'s ranging from 6-60 {mu}M were identified. These compounds tended to have significant polarity and negative charge, similar to the natural substrates (M5P and ATP). HSQC cross peak changes suggest that binding induces a global conformational change, such as domain closure. Compounds identified in this study serve as chemical genetic probes of human PMK, to explore pharmacology of the mevalonate pathway, as well as starting points for further drug development.

  13. Discovery and molecular characterization of a new luteovirus identified by high-throughput sequencing from apple

    Science.gov (United States)

    ‘Rapid Apple Decline’ (RAD) is a newly emerging problem of young, dwarf apple trees in the northeastern USA. The affected trees show trunk necrosis, bark cracking and canker formation before collapsing in the summer. In this study, a new luteovirus and three common viruses were identified from apple...

  14. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia

    NARCIS (Netherlands)

    van Uitert, Miranda; Moerland, Perry D.; Enquobahrie, Daniel A.; Laivuori, Hannele; van der Post, Joris A. M.; Ris-Stalpers, Carrie; Afink, Gijs B.

    2015-01-01

    Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia

  15. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS IN WATER

    Science.gov (United States)

    Hepatitis E virus (HEV) causes an infectious form of hepatitis associated with contaminated water. By analyzing the sequence of several HEV isolates, a reverse transciption-polymerase chain reaction method was developed and optimized that should be able to identify all of the kn...

  16. Microscopic and Molecular Tracing of Cryptosporidium Oocysts: Identifying a Possible Reservoir of Infection in Red Grouse

    Directory of Open Access Journals (Sweden)

    David Baines

    2017-11-01

    Full Text Available Infection by Cryptosporidium baileyi causes respiratory cryptosporidiosis in red grouse Lagopus lagopus scotica. First diagnosed in 2010, it has since been detected across half of moors managed for grouse shooting in northern England. We hypothesised that contaminated grouse faeces within communal trays visited by grouse containing grit coated with flubendazole, provided to control Trichostrongylus tenuis parasites of grouse, is a reservoir of infection. To establish the basis to this hypothesis, contents of 23 trays from a grouse moor were examined for Cryptosporidium oocysts. Contents were subjected to Immuno Magnetic Separation oocyst concentration techniques prior to examination by Immuno Fluorescence Antibody Test microscopy and molecular analysis on the 18S rRNA gene. Seven of 13 (54% grit trays known to be used by infected grouse were positive for Cryptosporidium by IMS-IFAT, compared to two of 10 (20% random background trays. Ten of the 13 (77% trays used by infected birds amplified positive for Cryptosporidium by Polymerase Chain Reaction and three of the 10 (30% random trays. All PCR amplified products sequenced matched with C. baileyi, with C. parvum also present in one tray. These data suggest that trays used to “worm” grouse may act as reservoirs of Cryptosporidium infection and their future design may need to be reconsidered to minimise contamination.

  17. Antimycobacterial drug discovery using Mycobacteria-infected amoebae identifies anti-infectives and new molecular targets.

    Science.gov (United States)

    Trofimov, Valentin; Kicka, Sébastien; Mucaria, Sabrina; Hanna, Nabil; Ramon-Olayo, Fernando; Del Peral, Laura Vela-Gonzalez; Lelièvre, Joël; Ballell, Lluís; Scapozza, Leonardo; Besra, Gurdyal S; Cox, Jonathan A G; Soldati, Thierry

    2018-03-02

    Tuberculosis remains a serious threat to human health world-wide, and improved efficiency of medical treatment requires a better understanding of the pathogenesis and the discovery of new drugs. In the present study, we performed a whole-cell based screen in order to complete the characterization of 168 compounds from the GlaxoSmithKline TB-set. We have established and utilized novel previously unexplored host-model systems to characterize the GSK compounds, i.e. the amoeboid organisms D. discoideum and A. castellanii, as well as a microglial phagocytic cell line, BV2. We infected these host cells with Mycobacterium marinum to monitor and characterize the anti-infective activity of the compounds with quantitative fluorescence measurements and high-content microscopy. In summary, 88.1% of the compounds were confirmed as antibiotics against M. marinum, 11.3% and 4.8% displayed strong anti-infective activity in, respectively, the mammalian and protozoan infection models. Additionally, in the two systems, 13-14% of the compounds displayed pro-infective activity. Our studies underline the relevance of using evolutionarily distant pathogen and host models in order to reveal conserved mechanisms of virulence and defence, respectively, which are potential "universal" targets for intervention. Subsequent mechanism of action studies based on generation of over-expresser M. bovis BCG strains, generation of spontaneous resistant mutants and whole genome sequencing revealed four new molecular targets, including FbpA, MurC, MmpL3 and GlpK.

  18. Galactosemia: A strategy to identify new biochemical phenotypes and molecular genotypes

    Energy Technology Data Exchange (ETDEWEB)

    Elsas, L.J.; Langley, S.; Steele, E.; Evinger, J.; Brown, A.; Singh, R.; Fernhoff, P.; Hjelm, L.N.; Dembure, P.P.; Fridovich-Keil, J.L. [Emory Univ. School of Medicine, Atlanta, GA (United States)

    1995-03-01

    We describe a stratagem for identifying new mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. GALT enzyme activity and isoforms were defined in erythrocytes from probands and their first-degree relatives. If the biochemical phenotypes segregated in an autosomal recesssive pattern, we screened for common mutations by using multiplex PCR and restriction endonuclease digestions. If common mutant alleles were not present, the 11 exons of the GALT gene were amplified by PCR, and variations from the normal nucleotide sequences were identified by SSCP. The suspected region(s) was then analyzed by direct DNA sequencing. We identified 86 mutant GALT alleles that reduced erythrocyte GALT activity. Seventy-five of these GALT genomes had abnormal SSCP patterns, of which 41 were sequenced, yielding 12 new and 21 previously reported, rare mutations. Among the novel group of 12 new mutations, an unusual biochemical phenotype was found in a family whose newborn proband has classical galactosemia. He had inherited two mutations in cis (N314D-E204K) from his father, whose GALT activity was near normal, and an additional GALT mutation in the splice-acceptor site of intron C (IVSC) from his mother. The substitution of a positively charged E204K mutation created a unique isoform-banding pattern. An asymptomatic sister`s GALT genes carries three mutations (E203K-N314D/N314D) with eight distinct isoform bands. Surprisingly, her erythrocytes have normal GALT activity. We conclude that the synergism of pedigree, biochemical, SSCP, and direct GALT gene analyses is an efficient protocol for identifying new mutations and speculate that E203K and N314D codon changes produce intra-allelic complementation when in cis. 40 refs., 4 figs., 3 tabs.

  19. Morphological and molecular methods to identify butternut (Juglans cinerea) and butternut hybrids: relevance to butternut conservation.

    Science.gov (United States)

    Ross-Davis, Amy; Huang, Zhonglian; McKenna, James; Ostry, Michael; Woeste, Keith

    2008-07-01

    Butternut (Juglans cinerea L.) is a native, cold-tolerant, hard-mast species formerly valued for its nuts and wood, which is now endangered. The most immediate threat to butternut restoration is the spread of butternut canker disease, caused by the exotic fungus Sirococcus clavigignenti-juglandacearum Nair, Kostichka & Kuntz. Other threats include the hybridization of butternut with the exotic Japanese walnut (Juglans ailantifolia Carr.) and poor regeneration. The hybrids, known as buartnuts, are vegetatively vigorous, highly fecund, more resistant than butternut to butternut canker disease and difficult to identify. We review the vegetative and reproductive morphological traits that distinguish butternut from hybrids and identify those that can be used by field biologists to separate the taxa. No single trait was sufficient to separate butternut from hybrids, but pith color, lenticel size, shape and abundance, and the presence or absence of a notch in the upper margin of leaf scars, can be used in combination with other traits to identify butternuts and exclude most hybrids. In at least one butternut population, reduced symptoms of butternut canker disease were significantly associated with a dark barked phenotype. We also describe two randomly amplified polymorphic DNA (RAPD) markers that differentiate butternuts from hybrids based on DNA polymorphism. Together, these results should assist in the identification and testing of non-hybrid butternut for breeding and reintroduction of the species to its former habitats.

  20. A systems biology pipeline identifies new immune and disease related molecular signatures and networks in human cells during microgravity exposure.

    Science.gov (United States)

    Mukhopadhyay, Sayak; Saha, Rohini; Palanisamy, Anbarasi; Ghosh, Madhurima; Biswas, Anupriya; Roy, Saheli; Pal, Arijit; Sarkar, Kathakali; Bagh, Sangram

    2016-05-17

    Microgravity is a prominent health hazard for astronauts, yet we understand little about its effect at the molecular systems level. In this study, we have integrated a set of systems-biology tools and databases and have analysed more than 8000 molecular pathways on published global gene expression datasets of human cells in microgravity. Hundreds of new pathways have been identified with statistical confidence for each dataset and despite the difference in cell types and experiments, around 100 of the new pathways are appeared common across the datasets. They are related to reduced inflammation, autoimmunity, diabetes and asthma. We have identified downregulation of NfκB pathway via Notch1 signalling as new pathway for reduced immunity in microgravity. Induction of few cancer types including liver cancer and leukaemia and increased drug response to cancer in microgravity are also found. Increase in olfactory signal transduction is also identified. Genes, based on their expression pattern, are clustered and mathematically stable clusters are identified. The network mapping of genes within a cluster indicates the plausible functional connections in microgravity. This pipeline gives a new systems level picture of human cells under microgravity, generates testable hypothesis and may help estimating risk and developing medicine for space missions.

  1. A systems biology pipeline identifies new immune and disease related molecular signatures and networks in human cells during microgravity exposure

    Science.gov (United States)

    Mukhopadhyay, Sayak; Saha, Rohini; Palanisamy, Anbarasi; Ghosh, Madhurima; Biswas, Anupriya; Roy, Saheli; Pal, Arijit; Sarkar, Kathakali; Bagh, Sangram

    2016-05-01

    Microgravity is a prominent health hazard for astronauts, yet we understand little about its effect at the molecular systems level. In this study, we have integrated a set of systems-biology tools and databases and have analysed more than 8000 molecular pathways on published global gene expression datasets of human cells in microgravity. Hundreds of new pathways have been identified with statistical confidence for each dataset and despite the difference in cell types and experiments, around 100 of the new pathways are appeared common across the datasets. They are related to reduced inflammation, autoimmunity, diabetes and asthma. We have identified downregulation of NfκB pathway via Notch1 signalling as new pathway for reduced immunity in microgravity. Induction of few cancer types including liver cancer and leukaemia and increased drug response to cancer in microgravity are also found. Increase in olfactory signal transduction is also identified. Genes, based on their expression pattern, are clustered and mathematically stable clusters are identified. The network mapping of genes within a cluster indicates the plausible functional connections in microgravity. This pipeline gives a new systems level picture of human cells under microgravity, generates testable hypothesis and may help estimating risk and developing medicine for space missions.

  2. Quantum Mechanics/Molecular Mechanics Simulations Identify the Ring-Opening Mechanism of Creatininase.

    Science.gov (United States)

    Jitonnom, Jitrayut; Mujika, Jon I; van der Kamp, Marc W; Mulholland, Adrian J

    2017-12-05

    Creatininase catalyzes the conversion of creatinine (a biosensor for kidney function) to creatine via a two-step mechanism: water addition followed by ring opening. Water addition is common to other known cyclic amidohydrolases, but the precise mechanism for ring opening is still under debate. The proton donor in this step is either His178 or a water molecule bound to one of the metal ions, and the roles of His178 and Glu122 are unclear. Here, the two possible reaction pathways have been fully examined by means of combined quantum mechanics/molecular mechanics simulations at the SCC-DFTB/CHARMM22 level of theory. The results indicate that His178 is the main catalytic residue for the whole reaction and explain its role as proton shuttle during the ring-opening step. In the first step, His178 provides electrostatic stabilization to the gem-diolate tetrahedral intermediate. In the second step, His178 abstracts the hydroxyl proton of the intermediate and delivers it to the cyclic amide nitrogen, leading to ring opening. The latter is the rate-limiting step with a free energy barrier of 18.5 kcal/mol, in agreement with the experiment. We find that Glu122 must be protonated during the enzyme reaction, so that it can form a stable hydrogen bond with its neighboring water molecule. Simulations of the E122Q mutant showed that this replacement disrupts the H-bond network formed by three conserved residues (Glu34, Ser78, and Glu122) and water, increasing the energy barrier. Our computational studies provide a comprehensive explanation for previous structural and kinetic observations, including why the H178A mutation causes a complete loss of activity but the E122Q mutation does not.

  3. Molecular Method Development to Identify Foodborne Sarcocystishominis in Raw Beef Commercial Hamburger

    Directory of Open Access Journals (Sweden)

    Bahador Hajimohammadi

    2014-11-01

    Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.

  4. Identifying Genetic Hotspots by Mapping Molecular Diversity of Widespread Trees: When Commonness Matters.

    Science.gov (United States)

    Souto, Cintia P; Mathiasen, Paula; Acosta, María Cristina; Quiroga, María Paula; Vidal-Russell, Romina; Echeverría, Cristian; Premoli, Andrea C

    2015-01-01

    Conservation planning requires setting priorities at the same spatial scale at which decision-making processes are undertaken considering all levels of biodiversity, but current methods for identifying biodiversity hotspots ignore its genetic component. We developed a fine-scale approach based on the definition of genetic hotspots, which have high genetic diversity and unique variants that represent their evolutionary potential and evolutionary novelties. Our hypothesis is that wide-ranging taxa with similar ecological tolerances, yet of phylogenetically independent lineages, have been and currently are shaped by ecological and evolutionary forces that result in geographically concordant genetic patterns. We mapped previously published genetic diversity and unique variants of biparentally inherited markers and chloroplast sequences for 9 species from 188 and 275 populations, respectively, of the 4 woody dominant families of the austral temperate forest, an area considered a biodiversity hotspot. Spatial distribution patterns of genetic polymorphisms differed among taxa according to their ecological tolerances. Eight genetic hotspots were detected and we recommend conservation actions for some in the southern Coastal Range in Chile. Existing spatially explicit genetic data from multiple populations and species can help to identify biodiversity hotspots and guide conservation actions to establish science-based protected areas that will preserve the evolutionary potential of key habitats and species. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Integrated analysis of the molecular action of Vorinostat identifies epi-sensitised targets for combination therapy.

    Science.gov (United States)

    Hay, Jodie F; Lappin, Katrina; Liberante, Fabio; Kettyle, Laura M; Matchett, Kyle B; Thompson, Alexander; Mills, Ken I

    2017-09-15

    Several histone deacetylase inhibitors including Vorinostat have received FDA approval for the treatment of haematological malignancies. However, data from these trials indicate that Vorinostat has limited efficacy as a monotherapy, prompting the need for rational design of combination therapies. A number of epi-sensitised pathways, including sonic hedgehog (SHH), were identified in AML cells by integration of global patterns of histone H3 lysine 9 (H3K9) acetylation with transcriptomic analysis following Vorinostat-treatment. Direct targeting of the SHH pathway with SANT-1, following Vorinostat induced epi-sensitisation, resulted in synergistic cell death of AML cells. In addition, xenograft studies demonstrated that combination therapy induced a marked reduction in leukemic burden compared to control or single agents. Together, the data supports epi-sensitisation as a potential component of the strategy for the rational development of combination therapies in AML.

  6. Clinical and molecular characterization of a novel INS mutation identified in patients with MODY phenotype.

    Science.gov (United States)

    Piccini, Barbara; Artuso, Rosangela; Lenzi, Lorenzo; Guasti, Monica; Braccesi, Giulia; Barni, Federica; Casalini, Emilio; Giglio, Sabrina; Toni, Sonia

    2016-11-01

    Correct diagnosis of Maturity-Onset Diabetes of the Young (MODY) is based on genetic tests requiring an appropriate subject selection by clinicians. Mutations in the insulin (INS) gene rarely occur in patients with MODY. This study is aimed at determining the genetic background and clinical phenotype in patients with suspected MODY. 34 patients with suspected MODY, negative for mutations in the GCK, HNF1α, HNF4α, HNF1β and PDX1 genes, were screened by next generation sequencing (NGS). A heterozygous INS mutation was identified in 4 members of the same family. First genetic tests performed identified two heterozygous silent nucleotide substitutions in MODY3/HNF1α gene. An ineffective attempt to suspend insulin therapy, administering repaglinide and sulphonylureas, was made. DNA was re-sequenced by NGS investigating a set of 102 genes. Genes implicated in the pathway of pancreatic β-cells, candidate genes for type 2 diabetes mellitus and genes causative of diabetes in mice were selected. A novel heterozygous variant in human preproinsulin INS gene (c.125T > C) was found in the affected family members. The new INS mutation broadens the spectrum of possible INS phenotypes. Screening for INS mutations is warranted not only in neonatal diabetes but also in MODYx patients and in selected patients with type 1 diabetes mellitus negative for autoantibodies. Subjects with complex diseases without a specific phenotype should be studied by NGS because Sanger sequencing is ineffective and time consuming in detecting rare variants. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  7. A molecular systems approach to modelling human skin pigmentation: identifying underlying pathways and critical components.

    Science.gov (United States)

    Raghunath, Arathi; Sambarey, Awanti; Sharma, Neha; Mahadevan, Usha; Chandra, Nagasuma

    2015-04-29

    Ultraviolet radiations (UV) serve as an environmental stress for human skin, and result in melanogenesis, with the pigment melanin having protective effects against UV induced damage. This involves a dynamic and complex regulation of various biological processes that results in the expression of melanin in the outer most layers of the epidermis, where it can exert its protective effect. A comprehensive understanding of the underlying cross talk among different signalling molecules and cell types is only possible through a systems perspective. Increasing incidences of both melanoma and non-melanoma skin cancers necessitate the need to better comprehend UV mediated effects on skin pigmentation at a systems level, so as to ultimately evolve knowledge-based strategies for efficient protection and prevention of skin diseases. A network model for UV-mediated skin pigmentation in the epidermis was constructed and subjected to shortest path analysis. Virtual knock-outs were carried out to identify essential signalling components. We describe a network model for UV-mediated skin pigmentation in the epidermis. The model consists of 265 components (nodes) and 429 directed interactions among them, capturing the manner in which one component influences the other and channels information. Through shortest path analysis, we identify novel signalling pathways relevant to pigmentation. Virtual knock-outs or perturbations of specific nodes in the network have led to the identification of alternate modes of signalling as well as enabled determining essential nodes in the process. The model presented provides a comprehensive picture of UV mediated signalling manifesting in human skin pigmentation. A systems perspective helps provide a holistic purview of interconnections and complexity in the processes leading to pigmentation. The model described here is extensive yet amenable to expansion as new data is gathered. Through this study, we provide a list of important proteins essential

  8. Rational approach to identify newer caspase-1 inhibitors using pharmacophore based virtual screening, docking and molecular dynamic simulation studies.

    Science.gov (United States)

    Patel, Shivani; Modi, Palmi; Chhabria, Mahesh

    2018-05-01

    Caspase-1 is a key endoprotease responsible for the post-translational processing of pro-inflammatory cytokines IL-1β, 18 & 33. Excessive secretion of IL-1β leads to numerous inflammatory and autoimmune diseases. Thus caspase-1 inhibition would be considered as an important therapeutic strategy for development of newer anti-inflammatory agents. Here we have employed an integrated virtual screening by combining pharmacophore mapping and docking to identify small molecules as caspase-1 inhibitors. The ligand based 3D pharmacophore model was generated having the essential structural features of (HBA, HY & RA) using a data set of 27 compounds. A validated pharmacophore hypothesis (Hypo 1) was used to screen ZINC and Minimaybridge chemical databases. The retrieved virtual hits were filtered by ADMET properties and molecular docking analysis. Subsequently, the cross-docking study was also carried out using crystal structure of caspase-1, 3, 7 and 8 to identify the key residual interaction for specific caspase-1 inhibition. Finally, the best mapped and top scored (ZINC00885612, ZINC72003647, BTB04175 and BTB04410) molecules were subjected to molecular dynamics simulation for accessing the dynamic structure of protein after ligand binding. This study identifies the most promising hits, which can be leads for the development of novel caspase-1 inhibitors as anti-inflammatory agents. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. A molecular method to detect and identify the native species of southwestern Atlantic Crassostrea (Mollusca: Ostreidae

    Directory of Open Access Journals (Sweden)

    Sandra Ludwig

    2011-08-01

    Full Text Available Among oysters, species of Crassostrea (Sacco, 1897 are the most attractive to aquaculture. In Brazil, the genus is represented by C. rhizophorae (Guilding, 1828 and C. brasiliana (Lamarck, 1819. Because the maturation and breeding technology is not well developed for these species, aquaculturists need a reliable method to decide the correct time to place spat collectors in the field, and to identify both species, which are morphologically similar. In this study a specific Multiplex PCR protocol was developed, using one pair of universal primers from 18S rDNA as a positive control and a pair of specific primers for each target species. The sensitivity and specificity of the protocol was evaluated. It detected C. rhizophorae DNA in low concentrations, and C. brasiliana DNA in even lower concentrations. Further, the Multiplex PCR proved efficient in detecting DNA in concentrations equivalent to that of a single larva of each species, either separated or combined, when mixed with total DNA extract of a plankton sample representing 1000 L of filtered water. Field tests confirmed the applicability of the protocol, which holds the promise to become an important tool for aquaculture or conservation programs, allowing for the continuous monitoring of the life cycle of C. brasiliana and C. rhizophorae, by detecting the right periods of larval release and settlement.

  10. Distinct forms of the β subunit of GTP-binding regulatory proteins identified by molecular cloning

    International Nuclear Information System (INIS)

    Fong, H.K.W.; Amatruda, T.T. III; Birren, B.W.; Simon, M.I.

    1987-01-01

    Two distinct β subunits of guanine nucleotide-binding regulatory proteins have been identified by cDNA cloning and are referred to as β 1 and β 1 subunits. The bovine transducin β subunit (β 1 ) has been cloned previously. The author now isolated and analyzed cDNA clones that encode the β 2 subunit from bovine adrenal, bovine brain, and a human myeloid leukemia cell line, HL-60. The 340-residue M/sub r/ 37,329 Β 2 protein is 90% identical with β 1 in predicted amino acid sequence, and it is also organized as a series of repetitive homologous segments. The major mRNA that encodes the bovine β 2 subunit is 1.7 kilobases in length. It is expressed at lower levels than β 1 subunit mRNA in all tissues examined. The β 1 and β 2 messages are expressed in cloned human cell lines. Hybridization of cDNA probes to bovine DNA showed that β 1 and β 2 are encoded by separate genes. The amino acid sequences for the bovine and human β 2 subunit are identical, as are the amino acid sequences for the bovine and human β 1 subunit. This evolutionary conservation suggests that the two β subunits have different roles in the signal transduction process

  11. Molecular characterization of a new efficiently transducing bacteriophage identified in meticillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Varga, Marian; Pantůček, Roman; Růžičková, Vladislava; Doškař, Jirˇí

    2016-01-01

    In Staphylococcus aureus, generalized transduction mediated by temperate bacteriophages represents a highly efficient way of transferring antibiotic resistance genes between strains. In the present study, we identified and characterized in detail a new efficiently transducing bacteriophage of the family Siphoviridae, designated ϕJB, which resides as a prophage in the meticillin-resistant S. aureus (MRSA) strain Jevons B. Whole-genome sequencing followed by detailed in silico analysis uncovered a linear dsDNA genome consisting of 43 ,12 bp and comprising 70 ORFs, of which ∼40 encoded proteins with unknown function. A global genome alignment of ϕJB and other efficiently transducing phages ϕ11, ϕ53, ϕ80, ϕ80α and ϕNM4 showed a high degree of homology with ϕNM4 and substantial differences with regard to other phages. Using a model transduction system with a well-defined donor and recipient, ϕJB transferred the tetracycline resistance plasmid pT181 and a penicillinase plasmid with outstanding frequencies, beating most of the above-mentioned phages by an order of magnitude. Moreover, ϕJB demonstrated high frequencies of transferring antibiotic resistance plasmids even upon induction from a lysogenic donor strain. Considering such transducing potential, ϕJB and related bacteriophages may serve as a suitable tool for elucidating the nature of transduction and its contribution to the spread of antibiotic resistance genes in naturally occurring MRSA populations.

  12. Identifying the pattern of molecular evolution for Zaire ebolavirus in the 2014 outbreak in West Africa.

    Science.gov (United States)

    Liu, Si-Qing; Deng, Cheng-Lin; Yuan, Zhi-Ming; Rayner, Simon; Zhang, Bo

    2015-06-01

    The current Ebola virus disease (EVD) epidemic has killed more than all previous Ebola outbreaks combined and, even as efforts appear to be bringing the outbreak under control, the threat of reemergence remains. The availability of new whole-genome sequences from West Africa in 2014 outbreak, together with those from the earlier outbreaks, provide an opportunity to investigate the genetic characteristics, the epidemiological dynamics and the evolutionary history for Zaire ebolavirus (ZEBOV). To investigate the evolutionary properties of ZEBOV in this outbreak, we examined amino acid mutations, positive selection, and evolutionary rates on the basis of 123 ZEBOV genome sequences. The estimated phylogenetic relationships within ZEBOV revealed that viral sequences from the same period or location formed a distinct cluster. The West Africa viruses probably derived from Middle Africa, consistent with results from previous studies. Analysis of the seven protein regions of ZEBOV revealed evidence of positive selection acting on the GP and L genes. Interestingly, all putatively positive-selected sites identified in the GP are located within the mucin-like domain of the solved structure of the protein, suggesting a possible role in the immune evasion properties of ZEBOV. Compared with earlier outbreaks, the evolutionary rate of GP gene was estimated to significantly accelerate in the 2014 outbreak, suggesting that more ZEBOV variants are generated for human to human transmission during this sweeping epidemic. However, a more balanced sample set and next generation sequencing datasets would help achieve a clearer understanding at the genetic level of how the virus is evolving and adapting to new conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. A concerted kinase interplay identifies PPARgamma as a molecular target of ghrelin signaling in macrophages.

    Directory of Open Access Journals (Sweden)

    Annie Demers

    2009-11-01

    Full Text Available The peroxisome proliferator-activator receptor PPARgamma plays an essential role in vascular biology, modulating macrophage function and atherosclerosis progression. Recently, we have described the beneficial effect of combined activation of the ghrelin/GHS-R1a receptor and the scavenger receptor CD36 to induce macrophage cholesterol release through transcriptional activation of PPARgamma. Although the interplay between CD36 and PPARgamma in atherogenesis is well recognized, the contribution of the ghrelin receptor to regulate PPARgamma remains unknown. Here, we demonstrate that ghrelin triggers PPARgamma activation through a concerted signaling cascade involving Erk1/2 and Akt kinases, resulting in enhanced expression of downstream effectors LXRalpha and ABC sterol transporters in human macrophages. These effects were associated with enhanced PPARgamma phosphorylation independently of the inhibitory conserved serine-84. Src tyrosine kinase Fyn was identified as being recruited to GHS-R1a in response to ghrelin, but failure of activated Fyn to enhance PPARgamma Ser-84 specific phosphorylation relied on the concomitant recruitment of docking protein Dok-1, which prevented optimal activation of the Erk1/2 pathway. Also, substitution of Ser-84 preserved the ghrelin-induced PPARgamma activity and responsiveness to Src inhibition, supporting a mechanism independent of Ser-84 in PPARgamma response to ghrelin. Consistent with this, we found that ghrelin promoted the PI3-K/Akt pathway in a Galphaq-dependent manner, resulting in Akt recruitment to PPARgamma, enhanced PPARgamma phosphorylation and activation independently of Ser-84, and increased expression of LXRalpha and ABCA1/G1. Collectively, these results illustrate a complex interplay involving Fyn/Dok-1/Erk and Galphaq/PI3-K/Akt pathways to transduce in a concerted manner responsiveness of PPARgamma to ghrelin in macrophages.

  14. Molecular analysis of expansion, differentiation, and growth factor treatment of human chondrocytes identifies differentiation markers and growth-related genes.

    Science.gov (United States)

    Benz, Karin; Breit, Stephen; Lukoschek, Martin; Mau, Hans; Richter, Wiltrud

    2002-04-26

    This study is intended to optimise expansion and differentiation of cultured human chondrocytes by growth factor application and to identify molecular markers to monitor their differentiation state. We dissected the molecular consequences of matrix release, monolayer, and 3D-alginate culture, growth factor optimised expansion, and re-differentiation protocols by gene expression analysis. Among 19 common cartilage molecules assessed by cDNA array, six proved best to monitor differentiation. Instant down-regulation at release of cells from the matrix was strongest for COL 2A1, fibromodulin, and PRELP while LUM, CHI3L1, and CHI3L2 were expansion-related. Both gene sets reflected the physiologic effects of the most potent growth-inducing (PDGF-BB) and proteoglycan-inducing (BMP-4) factors. Only CRTAC1 expression correlated with 2D/3D switches while the molecular phenotype of native chondrocytes was not restored. The markers and optimised protocols we suggest can help to improve cell therapy of cartilage defects and chondrocyte differentiation from stem cell sources.

  15. A comprehensive molecular study on Coffin-Siris and Nicolaides-Baraitser syndromes identifies a broad molecular and clinical spectrum converging on altered chromatin remodeling.

    Science.gov (United States)

    Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Steiner-Haldenstätt, Sabine; Pohl, Esther; Li, Yun; Milz, Esther; Martin, Marcel; Thiele, Holger; Altmüller, Janine; Alanay, Yasemin; Kayserili, Hülya; Klein-Hitpass, Ludger; Böhringer, Stefan; Wollstein, Andreas; Albrecht, Beate; Boduroglu, Koray; Caliebe, Almuth; Chrzanowska, Krystyna; Cogulu, Ozgur; Cristofoli, Francesca; Czeschik, Johanna Christina; Devriendt, Koenraad; Dotti, Maria Teresa; Elcioglu, Nursel; Gener, Blanca; Goecke, Timm O; Krajewska-Walasek, Malgorzata; Guillén-Navarro, Encarnación; Hayek, Joussef; Houge, Gunnar; Kilic, Esra; Simsek-Kiper, Pelin Özlem; López-González, Vanesa; Kuechler, Alma; Lyonnet, Stanislas; Mari, Francesca; Marozza, Annabella; Mathieu Dramard, Michèle; Mikat, Barbara; Morin, Gilles; Morice-Picard, Fanny; Ozkinay, Ferda; Rauch, Anita; Renieri, Alessandra; Tinschert, Sigrid; Utine, G Eda; Vilain, Catheline; Vivarelli, Rossella; Zweier, Christiane; Nürnberg, Peter; Rahmann, Sven; Vermeesch, Joris; Lüdecke, Hermann-Josef; Zeschnigk, Michael; Wollnik, Bernd

    2013-12-20

    Chromatin remodeling complexes are known to modify chemical marks on histones or to induce conformational changes in the chromatin in order to regulate transcription. De novo dominant mutations in different members of the SWI/SNF chromatin remodeling complex have recently been described in individuals with Coffin-Siris (CSS) and Nicolaides-Baraitser (NCBRS) syndromes. Using a combination of whole-exome sequencing, NGS-based sequencing of 23 SWI/SNF complex genes, and molecular karyotyping in 46 previously undescribed individuals with CSS and NCBRS, we identified a de novo 1-bp deletion (c.677delG, p.Gly226Glufs*53) and a de novo missense mutation (c.914G>T, p.Cys305Phe) in PHF6 in two individuals diagnosed with CSS. PHF6 interacts with the nucleosome remodeling and deacetylation (NuRD) complex implicating dysfunction of a second chromatin remodeling complex in the pathogenesis of CSS-like phenotypes. Altogether, we identified mutations in 60% of the studied individuals (28/46), located in the genes ARID1A, ARID1B, SMARCB1, SMARCE1, SMARCA2, and PHF6. We show that mutations in ARID1B are the main cause of CSS, accounting for 76% of identified mutations. ARID1B and SMARCB1 mutations were also found in individuals with the initial diagnosis of NCBRS. These individuals apparently belong to a small subset who display an intermediate CSS/NCBRS phenotype. Our proposed genotype-phenotype correlations are important for molecular screening strategies.

  16. MelanomaDB: a Web Tool for Integrative Analysis of Melanoma Genomic Information to Identify Disease-Associated Molecular Pathways

    Directory of Open Access Journals (Sweden)

    Alexander Joseph Trevarton

    2013-07-01

    Full Text Available Despite on-going research, metastatic melanoma survival rates remain low and treatment options are limited. Researchers can now access a rapidly growing amount of molecular and clinical information about melanoma. This information is becoming difficult to assemble and interpret due to its dispersed nature, yet as it grows it becomes increasingly valuable for understanding melanoma. Integration of this information into a comprehensive resource to aid rational experimental design and patient stratification is needed. As an initial step in this direction, we have assembled a web-accessible melanoma database, MelanomaDB, which incorporates clinical and molecular data from publically available sources, which will be regularly updated as new information becomes available. This database allows complex links to be drawn between many different aspects of melanoma biology: genetic changes (e.g. mutations in individual melanomas revealed by DNA sequencing, associations between gene expression and patient survival, data concerning drug targets, biomarkers, druggability and clinical trials, as well as our own statistical analysis of relationships between molecular pathways and clinical parameters that have been produced using these data sets. The database is freely available at http://genesetdb.auckland.ac.nz/melanomadb/about.html . A subset of the information in the database can also be accessed through a freely available web application in the Illumina genomic cloud computing platform BaseSpace at http://www.biomatters.com/apps/melanoma-profiler-for-research . This illustrates dysregulation of specific signalling pathways, both across 310 exome-sequenced melanomas and in individual tumours and identifies novel features about the distribution of somatic variants in melanoma. We suggest that this database can provide a context in which to interpret the tumour molecular profiles of individual melanoma patients relative to biological information and available

  17. Antibiotic discovery throughout the Small World Initiative: A molecular strategy to identify biosynthetic gene clusters involved in antagonistic activity.

    Science.gov (United States)

    Davis, Elizabeth; Sloan, Tyler; Aurelius, Krista; Barbour, Angela; Bodey, Elijah; Clark, Brigette; Dennis, Celeste; Drown, Rachel; Fleming, Megan; Humbert, Allison; Glasgo, Elizabeth; Kerns, Trent; Lingro, Kelly; McMillin, MacKenzie; Meyer, Aaron; Pope, Breanna; Stalevicz, April; Steffen, Brittney; Steindl, Austin; Williams, Carolyn; Wimberley, Carmen; Zenas, Robert; Butela, Kristen; Wildschutte, Hans

    2017-06-01

    The emergence of bacterial pathogens resistant to all known antibiotics is a global health crisis. Adding to this problem is that major pharmaceutical companies have shifted away from antibiotic discovery due to low profitability. As a result, the pipeline of new antibiotics is essentially dry and many bacteria now resist the effects of most commonly used drugs. To address this global health concern, citizen science through the Small World Initiative (SWI) was formed in 2012. As part of SWI, students isolate bacteria from their local environments, characterize the strains, and assay for antibiotic production. During the 2015 fall semester at Bowling Green State University, students isolated 77 soil-derived bacteria and genetically characterized strains using the 16S rRNA gene, identified strains exhibiting antagonistic activity, and performed an expanded SWI workflow using transposon mutagenesis to identify a biosynthetic gene cluster involved in toxigenic compound production. We identified one mutant with loss of antagonistic activity and through subsequent whole-genome sequencing and linker-mediated PCR identified a 24.9 kb biosynthetic gene locus likely involved in inhibitory activity in that mutant. Further assessment against human pathogens demonstrated the inhibition of Bacillus cereus, Listeria monocytogenes, and methicillin-resistant Staphylococcus aureus in the presence of this compound, thus supporting our molecular strategy as an effective research pipeline for SWI antibiotic discovery and genetic characterization. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  18. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  19. Global transcriptomic profiling of aspen trees under elevated [CO2] to identify potential molecular mechanisms responsible for enhanced radial growth.

    Science.gov (United States)

    Wei, Hairong; Gou, Jiqing; Yordanov, Yordan; Zhang, Huaxin; Thakur, Ramesh; Jones, Wendy; Burton, Andrew

    2013-03-01

    Aspen (Populus tremuloides) trees growing under elevated [CO(2)] at a free-air CO(2) enrichment (FACE) site produced significantly more biomass than control trees. We investigated the molecular mechanisms underlying the observed increase in biomass by producing transcriptomic profiles of the vascular cambium zone (VCZ) and leaves, and then performed a comparative study to identify significantly changed genes and pathways after 12 years exposure to elevated [CO(2)]. In leaves, elevated [CO(2)] enhanced expression of genes related to Calvin cycle activity and linked pathways. In the VCZ, the pathways involved in cell growth, cell division, hormone metabolism, and secondary cell wall formation were altered while auxin conjugation, ABA synthesis, and cytokinin glucosylation and degradation were inhibited. Similarly, the genes involved in hemicellulose and pectin biosynthesis were enhanced, but some genes that catalyze important steps in lignin biosynthesis pathway were inhibited. Evidence from systemic analysis supported the functioning of multiple molecular mechanisms that underpin the enhanced radial growth in response to elevated [CO(2)].

  20. Distinct Molecular Signature of Murine Fetal Liver and Adult Hematopoietic Stem Cells Identify Novel Regulators of Hematopoietic Stem Cell Function.

    Science.gov (United States)

    Manesia, Javed K; Franch, Monica; Tabas-Madrid, Daniel; Nogales-Cadenas, Ruben; Vanwelden, Thomas; Van Den Bosch, Elisa; Xu, Zhuofei; Pascual-Montano, Alberto; Khurana, Satish; Verfaillie, Catherine M

    2017-04-15

    During ontogeny, fetal liver (FL) acts as a major site for hematopoietic stem cell (HSC) maturation and expansion, whereas HSCs in the adult bone marrow (ABM) are largely quiescent. HSCs in the FL possess faster repopulation capacity as compared with ABM HSCs. However, the molecular mechanism regulating the greater self-renewal potential of FL HSCs has not yet extensively been assessed. Recently, we published RNA sequencing-based gene expression analysis on FL HSCs from 14.5-day mouse embryo (E14.5) in comparison to the ABM HSCs. We reanalyzed these data to identify key transcriptional regulators that play important roles in the expansion of HSCs during development. The comparison of FL E14.5 with ABM HSCs identified more than 1,400 differentially expressed genes. More than 200 genes were shortlisted based on the gene ontology (GO) annotation term "transcription." By morpholino-based knockdown studies in zebrafish, we assessed the function of 18 of these regulators, previously not associated with HSC proliferation. Our studies identified a previously unknown role for tdg, uhrf1, uchl5, and ncoa1 in the emergence of definitive hematopoiesis in zebrafish. In conclusion, we demonstrate that identification of genes involved in transcriptional regulation differentially expressed between expanding FL HSCs and quiescent ABM HSCs, uncovers novel regulators of HSC function.

  1. Mechanisms to medicines: elucidating neural and molecular substrates of fear extinction to identify novel treatments for anxiety disorders

    Science.gov (United States)

    Bukalo, Olena; Pinard, Courtney R; Holmes, Andrew

    2014-01-01

    The burden of anxiety disorders is growing, but the efficacy of available anxiolytic treatments remains inadequate. Cognitive behavioural therapy for anxiety disorders focuses on identifying and modifying maladaptive patterns of thinking and behaving, and has a testable analogue in rodents in the form of fear extinction. A large preclinical literature has amassed in recent years describing the neural and molecular basis of fear extinction in rodents. In this review, we discuss how this work is being harnessed to foster translational research on anxiety disorders and facilitate the search for new anxiolytic treatments. We begin by summarizing the anatomical and functional connectivity of a medial prefrontal cortex (mPFC)–amygdala circuit that subserves fear extinction, including new insights from optogenetics. We then cover some of the approaches that have been taken to model impaired fear extinction and associated impairments with mPFC–amygdala dysfunction. The principal goal of the review is to evaluate evidence that various neurotransmitter and neuromodulator systems mediate fear extinction by modulating the mPFC–amygdala circuitry. To that end, we describe studies that have tested how fear extinction is impaired or facilitated by pharmacological manipulations of dopamine, noradrenaline, 5-HT, GABA, glutamate, neuropeptides, endocannabinoids and various other systems, which either directly target the mPFC–amygdala circuit, or produce behavioural effects that are coincident with functional changes in the circuit. We conclude that there are good grounds to be optimistic that the progress in defining the molecular substrates of mPFC–amygdala circuit function can be effectively leveraged to identify plausible candidates for extinction-promoting therapies for anxiety disorders. Linked Articles This article is part of a themed section on Animal Models in Psychiatry Research. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2014

  2. Mechanisms to medicines: elucidating neural and molecular substrates of fear extinction to identify novel treatments for anxiety disorders.

    Science.gov (United States)

    Bukalo, Olena; Pinard, Courtney R; Holmes, Andrew

    2014-10-01

    The burden of anxiety disorders is growing, but the efficacy of available anxiolytic treatments remains inadequate. Cognitive behavioural therapy for anxiety disorders focuses on identifying and modifying maladaptive patterns of thinking and behaving, and has a testable analogue in rodents in the form of fear extinction. A large preclinical literature has amassed in recent years describing the neural and molecular basis of fear extinction in rodents. In this review, we discuss how this work is being harnessed to foster translational research on anxiety disorders and facilitate the search for new anxiolytic treatments. We begin by summarizing the anatomical and functional connectivity of a medial prefrontal cortex (mPFC)-amygdala circuit that subserves fear extinction, including new insights from optogenetics. We then cover some of the approaches that have been taken to model impaired fear extinction and associated impairments with mPFC-amygdala dysfunction. The principal goal of the review is to evaluate evidence that various neurotransmitter and neuromodulator systems mediate fear extinction by modulating the mPFC-amygdala circuitry. To that end, we describe studies that have tested how fear extinction is impaired or facilitated by pharmacological manipulations of dopamine, noradrenaline, 5-HT, GABA, glutamate, neuropeptides, endocannabinoids and various other systems, which either directly target the mPFC-amygdala circuit, or produce behavioural effects that are coincident with functional changes in the circuit. We conclude that there are good grounds to be optimistic that the progress in defining the molecular substrates of mPFC-amygdala circuit function can be effectively leveraged to identify plausible candidates for extinction-promoting therapies for anxiety disorders. © 2014 The British Pharmacological Society.

  3. Advanced computational biology methods identify molecular switches for malignancy in an EGF mouse model of liver cancer.

    Directory of Open Access Journals (Sweden)

    Philip Stegmaier

    Full Text Available The molecular causes by which the epidermal growth factor receptor tyrosine kinase induces malignant transformation are largely unknown. To better understand EGFs' transforming capacity whole genome scans were applied to a transgenic mouse model of liver cancer and subjected to advanced methods of computational analysis to construct de novo gene regulatory networks based on a combination of sequence analysis and entrained graph-topological algorithms. Here we identified transcription factors, processes, key nodes and molecules to connect as yet unknown interacting partners at the level of protein-DNA interaction. Many of those could be confirmed by electromobility band shift assay at recognition sites of gene specific promoters and by western blotting of nuclear proteins. A novel cellular regulatory circuitry could therefore be proposed that connects cell cycle regulated genes with components of the EGF signaling pathway. Promoter analysis of differentially expressed genes suggested the majority of regulated transcription factors to display specificity to either the pre-tumor or the tumor state. Subsequent search for signal transduction key nodes upstream of the identified transcription factors and their targets suggested the insulin-like growth factor pathway to render the tumor cells independent of EGF receptor activity. Notably, expression of IGF2 in addition to many components of this pathway was highly upregulated in tumors. Together, we propose a switch in autocrine signaling to foster tumor growth that was initially triggered by EGF and demonstrate the knowledge gain form promoter analysis combined with upstream key node identification.

  4. Integrated Bioinformatics, Environmental Epidemiologic and Genomic Approaches to Identify Environmental and Molecular Links between Endometriosis and Breast Cancer

    Directory of Open Access Journals (Sweden)

    Deodutta Roy

    2015-10-01

    Full Text Available We present a combined environmental epidemiologic, genomic, and bioinformatics approach to identify: exposure of environmental chemicals with estrogenic activity; epidemiologic association between endocrine disrupting chemical (EDC and health effects, such as, breast cancer or endometriosis; and gene-EDC interactions and disease associations. Human exposure measurement and modeling confirmed estrogenic activity of three selected class of environmental chemicals, polychlorinated biphenyls (PCBs, bisphenols (BPs, and phthalates. Meta-analysis showed that PCBs exposure, not Bisphenol A (BPA and phthalates, increased the summary odds ratio for breast cancer and endometriosis. Bioinformatics analysis of gene-EDC interactions and disease associations identified several hundred genes that were altered by exposure to PCBs, phthalate or BPA. EDCs-modified genes in breast neoplasms and endometriosis are part of steroid hormone signaling and inflammation pathways. All three EDCs–PCB 153, phthalates, and BPA influenced five common genes—CYP19A1, EGFR, ESR2, FOS, and IGF1—in breast cancer as well as in endometriosis. These genes are environmentally and estrogen responsive, altered in human breast and uterine tumors and endometriosis lesions, and part of Mitogen Activated Protein Kinase (MAPK signaling pathways in cancer. Our findings suggest that breast cancer and endometriosis share some common environmental and molecular risk factors.

  5. Expression Profiling of Differentiating Emerin-Null Myogenic Progenitor Identifies Molecular Pathways Implicated in Their Impaired Differentiation

    Directory of Open Access Journals (Sweden)

    Ashvin Iyer

    2017-10-01

    Full Text Available Mutations in the gene encoding emerin cause Emery-Dreifuss muscular dystrophy (EDMD, a disorder causing progressive skeletal muscle wasting, irregular heart rhythms and contractures of major tendons. RNA sequencing was performed on differentiating wildtype and emerin-null myogenic progenitors to identify molecular pathways implicated in EDMD, 340 genes were uniquely differentially expressed during the transition from day 0 to day 1 in wildtype cells. 1605 genes were uniquely expressed in emerin-null cells; 1706 genes were shared among both wildtype and emerin-null cells. One thousand and forty-seven transcripts showed differential expression during the transition from day 1 to day 2. Four hundred and thirty-one transcripts showed altered expression in both wildtype and emerin-null cells. Two hundred and ninety-five transcripts were differentially expressed only in emerin-null cells and 321 transcripts were differentially expressed only in wildtype cells. DAVID, STRING and Ingenuity Pathway Analysis identified pathways implicated in impaired emerin-null differentiation, including cell signaling, cell cycle checkpoints, integrin signaling, YAP/TAZ signaling, stem cell differentiation, and multiple muscle development and myogenic differentiation pathways. Functional enrichment analysis showed biological functions associated with the growth of muscle tissue and myogenesis of skeletal muscle were inhibited. The large number of differentially expressed transcripts upon differentiation induction suggests emerin functions during transcriptional reprograming of progenitors to committed myoblasts.

  6. Molecular profiling of aged neural progenitors identifies Dbx2 as a candidate regulator of age-associated neurogenic decline.

    Science.gov (United States)

    Lupo, Giuseppe; Nisi, Paola S; Esteve, Pilar; Paul, Yu-Lee; Novo, Clara Lopes; Sidders, Ben; Khan, Muhammad A; Biagioni, Stefano; Liu, Hai-Kun; Bovolenta, Paola; Cacci, Emanuele; Rugg-Gunn, Peter J

    2018-06-01

    Adult neurogenesis declines with aging due to the depletion and functional impairment of neural stem/progenitor cells (NSPCs). An improved understanding of the underlying mechanisms that drive age-associated neurogenic deficiency could lead to the development of strategies to alleviate cognitive impairment and facilitate neuroregeneration. An essential step towards this aim is to investigate the molecular changes that occur in NSPC aging on a genomewide scale. In this study, we compare the transcriptional, histone methylation and DNA methylation signatures of NSPCs derived from the subventricular zone (SVZ) of young adult (3 months old) and aged (18 months old) mice. Surprisingly, the transcriptional and epigenomic profiles of SVZ-derived NSPCs are largely unchanged in aged cells. Despite the global similarities, we detect robust age-dependent changes at several hundred genes and regulatory elements, thereby identifying putative regulators of neurogenic decline. Within this list, the homeobox gene Dbx2 is upregulated in vitro and in vivo, and its promoter region has altered histone and DNA methylation levels, in aged NSPCs. Using functional in vitro assays, we show that elevated Dbx2 expression in young adult NSPCs promotes age-related phenotypes, including the reduced proliferation of NSPC cultures and the altered transcript levels of age-associated regulators of NSPC proliferation and differentiation. Depleting Dbx2 in aged NSPCs caused the reverse gene expression changes. Taken together, these results provide new insights into the molecular programmes that are affected during mouse NSPC aging, and uncover a new functional role for Dbx2 in promoting age-related neurogenic decline. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  7. Omics analysis of human bone to identify genes and molecular networks regulating skeletal remodeling in health and disease.

    Science.gov (United States)

    Reppe, Sjur; Datta, Harish K; Gautvik, Kaare M

    2017-08-01

    The skeleton is a metabolically active organ throughout life where specific bone cell activity and paracrine/endocrine factors regulate its morphogenesis and remodeling. In recent years, an increasing number of reports have used multi-omics technologies to characterize subsets of bone biological molecular networks. The skeleton is affected by primary and secondary disease, lifestyle and many drugs. Therefore, to obtain relevant and reliable data from well characterized patient and control cohorts are vital. Here we provide a brief overview of omics studies performed on human bone, of which our own studies performed on trans-iliacal bone biopsies from postmenopausal women with osteoporosis (OP) and healthy controls are among the first and largest. Most other studies have been performed on smaller groups of patients, undergoing hip replacement for osteoarthritis (OA) or fracture, and without healthy controls. The major findings emerging from the combined studies are: 1. Unstressed and stressed bone show profoundly different gene expression reflecting differences in bone turnover and remodeling and 2. Omics analyses comparing healthy/OP and control/OA cohorts reveal characteristic changes in transcriptomics, epigenomics (DNA methylation), proteomics and metabolomics. These studies, together with genome-wide association studies, in vitro observations and transgenic animal models have identified a number of genes and gene products that act via Wnt and other signaling systems and are highly associated to bone density and fracture. Future challenge is to understand the functional interactions between bone-related molecular networks and their significance in OP and OA pathogenesis, and also how the genomic architecture is affected in health and disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity

    Science.gov (United States)

    Xu, Ning; Cui, Jinrui; Mengesha, Emebet; Chen, Yii-Der I.; Taylor, Kent D.; Azziz, Ricardo; Goodarzi, Mark O.

    2015-01-01

    Genome wide association studies (GWAS) have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS), a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs) therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS. PMID:26305227

  9. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity.

    Directory of Open Access Journals (Sweden)

    Michelle R Jones

    2015-08-01

    Full Text Available Genome wide association studies (GWAS have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS, a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS.

  10. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity.

    Science.gov (United States)

    Jones, Michelle R; Brower, Meredith A; Xu, Ning; Cui, Jinrui; Mengesha, Emebet; Chen, Yii-Der I; Taylor, Kent D; Azziz, Ricardo; Goodarzi, Mark O

    2015-08-01

    Genome wide association studies (GWAS) have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS), a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs) therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS.

  11. Identifying cell and molecular stress after radiation in a three-dimensional (3-D) model of oral mucositis

    International Nuclear Information System (INIS)

    Lambros, Maria Polikandritou; Parsa, Cyrus; Mulamalla, HariChandana; Orlando, Robert; Lau, Bernard; Huang, Ying; Pon, Doreen; Chow, Moses

    2011-01-01

    Research highlights: → We irradiated a 3-D human oral cell culture of keratinocytes and fibroblasts with 12 and 2 Gy. → 6 h after irradiation the histopathology and apoptosis of the 3-D culture were evaluated. Microarrays were used to assess the gene expression in the irradiated 3-D tissue. → 12 Gy induced significant histopathologic changes and cellular apoptosis. → 12 Gy significantly affected genes of the NF-kB pathway, inflammatory cytokines and DAMPs. -- Abstract: Mucositis is a debilitating adverse effect of chemotherapy and radiation treatment. It is important to develop a simple and reliable in vitro model, which can routinely be used to screen new drugs for prevention and treatment of mucositis. Furthermore, identifying cell and molecular stresses especially in the initiation phase of mucositis in this model will help towards this end. We evaluated a three-dimensional (3-D) human oral cell culture that consisted of oral keratinocytes and fibroblasts as a model of oral mucositis. The 3-D cell culture model was irradiated with 12 or 2 Gy. Six hours after the irradiation we evaluated microscopic sections of the cell culture for evidence of morphologic changes including apoptosis. We used microarrays to compare the expression of several genes from the irradiated tissue with identical genes from tissue that was not irradiated. We found that irradiation with 12 Gy induced significant histopathologic effects including cellular apoptosis. Irradiation significantly affected the expression of several genes of the NF-kB pathway and several inflammatory cytokines, such as IL-1B, 1L-8, NF-kB1, and FOS compared to tissue that was not irradiated. We identified significant upregulation of several genes that belong to damage-associated molecular patterns (DAMPs) such as HMB1, S100A13, SA10014, and SA10016 in the 3-D tissues that received 12 Gy but not in tissues that received 2 Gy. In conclusion, this model quantifies radiation damage and this is an important first

  12. Molecular Characterization and Functional Analysis of PR-1-Like Proteins Identified from the Wheat Head Blight Fungus Fusarium graminearum.

    Science.gov (United States)

    Lu, Shunwen; Edwards, Michael C

    2018-04-01

    The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologs are also found in other eukaryotic kingdoms. Studies on nonplant PR-1-like (PR-1L) proteins have been pursued widely in humans and animals but rarely in filamentous ascomycetes. Here, we report the characterization of four PR-1L proteins identified from the ascomycete fungus Fusarium graminearum, the primary cause of Fusarium head blight of wheat and barley (designated FgPR-1L). Molecular cloning revealed that the four FgPR-1L proteins are all encoded by small open reading frames (612 to 909 bp) that are often interrupted by introns, in contrast to plant PR-1 genes that lack introns. Sequence analysis indicated that all FgPR-1L proteins contain the PR-1-specific three-dimensional structure, and one of them features a C-terminal transmembrane (TM) domain that has not been reported for any stand-alone PR-1 proteins. Transcriptional analysis revealed that the four FgPR-1L genes are expressed in axenic cultures and in planta with different spatial or temporal expression patterns. Phylogenetic analysis indicated that fungal PR-1L proteins fall into three major groups, one of which harbors FgPR-1L-2-related TM-containing proteins from both phytopathogenic and human-pathogenic ascomycetes. Low-temperature sodium dodecyl sulfate polyacrylamide gel electrophoresis and proteolytic assays indicated that the recombinant FgPR-1L-4 protein exists as a monomer and is resistant to subtilisin of the serine protease family. Functional analysis confirmed that deletion of the FgPR-1L-4 gene from the fungal genome results in significantly reduced virulence on susceptible wheat. This study provides the first example that the F. graminearum-wheat interaction involves a pathogen-derived PR-1L protein that affects fungal virulence on the host.

  13. An innovative strategy for the molecular diagnosis of Usher syndrome identifies causal biallelic mutations in 93% of European patients.

    Science.gov (United States)

    Bonnet, Crystel; Riahi, Zied; Chantot-Bastaraud, Sandra; Smagghe, Luce; Letexier, Mélanie; Marcaillou, Charles; Lefèvre, Gaëlle M; Hardelin, Jean-Pierre; El-Amraoui, Aziz; Singh-Estivalet, Amrit; Mohand-Saïd, Saddek; Kohl, Susanne; Kurtenbach, Anne; Sliesoraityte, Ieva; Zobor, Ditta; Gherbi, Souad; Testa, Francesco; Simonelli, Francesca; Banfi, Sandro; Fakin, Ana; Glavač, Damjan; Jarc-Vidmar, Martina; Zupan, Andrej; Battelino, Saba; Martorell Sampol, Loreto; Claveria, Maria Antonia; Catala Mora, Jaume; Dad, Shzeena; Møller, Lisbeth B; Rodriguez Jorge, Jesus; Hawlina, Marko; Auricchio, Alberto; Sahel, José-Alain; Marlin, Sandrine; Zrenner, Eberhart; Audo, Isabelle; Petit, Christine

    2016-12-01

    Usher syndrome (USH), the most prevalent cause of hereditary deafness-blindness, is an autosomal recessive and genetically heterogeneous disorder. Three clinical subtypes (USH1-3) are distinguishable based on the severity of the sensorineural hearing impairment, the presence or absence of vestibular dysfunction, and the age of onset of the retinitis pigmentosa. A total of 10 causal genes, 6 for USH1, 3 for USH2, and 1 for USH3, and an USH2 modifier gene, have been identified. A robust molecular diagnosis is required not only to improve genetic counseling, but also to advance gene therapy in USH patients. Here, we present an improved diagnostic strategy that is both cost- and time-effective. It relies on the sequential use of three different techniques to analyze selected genomic regions: targeted exome sequencing, comparative genome hybridization, and quantitative exon amplification. We screened a large cohort of 427 patients (139 USH1, 282 USH2, and six of undefined clinical subtype) from various European medical centers for mutations in all USH genes and the modifier gene. We identified a total of 421 different sequence variants predicted to be pathogenic, about half of which had not been previously reported. Remarkably, we detected large genomic rearrangements, most of which were novel and unique, in 9% of the patients. Thus, our strategy led to the identification of biallelic and monoallelic mutations in 92.7% and 5.8% of the USH patients, respectively. With an overall 98.5% mutation characterization rate, the diagnosis efficiency was substantially improved compared with previously reported methods.

  14. A Network Biology Approach Identifies Molecular Cross-Talk between Normal Prostate Epithelial and Prostate Carcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Victor Trevino

    2016-04-01

    Full Text Available The advent of functional genomics has enabled the genome-wide characterization of the molecular state of cells and tissues, virtually at every level of biological organization. The difficulty in organizing and mining this unprecedented amount of information has stimulated the development of computational methods designed to infer the underlying structure of regulatory networks from observational data. These important developments had a profound impact in biological sciences since they triggered the development of a novel data-driven investigative approach. In cancer research, this strategy has been particularly successful. It has contributed to the identification of novel biomarkers, to a better characterization of disease heterogeneity and to a more in depth understanding of cancer pathophysiology. However, so far these approaches have not explicitly addressed the challenge of identifying networks representing the interaction of different cell types in a complex tissue. Since these interactions represent an essential part of the biology of both diseased and healthy tissues, it is of paramount importance that this challenge is addressed. Here we report the definition of a network reverse engineering strategy designed to infer directional signals linking adjacent cell types within a complex tissue. The application of this inference strategy to prostate cancer genome-wide expression profiling data validated the approach and revealed that normal epithelial cells exert an anti-tumour activity on prostate carcinoma cells. Moreover, by using a Bayesian hierarchical model integrating genetics and gene expression data and combining this with survival analysis, we show that the expression of putative cell communication genes related to focal adhesion and secretion is affected by epistatic gene copy number variation and it is predictive of patient survival. Ultimately, this study represents a generalizable approach to the challenge of deciphering cell

  15. Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity.

    Directory of Open Access Journals (Sweden)

    Guan-Feng Wang

    2015-02-01

    Full Text Available Plant disease resistance is often mediated by nucleotide binding-leucine rich repeat (NLR proteins which remain auto-inhibited until recognition of specific pathogen-derived molecules causes their activation, triggering a rapid, localized cell death called a hypersensitive response (HR. Three domains are recognized in one of the major classes of NLR proteins: a coiled-coil (CC, a nucleotide binding (NB-ARC and a leucine rich repeat (LRR domains. The maize NLR gene Rp1-D21 derives from an intergenic recombination event between two NLR genes, Rp1-D and Rp1-dp2 and confers an autoactive HR. We report systematic structural and functional analyses of Rp1 proteins in maize and N. benthamiana to characterize the molecular mechanism of NLR activation/auto-inhibition. We derive a model comprising the following three main features: Rp1 proteins appear to self-associate to become competent for activity. The CC domain is signaling-competent and is sufficient to induce HR. This can be suppressed by the NB-ARC domain through direct interaction. In autoactive proteins, the interaction of the LRR domain with the NB-ARC domain causes de-repression and thus disrupts the inhibition of HR. Further, we identify specific amino acids and combinations thereof that are important for the auto-inhibition/activity of Rp1 proteins. We also provide evidence for the function of MHD2, a previously uncharacterized, though widely conserved NLR motif. This work reports several novel insights into the precise structural requirement for NLR function and informs efforts towards utilizing these proteins for engineering disease resistance.

  16. A Network Biology Approach Identifies Molecular Cross-Talk between Normal Prostate Epithelial and Prostate Carcinoma Cells.

    Science.gov (United States)

    Trevino, Victor; Cassese, Alberto; Nagy, Zsuzsanna; Zhuang, Xiaodong; Herbert, John; Antczak, Philipp; Clarke, Kim; Davies, Nicholas; Rahman, Ayesha; Campbell, Moray J; Guindani, Michele; Bicknell, Roy; Vannucci, Marina; Falciani, Francesco

    2016-04-01

    The advent of functional genomics has enabled the genome-wide characterization of the molecular state of cells and tissues, virtually at every level of biological organization. The difficulty in organizing and mining this unprecedented amount of information has stimulated the development of computational methods designed to infer the underlying structure of regulatory networks from observational data. These important developments had a profound impact in biological sciences since they triggered the development of a novel data-driven investigative approach. In cancer research, this strategy has been particularly successful. It has contributed to the identification of novel biomarkers, to a better characterization of disease heterogeneity and to a more in depth understanding of cancer pathophysiology. However, so far these approaches have not explicitly addressed the challenge of identifying networks representing the interaction of different cell types in a complex tissue. Since these interactions represent an essential part of the biology of both diseased and healthy tissues, it is of paramount importance that this challenge is addressed. Here we report the definition of a network reverse engineering strategy designed to infer directional signals linking adjacent cell types within a complex tissue. The application of this inference strategy to prostate cancer genome-wide expression profiling data validated the approach and revealed that normal epithelial cells exert an anti-tumour activity on prostate carcinoma cells. Moreover, by using a Bayesian hierarchical model integrating genetics and gene expression data and combining this with survival analysis, we show that the expression of putative cell communication genes related to focal adhesion and secretion is affected by epistatic gene copy number variation and it is predictive of patient survival. Ultimately, this study represents a generalizable approach to the challenge of deciphering cell communication networks

  17. Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity.

    Science.gov (United States)

    Wang, Guan-Feng; Ji, Jiabing; El-Kasmi, Farid; Dangl, Jeffery L; Johal, Guri; Balint-Kurti, Peter J

    2015-02-01

    Plant disease resistance is often mediated by nucleotide binding-leucine rich repeat (NLR) proteins which remain auto-inhibited until recognition of specific pathogen-derived molecules causes their activation, triggering a rapid, localized cell death called a hypersensitive response (HR). Three domains are recognized in one of the major classes of NLR proteins: a coiled-coil (CC), a nucleotide binding (NB-ARC) and a leucine rich repeat (LRR) domains. The maize NLR gene Rp1-D21 derives from an intergenic recombination event between two NLR genes, Rp1-D and Rp1-dp2 and confers an autoactive HR. We report systematic structural and functional analyses of Rp1 proteins in maize and N. benthamiana to characterize the molecular mechanism of NLR activation/auto-inhibition. We derive a model comprising the following three main features: Rp1 proteins appear to self-associate to become competent for activity. The CC domain is signaling-competent and is sufficient to induce HR. This can be suppressed by the NB-ARC domain through direct interaction. In autoactive proteins, the interaction of the LRR domain with the NB-ARC domain causes de-repression and thus disrupts the inhibition of HR. Further, we identify specific amino acids and combinations thereof that are important for the auto-inhibition/activity of Rp1 proteins. We also provide evidence for the function of MHD2, a previously uncharacterized, though widely conserved NLR motif. This work reports several novel insights into the precise structural requirement for NLR function and informs efforts towards utilizing these proteins for engineering disease resistance.

  18. A molecular key for building hyphae aggregates: the role of the newly identified Streptomyces protein HyaS.

    Science.gov (United States)

    Koebsch, Ilona; Overbeck, Jens; Piepmeyer, Sophie; Meschke, Holger; Schrempf, Hildgund

    2009-05-01

    Streptomycetes produce many metabolites with medical and biotechnological applications. During fermentations, their hyphae build aggregates, a process in which the newly identified protein HyaS plays an important role. The corresponding hyaS gene is present within all investigated Streptomyces species. Reporter fusions indicate that transcription of hyaS occurs within substrate hyphae of the Streptomyces lividans wild type (WT). The HyaS protein is dominantly associated with the substrate hyphae. The WT strain forms cylindrically shaped clumps of densely packed substrate hyphae, often fusing to higher aggregates (pellets), which remain stably associated during shaking. Investigations by electron microscopy suggest that HyaS induces tight fusion-like contacts among substrate hyphae. In contrast, the pellets of the designed hyaS disruption mutant ΔH are irregular in shape, contain frequently outgrowing bunches of hyphae, and fuse less frequently. ΔH complemented with a plasmid carrying hyaS resembles the WT phenotype. Biochemical studies indicate that the C-terminal region of HyaS has amine oxidase activity. Investigations of ΔH transformants, each carrying a specifically mutated gene, lead to the conclusion that the in situ oxidase activity correlates with the pellet-inducing role of HyaS, and depends on the presence of certain histidine residues. Furthermore, the level of undecylprodigiosin, a red pigment with antibiotic activity, is influenced by the engineered hyaS subtype within a strain. These data present the first molecular basis for future manipulation of pellets, and concomitant production of secondary metabolites during biotechnological processes. © 2009 The Authors. Journal compilation © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.

  19. The molecular signature of impaired diabetic wound healing identifies serpinB3 as a healing biomarker.

    Science.gov (United States)

    Fadini, Gian Paolo; Albiero, Mattia; Millioni, Renato; Poncina, Nicol; Rigato, Mauro; Scotton, Rachele; Boscari, Federico; Brocco, Enrico; Arrigoni, Giorgio; Villano, Gianmarco; Turato, Cristian; Biasiolo, Alessandra; Pontisso, Patrizia; Avogaro, Angelo

    2014-09-01

    Chronic foot ulceration is a severe complication of diabetes, driving morbidity and mortality. The mechanisms underlying delaying wound healing in diabetes are incompletely understood and tools to identify such pathways are eagerly awaited. Wound biopsies were obtained from 75 patients with diabetic foot ulcers. Matched subgroups of rapidly healing (RH, n = 17) and non-healing (NH, n = 11) patients were selected. Proteomic analysis was performed by labelling with isobaric tag for relative and absolute quantification and mass spectrometry. Differentially expressed proteins were analysed in NH vs RH for identification of pathogenic pathways. Individual sample gene/protein validation and in vivo validation of candidate pathways in mouse models were carried out. Pathway analyses were conducted on 92/286 proteins that were differentially expressed in NH vs RH. The following pathways were enriched in NH vs RH patients: apoptosis, protease inhibitors, epithelial differentiation, serine endopeptidase activity, coagulation and regulation of defence response. SerpinB3 was strongly upregulated in RH vs NH wounds, validated as protein and mRNA in individual samples. To test the relevance of serpinB3 in vivo, we used a transgenic mouse model with α1-antitrypsin promoter-driven overexpression of human SERPINB3. In this model, wound healing was unaffected by SERPINB3 overexpression in non-diabetic or diabetic mice with or without hindlimb ischaemia. In an independent validation cohort of 47 patients, high serpinB3 protein content was confirmed as a biomarker of healing improvement. We provide a benchmark for the unbiased discovery of novel molecular targets and biomarkers of impaired diabetic wound healing. High serpinB3 protein content was found to be a biomarker of successful healing in diabetic patients.

  20. Integrative genome-wide expression profiling identifies three distinct molecular subgroups of renal cell carcinoma with different patient outcome

    Directory of Open Access Journals (Sweden)

    Beleut Manfred

    2012-07-01

    Full Text Available Abstract Background Renal cell carcinoma (RCC is characterized by a number of diverse molecular aberrations that differ among individuals. Recent approaches to molecularly classify RCC were based on clinical, pathological as well as on single molecular parameters. As a consequence, gene expression patterns reflecting the sum of genetic aberrations in individual tumors may not have been recognized. In an attempt to uncover such molecular features in RCC, we used a novel, unbiased and integrative approach. Methods We integrated gene expression data from 97 primary RCC of different pathologic parameters, 15 RCC metastases as well as 34 cancer cell lines for two-way nonsupervised hierarchical clustering using gene groups suggested by the PANTHER Classification System. We depicted the genomic landscape of the resulted tumor groups by means of Single Nuclear Polymorphism (SNP technology. Finally, the achieved results were immunohistochemically analyzed using a tissue microarray (TMA composed of 254 RCC. Results We found robust, genome wide expression signatures, which split RCC into three distinct molecular subgroups. These groups remained stable even if randomly selected gene sets were clustered. Notably, the pattern obtained from RCC cell lines was clearly distinguishable from that of primary tumors. SNP array analysis demonstrated differing frequencies of chromosomal copy number alterations among RCC subgroups. TMA analysis with group-specific markers showed a prognostic significance of the different groups. Conclusion We propose the existence of characteristic and histologically independent genome-wide expression outputs in RCC with potential biological and clinical relevance.

  1. Molecular grading of tumors of the upper urothelial tract using FGFR3 mutation status identifies patients with favorable prognosis

    OpenAIRE

    Fernandez, Cecilia; Lyle,Stephen; Hsieh,; Shuber,Anthony

    2012-01-01

    Stephen R Lyle,1 Chung-Cheng Hsieh,1 Cecilia A Fernandez,2 Anthony P Shuber21University of Massachusetts, Worcester, MA, 2Predictive Biosciences Inc., Lexington, MA, USABackground: Mutations in FGFR3 have been shown to occur in tumors of the upper urothelial tract and may be indicative of a good prognosis. In bladder tumors, the combination of FGFR3 mutation status and Ki-67 level has been used to define a tumor's molecular grade and predict survival. Pathological evaluation of upper ...

  2. Molecular fingerprinting of the myxozoan community in common carp suffering Swim Bladder Inflammation (SBI) identifies multiple etiological agents

    Czech Academy of Sciences Publication Activity Database

    Holzer, Astrid S.; Hartigan, Ashlie; Patra, Sneha; Pecková, Hana; Eszterbauer, E.

    2014-01-01

    Roč. 7, AUG 28 2014 (2014), s. 398 ISSN 1756-3305 R&D Projects: GA AV ČR(CZ) M200961205; GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : Cyprinus carpio carpio * swim bladder inflammation * fish disease * Myxozoa * molecular diagnostic * rDNA * in situ hybridisation Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.430, year: 2014

  3. A Phylogenomic Census of Molecular Functions Identifies Modern Thermophilic Archaea as the Most Ancient Form of Cellular Life

    Directory of Open Access Journals (Sweden)

    Arshan Nasir

    2014-01-01

    Full Text Available The origins of diversified life remain mysterious despite considerable efforts devoted to untangling the roots of the universal tree of life. Here we reconstructed phylogenies that described the evolution of molecular functions and the evolution of species directly from a genomic census of gene ontology (GO definitions. We sampled 249 free-living genomes spanning organisms in the three superkingdoms of life, Archaea, Bacteria, and Eukarya, and used the abundance of GO terms as molecular characters to produce rooted phylogenetic trees. Results revealed an early thermophilic origin of Archaea that was followed by genome reduction events in microbial superkingdoms. Eukaryal genomes displayed extraordinary functional diversity and were enriched with hundreds of novel molecular activities not detected in the akaryotic microbial cells. Remarkably, the majority of these novel functions appeared quite late in evolution, synchronized with the diversification of the eukaryal superkingdom. The distribution of GO terms in superkingdoms confirms that Archaea appears to be the simplest and most ancient form of cellular life, while Eukarya is the most diverse and recent.

  4. A phylogenomic census of molecular functions identifies modern thermophilic archaea as the most ancient form of cellular life.

    Science.gov (United States)

    Nasir, Arshan; Kim, Kyung Mo; Caetano-Anollés, Gustavo

    2014-01-01

    The origins of diversified life remain mysterious despite considerable efforts devoted to untangling the roots of the universal tree of life. Here we reconstructed phylogenies that described the evolution of molecular functions and the evolution of species directly from a genomic census of gene ontology (GO) definitions. We sampled 249 free-living genomes spanning organisms in the three superkingdoms of life, Archaea, Bacteria, and Eukarya, and used the abundance of GO terms as molecular characters to produce rooted phylogenetic trees. Results revealed an early thermophilic origin of Archaea that was followed by genome reduction events in microbial superkingdoms. Eukaryal genomes displayed extraordinary functional diversity and were enriched with hundreds of novel molecular activities not detected in the akaryotic microbial cells. Remarkably, the majority of these novel functions appeared quite late in evolution, synchronized with the diversification of the eukaryal superkingdom. The distribution of GO terms in superkingdoms confirms that Archaea appears to be the simplest and most ancient form of cellular life, while Eukarya is the most diverse and recent.

  5. Evaluation of serological and molecular tests used to identify Toxoplasma gondii infection in pregnant women attended in a public health service in São Paulo state, Brazil.

    Science.gov (United States)

    Murata, Fernando Henrique Antunes; Ferreira, Marina Neves; Pereira-Chioccola, Vera Lucia; Spegiorin, Lígia Cosentino Junqueira Franco; Meira-Strejevitch, Cristina da Silva; Gava, Ricardo; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

    2017-09-01

    Toxoplasmosis during pregnancy can have severe consequences. The use of sensitive and specific serological and molecular methods is extremely important for the correct diagnosis of the disease. We compared the ELISA and ELFA serological methods, conventional PCR (cPCR), Nested PCR and quantitative PCR (qPCR) in the diagnosis of Toxoplasma gondii infection in pregnant women without clinical suspicion of toxoplasmosis (G1=94) and with clinical suspicion of toxoplasmosis (G2=53). The results were compared using the Kappa index, and the sensitivity, specificity, positive predictive value and negative predictive value were calculated. The results of the serological methods showed concordance between the ELISA and ELFA methods even though ELFA identified more positive cases than ELISA. Molecular methods were discrepant with cPCR using B22/23 primers having greater sensitivity and lower specificity compared to the other molecular methods. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Integrative Bioinformatic Analysis of Transcriptomic Data Identifies Conserved Molecular Pathways Underlying Ionizing Radiation-Induced Bystander Effects (RIBE

    Directory of Open Access Journals (Sweden)

    Constantinos Yeles

    2017-11-01

    Full Text Available Ionizing radiation-induced bystander effects (RIBE encompass a number of effects with potential for a plethora of damages in adjacent non-irradiated tissue. The cascade of molecular events is initiated in response to the exposure to ionizing radiation (IR, something that may occur during diagnostic or therapeutic medical applications. In order to better investigate these complex response mechanisms, we employed a unified framework integrating statistical microarray analysis, signal normalization, and translational bioinformatics functional analysis techniques. This approach was applied to several microarray datasets from Gene Expression Omnibus (GEO related to RIBE. The analysis produced lists of differentially expressed genes, contrasting bystander and irradiated samples versus sham-irradiated controls. Furthermore, comparative molecular analysis through BioInfoMiner, which integrates advanced statistical enrichment and prioritization methodologies, revealed discrete biological processes, at the cellular level. For example, the negative regulation of growth, cellular response to Zn2+-Cd2+, and Wnt and NIK/NF-kappaB signaling, thus refining the description of the phenotypic landscape of RIBE. Our results provide a more solid understanding of RIBE cell-specific response patterns, especially in the case of high-LET radiations, like α-particles and carbon-ions.

  7. Subtype-Specific Genes that Characterize Subpopulations of Callosal Projection Neurons in Mouse Identify Molecularly Homologous Populations in Macaque Cortex.

    Science.gov (United States)

    Fame, Ryann M; Dehay, Colette; Kennedy, Henry; Macklis, Jeffrey D

    2017-03-01

    Callosal projection neurons (CPN) interconnect the neocortical hemispheres via the corpus callosum and are implicated in associative integration of multimodal information. CPN have undergone differential evolutionary elaboration, leading to increased diversity of cortical neurons-and more extensive and varied connections in neocortical gray and white matter-in primates compared with rodents. In mouse, distinct sets of genes are enriched in discrete subpopulations of CPN, indicating the molecular diversity of rodent CPN. Elements of rodent CPN functional and organizational diversity might thus be present in the further elaborated primate cortex. We address the hypothesis that genes controlling mouse CPN subtype diversity might reflect molecular patterns shared among mammals that arose prior to the divergence of rodents and primates. We find that, while early expression of the examined CPN-enriched genes, and postmigratory expression of these CPN-enriched genes in deep layers are highly conserved (e.g., Ptn, Nnmt, Cited2, Dkk3), in contrast, the examined genes expressed by superficial layer CPN show more variable levels of conservation (e.g., EphA3, Chn2). These results suggest that there has been evolutionarily differential retraction and elaboration of superficial layer CPN subpopulations between mouse and macaque, with independent derivation of novel populations in primates. Together, these data inform future studies regarding CPN subpopulations that are unique to primates and rodents, and indicate putative evolutionary relationships. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Atom Tunneling in the Hydroxylation Process of Taurine/α-Ketoglutarate Dioxygenase Identified by Quantum Mechanics/Molecular Mechanics Simulations.

    Science.gov (United States)

    Álvarez-Barcia, Sonia; Kästner, Johannes

    2017-06-01

    Taurine/α-ketoglutarate dioxygenase is one of the most studied α-ketoglutarate-dependent dioxygenases (αKGDs), involved in several biotechnological applications. We investigated the key step in the catalytic cycle of the αKGDs, the hydrogen transfer process, by a quantum mechanics/molecular mechanics approach (B3LYP/CHARMM22). Analysis of the charge and spin densities during the reaction demonstrates that a concerted mechanism takes place, where the H atom transfer happens simultaneously with the electron transfer from taurine to the Fe═O cofactor. We found the quantum tunneling of the hydrogen atom to increase the rate constant by a factor of 40 at 5 °C. As a consequence, a quite high kinetic isotope effect close to 60 is obtained, which is consistent with the experimental value.

  9. Potential bacterial core species associated with digital dermatitis in cattle herds identified by molecular profiling of interdigital skin samples

    DEFF Research Database (Denmark)

    Weiss Nielsen, Martin; Strube, Mikael Lenz; Isbrand, Anastasia

    2016-01-01

    of different molecular methods. Deep sequencing of the 16S rRNA gene variable regions V1–V2 showed that Treponema, Mycoplasma, Fusobacterium and Porphyromonas were the genera best differentiating the DD samples from the controls. Additional deep sequencing analysis of the most abundant genus, Treponema...... in the epidermal lesions and were present in only a subset of samples. RT-qPCR analysis showed that treponemes were also actively expressing a panel of virulence factors at the site of infection. Our results further support the hypothesis that species belonging to the genus Treponema are major pathogens of DD...... and also provide sufficient clues to motivate additional research into the role of M. fermentans, F. necrophorum and P. levii in the etiology of DD....

  10. Molecular characterization and functional analysis of PR-1-like proteins identified from the wheat head blight fungus Fusarium graminearum

    Science.gov (United States)

    The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologues are also found in other eukaryotic kingdoms. Studies on non-plant PR-1-like (PR-1L) proteins have been pursued widely in humans/animals but rarely in filamentous ascomycetes. Here we report the ch...

  11. sxtA-Based Quantitative Molecular Assay To Identify Saxitoxin-Producing Harmful Algal Blooms in Marine Waters ▿ †

    Science.gov (United States)

    Murray, Shauna A.; Wiese, Maria; Stüken, Anke; Brett, Steve; Kellmann, Ralf; Hallegraeff, Gustaaf; Neilan, Brett A.

    2011-01-01

    The recent identification of genes involved in the production of the potent neurotoxin and keystone metabolite saxitoxin (STX) in marine eukaryotic phytoplankton has allowed us for the first time to develop molecular genetic methods to investigate the chemical ecology of harmful algal blooms in situ. We present a novel method for detecting and quantifying the potential for STX production in marine environmental samples. Our assay detects a domain of the gene sxtA that encodes a unique enzyme putatively involved in the sxt pathway in marine dinoflagellates, sxtA4. A product of the correct size was recovered from nine strains of four species of STX-producing Alexandrium and Gymnodinium catenatum and was not detected in the non-STX-producing Alexandrium species, other dinoflagellate cultures, or an environmental sample that did not contain known STX-producing species. However, sxtA4 was also detected in the non-STX-producing strain of Alexandrium tamarense, Tasmanian ribotype. We investigated the copy number of sxtA4 in three strains of Alexandrium catenella and found it to be relatively constant among strains. Using our novel method, we detected and quantified sxtA4 in three environmental blooms of Alexandrium catenella that led to STX uptake in oysters. We conclude that this method shows promise as an accurate, fast, and cost-effective means of quantifying the potential for STX production in marine samples and will be useful for biological oceanographic research and harmful algal bloom monitoring. PMID:21841034

  12. sxtA-based quantitative molecular assay to identify saxitoxin-producing harmful algal blooms in marine waters.

    Science.gov (United States)

    Murray, Shauna A; Wiese, Maria; Stüken, Anke; Brett, Steve; Kellmann, Ralf; Hallegraeff, Gustaaf; Neilan, Brett A

    2011-10-01

    The recent identification of genes involved in the production of the potent neurotoxin and keystone metabolite saxitoxin (STX) in marine eukaryotic phytoplankton has allowed us for the first time to develop molecular genetic methods to investigate the chemical ecology of harmful algal blooms in situ. We present a novel method for detecting and quantifying the potential for STX production in marine environmental samples. Our assay detects a domain of the gene sxtA that encodes a unique enzyme putatively involved in the sxt pathway in marine dinoflagellates, sxtA4. A product of the correct size was recovered from nine strains of four species of STX-producing Alexandrium and Gymnodinium catenatum and was not detected in the non-STX-producing Alexandrium species, other dinoflagellate cultures, or an environmental sample that did not contain known STX-producing species. However, sxtA4 was also detected in the non-STX-producing strain of Alexandrium tamarense, Tasmanian ribotype. We investigated the copy number of sxtA4 in three strains of Alexandrium catenella and found it to be relatively constant among strains. Using our novel method, we detected and quantified sxtA4 in three environmental blooms of Alexandrium catenella that led to STX uptake in oysters. We conclude that this method shows promise as an accurate, fast, and cost-effective means of quantifying the potential for STX production in marine samples and will be useful for biological oceanographic research and harmful algal bloom monitoring.

  13. Molecular analysis of faecal samples from birds to identify potential crop pests and useful biocontrol agents in natural areas.

    Science.gov (United States)

    King, R A; Symondson, W O C; Thomas, R J

    2015-06-01

    Wild habitats adjoining farmland are potentially valuable sources of natural enemies, but also of pests. Here we tested the utility of birds as 'sampling devices', to identify the diversity of prey available to predators and particularly to screen for pests and natural enemies using natural ecosystems as refugia. Here we used PCR to amplify prey DNA from three sympatric songbirds foraging on small invertebrates in Phragmites reedbed ecosystems, namely the Reed Warbler (Acrocephalus scirpaceus), Sedge Warbler (Acrocephalus schoenobaenus) and Cetti's Warbler (Cettia cetti). A recently described general invertebrate primer pair was used for the first time to analyse diets. Amplicons were cloned and sequenced, then identified by reference to the Barcoding of Life Database and to our own sequences obtained from fresh invertebrates. Forty-five distinct prey DNA sequences were obtained from 11 faecal samples, of which 39 could be identified to species or genus. Targeting three warbler species ensured that species-specific differences in prey choice broadened the range of prey taken. Amongst the prey found in reedbeds were major pests (including the tomato moth Lacanobia oleracea) as well as many potentially valuable natural enemies including aphidophagous hoverflies and braconid wasps. Given the mobility of birds, this approach provides a practical way of sampling a whole habitat at once, providing growers with information on possible invasion by locally resident pests and the colonization potential of natural enemies from local natural habitats.

  14. Molecular typing and characterization of a new serotype of human enterovirus (EV-B111) identified in China.

    Science.gov (United States)

    Zhang, Yong; Hong, Mei; Sun, Qiang; Zhu, Shuangli; Tsewang; Li, Xiaolei; Yan, Dongmei; Wang, Dongyan; Xu, Wenbo

    2014-04-01

    Molecular methods, based on sequencing the region encoding the complete VP1 or P1 protein, have enabled the rapid identification of new enterovirus serotypes. In the present study, the complete genome of a newly discovered enterovirus serotype, strain Q0011/XZ/CHN/2000 (hereafter referred to as Q0011), was sequenced and analyzed. The virus, isolated from a stool sample from a patient with acute flaccid paralysis in the Tibet region of China in 2000, was characterized by amplicon sequencing and comparison to a GenBank database of enterovirus nucleotide sequences. The nucleotide sequence encoding the complete VP1 capsid protein is most closely related to the sequences of viruses within the species enterovirus B (EV-B), but is less than 72.1% identical to the homologous sequences of the recognized human enterovirus serotypes, with the greatest homology to EV-B101 and echovirus 32. Moreover, the deduced amino acid sequence of the complete VP1 region is less than 84.7% identical to those of the recognized serotypes, suggesting that the strain is a new serotype of enterovirus within EV-B. The virus was characterized as a new enterovirus type, named EV-B111, by the Picornaviridae Study Group of the International Committee on Taxonomy of Viruses. Low positive rate and titer of neutralizing antibody against EV-B111 were found in the Tibet region of China. Nearly 50% of children ≤5 years had no neutralizing antibody against EV-B111. So the extent of transmission and the exposure of the population to this new EV are very limited. This is the first identification of a new serotype of human enterovirus in China, and strain Q0011 was designated the prototype strain of EV-B111. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Genetic relationships in an international collection of Puccinia horiana isolates based on newly identified molecular markers and demonstration of recombination.

    Science.gov (United States)

    De Backer, M; Bonants, P; Pedley, K F; Maes, M; Roldan-Ruiz, I; Van Bockstaele, E; Heungens, K; van der Lee, T

    2013-11-01

    The obligate biotrophic pathogen Puccinia horiana is the causal agent of chrysanthemum white rust. Although P. horiana is a quarantine organism, it has been able to spread to most chrysanthemum-producing regions in the world since the 1960s; however, the transfer routes are largely obscure. An extremely low level of allelic diversity was observed in a geographically diverse set of eight isolates using complexity reduction of polymorphic sequences (CRoPS) technology. Only 184 of the 16,196 contigs (1.1%) showed one or more single-nucleotide polymorphisms (SNPs). Thirty-two SNPs and one simple-sequence repeat were translated into molecular markers and used to genotype 45 isolates originating from North and South America, Asia, and Europe. In most cases, phylogenetic clustering was related to geographic origin, indicating local establishment. The European isolates mostly grouped in two major populations that may relate to the two historic introductions previously reported. However, evidence of recent geographic transfer was also observed, including transfer events between Europe and South America and between Southeast Asia and Europe. In contrast with the presumed clonal propagation of this microcyclic rust, strong indications of marker recombination were observed, presumably as a result of anastomosis, karyogamy, and somatic meiosis. Recombination and transfer also explain the geographic dispersal of specific markers. A near-to-significant correlation between the genotypic data and previously obtained pathotype data was observed and one marker was associated with the most virulent pathotype group. In combination with a fast SNP detection method, the markers presented here will be helpful tools to further elucidate the transfer pathways and local survival of this pathogen.

  16. Development of a new marker system for identifying the complex members of the low-molecular-weight glutenin subunit gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Zhang, Xiaofei; Liu, Dongcheng; Yang, Wenlong; Liu, Kunfan; Sun, Jiazhu; Guo, Xiaoli; Li, Yiwen; Wang, Daowen; Ling, Hongqing; Zhang, Aimin

    2011-05-01

    Low-molecular-weight glutenin subunits (LMW-GSs) play an important role in determining the bread-making quality of bread wheat. However, LMW-GSs display high polymorphic protein complexes encoded by multiple genes, and elucidating the complex LMW-GS gene family in bread wheat remains challenging. In the present study, using conventional polymerase chain reaction (PCR) with conserved primers and high-resolution capillary electrophoresis, we developed a new molecular marker system for identifying LMW-GS gene family members. Based on sequence alignment of 13 LMW-GS genes previously identified in the Chinese bread wheat variety Xiaoyan 54 and other genes available in GenBank, PCR primers were developed and assigned to conserved sequences spanning the length polymorphism regions of LMW-GS genes. After PCR amplification, 17 DNA fragments in Xiaoyan 54 were detected using capillary electrophoresis. In total, 13 fragments were identical to previously identified LMW-GS genes, and the other 4 were derived from unique LMW-GS genes by sequencing. This marker system was also used to identify LMW-GS genes in Chinese Spring and its group 1 nulli-tetrasomic lines. Among the 17 detected DNA fragments, 4 were located on chromosome 1A, 5 on 1B, and 8 on 1D. The results suggest that this marker system is useful for large-scale identification of LMW-GS genes in bread wheat varieties, and for the selection of desirable LMW-GS genes to improve the bread-making quality in wheat molecular breeding programmes.

  17. Molecular profiling of short-term and long-term surviving patients identifies CD34 mRNA level as prognostic for glioblastoma survival

    DEFF Research Database (Denmark)

    Michaelsen, Signe Regner; Urup, Thomas; Olsen, Lars Rønn

    2018-01-01

    Despite extensive treatment, overall survival (OS) for glioblastoma (GBM) remains poor. A small proportion of patients present long survival over 3 years, but the underlying molecular background separating these long-term survivors (LTS) from short-term survivors (STS) are insufficiently understood....... Accordingly, study aim was to identify independent prognostic biomarkers for survival. Study cohort consisted of 93 primary GBM patients treated with radiation-, chemo- and bevacizumab therapy, among which 14 STS (OS ≤ 12 months) and 6 LTS (OS ≥ 36 months) were identified, all confirmed being IDH wild......-type. RNA expression levels in diagnostic tumor specimen for 792 genes were analyzed by NanoString technology. While no differences were found with regard to GBM subtype between LTS versus STS, comparative analysis of individual genes identified 14 significantly differently expressed candidate genes...

  18. Biochemical and molecular characteristics of patients with organic acidaemias and urea cycle disorders identified through newborn screening.

    Science.gov (United States)

    Barends, M; Pitt, J; Morrissy, S; Tzanakos, N; Boneh, A

    2014-01-01

    In recent years it has become clear that newborn screening (NBS) programmes using tandem mass spectrometry identify "patients" with "classical" inborn errors of metabolism who are asymptomatic. This observation raises issues regarding medicalization of "non-diseases," potentially unnecessary treatment and unnecessary anxiety to parents. This study aims to identify possible markers that may assist in predicting the need for treatment of infants with "classical" organic acidaemias (OA) and urea cycle disorders (UCD) diagnosed through NBS. Medical records of all patients with classical OA and UCD detected through the Victorian NBS programme from February 2002 to January 2014, or diagnosed clinically between 1990 and January 2002 were retrospectively reviewed. Neonatal presentation did not always predict the need for on-going strict treatment. Blood concentrations of amino acids and acyl-carnitines and the changes thereof in follow-up samples correlated with severity in citrullinaemia-I, possibly isovaleric acidaemia but not in argininosuccinic aciduria or propionic acidaemia. Some specific mutations correlate with "attenuated" citrullinaemia-I. Gender may affect clinical outcome in propionic acidaemia. Changes in blood concentration of certain metabolites (amino acids, acyl-carnitines) in the first weeks of life may be predictive of the need for treatment in some disorders but not in others. Mutation analysis may be predictive in some disorders but whether or not this should be considered as second-tier testing in NBS should be discussed separately. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  20. Molecular characterization of an unauthorized genetically modified Bacillus subtilis production strain identified in a vitamin B2 feed additive.

    Science.gov (United States)

    Paracchini, Valentina; Petrillo, Mauro; Reiting, Ralf; Angers-Loustau, Alexandre; Wahler, Daniela; Stolz, Andrea; Schönig, Birgit; Matthies, Anastasia; Bendiek, Joachim; Meinel, Dominik M; Pecoraro, Sven; Busch, Ulrich; Patak, Alex; Kreysa, Joachim; Grohmann, Lutz

    2017-09-01

    Many food and feed additives result from fermentation of genetically modified (GM) microorganisms. For vitamin B2 (riboflavin), GM Bacillus subtilis production strains have been developed and are often used. The presence of neither the GM strain nor its recombinant DNA is allowed for fermentation products placed on the EU market as food or feed additive. A vitamin B 2 product (80% feed grade) imported from China was analysed. Viable B. subtilis cells were identified and DNAs of two bacterial isolates (LHL and LGL) were subjected to three whole genome sequencing (WGS) runs with different devices (MiSeq, 454 or HiSeq system). WGS data revealed the integration of a chloramphenicol resistance gene, the deletion of the endogenous riboflavin (rib) operon and presence of four putative plasmids harbouring rib operons. Event- and construct-specific real-time PCR methods for detection of the GM strain and its putative plasmids in food and feed products have been developed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, Rikke L. V.; Oettinger, Thomas; Rosenkrands, Ida

    2000-01-01

    . The molecules were characterized, mapped in a two-dimensional electrophoresis reference map of short-term culture filtrate, and compared with another recently identified low-mass protein, CFP10 (F. X. Berthet, P, B. Rasmussen, I. Rosenkrands, P. Andersen, and B. Gicquel. Microbiology 144:3195-3203, 1998......), and the well-described ESAT-6 antigen. Genetic analyses demonstrated that TB10.4 as well as CFP10 belongs to the ESAT-6 family of low-mass proteins, whereas TB7.3 is a low-molecular-mass protein outside this family. The proteins were expressed in Escherichia coli, and their immunogenicity was tested...

  2. Diet of pumas (Puma concolor) in Sonora, Mexico, as determined by GPS kill sites and molecular identified scat, with comments on jaguar (Panthera onca) diet

    Science.gov (United States)

    Cassaigne, Ivonne; Medellin, Rodrigo A.; Thompson, Ron W.; Culver, Melanie; Ochoa, Alexander; Vargas, Karla; Childs, Jack L.; Sanderson, Jim; List, Rurik; Torres-Gomez, Armando

    2016-01-01

    We documented puma (Puma concolor) and jaguar (Panthera onca) prey consumption in northeastern Sonora, Mexico, by investigating global positioning system cluster sites (n = 220), and conducting molecular analyses of scat (n = 116) collected between 2011 and 2013. We used camera trap data (n = 8,976 camera days) to estimate relative abundances of pumas and jaguars. Deer (Odocoileus virginianus) was the most frequent prey for puma found at kill sites (67%) and identified from scat (74%), although based on relative numbers of prey consumed, deer represented 45% and lagomorphs 20% of the proportion of all individuals eaten. A variety of small prey (weighing Sonora.

  3. Virtual screening approach to identifying influenza virus neuraminidase inhibitors using molecular docking combined with machine-learning-based scoring function.

    Science.gov (United States)

    Zhang, Li; Ai, Hai-Xin; Li, Shi-Meng; Qi, Meng-Yuan; Zhao, Jian; Zhao, Qi; Liu, Hong-Sheng

    2017-10-10

    In recent years, an epidemic of the highly pathogenic avian influenza H7N9 virus has persisted in China, with a high mortality rate. To develop novel anti-influenza therapies, we have constructed a machine-learning-based scoring function (RF-NA-Score) for the effective virtual screening of lead compounds targeting the viral neuraminidase (NA) protein. RF-NA-Score is more accurate than RF-Score, with a root-mean-square error of 1.46, Pearson's correlation coefficient of 0.707, and Spearman's rank correlation coefficient of 0.707 in a 5-fold cross-validation study. The performance of RF-NA-Score in a docking-based virtual screening of NA inhibitors was evaluated with a dataset containing 281 NA inhibitors and 322 noninhibitors. Compared with other docking-rescoring virtual screening strategies, rescoring with RF-NA-Score significantly improved the efficiency of virtual screening, and a strategy that averaged the scores given by RF-NA-Score, based on the binding conformations predicted with AutoDock, AutoDock Vina, and LeDock, was shown to be the best strategy. This strategy was then applied to the virtual screening of NA inhibitors in the SPECS database. The 100 selected compounds were tested in an in vitro H7N9 NA inhibition assay, and two compounds with novel scaffolds showed moderate inhibitory activities. These results indicate that RF-NA-Score improves the efficiency of virtual screening for NA inhibitors, and can be used successfully to identify new NA inhibitor scaffolds. Scoring functions specific for other drug targets could also be established with the same method.

  4. T cell differentiation stages identified by molecular and immunologic analysis of the T cell receptor complex in childhood lymphoblastic leukemia.

    Science.gov (United States)

    Mirro, J; Kitchingman, G; Behm, F G; Murphy, S B; Goorha, R M

    1987-03-01

    T cell differentiation was investigated by determining the relationship of T cell receptor (Ti) gene rearrangement and transcription to the expression of surface and cytoplasmic T3 antigen using blast cells from five children with acute lymphoblastic leukemia of thymic origin. Patterns of monoclonal antibody (MoAb) reactivity indicated that these cases were representative of the three recognized stages (I, II, III) of human thymocyte development. The T3 antigen, which becomes linked to the Ti to form a functional T cell receptor complex on mature thymocytes, was expressed on the cell surface in two cases (stage III). However, in the remaining three cases that were surface T3 negative (stages I and II), large amounts of T3 were identified in the cytoplasm by immunoperoxidase staining and flow cytometry. Leukemic blasts from all five patients showed rearranged genes encoding the beta-chain portion of the Ti heterodimer. RNA transcripts of Ti beta-chain genes were also evident in lymphoblasts from all five cases, but transcripts coding for the alpha-chain portion of Ti were found only in cases that expressed T3 on the cell surface. Thus the absence of surface T3 (and presumably Ti) coincides with the absence of Ti alpha-chain RNA, suggesting that transcription of alpha-chain genes is a critical regulatory event in the surface expression of the Ti-T3 complex. Leukemic T cells that rearrange and express Ti beta-chain genes but lack Ti alpha-chain messenger RNA (mRNA) may represent a stage of differentiation analogous to pre-B cells, where heavy-chain immunoglobulin (Ig) genes are rearranged and expressed but light-chain Ig genes are not expressed.

  5. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, R L; Oettinger, T; Rosenkrands, I

    2000-01-01

    Culture filtrate from Mycobacterium tuberculosis contains protective antigens of relevance for the generation of a new antituberculosis vaccine. We have identified two previously uncharacterized M. tuberculosis proteins (TB7.3 and TB10.4) from the highly active low-mass fraction of culture filtrate....... The molecules were characterized, mapped in a two-dimensional electrophoresis reference map of short-term culture filtrate, and compared with another recently identified low-mass protein, CFP10 (F. X. Berthet, P. B. Rasmussen, I. Rosenkrands, P. Andersen, and B. Gicquel. Microbiology 144:3195-3203, 1998......), and the well-described ESAT-6 antigen. Genetic analyses demonstrated that TB10.4 as well as CFP10 belongs to the ESAT-6 family of low-mass proteins, whereas TB7.3 is a low-molecular-mass protein outside this family. The proteins were expressed in Escherichia coli, and their immunogenicity was tested...

  6. Transcriptomic profiling of diverse Aedes aegypti strains reveals increased basal-level immune activation in dengue virus-refractory populations and identifies novel virus-vector molecular interactions.

    Directory of Open Access Journals (Sweden)

    Shuzhen Sim

    Full Text Available Genetic variation among Aedes aegypti populations can greatly influence their vector competence for human pathogens such as the dengue virus (DENV. While intra-species transcriptome differences remain relatively unstudied when compared to coding sequence polymorphisms, they also affect numerous aspects of mosquito biology. Comparative molecular profiling of mosquito strain transcriptomes can therefore provide valuable insight into the regulation of vector competence. We established a panel of A. aegypti strains with varying levels of susceptibility to DENV, comprising both laboratory-maintained strains and field-derived colonies collected from geographically distinct dengue-endemic regions spanning South America, the Caribbean, and Southeast Asia. A comparative genome-wide gene expression microarray-based analysis revealed higher basal levels of numerous immunity-related gene transcripts in DENV-refractory mosquito strains than in susceptible strains, and RNA interference assays further showed different degrees of immune pathway contribution to refractoriness in different strains. By correlating transcript abundance patterns with DENV susceptibility across our panel, we also identified new candidate modulators of DENV infection in the mosquito, and we provide functional evidence for two potential DENV host factors and one potential restriction factor. Our comparative transcriptome dataset thus not only provides valuable information about immune gene regulation and usage in natural refractoriness of mosquito populations to dengue virus but also allows us to identify new molecular interactions between the virus and its mosquito vector.

  7. Genomic, Epigenomic, and Transcriptomic Profiling towards Identifying Omics Features and Specific Biomarkers That Distinguish Uterine Leiomyosarcoma and Leiomyoma at Molecular Levels

    Directory of Open Access Journals (Sweden)

    Tomoko Miyata

    2015-01-01

    Full Text Available Uterine leiomyosarcoma (LMS is the worst malignancy among the gynecologic cancers. Uterine leiomyoma (LM, a benign tumor of myometrial origin, is the most common among women of childbearing age. Because of their similar symptoms, it is difficult to preoperatively distinguish the two conditions only by ultrasound and pelvic MRI. While histopathological diagnosis is currently the main approach used to distinguish them postoperatively, unusual histologic variants of LM tend to be misdiagnosed as LMS. Therefore, development of molecular diagnosis as an alternative or confirmatory means will help to diagnose LMS more accurately. We adopted omics-based technologies to identify genome-wide features to distinguish LMS from LM and revealed that copy number, gene expression, and DNA methylation profiles successfully distinguished these tumors. LMS was found to possess features typically observed in malignant solid tumors, such as extensive chromosomal abnormalities, overexpression of cell cycle-related genes, hypomethylation spreading through large genomic regions, and frequent hypermethylation at the polycomb group target genes and protocadherin genes. We also identified candidate expression and DNA methylation markers, which will facilitate establishing postoperative molecular diagnostic tests based on conventional quantitative assays. Our results demonstrate the feasibility of establishing such tests and the possibility of developing preoperative and noninvasive methods.

  8. Informing Antibiotic Treatment Decisions: Evaluating Rapid Molecular Diagnostics To Identify Susceptibility and Resistance to Carbapenems against Acinetobacter spp. in PRIMERS III.

    Science.gov (United States)

    Evans, Scott R; Hujer, Andrea M; Jiang, Hongyu; Hill, Carol B; Hujer, Kristine M; Mediavilla, Jose R; Manca, Claudia; Tran, Thuy Tien T; Domitrovic, T Nicholas; Higgins, Paul G; Seifert, Harald; Kreiswirth, Barry N; Patel, Robin; Jacobs, Michael R; Chen, Liang; Sampath, Rangarajan; Hall, Thomas; Marzan, Christine; Fowler, Vance G; Chambers, Henry F; Bonomo, Robert A

    2017-01-01

    The widespread dissemination of carbapenem-resistant Acinetobacter spp. has created significant therapeutic challenges. At present, rapid molecular diagnostics (RMDs) that can identify this phenotype are not commercially available. Two RMD platforms, PCR combined with electrospray ionization mass spectrometry (PCR/ESI-MS) and molecular beacons (MB), for detecting genes conferring resistance/susceptibility to carbapenems in Acinetobacter spp. were evaluated. An archived collection of 200 clinical Acinetobacter sp. isolates was tested. Predictive values for susceptibility and resistance were estimated as a function of susceptibility prevalence and were based on the absence or presence of beta-lactamase (bla) NDM, VIM, IMP, KPC, and OXA carbapenemase genes (e.g., bla OXA-23 , bla OXA-24/40 , and bla OXA-58 found in this study) against the reference standard of MIC determinations. According to the interpretation of MICs, 49% (n = 98) of the isolates were carbapenem resistant (as defined by either resistance or intermediate resistance to imipenem). The susceptibility sensitivities (95% confidence interval [CI]) for imipenem were 82% (74%, 89%) and 92% (85%, 97%) for PCR/ESI-MS and MB, respectively. Resistance sensitivities (95% CI) for imipenem were 95% (88%, 98%) and 88% (80%, 94%) for PCR/ESI-MS and MB, respectively. PRIMERS III establishes that RMDs can discriminate between carbapenem resistance and susceptibility in Acinetobacter spp. In the context of a known prevalence of resistance, SPVs and RPVs can inform clinicians regarding the best choice for empiric antimicrobial therapy against this multidrug-resistant pathogen. Copyright © 2016 American Society for Microbiology.

  9. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  10. Therapeutic molecules for multiple human diseases identified from pigeon pea (Cajanus cajan L. Millsp. through GC–MS and molecular docking

    Directory of Open Access Journals (Sweden)

    Deepu Mathew

    2017-12-01

    Full Text Available Molecular mechanism behind the therapeutic potential of pigeon pea over the human diseases such as rheumatoid arthritis, breast cancer, type II diabetes, malaria, measles and sickle cell disease were revealed through docking of GC–MS identified phyto-compound ligands with candidate disease proteins. Of the 242 ligands, three dimensional structures of 47 compounds had to be drawn using ChemSketch and the remaining structures were retrieved from PubChem and docked with the active sites of candidate proteins. The molecules identified through docking were further subjected to ADMET analysis and promising drug candidates were identified for each disease. This paper presents a precise account of the chemoprofile of pigeon pea leaves, stems and seeds, interaction of these molecules with target proteins and suggests 26 highly potential molecules which are drug candidates for multiple human diseases. Pigeon pea seeds are especially proven as invaluable source for therapeutic molecules. Keywords: Breast cancer, Drug discovery, Herbal medicine, In silico, Malaria, Measles, Phyto-compounds, Rheumatoid arthritis, Sickle cell disease, Type II diabetes

  11. Targeting N-Glycan Cryptic Sugar Moieties for Broad-Spectrum Virus Neutralization: Progress in Identifying Conserved Molecular Targets in Viruses of Distinct Phylogenetic Origins

    Directory of Open Access Journals (Sweden)

    Denong Wang

    2015-03-01

    Full Text Available Identifying molecular targets for eliciting broadly virus-neutralizing antibodies is one of the key steps toward development of vaccines against emerging viral pathogens. Owing to genomic and somatic diversities among viral species, identifying protein targets for broad-spectrum virus neutralization is highly challenging even for the same virus, such as HIV-1. However, viruses rely on host glycosylation machineries to synthesize and express glycans and, thereby, may display common carbohydrate moieties. Thus, exploring glycan-binding profiles of broad-spectrum virus-neutralizing agents may provide key information to uncover the carbohydrate-based virus-neutralizing epitopes. In this study, we characterized two broadly HIV-neutralizing agents, human monoclonal antibody 2G12 and Galanthus nivalis lectin (GNA, for their viral targeting activities. Although these agents were known to be specific for oligomannosyl antigens, they differ strikingly in virus-binding activities. The former is HIV-1 specific; the latter is broadly reactive and is able to neutralize viruses of distinct phylogenetic origins, such as HIV-1, severe acute respiratory syndrome coronavirus (SARS-CoV, and human cytomegalovirus (HCMV. In carbohydrate microarray analyses, we explored the molecular basis underlying the striking differences in the spectrum of anti-virus activities of the two probes. Unlike 2G12, which is strictly specific for the high-density Man9GlcNAc2Asn (Man9-clusters, GNA recognizes a number of N-glycan cryptic sugar moieties. These include not only the known oligomannosyl antigens but also previously unrecognized tri-antennary or multi-valent GlcNAc-terminating N-glycan epitopes (Tri/m-Gn. These findings highlight the potential of N-glycan cryptic sugar moieties as conserved targets for broad-spectrum virus neutralization and suggest the GNA-model of glycan-binding warrants focused investigation.

  12. Molecular forensics in avian conservation: a DNA-based approach for identifying mammalian predators of ground-nesting birds and eggs.

    Science.gov (United States)

    Hopken, Matthew W; Orning, Elizabeth K; Young, Julie K; Piaggio, Antoinette J

    2016-01-07

    The greater sage-grouse (Centrocercus urophasianus) is a ground-nesting bird from the Northern Rocky Mountains and a species at risk of extinction in in multiple U.S. states and Canada. Herein we report results from a proof of concept that mitochondrial and nuclear DNAs from mammalian predator saliva could be non-invasively collected from depredated greater sage-grouse eggshells and carcasses and used for predator species identification. Molecular forensic approaches have been applied to identify predators from depredated remains as one strategy to better understand predator-prey dynamics and guide management strategies. This can aid conservation efforts by correctly identifying predators most likely to impact threatened and endangered species. DNA isolated from non-invasive samples around nesting sites (e.g. fecal or hair samples) is one method that can increase the success and accuracy of predator species identification when compared to relying on nest remains alone. Predator saliva DNA was collected from depredated eggshells and carcasses using swabs. We sequenced two partial fragments of two mitochondrial genes and obtained microsatellite genotypes using canid specific primers for species and individual identification, respectively. Using this multilocus approach we were able to identify predators, at least down to family, from 11 out of 14 nests (79%) and three out of seven carcasses (47%). Predators detected most frequently were canids (86%), while other taxa included rodents, a striped skunk, and cattle. We attempted to match the genotypes of individual coyotes obtained from eggshells and carcasses with those obtained from fecal samples and coyotes collected in the areas, but no genotype matches were found. Predation is a main cause of nest failure in ground-nesting birds and can impact reproduction and recruitment. To inform predator management for ground-nesting bird conservation, accurate identification of predator species is necessary. Considering

  13. Array-based molecular karyotyping in 115 VATER/VACTERL and VATER/VACTERL-like patients identifies disease-causing copy number variations.

    Science.gov (United States)

    Zhang, Rong; Marsch, Florian; Kause, Franziska; Degenhardt, Franziska; Schmiedeke, Eeberhard; Märzheuser, Stefanie; Hoppe, Bernd; Bachour, Haitham; Boemers, Thomas M; Schäfer, Matthias; Spychalski, Nicole; Neser, Jörg; Leonhardt, Johannes; Kosch, Ferdinand; Ure, Benno; Gómez, Barbara; Lacher, Martin; Deffaa, Oliver J; Palta, Markus; Wittekindt, Boris; Kleine, Katharina; Schmedding, Andrea; Grasshoff-Derr, Sabine; Ven, Amelie van der; Heilmann-Heimbach, Stefanie; Zwink, Nadine; Jenetzky, Ekkehart; Ludwig, Michael; Reutter, Heiko

    2017-07-17

    The acronym VATER/VACTERL refers to the rare nonrandom association of the following component features (CF): vertebral defects (V), anorectal malformations (A), cardiac defects (C), tracheoesophageal fistula with or without esophageal atresia, renal malformations (R), and limb defects (L). Patients presenting with at least three CFs are diagnosed as having VATER/VACTERL association while patients presenting with only two CFs are diagnosed as having VATER/VACTERL-like phenotypes. Recently, rare causative copy number variations (CNVs) have been identified in patients with VATER/VACTERL association and VATER/VACTERL-like phenotypes. To detect further causative CNVs we performed array based molecular karyotyping in 75 VATER/VACTERL and 40 VATER/VACTERL-like patients. Following the application of stringent filter criteria, we identified 13 microdeletions and seven microduplications in 20 unrelated patients all of which were absent in 1,307 healthy inhouse controls (n microdeletion at 17q12 was confirmed to be de novo. Three microdeletions at 5q23.1, 16q23.3, 22q11.21, and one microduplication at 10q11.21 were all absent in the available parent. Microdeletion of chromosomal region 22q11.21 was previously found in VATER/VACTERL patients rendering it to be causative in our patient. The remaining 15 CNVs were inherited from a healthy parent. In two of 115 patients' causative CNVs were found (2%). The remaining identified rare CNVs represent candidates for further evaluation. Rare inherited CNVs may constitute modifiers of, or contributors to, multifactorial VATER/VACTERL or VATER/VACTERL-like phenotypes. Birth Defects Research 109:1063-1069, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  14. Basal gene expression by lung CD4+ T cells in chronic obstructive pulmonary disease identifies independent molecular correlates of airflow obstruction and emphysema extent.

    Directory of Open Access Journals (Sweden)

    Christine M Freeman

    Full Text Available Lung CD4+ T cells accumulate as chronic obstructive pulmonary disease (COPD progresses, but their role in pathogenesis remains controversial. To address this controversy, we studied lung tissue from 53 subjects undergoing clinically-indicated resections, lung volume reduction, or transplant. Viable single-cell suspensions were analyzed by flow cytometry or underwent CD4+ T cell isolation, followed either by stimulation with anti-CD3 and cytokine/chemokine measurement, or by real-time PCR analysis. In lung CD4+ T cells of most COPD subjects, relative to lung CD4+ T cells in smokers with normal spirometry: (a stimulation induced minimal IFN-γ or other inflammatory mediators, but many subjects produced more CCL2; (b the T effector memory subset was less uniformly predominant, without correlation with decreased IFN-γ production. Analysis of unstimulated lung CD4+ T cells of all subjects identified a molecular phenotype, mainly in COPD, characterized by markedly reduced mRNA transcripts for the transcription factors controlling TH1, TH2, TH17 and FOXP3+ T regulatory subsets and their signature cytokines. This mRNA-defined CD4+ T cell phenotype did not result from global inability to elaborate mRNA; increased transcripts for inhibitory CD28 family members or markers of anergy; or reduced telomerase length. As a group, these subjects had significantly worse spirometry, but not DLCO, relative to subjects whose lung CD4+ T cells expressed a variety of transcripts. Analysis of mRNA transcripts of unstimulated lung CD4+ T cell among all subjects identified two distinct molecular correlates of classical COPD clinical phenotypes: basal IL-10 transcripts correlated independently and inversely with emphysema extent (but not spirometry; by contrast, unstimulated IFN-γ transcripts correlated independently and inversely with reduced spirometry (but not reduced DLCO or emphysema extent. Aberrant lung CD4+ T cells polarization appears to be common in advanced

  15. Molecular and Conventional Analysis of Acute Diarrheal Isolates Identifies Epidemiological Trends, Antibiotic Resistance and Virulence Profiles of Common Enteropathogens in Shanghai

    Directory of Open Access Journals (Sweden)

    Feng Yang

    2018-02-01

    Full Text Available Objective: To investigate prevalence of acute diarrhea in Shanghai and analyze virulence associated-genes and antibiotic resistance of major enteropathogens using combination of conventional and molecular epidemiology methods.Method: The 412 stool specimens were obtained by systematic sampling from diarrhea patients throughout entire year 2016. Bacterial and viral pathogens were identified and bacterial isolates were cultured and screened for antibiotic resistance profiles. Two most prevalent bacteria, Vibrio parahaemolyticus and Salmonella were further typed by multi-locus sequence typing (MLST and analyzed for presence of virulence-associated genes. The association between virulence genes, resistance phenotypes and genetic diversities was analyzed.Results: Among stool specimens testing positive for pathogens (23.1%, 59 bacterial and 36 viral pathogens were identified. V. parahaemolyticus (27/412, 6.6%, Salmonella (23/412, 5.6% and norovirus GII (21/412, 5.1% were three most-commonly found. Most bacterial isolates exhibited high levels of antibiotic resistance with high percentage of MDR. The drug resistance rates of V. parahaemolyticus and Salmonella isolates to cephalosporins were high, such as 100.0 and 34.8% to CFX, 55.6 and 43.4% to CTX, 92.6 and 95.7% to CXM, respectively. The most common resistance combination of V. parahaemolyticus and Salmonella was cephalosporins and quinolone. The dominant sequence types (STs of V. parahaemolyticus and Salmonella were ST3 (70.4% and ST11 (43.5%, respectively. The detection rates of virulence genes in V. parahaemolyticus were tlh (100% and tdh (92.6%, without trh and ureR. Most of the Salmonella isolates were positive for the Salmonella pathogenicity islands (SPIs genes (87–100%, and some for Salmonella plasmid virulence (SPV genes (34.8% for spvA and spvB, 43.5% for spvC. In addition, just like the drug resistance, virulence genes exhibited wide-spread distribution among the different STs albeit

  16. Applying Unique Molecular Identifiers in Next Generation Sequencing Reveals a Constrained Viral Quasispecies Evolution under Cross-Reactive Antibody Pressure Targeting Long Alpha Helix of Hemagglutinin

    Science.gov (United States)

    Hauck, Nastasja C.; Kirpach, Josiane; Kiefer, Christina; Farinelle, Sophie; Morris, Stephen A.; Muller, Claude P.; Lu, I-Na

    2018-01-01

    To overcome yearly efforts and costs for the production of seasonal influenza vaccines, new approaches for the induction of broadly protective and long-lasting immune responses have been developed in the past decade. To warrant safety and efficacy of the emerging crossreactive vaccine candidates, it is critical to understand the evolution of influenza viruses in response to these new immune pressures. Here we applied unique molecular identifiers in next generation sequencing to analyze the evolution of influenza quasispecies under in vivo antibody pressure targeting the hemagglutinin (HA) long alpha helix (LAH). Our vaccine targeting LAH of hemagglutinin elicited significant seroconversion and protection against homologous and heterologous influenza virus strains in mice. The vaccine not only significantly reduced lung viral titers, but also induced a well-known bottleneck effect by decreasing virus diversity. In contrast to the classical bottleneck effect, here we showed a significant increase in the frequency of viruses with amino acid sequences identical to that of vaccine targeting LAH domain. No escape mutant emerged after vaccination. These results not only support the potential of a universal influenza vaccine targeting the conserved LAH domains, but also clearly demonstrate that the well-established bottleneck effect on viral quasispecies evolution does not necessarily generate escape mutants. PMID:29587397

  17. Proteomics Analysis to Identify and Characterize the Molecular Signatures of Hepatic Steatosis in Ovariectomized Rats as a Model of Postmenopausal Status

    Directory of Open Access Journals (Sweden)

    Chen-Chung Liao

    2015-10-01

    Full Text Available Postmenopausal women are particularly at increased risk of developing non-alcoholic fatty liver disease (NAFLD. Here we aimed to determine the impact of postmenopausal-induced NAFLD (PM-NAFLD in an ovariectomized rat model. Sixteen six-week-old Sprague-Dawley female rats were randomly divided into two groups (eight per group, for sham-operation (Sham or bilateral ovariectomy (Ovx. Four months after surgery, indices of liver damage and liver histomorphometry were measured. Both serum aspartate aminotransferase (AST and alanine aminotranferease (ALT levels were significantly higher in the Ovx than Sham group. We performed quantitative LC-MS/MS-based proteomic profiling of livers from rats with PM-NAFLD to provide baseline knowledge of the PM-NAFLD proteome and to investigate proteins involved in PM-NAFLD by ingenuity pathways analysis (IPA to provide corroborative evidence for differential regulation of molecular and cellular functions affecting metabolic processes. Of the 586 identified proteins, the levels of 59 (10.0% and 48 (8.2% were significantly higher and lower, respectively, in the Ovx group compared to the Sham group. In conclusion, the changes in regulation of proteins implicated in PM-NAFLD may affect other vital biological processes in the body apart from causing postmenopause-mediated liver dysfunction. Our quantitative proteomics analysis may also suggest potential biomarkers and further clinical applications for PM-NAFLD.

  18. Integrated molecular analysis of Tamoxifen-resistant invasive lobular breast cancer cells identifies MAPK and GRM/mGluR signaling as therapeutic vulnerabilities.

    Science.gov (United States)

    Stires, Hillary; Heckler, Mary M; Fu, Xiaoyong; Li, Zhao; Grasso, Catherine S; Quist, Michael J; Lewis, Joseph A; Klimach, Uwe; Zwart, Alan; Mahajan, Akanksha; Győrffy, Balázs; Cavalli, Luciane R; Riggins, Rebecca B

    2018-08-15

    Invasive lobular breast cancer (ILC) is an understudied malignancy with distinct clinical, pathological, and molecular features that distinguish it from the more common invasive ductal carcinoma (IDC). Mounting evidence suggests that estrogen receptor-alpha positive (ER+) ILC has a poor response to Tamoxifen (TAM), but the mechanistic drivers of this are undefined. In the current work, we comprehensively characterize the SUM44/LCCTam ILC cell model system through integrated analysis of gene expression, copy number, and mutation, with the goal of identifying actionable alterations relevant to clinical ILC that can be co-targeted along with ER to improve treatment outcomes. We show that TAM has several distinct effects on the transcriptome of LCCTam cells, that this resistant cell model has acquired copy number alterations and mutations that impinge on MAPK and metabotropic glutamate receptor (GRM/mGluR) signaling networks, and that pharmacological inhibition of either improves or restores the growth-inhibitory actions of endocrine therapy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Applying Unique Molecular Identifiers in Next Generation Sequencing Reveals a Constrained Viral Quasispecies Evolution under Cross-Reactive Antibody Pressure Targeting Long Alpha Helix of Hemagglutinin

    Directory of Open Access Journals (Sweden)

    Nastasja C. Hauck

    2018-03-01

    Full Text Available To overcome yearly efforts and costs for the production of seasonal influenza vaccines, new approaches for the induction of broadly protective and long-lasting immune responses have been developed in the past decade. To warrant safety and efficacy of the emerging crossreactive vaccine candidates, it is critical to understand the evolution of influenza viruses in response to these new immune pressures. Here we applied unique molecular identifiers in next generation sequencing to analyze the evolution of influenza quasispecies under in vivo antibody pressure targeting the hemagglutinin (HA long alpha helix (LAH. Our vaccine targeting LAH of hemagglutinin elicited significant seroconversion and protection against homologous and heterologous influenza virus strains in mice. The vaccine not only significantly reduced lung viral titers, but also induced a well-known bottleneck effect by decreasing virus diversity. In contrast to the classical bottleneck effect, here we showed a significant increase in the frequency of viruses with amino acid sequences identical to that of vaccine targeting LAH domain. No escape mutant emerged after vaccination. These results not only support the potential of a universal influenza vaccine targeting the conserved LAH domains, but also clearly demonstrate that the well-established bottleneck effect on viral quasispecies evolution does not necessarily generate escape mutants.

  20. Molecular Cytogenetic Characterization Identified the Murine B-Cell Lymphoma Cell Line A-20 as a Model for Sporadic Burkitt's Lymphoma.

    Science.gov (United States)

    Guja, Karolina; Liehr, Thomas; Rincic, Martina; Kosyakova, Nadezda; Hussein Azawi, Shaymaa S

    2017-11-01

    Here, we report the first molecular cytogenetic characterization of the BALB/cAnN mouse derived B-cell non-Hodgkin lymphoma (B-cell NHL) cell lines A-20. Even though previously used as a model for testing of, for example, dexametason, up to present, no data in the genetic properties of A-20 were available. The present study closed this gap and provides evidence that A-20 is a model for B-cell NHL subgroup sporadic Burkitt's lymphoma. C-myc oncogene is involved in a translocation and copy number alterations as gain of murine 14q material could be observed. Interestingly, the cell line showed the karyotype 39,X,-X or -Y,t(2;15)(qE5;qD2),del(6)(qB3qC3),del(9)(qA3qA4),dup(14)(qE1qE4) in ~95% of the cells, being exceptionally stable for cell lines being established 38 years ago. Still, ~5% of the cells showed polyploidization followed by chromothripsis. It remains to be determined if this can be observed also in other cell lines, just has not been reported yet, and/or if it is a unique feature of A-20. Overall, finally here, the necessary genetic data to identify A-20 as a model for human sporadic Burkitt's lymphoma are provided.

  1. Experimentally-derived fibroblast gene signatures identify molecular pathways associated with distinct subsets of systemic sclerosis patients in three independent cohorts.

    Directory of Open Access Journals (Sweden)

    Michael E Johnson

    Full Text Available Genome-wide expression profiling in systemic sclerosis (SSc has identified four 'intrinsic' subsets of disease (fibroproliferative, inflammatory, limited, and normal-like, each of which shows deregulation of distinct signaling pathways; however, the full set of pathways contributing to this differential gene expression has not been fully elucidated. Here we examine experimentally derived gene expression signatures in dermal fibroblasts for thirteen different signaling pathways implicated in SSc pathogenesis. These data show distinct and overlapping sets of genes induced by each pathway, allowing for a better understanding of the molecular relationship between profibrotic and immune signaling networks. Pathway-specific gene signatures were analyzed across a compendium of microarray datasets consisting of skin biopsies from three independent cohorts representing 80 SSc patients, 4 morphea, and 26 controls. IFNα signaling showed a strong association with early disease, while TGFβ signaling spanned the fibroproliferative and inflammatory subsets, was associated with worse MRSS, and was higher in lesional than non-lesional skin. The fibroproliferative subset was most strongly associated with PDGF signaling, while the inflammatory subset demonstrated strong activation of innate immune pathways including TLR signaling upstream of NF-κB. The limited and normal-like subsets did not show associations with fibrotic and inflammatory mediators such as TGFβ and TNFα. The normal-like subset showed high expression of genes associated with lipid signaling, which was absent in the inflammatory and limited subsets. Together, these data suggest a model by which IFNα is involved in early disease pathology, and disease severity is associated with active TGFβ signaling.

  2. Integrated RNA-Seq and sRNA-Seq Analysis Identifies Chilling and Freezing Responsive Key Molecular Players and Pathways in Tea Plant (Camellia sinensis)

    Science.gov (United States)

    Zheng, Chao; Zhao, Lei; Wang, Yu; Shen, Jiazhi; Zhang, Yinfei; Jia, Sisi; Li, Yusheng; Ding, Zhaotang

    2015-01-01

    Tea [Camellia sinensis (L) O. Kuntze, Theaceae] is one of the most popular non-alcoholic beverages worldwide. Cold stress is one of the most severe abiotic stresses that limit tea plants’ growth, survival and geographical distribution. However, the genetic regulatory network and signaling pathways involved in cold stress responses in tea plants remain unearthed. Using RNA-Seq, DGE and sRNA-Seq technologies, we performed an integrative analysis of miRNA and mRNA expression profiling and their regulatory network of tea plants under chilling (4℃) and freezing (-5℃) stress. Differentially expressed (DE) miRNA and mRNA profiles were obtained based on fold change analysis, miRNAs and target mRNAs were found to show both coherent and incoherent relationships in the regulatory network. Furthermore, we compared several key pathways (e.g., ‘Photosynthesis’), GO terms (e.g., ‘response to karrikin’) and transcriptional factors (TFs, e.g., DREB1b/CBF1) which were identified as involved in the early chilling and/or freezing response of tea plants. Intriguingly, we found that karrikins, a new group of plant growth regulators, and β-primeverosidase (BPR), a key enzyme functionally relevant with the formation of tea aroma might play an important role in both early chilling and freezing response of tea plants. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-Seq and sRNA-Seq analysis. This is the first study to simultaneously profile the expression patterns of both miRNAs and mRNAs on a genome-wide scale to elucidate the molecular mechanisms of early responses of tea plants to cold stress. In addition to gaining a deeper insight into the cold resistant characteristics of tea plants, we provide a good case study to analyse mRNA/miRNA expression and profiling of non-model plant species using next-generation sequencing technology. PMID:25901577

  3. Identifying the Interaction of Vancomycin With Novel pH-Responsive Lipids as Antibacterial Biomaterials Via Accelerated Molecular Dynamics and Binding Free Energy Calculations.

    Science.gov (United States)

    Ahmed, Shaimaa; Vepuri, Suresh B; Jadhav, Mahantesh; Kalhapure, Rahul S; Govender, Thirumala

    2018-06-01

    Nano-drug delivery systems have proven to be an efficient formulation tool to overcome the challenges with current antibiotics therapy and resistance. A series of pH-responsive lipid molecules were designed and synthesized for future liposomal formulation as a nano-drug delivery system for vancomycin at the infection site. The structures of these lipids differ from each other in respect of hydrocarbon tails: Lipid1, 2, 3 and 4 have stearic, oleic, linoleic, and linolenic acid hydrocarbon chains, respectively. The impact of variation in the hydrocarbon chain in the lipid structure on drug encapsulation and release profile, as well as mode of drug interaction, was investigated using molecular modeling analyses. A wide range of computational tools, including accelerated molecular dynamics, normal molecular dynamics, binding free energy calculations and principle component analysis, were applied to provide comprehensive insight into the interaction landscape between vancomycin and the designed lipid molecules. Interestingly, both MM-GBSA and MM-PBSA binding affinity calculations using normal molecular dynamics and accelerated molecular dynamics trajectories showed a very consistent trend, where the order of binding affinity towards vancomycin was lipid4 > lipid1 > lipid2 > lipid3. From both normal molecular dynamics and accelerated molecular dynamics, the interaction of lipid3 with vancomycin is demonstrated to be the weakest (∆G binding  = -2.17 and -11.57, for normal molecular dynamics and accelerated molecular dynamics, respectively) when compared to other complexes. We believe that the degree of unsaturation of the hydrocarbon chain in the lipid molecules may impact on the overall conformational behavior, interaction mode and encapsulation (wrapping) of the lipid molecules around the vancomycin molecule. This thorough computational analysis prior to the experimental investigation is a valuable approach to guide for predicting the encapsulation

  4. Energetics of the rearrangement of neutral and ionized perfluorocyclopropane to perfluoropropylene. Use of infrared multiphoton dissociation spectra to identify structural isomers of molecular ions

    International Nuclear Information System (INIS)

    Bomse, D.S.; Berman, D.W.; Beauchamp, J.L.

    1981-01-01

    Infrared photodissociation spectroscopy is used to compare the structure of gas-phase C 3 F 6 + ions obtained by electron-impact ionization of two isomeric precursors: perfluoropropylene and perfluorocyclopropane. Photodissociation spectra are obtained by observing the extent of multiphoton dissociation as the CO 2 laser is tuned across the 925 to 1080 cm -1 wavelength range. Ions are formed, stored, and detected with the use of techniques of ion cyclotron resonance spectroscopy. Infrared multiphoton excitation is effected by using low-power, continuous-wave laser radiation. The fingerprint spectrum of the molecular ion of perfluorocyclopropane is identical with that obtained from perfluoropropylene, indicating rearrangement of the former to the latter. Photodissociation kinetics indicate that the entire perfluorocyclopropane molecular ion population isomerizes to the more stable perfluoropropylene structure. Thermochemistry of C 3 F 6 and C 3 F 6 + isomers is discussed. Comparisons are made with the analogous C 3 H 6 system. Photoionization mass spectroscopy results yield ΔH/sub f/(c-C 3 F 6 ) = -233.8 kcal/mol. 4 figures

  5. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots.

    Science.gov (United States)

    Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang

    2017-02-06

    Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. 'MAPK cascade'), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway'), reactive oxygen species (ROS) metabolic process (e.g. 'hydrogen peroxide catabolic process') and transcription factors (e.g., 'MYB, ZFP and bZIP') were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment.

  6. Structure of Human B12 Trafficking Protein CblD Reveals Molecular Mimicry and Identifies a New Subfamily of Nitro-FMN Reductases.

    Science.gov (United States)

    Yamada, Kazuhiro; Gherasim, Carmen; Banerjee, Ruma; Koutmos, Markos

    2015-12-04

    In mammals, B12 (or cobalamin) is an essential cofactor required by methionine synthase and methylmalonyl-CoA mutase. A complex intracellular pathway supports the assimilation of cobalamin into its active cofactor forms and delivery to its target enzymes. MMADHC (the methylmalonic aciduria and homocystinuria type D protein), commonly referred to as CblD, is a key chaperone involved in intracellular cobalamin trafficking, and mutations in CblD cause methylmalonic aciduria and/or homocystinuria. Herein, we report the first crystal structure of the globular C-terminal domain of human CblD, which is sufficient for its interaction with MMADHC (the methylmalonic aciduria and homocystinuria type C protein), or CblC, and for supporting the cytoplasmic cobalamin trafficking pathway. CblD contains an α+β fold that is structurally reminiscent of the nitro-FMN reductase superfamily. Two of the closest structural relatives of CblD are CblC, a multifunctional enzyme important for cobalamin trafficking, and the activation domain of methionine synthase. CblD, CblC, and the activation domain of methionine synthase share several distinguishing features and, together with two recently described corrinoid-dependent reductive dehalogenases, constitute a new subclass within the nitro-FMN reductase superfamily. We demonstrate that CblD enhances oxidation of cob(II)alamin bound to CblC and that disease-causing mutations in CblD impair the kinetics of this reaction. The striking structural similarity of CblD to CblC, believed to be contiguous in the cobalamin trafficking pathway, suggests the co-option of molecular mimicry as a strategy for achieving its function. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Molecular dynamics simulations of site point mutations in the TPR domain of cyclophilin 40 identify conformational states with distinct dynamic and enzymatic properties

    Science.gov (United States)

    Gur, Mert; Blackburn, Elizabeth A.; Ning, Jia; Narayan, Vikram; Ball, Kathryn L.; Walkinshaw, Malcolm D.; Erman, Burak

    2018-04-01

    Cyclophilin 40 (Cyp40) is a member of the immunophilin family that acts as a peptidyl-prolyl-isomerase enzyme and binds to the heat shock protein 90 (Hsp90). Its structure comprises an N-terminal cyclophilin domain and a C-terminal tetratricopeptide (TPR) domain. Cyp40 is overexpressed in prostate cancer and certain T-cell lymphomas. The groove for Hsp90 binding on the TPR domain includes residues Lys227 and Lys308, referred to as the carboxylate clamp, and is essential for Cyp40-Hsp90 binding. In this study, the effect of two mutations, K227A and K308A, and their combinative mutant was investigated by performing a total of 5.76 μs of all-atom molecular dynamics (MD) simulations in explicit solvent. All simulations, except the K308A mutant, were found to adopt two distinct (extended or compact) conformers defined by different cyclophilin-TPR interdomain distances. The K308A mutant was only observed in the extended form which is observed in the Cyp40 X-ray structure. The wild-type, K227A, and combined mutant also showed bimodal distributions. The experimental melting temperature, Tm, values of the mutants correlate with the degree of compactness with the K308A extended mutant having a marginally lower melting temperature. Another novel measure of compactness determined from the MD data, the "coordination shell volume," also shows a direct correlation with Tm. In addition, the MD simulations show an allosteric effect with the mutations in the remote TPR domain having a pronounced effect on the molecular motions of the enzymatic cyclophilin domain which helps rationalise the experimentally observed increase in enzyme activity measured for all three mutations.

  8. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, R L; Oettinger, T; Rosenkrands, I

    2000-01-01

    Culture filtrate from Mycobacterium tuberculosis contains protective antigens of relevance for the generation of a new antituberculosis vaccine. We have identified two previously uncharacterized M. tuberculosis proteins (TB7.3 and TB10.4) from the highly active low-mass fraction of culture filtra...

  9. Use of quantitative molecular diagnostic methods to identify causes of diarrhoea in children: a reanalysis of the GEMS case-control study.

    Science.gov (United States)

    Liu, Jie; Platts-Mills, James A; Juma, Jane; Kabir, Furqan; Nkeze, Joseph; Okoi, Catherine; Operario, Darwin J; Uddin, Jashim; Ahmed, Shahnawaz; Alonso, Pedro L; Antonio, Martin; Becker, Stephen M; Blackwelder, William C; Breiman, Robert F; Faruque, Abu S G; Fields, Barry; Gratz, Jean; Haque, Rashidul; Hossain, Anowar; Hossain, M Jahangir; Jarju, Sheikh; Qamar, Farah; Iqbal, Najeeha Talat; Kwambana, Brenda; Mandomando, Inacio; McMurry, Timothy L; Ochieng, Caroline; Ochieng, John B; Ochieng, Melvin; Onyango, Clayton; Panchalingam, Sandra; Kalam, Adil; Aziz, Fatima; Qureshi, Shahida; Ramamurthy, Thandavarayan; Roberts, James H; Saha, Debasish; Sow, Samba O; Stroup, Suzanne E; Sur, Dipika; Tamboura, Boubou; Taniuchi, Mami; Tennant, Sharon M; Toema, Deanna; Wu, Yukun; Zaidi, Anita; Nataro, James P; Kotloff, Karen L; Levine, Myron M; Houpt, Eric R

    2016-09-24

    Diarrhoea is the second leading cause of mortality in children worldwide, but establishing the cause can be complicated by diverse diagnostic approaches and varying test characteristics. We used quantitative molecular diagnostic methods to reassess causes of diarrhoea in the Global Enteric Multicenter Study (GEMS). GEMS was a study of moderate to severe diarrhoea in children younger than 5 years in Africa and Asia. We used quantitative real-time PCR (qPCR) to test for 32 enteropathogens in stool samples from cases and matched asymptomatic controls from GEMS, and compared pathogen-specific attributable incidences with those found with the original GEMS microbiological methods, including culture, EIA, and reverse-transcriptase PCR. We calculated revised pathogen-specific burdens of disease and assessed causes in individual children. We analysed 5304 sample pairs. For most pathogens, incidence was greater with qPCR than with the original methods, particularly for adenovirus 40/41 (around five times), Shigella spp or enteroinvasive Escherichia coli (EIEC) and Campylobactor jejuni o C coli (around two times), and heat-stable enterotoxin-producing E coli ([ST-ETEC] around 1·5 times). The six most attributable pathogens became, in descending order, Shigella spp, rotavirus, adenovirus 40/41, ST-ETEC, Cryptosporidium spp, and Campylobacter spp. Pathogen-attributable diarrhoeal burden was 89·3% (95% CI 83·2-96·0) at the population level, compared with 51·5% (48·0-55·0) in the original GEMS analysis. The top six pathogens accounted for 77·8% (74·6-80·9) of all attributable diarrhoea. With use of model-derived quantitative cutoffs to assess individual diarrhoeal cases, 2254 (42·5%) of 5304 cases had one diarrhoea-associated pathogen detected and 2063 (38·9%) had two or more, with Shigella spp and rotavirus being the pathogens most strongly associated with diarrhoea in children with mixed infections. A quantitative molecular diagnostic approach improved population

  10. Molecular characterization of the VP4, VP6, VP7, and NSP4 genes of lapine rotaviruses identified in italy: emergence of a novel VP4 genotype

    International Nuclear Information System (INIS)

    Martella, Vito; Ciarlet, Max; Camarda, Antonio; Pratelli, Annamaria; Tempesta, Maria; Greco, Grazia; Cavalli, Alessandra; Elia, Gabriella; Decaro, Nicola; Terio, Valentina; Bozzo, Giancarlo; Camero, Michele; Buonavoglia, Canio

    2003-01-01

    The genes encoding the glycoprotein VP7, the VP8* trypsin-cleavage product of the protein VP4, a fragment of the protein VP6 associated with subgroup (SG) specificity, and the enterotoxin NSP4 of rotavirus strains identified in diarrheic fecal samples of rabbits in Italy were sequenced. The Italian lapine rotavirus (LRV) strains possessed a G3 VP7, SG I VP6, and KUN-like NSP4, a gene constellation typical of LRVs. One LRV strain (30/96), isolated in 1996, shared the closest amino acid (aa) identity (87-96%) with the P[14] genotype, composed of human and LRV strains. Conversely, three LRV strains (160/01, 229/01, and 308/01), identified in 2001, were highly identical (90-95%) among each other, but showed low aa identity (34-77%) to the VP8* genotype-specific sequences of representative rotavirus strains of all remaining P genotypes. This report confirms the worldwide genetic constellations of LRVs and identifies a novel VP4 genotype in rabbits, tentatively proposed as genotype P[22

  11. Giant Galápagos tortoises; molecular genetic analyses identify a trans-island hybrid in a repatriation program of an endangered taxon

    Directory of Open Access Journals (Sweden)

    Caccone Adalgisa

    2007-02-01

    Full Text Available Abstract Background Giant Galápagos tortoises on the island of Española have been the focus of an intensive captive breeding-repatriation programme for over 35 years that saved the taxon from extinction. However, analysis of 118 samples from released individuals indicated that the bias sex ratio and large variance in reproductive success among the 15 breeders has severely reduced the effective population size (Ne. Results We report here that an analysis of an additional 473 captive-bred tortoises released back to the island reveals an individual (E1465 that exhibits nuclear microsatellite alleles not found in any of the 15 breeders. Statistical analyses incorporating genotypes of 304 field-sampled individuals from all populations on the major islands indicate that E1465 is most probably a hybrid between an Española female tortoise and a male from the island of Pinzón, likely present on Española due to human transport. Conclusion Removal of E1465 as well as its father and possible (half-siblings is warranted to prevent further contamination within this taxon of particular conservation significance. Despite this detected single contamination, it is highly noteworthy to emphasize the success of this repatriation program conducted over nearly 40 years and involving release of over 2000 captive-bred tortoises that now reproduce in situ. The incorporation of molecular genetic analysis of the program is providing guidance that will aid in monitoring the genetic integrity of this ambitious effort to restore a unique linage of a spectacular animal.

  12. What does it take to resolve relationships and to identify species with molecular markers? An example from the epiphytic Rhipsalideae (Cactaceae).

    Science.gov (United States)

    Korotkova, Nadja; Borsch, Thomas; Quandt, Dietmar; Taylor, Nigel P; Müller, Kai F; Barthlott, Wilhelm

    2011-09-01

    The Cactaceae are a major New World plant family and popular in horticulture. Still, taxonomic units and species limits have been difficult to define, and molecular phylogenetic studies so far have yielded largely unresolved trees, so relationships within Cactaceae remain insufficiently understood. This study focuses on the predominantly epiphytic tribe Rhipsalideae and evaluates the utility of a spectrum of plastid genomic regions. • We present a phylogenetic study including 52 of the 53 Rhipsalideae species and all the infraspecific taxa. Seven regions (trnK intron, matK, rbcL, rps3-rpl16, rpl16 intron, psbA-trnH, trnQ-rps16), ca. 5600 nucleotides (nt) were sequenced per sample. The regions used were evaluated for their phylogenetic performance and performance in DNA-based species recognition based on operational taxonomic units (OTUs) defined beforehand. • The Rhipsalideae are monophyletic and contain five clades that correspond to the genera Rhipsalis, Lepismium, Schlumbergera, Hatiora, and Rhipsalidopsis. The species-level tree was well resolved and supported; the rpl16 and trnK introns yielded the best phylogenetic signal. Although the psbA-trnH and trnQ-rps16 spacers were the most successful individual regions for OTU identification, their success rate did not significantly exceed 70%. The highest OTU identification rate of 97% was found using the combination of psbA-trnH, rps3-rpl16, trnK intron, and trnQ-rps16 as a minimum possible marker length (ca. 1660 nt). • The phylogenetic performance of a marker is not determined by the level of sequence variability, and species discrimination power does not necessarily correlate with phylogenetic utility.

  13. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  14. Urinary Metabolomics Identifies a Molecular Correlate of Interstitial Cystitis/Bladder Pain Syndrome in a Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP Research Network Cohort

    Directory of Open Access Journals (Sweden)

    Kaveri S. Parker

    2016-05-01

    Full Text Available Interstitial cystitis/bladder pain syndrome (IC/BPS is a poorly understood syndrome affecting up to 6.5% of adult women in the U.S. The lack of broadly accepted objective laboratory markers for this condition hampers efforts to diagnose and treat this condition. To identify biochemical markers for IC/BPS, we applied mass spectrometry-based global metabolite profiling to urine specimens from a cohort of female IC/BPS subjects from the Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP Research Network. These analyses identified multiple metabolites capable of discriminating IC/BPS and control subjects. Of these candidate markers, etiocholan-3α-ol-17-one sulfate (Etio-S, a sulfoconjugated 5-β reduced isomer of testosterone, distinguished female IC/BPS and control subjects with a sensitivity and specificity >90%. Among IC/BPS subjects, urinary Etio-S levels are correlated with elevated symptom scores (symptoms, pelvic pain, and number of painful body sites and could resolve high- from low-symptom IC/BPS subgroups. Etio-S-associated biochemical changes persisted through 3–6 months of longitudinal follow up. These results raise the possibility that an underlying biochemical abnormality contributes to symptoms in patients with severe IC/BPS.

  15. Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

    Science.gov (United States)

    Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

    2012-07-01

    Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and

  16. Epidemiological links between tuberculosis cases identified twice as efficiently by whole genome sequencing than conventional molecular typing: A population-based study.

    Science.gov (United States)

    Jajou, Rana; de Neeling, Albert; van Hunen, Rianne; de Vries, Gerard; Schimmel, Henrieke; Mulder, Arnout; Anthony, Richard; van der Hoek, Wim; van Soolingen, Dick

    2018-01-01

    Patients with Mycobacterium tuberculosis isolates sharing identical DNA fingerprint patterns can be epidemiologically linked. However, municipal health services in the Netherlands are able to confirm an epidemiological link in only around 23% of the patients with isolates clustered by the conventional variable number of tandem repeat (VNTR) genotyping. This research aims to investigate whether whole genome sequencing (WGS) is a more reliable predictor of epidemiological links between tuberculosis patients than VNTR genotyping. VNTR genotyping and WGS were performed in parallel on all Mycobacterium tuberculosis complex isolates received at the Netherlands National Institute for Public Health and the Environment in 2016. Isolates were clustered by VNTR when they shared identical 24-loci VNTR patterns; isolates were assigned to a WGS cluster when the pair-wise genetic distance was ≤ 12 single nucleotide polymorphisms (SNPs). Cluster investigation was performed by municipal health services on all isolates clustered by VNTR in 2016. The proportion of epidemiological links identified among patients clustered by either method was calculated. In total, 535 isolates were genotyped, of which 25% (134/535) were clustered by VNTR and 14% (76/535) by WGS; the concordance between both typing methods was 86%. The proportion of epidemiological links among WGS clustered cases (57%) was twice as common than among VNTR clustered cases (31%). When WGS was applied, the number of clustered isolates was halved, while all epidemiologically linked cases remained clustered. WGS is therefore a more reliable tool to predict epidemiological links between tuberculosis cases than VNTR genotyping and will allow more efficient transmission tracing, as epidemiological investigations based on false clustering can be avoided.

  17. Exploring the influence of EGCG on the β-sheet-rich oligomers of human islet amyloid polypeptide (hIAPP1-37 and identifying its possible binding sites from molecular dynamics simulation.

    Directory of Open Access Journals (Sweden)

    Qianqian Wang

    Full Text Available EGCG possesses the ability of disaggregating the existing amyloid fibrils which were associated with many age-related degenerative diseases. However, the molecular mechanism of EGCG to disaggregate these fibrils is poorly known. In this work, to study the influence of EGCG on the full-length human islet amyloid polypeptide 1-37 (hIAPP1-37 oligomers, molecular dynamics simulations of hIAPP1-37 pentamer and decamer with EGCG were performed, respectively. The obtained results indicate that EGCG indeed destabilized the hIAPP1-37 oligomers. The nematic order parameter and secondary structure calculations coupled with the free-energy landscape indicate that EGCG broke the initial ordered pattern of two polymers, greatly reduced their β-sheet content and enlarged their conformational space. On this basis, three possible target sites were identified with the binding capacity order of S1>S2>S3. After a deeper analysis of each site, we found that S1 was the most possible site on which residues B-Ile26/Ala25, A-Phe23, B/C-Leu27 and E-Tyr37 played an important role for their binding. The proposal of this molecular mechanism can not only provide a prospective interaction figure between EGCG and β-sheet-rich fibrils of hIAPP1-37, but also is useful for further discovering other potential inhibitors.

  18. Molecular dynamics simulations of Hsp40 J-domain mutants identifies disruption of the critical HPD-motif as the key factor for impaired curing in vivo of the yeast prion [URE3].

    Science.gov (United States)

    Xue, You-Lin; Wang, Hao; Riedy, Michael; Roberts, Brittany-Lee; Sun, Yuna; Song, Yong-Bo; Jones, Gary W; Masison, Daniel C; Song, Youtao

    2018-05-01

    Genetic screens using Saccharomyces cerevisiae have identified an array of Hsp40 (Ydj1p) J-domain mutants that are impaired in the ability to cure the yeast [URE3] prion through disrupting functional interactions with Hsp70. However, biochemical analysis of some of these Hsp40 J-domain mutants has so far failed to provide major insight into the specific functional changes in Hsp40-Hsp70 interactions. To explore the detailed structural and dynamic properties of the Hsp40 J-domain, 20 ns molecular dynamic simulations of 4 mutants (D9A, D36A, A30T, and F45S) and wild-type J-domain were performed, followed by Hsp70 docking simulations. Results demonstrated that although the Hsp70 interaction mechanism of the mutants may vary, the major structural change was targeted to the critical HPD motif of the J-domain. Our computational analysis fits well with previous yeast genetics studies regarding highlighting the importance of J-domain function in prion propagation. During the molecular dynamics simulations several important residues were identified and predicted to play an essential role in J-domain structure. Among these residues, Y26 and F45 were confirmed, using both in silico and in vivo methods, as being critical for Ydj1p function.

  19. Identifying the Molecular Origin of Global Warming

    Science.gov (United States)

    Bera, Partha P.; Francisco, Joseph S.; Lee, Timothy J.

    2009-01-01

    We have investigated the physical characteristics of greenhouse gases (GHGs) to assess which properties are most important in determining the efficiency of a GHG. Chlorofluorcarbons (CFCs), hydrofluorocarbons (HFCs), perfluorocarbons (PFCs), nitrogen fluorides, and various other known atmospheric trace molecules have been included in this study. Compounds containing the halogens F or Cl have in common very polar X-F or X-Cl bonds, particularly the X-F bonds. It is shown that as more F atoms bond to the same central atom, the bond dipoles become larger as a result of the central atom becoming more positive. This leads to a linear increase in the total or integrated XF bond dipole derivatives for the molecule, which leads to a non-linear (quadratic) increase in infrared (IR) intensity. Moreover, virtually all of the X-F bond stretches occur in the atmospheric IR window as opposed to X-H stretches, which do not occur in the atmospheric window. It is concluded that molecules possessing several F atoms will always have a large radiative forcing parameter in the calculation of their global warming potential. Some of the implications for global warming and climate change are discussed.

  20. Investigation of naphthofuran moiety as potential dual inhibitor against BACE-1 and GSK-3β: molecular dynamics simulations, binding energy, and network analysis to identify first-in-class dual inhibitors against Alzheimer's disease.

    Science.gov (United States)

    Kumar, Akhil; Srivastava, Gaurava; Srivastava, Swati; Verma, Seema; Negi, Arvind S; Sharma, Ashok

    2017-08-01

    BACE-1 and GSK-3β are potential therapeutic drug targets for Alzheimer's disease. Recently, both the targets received attention for designing dual inhibitors for Alzheimer's disease. Until now, only two-scaffold triazinone and curcumin have been reported as BACE-1 and GSK-3β dual inhibitors. Docking, molecular dynamics, clustering, binding energy, and network analysis of triazinone derivatives with BACE-1 and GSK-3β was performed to get molecular insight into the first reported dual inhibitor. Further, we designed and evaluated a naphthofuran series for its ability to inhibit BACE-1 and GSK-3β with the computational approaches. Docking study of naphthofuran series showed a good binding affinity towards both the targets. Molecular dynamics, binding energy, and network analysis were performed to compare their binding with the targets and amino acids responsible for binding. Naphthofuran series derivatives showed good interaction within the active site residues of both of the targets. Hydrogen bond occupancy and binding energy suggested strong binding with the targets. Dual-inhibitor binding was mostly governed by the hydrophobic interactions for both of the targets. Per residue energy decomposition and network analysis identified the key residues involved in the binding and inhibiting BACE-1 and GSK-3β. The results indicated that naphthofuran series derivative 11 may be a promising first-in-class dual inhibitor against BACE-1 and GSK-3β. This naphthofuran series may be further explored to design better dual inhibitors. Graphical abstract Naphthofuran derivative as a dual inhibitor for BACE-1 and GSK-3β.

  1. The 1.1 Å resolution structure of a periplasmic phosphate-binding protein from Stenotrophomonas maltophilia: a crystallization contaminant identified by molecular replacement using the entire Protein Data Bank.

    Science.gov (United States)

    Keegan, Ronan; Waterman, David G; Hopper, David J; Coates, Leighton; Taylor, Graham; Guo, Jingxu; Coker, Alun R; Erskine, Peter T; Wood, Steve P; Cooper, Jonathan B

    2016-08-01

    During efforts to crystallize the enzyme 2,4-dihydroxyacetophenone dioxygenase (DAD) from Alcaligenes sp. 4HAP, a small number of strongly diffracting protein crystals were obtained after two years of crystal growth in one condition. The crystals diffracted synchrotron radiation to almost 1.0 Å resolution and were, until recently, assumed to be formed by the DAD protein. However, when another crystal form of this enzyme was eventually solved at lower resolution, molecular replacement using this new structure as the search model did not give a convincing solution with the original atomic resolution data set. Hence, it was considered that these crystals might have arisen from a protein impurity, although molecular replacement using the structures of common crystallization contaminants as search models again failed. A script to perform molecular replacement using MOLREP in which the first chain of every structure in the PDB was used as a search model was run on a multi-core cluster. This identified a number of prokaryotic phosphate-binding proteins as scoring highly in the MOLREP peak lists. Calculation of an electron-density map at 1.1 Å resolution based on the solution obtained with PDB entry 2q9t allowed most of the amino acids to be identified visually and built into the model. A BLAST search then indicated that the molecule was most probably a phosphate-binding protein from Stenotrophomonas maltophilia (UniProt ID B4SL31; gene ID Smal_2208), and fitting of the corresponding sequence to the atomic resolution map fully corroborated this. Proteins in this family have been linked to the virulence of antibiotic-resistant strains of pathogenic bacteria and with biofilm formation. The structure of the S. maltophilia protein has been refined to an R factor of 10.15% and an Rfree of 12.46% at 1.1 Å resolution. The molecule adopts the type II periplasmic binding protein (PBP) fold with a number of extensively elaborated loop regions. A fully dehydrated phosphate

  2. Molecular Foundry

    Science.gov (United States)

    . New Study Indicates Greater Capacity for Carbon Storage in the Earth's Subsurface A team of Foundry minerals which make up the dominant clays in the Earth's deep subsurface. Doubling Down on Energy Storage identify molecular components within small volumes of biological samples, such as blood or urine. Industry

  3. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    Directory of Open Access Journals (Sweden)

    Abadie Jerome

    2011-05-01

    Full Text Available Abstract Background Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Methods Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Results Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. Conclusions The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model

  4. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    International Nuclear Information System (INIS)

    Hedan, Benoit; Thomas, Rachael; Motsinger-Reif, Alison; Abadie, Jerome; Andre, Catherine; Cullen, John; Breen, Matthew

    2011-01-01

    Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS) is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs) that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model for the human counterpart, providing additional evidence towards

  5. Genetic and molecular risk factors within the newly identified primate-specific exon of the SAP97/DLG1 gene in the 3q29 schizophrenia-associated locus.

    Science.gov (United States)

    Uezato, Akihito; Yamamoto, Naoki; Jitoku, Daisuke; Haramo, Emiko; Hiraaki, Eri; Iwayama, Yoshimi; Toyota, Tomoko; Umino, Masakazu; Umino, Asami; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Hashimoto, Tasuku; Kanahara, Nobuhisa; Kurumaji, Akeo; Yoshikawa, Takeo; Nishikawa, Toru

    2017-12-01

    The synapse-associated protein 97/discs, large homolog 1 of Drosophila (DLG1) gene encodes synaptic scaffold PDZ proteins interacting with ionotropic glutamate receptors including the N-methyl-D-aspartate type glutamate receptor (NMDAR) that is presumed to be hypoactive in brains of patients with schizophrenia. The DLG1 gene resides in the chromosomal position 3q29, the microdeletion of which confers a 40-fold increase in the risk for schizophrenia. In the present study, we performed genetic association analyses for DLG1 gene using a Japanese cohort with 1808 schizophrenia patients and 2170 controls. We detected an association which remained significant after multiple comparison testing between schizophrenia and the single nucleotide polymorphism (SNP) rs3915512 that is located within the newly identified primate-specific exon (exon 3b) of the DLG1 gene and constitutes the exonic splicing enhancer sequence. When stratified by onset age, although it did not survive multiple comparisons, the association was observed in non-early onset schizophrenia, whose onset-age selectivity is consistent with our recent postmortem study demonstrating a decrease in the expression of the DLG1 variant in early-onset schizophrenia. Although the present study did not demonstrate the previously reported association of the SNP rs9843659 by itself, a meta-analysis revealed a significant association between DLG1 gene and schizophrenia. These findings provide a valuable clue for molecular mechanisms on how genetic variations in the primate-specific exon of the gene in the schizophrenia-associated 3q29 locus affect its regulation in the glutamate system and lead to the disease onset around a specific stage of brain development. © 2017 Wiley Periodicals, Inc.

  6. Transcriptional profiling reveals molecular signatures associated with HIV permissiveness in Th1Th17 cells and identifies Peroxisome Proliferator-Activated Receptor Gamma as an intrinsic negative regulator of viral replication

    Science.gov (United States)

    2013-01-01

    Background We previously demonstrated that primary Th1Th17 cells are highly permissive to HIV-1, whereas Th1 cells are relatively resistant. Molecular mechanisms underlying these differences remain unknown. Results Exposure to replication competent and single-round VSV-G pseudotyped HIV strains provide evidence that superior HIV replication in Th1Th17 vs. Th1 cells was regulated by mechanisms located at entry and post-entry levels. Genome-wide transcriptional profiling identified transcripts upregulated (n = 264) and downregulated (n = 235) in Th1Th17 vs. Th1 cells (p-value Th17 (nuclear receptors, trafficking, p38/MAPK, NF-κB, p53/Ras, IL-23) vs. Th1 cells (proteasome, interferon α/β). Differentially expressed genes were classified into biological categories using Gene Ontology. Th1Th17 cells expressed typical Th17 markers (IL-17A/F, IL-22, CCL20, RORC, IL-26, IL-23R, CCR6) and transcripts functionally linked to regulating cell trafficking (CEACAM1, MCAM), activation (CD28, CD40LG, TNFSF13B, TNFSF25, PTPN13, MAP3K4, LTB, CTSH), transcription (PPARγ, RUNX1, ATF5, ARNTL), apoptosis (FASLG), and HIV infection (CXCR6, FURIN). Differential expression of CXCR6, PPARγ, ARNTL, PTPN13, MAP3K4, CTSH, SERPINB6, PTK2, and ISG20 was validated by RT-PCR, flow cytometry and/or confocal microscopy. The nuclear receptor PPARγ was preferentially expressed by Th1Th17 cells. PPARγ RNA interference significantly increased HIV replication at levels post-entry and prior HIV-DNA integration. Finally, the activation of PPARγ pathway via the agonist Rosiglitazone induced the nuclear translocation of PPARγ and a robust inhibition of viral replication. Conclusions Thus, transcriptional profiling in Th1Th17 vs. Th1 cells demonstrated that HIV permissiveness is associated with a superior state of cellular activation and limited antiviral properties and identified PPARγ as an intrinsic negative regulator of viral replication. Therefore, triggering PPARγ pathway via non

  7. Children's First Experience of Taking Anabolic-Androgenic Steroids can Occur before Their 10th Birthday: A Systematic Review Identifying 9 Factors That Predicted Doping among Young People

    Science.gov (United States)

    Nicholls, Adam R.; Cope, Ed; Bailey, Richard; Koenen, Katrin; Dumon, Detlef; Theodorou, Nikolaos C.; Chanal, Benoit; Saint Laurent, Delphine; Müller, David; Andrés, Mar P.; Kristensen, Annemarie H.; Thompson, Mark A.; Baumann, Wolfgang; Laurent, Jean-Francois

    2017-01-01

    Taking performance-enhancing drugs (PEDs) can cause serious and irreversible health consequences, which can ultimately lead to premature death. Some young people may take PEDs without fully understanding the ramifications of their actions or based on the advice from others. The purpose of this systematic review was to identify the main factors that predicted doping among young people. The literature was systematically reviewed using search engines, manually searching specialist journals, and pearl growing. Fifty-two studies, which included 187,288 young people aged between 10 and 21 years of age, 883 parents of adolescent athletes, and 11 adult coaches, who were interviewed regarding young athletes, were included in this review. Nine factors predicted doping among young people: gender; age; sports participation; sport type; psychological variables; entourage; ethnicity; nutritional supplements; and health harming behaviors. In regards to psychological variables, 22 different constructs were associated with doping among young people. Some psychological constructs were negatively associated with doping (e.g., self-esteem, resisting social pressure, and perfectionist strivings), whereas other were positively associated with doping (e.g., suicide risk, anticipated regret, and aggression). Policy makers and National Anti-Doping Organizations could use these findings to help identify athletes who are more at risk of doping and then expose these individuals to anti-doping education. Based on the current findings, it also appears that education programs should commence at the onset of adolescence or even late childhood, due to the young age in which some individuals start doping. PMID:28676778

  8. Children's First Experience of Taking Anabolic-Androgenic Steroids can Occur before Their 10th Birthday: A Systematic Review Identifying 9 Factors That Predicted Doping among Young People

    Directory of Open Access Journals (Sweden)

    Adam R. Nicholls

    2017-06-01

    Full Text Available Taking performance-enhancing drugs (PEDs can cause serious and irreversible health consequences, which can ultimately lead to premature death. Some young people may take PEDs without fully understanding the ramifications of their actions or based on the advice from others. The purpose of this systematic review was to identify the main factors that predicted doping among young people. The literature was systematically reviewed using search engines, manually searching specialist journals, and pearl growing. Fifty-two studies, which included 187,288 young people aged between 10 and 21 years of age, 883 parents of adolescent athletes, and 11 adult coaches, who were interviewed regarding young athletes, were included in this review. Nine factors predicted doping among young people: gender; age; sports participation; sport type; psychological variables; entourage; ethnicity; nutritional supplements; and health harming behaviors. In regards to psychological variables, 22 different constructs were associated with doping among young people. Some psychological constructs were negatively associated with doping (e.g., self-esteem, resisting social pressure, and perfectionist strivings, whereas other were positively associated with doping (e.g., suicide risk, anticipated regret, and aggression. Policy makers and National Anti-Doping Organizations could use these findings to help identify athletes who are more at risk of doping and then expose these individuals to anti-doping education. Based on the current findings, it also appears that education programs should commence at the onset of adolescence or even late childhood, due to the young age in which some individuals start doping.

  9. Children's First Experience of Taking Anabolic-Androgenic Steroids can Occur before Their 10th Birthday: A Systematic Review Identifying 9 Factors That Predicted Doping among Young People.

    Science.gov (United States)

    Nicholls, Adam R; Cope, Ed; Bailey, Richard; Koenen, Katrin; Dumon, Detlef; Theodorou, Nikolaos C; Chanal, Benoit; Saint Laurent, Delphine; Müller, David; Andrés, Mar P; Kristensen, Annemarie H; Thompson, Mark A; Baumann, Wolfgang; Laurent, Jean-Francois

    2017-01-01

    Taking performance-enhancing drugs (PEDs) can cause serious and irreversible health consequences, which can ultimately lead to premature death. Some young people may take PEDs without fully understanding the ramifications of their actions or based on the advice from others. The purpose of this systematic review was to identify the main factors that predicted doping among young people. The literature was systematically reviewed using search engines, manually searching specialist journals, and pearl growing. Fifty-two studies, which included 187,288 young people aged between 10 and 21 years of age, 883 parents of adolescent athletes, and 11 adult coaches, who were interviewed regarding young athletes, were included in this review. Nine factors predicted doping among young people: gender; age; sports participation; sport type; psychological variables; entourage; ethnicity; nutritional supplements; and health harming behaviors. In regards to psychological variables, 22 different constructs were associated with doping among young people. Some psychological constructs were negatively associated with doping (e.g., self-esteem, resisting social pressure, and perfectionist strivings), whereas other were positively associated with doping (e.g., suicide risk, anticipated regret, and aggression). Policy makers and National Anti-Doping Organizations could use these findings to help identify athletes who are more at risk of doping and then expose these individuals to anti-doping education. Based on the current findings, it also appears that education programs should commence at the onset of adolescence or even late childhood, due to the young age in which some individuals start doping.

  10. Global Microbial Identifier

    DEFF Research Database (Denmark)

    Wielinga, Peter; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2017-01-01

    ) will likely also enable a much better understanding of the pathogenesis of the infection and the molecular basis of the host response to infection. But the full potential of these advances will only transpire if the data in this area become transferable and thereby comparable, preferably in open-source...... of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect outbreaks and emerging pathogens. To harness the full potential of WGS, a shared global database of genomes linked to relevant metadata and the necessary software tools needs to be generated, hence the global...... microbial identifier (GMI) initiative. This tool will ideally be used in amongst others in the diagnosis of infectious diseases in humans and animals, in the identification of microorganisms in food and environment, and to track and trace microbial agents in all arenas globally. This will require...

  11. An evaluation of a diagnostic test to identify the sex of farmed rainbow trout, using sex-specific molecular markers Evaluación de un test diagnóstico para identificar el sexo en truchas arcoíris por medio de marcadores moleculares específicos

    Directory of Open Access Journals (Sweden)

    María E López

    2012-11-01

    Full Text Available In trout farming males exhibits lower growth rate and precocious sexual maturation in contrast to females. Since these traits are detrimental for intensive production, all females populations are most appreciated by fish farmers. Molecular markers sex-specific have been developed for rainbow trout that can be useful to diagnose the phenotypic sex of individuals. We evaluated the use of two SCAR markers (OmyP9 & Omy163, which show polymorphisms between males and females in rainbow trout as a diagnostic test for sexing farmed trout. Adult trout (n = 131 were genotyped to assess the association of the SCAR markers with phenotypic sex. To evaluate the correct performance of the SCAR marker in sex diagnosis, each marker and both were analyzed to estimate its specificity (the proportion of males that are correctly identified, sensitivity (the proportion of females that are correctly identified and predictive value (the probability of the correct positive or negative female identification. Significant associations with phenotypic sex of both SCAR markers with sex were found. The sensitivity and predictive (positive and negative indexes show higher values when both SCAR markers were considered (95.7, 77.4 and 94.4%, respectively. For joined SCAR markers a likelihood ratio (LR+ of 3.43 was obtained indicating its utility to establish a diagnostic test for sexing trout by use of marker-based analysis.En el cultivo de truchas los individuos del sexo masculino presentan menor tasa de crecimiento y maduración sexual precoz, características que no presentan las hembras. Debido a estos rasgos indeseables para el cultivo intensivo, el uso de poblaciones todo hembra es una práctica habitual en el cultivo de truchas. Para trucha arcoíris se han desarrollado marcadores moleculares sexo específico que pueden utilizarse en el diagnóstico temprano del sexo, en condiciones de cultivo. Se evaluó la aplicación de dos marcadores SCAR (OmyP9 y Omy163, que muestran

  12. Magnetismo Molecular (Molecular Magentism)

    Energy Technology Data Exchange (ETDEWEB)

    Reis, Mario S [Universidade Federal Fluminense, Brasil; Moreira Dos Santos, Antonio F [ORNL

    2010-07-01

    The new synthesis processes in chemistry open a new world of research, new and surprising materials never before found in nature can now be synthesized and, as a wonderful result, observed a series of physical phenomena never before imagined. Among these are many new materials the molecular magnets, the subject of this book and magnetic properties that are often reflections of the quantum behavior of these materials. Aside from the wonderful experience of exploring something new, the theoretical models that describe the behavior these magnetic materials are, in most cases, soluble analytically, which allows us to know in detail the physical mechanisms governing these materials. Still, the academic interest in parallel this subject, these materials have a number of properties that are promising to be used in technological devices, such as in computers quantum magnetic recording, magnetocaloric effect, spintronics and many other devices. This volume will journey through the world of molecular magnets, from the structural description of these materials to state of the art research.

  13. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  14. Molecular modeling, dynamics studies and density functional theory approaches to identify potential inhibitors of SIRT4 protein from Homo sapiens : a novel target for the treatment of type 2 diabetes.

    Science.gov (United States)

    Choubey, Sanjay K; Prabhu, Dhamodharan; Nachiappan, Mutharasappan; Biswal, Jayshree; Jeyakanthan, Jeyaraman

    2017-11-01

    Type 2 diabetes is one of the biggest health challenges in the world and WHO projects it to be the 7th leading cause of death in 2030. It is a chronic condition affecting the way our body metabolizes sugar. Insulin resistance is high risk factor marked by expression of Lipoprotein Lipases and Peroxisome Proliferator-Activated Receptor that predisposes to type 2 diabetes. AMP-dependent protein kinase in AMPK signaling pathway is a central sensor of energy status. Deregulation of AMPK signaling leads to inflammation, oxidative stress, and deactivation of autophagy which are implicated in pathogenesis of insulin resistance. SIRT4 protein deactivates AMPK as well as directly inhibits insulin secretion. SIRT4 overexpression leads to dyslipidimeia, decreased fatty acid oxidation, and lipogenesis which are the characteristic features of insulin resistance promoting type 2 diabetes. This makes SIRT4 a novel therapeutic target to control type 2 diabetes. Virtual screening and molecular docking studies were performed to obtain potential ligands. To further optimize the geometry of protein-ligand complexes Quantum Polarized Ligand Docking was performed. Binding Free Energy was calculated for the top three ligand molecules. In view of exploring the stereoelectronic features of the ligand, density functional theory approach was implemented at B3LYP/6-31G* level. 30 ns MD simulation studies of the protein-ligand complexes were done. The present research work proposes ZINC12421989 as potential inhibitor of SIRT4 with docking score (-7.54 kcal/mol), docking energy (-51.34 kcal/mol), binding free energy (-70.21 kcal/mol), and comparatively low energy gap (-0.1786 eV) for HOMO and LUMO indicating reactivity of the lead molecule.

  15. Molecular hematology

    National Research Council Canada - National Science Library

    Provan, Drew; Gribben, John

    2010-01-01

    ... The molecular basis of hemophilia, 219 Paul LF Giangrande 4 The genetics of acute myeloid leukemias, 42 Carolyn J Owen & Jude Fitzgibbon 19 The molecular basis of von Willebrand disease, 233 Luciano Baronc...

  16. L'entourage d'un Fait d'expression Comme Guide a la Traduction ...

    African Journals Online (AJOL)

    Speech is an act of communication. The speech environment consists of the context, situation of communication, mimicry and intonation which surround the act of enunciation resulting in meaning. The translator is always faced with choices to make, but the speech environment helps to delimit speech and enables him ...

  17. New molecular identifiers for Simulium limbatum and Simulium incrustatum s.l. and the detection of genetic substructure with potential implications for onchocerciasis epidemiology in the Amazonia focus of Brazil.

    Science.gov (United States)

    Conceição, Priscila A; Crainey, James L; Almeida, Tatiana P; Shelley, Anthony J; Luz, Sergio L B

    2013-08-01

    The Amazonia onchocerciasis focus of southern Venezuela and northern Brazil is the larger of the two remaining Latin American onchocerciasis foci where disease transmission still occurs and is often regarded as the most challenging of all the Latin American foci to eliminate onchocerciasis. The site is home to a population of over 20,000 semi-nomadic, hunter-gatherer Yanomami people and is made-up of a mosaic of rainforest and savannah ecologies, which are influenced by the area's undulating terrain and rich geological diversity. At least six blackfly vectors have been implicated in onchocerciasis transmission in this focus; however, because of the difficulty in their routine identification the relative importance of each has been obscured. Simulium limbatum and Simulium incrustatum s.l. have both been recorded as vectors in the Amazonia focus, but they are difficult to discriminate morphologically and thus the ecological range of these species, and indeed the presence of S. limbatum in the Amazonia focus at all, have remained controversial. In the work described here, we report 15 S. incrustatum s.l. CO1 sequences and 27 S. limbatum sequences obtained from field-caught adult female blackflies collected from forest and savannah localities, inside and just outside the Amazonia focus. Phylogenetic analysis with the sequences generated in this study, showed that both the S. limbatum and the S. incrustatum s.l. CO1 sequences obtained (even from specimens living in sympatry) all fell into discrete species-specific bootstrap-supported monophyletic groups and thus confirmed the utility of the CO1 gene for identifying both these species inside the Amazonia focus. As the S. limbatum-exclusive cluster included CO1 sequences obtained from forest-caught and morphologically identified specimens these results provide the clearest evidence yet of the presence of S. limbatum inside the Amazonia focus. The question, however, of whether S. limbatum is actually a vector in the focus

  18. Molecular Diagnostics

    OpenAIRE

    Choe, Hyonmin; Deirmengian, Carl A.; Hickok, Noreen J.; Morrison, Tiffany N.; Tuan, Rocky S.

    2015-01-01

    Orthopaedic infections are complex conditions that require immediate diagnosis and accurate identification of the causative organisms to facilitate appropriate management. Conventional methodologies for diagnosis of these infections sometimes lack accuracy or sufficient rapidity. Current molecular diagnostics are an emerging area of bench-to-bedside research in orthopaedic infections. Examples of promising molecular diagnostics include measurement of a specific biomarker in the synovial fluid...

  19. Molecular genetics

    International Nuclear Information System (INIS)

    Parkinson, D.R.; Krontiris, T.G.

    1986-01-01

    In this chapter the authors review new findings concerning the molecular genetics of malignant melanoma in the context of other information obtained from clinical, epidemiologic, and cytogenetic studies in this malignancy. These new molecular approaches promise to provide a more complete understanding of the mechanisms involved in the development of melanoma, thereby suggesting new methods for its treatment and prevention

  20. Molecular Modeling

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 9; Issue 5. Molecular Modeling: A Powerful Tool for Drug Design and Molecular Docking. Rama Rao Nadendla. General Article Volume 9 Issue 5 May 2004 pp 51-60. Fulltext. Click here to view fulltext PDF. Permanent link:

  1. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    OpenAIRE

    Abel, Frida; Dalevi, Daniel; Nethander, Maria; Jörnsten, Rebecka; De Preter, Katleen; Vermeulen, Joëlle; Stallings, Raymond; Kogner, Per; Maris, John; Nilsson, Staffan

    2011-01-01

    Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linke...

  2. Identifying molecular markers associated with stigma characteristics in rice

    Science.gov (United States)

    Stigma characteristics play essential roles in hybrid seed production of rice and marker-assisted breeding plays essential role because they are quantitatively inherited with single-flowered perfect spikelet. Ninety four accessions originated from 47 countries were selected from the USDA rice core c...

  3. Identifying Slow Molecular Motions in Complex Chemical Reactions.

    Science.gov (United States)

    Piccini, GiovanniMaria; Polino, Daniela; Parrinello, Michele

    2017-09-07

    We have studied the cyclization reaction of deprotonated 4-chloro-1-butanethiol to tetrahydrothiophene by means of well-tempered metadynamics. To properly select the collective variables, we used the recently proposed variational approach to conformational dynamics within the framework of metadyanmics. This allowed us to select the appropriate linear combinations from a set of collective variables representing the slow degrees of freedom that best describe the slow modes of the reaction. We performed our calculations at three different temperatures, namely, 300, 350, and 400 K. We show that the choice of such collective variables allows one to easily interpret the complex free-energy surface of such a reaction by univocal identification of the conformers belonging to reactants and product states playing a fundamental role in the reaction mechanism.

  4. Identifying Molecular Targets for PTSD Treatment Using Single Prolonged Stress

    Science.gov (United States)

    2015-10-01

    in the locus coeruleus. Based on our findings we hypothesize that SPS alters glucocorticoid and beta adrenergic receptor (β-AR) expression leading...individual was a recent graduate from PhD training and came with expertise in animal behavioral tests of anxiety . During her first 6 months of work, she has... Anxiety Disorders, 2013, 3,22; Psychopharmacology, 2014, DOI:10.1007/s00213-014-3635-x). Dr. George has also been promoted within the University of

  5. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS

    Science.gov (United States)

    Hepatitis E virus (HEV) is a waterborne emerging pathogen that causes significant illness in the developing world. Thus far, an HEV outbreak has not been reported in the U.S., although a swine variant of the virus is common in Midwestern hogs. Because viruses isolated from two ...

  6. Identifying Molecular Targets For PTSD Treatment Using Single Prolonged Stress

    Science.gov (United States)

    2014-10-01

    Post - traumatic stress disorder ( PTSD ) is a chronic, debilitating psychiatric disorder that can...SPS animals. Post - traumatic stress disorder ( PTSD ) is associated with neurocognitive impairments that have been attributed to functional deficits...and resilience. 2. KEYWORDS Post - traumatic stress disorder , Single Prolonged Stress , Neurobiological Mechanisms 5 3. ACCOMPLISHMENTS

  7. New St-chromosome-specific molecular markers for identifying ...

    Indian Academy of Sciences (India)

    et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

  8. Molecular geometry

    CERN Document Server

    Rodger, Alison

    1995-01-01

    Molecular Geometry discusses topics relevant to the arrangement of atoms. The book is comprised of seven chapters that tackle several areas of molecular geometry. Chapter 1 reviews the definition and determination of molecular geometry, while Chapter 2 discusses the unified view of stereochemistry and stereochemical changes. Chapter 3 covers the geometry of molecules of second row atoms, and Chapter 4 deals with the main group elements beyond the second row. The book also talks about the complexes of transition metals and f-block elements, and then covers the organometallic compounds and trans

  9. Molecular Electronics

    DEFF Research Database (Denmark)

    Jennum, Karsten Stein

    This thesis includes the synthesis and characterisation of organic compounds designed for molecular electronics. The synthesised organic molecules are mainly based on two motifs, the obigo(phenyleneethynylenes) (OPE)s and tetrathiafulvalene (TTF) as shown below. These two scaffolds (OPE and TTF......) are chemically merged together to form cruciform-like structures that are an essential part of the thesis. The cruciform molecules were subjected to molecular conductance measurements to explore their capability towards single-crystal field-effect transistors (Part 1), molecular wires, and single electron......, however, was obtained by a study of a single molecular transistor. The investigated OPE5-TTF compound was captured in a three-terminal experiment, whereby manipulation of the molecule’s electronic spin was possible in different charge states. Thus, we demonstrated how the cruciform molecules could...

  10. Molecular sciences

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    The research in molecular sciences summarized includes photochemistry, radiation chemistry, geophysics, electromechanics, heavy-element oxidizers , heavy element chemistry collisions, atoms, organic solids. A list of publications is included

  11. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  12. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  13. Molecular fountain.

    Energy Technology Data Exchange (ETDEWEB)

    Strecker, Kevin E.; Chandler, David W.

    2009-09-01

    A molecular fountain directs slowly moving molecules against gravity to further slow them to translational energies that they can be trapped and studied. If the molecules are initially slow enough they will return some time later to the position from which they were launched. Because this round trip time can be on the order of a second a single molecule can be observed for times sufficient to perform Hz level spectroscopy. The goal of this LDRD proposal was to construct a novel Molecular Fountain apparatus capable of producing dilute samples of molecules at near zero temperatures in well-defined user-selectable, quantum states. The slowly moving molecules used in this research are produced by the previously developed Kinematic Cooling technique, which uses a crossed atomic and molecular beam apparatus to generate single rotational level molecular samples moving slowly in the laboratory reference frame. The Kinematic Cooling technique produces cold molecules from a supersonic molecular beam via single collisions with a supersonic atomic beam. A single collision of an atom with a molecule occurring at the correct energy and relative velocity can cause a small fraction of the molecules to move very slowly vertically against gravity in the laboratory. These slowly moving molecules are captured by an electrostatic hexapole guiding field that both orients and focuses the molecules. The molecules are focused into the ionization region of a time-of-flight mass spectrometer and are ionized by laser radiation. The new molecular fountain apparatus was built utilizing a new design for molecular beam apparatus that has allowed us to miniaturize the apparatus. This new design minimizes the volumes and surface area of the machine allowing smaller pumps to maintain the necessary background pressures needed for these experiments.

  14. Molecular docking.

    Science.gov (United States)

    Morris, Garrett M; Lim-Wilby, Marguerita

    2008-01-01

    Molecular docking is a key tool in structural molecular biology and computer-assisted drug design. The goal of ligand-protein docking is to predict the predominant binding mode(s) of a ligand with a protein of known three-dimensional structure. Successful docking methods search high-dimensional spaces effectively and use a scoring function that correctly ranks candidate dockings. Docking can be used to perform virtual screening on large libraries of compounds, rank the results, and propose structural hypotheses of how the ligands inhibit the target, which is invaluable in lead optimization. The setting up of the input structures for the docking is just as important as the docking itself, and analyzing the results of stochastic search methods can sometimes be unclear. This chapter discusses the background and theory of molecular docking software, and covers the usage of some of the most-cited docking software.

  15. Evolutionary molecular medicine.

    Science.gov (United States)

    Nesse, Randolph M; Ganten, Detlev; Gregory, T Ryan; Omenn, Gilbert S

    2012-05-01

    Evolution has long provided a foundation for population genetics, but some major advances in evolutionary biology from the twentieth century that provide foundations for evolutionary medicine are only now being applied in molecular medicine. They include the need for both proximate and evolutionary explanations, kin selection, evolutionary models for cooperation, competition between alleles, co-evolution, and new strategies for tracing phylogenies and identifying signals of selection. Recent advances in genomics are transforming evolutionary biology in ways that create even more opportunities for progress at its interfaces with genetics, medicine, and public health. This article reviews 15 evolutionary principles and their applications in molecular medicine in hopes that readers will use them and related principles to speed the development of evolutionary molecular medicine.

  16. Molecular modeling

    Directory of Open Access Journals (Sweden)

    Aarti Sharma

    2009-01-01

    Full Text Available The use of computational chemistry in the development of novel pharmaceuticals is becoming an increasingly important tool. In the past, drugs were simply screened for effectiveness. The recent advances in computing power and the exponential growth of the knowledge of protein structures have made it possible for organic compounds to be tailored to decrease the harmful side effects and increase the potency. This article provides a detailed description of the techniques employed in molecular modeling. Molecular modeling is a rapidly developing discipline, and has been supported by the dramatic improvements in computer hardware and software in recent years.

  17. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  18. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  19. Molecular spectroscopy

    International Nuclear Information System (INIS)

    Kokh, Eh.; Zonntag, B.

    1981-01-01

    The latest investigation results on molecular spectroscopy with application of synchrotron radiation in the region of vacuum ultraviolet are generalized. Some results on investigation of excited, superexcited and ionized molecule states with the use of adsorption spectroscopy, photoelectron spectroscopy, by fluorescent and mass-spectrometric methods are considered [ru

  20. Molecular farming

    NARCIS (Netherlands)

    Merck, K.B.; Vereijken, J.M.

    2006-01-01

    Molecular Farming is a new and emerging technology that promises relatively cheap and flexible production of large quantities of pharmaceuticals in genetically modified plants. Many stakeholders are involved in the production of pharmaceuticals in plants, which complicates the discussion on the

  1. Molecular gastronomy

    Science.gov (United States)

    This, Hervé

    2005-01-01

    For centuries, cooks have been applying recipes without looking for the mechanisms of the culinary transformations. A scientific discipline that explores these changes from raw ingredients to eating the final dish, is developing into its own field, termed molecular gastronomy. Here, one of the founders of the discipline discusses its aims and importance.

  2. Molecular Star

    Indian Academy of Sciences (India)

    In molecular self-assembly, molecules put themselves together in a predefined way ... work has been already published in Chemistry- A European Jour- nal in the September ... prevalent in matter ranging from atoms to molecules to biomolecules; it is also ... erate chemical forces are reversible and dynamic in nature mean-.

  3. Molecular ferromagnetism

    International Nuclear Information System (INIS)

    Epstein, A.J.

    1990-01-01

    This past year has been one of substantial advancement in both the physics and chemistry of molecular and polymeric ferromagnets. The specific heat studies of (DMeFc)(TCNE) have revealed a cusp at the three-dimensional ferromagnetic transition temperature with a crossover to primarily 1-D behavior at higher temperatures. This paper discusses these studies

  4. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  5. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  6. Molecular markers in glioma.

    Science.gov (United States)

    Ludwig, Kirsten; Kornblum, Harley I

    2017-09-01

    Gliomas are the most malignant and aggressive form of brain tumors, and account for the majority of brain cancer related deaths. Malignant gliomas, including glioblastoma are treated with radiation and temozolomide, with only a minor benefit in survival time. A number of advances have been made in understanding glioma biology, including the discovery of cancer stem cells, termed glioma stem cells (GSC). Some of these advances include the delineation of molecular heterogeneity both between tumors from different patients as well as within tumors from the same patient. Such research highlights the importance of identifying and validating molecular markers in glioma. This review, intended as a practical resource for both clinical and basic investigators, summarizes some of the more well-known molecular markers (MGMT, 1p/19q, IDH, EGFR, p53, PI3K, Rb, and RAF), discusses how they are identified, and what, if any, clinical relevance they may have, in addition to discussing some of the specific biology for these markers. Additionally, we discuss identification methods for studying putative GSC's (CD133, CD15, A2B5, nestin, ALDH1, proteasome activity, ABC transporters, and label-retention). While much research has been done on these markers, there is still a significant amount that we do not yet understand, which may account for some conflicting reports in the literature. Furthermore, it is unlikely that the investigator will be able to utilize one single marker to prospectively identify and isolate GSC from all, or possibly, any gliomas.

  7. Molecular Modelling

    Directory of Open Access Journals (Sweden)

    Aarti Sharma

    2009-12-01

    Full Text Available

    The use of computational chemistry in the development of novel pharmaceuticals is becoming an increasingly important
    tool. In the past, drugs were simply screened for effectiveness. The recent advances in computing power and
    the exponential growth of the knowledge of protein structures have made it possible for organic compounds to tailored to
    decrease harmful side effects and increase the potency. This article provides a detailed description of the techniques
    employed in molecular modeling. Molecular modelling is a rapidly developing discipline, and has been supported from
    the dramatic improvements in computer hardware and software in recent years.

  8. Molecular pathology and thyroid FNA.

    Science.gov (United States)

    Poller, D N; Glaysher, S

    2017-12-01

    This review summarises molecular pathological techniques applicable to thyroid FNA. The molecular pathology of thyroid tumours is now fairly well understood. Molecular methods may be used as a rule-in test for diagnosis of malignancy in thyroid nodules, eg BRAF V600E point mutation, use of a seven-gene mutational panel (BRAF V600E, RAS genes, RET/PTC or PAX8/PPARG rearrangement), or as a comprehensive multigene next-generation sequencing panel, eg ThyroSeq v2. Molecular methods can also be applied as rule-out tests for malignancy in thyroid nodules, eg Afirma or ThyroSeq v2 or as markers of prognosis, eg TERT promoter mutation or other gene mutations including BRAF V600E, TP53 and AKT1, and as tests for newly defined tumour entities such as non-invasive follicular thyroid neoplasm with papillary like nuclei, or as a molecular marker(s) for targeted therapies. This review describes practical examples of molecular techniques as applied to thyroid FNA in routine clinical practice and the value of molecular diagnostics in thyroid FNA. It describes the range of molecular abnormalities identified in thyroid nodules and thyroid cancers with some practical applications of molecular methods to diagnosis and prognosis of thyroid nodules and thyroid cancer. © 2017 John Wiley & Sons Ltd.

  9. Molecular scale

    Directory of Open Access Journals (Sweden)

    Christopher H. Childers

    2016-03-01

    Full Text Available This manuscript demonstrates the molecular scale cure rate dependence of di-functional epoxide based thermoset polymers cured with amines. A series of cure heating ramp rates were used to determine the influence of ramp rate on the glass transition temperature (Tg and sub-Tg transitions and the average free volume hole size in these systems. The networks were comprised of 3,3′-diaminodiphenyl sulfone (33DDS and diglycidyl ether of bisphenol F (DGEBF and were cured at ramp rates ranging from 0.5 to 20 °C/min. Differential scanning calorimetry (DSC and NIR spectroscopy were used to explore the cure ramp rate dependence of the polymer network growth, whereas broadband dielectric spectroscopy (BDS and free volume hole size measurements were used to interrogate networks’ molecular level structural variations upon curing at variable heating ramp rates. It was found that although the Tg of the polymer matrices was similar, the NIR and DSC measurements revealed a strong correlation for how these networks grow in relation to the cure heating ramp rate. The free volume analysis and BDS results for the cured samples suggest differences in the molecular architecture of the matrix polymers due to cure heating rate dependence.

  10. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  11. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  12. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  13. Spintronics: The molecular way

    Science.gov (United States)

    Cornia, Andrea; Seneor, Pierre

    2017-05-01

    Molecular spintronics is an interdisciplinary field at the interface between organic spintronics, molecular magnetism, molecular electronics and quantum computing, which is advancing fast and promises large technological payoffs.

  14. Identifying phenomenal consciousness.

    Science.gov (United States)

    Schier, Elizabeth

    2009-03-01

    This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.

  15. Molecular studies of achondroplasia

    Directory of Open Access Journals (Sweden)

    Nahar Risha

    2009-01-01

    Full Text Available Background: Achondroplasia (ACH is the most frequent form of short-limbed dwarfi sm, caused by mutations in the FGFR3 gene. It follows an autosomal dominant inheritance, though most cases are sporadic. The molecular techniques are the only available methods to confi rm the diagnosis of a skeletal dysplasia. Clinical and radiological features are only suggestive and not confi rmatory. The present study was conducted to fi nd out how often the clinical diagnosis of achondroplasia is verifi ed on molecular studies. Materials and Methods: From 1998 through 2007, we carried out molecular analysis for the two common mutations in the FGFR3 gene in 130 cases clinically suspected to have ACH. Results: A diagnostic mutation was identifi ed in 53 (40.8% cases. The common mutation (1138G>A was present in 50 (94.7% of the positive cases, while the rare 1138 G>C substitution was found in three (5.3%. Conclusion: This study shows that confi rmation of clinical diagnosis of ACH by molecular genetic testing is essential to distinguish it from other skeletal dysplasias, to plan therapeutic options, and to offer genetic counseling. Management (medical and surgical in patients confi rmed to have ACH, is briefl y discussed.

  16. Molecular diagnosis and immunotherapy.

    Science.gov (United States)

    Sastre, Joaquín; Sastre-Ibañez, Marina

    2016-12-01

    To describe recent insights into how molecular diagnosis can improve indication and selection of suitable allergens for specific immunotherapy and increase the safety of this therapy. As specific allergen immunotherapy targets specific allergens, identification of the disease-eliciting allergen is a prerequisite for accurate prescription of treatment. In areas of complex sensitization to aeroallergens or in cases of hymenoptera venom allergy, the use of molecular diagnosis has demonstrated that it may lead to a change in indication and selection of allergens for immunotherapy in a large proportion of patients when compared with diagnosis based on skin prick testing and/or specific IgE determination with commercial extracts. These changes in immunotherapy prescription aided by molecular diagnosis have been demonstrated to be cost-effective in some scenarios. Certain patterns of sensitization to grass or olive pollen and bee allergens may identify patients with higher risk of adverse reaction during immunotherapy. Molecular diagnosis, when used with other tools and patients' clinical records, can help clinicians better to select the most appropriate patients and allergens for specific immunotherapy and, in some cases, predict the risk of adverse reactions. The pattern of sensitization to allergens could potentially predict the efficacy of allergen immunotherapy provided that these immunotherapy products contain a sufficient amount of these allergens. Nevertheless, multiplex assay remains a third-level approach, not to be used as screening method in current practice.

  17. Molecular radio-oncology

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Michael; Krause, Mechthild; Cordes, Nils (eds.) [Technische Univ. Dresden (Germany). Faculty of Medicine and University Hospital

    2016-07-01

    This book concisely reviews our current understanding of hypoxia, molecular targeting, DNA repair, cancer stem cells, and tumor pathophysiology, while also discussing novel strategies for putting these findings into practice in daily clinical routine. Radiotherapy is an important part of modern multimodal cancer treatment, and the past several years have witnessed not only substantial improvements in radiation techniques and the use of new beam qualities, but also major strides in our understanding of molecular tumor biology and tumor radiation response. Against this backdrop, the book highlights recent efforts to identify reasonable and clinically applicable biomarkers using broad-spectrum tissue microarrays and high-throughput systems biology approaches like genomics and epigenomics. In particular, it describes in detail how such molecular information is now being exploited for diagnostic imaging and imaging throughout treatment using the example of positron emission tomography. By discussing all these issues in the context of modern radiation oncology, the book provides a broad, up-to-date overview of the molecular aspects of radiation oncology that will hopefully foster its further optimization.

  18. Molecular radio-oncology

    International Nuclear Information System (INIS)

    Baumann, Michael; Krause, Mechthild; Cordes, Nils

    2016-01-01

    This book concisely reviews our current understanding of hypoxia, molecular targeting, DNA repair, cancer stem cells, and tumor pathophysiology, while also discussing novel strategies for putting these findings into practice in daily clinical routine. Radiotherapy is an important part of modern multimodal cancer treatment, and the past several years have witnessed not only substantial improvements in radiation techniques and the use of new beam qualities, but also major strides in our understanding of molecular tumor biology and tumor radiation response. Against this backdrop, the book highlights recent efforts to identify reasonable and clinically applicable biomarkers using broad-spectrum tissue microarrays and high-throughput systems biology approaches like genomics and epigenomics. In particular, it describes in detail how such molecular information is now being exploited for diagnostic imaging and imaging throughout treatment using the example of positron emission tomography. By discussing all these issues in the context of modern radiation oncology, the book provides a broad, up-to-date overview of the molecular aspects of radiation oncology that will hopefully foster its further optimization.

  19. Identifying salt stress-responsive transcripts from Roselle ( Hibiscus ...

    African Journals Online (AJOL)

    Hibiscus sabdariffa L.). Identifying the potentially novel transcripts responsible for salt stress tolerance in roselle will increase knowledge of the molecular mechanism underlying salt stress responses. In this study, differential display reverse ...

  20. TCGA study identifies genomic features of cervical cancer

    Science.gov (United States)

    Investigators with The Cancer Genome Atlas (TCGA) Research Network have identified novel genomic and molecular characteristics of cervical cancer that will aid in subclassification of the disease and may help target therapies that are most appropriate for each patient.

  1. Molecular nanomagnets

    CERN Document Server

    Gatteschi, Dante; Villain, Jacques

    2006-01-01

    Nanomagnetism is a rapidly expanding area of research which appears to be able to provide novel applications. Magnetic molecules are at the very bottom of the possible size of nanomagnets and they provide a unique opportunity to observe the coexistence of classical and quantum properties. The discovery in the early 90's that a cluster comprising twelve manganese ions shows hysteresis of molecular origin, and later proved evidence of quantum effects, opened a new research area whichis still flourishing through the collaboration of chemists and physicists. This book is the first attempt to cover

  2. Molecular plasmonics

    CERN Document Server

    Fritzsche, Wolfgang

    2014-01-01

    Adopting a novel approach, this book provides a unique ""molecular perspective"" on plasmonics, concisely presenting the fundamentals and applications in a way suitable for beginners entering this hot field as well as for experienced researchers and practitioners. It begins by introducing readers to the optical effects that occur at the nanoscale and particularly their modification in the presence of biomolecules, followed by a concise yet thorough overview of the different methods for the actual fabrication of nanooptical materials. Further chapters address the relevant nanooptics, as well as

  3. EVOLUTIONARY FOUNDATIONS FOR MOLECULAR MEDICINE

    Science.gov (United States)

    Nesse, Randolph M.; Ganten, Detlev; Gregory, T. Ryan; Omenn, Gilbert S.

    2015-01-01

    Evolution has long provided a foundation for population genetics, but many major advances in evolutionary biology from the 20th century are only now being applied in molecular medicine. They include the distinction between proximate and evolutionary explanations, kin selection, evolutionary models for cooperation, and new strategies for tracing phylogenies and identifying signals of selection. Recent advances in genomics are further transforming evolutionary biology and creating yet more opportunities for progress at the interface of evolution with genetics, medicine, and public health. This article reviews 15 evolutionary principles and their applications in molecular medicine in hopes that readers will use them and others to speed the development of evolutionary molecular medicine. PMID:22544168

  4. List identifies threatened ecosystems

    Science.gov (United States)

    Showstack, Randy

    2012-09-01

    The International Union for Conservation of Nature (IUCN) announced on 9 September that it will develop a new Red List of Ecosystems that will identify which ecosystems are vulnerable or endangered. The list, which is modeled on the group's Red List of Threatened Species™, could help to guide conservation activities and influence policy processes such as the Convention on Biological Diversity, according to the group. “We will assess the status of marine, terrestrial, freshwater, and subterranean ecosystems at local, regional, and global levels,” stated Jon Paul Rodriguez, leader of IUCN's Ecosystems Red List Thematic Group. “The assessment can then form the basis for concerted implementation action so that we can manage them sustainably if their risk of collapse is low or restore them if they are threatened and then monitor their recovery.”

  5. Radiograph identifying means

    International Nuclear Information System (INIS)

    Sheldon, A.D.

    1983-01-01

    A flexible character-indentable plastics embossing tape is backed by and bonded to a lead strip, not more than 0.025 inches thick, to form a tape suitable for identifying radiographs. The lead strip is itself backed by a relatively thin and flimsy plastics or fabric strip which, when removed, allows the lead plastic tape to be pressure-bonded to the surface to be radiographed. A conventional tape-embossing gun is used to indent the desired characters in succession into the lead-backed tape, without necessarily severing the lead; and then the backing strip is peeled away to expose the layer of adhesive which pressure-bonds the indented tape to the object to be radiographed. X-rays incident on the embossed tape will cause the raised characters to show up dark on the subsequently-developed film, whilst the raised side areas will show up white. Each character will thus stand out on the developed film. (author)

  6. Bringing molecules back into molecular evolution.

    Directory of Open Access Journals (Sweden)

    Claus O Wilke

    Full Text Available Much molecular-evolution research is concerned with sequence analysis. Yet these sequences represent real, three-dimensional molecules with complex structure and function. Here I highlight a growing trend in the field to incorporate molecular structure and function into computational molecular-evolution work. I consider three focus areas: reconstruction and analysis of past evolutionary events, such as phylogenetic inference or methods to infer selection pressures; development of toy models and simulations to identify fundamental principles of molecular evolution; and atom-level, highly realistic computational modeling of molecular structure and function aimed at making predictions about possible future evolutionary events.

  7. Progress on molecular imaging

    International Nuclear Information System (INIS)

    Chen Quan; Zhang Yongxue

    2011-01-01

    Molecular imaging is a new era of medical imaging,which can non-invasively monitor biological processes at the cellular and molecular level in vivo, including molecular imaging of nuclear medicine, magnetic resonance molecular imaging, ultrasound molecular imaging,optical molecular imaging and molecular imaging with X-ray. Recently, with the development of multi-subjects amalgamation, multimodal molecular imaging technology has been applied in clinical imaging, such as PET-CT and PET-MRI. We believe that with development of molecular probe and multi-modal imaging, more and more molecular imaging techniques will be applied in clinical diagnosis and treatment. (authors)

  8. Molecular imaging: current status and emerging strategies

    International Nuclear Information System (INIS)

    Pysz, M.A.; Gambhir, S.S.; Willmann, J.K.

    2010-01-01

    In vivo molecular imaging has a great potential to impact medicine by detecting diseases in early stages (screening), identifying extent of disease, selecting disease- and patient-specific treatment (personalized medicine), applying a directed or targeted therapy, and measuring molecular-specific effects of treatment. Current clinical molecular imaging approaches primarily use positron-emission tomography (PET) or single photon-emission computed tomography (SPECT)-based techniques. In ongoing preclinical research, novel molecular targets of different diseases are identified and, sophisticated and multifunctional contrast agents for imaging these molecular targets are developed along with new technologies and instrumentation for multi-modality molecular imaging. Contrast-enhanced molecular ultrasound (US) with molecularly-targeted contrast microbubbles is explored as a clinically translatable molecular imaging strategy for screening, diagnosing, and monitoring diseases at the molecular level. Optical imaging with fluorescent molecular probes and US imaging with molecularly-targeted microbubbles are attractive strategies as they provide real-time imaging, are relatively inexpensive, produce images with high spatial resolution, and do not involve exposure to ionizing irradiation. Raman spectroscopy/microscopy has emerged as a molecular optical imaging strategy for ultrasensitive detection of multiple biomolecules/biochemicals with both in vivo and ex vivo versatility. Photoacoustic imaging is a hybrid of optical and US techniques involving optically-excitable molecularly-targeted contrast agents and quantitative detection of resulting oscillatory contrast agent movement with US. Current preclinical findings and advances in instrumentation, such as endoscopes and microcatheters, suggest that these molecular imaging methods have numerous potential clinical applications and will be translated into clinical use in the near future.

  9. Molecular profiling of intrahepatic cholangiocarcinoma

    DEFF Research Database (Denmark)

    Oliveira, Douglas V N P; Zhang, Shanshan; Chen, Xin

    2017-01-01

    . Areas covered: The present review article outlines the main studies and resulting discoveries on the molecular profiling of iCCA, with a special emphasis on the different techniques used for this purpose, the diagnostic and prognostic markers identified, as well as the genes and pathways that could......INTRODUCTION: Intrahepatic cholangiocarcinoma (iCCA) is the second most frequent primary tumor of the liver and a highly lethal disease. Therapeutic options for advanced iCCA are limited and ineffective due to the largely incomplete understanding of the molecular pathogenesis of this deadly tumor...... be potentially targeted with innovative therapies. Expert commentary: Molecular profiling has led to the identification of distinct iCCA subtypes, characterized by peculiar genetic alterations and transcriptomic features. Targeted therapies against some of the identified genes are ongoing and hold great promise...

  10. Molecular Electronic Terms and Molecular Orbital Configurations.

    Science.gov (United States)

    Mazo, R. M.

    1990-01-01

    Discussed are the molecular electronic terms which can arise from a given electronic configuration. Considered are simple cases, molecular states, direct products, closed shells, and open shells. Two examples are provided. (CW)

  11. Identifying novel drug indications through automated reasoning.

    Directory of Open Access Journals (Sweden)

    Luis Tari

    Full Text Available With the large amount of pharmacological and biological knowledge available in literature, finding novel drug indications for existing drugs using in silico approaches has become increasingly feasible. Typical literature-based approaches generate new hypotheses in the form of protein-protein interactions networks by means of linking concepts based on their cooccurrences within abstracts. However, this kind of approaches tends to generate too many hypotheses, and identifying new drug indications from large networks can be a time-consuming process.In this work, we developed a method that acquires the necessary facts from literature and knowledge bases, and identifies new drug indications through automated reasoning. This is achieved by encoding the molecular effects caused by drug-target interactions and links to various diseases and drug mechanism as domain knowledge in AnsProlog, a declarative language that is useful for automated reasoning, including reasoning with incomplete information. Unlike other literature-based approaches, our approach is more fine-grained, especially in identifying indirect relationships for drug indications.To evaluate the capability of our approach in inferring novel drug indications, we applied our method to 943 drugs from DrugBank and asked if any of these drugs have potential anti-cancer activities based on information on their targets and molecular interaction types alone. A total of 507 drugs were found to have the potential to be used for cancer treatments. Among the potential anti-cancer drugs, 67 out of 81 drugs (a recall of 82.7% are indeed known cancer drugs. In addition, 144 out of 289 drugs (a recall of 49.8% are non-cancer drugs that are currently tested in clinical trials for cancer treatments. These results suggest that our method is able to infer drug indications (original or alternative based on their molecular targets and interactions alone and has the potential to discover novel drug indications for

  12. SPARQL-enabled identifier conversion with Identifiers.org

    Science.gov (United States)

    Wimalaratne, Sarala M.; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-01-01

    Motivation: On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. Results: We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. Availability and implementation: The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. Contact: sarala@ebi.ac.uk PMID:25638809

  13. SPARQL-enabled identifier conversion with Identifiers.org.

    Science.gov (United States)

    Wimalaratne, Sarala M; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-06-01

    On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. © The Author 2015. Published by Oxford University Press.

  14. An ab initio molecular

    Indian Academy of Sciences (India)

    mechanisms of two molecular crystals: An ab initio molecular dynamics ... for Computation in Molecular and Materials Science and Department of Chemistry, School of ..... NSAF Foundation of National Natural Science Foun- ... Matter 14 2717.

  15. Fungal peroxidases : molecular aspects and applications

    NARCIS (Netherlands)

    Conesa, A.; Punt, P.J.; Hondel, C.A.M.J.J.

    2002-01-01

    Peroxidases are oxidoreductases that utilize hydrogen peroxide to catalyze oxidative reactions. A large number of peroxidases have been identified in fungal species and are being characterized at the molecular level. In this manuscript we review the current knowledge on the molecular aspects of this

  16. Molecular Nevogenesis

    Directory of Open Access Journals (Sweden)

    Andrew L. Ross

    2011-01-01

    Full Text Available Despite recent advances, the biology underlying nevogenesis remains unclear. Activating mutations in NRAS, HRAS, BRAF, and GNAQ have been identified in benign nevi. Their presence roughly correlates with congenital, Spitz, acquired, and blue nevi, respectively. These mutations are likely to play a critical role in driving nevogenesis. While each mutation is able to activate the MAP kinase pathway, they also interact with a host of different proteins in other pathways. The different melanocytic developmental pathways activated by each mutation cause the cells to migrate, proliferate, and differentiate to different extents within the skin. This causes each mutation to give rise to a characteristic growth pattern. The exact location and differentiation state of the cell of origin for benign moles remains to be discovered. Further research is necessary to fully understand nevus development given that most of the same developmental pathways are also present in melanoma.

  17. Molecular sieving through a graphene nanopore: non-equilibrium molecular dynamics simulation

    Institute of Scientific and Technical Information of China (English)

    Chengzhen Sun; Bofeng Bai

    2017-01-01

    Two-dimensional graphene nanopores have shown great promise as ultra-permeable molecular sieves based on their size-sieving effects.We design a nitrogen/hydrogen modified graphene nanopore and conduct a transient non-equilibrium molecular dynamics simulation on its molecular sieving effects.The distinct time-varying molecular crossing numbers show that this special nanopore can efficiently sieve CO2 and H2S molecules from CH4 molecules with high selectivity.By analyzing the molecular structure and pore functionalization-related molecular orientation and permeable zone in the nanopore,density distribution in the molecular adsorption layer on the graphene surface,as well as other features,the molecular sieving mechanisms of graphene nanopores are revealed.Finally,several implications on the design of highly-efficient graphene nanopores,especially for determining the porosity and chemical functionalization,as gas separation membranes are summarized based on the identified phenomena and mechanisms.

  18. [Advance in molecular biology of Dendrobium (Orchidaceae)].

    Science.gov (United States)

    Li, Qing; Li, Biao; Guo, Shun-Xing

    2016-08-01

    With the development of molecular biology, the process in molecular biology research of Dendrobium is going fast. Not only did it provide new ways to identify Dendrobium quickly, reveal the genetic diversity and relationship of Dendrobium, but also lay the vital foundation for explaining the mechanism of Dendrobium growth and metabolism. The present paper reviews the recent process in molecular biology research of Dendrobium from three aspects, including molecular identification, genetic diversity and functional genes. And this review will facilitate the development of this research area and Dendrobium. Copyright© by the Chinese Pharmaceutical Association.

  19. THE CALIFORNIA MOLECULAR CLOUD

    International Nuclear Information System (INIS)

    Lada, Charles J.; Lombardi, Marco; Alves, Joao F.

    2009-01-01

    We present an analysis of wide-field infrared extinction maps of a region in Perseus just north of the Taurus-Auriga dark cloud complex. From this analysis we have identified a massive, nearby, but previously unrecognized, giant molecular cloud (GMC). Both a uniform foreground star density and measurements of the cloud's velocity field from CO observations indicate that this cloud is likely a coherent structure at a single distance. From comparison of foreground star counts with Galactic models, we derive a distance of 450 ± 23 pc to the cloud. At this distance the cloud extends over roughly 80 pc and has a mass of ∼ 10 5 M sun , rivaling the Orion (A) molecular cloud as the largest and most massive GMC in the solar neighborhood. Although surprisingly similar in mass and size to the more famous Orion molecular cloud (OMC) the newly recognized cloud displays significantly less star formation activity with more than an order of magnitude fewer young stellar objects than found in the OMC, suggesting that both the level of star formation and perhaps the star formation rate in this cloud are an order of magnitude or more lower than in the OMC. Analysis of extinction maps of both clouds shows that the new cloud contains only 10% the amount of high extinction (A K > 1.0 mag) material as is found in the OMC. This, in turn, suggests that the level of star formation activity and perhaps the star formation rate in these two clouds may be directly proportional to the total amount of high extinction material and presumably high density gas within them and that there might be a density threshold for star formation on the order of n(H 2 ) ∼ a few x 10 4 cm -3 .

  20. Molecular HIV screening.

    Science.gov (United States)

    Bourlet, Thomas; Memmi, Meriam; Saoudin, Henia; Pozzetto, Bruno

    2013-09-01

    Nuclear acid testing is more and more used for the diagnosis of infectious diseases. This paper focuses on the use of molecular tools for HIV screening. The term 'screening' will be used under the meaning of first-line HIV molecular techniques performed on a routine basis, which excludes HIV molecular tests designed to confirm or infirm a newly discovered HIV-seropositive patient or other molecular tests performed for the follow-up of HIV-infected patients. The following items are developed successively: i) presentation of the variety of molecular tools used for molecular HIV screening, ii) use of HIV molecular tools for the screening of blood products, iii) use of HIV molecular tools for the screening of organs and tissue from human origin, iv) use of HIV molecular tools in medically assisted procreation and v) use of HIV molecular tools in neonates from HIV-infected mothers.

  1. Understanding molecular structure from molecular mechanics.

    Science.gov (United States)

    Allinger, Norman L

    2011-04-01

    Molecular mechanics gives us a well known model of molecular structure. It is less widely recognized that valence bond theory gives us structures which offer a direct interpretation of molecular mechanics formulations and parameters. The electronic effects well-known in physical organic chemistry can be directly interpreted in terms of valence bond structures, and hence quantitatively calculated and understood. The basic theory is outlined in this paper, and examples of the effects, and their interpretation in illustrative examples is presented.

  2. Molecular mechanisms in gliomagenesis

    DEFF Research Database (Denmark)

    Hulleman, Esther; Helin, Kristian

    2005-01-01

    Glioma, and in particular high-grade astrocytoma termed glioblastoma multiforme (GBM), is the most common primary tumor of the brain. Primarily because of its diffuse nature, there is no effective treatment for GBM, and relatively little is known about the processes by which it develops. Therefore......, in order to design novel therapies and treatments for GBM, research has recently intensified to identify the cellular and molecular mechanisms leading to GBM formation. Modeling of astrocytomas by genetic manipulation of mice suggests that deregulation of the pathways that control gliogenesis during normal...... brain development, such as the differentiation of neural stem cells (NSCs) into astrocytes, might contribute to GBM formation. These pathways include growth factor-induced signal transduction routes and processes that control cell cycle progression, such as the p16-CDK4-RB and the ARF-MDM2-p53 pathways...

  3. Molecular mechanisms of carcinogenesis

    International Nuclear Information System (INIS)

    Hall, E.J.

    1997-01-01

    The possibility that chromosomal changes are responsible for neoplasia was proposed in the early years of this century. A combination of improved cytogenetics and the advent of recombinant technology has settled the issue. As recently as 20 years ago, however, the genetic and molecular basis of familiar predisposition to cancer were a mystery, and it is only in the last few years that light has been shed on a few specific types of malignancies. As the genetic basis of human cancer had been documented, a number of genes have been identified as functioning either as oncogenes which act in a dominant fashion to promote tumor growth when mutated, or as tumor suppressor genes which act in a recessive fashion

  4. Molecular genetics of craniosynostosis

    Science.gov (United States)

    Caterine; Auerkari, Elza Ibrahim

    2018-03-01

    Tight regulation process and complex interplay occur along the osteogenic interfaces of the cranial sutures in normal growth and development of the skull. Cranial sutures serve as sites of bone growth while maintaining a state of patency to accommodate the developing brain. Cranial sutures are fibro-cellular structures that separate the rigid plates of the skull bones. Premature fusion of one or more cranial sutures leads to a condition known as craniosynostosis. Craniosynostosis is one of the most common craniofacial anomalies with a prevalence of 1 in 2,500 newborns. Several genes have been identified in the pathogenesis of craniosynostosis. Molecular signaling events and the intracellular signal transduction pathways implicated in the suture pathobiology will provide a useful approach for therapeutic targeting.

  5. A review of molecular biomarkers for bladder cancer | Miakhil ...

    African Journals Online (AJOL)

    Background: Numerous molecular markers for bladder cancer have been identified and investigated with various laboratory techniques. Molecular markers are isolated from tissue, serum and urine. They fall into proteomic, genetic and epigenetic categories. Some of molecular markers show promising results in terms of ...

  6. Guidelines on the use of molecular genetics in reintroduction programs

    Science.gov (United States)

    Michael K. Schwartz

    2005-01-01

    The use of molecular genetics can play a key role in reintroduction efforts. Prior to the introduction of any individuals, molecular genetics can be used to identify the most appropriate source population for the reintroduction, ensure that no relic populations exist in the reintroduction area, and guide captive breeding programs. The use of molecular genetics post-...

  7. Molecular outflows in the L1641 region of Orion

    International Nuclear Information System (INIS)

    Morgan, J.A.

    1990-01-01

    Little is known about the interaction between molecular outflows associated with young stellar objects and the parent molecular cloud that produced them. This is because molecular outflows are a recently discovered phenomenon and, so, have not had their global properties studied in great detail and molecular clouds were not mapped to sufficiently high spatial resolution to resolve the interaction. The interaction between molecular outflows and the L1641 molecular cloud is addressed by both identifying and mapping all the molecular outflows as well as the detailed structure of the cloud. Candidate molecular outflows were found from single point 12-CO observations of young stellar objects identified from the IRAS survey data. The candidate sources were then mapped to confirm their molecular outflow nature. From these maps, molecular outflow characteristics such as their morphology, orientation, and energetics were determined. In addition, the Orion molecular cloud was mapped to compare directly with the molecular outflows. The molecular outflows identified were found to have rising infrared spectra, radio continuum emission that suggests a stellar wind or optically thick H II region, and molecular line strengths that indicate that they are embedded within a very dense environment. The lack of an optical counterpart for many molecular outflows suggests that they occur at the earliest stages of stellar evolution. The lack of an optical counterpart for many molecular outflows suggest that they occur at the earliest stages of stellar evolution. The orientations of the molecular outflows appear to lie in no preferred direction and they have shapes that indicate that the molecular cloud is responsible for determining their direction and collimation

  8. Near Identifiability of Dynamical Systems

    Science.gov (United States)

    Hadaegh, F. Y.; Bekey, G. A.

    1987-01-01

    Concepts regarding approximate mathematical models treated rigorously. Paper presents new results in analysis of structural identifiability, equivalence, and near equivalence between mathematical models and physical processes they represent. Helps establish rigorous mathematical basis for concepts related to structural identifiability and equivalence revealing fundamental requirements, tacit assumptions, and sources of error. "Structural identifiability," as used by workers in this field, loosely translates as meaning ability to specify unique mathematical model and set of model parameters that accurately predict behavior of corresponding physical system.

  9. Molecular sensors and molecular logic gates

    International Nuclear Information System (INIS)

    Georgiev, N.; Bojinov, V.

    2013-01-01

    Full text: The rapid grow of nanotechnology field extended the concept of a macroscopic device to the molecular level. Because of this reason the design and synthesis of (supra)-molecular species capable of mimicking the functions of macroscopic devices are currently of great interest. Molecular devices operate via electronic and/or nuclear rearrangements and, like macroscopic devices, need energy to operate and communicate between their elements. The energy needed to make a device work can be supplied as chemical energy, electrical energy, or light. Luminescence is one of the most useful techniques to monitor the operation of molecular-level devices. This fact determinates the synthesis of novel fluorescence compounds as a considerable and inseparable part of nanoscience development. Further miniaturization of semiconductors in electronic field reaches their limit. Therefore the design and construction of molecular systems capable of performing complex logic functions is of great scientific interest now. In semiconductor devices the logic gates work using binary logic, where the signals are encoded as 0 and 1 (low and high current). This process is executable on molecular level by several ways, but the most common are based on the optical properties of the molecule switches encoding the low and high concentrations of the input guest molecules and the output fluorescent intensities with binary 0 and 1 respectively. The first proposal to execute logic operations at the molecular level was made in 1988, but the field developed only five years later when the analogy between molecular switches and logic gates was experimentally demonstrated by de Silva. There are seven basic logic gates: AND, OR, XOR, NOT, NAND, NOR and XNOR and all of them were achieved by molecules, the fluorescence switching as well. key words: fluorescence, molecular sensors, molecular logic gates

  10. Indexing molecules with chemical graph identifiers.

    Science.gov (United States)

    Gregori-Puigjané, Elisabet; Garriga-Sust, Rut; Mestres, Jordi

    2011-09-01

    Fast and robust algorithms for indexing molecules have been historically considered strategic tools for the management and storage of large chemical libraries. This work introduces a modified and further extended version of the molecular equivalence number naming adaptation of the Morgan algorithm (J Chem Inf Comput Sci 2001, 41, 181-185) for the generation of a chemical graph identifier (CGI). This new version corrects for the collisions recognized in the original adaptation and includes the ability to deal with graph canonicalization, ensembles (salts), and isomerism (tautomerism, regioisomerism, optical isomerism, and geometrical isomerism) in a flexible manner. Validation of the current CGI implementation was performed on the open NCI database and the drug-like subset of the ZINC database containing 260,071 and 5,348,089 structures, respectively. The results were compared with those obtained with some of the most widely used indexing codes, such as the CACTVS hash code and the new InChIKey. The analyses emphasize the fact that compound management activities, like duplicate analysis of chemical libraries, are sensitive to the exact definition of compound uniqueness and thus still depend, to a minor extent, on the type and flexibility of the molecular index being used. Copyright © 2011 Wiley Periodicals, Inc.

  11. Quasi-molecular states in sd-shell nuclei

    International Nuclear Information System (INIS)

    Kubono, S.; Ikeda, N.; Nomura, T.

    1988-08-01

    Quasi-molecular states near and below the threshold of the molecular configuration in sd-shell nuclei are discussed using recent experimental data with particle-gamma coincidence method and particle-particle coincidence method. Possible quasi-molecular states have been identified in 24 Mg as well as in 28 Si and 32 S. The important role of quasi-molecular states are discussed, specifically for the shape evolution of nuclei as a function of excitation energy and angular momentum. (author)

  12. Gene expression analysis identifies global gene dosage sensitivity in cancer

    DEFF Research Database (Denmark)

    Fehrmann, Rudolf S. N.; Karjalainen, Juha M.; Krajewska, Malgorzata

    2015-01-01

    Many cancer-associated somatic copy number alterations (SCNAs) are known. Currently, one of the challenges is to identify the molecular downstream effects of these variants. Although several SCNAs are known to change gene expression levels, it is not clear whether each individual SCNA affects gen...

  13. Identifying Multiquark Hadrons from Heavy Ion Collisions

    International Nuclear Information System (INIS)

    Cho, Sungtae; Furumoto, Takenori; Yazaki, Koichi; Hyodo, Tetsuo; Jido, Daisuke; Ohnishi, Akira; Ko, Che Ming; Lee, Su Houng; Nielsen, Marina; Sekihara, Takayasu; Yasui, Shigehiro

    2011-01-01

    Identifying hadronic molecular states and/or hadrons with multiquark components either with or without exotic quantum numbers is a long-standing challenge in hadronic physics. We suggest that studying the production of these hadrons in relativistic heavy ion collisions offers a promising resolution to this problem as yields of exotic hadrons are expected to be strongly affected by their structures. Using the coalescence model for hadron production, we find that, compared to the case of a nonexotic hadron with normal quark numbers, the yield of an exotic hadron is typically an order of magnitude smaller when it is a compact multiquark state and a factor of 2 or more larger when it is a loosely bound hadronic molecule. We further find that some of the newly proposed heavy exotic states could be produced and realistically measured in these experiments.

  14. Basic molecular spectroscopy

    CERN Document Server

    Gorry, PA

    1985-01-01

    BASIC Molecular Spectroscopy discusses the utilization of the Beginner's All-purpose Symbolic Instruction Code (BASIC) programming language in molecular spectroscopy. The book is comprised of five chapters that provide an introduction to molecular spectroscopy through programs written in BASIC. The coverage of the text includes rotational spectra, vibrational spectra, and Raman and electronic spectra. The book will be of great use to students who are currently taking a course in molecular spectroscopy.

  15. Digitotalar dysmorphism: Molecular elucidation

    African Journals Online (AJOL)

    obtained for molecular studies. Since the distal arthrogryposes (DAs) are genetically heterogeneous, an unbiased approach to mutation ... Diseases and Molecular Medicine, Department of Pathology, Faculty of Health Sciences, University of Cape Town, South Africa, with an interest in molecular genetics of connective ...

  16. Artificial molecular motors

    NARCIS (Netherlands)

    Kassem, Salma; van Leeuwen, Thomas; Lubbe, Anouk S.; Wilson, Miriam R.; Feringa, Ben L.; Leigh, David A.

    2017-01-01

    Motor proteins are nature's solution for directing movement at the molecular level. The field of artificial molecular motors takes inspiration from these tiny but powerful machines. Although directional motion on the nanoscale performed by synthetic molecular machines is a relatively new

  17. The NOAA Dataset Identifier Project

    Science.gov (United States)

    de la Beaujardiere, J.; Mccullough, H.; Casey, K. S.

    2013-12-01

    The US National Oceanic and Atmospheric Administration (NOAA) initiated a project in 2013 to assign persistent identifiers to datasets archived at NOAA and to create informational landing pages about those datasets. The goals of this project are to enable the citation of datasets used in products and results in order to help provide credit to data producers, to support traceability and reproducibility, and to enable tracking of data usage and impact. A secondary goal is to encourage the submission of datasets for long-term preservation, because only archived datasets will be eligible for a NOAA-issued identifier. A team was formed with representatives from the National Geophysical, Oceanographic, and Climatic Data Centers (NGDC, NODC, NCDC) to resolve questions including which identifier scheme to use (answer: Digital Object Identifier - DOI), whether or not to embed semantics in identifiers (no), the level of granularity at which to assign identifiers (as coarsely as reasonable), how to handle ongoing time-series data (do not break into chunks), creation mechanism for the landing page (stylesheet from formal metadata record preferred), and others. Decisions made and implementation experience gained will inform the writing of a Data Citation Procedural Directive to be issued by the Environmental Data Management Committee in 2014. Several identifiers have been issued as of July 2013, with more on the way. NOAA is now reporting the number as a metric to federal Open Government initiatives. This paper will provide further details and status of the project.

  18. Molecular computing origins and promises

    CERN Document Server

    Rambidi, Nicholas G

    2014-01-01

    Molecular Computing explores whether molecular primitives can prove to be real alternatives to contemporary semiconductor means. The text discusses molecular primitives and circuitry for information processing devices.

  19. Molecular pathology of bone tumours: diagnostic implications.

    Science.gov (United States)

    Puls, Florian; Niblett, Angela J; Mangham, D Chas

    2014-03-01

    Alongside histomorphology and immunohistochemistry, molecular pathology is now established as one of the cornerstones in the tissue diagnosis of bone tumours. We describe the principal molecular pathological techniques employed, and each of the bone tumour entities where their identified characteristic molecular pathological changes can be detected to support and confirm the suspected histological diagnosis. Tumours discussed include fibrous dysplasia, classical and subtype osteosarcomas, central and surface cartilaginous tumours, Ewing's sarcoma, vascular tumours, aneurysmal bone cyst, chordoma, myoepithelioma, and angiomatoid fibrous histiocytoma. This is a rapidly evolving field with discoveries occurring every few months, and some of the newer entities (the Ewing's-like sarcomas), which are principally identified by their molecular pathology characteristics, are discussed. © 2013 John Wiley & Sons Ltd.

  20. Molecular clouds without detectable CO

    International Nuclear Information System (INIS)

    Blitz, L.; Bazell, D.; Desert, F.X.

    1990-01-01

    The clouds identified by Desert, Bazell, and Boulanger (DBB clouds) in their search for high-latitude molecular clouds were observed in the CO (J = 1-0) line, but only 13 percent of the sample was detected. The remaining 87 percent are diffuse molecular clouds with CO abundances of about 10 to the -6th, a typical value for diffuse clouds. This hypothesis is shown to be consistent with Copernicus data. The DBB clouds are shown to be an essentially complete catalog of diffuse molecular clouds in the solar vicinity. The total molecular surface density in the vicinity of the sun is then only about 20 percent greater than the 1.3 solar masses/sq pc determined by Dame et al. (1987). Analysis of the CO detections indicates that there is a sharp threshold in extinction of 0.25 mag before CO is detectable and is derived from the IRAS I(100) micron threshold of 4 MJy/sr. This threshold is presumably where the CO abundance exhibits a sharp increase 18 refs

  1. Cancer Stratification by Molecular Imaging

    Directory of Open Access Journals (Sweden)

    Justus Weber

    2015-03-01

    Full Text Available The lack of specificity of traditional cytotoxic drugs has triggered the development of anticancer agents that selectively address specific molecular targets. An intrinsic property of these specialized drugs is their limited applicability for specific patient subgroups. Consequently, the generation of information about tumor characteristics is the key to exploit the potential of these drugs. Currently, cancer stratification relies on three approaches: Gene expression analysis and cancer proteomics, immunohistochemistry and molecular imaging. In order to enable the precise localization of functionally expressed targets, molecular imaging combines highly selective biomarkers and intense signal sources. Thus, cancer stratification and localization are performed simultaneously. Many cancer types are characterized by altered receptor expression, such as somatostatin receptors, folate receptors or Her2 (human epidermal growth factor receptor 2. Similar correlations are also known for a multitude of transporters, such as glucose transporters, amino acid transporters or hNIS (human sodium iodide symporter, as well as cell specific proteins, such as the prostate specific membrane antigen, integrins, and CD20. This review provides a comprehensive description of the methods, targets and agents used in molecular imaging, to outline their application for cancer stratification. Emphasis is placed on radiotracers which are used to identify altered expression patterns of cancer associated markers.

  2. Molecular dynamics modeling of polymer flammability

    International Nuclear Information System (INIS)

    Nyden, M.R.; Brown, J.E.; Lomakin, S.M.

    1992-01-01

    Molecular dynamic simulations were used to identify factors which promote char formation during the thermal degradation of polymers. Computer movies based on these simulations, indicate that cross-linked model polymers tend to undergo further cross-linking when burned, eventually forming a high molecular weight, thermally stable char. This paper reports that the prediction was confirmed by char yield measurements made on γ and e - -irradiated polyethylene and chemically cross-linked poly(methyl methacrylate)

  3. Molecular similarity measures.

    Science.gov (United States)

    Maggiora, Gerald M; Shanmugasundaram, Veerabahu

    2011-01-01

    Molecular similarity is a pervasive concept in chemistry. It is essential to many aspects of chemical reasoning and analysis and is perhaps the fundamental assumption underlying medicinal chemistry. Dissimilarity, the complement of similarity, also plays a major role in a growing number of applications of molecular diversity in combinatorial chemistry, high-throughput screening, and related fields. How molecular information is represented, called the representation problem, is important to the type of molecular similarity analysis (MSA) that can be carried out in any given situation. In this work, four types of mathematical structure are used to represent molecular information: sets, graphs, vectors, and functions. Molecular similarity is a pairwise relationship that induces structure into sets of molecules, giving rise to the concept of chemical space. Although all three concepts - molecular similarity, molecular representation, and chemical space - are treated in this chapter, the emphasis is on molecular similarity measures. Similarity measures, also called similarity coefficients or indices, are functions that map pairs of compatible molecular representations that are of the same mathematical form into real numbers usually, but not always, lying on the unit interval. This chapter presents a somewhat pedagogical discussion of many types of molecular similarity measures, their strengths and limitations, and their relationship to one another. An expanded account of the material on chemical spaces presented in the first edition of this book is also provided. It includes a discussion of the topography of activity landscapes and the role that activity cliffs in these landscapes play in structure-activity studies.

  4. Molecular diagnostics of myeloproliferative neoplasms.

    Science.gov (United States)

    Langabeer, Stephen E; Andrikovics, Hajnalka; Asp, Julia; Bellosillo, Beatriz; Carillo, Serge; Haslam, Karl; Kjaer, Lasse; Lippert, Eric; Mansier, Olivier; Oppliger Leibundgut, Elisabeth; Percy, Melanie J; Porret, Naomi; Palmqvist, Lars; Schwarz, Jiri; McMullin, Mary F; Schnittger, Susanne; Pallisgaard, Niels; Hermouet, Sylvie

    2015-10-01

    Since the discovery of the JAK2 V617F mutation in the majority of the myeloproliferative neoplasms (MPN) of polycythemia vera, essential thrombocythemia and primary myelofibrosis ten years ago, further MPN-specific mutational events, notably in JAK2 exon 12, MPL exon 10 and CALR exon 9 have been identified. These discoveries have been rapidly incorporated into evolving molecular diagnostic algorithms. Whilst many of these mutations appear to have prognostic implications, establishing MPN diagnosis is of immediate clinical importance with selection, implementation and the continual evaluation of the appropriate laboratory methodology to achieve this diagnosis similarly vital. The advantages and limitations of these approaches in identifying and quantitating the common MPN-associated mutations are considered herein with particular regard to their clinical utility. The evolution of molecular diagnostic applications and platforms has occurred in parallel with the discovery of MPN-associated mutations, and it therefore appears likely that emerging technologies such as next-generation sequencing and digital PCR will in the future play an increasing role in the molecular diagnosis of MPN. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Identifying tier one key suppliers.

    Science.gov (United States)

    Wicks, Steve

    2013-01-01

    In today's global marketplace, businesses are becoming increasingly reliant on suppliers for the provision of key processes, activities, products and services in support of their strategic business goals. The result is that now, more than ever, the failure of a key supplier has potential to damage reputation, productivity, compliance and financial performance seriously. Yet despite this, there is no recognised standard or guidance for identifying a tier one key supplier base and, up to now, there has been little or no research on how to do so effectively. This paper outlines the key findings of a BCI-sponsored research project to investigate good practice in identifying tier one key suppliers, and suggests a scalable framework process model and risk matrix tool to help businesses effectively identify their tier one key supplier base.

  6. Football refereeing: Identifying innovative methods

    Directory of Open Access Journals (Sweden)

    Reza MohammadKazemi

    2014-08-01

    Full Text Available The aim of the present study is to identify the potentials innovation in football industry. Data were collected from 10 national and international referees, assistant referees and referees’ supervisors in Iran. In this study, technological innovations are identified that assist better refereeing performances. The analysis revealed a significant relationship between using new technologies and referees ‘performance. The results indicate that elite referees, assistant referees and supervisors agreed to use new technological innovations during the game. According to their comments, this kind of technology causes the referees’ performance development.

  7. Molecular analysis of thymoma.

    Directory of Open Access Journals (Sweden)

    Sunil Badve

    Full Text Available Histologic classification of thymomas has significant limitations with respect to both subtype definitions and consistency. In order to better understand the biology of the disease processes, we performed whole genome gene expression analysis. RNA was extracted from fresh frozen tumors from 34 patients with thymomas and followup data was available. Using the Illumina BeadStudio® platform and Human Ref-8 Beadchip, gene expression data was analyzed with Partek Genomics Suite®, and Ingenuity Pathways Analysis (IPA. Unsupervised clustering of gene expression data, representing one of the largest series in literature, resulted in identification of four molecular clusters of tumors (C1-C4, which correlated with histology (P = 0.002. However, neither histology nor clusters correlated with clinical outcomes. Correlation of gene expression data with clinical data showed that a number of genes were associated with either advanced stage at diagnosis or development of recurrence or metastases. The top pathways associated with metastases were amino acid metabolisms, biosynthesis of steroids and glycosphingolipids, cell cycle checkpoint proteins and Notch signaling. The differential expression of some of the top genes related to both metastases and stage was confirmed by RT-PCR in all cases of metastases and matched nonmetastatic cases. A number of potential candidates for therapeutics were also identified.

  8. SOCIODEMOGRAPHIC DATA USED FOR IDENTIFYING ...

    Science.gov (United States)

    Due to unique social and demographic characteristics, various segments of the population may experience exposures different from those of the general population, which, in many cases, may be greater. When risk assessments do not characterize subsets of the general population, the populations that may experience the greatest risk remain unidentified. When such populations are not identified, the social and demographic data relevant to these populations is not considered when preparing exposure estimates, which can underestimate exposure and risk estimates for at-risk populations. Thus, it is necessary for risk or exposure assessors characterizing a diverse population, to first identify and then enumerate certain groups within the general population who are at risk for greater contaminant exposures. The document entitled Sociodemographic Data Used for Identifying Potentially Highly Exposed Populations (also referred to as the Highly Exposed Populations document), assists assessors in identifying and enumerating potentially highly exposed populations. This document presents data relating to factors which potentially impact an individual or group's exposure to environmental contaminants based on activity patterns (how time is spent), microenvironments (locations where time is spent), and other socio-demographic data such as age, gender, race and economic status. Populations potentially more exposed to various chemicals of concern, relative to the general population

  9. SNP interaction pattern identifier (SIPI)

    DEFF Research Database (Denmark)

    Lin, Hui Yi; Chen, Dung Tsa; Huang, Po Yu

    2017-01-01

    Motivation: Testing SNP-SNP interactions is considered as a key for overcoming bottlenecks of genetic association studies. However, related statistical methods for testing SNP-SNP interactions are underdeveloped. Results: We propose the SNP Interaction Pattern Identifier (SIPI), which tests 45...

  10. Identifying the Gifted Child Humorist.

    Science.gov (United States)

    Fern, Tami L.

    1991-01-01

    This study attempted to identify gifted child humorists among 1,204 children in grades 3-6. Final identification of 13 gifted child humorists was determined through application of such criteria as funniness, originality, and exemplary performance or product. The influence of intelligence, development, social factors, sex differences, family…

  11. Identifying high-risk medication

    DEFF Research Database (Denmark)

    Sædder, Eva; Brock, Birgitte; Nielsen, Lars Peter

    2014-01-01

    salicylic acid, and beta-blockers; 30 drugs or drug classes caused 82 % of all serious MEs. The top ten drugs involved in fatal events accounted for 73 % of all drugs identified. CONCLUSION: Increasing focus on seven drugs/drug classes can potentially reduce hospitalizations, extended hospitalizations...

  12. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  13. Molecular photoionization dynamics

    International Nuclear Information System (INIS)

    Dehmer, J.L.

    1982-01-01

    This program seeks to develop both physical insight and quantitative characterization of molecular photoionization processes. Progress is briefly described, and some publications resulting from the research are listed

  14. Polymer friction Molecular Dynamics

    DEFF Research Database (Denmark)

    Sivebæk, Ion Marius; Samoilov, Vladimir N.; Persson, Bo N. J.

    We present molecular dynamics friction calculations for confined hydrocarbon solids with molecular lengths from 20 to 1400 carbon atoms. Two cases are considered: a) polymer sliding against a hard substrate, and b) polymer sliding on polymer. In the first setup the shear stresses are relatively...... independent of molecular length. For polymer sliding on polymer the friction is significantly larger, and dependent on the molecular chain length. In both cases, the shear stresses are proportional to the squeezing pressure and finite at zero load, indicating an adhesional contribution to the friction force....

  15. ORCID: Author Identifiers for Librarians

    Directory of Open Access Journals (Sweden)

    Robyn B. Reed

    2017-10-01

    Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.

  16. Device for identifying fuel assembly

    International Nuclear Information System (INIS)

    Imai, Tetsuo; Miyazawa, Tatsuo.

    1982-01-01

    Purpose: To accurately identify a symbol printed on a hanging tool at the upper part of a fuel assembly. Constitution: Optical fibers are bundled to prepare a detector which is disposed at a predetermined position on a hanging tool. This position is set by a guide. Thus, the light emitted from an illumination lamp arrives at the bottom of a groove printed on the upper surface of the tool, and is divided into a weak light reflected upwardly and a strong light reflected on the surface lower than the groove. When these lights are received by the optical fibers, the fibers corresponding to the grooved position become dark, and the fibers corresponding to the ungrooved position become bright. Since the fuel assembly is identified by the dark and bright of the optical fibers as symbols, different machining can be performed every fuel assembly on the upper surface of the tool. (Yoshihara, H.)

  17. Identifying patient risks during hospitalization

    Directory of Open Access Journals (Sweden)

    Lucélia Ferreira Lima

    2008-12-01

    Full Text Available Objective: To identify the risks reported at a public institution andto know the main patient risks from the nursing staff point of view.Methods: A retrospective, descriptive and exploratory study. Thesurvey was developed at a hospital in the city of Taboão da Serra, SãoPaulo, Brazil. The study included all nurses working in care areas whoagreed to participate in the study. At the same time, sentinel eventsoccurring in the period from July 2006 to July 2007 were identified.Results: There were 440 sentinel events reported, and the main risksincluded patient falls, medication errors and pressure ulcers. Sixty-fivenurses were interviewed. They also reported patient falls, medicationerrors and pressure ulcers as the main risks. Conclusions: Riskassessment and implementation of effective preventive actions arenecessary to ensure patient’s safety. Involvement of a multidisciplinaryteam is one of the steps for a successful process.

  18. Identifying High Performance ERP Projects

    OpenAIRE

    Stensrud, Erik; Myrtveit, Ingunn

    2002-01-01

    Learning from high performance projects is crucial for software process improvement. Therefore, we need to identify outstanding projects that may serve as role models. It is common to measure productivity as an indicator of performance. It is vital that productivity measurements deal correctly with variable returns to scale and multivariate data. Software projects generally exhibit variable returns to scale, and the output from ERP projects is multivariate. We propose to use Data Envelopment ...

  19. Neutron molecular spectroscopy: future prospects

    International Nuclear Information System (INIS)

    Tomkinson, J.; Carlile, C.J.; Krishna, P.S.R.

    1994-07-01

    The recent revolution in Neutron Molecular Spectroscopy, caused by extending the spectral range, is briefly reviewed. The need to constantly improve the spectral resolution is underlined and the likely benefits are identified. Recent work on improving the energy resolution on TFXA is presented and three future options for TFXA are outlined. Some preliminary high resolution results, from a mock-up spectrometer, are reported. These clearly show that narrow bands are available in solids and improved resolutions can be achieved to observe them. (Author)

  20. Making molecular machines work

    NARCIS (Netherlands)

    Browne, Wesley R.; Feringa, Ben L.

    2006-01-01

    In this review we chart recent advances in what is at once an old and very new field of endeavour the achievement of control of motion at the molecular level including solid-state and surface-mounted rotors, and its natural progression to the development of synthetic molecular machines. Besides a

  1. Veterinary Molecular Diagnostics

    NARCIS (Netherlands)

    Roest, H.I.J.; Engelsma, M.Y.; Weesendorp, E.; Bossers, A.; Elbers, A.R.W.

    2017-01-01

    In veterinary molecular diagnostics, samples originating from animals are tested. Developments in the farm animals sector and in our societal attitude towards pet animals have resulted in an increased demand for fast and reliable diagnostic techniques. Molecular diagnostics perfectly matches this

  2. Molecular Beacons in Diagnostics

    OpenAIRE

    Tyagi, Sanjay; Kramer, Fred Russell

    2012-01-01

    Recent technical advances have begun to realize the potential of molecular beacons to test for diverse infections in clinical diagnostic laboratories. These include the ability to test for, and quantify, multiple pathogens in the same clinical sample, and to detect antibiotic resistant strains within hours. The design principles of molecular beacons have also spawned a variety of allied technologies.

  3. Molecular microbial ecology manual

    NARCIS (Netherlands)

    Kowalchuk, G.A.; Bruijn, de F.J.; Head, I.M.; Akkermans, A.D.L.

    2004-01-01

    The field of microbial ecology has been revolutionized in the past two decades by the introduction of molecular methods into the toolbox of the microbial ecologist. This molecular arsenal has helped to unveil the enormity of microbial diversity across the breadth of the earth's ecosystems, and has

  4. Principles of molecular oncology

    National Research Council Canada - National Science Library

    Bronchud, Miguel H

    2008-01-01

    ...-threatening diseases. Many new molecularly targeted diagnostics and therapeutics described in this text, developed based on the rapid growth in our understanding of the molecular basis of cancer, already substantially improve survival of patients with previously lethal malignancies, and also improve quality of life because of fewer toxicities. Clearly re...

  5. Molecular Typing and Differentiation

    Science.gov (United States)

    In this chapter, general background and bench protocols are provided for a number of molecular typing techniques in common use today. Methods for the molecular typing and differentiation of microorganisms began to be widely adopted following the development of the polymerase chai...

  6. Principles of molecular oncology

    National Research Council Canada - National Science Library

    Bronchud, Miguel H; Thomas, E. Donnall; Weatherall, D. J; Crowther, D. G

    2004-01-01

    ...-threatening diseases. Many new molecularly targeted diagnostics and therapeutics described in this text, developed based on the rapid growth in our understanding of the molecular basis of cancer, already substantially improve survival of patients with previously lethal malignancies, and also improve quality of life because of fewer toxicities. Clearly re...

  7. Ionic and Molecular Liquids

    DEFF Research Database (Denmark)

    Chaban, Vitaly V.; Prezhdo, Oleg

    2013-01-01

    applications of RTILs in combination with molecular liquids, concentrating on three significant areas: (1) the use of molecular liquids to decrease the viscosity of RTILs; (2) the role of RTIL micelle formation in water and organic solvents; and (3) the ability of RTILs to adsorb pollutant gases. Current...

  8. Molecular Stirrers in Action

    NARCIS (Netherlands)

    Chen, Jiawen; Kistemaker, Jos C. M.; Robertus, Jort; Feringa, Ben L.

    2014-01-01

    A series of first-generation light-driven molecular motors with rigid substituents of varying length was synthesized to act as "molecular stirrers". Their rotary motion was studied by H-1 NMR and UV-vis absorption spectroscopy in a variety of solvents with different polarity and viscosity.

  9. Molecular subgroups of medulloblastoma

    OpenAIRE

    Northcott, Paul A; Dubuc, Adrian M; Pfister, Stefan; Taylor, Michael D

    2012-01-01

    Recent efforts at stratifying medulloblastomas based on their molecular features have revolutionized our understanding of this morbidity. Collective efforts by multiple independent groups have subdivided medulloblastoma from a single disease into four distinct molecular subgroups characterized by disparate transcriptional signatures, mutational spectra, copy number profiles and, most importantly, clinical features. We present a summary of recent studies that have contributed to our understand...

  10. Targeting molecular networks for drug research

    Directory of Open Access Journals (Sweden)

    José Pedro Pinto

    2014-06-01

    Full Text Available The study of molecular networks has recently moved into the limelight of biomedical research. While it has certainly provided us with plenty of new insights into cellular mechanisms, the challenge now is how to modify or even restructure these networks. This is especially true for human diseases, which can be regarded as manifestations of distorted states of molecular networks. Of the possible interventions for altering networks, the use of drugs is presently the most feasible. In this mini-review, we present and discuss some exemplary approaches of how analysis of molecular interaction networks can contribute to pharmacology (e.g., by identifying new drug targets or prediction of drug side effects, as well as listing pointers to relevant resources and software to guide future research. We also outline recent progress in the use of drugs for in vitro reprogramming of cells, which constitutes an example par excellence for altering molecular interaction networks with drugs.

  11. Sparse Linear Identifiable Multivariate Modeling

    DEFF Research Database (Denmark)

    Henao, Ricardo; Winther, Ole

    2011-01-01

    and bench-marked on artificial and real biological data sets. SLIM is closest in spirit to LiNGAM (Shimizu et al., 2006), but differs substantially in inference, Bayesian network structure learning and model comparison. Experimentally, SLIM performs equally well or better than LiNGAM with comparable......In this paper we consider sparse and identifiable linear latent variable (factor) and linear Bayesian network models for parsimonious analysis of multivariate data. We propose a computationally efficient method for joint parameter and model inference, and model comparison. It consists of a fully...

  12. Identifying flares in rheumatoid arthritis

    DEFF Research Database (Denmark)

    Bykerk, Vivian P; Bingham, Clifton O; Choy, Ernest H

    2016-01-01

    to flare, with escalation planned in 61%. CONCLUSIONS: Flares are common in rheumatoid arthritis (RA) and are often preceded by treatment reductions. Patient/MD/DAS agreement of flare status is highest in patients worsening from R/LDA. OMERACT RA flare questions can discriminate between patients with...... Set. METHODS: Candidate flare questions and legacy measures were administered at consecutive visits to Canadian Early Arthritis Cohort (CATCH) patients between November 2011 and November 2014. The American College of Rheumatology (ACR) core set indicators were recorded. Concordance to identify flares...

  13. Theoretical molecular biophysics

    CERN Document Server

    Scherer, Philipp O J

    2017-01-01

    This book gives an introduction to molecular biophysics. It starts from material properties at equilibrium related to polymers, dielectrics and membranes. Electronic spectra are developed for the understanding of elementary dynamic processes in photosynthesis including proton transfer and dynamics of molecular motors. Since the molecular structures of functional groups of bio-systems were resolved, it has become feasible to develop a theory based on the quantum theory and statistical physics with emphasis on the specifics of the high complexity of bio-systems. This introduction to molecular aspects of the field focuses on solvable models. Elementary biological processes provide as special challenge the presence of partial disorder in the structure which does not destroy the basic reproducibility of the processes. Apparently the elementary molecular processes are organized in a way to optimize the efficiency. Learning from nature by means exploring the relation between structure and function may even help to b...

  14. MOLECULAR DIAGNOSTICS OF YERSINIA RUCKERI

    Directory of Open Access Journals (Sweden)

    Yu. Rud

    2014-06-01

    Full Text Available Purpose. The analysis of nucleotide sequences of the 16S rDNA gene of virulent strains of Yersinia ruckeri and to develop the method of molecular diagnostic of enteric redmouth disease. Methodology. By the method of CLUSTALW algorithm in MEGA software version 6.0 the nucleotide sequences of the 16S rDNA gene of virulent strains of Yersinia ruckeri were analysed. For development of molecular diagnostic of Y. ruckeri the method of polymerase chain reaction (PCR was used. Primer selection was carried out in software VectorNTI11 and on-line-service BLAST. The PCR products were investigated by the methods of sequencing and nucleotide analysis. Findings. Based on PCR assay the method of molecular diagnostic of enteric redmouth disease agent, bacterium Y. ruckeri was developed. It was shown that specific oligonucleotide primers generated PCR products in size of 600 base pairs. PCR products were investigated by the sequencing that showed right targeting of primers in reaction. Originality. Among high-conservative gene of 16S rDNA of Y. ruckeri the fragment of DNA was determined to which the specific primers for rapid diagnostic of virulent strains were selected. Practical Value. Rapid diagnostic of yersiniosis will allow to identify an agent of this infectious disease, bacterium Y. ruckeri, and to provide the prophylactic or medical measures in the fish farming of Ukraine.

  15. Molecular biology of pancreatic cancer.

    Science.gov (United States)

    Zavoral, Miroslav; Minarikova, Petra; Zavada, Filip; Salek, Cyril; Minarik, Marek

    2011-06-28

    In spite of continuous research efforts directed at early detection and treatment of pancreatic cancer, the outlook for patients affected by the disease remains dismal. With most cases still being diagnosed at advanced stages, no improvement in survival prognosis is achieved with current diagnostic imaging approaches. In the absence of a dominant precancerous condition, several risk factors have been identified including family history, chronic pancreatitis, smoking, diabetes mellitus, as well as certain genetic disorders such as hereditary pancreatitis, cystic fibrosis, familial atypical multiple mole melanoma, and Peutz-Jeghers and Lynch syndromes. Most pancreatic carcinomas, however, remain sporadic. Current progress in experimental molecular techniques has enabled detailed understanding of the molecular processes of pancreatic cancer development. According to the latest information, malignant pancreatic transformation involves multiple oncogenes and tumor-suppressor genes that are involved in a variety of signaling pathways. The most characteristic aberrations (somatic point mutations and allelic losses) affect oncogenes and tumor-suppressor genes within RAS, AKT and Wnt signaling, and have a key role in transcription and proliferation, as well as systems that regulate the cell cycle (SMAD/DPC, CDKN2A/p16) and apoptosis (TP53). Understanding of the underlying molecular mechanisms should promote development of new methodology for early diagnosis and facilitate improvement in current approaches for pancreatic cancer treatment.

  16. Gradient temperature Raman spectroscopy identifies flexible sites in proline and alanine peptides

    Science.gov (United States)

    Continuous thermo dynamic Raman spectroscopy (TDRS) applies the temperature gradients utilized in differential scanning calorimetry (DSC) to Raman spectroscopy, providing a straightforward technique to identify molecular rearrangements that occur just prior to phase transitions. Herein we apply TDRS...

  17. Identifying known unknowns using the US EPA's CompTox Chemistry Dashboard

    Science.gov (United States)

    Chemical features observed using high-resolution mass spectrometry can be tentatively identified using online chemical reference databases by searching molecular formulae and monoisotopic masses and then rank-ordering of the hits using appropriate relevance criteria. The most li...

  18. [Molecular heterogeneity of malignant pleural mesotheliomas].

    Science.gov (United States)

    Tranchant, Robin; Montagne, François; Jaurand, Marie-Claude; Jean, Didier

    2018-01-01

    Malignant pleural mesothelioma (MPM) is predominantly an occupational cancer, most often linked to asbestos exposure. Malignant pleural mesothelioma prognosis is poor with a short survival median, due to the aggressiveness of tumor cells and the weak efficiency of conventional anti-cancer therapies. Clinical, histological, and molecular data suggest tumor heterogeneity between patients as it was also shown for other cancer types. Consequently, there is an urgent need to develop new therapies that take into account this heterogeneity and the molecular characteristics of malignant pleural mesothelioma, in particular by identifying new anti-cancer drugs targeting the molecular specificities of each malignant pleural mesothelioma. Malignant pleural mesothelioma is characterized by numerous molecular alterations at the chromosomal, genetic and epigenetic levels. Molecular classification based on gene expression profile has firstly defined two tumor groups, C1 and C2, and more recently, four groups. By integrating genetic and transcriptomic analysis, a C2 LN tumor subgroup of the C2 group has been identified and characterized. In addition to tumor heterogeneity between patients, intra-tumor heterogeneity is supported by several evidences. Most therapeutic strategies that take into account the tumor molecular characteristics have focused on targeted therapies based on mutated genes. A more appropriate strategy would be to consider better-defined tumor groups on the basis of several molecular alterations types as it has been proposed for the C2 LN subgroup. A robust definition of homogeneous tumor groups sharing common molecular characteristics is necessary for the development of effective precision medicine for malignant pleural mesothelioma. Copyright © 2017 Société Française du Cancer. Published by Elsevier Masson SAS. All rights reserved.

  19. Issues in identifying germ tube positive yeasts by conventional methods.

    Science.gov (United States)

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  20. Sampling Molecular Conformers in Solution with Quantum Mechanical Accuracy at a Nearly Molecular-Mechanics Cost.

    Science.gov (United States)

    Rosa, Marta; Micciarelli, Marco; Laio, Alessandro; Baroni, Stefano

    2016-09-13

    We introduce a method to evaluate the relative populations of different conformers of molecular species in solution, aiming at quantum mechanical accuracy, while keeping the computational cost at a nearly molecular-mechanics level. This goal is achieved by combining long classical molecular-dynamics simulations to sample the free-energy landscape of the system, advanced clustering techniques to identify the most relevant conformers, and thermodynamic perturbation theory to correct the resulting populations, using quantum-mechanical energies from density functional theory. A quantitative criterion for assessing the accuracy thus achieved is proposed. The resulting methodology is demonstrated in the specific case of cyanin (cyanidin-3-glucoside) in water solution.

  1. Persistent Identifiers as Boundary Objects

    Science.gov (United States)

    Parsons, M. A.; Fox, P. A.

    2017-12-01

    In 1989, Leigh Star and Jim Griesemer defined the seminal concept of `boundary objects'. These `objects' are what Latour calls `immutable mobiles' that enable communication and collaboration across difference by helping meaning to be understood in different contexts. As Star notes, they are a sort of arrangement that allow different groups to work together without (a priori) consensus. Part of the idea is to recognize and allow for the `interpretive flexibility' that is central to much of the `constructivist' approach in the sociology of science. Persistent Identifiers (PIDs) can clearly act as boundary objects, but people do not usually assume that they enable interpretive flexibility. After all, they are meant to be unambiguous, machine-interpretable identifiers of defined artifacts. In this paper, we argue that PIDs can fill at least two roles: 1) That of the standardized form, where there is strong agreement on what is being represented and how and 2) that of the idealized type, a more conceptual concept that allows many different representations. We further argue that these seemingly abstract conceptions actually help us implement PIDs more effectively to link data, publications, various other artifacts, and especially people. Considering PIDs as boundary objects can help us address issues such as what level of granularity is necessary for PIDs, what metadata should be directly associated with PIDs, and what purpose is the PID serving (reference, provenance, credit, etc.). In short, sociological theory can improve data sharing standards and their implementation in a way that enables broad interdisciplinary data sharing and reuse. We will illustrate this with several specific examples of Earth science data.

  2. A molecular marker map for roses

    NARCIS (Netherlands)

    Debener, T.; Mattiesch, L.; Vosman, B.

    2001-01-01

    n addition to an existing core map for diploid roses which comprised 305 molecular markers 60 additional markers were mapped to extend the map. As a first application of the information contained in the map, the map position of a resistance gene from roses, Rdr1, was determined by identifying

  3. Molecular Identification of Methicillin-Resistant Staphylococcus ...

    African Journals Online (AJOL)

    We use the molecular techniques of PCR and PFGE to identify MRSA from clinical isolates of Staphylococcus aureus causing infections among hospitalized patients in Benin-City, Nigeria. A total of 36 isolates were obtained from the University of Benin Teaching Hospital between July-September, 2007. The MRSA strains ...

  4. Molecular Characterization of Glucose-6-Phosphate ...

    African Journals Online (AJOL)

    G6PD) deficiency among staff and students of a university community in Malaysia as well as to identify molecular genetics by determination of G6PD mutations. Methods: Cross-sectional and experimental studies were carried out on the staff ...

  5. Determination of morphological features and molecular interactions ...

    African Journals Online (AJOL)

    This research focused on identifying the morphological features and molecular interactions of the Nigerian Bentonitic clays using Scanning Electron Microscope (SEM) characterisation technique. The SEM microstructure images indicated that the bentonite samples are generally moderately dispersive to dispersive with ...

  6. Systematic Representation of Molecular Biology Knowledge.

    Science.gov (United States)

    Fisher, Kathleen M.

    A small set of relationships has been identified which appears to be sufficient for describing all molecular and cellular reactions and structures discussed in an introductory biology course. A precise definition has been developed for each relationship. These 20 relationships are of four types: (1) analytical; (2) spatial; (3) temporal; and (4)…

  7. Visions of a Semantic Molecular Future

    OpenAIRE

    Murray-Rust, Peter; Brooks, Brian; Bolton, Charlotte

    2011-01-01

    Booklet handout distributed at the VSMF Symposium held at the Unilever Centre on 2011-01-17 The event looks forward. Scholarship (universities, research, teaching, publishing) has been slow to take up the opportunities of this digital century. This is an opportunity to identify and build the future. EPSRC (Pathways to Impact Award). Unilever plc (Unilever Centre for Molecular Science Informatics)

  8. Visions of a Semantic Molecular Future

    OpenAIRE

    Murray-Rust, Peter

    2011-01-01

    Additional booklet insert distributed at the VSMF Symposium held at the Unilever Centre on 2011-01-17 The event looks forward. Scholarship (universities, research, teaching, publishing) has been slow to take up the opportunities of this digital century. This is an opportunity to identify and build the future. EPSRC (Pathways to Impact award). Unilever plc (Unilever Centre for Molecular Science Informatics)

  9. Molecular Population Genetics.

    Science.gov (United States)

    Casillas, Sònia; Barbadilla, Antonio

    2017-03-01

    Molecular population genetics aims to explain genetic variation and molecular evolution from population genetics principles. The field was born 50 years ago with the first measures of genetic variation in allozyme loci, continued with the nucleotide sequencing era, and is currently in the era of population genomics. During this period, molecular population genetics has been revolutionized by progress in data acquisition and theoretical developments. The conceptual elegance of the neutral theory of molecular evolution or the footprint carved by natural selection on the patterns of genetic variation are two examples of the vast number of inspiring findings of population genetics research. Since the inception of the field, Drosophila has been the prominent model species: molecular variation in populations was first described in Drosophila and most of the population genetics hypotheses were tested in Drosophila species. In this review, we describe the main concepts, methods, and landmarks of molecular population genetics, using the Drosophila model as a reference. We describe the different genetic data sets made available by advances in molecular technologies, and the theoretical developments fostered by these data. Finally, we review the results and new insights provided by the population genomics approach, and conclude by enumerating challenges and new lines of inquiry posed by increasingly large population scale sequence data. Copyright © 2017 Casillas and Barbadilla.

  10. EDITORIAL: Molecular Imaging Technology

    Science.gov (United States)

    Asai, Keisuke; Okamoto, Koji

    2006-06-01

    'Molecular Imaging Technology' focuses on image-based techniques using nanoscale molecules as sensor probes to measure spatial variations of various species (molecular oxygen, singlet oxygen, carbon dioxide, nitric monoxide, etc) and physical properties (pressure, temperature, skin friction, velocity, mechanical stress, etc). This special feature, starting on page 1237, contains selected papers from The International Workshop on Molecular Imaging for Interdisciplinary Research, sponsored by the Ministry of Education, Culture, Sports, Science and Technology (MEXT) in Japan, which was held at the Sendai Mediatheque, Sendai, Japan, on 8 9 November 2004. The workshop was held as a sequel to the MOSAIC International Workshop that was held in Tokyo in 2003, to summarize the outcome of the 'MOSAIC Project', a five-year interdisciplinary project supported by Techno-Infrastructure Program, the Special Coordination Fund for Promotion of Science Technology to develop molecular sensor technology for aero-thermodynamic research. The workshop focused on molecular imaging technology and its applications to interdisciplinary research areas. More than 110 people attended this workshop from various research fields such as aerospace engineering, automotive engineering, radiotechnology, fluid dynamics, bio-science/engineering and medical engineering. The purpose of this workshop is to stimulate intermixing of these interdisciplinary fields for further development of molecular sensor and imaging technology. It is our pleasure to publish the seven papers selected from our workshop as a special feature in Measurement and Science Technology. We will be happy if this issue inspires people to explore the future direction of molecular imaging technology for interdisciplinary research.

  11. Molecular ingredients of heterogeneous catalysis

    International Nuclear Information System (INIS)

    Somorjai, G.A.

    1982-06-01

    The purpose of this paper is to present a review and status report to those in theoretical chemistry of the rapidly developing surface science of heterogeneous catalysis. The art of catalysis is developing into science. This profound change provides one with opportunities not only to understand the molecular ingredients of important catalytic systems but also to develop new and improved catalyst. The participation of theorists to find answers to important questions is sorely needed for the sound development of the field. It is the authors hope that some of the outstanding problems of heterogeneous catalysis that are identified in this paper will be investigated. For this purpose the paper is divided into several sections. The brief Introduction to the methodology and recent results of the surface science of heterogeneous catalysis is followed by a review of the concepts of heterogeneous catalysis. Then, the experimental results that identified the three molecular ingredients of catalysis, structure, carbonaceous deposit and the oxidation state of surface atoms are described. Each section is closed with a summary and a list of problems that require theoretical and experimental scrutiny. Finally attempts to build new catalyst systems and the theoretical and experimental problems that appeared in the course of this research are described

  12. Molecular Characterization of Copepod Photoreception.

    Science.gov (United States)

    Porter, Megan L; Steck, Mireille; Roncalli, Vittoria; Lenz, Petra H

    2017-08-01

    Copepod crustaceans are an abundant and ecologically significant group whose basic biology is guided by numerous visually guided behaviors. These behaviors are driven by copepod eyes, including naupliar eyes and Gicklhorn's organs, which vary widely in structure and function among species. Yet little is known about the molecular aspects of copepod vision. In this study we present a general overview of the molecular aspects of copepod vision by identifying phototransduction genes from newly generated and publicly available RNA-sequencing data and assemblies from 12 taxonomically diverse copepod species. We identify a set of 10 expressed transcripts that serve as a set of target genes for future studies of copepod phototransduction. Our more detailed evolutionary analyses of the opsin gene responsible for forming visual pigments found that all of the copepod species investigated express two main groups of opsins: middle-wavelength-sensitive (MWS) opsins and pteropsins. Additionally, there is evidence from a few species (e.g., Calanus finmarchicus, Eurytemora affinis, Paracyclopina nana, and Lernaea cyprinacea) for the expression of two additional groups of opsins-the peropsins and rhodopsin 7 (Rh7) opsins-at low levels or distinct developmental stages. An ontogenetic analysis of opsin expression in Calanus finmarchicus found the expression of a single dominant MWS opsin, as well as evidence for differences in expression across development in some MWS, pteropsin, and Rh7 opsins, with expression peaking in early naupliar through early copepodite stages.

  13. Molecular ingredients of heterogeneous catalysis

    Energy Technology Data Exchange (ETDEWEB)

    Somorjai, G.A.

    1982-06-01

    The purpose of this paper is to present a review and status report to those in theoretical chemistry of the rapidly developing surface science of heterogeneous catalysis. The art of catalysis is developing into science. This profound change provides one with opportunities not only to understand the molecular ingredients of important catalytic systems but also to develop new and improved catalyst. The participation of theorists to find answers to important questions is sorely needed for the sound development of the field. It is the authors hope that some of the outstanding problems of heterogeneous catalysis that are identified in this paper will be investigated. For this purpose the paper is divided into several sections. The brief Introduction to the methodology and recent results of the surface science of heterogeneous catalysis is followed by a review of the concepts of heterogeneous catalysis. Then, the experimental results that identified the three molecular ingredients of catalysis, structure, carbonaceous deposit and the oxidation state of surface atoms are described. Each section is closed with a summary and a list of problems that require theoretical and experimental scrutiny. Finally attempts to build new catalyst systems and the theoretical and experimental problems that appeared in the course of this research are described.

  14. Molecularly Imprinted Membranes

    Science.gov (United States)

    Trotta, Francesco; Biasizzo, Miriam; Caldera, Fabrizio

    2012-01-01

    Although the roots of molecularly imprinted polymers lie in the beginning of 1930s in the past century, they have had an exponential growth only 40–50 years later by the works of Wulff and especially by Mosbach. More recently, it was also proved that molecular imprinted membranes (i.e., polymer thin films) that show recognition properties at molecular level of the template molecule are used in their formation. Different procedures and potential application in separation processes and catalysis are reported. The influences of different parameters on the discrimination abilities are also discussed. PMID:24958291

  15. Photoionization and molecular structure

    International Nuclear Information System (INIS)

    Palma, A.

    1983-01-01

    A presentation is here given of the theoretical work on photoionization and molecular structure carried out by the author and coworkers. The implications of the photoionization process on the molecular geometry are emphasized. In particular, the ionization effect on deep orbitals is considered and it is shown that, contrary to traditional thinking, these orbitals have relevant effects on the molecular geometry. The problem of calculating photoionization relative intensities for the full spectrum is also considered, and the results of the present model are compared with experimental and other theoretical results. (author)

  16. RECOVIR Software for Identifying Viruses

    Science.gov (United States)

    Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

    2013-01-01

    Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

  17. Gene hunting: molecular analysis of the chicken genome

    NARCIS (Netherlands)

    Crooijmans, R.P.M.A.

    2000-01-01

    This dissertation describes the development of molecular tools to identify genes that are involved in production and health traits in poultry. To unravel the chicken genome, fluorescent molecular markers (microsatellite markers) were developed and optimized to perform high throughput

  18. Molecular cytogenetic characterization of a new wheat Secale ...

    Indian Academy of Sciences (India)

    A stable, highly fertile wheat Secale africanum substitution line LF24, derived from the F7 generation of a cross between Mianyang11 (MY11) and Triticum durum, S. africanum amphiploid (YF) was identified through molecular cytogenetic analysis. Application of C-banding, in situ hybridization and molecular markers ...

  19. Polypeptides Based Molecular Electronics

    National Research Council Canada - National Science Library

    Lam, Yeng M; Mhaisalkar, Subodh; Li, Lain-Jong; Dravid, Vinayak P; Shekhawat, Gajendra S; Suri, Raman

    2008-01-01

    ... the formation of molecular devices such as transistors, diodes, and sensors. We have designed the peptides, arranged them on substrates using self-assembly, Dip-PEN nanolithography, and also e-beam assisted lithography...

  20. Molecular electronic junction transport

    DEFF Research Database (Denmark)

    Solomon, Gemma C.; Herrmann, Carmen; Ratner, Mark

    2012-01-01

    Whenasinglemolecule,oracollectionofmolecules,isplacedbetween two electrodes and voltage is applied, one has a molecular transport junction. We discuss such junctions, their properties, their description, and some of their applications. The discussion is qualitative rather than quantitative, and f...

  1. Atomic and Molecular Interactions

    International Nuclear Information System (INIS)

    2002-01-01

    The Gordon Research Conference (GRC) on Atomic and Molecular Interactions was held at Roger Williams University, Bristol, RI. Emphasis was placed on current unpublished research and discussion of the future target areas in this field

  2. Noncovalent Molecular Electronics.

    Science.gov (United States)

    Gryn'ova, G; Corminboeuf, C

    2018-05-03

    Molecular electronics covers several distinctly different conducting architectures, including organic semiconductors and single-molecule junctions. The noncovalent interactions, abundant in the former, are also often found in the latter, i.e., the dimer junctions. In the present work, we draw the parallel between the two types of noncovalent molecular electronics for a range of π-conjugated heteroaromatic molecules. In silico modeling allows us to distill the factors that arise from the chemical nature of their building blocks and from their mutual arrangement. We find that the same compounds are consistently the worst and the best performers in the two types of electronic assemblies, emphasizing the universal imprint of the underlying chemistry of the molecular cores on their diverse charge transport characteristics. The interplay between molecular and intermolecular factors creates a spectrum of noncovalent conductive architectures, which can be manipulated using the design strategies based upon the established relationships between chemistry and transport.

  3. The Molecular Foundry (TMF)

    Data.gov (United States)

    Federal Laboratory Consortium — Founded in 2006 by the Department of Energy (DOE), the Molecular Foundry is a critical part of the DOE's National Nanotechnology Initiative, a multi-agency framework...

  4. Molecular ion photofragment spectroscopy

    International Nuclear Information System (INIS)

    Bustamente, S.W.

    1983-11-01

    A new molecular ion photofragment spectrometer is described which features a supersonic molecular beam ion source and a radio frequency octapole ion trap interaction region. This unique combination allows several techniques to be applied to the problem of detecting a photon absorption event of a molecular ion. In particular, it may be possible to obtain low resolution survey spectra of exotic molecular ions by using a direct vibrational predissociation process, or by using other more indirect detection methods. The use of the spectrometer is demonstrated by measuring the lifetime of the O 2 + ( 4 π/sub u/) metastable state which is found to consist of two main components: the 4 π/sub 5/2/ and 4 π/sub -1/2/ spin components having a long lifetime (approx. 129 ms) and the 4 π/sub 3/2/ and 4 π/sub 1/2/ spin components having a short lifetime (approx. 6 ms)

  5. Crossed molecular beams

    International Nuclear Information System (INIS)

    Lee, Y.T.

    1976-01-01

    Research activities with crossed molecular beams at Lawrence Berkeley Laboratory during 1976 are described. Topics covered include: scattering of Ar*, Kr*, with Xe; metastable rare gas interactions, He* + H 2 ; an atomic and molecular halogen beam source; a crossed molecular beam study of the Cl + Br 2 → BrCl + Br reaction; O( 3 P) reaction dynamics, development of the high pressure plasma beam source; energy randomization in the Cl + C 2 H 3 Br → Br + C 2 H 3 Cl reaction; high resolution photoionization studies of NO and ICl; photoionization of (H 2 O)/sub n/ and (NH 3 ) 2 ; photoionization mass spectroscopy of NH 3 + and O 3 + ; photo fragmentation of bromine; and construction of chemiluminescence-laser fluorescence crossed molecular beam machine

  6. Molecular Electronic Shift Registers

    Science.gov (United States)

    Beratan, David N.; Onuchic, Jose N.

    1990-01-01

    Molecular-scale shift registers eventually constructed as parts of high-density integrated memory circuits. In principle, variety of organic molecules makes possible large number of different configurations and modes of operation for such shift-register devices. Several classes of devices and implementations in some specific types of molecules proposed. All based on transfer of electrons or holes along chains of repeating molecular units.

  7. Molecular imaging in oncology

    Energy Technology Data Exchange (ETDEWEB)

    Schober, Otmar; Riemann, Burkhard (eds.) [Universitaetsklinikum Muenster (Germany). Klinik fuer Nuklearmedizin

    2013-02-01

    Considers in detail all aspects of molecular imaging in oncology, ranging from basic research to clinical applications in the era of evidence-based medicine. Examines technological issues and probe design. Discusses preclinical studies in detail, with particular attention to multimodality imaging. Presents current clinical use of PET/CT, SPECT/CT, and optical imagingWritten by acknowledged experts. The impact of molecular imaging on diagnostics, therapy, and follow-up in oncology is increasing significantly. The process of molecular imaging includes key biotarget identification, design of specific molecular imaging probes, and their preclinical evaluation, e.g., in vivo using small animal studies. A multitude of such innovative molecular imaging probes have already entered clinical diagnostics in oncology. There is no doubt that in future the emphasis will be on multimodality imaging in which morphological, functional, and molecular imaging techniques are combined in a single clinical investigation that will optimize diagnostic processes. This handbook addresses all aspects of molecular imaging in oncology, ranging from basic research to clinical applications in the era of evidence-based medicine. The first section is devoted to technology and probe design, and examines a variety of PET and SPECT tracers as well as multimodality probes. Preclinical studies are then discussed in detail, with particular attention to multimodality imaging. In the third section, diverse clinical applications are presented, and the book closes by looking at future challenges. This handbook will be of value to all who are interested in the revolution in diagnostic oncology that is being brought about by molecular imaging.

  8. Human papillomavirus molecular biology.

    Science.gov (United States)

    Harden, Mallory E; Munger, Karl

    Human papillomaviruses are small DNA viruses with a tropism for squamous epithelia. A unique aspect of human papillomavirus molecular biology involves dependence on the differentiation status of the host epithelial cell to complete the viral lifecycle. A small group of these viruses are the etiologic agents of several types of human cancers, including oral and anogenital tract carcinomas. This review focuses on the basic molecular biology of human papillomaviruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Molecular imaging in oncology

    International Nuclear Information System (INIS)

    Schober, Otmar; Riemann, Burkhard

    2013-01-01

    Considers in detail all aspects of molecular imaging in oncology, ranging from basic research to clinical applications in the era of evidence-based medicine. Examines technological issues and probe design. Discusses preclinical studies in detail, with particular attention to multimodality imaging. Presents current clinical use of PET/CT, SPECT/CT, and optical imagingWritten by acknowledged experts. The impact of molecular imaging on diagnostics, therapy, and follow-up in oncology is increasing significantly. The process of molecular imaging includes key biotarget identification, design of specific molecular imaging probes, and their preclinical evaluation, e.g., in vivo using small animal studies. A multitude of such innovative molecular imaging probes have already entered clinical diagnostics in oncology. There is no doubt that in future the emphasis will be on multimodality imaging in which morphological, functional, and molecular imaging techniques are combined in a single clinical investigation that will optimize diagnostic processes. This handbook addresses all aspects of molecular imaging in oncology, ranging from basic research to clinical applications in the era of evidence-based medicine. The first section is devoted to technology and probe design, and examines a variety of PET and SPECT tracers as well as multimodality probes. Preclinical studies are then discussed in detail, with particular attention to multimodality imaging. In the third section, diverse clinical applications are presented, and the book closes by looking at future challenges. This handbook will be of value to all who are interested in the revolution in diagnostic oncology that is being brought about by molecular imaging.

  10. Identifying ELIXIR Core Data Resources.

    Science.gov (United States)

    Durinx, Christine; McEntyre, Jo; Appel, Ron; Apweiler, Rolf; Barlow, Mary; Blomberg, Niklas; Cook, Chuck; Gasteiger, Elisabeth; Kim, Jee-Hyub; Lopez, Rodrigo; Redaschi, Nicole; Stockinger, Heinz; Teixeira, Daniel; Valencia, Alfonso

    2016-01-01

    The core mission of ELIXIR is to build a stable and sustainable infrastructure for biological information across Europe. At the heart of this are the data resources, tools and services that ELIXIR offers to the life-sciences community, providing stable and sustainable access to biological data. ELIXIR aims to ensure that these resources are available long-term and that the life-cycles of these resources are managed such that they support the scientific needs of the life-sciences, including biological research. ELIXIR Core Data Resources are defined as a set of European data resources that are of fundamental importance to the wider life-science community and the long-term preservation of biological data. They are complete collections of generic value to life-science, are considered an authority in their field with respect to one or more characteristics, and show high levels of scientific quality and service. Thus, ELIXIR Core Data Resources are of wide applicability and usage. This paper describes the structures, governance and processes that support the identification and evaluation of ELIXIR Core Data Resources. It identifies key indicators which reflect the essence of the definition of an ELIXIR Core Data Resource and support the promotion of excellence in resource development and operation. It describes the specific indicators in more detail and explains their application within ELIXIR's sustainability strategy and science policy actions, and in capacity building, life-cycle management and technical actions. The identification process is currently being implemented and tested for the first time. The findings and outcome will be evaluated by the ELIXIR Scientific Advisory Board in March 2017. Establishing the portfolio of ELIXIR Core Data Resources and ELIXIR Services is a key priority for ELIXIR and publicly marks the transition towards a cohesive infrastructure.

  11. DIA-datasnooping and identifiability

    Science.gov (United States)

    Zaminpardaz, S.; Teunissen, P. J. G.

    2018-04-01

    In this contribution, we present and analyze datasnooping in the context of the DIA method. As the DIA method for the detection, identification and adaptation of mismodelling errors is concerned with estimation and testing, it is the combination of both that needs to be considered. This combination is rigorously captured by the DIA estimator. We discuss and analyze the DIA-datasnooping decision probabilities and the construction of the corresponding partitioning of misclosure space. We also investigate the circumstances under which two or more hypotheses are nonseparable in the identification step. By means of a theorem on the equivalence between the nonseparability of hypotheses and the inestimability of parameters, we demonstrate that one can forget about adapting the parameter vector for hypotheses that are nonseparable. However, as this concerns the complete vector and not necessarily functions of it, we also show that parameter functions may exist for which adaptation is still possible. It is shown how this adaptation looks like and how it changes the structure of the DIA estimator. To demonstrate the performance of the various elements of DIA-datasnooping, we apply the theory to some selected examples. We analyze how geometry changes in the measurement setup affect the testing procedure, by studying their partitioning of misclosure space, the decision probabilities and the minimal detectable and identifiable biases. The difference between these two minimal biases is highlighted by showing the difference between their corresponding contributing factors. We also show that if two alternative hypotheses, say Hi and Hj , are nonseparable, the testing procedure may have different levels of sensitivity to Hi -biases compared to the same Hj -biases.

  12. Nanoplatform-based molecular imaging

    National Research Council Canada - National Science Library

    Chen, Xiaoyuan

    2011-01-01

    "Nanoplathform-Based Molecular Imaging provides rationale for using nanoparticle-based probes for molecular imaging, then discusses general strategies for this underutilized, yet promising, technology...

  13. Cardiovascular Molecular Imaging

    International Nuclear Information System (INIS)

    Lee, Kyung Han

    2009-01-01

    Molecular imaging strives to visualize processes in living subjects at the molecular level. Monitoring biochemical processes at this level will allow us to directly track biological processes and signaling events that lead to pathophysiological abnormalities, and help make personalized medicine a reality by allowing evaluation of therapeutic efficacies on an individual basis. Although most molecular imaging techniques emerged from the field of oncology, they have now gradually gained acceptance by the cardiovascular community. Hence, the availability of dedicated high-resolution small animal imaging systems and specific targeting imaging probes is now enhancing our understanding of cardiovascular diseases and expediting the development of newer therapies. Examples include imaging approaches to evaluate and track the progress of recent genetic and cellular therapies for treatment of myocardial ischemia. Other areas include in vivo monitoring of such key molecular processes as angiogenesis and apoptosis. Cardiovascular molecular imaging is already an important research tool in preclinical experiments. The challenge that lies ahead is to implement these techniques into the clinics so that they may help fulfill the promise of molecular therapies and personalized medicine, as well as to resolve disappointments and controversies surrounding the field

  14. Molecular toxicity of nanomaterials.

    Science.gov (United States)

    Chang, Xue-Ling; Yang, Sheng-Tao; Xing, Gengmei

    2014-10-01

    With the rapid developments in the fields of nanoscience and nanotechnlogy, more and more nanomaterials and their based consumer products have been used into our daily life. The safety concerns of nanomaterials have been well recognized by the scientific community and the public. Molecular mechanism of interactions between nanomaterials and biosystems is the most essential topic and final core of the biosafety. In the last two decades, nanotoxicology developed very fast and toxicity phenomena of nanomaterials have been reported. To achieve better understanding and detoxication of nanomaterials, thorough studies of nanotoxicity at molecular level are important. The interactions between nanomaterials and biomolecules have been widely investigated as the first step toward the molecular nanotoxicology. The consequences of such interactions have been discussed in the literature. Besides this, the chemical mechanism of nanotoxicology is gaining more attention, which would lead to a better design of nontoxic nanomaterials. In this review, we focus on the molecular nanotoxicology and explore the toxicity of nanomaterials at molecular level. The molecular level studies of nanotoxicology are summarized and the published nanotoxicological data are revisited.

  15. Molecular imaging of oncolytic viral therapy

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2014-01-01

    Full Text Available Oncolytic viruses have made their mark on the cancer world as a potential therapeutic option, with the possible advantages of reduced side effects and strengthened treatment efficacy due to higher tumor selectivity. Results have been so promising, that oncolytic viral treatments have now been approved for clinical trials in several countries. However, clinical studies may benefit from the ability to noninvasively and serially identify sites of viral targeting via molecular imaging in order to provide safety, efficacy, and toxicity information. Furthermore, molecular imaging of oncolytic viral therapy may provide a more sensitive and specific diagnostic technique to detect tumor origin and, more importantly, presence of metastases. Several strategies have been investigated for molecular imaging of viral replication broadly categorized into optical and deep tissue imaging, utilizing several reporter genes encoding for fluorescence proteins, conditional enzymes, and membrane protein and transporters. Various imaging methods facilitate molecular imaging, including computer tomography, magnetic resonance imaging, positron emission tomography, single photon emission CT, gamma-scintigraphy, and photoacoustic imaging. In addition, several molecular probes are used for medical imaging, which act as targeting moieties or signaling agents. This review will explore the preclinical and clinical use of in vivo molecular imaging of replication-competent oncolytic viral therapy.

  16. Molecular identification of the Sporothrix schenckii complex.

    Science.gov (United States)

    Oliveira, Manoel Marques Evangelista; Almeida-Paes, Rodrigo; Gutierrez-Galhardo, Maria Clara; Zancope-Oliveira, Rosely M

    2014-01-01

    Sporothrix schenckii, an ascomycetous dimorphic organism that for over a century was recognized as the sole agent of sporotrichosis, a subcutaneous mycosis with a worldwide distribution. However, it has been proposed, based on physiologic and molecular aspects, that S. schenckii is a complex of distinct species: Sporothrix brasiliensis, Sporothrix mexicana, Sporothrix globosa, S. schenckii sensu strictu, Sporothrix luriei, and Sporothrix albicans (formerly Sporothrix pallida). Human disease has a broad range of clinical manifestations and can be classified into fixed cutaneous, lymphocutaneous, disseminated cutaneous, and extracutaneous sporotrichosis. The gold standard for the diagnosis of sporotrichosis is the culture; however, serologic, histopathologic and molecular approaches have been recently adopted for the diagnosis of this mycosis. Few molecular methods have been applied to the diagnosis of sporotrichosis to detect S. schenckii DNA from clinical specimens, and to identify Sporothrix spp. in culture. Until now, Sporothrix is the unique clinically relevant dimorphic fungus without an elucidated genome sequence, thus limiting molecular knowledge about the cryptic species of this complex, and the sexual form of all S. schenckii complex species. In this review we shall focus on the current diagnosis of the sporotrichosis, and discuss the current molecular tools applied to the diagnosis and identification of the Sporothrix complex species. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  17. Toward the identification of molecular cogs.

    Science.gov (United States)

    Dziubiński, Maciej; Lesyng, Bogdan

    2016-04-05

    Computer simulations of molecular systems allow determination of microscopic interactions between individual atoms or groups of atoms, as well as studies of intramolecular motions. Nevertheless, description of structural transformations at the mezoscopic level and identification of causal relations associated with these transformations is very difficult. Structural and functional properties are related to free energy changes. Therefore, to better understand structural and functional properties of molecular systems, it is required to deepen our knowledge of free energy contributions arising from molecular subsystems in the course of structural transformations. The method presented in this work quantifies the energetic contribution of each pair of atoms to the total free energy change along a given collective variable. Next, with the help of a genetic clustering algorithm, the method proposes a division of the system into two groups of atoms referred to as molecular cogs. Atoms which cooperate to push the system forward along a collective variable are referred to as forward cogs, and those which work in the opposite direction as reverse cogs. The procedure was tested on several small molecules for which the genetic clustering algorithm successfully found optimal partitionings into molecular cogs. The primary result of the method is a plot depicting the energetic contributions of the identified molecular cogs to the total Potential of Mean Force (PMF) change. Case-studies presented in this work should help better understand the implications of our approach, and were intended to pave the way to a future, publicly available implementation. © 2015 Wiley Periodicals, Inc.

  18. Common Molecular Subtypes Among Asian Hepatocellular Carcinoma and Cholangiocarcinoma

    DEFF Research Database (Denmark)

    Chaisaingmongkol, Jittiporn; Budhu, Anuradha; Dang, Hien

    2017-01-01

    Intrahepatic cholangiocarcinoma (ICC) and hepatocellular carcinoma (HCC) are clinically disparate primary liver cancers with etiological and biological heterogeneity. We identified common molecular subtypes linked to similar prognosis among 199 Thai ICC and HCC patients through systems integratio...

  19. Morphological and molecular characterization of L-methioninase ...

    African Journals Online (AJOL)

    Six species of L-methioninase producing Aspergillus species, isolated from Egyptian soil, were selected for comprehensive morphotypic and molecular characterization. Based on morphological and physiological features, these isolates were identified as Aspergillus flavipes, Aspergillus carneus, Aspergillus flavus, ...

  20. Identification of a myometrial molecular profile for dystocic labor.

    LENUS (Irish Health Repository)

    Brennan, Donal J

    2011-01-01

    The most common indication for cesarean section (CS) in nulliparous women is dystocia secondary to ineffective myometrial contractility. The aim of this study was to identify a molecular profile in myometrium associated with dystocic labor.

  1. Nanotechnology Review: Molecular Electronics to Molecular Motors

    Science.gov (United States)

    Srivastava, Deepak; Saini, Subhash (Technical Monitor)

    1998-01-01

    Reviewing the status of current approaches and future projections, as already published in scientific journals and books, the talk will summarize the direction in which computational and experimental nanotechnologies are progressing. Examples of nanotechnological approaches to the concepts of design and simulation of carbon nanotube based molecular electronic and mechanical devices will be presented. The concepts of nanotube based gears and motors will be discussed. The above is a non-technical review talk which covers long term precompetitive basic research in already published material that has been presented before many US scientific meeting audiences.

  2. Molecular signatures of thyroid follicular neoplasia

    DEFF Research Database (Denmark)

    Borup, R.; Rossing, M.; Henao, Ricardo

    2010-01-01

    The molecular pathways leading to thyroid follicular neoplasia are incompletely understood, and the diagnosis of follicular tumors is a clinical challenge. To provide leads to the pathogenesis and diagnosis of the tumors, we examined the global transcriptome signatures of follicular thyroid...... a mechanism for cancer progression, which is why we exploited the results in order to generate a molecular classifier that could identify 95% of all carcinomas. Validation employing public domain and cross-platform data demonstrated that the signature was robust and could diagnose follicular nodules...... and robust genetic signature for the diagnosis of FA and FC. Endocrine-Related Cancer (2010) 17 691-708...

  3. Quasi-molecular processes in dense plasmas

    International Nuclear Information System (INIS)

    Younger, S.M.

    1991-01-01

    Quasi-molecular phenomena occur in dense plasmas when the interatomic spacing is comparable to the characteristic wavelength of the electrons. If the electronic states are bound, covalent orbitals arise with different excitation energies, radiative rates, and collisional rates than for isolated ions. For continuum electrons, charge localization near transient clusters of nuclei can influence many scattering and transport processes. We identify several novel consequences of quasi-molecular phenomena in plasmas and give a possible explanation of high energy features associated with helium-like emissions lines observed in recent inertial fusion experiments. 7 refs

  4. Exploring RNA structure by integrative molecular modelling

    DEFF Research Database (Denmark)

    Masquida, Benoît; Beckert, Bertrand; Jossinet, Fabrice

    2010-01-01

    RNA molecular modelling is adequate to rapidly tackle the structure of RNA molecules. With new structured RNAs constituting a central class of cellular regulators discovered every year, the need for swift and reliable modelling methods is more crucial than ever. The pragmatic method based...... on interactive all-atom molecular modelling relies on the observation that specific structural motifs are recurrently found in RNA sequences. Once identified by a combination of comparative sequence analysis and biochemical data, the motifs composing the secondary structure of a given RNA can be extruded...

  5. Parameter trajectory analysis to identify treatment effects of pharmacological interventions.

    Directory of Open Access Journals (Sweden)

    Christian A Tiemann

    Full Text Available The field of medical systems biology aims to advance understanding of molecular mechanisms that drive disease progression and to translate this knowledge into therapies to effectively treat diseases. A challenging task is the investigation of long-term effects of a (pharmacological treatment, to establish its applicability and to identify potential side effects. We present a new modeling approach, called Analysis of Dynamic Adaptations in Parameter Trajectories (ADAPT, to analyze the long-term effects of a pharmacological intervention. A concept of time-dependent evolution of model parameters is introduced to study the dynamics of molecular adaptations. The progression of these adaptations is predicted by identifying necessary dynamic changes in the model parameters to describe the transition between experimental data obtained during different stages of the treatment. The trajectories provide insight in the affected underlying biological systems and identify the molecular events that should be studied in more detail to unravel the mechanistic basis of treatment outcome. Modulating effects caused by interactions with the proteome and transcriptome levels, which are often less well understood, can be captured by the time-dependent descriptions of the parameters. ADAPT was employed to identify metabolic adaptations induced upon pharmacological activation of the liver X receptor (LXR, a potential drug target to treat or prevent atherosclerosis. The trajectories were investigated to study the cascade of adaptations. This provided a counter-intuitive insight concerning the function of scavenger receptor class B1 (SR-B1, a receptor that facilitates the hepatic uptake of cholesterol. Although activation of LXR promotes cholesterol efflux and -excretion, our computational analysis showed that the hepatic capacity to clear cholesterol was reduced upon prolonged treatment. This prediction was confirmed experimentally by immunoblotting measurements of SR-B1

  6. White piedra: molecular identification of Trichosporon inkin in members of the same family.

    Science.gov (United States)

    Richini-Pereira, Virgínia Bodelão; Camargo, Rosângela Maria Pires de; Bagagli, Eduardo; Marques, Silvio Alencar

    2012-06-01

    White piedra is a superficial mycosis caused by the genus Trichosporon and characterized by nodules on hair shaft. The authors report a family referred to as pediculosis. Mycological culture on Mycosel® plus molecular identification was performed to precisely identify the etiology. A Trichosporon spp. infection was revealed. The molecular procedure identified the agent as Trichosporon inkin. White piedra and infection caused by T. inkin are rarely reported in Southern Brazil. The molecular tools are essentials on identifying the Trichosporon species.

  7. Identifying candidate driver genes by integrative ovarian cancer genomics data

    Science.gov (United States)

    Lu, Xinguo; Lu, Jibo

    2017-08-01

    Integrative analysis of molecular mechanics underlying cancer can distinguish interactions that cannot be revealed based on one kind of data for the appropriate diagnosis and treatment of cancer patients. Tumor samples exhibit heterogeneity in omics data, such as somatic mutations, Copy Number Variations CNVs), gene expression profiles and so on. In this paper we combined gene co-expression modules and mutation modulators separately in tumor patients to obtain the candidate driver genes for resistant and sensitive tumor from the heterogeneous data. The final list of modulators identified are well known in biological processes associated with ovarian cancer, such as CCL17, CACTIN, CCL16, CCL22, APOB, KDF1, CCL11, HNF1B, LRG1, MED1 and so on, which can help to facilitate the discovery of biomarkers, molecular diagnostics, and drug discovery.

  8. Molecular dewetting on insulators

    International Nuclear Information System (INIS)

    Burke, S A; Topple, J M; Gruetter, P

    2009-01-01

    Recent attention given to the growth and morphology of organic thin films with regard to organic electronics has led to the observation of dewetting (a transition from layer(s) to islands) of molecular deposits in many of these systems. Dewetting is a much studied phenomenon in the formation of polymer and liquid films, but its observation in thin films of the 'small' molecules typical of organic electronics requires additional consideration of the structure of the interface between the molecular film and the substrate. This review covers some key concepts related to dewetting and molecular film growth. In particular, the origins of different growth modes and the thickness dependent interactions which give rise to dewetting are discussed in terms of surface energies and the disjoining pressure. Characteristics of molecular systems which may lead to these conditions, including the formation of metastable interface structures and commensurate-incommensurate phase transitions, are also discussed. Brief descriptions of some experimental techniques which have been used to study molecular dewetting are given as well. Examples of molecule-on-insulator systems which undergo dewetting are described in some detail, specifically perylene derivatives on alkali halides, C 60 on alkali halides, and the technologically important system of pentacene on SiO 2 . These examples point to some possible predicting factors for the occurrence of dewetting, most importantly the formation of an interface layer which differs from the bulk crystal structure. (topical review)

  9. Molecular dewetting on insulators.

    Science.gov (United States)

    Burke, S A; Topple, J M; Grütter, P

    2009-10-21

    Recent attention given to the growth and morphology of organic thin films with regard to organic electronics has led to the observation of dewetting (a transition from layer(s) to islands) of molecular deposits in many of these systems. Dewetting is a much studied phenomenon in the formation of polymer and liquid films, but its observation in thin films of the 'small' molecules typical of organic electronics requires additional consideration of the structure of the interface between the molecular film and the substrate. This review covers some key concepts related to dewetting and molecular film growth. In particular, the origins of different growth modes and the thickness dependent interactions which give rise to dewetting are discussed in terms of surface energies and the disjoining pressure. Characteristics of molecular systems which may lead to these conditions, including the formation of metastable interface structures and commensurate-incommensurate phase transitions, are also discussed. Brief descriptions of some experimental techniques which have been used to study molecular dewetting are given as well. Examples of molecule-on-insulator systems which undergo dewetting are described in some detail, specifically perylene derivatives on alkali halides, C(60) on alkali halides, and the technologically important system of pentacene on SiO(2). These examples point to some possible predicting factors for the occurrence of dewetting, most importantly the formation of an interface layer which differs from the bulk crystal structure.

  10. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  11. Molecular MR imaging

    International Nuclear Information System (INIS)

    Fleige, G.; Hamm, B.

    2000-01-01

    Basic medicobiological research in recent years has made rapid advances in the functional understanding of normal and pathological processes down to the molecular level. At the same time, various imaging modalities have developed from the depiction of organs to approaching the depiction of the cellular level and are about to make the visualization of molecular processes an established procedure. Besides other modalities like PET and near-infrared fluorescence, MR imaging offers some promising options for molecular imaging as well as some applications that have already been tested such as the visualization of enzyme activity, the depiction of the expression of certain genes, the visualization of surface receptors, or the specific demonstration of cells involved in the body's immune response. A major advantage of molecular magnetic resonance imaging (mMRI) over other more sensitive modalities is its high spatial resolution. However, the establishment of mMRI crucially relies on further improvements in resolution and the development of molecular markers for improving its sensitivity and specificity. The state of the art of mMRI is presented by giving a survey of the literature on experimental studies and reporting the results our study group obtained during investigation on gliomas. (orig.) [de

  12. Molecularly targeted therapeutic radiopharmaceuticals

    International Nuclear Information System (INIS)

    Saw, M.M.

    2007-01-01

    Full text: It is generally agreed that current focus of nuclear medicine development should be on molecular imaging and therapy. Though, the widespread use of the terminology 'molecular imaging' is quite recent, nuclear medicine has used molecular imaging techniques for more than 20 years ago. A variety of radiopharmaceuticals have been introduced for the internal therapy of malignant and inflammatory lesions in nuclear medicine. In the field of bio/medical imaging, nuclear medicine is one of the disciplines which has the privilege of organized and well developed chemistry/ pharmacy section; radio-chemistry/radiopharmacy. Fundamental principles have been developed more than 40 years ago and advanced research is going well into postgenomic era. The genomic revolution and dramatically increased insight in the molecular mechanisms underlying pathology have led to paradigm shift in drug development. Likewise does in the nuclear medicine. Here, the author will present current clinical and pre-clinical therapeutic radiopharmaceuticals based on molecular targets such as membrane-bound receptors, enzymes, nucleic acids, sodium iodide symporter, etc, in correlation with fundamentals of radiopharmacy. (author)

  13. Molecular dissection of Norrie disease.

    Science.gov (United States)

    Berger, W

    1998-01-01

    Norrie disease (ND) is a severe form of congenital blindness accompanied by mental retardation and/or deafness in at least one third of the patients. This article summarizes advances in the molecular genetic analysis of this disease during the last 13 years, including mapping and cloning of the human gene and the generation and characterization of a mouse model. Genetic linkage studies and physical mapping strategies have assigned the ND locus to the proximal short arm of the human X chromosome. The identification of chromosomal rearrangements in several patients, such as microdeletions, enabled the isolation of the ND gene by a positional cloning approach. Numerous point mutations in this gene have been identified in three distinct clinical entities: (1) ND, (2) familial and sporadic exudative vitreoretinopathy, and (3) retinopathy of prematurity. The gene encodes a relatively small protein, consisting of 133 amino acids. The function of the gene product is yet unknown, although homologies with known proteins and molecular modelling data suggest a role in the regulation of cell interaction or differentiation processes. A mouse model has been generated to shed more light on early pathogenic events involved in ND and allelic disorders. The mouse homologous protein is highly identical (94%) to the human polypeptide. The gene is expressed in the neuronal layers of the mouse retina, the cerebellum and olfactory epithelium. Mutant mice show snowflake-like opacities within the vitreous, dysgenesis of the ganglion cell layer and occasionally degeneration of photoreceptor cells. The mouse phenotype does not include phthisis bulbi and, overall, resembles a mild form of ND. Electrophysiological studies revealed a severely altered electroretinogram b-wave. These results suggest a primary defect in the inner neuronal layers of the retina. Defects in the vitreous and photoreceptor cell layer are most likely secondary effects. Further histological, functional and molecular

  14. Interpreting closed-loop learning control of molecular fragmentation in terms of wave-packet dynamics and enhanced molecular ionization

    International Nuclear Information System (INIS)

    Cardoza, David; Baertschy, Mark; Weinacht, Thomas

    2005-01-01

    We interpret a molecular fragmentation experiment using shaped, ultrafast laser pulses in terms of enhanced molecular ionization during dissociation. A closed-loop learning control experiment was performed to maximize the CF 3 + /CH 3 + production ratio in the dissociative ionization of CH 3 COCF 3 . Using ab inito molecular structure calculations and quasistatic molecular ionization calculations along with data from pump-probe experiments, we identify the primary control mechanism which is quite general and should be applicable to a broad class of molecules

  15. Molecular packing in 1-hexanol-DMPC bilayers studied by molecular dynamics simulation

    DEFF Research Database (Denmark)

    Pedersen, U.R.; Peters, Günther H.j.; Westh, P.

    2007-01-01

    The structure and molecular packing density of a “mismatched” solute, 1-hexanol, in lipid membranes of dimyristoyl phosphatidylcholine (DMPC) was studied by molecular dynamics simulations. We found that the average location and orientation of the hexanol molecules matched earlier experimental data...... on comparable systems. The local density or molecular packing in DMPC–hexanol was elucidated through the average Voronoi volumes of all heavy (non-hydrogen) atoms. Analogous analysis was conducted on trajectories from simulations of pure 1-hexanol and pure (hydrated) DMPC bilayers. The results suggested...... of the alcohol upon partitioning and an even stronger loosening in the packing of the lipid. Furthermore, analysis of Voronoi volumes along the membrane normal identifies a distinctive depth dependence of the changes in molecular packing. The outer (interfacial) part of the lipid acyl chains (up to C8...

  16. [Molecular techniques in mycology].

    Science.gov (United States)

    Rodríguez-Tudela, Juan Luis; Cuesta, Isabel; Gómez-López, Alicia; Alastruey-Izquierdo, Ana; Bernal-Martínez, Leticia; Cuenca-Estrella, Manuel

    2008-11-01

    An increasing number of molecular techniques for the diagnosis of fungal infections have been developed in the last few years, due to the growing prevalence of mycoses and the length of time required for diagnosis when classical microbiological methods are used. These methods are designed to resolve the following aspects of mycological diagnosis: a) Identification of fungi to species level by means of sequencing relevant taxonomic targets; b) early clinical diagnosis of invasive fungal infections; c) detection of molecular mechanisms of resistance to antifungal agents; and d) molecular typing of fungi. Currently, these methods are restricted to highly developed laboratories. However, some of these techniques will probably be available in daily clinical practice in the near future.

  17. Theoretical Molecular Biophysics

    CERN Document Server

    Scherer, Philipp

    2010-01-01

    "Theoretical Molecular Biophysics" is an advanced study book for students, shortly before or after completing undergraduate studies, in physics, chemistry or biology. It provides the tools for an understanding of elementary processes in biology, such as photosynthesis on a molecular level. A basic knowledge in mechanics, electrostatics, quantum theory and statistical physics is desirable. The reader will be exposed to basic concepts in modern biophysics such as entropic forces, phase separation, potentials of mean force, proton and electron transfer, heterogeneous reactions coherent and incoherent energy transfer as well as molecular motors. Basic concepts such as phase transitions of biopolymers, electrostatics, protonation equilibria, ion transport, radiationless transitions as well as energy- and electron transfer are discussed within the frame of simple models.

  18. Molecular Diagnosis of Tuberculosis.

    Science.gov (United States)

    Nurwidya, Fariz; Handayani, Diah; Burhan, Erlina; Yunus, Faisal

    2018-01-01

    Tuberculosis (TB) is one of the leading causes of adult death in the Asia-Pacific Region, including Indonesia. As an infectious disease caused by Mycobacterium tuberculosis (MTB), TB remains a major public health issue especially in developing nations due to the lack of adequate diagnostic testing facilities. Diagnosis of TB has entered an era of molecular detection that provides faster and more cost-effective methods to diagnose and confirm drug resistance in TB cases, meanwhile, diagnosis by conventional culture systems requires several weeks. New advances in the molecular detection of TB, including the faster and simpler nucleic acid amplification test (NAAT) and whole-genome sequencing (WGS), have resulted in a shorter time for diagnosis and, therefore, faster TB treatments. In this review, we explored the current findings on molecular diagnosis of TB and drug-resistant TB to see how this advancement could be integrated into public health systems in order to control TB.

  19. Molecular radiation biology: Future aspects

    International Nuclear Information System (INIS)

    Hagen, U.

    1990-01-01

    Future aspects of molecular radiation biology may be envisaged by looking for unsolved problems and ways to analyse them. Considering the endpoints of cellular radiation effects as cell inactivation, chromosome aberrations, mutation and transformation, the type of DNA damage in the irradiated cell and the mechanisms of DNA repair as excision repair, recombination repair and mutagenic repair are essential topics. At present, great efforts are made to identify, to clone and to sequence genes involved in the control of repair of DNA damage and to study their regulation. There are close relationships between DNA repair genes isolated from various organisms, which promises fast progress for the molecular analysis of repair processes in mammalian cells. More knowledge is necessary regarding the function of the gene products, i.e. enzymes and proteins involved in DNA repair. Effort should be made to analyse the enzymatic reactions, leading to an altered nucleotide sequence, encountered as a point mutation. Mislead mismatch repair and modulation of DNA polymerase might be possible mechanisms. (orig.)

  20. Photodissociation processes in molecular beams

    International Nuclear Information System (INIS)

    Carlson, L.R.

    1979-05-01

    A description is presented of a study of the photodissociation dynamics of molecules in a molecular beam. Photo-fragmentation translational spectroscopy has been utilized to observe the photodissociation dynamics of ozone. Using a supersonic molecular beam and a 10 nanosecond pulsed laser at lambda = 266 nm, the velocities of the fragment products are measured by the method of time of flight. The resolution of the time of flight spectrum of ozone is sufficiently high that the electronic and vibrational states are clearly resolved and identified. Above the threshold (lambda 1 D) has been estimated in the past to be unity for the process O 3 ( 1 A 1 ) + hν)lambda 3 ( 1 B 2 ) → O 2 ( 1 Δ/sub g/) + O( 1 D). However a small production of O 2 ( 3 Σ/sub g/ - ) + O( 3 P) has been observed in this study. The O 2 ( 1 Δ/sub g/) product yields four vibrational states (v = 0, 1, 2, 3) which yields a vibrational temperature of 2700 0 K along with narrow energy distributions of rotational levels. These energy distributions are compared with photodissociation models along with the polarization dependence of the dissociative process which was also measured. 143 references

  1. Photodissociation processes in molecular beams

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, L.R.

    1979-05-01

    A description is presented of a study of the photodissociation dynamics of molecules in a molecular beam. Photo-fragmentation translational spectroscopy has been utilized to observe the photodissociation dynamics of ozone. Using a supersonic molecular beam and a 10 nanosecond pulsed laser at lambda = 266 nm, the velocities of the fragment products are measured by the method of time of flight. The resolution of the time of flight spectrum of ozone is sufficiently high that the electronic and vibrational states are clearly resolved and identified. Above the threshold (lambda < 310 nm), the quantum yield for the production of O(/sup 1/D) has been estimated in the past to be unity for the process O/sub 3/ (/sup 1/A/sub 1/) + h..nu..)lambda < 300 nm) ..-->.. O/sub 3/(/sup 1/B/sub 2/) ..-->.. O/sub 2/(/sup 1/..delta../sub g/) + O(/sup 1/D). However a small production of O/sub 2/ (/sup 3/..sigma../sub g//sup -/) + O(/sup 3/P) has been observed in this study. The O/sub 2/(/sup 1/..delta../sub g/) product yields four vibrational states (v = 0, 1, 2, 3) which yields a vibrational temperature of 2700/sup 0/K along with narrow energy distributions of rotational levels. These energy distributions are compared with photodissociation models along with the polarization dependence of the dissociative process which was also measured. 143 references.

  2. Identifying units for conservation using molecular systematics: the cautionary tale of the Karner blue butterfly.

    Science.gov (United States)

    Gompert, Zachariah; Nice, Chris C; Fordyce, James A; Forister, Matthew L; Shapiro, Arthur M

    2006-06-01

    The federally endangered North American Karner blue butterfly (Lycaeides melissa samuelis) and the closely related Melissa blue butterfly (L. m. melissa) can be distinguished based on life history and morphology. Western populations of L. m. samuelis share mitochondrial haplotypes with L. m. melissa populations, while eastern populations of L. m. samuelis have divergent haplotypes. Here we test two hypotheses concerning the presence of L. m. melissa mitochondrial haplotypes in western L. m. samuelis populations: (i) mitochondrial introgression has occurred from L. m. melissa populations into western L. m. samuelis populations, or (ii) western populations of the nominal L. m. samuelis are more closely related to L. m. melissa than to eastern L. m. samuelis populations, yet are phenotypically similar to the latter. A Bayesian algorithm was used to cluster 190 L. melissa individuals based on 143 informative amplified fragment length polymorphism (AFLP) loci. This method clearly differentiated L. m. samuelis and L. m. melissa. Thus, genomic divergence was greater between western L. m. samuelis populations and L. m. melissa populations than it was between western and eastern populations of L. m. samuelis. This supports the hypothesis that the presence of L. m. melissa mitochondrial haplotypes in western L. m. samuelis populations is the result of mitochondrial introgression. These data provide valuable information for conservation and management plans for the endangered L. m. samuelis, and illustrate the risks of using data from a single locus for diagnosing significant units of biodiversity for conservation.

  3. Combined molecular and biochemical approach identifies Aspergillus japonicus and Aspergillus aculeatus as two species

    DEFF Research Database (Denmark)

    Parenicova, L.; Skouboe, P.; Frisvad, Jens Christian

    2001-01-01

    of the internal transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene could not be used to distinguish between A. japonicus and A. aculeatus but did show that these two taxa are more closely related to each other than to other species of black aspergilli. Aspergillus niger pyruvate kinase (pkiA) and pectin...... variation when they were probed with the pelA gene. The secondary-metabolite profiles supported division of the isolates into the two species and differed from those of other black aspergilli. The strains classified as A. japonicus produced indole alkaloids and a polar metabolite, while the A. aculeatus...... lyase A (pelA) and Agaricus bisporus 28S rRNA genes, which were used as probes in the RFLP analysis, revealed clear polymorphism between these two taxa. The A. niger pkiA and pelA probes placed six strains in an A. japonicus group and 12 isolates in an A. aculeatus group, which exhibited intraspecific...

  4. Proteomics identifies molecular networks affected by tetradecylthioacetic acid and fish oil supplemented diets

    DEFF Research Database (Denmark)

    Wrzesinski, Krzysztof; León, Ileana R.; Kulej, Katarzyna

    2013-01-01

    - high fat diet that is thought to contribute to the development of metabolic syndrome - a condition that is strongly associated with diabetes, obesity and heart failure. Fish oil and TTA are known to have beneficial effects for the fatty acid metabolism and have been shown to alleviate some...... expression in a long-term study (50weeks) in male Wistar rats fed 5 different diets. The diets were as follows: low fat diet; high fat diet; and three diets that combined high fat diet with fish oil, TTA or combination of those two as food supplements. We used two different proteomics techniques: a protein...... antioxidant properties of TTA. BIOLOGICAL SIGNIFICANCE: This study for the first time explores the effect of fish oil and TTA - tetradecyl-thioacetic acid and the combination of those two as diet supplements on mitochondria metabolism in a comprehensive and systematic manner. We show that fish oil and TTA...

  5. Molecular epidemiology of coxsackievirus A16: intratype and prevalent intertype recombination identified.

    Directory of Open Access Journals (Sweden)

    Xiangpeng Chen

    Full Text Available Coxsackievirus A16 (CVA16 is responsible for nearly 50% of all the confirmed hand, foot, and mouth disease (HFMD cases in mainland China, sometimes it could also cause severe complications, and even death. To clarify the genetic characteristics and the epidemic patterns of CVA16 in mainland China, comprehensive bioinfomatics analyses were performed by using 35 CVA16 whole genome sequences from 1998 to 2011, 593 complete CVA16 VP1 sequences from 1981 to 2011, and prototype strains of human enterovirus species A (EV-A. Analysis on complete VP1 sequences revealed that subgenotypes B1a and B1b were prevalent strains and have been co-circulating in many Asian countries since 2000, especially in mainland China for at least 13 years. While the prevalence of subgenotype B1c (totally 20 strains was much limited, only found in Malaysia from 2005 to 2007 and in France in 2010. Genotype B2 only caused epidemic in Japan and Malaysia from 1981 to 2000. Both subgenotypes B1a and B1b were potential recombinant viruses containing sequences from other EV-A donors in the 5'-untranslated region and P2, P3 non-structural protein encoding regions.

  6. An organelle-specific protein landscape identifies novel diseases and molecular mechanisms.

    Science.gov (United States)

    Boldt, Karsten; van Reeuwijk, Jeroen; Lu, Qianhao; Koutroumpas, Konstantinos; Nguyen, Thanh-Minh T; Texier, Yves; van Beersum, Sylvia E C; Horn, Nicola; Willer, Jason R; Mans, Dorus A; Dougherty, Gerard; Lamers, Ideke J C; Coene, Karlien L M; Arts, Heleen H; Betts, Matthew J; Beyer, Tina; Bolat, Emine; Gloeckner, Christian Johannes; Haidari, Khatera; Hetterschijt, Lisette; Iaconis, Daniela; Jenkins, Dagan; Klose, Franziska; Knapp, Barbara; Latour, Brooke; Letteboer, Stef J F; Marcelis, Carlo L; Mitic, Dragana; Morleo, Manuela; Oud, Machteld M; Riemersma, Moniek; Rix, Susan; Terhal, Paulien A; Toedt, Grischa; van Dam, Teunis J P; de Vrieze, Erik; Wissinger, Yasmin; Wu, Ka Man; Apic, Gordana; Beales, Philip L; Blacque, Oliver E; Gibson, Toby J; Huynen, Martijn A; Katsanis, Nicholas; Kremer, Hannie; Omran, Heymut; van Wijk, Erwin; Wolfrum, Uwe; Kepes, François; Davis, Erica E; Franco, Brunella; Giles, Rachel H; Ueffing, Marius; Russell, Robert B; Roepman, Ronald

    2016-05-13

    Cellular organelles provide opportunities to relate biological mechanisms to disease. Here we use affinity proteomics, genetics and cell biology to interrogate cilia: poorly understood organelles, where defects cause genetic diseases. Two hundred and seventeen tagged human ciliary proteins create a final landscape of 1,319 proteins, 4,905 interactions and 52 complexes. Reverse tagging, repetition of purifications and statistical analyses, produce a high-resolution network that reveals organelle-specific interactions and complexes not apparent in larger studies, and links vesicle transport, the cytoskeleton, signalling and ubiquitination to ciliary signalling and proteostasis. We observe sub-complexes in exocyst and intraflagellar transport complexes, which we validate biochemically, and by probing structurally predicted, disruptive, genetic variants from ciliary disease patients. The landscape suggests other genetic diseases could be ciliary including 3M syndrome. We show that 3M genes are involved in ciliogenesis, and that patient fibroblasts lack cilia. Overall, this organelle-specific targeting strategy shows considerable promise for Systems Medicine.

  7. Quantitative proteomics identify molecular targets that are crucial in larval settlement and metamorphosis of bugula neritina

    KAUST Repository

    Zhang, Huoming; Wong, Yuehim; Wang, Hao; Chen, Zhangfan; Arellano, Shawn M.; Ravasi, Timothy; Qian, Peiyuan

    2011-01-01

    The marine invertebrate Bugula neritina has a biphasic life cycle that consists of a swimming larval stage and a sessile juvenile and adult stage. The attachment of larvae to the substratum and their subsequent metamorphosis have crucial ecological

  8. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles

    DEFF Research Database (Denmark)

    Farshidfar, Farshad; Zheng, Siyuan; Gingras, Marie-Claude

    2017-01-01

    Cholangiocarcinoma (CCA) is an aggressive malignancy of the bile ducts, with poor prognosis and limited treatment options. Here, we describe the integrated analysis of somatic mutations, RNA expression, copy number, and DNA methylation by The Cancer Genome Atlas of a set of predominantly intrahep...

  9. Dehydration and vernalization treatments identify overlapping molecular networks impacting endodormancy maintenance in leafy spurge crown buds

    Science.gov (United States)

    Leafy spurge (Euphorbia esula L.) is an herbaceous perennial weed that reproduces vegetatively from an abundance of underground adventitious buds (UABs), which undergo well-defined phases of seasonal dormancy (para-, endo- and eco-dormancy). In this study, the effects of dehydration-stress on vegeta...

  10. Comparative analysis of perturbed molecular pathways identified in in vitro and in vivo toxicology studies

    NARCIS (Netherlands)

    Wiesinger, Martin; Mayer, Bernd; Jennings, Paul; Lukas, Arno

    The development of in vitro toxicological testing strategies are hampered by the difficulty in extrapolation to the intact organism. Academic toxicological literature contains a wealth of mechanistically rich information, especially arising from omic studies, which could potentially be utilized to

  11. Developing Molecular Methods to Identify and Quantify Ballast Water Organisms: A Test Case with Cnidarians

    National Research Council Canada - National Science Library

    Kreiser, Brian R

    2004-01-01

    .... Furthermore, biological invasions mediated by ballast water transport have led to some rather severe economic and ecological consequences as seen in the examples of the zebra mussel and green crab...

  12. Identifying A Molecular Phenotype for Bone Marrow Stromal Cells With In Vivo Bone Forming Capacity

    DEFF Research Database (Denmark)

    Larsen, Kenneth H; Frederiksen, Casper M; Burns, Jorge S

    2009-01-01

    (17% versus 5%) and a larger percentage of genes with predicted SP3 transcription factor binding sites in their promoter region (21% versus 8%). On the other hand, hBMSC-TERT(-Bone) cells expressed a larger number of immune-response related genes (26% versus 8%). In order to test for the predictive...... value of these markers, we studied the correlation between their expression levels in 6 different hBMSC-derived clones and the ability to form bone in vivo. We found a significant correlation for, decorin, lysyl oxidase-like 4, natriuretic peptide receptor C, and tetranectin. No significant positive...

  13. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY THE EMERGING PATHOGEN HEPATITIS E IN WATER SAMPLES

    Science.gov (United States)

    Hepatitis E virus (HEV) is an emerging pathogen that causes significant illness in the developing world. Like the hepatitis A virus, it is transmitted via the fecal-oral route and can cause short-term, acute hepatitis. In addition, hepatitis E has been found to cause a signific...

  14. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY THE MERGING PATHOGEN HEPATITIS E IN WATER SAMPLES

    Science.gov (United States)

    Hepatitis E virus (HEV) is an emerging pathogen that causes significant illness in the developing world. Like the hepatitis A virus, it is transmitted via the fecal-oral route and can cause short-term, acute hepatitis. In addition, hepatitis E has been found to cause a signific...

  15. Back to the sea twice : identifying candidate plant genes for molecular evolution to marine life

    NARCIS (Netherlands)

    Wissler, Lothar; Codoner, Francisco M.; Gu, Jenny; Reusch, Thorsten B. H.; Olsen, Jeanine L.; Procaccini, Gabriele; Bornberg-Bauer, Erich

    2011-01-01

    Background: Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs) of two wide-spread and ecologically important seagrass species, the Mediterranean

  16. Identifying Molecular Culprits of Cervical Cancer Progression | Center for Cancer Research

    Science.gov (United States)

    Human papillomavirus (HPV) DNA is found in 99.7% of invasive cervical carcinomas, providing strong evidence that the virus is a causative agent in the development of this disease. However, most women who become infected with HPV do not develop invasive cervical lesions, indicating that additional exogenous or genetic factors may determine whether HPV preclinical lesions will

  17. Use of Novel Technologies to Identify and Investigate Molecular Markers for Ovarian Cancer Screening and Prevention

    Science.gov (United States)

    1999-10-01

    a, □2 □3 39 Pleural effusion □, No □2Yes 19 Ileum a. □2 Q3 40 Ascites □, No □2 Yes 20 Appendix a. Q. □3 41 Volume: ml 21...postmenopausal women by CA 125 measurement and ultrasonography [see comments]. Br. Med. J. 306, 1030-1034. Karlan, B.Y., Jones, J., Greenwald, M

  18. Multi-omics approach identifies molecular mechanisms of plant-fungus mycorrhizal interaction

    Directory of Open Access Journals (Sweden)

    Peter E Larsen

    2016-01-01

    Full Text Available In mycorrhizal symbiosis, plant roots form close, mutually beneficial interactions with soil fungi. Before this mycorrhizal interaction can be established however, plant roots must be capable of detecting potential beneficial fungal partners and initiating the gene expression patterns necessary to begin symbiosis. To predict a plant root – mycorrhizal fungi sensor systems, we analyzed in vitro experiments of Populus tremuloides (aspen tree and Laccaria bicolor (mycorrhizal fungi interaction and leveraged over 200 previously published transcriptomic experimental data sets, 159 experimentally validated plant transcription factor binding motifs, and more than 120-thousand experimentally validated protein-protein interactions to generate models of pre-mycorrhizal sensor systems in aspen root. These sensor mechanisms link extracellular signaling molecules with gene regulation through a network comprised of membrane receptors, signal cascade proteins, transcription factors, and transcription factor biding DNA motifs. Modeling predicted four pre-mycorrhizal sensor complexes in aspen that interact with fifteen transcription factors to regulate the expression of 1184 genes in response to extracellular signals synthesized by Laccaria. Predicted extracellular signaling molecules include common signaling molecules such as phenylpropanoids, salicylate, and, jasmonic acid. This multi-omic computational modeling approach for predicting the complex sensory networks yielded specific, testable biological hypotheses for mycorrhizal interaction signaling compounds, sensor complexes, and mechanisms of gene regulation.

  19. Identifying Molecular Regulators of Neuronal Functions Affected in the Movement Disorder Dystonia

    Science.gov (United States)

    2015-08-01

    trained by the PI for writing, revising and reviewing manuscripts in one-on-one sessions. He successfully presented a poster in an international...Impairment of bidirectional synaptic plasticity in the striatum of a mouse model of DYT1 dystonia: Role of endogenous acetylcholine. Brain 2009;132:2336–2349...Page 20 of 24 Right before usage , add 20 mg of trypsin (final concentration of 10 mg/ml) and 20 μl of DNase (final concentration of 750 units/ml) to 2

  20. Electron and Phonon Transport in Molecular Junctions

    DEFF Research Database (Denmark)

    Li, Qian

    Molecular electronics provide the possibility to investigate electron and phonon transport at the smallest imaginable scale, where quantum effects can be investigated and exploited directly in the design. In this thesis, we study both electron transport and phonon transport in molecular junctions....... The system we are interested in here are π-stacked molecules connected with two semi-infinite leads. π-stacked aromatic rings, connected via π-π electronic coupling, provides a rather soft mechanical bridge while maintaining high electronic conductivity. We investigate electron transport...... transmission at the Fermi energy. We propose and analyze a way of using π   stacking to design molecular junctions to control heat transport. We develop a simple model system to identify optimal parameter regimes and then use density functional theory (DFT) to extract model parameters for a number of specific...

  1. Molecular biology of human muscle disease

    Energy Technology Data Exchange (ETDEWEB)

    Dunne, P.W.; Epstein, H.F. (Baylor Coll. of Medicine, Houston, TX (United States))

    1991-01-01

    The molecular revolution that is transforming the entire biomedical field has had far-reaching impact in its application to inherited human muscle disease. The gene for Duchenne muscular dystrophy was one of the first cloned without knowledge of the defective protein product. This success was based upon the availability of key chromosomal aberrations that provided molecular landmarks for the disease locus. Subsequent discoveries regarding the mode of expression for this gene, the structure and localization of its protein product dystrophin, and molecular diagnosis of affected and carrier individuals constitute a paradigm for investigation of human genetics. Finding the gene for myotonic muscular dystrophy is requiring the brute force approach of cloning several million bases of DNA, identifying expressed sequences, and characterizing candidate genes. The gene that causes hypertrophic cardiomyopathy has been found serendipitously to be one of the genetic markers on chromosome 14, the {beta} myosin heavy chain.

  2. Molecular biology applications to infectious diseases diagnostic

    International Nuclear Information System (INIS)

    2001-01-01

    This project goes directed to the applications of the techniques of molecular biology in hepatitis virus.A great advance of these techniques it allows its application to the diagnose molecular and it becomes indispensable to have these fundamental tools in the field of the Health Public for the detection precocious, pursuit of the treatment, the one predicts and the evolution of the patient hepatitis bearing virus technical.Use of molecular biology to increase the handling and the control of the patients with hepatitis B and C and to detect an adult numbers of positive cases by means of the training and integration of all the countries participating.Implement the technique of PCR to identify the virus of the hepatitis B and C,implement quantification methods and genotipification for these virus

  3. Molecular characterization of PCN populations from Serbia

    Directory of Open Access Journals (Sweden)

    Oro Violeta

    2012-01-01

    Full Text Available The morphology of potato cyst nematodes (PCN was until recently almost the only way to identify these quarantine organisms. In the last two decades, molecular analyses contributed to faster and more efficient identification of two Globodera species (Globodera pallida and G. rostochiensis and allowed insight into the genetic structure of those parts that were practically inaccessible by morphological studies. Molecular characterization was performed in ITS1-5.8S-ITS2 region. The comparison was made with sequences of different foreign PCN populations via NCBI GenBank database. The results of molecular studies showed similarities and differences between local and foreign PCN populations in the part of genome that was studied.

  4. Characteristic molecular vibrations of adenosine receptor ligands.

    Science.gov (United States)

    Chee, Hyun Keun; Yang, Jin-San; Joung, Je-Gun; Zhang, Byoung-Tak; Oh, S June

    2015-02-13

    Although the regulation of membrane receptor activation is known to be crucial for molecular signal transduction, the molecular mechanism underlying receptor activation is not fully elucidated. Here we study the physicochemical nature of membrane receptor behavior by investigating the characteristic molecular vibrations of receptor ligands using computational chemistry and informatics methods. By using information gain, t-tests, and support vector machines, we have identified highly informative features of adenosine receptor (AdoR) ligand and corresponding functional amino acid residues such as Asn (6.55) of AdoR that has informative significance and is indispensable for ligand recognition of AdoRs. These findings may provide new perspectives and insights into the fundamental mechanism of class A G protein-coupled receptor activation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  5. Cellular and Molecular Basis of Cerebellar Development

    Directory of Open Access Journals (Sweden)

    Salvador eMartinez

    2013-06-01

    Full Text Available Historically, the molecular and cellular mechanisms of cerebellar development were investigated through structural descriptions and studying spontaneous mutations in animal models and humans. Advances in experimental embryology, genetic engineering and neuroimaging techniques render today the possibility to approach the analysis of molecular mechanisms underlying histogenesis and morphogenesis of the cerebellum by experimental designs. Several genes and molecules were identified to be involved in the cerebellar plate regionalization, specification and differentiation of cerebellar neurons, as well as the establishment of cellular migratory routes and the subsequent neuronal connectivity. Indeed, pattern formation of the cerebellum requires the adequate orchestration of both key morphogenetic signals, arising from distinct brain regions, and local expression of specific transcription factors. Thus, the present review wants to revisit and discuss these morphogenetic and molecular mechanisms taking place during cerebellar development in order to understand causal processes regulating cerebellar cytoarchitecture, its highly topographically ordered circuitry and its role in brain function.

  6. Molecular Epidemiology for Vector Research on Leishmaniasis

    Science.gov (United States)

    Kato, Hirotomo; Gomez, Eduardo A; Cáceres, Abraham G; Uezato, Hiroshi; Mimori, Tatsuyuki; Hashiguchi, Yoshihisa

    2010-01-01

    Leishmaniasis is a protozoan disease caused by the genus Leishmania transmitted by female phlebotomine sand flies. Surveillance of the prevalence of Leishmania and responsive vector species in endemic and surrounding areas is important for predicting the risk and expansion of the disease. Molecular biological methods are now widely applied to epidemiological studies of infectious diseases including leishmaniasis. These techniques are used to detect natural infections of sand fly vectors with Leishmania protozoa and are becoming powerful tools due to their sensitivity and specificity. Recently, genetic analyses have been performed on sand fly species and genotyping using PCR-RFLP has been applied to the sand fly taxonomy. In addition, a molecular mass screening method has been established that enables both sand fly species and natural leishmanial infections to be identified simultaneously in hundreds of sand flies with limited effort. This paper reviews recent advances in the study of sand flies, vectors of leishmaniasis, using molecular biological approaches. PMID:20617005

  7. Molecular Epidemiology for Vector Research on Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Hirotomo Kato

    2010-03-01

    Full Text Available Leishmaniasis is a protozoan disease caused by the genus Leishmania transmitted by female phlebotomine sand flies. Surveillance of the prevalence of Leishmania and responsive vector species in endemic and surrounding areas is important for predicting the risk and expansion of the disease. Molecular biological methods are now widely applied to epidemiological studies of infectious diseases including leishmaniasis. These techniques are used to detect natural infections of sand fly vectors with Leishmania protozoa and are becoming powerful tools due to their sensitivity and specificity. Recently, genetic analyses have been performed on sand fly species and genotyping using PCR-RFLP has been applied to the sand fly taxonomy. In addition, a molecular mass screening method has been established that enables both sand fly species and natural leishmanial infections to be identified simultaneously in hundreds of sand flies with limited effort. This paper reviews recent advances in the study of sand flies, vectors of leishmaniasis, using molecular biological approaches.

  8. Molecular epidemiology for vector research on leishmaniasis.

    Science.gov (United States)

    Kato, Hirotomo; Gomez, Eduardo A; Cáceres, Abraham G; Uezato, Hiroshi; Mimori, Tatsuyuki; Hashiguchi, Yoshihisa

    2010-03-01

    Leishmaniasis is a protozoan disease caused by the genus Leishmania transmitted by female phlebotomine sand flies. Surveillance of the prevalence of Leishmania and responsive vector species in endemic and surrounding areas is important for predicting the risk and expansion of the disease. Molecular biological methods are now widely applied to epidemiological studies of infectious diseases including leishmaniasis. These techniques are used to detect natural infections of sand fly vectors with Leishmania protozoa and are becoming powerful tools due to their sensitivity and specificity. Recently, genetic analyses have been performed on sand fly species and genotyping using PCR-RFLP has been applied to the sand fly taxonomy. In addition, a molecular mass screening method has been established that enables both sand fly species and natural leishmanial infections to be identified simultaneously in hundreds of sand flies with limited effort. This paper reviews recent advances in the study of sand flies, vectors of leishmaniasis, using molecular biological approaches.

  9. Treatment Algorithms Based on Tumor Molecular Profiling: The Essence of Precision Medicine Trials.

    Science.gov (United States)

    Le Tourneau, Christophe; Kamal, Maud; Tsimberidou, Apostolia-Maria; Bedard, Philippe; Pierron, Gaëlle; Callens, Céline; Rouleau, Etienne; Vincent-Salomon, Anne; Servant, Nicolas; Alt, Marie; Rouzier, Roman; Paoletti, Xavier; Delattre, Olivier; Bièche, Ivan

    2016-04-01

    With the advent of high-throughput molecular technologies, several precision medicine (PM) studies are currently ongoing that include molecular screening programs and PM clinical trials. Molecular profiling programs establish the molecular profile of patients' tumors with the aim to guide therapy based on identified molecular alterations. The aim of prospective PM clinical trials is to assess the clinical utility of tumor molecular profiling and to determine whether treatment selection based on molecular alterations produces superior outcomes compared with unselected treatment. These trials use treatment algorithms to assign patients to specific targeted therapies based on tumor molecular alterations. These algorithms should be governed by fixed rules to ensure standardization and reproducibility. Here, we summarize key molecular, biological, and technical criteria that, in our view, should be addressed when establishing treatment algorithms based on tumor molecular profiling for PM trials. © The Author 2015. Published by Oxford University Press.

  10. Synergetics of molecular systems

    CERN Document Server

    Lupichev, Lev N; Kadantsev, Vasiliy N

    2014-01-01

    Synergetics is the quantitative study of multicomponent systems that exhibit nonlinear dynamics and cooperativity. This book specifically considers basic models of the nonlinear dynamics of molecular systems and discusses relevant applications in biological physics and the polymer sciences.Emphasis is placed on specific solutions to the dynamical equations that correspond to the coherent formation of spatial-temporal structures, such as solitons, kinks and breathers, in particular. The emergence of these patterns in molecular structures provides a variety of information on their structural pro

  11. Molecular environmental geochemistry

    Science.gov (United States)

    O'Day, Peggy A.

    1999-05-01

    The chemistry, mobility, and bioavailability of contaminant species in the natural environment are controlled by reactions that occur in and among solid, aqueous, and gas phases. These reactions are varied and complex, involving changes in chemical form and mass transfer among inorganic, organic, and biochemical species. The field of molecular environmental geochemistry seeks to apply spectroscopic and microscopic probes to the mechanistic understanding of environmentally relevant chemical processes, particularly those involving contaminants and Earth materials. In general, empirical geochemical models have been shown to lack uniqueness and adequate predictive capability, even in relatively simple systems. Molecular geochemical tools, when coupled with macroscopic measurements, can provide the level of chemical detail required for the credible extrapolation of contaminant reactivity and bioavailability over ranges of temperature, pressure, and composition. This review focuses on recent advances in the understanding of molecular chemistry and reaction mechanisms at mineral surfaces and mineral-fluid interfaces spurred by the application of new spectroscopies and microscopies. These methods, such as synchrotron X-ray absorption and scattering techniques, vibrational and resonance spectroscopies, and scanning probe microscopies, provide direct chemical information that can elucidate molecular mechanisms, including element speciation, ligand coordination and oxidation state, structural arrangement and crystallinity on different scales, and physical morphology and topography of surfaces. Nonvacuum techniques that allow examination of reactions in situ (i.e., with water or fluids present) and in real time provide direct links between molecular structure and reactivity and measurements of kinetic rates or thermodynamic properties. Applications of these diverse probes to laboratory model systems have provided fundamental insight into inorganic and organic reactions at

  12. Molecular cardiovascular imaging

    International Nuclear Information System (INIS)

    Schaefers, M.

    2007-01-01

    Although huge and long-lasting research efforts have been spent on the development of new diagnostic techniques investigating cardiovascular diseases, still fundamental challenges exist; the main challenge being the diagnosis of a suspected or known coronary artery disease or its consequences (myocardial infarction, heart failure etc.). Beside morphological techniques, functional imaging modalities are available in clinical diagnostic algorithms, whereas molecular cardiovascular imaging techniques are still under development. This review summarizes clinical-diagnostical challenges of modern cardiovascular medicine as well as the potential of new molecular imaging techniques to face these. (orig.)

  13. Targeted molecular imaging

    International Nuclear Information System (INIS)

    Kim, E. Edmund

    2003-01-01

    Molecular imaging aims to visualize the cellular and molecular processes occurring in living tissues, and for the imaging of specific molecules in vivo, the development of reporter probes and dedicated imaging equipment is most important. Reporter genes can be used to monitor the delivery and magnitude of therapeutic gene transfer, and the time variation involved. Imaging technologies such as micro-PET, SPECT, MRI and CT, as well as optical imaging systems, are able to non-invasively detect, measure, and report the simultaneous expression of multiple meaningful genes. It is believed that recent advances in reporter probes, imaging technologies and gene transfer strategies will enhance the effectiveness of gene therapy trials

  14. Substructured multibody molecular dynamics.

    Energy Technology Data Exchange (ETDEWEB)

    Grest, Gary Stephen; Stevens, Mark Jackson; Plimpton, Steven James; Woolf, Thomas B. (Johns Hopkins University, Baltimore, MD); Lehoucq, Richard B.; Crozier, Paul Stewart; Ismail, Ahmed E.; Mukherjee, Rudranarayan M. (Rensselaer Polytechnic Institute, Troy, NY); Draganescu, Andrei I.

    2006-11-01

    We have enhanced our parallel molecular dynamics (MD) simulation software LAMMPS (Large-scale Atomic/Molecular Massively Parallel Simulator, lammps.sandia.gov) to include many new features for accelerated simulation including articulated rigid body dynamics via coupling to the Rensselaer Polytechnic Institute code POEMS (Parallelizable Open-source Efficient Multibody Software). We use new features of the LAMMPS software package to investigate rhodopsin photoisomerization, and water model surface tension and capillary waves at the vapor-liquid interface. Finally, we motivate the recipes of MD for practitioners and researchers in numerical analysis and computational mechanics.

  15. Open source molecular modeling.

    Science.gov (United States)

    Pirhadi, Somayeh; Sunseri, Jocelyn; Koes, David Ryan

    2016-09-01

    The success of molecular modeling and computational chemistry efforts are, by definition, dependent on quality software applications. Open source software development provides many advantages to users of modeling applications, not the least of which is that the software is free and completely extendable. In this review we categorize, enumerate, and describe available open source software packages for molecular modeling and computational chemistry. An updated online version of this catalog can be found at https://opensourcemolecularmodeling.github.io. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  16. Molecular epidemiology of Blastocystis

    Directory of Open Access Journals (Sweden)

    Fadime Eroğlu

    2015-12-01

    Full Text Available Blastocystis pathogenicity and classification was newly illuminated with molecular genetic studies and recently the parasite was found in the focus of many researchers. Several molecular methods such as; polymerase chain reaction (PCR, PCR-restriction fragment length polymorphism, random amplified polymorphic DNA, real-time polymerase chain reaction and DNA sequencing analyses can be used in genotyping of Blastocystis. Blastocystis parasites may cause diarrhea, abdominal pain, bloating, gas, irritability, anorexia, cramps, vomiting, dehydration, insomnia, nausea, loss of appetite, weight loss, fatigue symptoms and also could be asymptomatic cases. In this review, it was aimed to summarize the associations between Blastocystis subtypes and pathogenicity.

  17. Valency and molecular structure

    CERN Document Server

    Cartmell, E

    1977-01-01

    Valency and Molecular Structure, Fourth Edition provides a comprehensive historical background and experimental foundations of theories and methods relating to valency and molecular structures. In this edition, the chapter on Bohr theory has been removed while some sections, such as structures of crystalline solids, have been expanded. Details of structures have also been revised and extended using the best available values for bond lengths and bond angles. Recent developments are mostly noted in the chapter on complex compounds, while a new chapter has been added to serve as an introduction t

  18. Ionic and Molecular Liquids

    DEFF Research Database (Denmark)

    Chaban, Vitaly V.; Prezhdo, Oleg

    2013-01-01

    Because of their outstanding versatility, room-temperature ionic liquids (RTILs) are utilized in an ever increasing number of novel and fascinating applications, making them the Holy Grail of modern materials science. In this Perspective, we address the fundamental research and prospective...... applications of RTILs in combination with molecular liquids, concentrating on three significant areas: (1) the use of molecular liquids to decrease the viscosity of RTILs; (2) the role of RTIL micelle formation in water and organic solvents; and (3) the ability of RTILs to adsorb pollutant gases. Current...

  19. Molecular confocal laser endomicroscopy

    DEFF Research Database (Denmark)

    Karstensen, John Gásdal; Klausen, Pia Helene; Saftoiu, Adrian

    2014-01-01

    While flexible endoscopy is essential for macroscopic evaluation, confocal laser endomicroscopy (CLE) has recently emerged as an endoscopic method enabling visualization at a cellular level. Two systems are currently available, one based on miniprobes that can be inserted via a conventional...... during on-going endoscopy), a novel world of molecular evaluation opens up. The method of molecular CLE could potentially be used for estimating the expression of important receptors in carcinomas, subsequently resulting in immediate individualization of treatment regimens, but also for improving...

  20. [Molecular basis of Fanconi's anemia].

    Science.gov (United States)

    Digweed, M

    1999-01-01

    Fanconi anaemia (FA) is an autosomal recessive genetic disorder characterised clinically by progressive bone marrow failure, skeletal deformities and a predisposition to neoplasia. Patient cells manifest an extreme chromosomal instability and hypersensitivity to polyfunctional alkylating agents. It is assumed that the basic defect is related to the repair of DNA damage, in particular that of so-called DNA crosslinks. Currently there are eight complementation groups in FA (FA-A-FA-H) which indicates that at least eight independent genes can lead to FA. Three of these genes have been identified: FANCA, FANCC and FANCG. In this review, the molecular biology and genetics of FA are presented and possible functions of the FANC proteins are discussed.

  1. ARID1B alterations identify aggressive tumors in neuroblastoma.

    Science.gov (United States)

    Lee, Soo Hyun; Kim, Jung-Sun; Zheng, Siyuan; Huse, Jason T; Bae, Joon Seol; Lee, Ji Won; Yoo, Keon Hee; Koo, Hong Hoe; Kyung, Sungkyu; Park, Woong-Yang; Sung, Ki W

    2017-07-11

    Targeted panel sequencing was performed to determine molecular targets and biomarkers in 72 children with neuroblastoma. Frequent genetic alterations were detected in ALK (16.7%), BRCA1 (13.9%), ATM (12.5%), and PTCH1 (11.1%) in an 83-gene panel. Molecular targets for targeted therapy were identified in 16 of 72 patients (22.2%). Two-thirds of ALK mutations were known to increase sensitivity to ALK inhibitors. Sequence alterations in ARID1B were identified in 5 of 72 patients (6.9%). Four of five ARID1B alterations were detected in tumors of high-risk patients. Two of five patients with ARID1B alterations died of disease progression. Relapse-free survival was lower in patients with ARID1B alterations than in those without (p = 0.01). In analysis confined to high-risk patients, 3-year overall survival was lower in patients with an ARID1B alteration (33.3 ± 27.2%) or MYCN amplification (30.0 ± 23.9%) than in those with neither ARID1B alteration nor MYCN amplification (90.5 ± 6.4%, p = 0.05). These results provide possibilities for targeted therapy and a new biomarker identifying a subgroup of neuroblastoma patients with poor prognosis.

  2. Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

    Directory of Open Access Journals (Sweden)

    Victor M. Bii

    2016-10-01

    Full Text Available Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types.

  3. Gene Signature in Sessile Serrated Polyps Identifies Colon Cancer Subtype

    Science.gov (United States)

    Kanth, Priyanka; Bronner, Mary P.; Boucher, Kenneth M.; Burt, Randall W.; Neklason, Deborah W.; Hagedorn, Curt H.; Delker, Don A.

    2016-01-01

    Sessile serrated colon adenoma/polyps (SSA/Ps) are found during routine screening colonoscopy and may account for 20–30% of colon cancers. However, differentiating SSA/Ps from hyperplastic polyps (HP) with little risk of cancer is challenging and complementary molecular markers are needed. Additionally, the molecular mechanisms of colon cancer development from SSA/Ps are poorly understood. RNA sequencing was performed on 21 SSA/Ps, 10 HPs, 10 adenomas, 21 uninvolved colon and 20 control colon specimens. Differential expression and leave-one-out cross validation methods were used to define a unique gene signature of SSA/Ps. Our SSA/P gene signature was evaluated in colon cancer RNA-Seq data from The Cancer Genome Atlas (TCGA) to identify a subtype of colon cancers that may develop from SSA/Ps. A total of 1422 differentially expressed genes were found in SSA/Ps relative to controls. Serrated polyposis syndrome (n=12) and sporadic SSA/Ps (n=9) exhibited almost complete (96%) gene overlap. A 51-gene panel in SSA/P showed similar expression in a subset of TCGA colon cancers with high microsatellite instability (MSI-H). A smaller seven-gene panel showed high sensitivity and specificity in identifying BRAF mutant, CpG island methylator phenotype high (CIMP-H) and MLH1 silenced colon cancers. We describe a unique gene signature in SSA/Ps that identifies a subset of colon cancers likely to develop through the serrated pathway. These gene panels may be utilized for improved differentiation of SSA/Ps from HPs and provide insights into novel molecular pathways altered in colon cancer arising from the serrated pathway. PMID:27026680

  4. Learning surface molecular structures via machine vision

    Science.gov (United States)

    Ziatdinov, Maxim; Maksov, Artem; Kalinin, Sergei V.

    2017-08-01

    Recent advances in high resolution scanning transmission electron and scanning probe microscopies have allowed researchers to perform measurements of materials structural parameters and functional properties in real space with a picometre precision. In many technologically relevant atomic and/or molecular systems, however, the information of interest is distributed spatially in a non-uniform manner and may have a complex multi-dimensional nature. One of the critical issues, therefore, lies in being able to accurately identify (`read out') all the individual building blocks in different atomic/molecular architectures, as well as more complex patterns that these blocks may form, on a scale of hundreds and thousands of individual atomic/molecular units. Here we employ machine vision to read and recognize complex molecular assemblies on surfaces. Specifically, we combine Markov random field model and convolutional neural networks to classify structural and rotational states of all individual building blocks in molecular assembly on the metallic surface visualized in high-resolution scanning tunneling microscopy measurements. We show how the obtained full decoding of the system allows us to directly construct a pair density function—a centerpiece in analysis of disorder-property relationship paradigm—as well as to analyze spatial correlations between multiple order parameters at the nanoscale, and elucidate reaction pathway involving molecular conformation changes. The method represents a significant shift in our way of analyzing atomic and/or molecular resolved microscopic images and can be applied to variety of other microscopic measurements of structural, electronic, and magnetic orders in different condensed matter systems.

  5. Molecular Imaging of Inflammation in Atherosclerosis

    Science.gov (United States)

    Wildgruber, Moritz; Swirski, Filip K.; Zernecke, Alma

    2013-01-01

    Acute rupture of vulnerable plaques frequently leads to myocardial infarction and stroke. Within the last decades, several cellular and molecular players have been identified that promote atherosclerotic lesion formation, maturation and plaque rupture. It is now widely recognized that inflammation of the vessel wall and distinct leukocyte subsets are involved throughout all phases of atherosclerotic lesion development. The mechanisms that render a stable plaque unstable and prone to rupture, however, remain unknown and the identification of the vulnerable plaque remains a major challenge in cardiovascular medicine. Imaging technologies used in the clinic offer minimal information about the underlying biology and potential risk for rupture. New imaging technologies are therefore being developed, and in the preclinical setting have enabled new and dynamic insights into the vessel wall for a better understanding of this complex disease. Molecular imaging has the potential to track biological processes, such as the activity of cellular and molecular biomarkers in vivo and over time. Similarly, novel imaging technologies specifically detect effects of therapies that aim to stabilize vulnerable plaques and silence vascular inflammation. Here we will review the potential of established and new molecular imaging technologies in the setting of atherosclerosis, and discuss the cumbersome steps required for translating molecular imaging approaches into the clinic. PMID:24312156

  6. Molecular theory of capillarity

    CERN Document Server

    Rowlinson, J S

    2002-01-01

    History of thought on molecular origins of surface phenomena offers a critical and detailed examination and assessment of modern theories, focusing on statistical mechanics and application of results in mean-field approximation to model systems. Emphasis on liquid-gas surface, with a focus on liquid-liquid surfaces in the final chapters. 1989 edition.

  7. Reviews: The Molecular Animator.

    Science.gov (United States)

    Journal of Chemical Education, 1987

    1987-01-01

    Provided is a review of a chemical software package. The package makes possible an instructional technique that is not effective by any other means, namely the ability to view molecular shapes in three dimensions. The program can be used with either IBM or Apple hardware. (RH)

  8. [Towards a molecular psychiatry].

    Science.gov (United States)

    de la Fuente, J R

    1988-06-01

    Recent research data from psychopharmacology, brain imaging and molecular genetics support the notion of a new psychiatric frontier: that of molecular psychiatry. Identification of different subtypes of neurotransmitter receptors and their changes in density and sensitivity in response to endogenous ligands and/or psychotropic drugs may account for the clinical expression of various behavioral phenomena, including some psychiatric disorders. Brain imaging, in particular positron-emission tomographic evaluations, are likely to change psychiatric nosology. New diagnostic elements derived from these scanners will allow to associate psychotic states to neuroreceptor changes. Molecular genetics has shown that bipolar affective disorder can be caused by a single gene. A strong linkage seems to exist between a gene locus on chromosome 11 and bipolar illness. An amyloid gene located on chromosome 21 has also been shown to be strongly related to familial Alzheimer's disease. While genetic heterogeneity limits the screening value of these findings, the powerful techniques of molecular biology have entered the field of psychiatry. Ethical issues regarding DNA immortality, gene cloning and gene therapy will strengthen this relationship.

  9. Isotopes in molecular biology

    International Nuclear Information System (INIS)

    Goldfarb, P.S.G.

    1988-01-01

    The use of radioisotopes in molecular biology, with particular reference to the structure and functions of DNA, RNA and the cellular synthesis of proteins, is discussed. The use of labelled DNA and RNA in diagnostic techniques is presented. (U.K.)

  10. Biophysics of molecular gastronomy.

    Science.gov (United States)

    Brenner, Michael P; Sörensen, Pia M

    2015-03-26

    Chefs and scientists exploring biophysical processes have given rise to molecular gastronomy. In this Commentary, we describe how a scientific understanding of recipes and techniques facilitates the development of new textures and expands the flavor palette. The new dishes that result engage our senses in unexpected ways. PAPERCLIP. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Molecular gastronomy in Spain

    DEFF Research Database (Denmark)

    García-Segovia, P.; Garrido, M. D.; Vercet, A.

    2014-01-01

    Beyond the overwhelming international success of Ferrán Adria, Spain has been one of the countries with a more active implication in molecular gastronomy as a scientific discipline but also in the use of ingredients, technologies, and equipment from the scientific and technological universe...... with scientists for facing the future of Spanish gastronomy....

  12. Molecular Mechanisms of Preeclampsia

    Directory of Open Access Journals (Sweden)

    N. Vitoratos

    2012-01-01

    Full Text Available Preeclampsia is one of the leading causes of maternal morbidity/mortality. The pathogenesis of preeclampsia is still under investigation. The aim of this paper is to present the molecular mechanisms implicating in the pathway leading to preeclampsia.

  13. Molecular MR Imaging Probes

    OpenAIRE

    MAHMOOD, UMAR; JOSEPHSON, LEE

    2005-01-01

    Magnetic resonance imaging (MRI) has been successfully applied to many of the applications of molecular imaging. This review discusses by example some of the advances in areas such as multimodality MR-optical agents, receptor imaging, apoptosis imaging, angiogenesis imaging, noninvasive cell tracking, and imaging of MR marker genes.

  14. Molecular dynamics for fermions

    International Nuclear Information System (INIS)

    Feldmeier, H.; Schnack, J.

    2000-02-01

    The time-dependent variational principle for many-body trial states is used to discuss the relation between the approaches of different molecular dynamics models to describe indistinguishable fermions. Early attempts to include effects of the Pauli principle by means of nonlocal potentials as well as more recent models which work with antisymmetrized many-body states are reviewed under these premises. (orig.)

  15. Nanopatterning by molecular polygons.

    Science.gov (United States)

    Jester, Stefan-S; Sigmund, Eva; Höger, Sigurd

    2011-07-27

    Molecular polygons with three to six sides and binary mixtures thereof form long-range ordered patterns at the TCB/HOPG interface. This includes also the 2D crystallization of pentagons. The results provide an insight into how the symmetry of molecules is translated into periodic structures.

  16. Molecular Pathogenesis of Spondyloarthritis

    DEFF Research Database (Denmark)

    Carlsen, Thomas Gelsing

    This dissertation includes a presentation of knowledge on the molecular pathogenesis of spondyloarthritis achieved through a PhD programme at Aalborg University from 1.12.2011 - 1.12.2014. Work was carried out in the Laboratory of Medical Mass Spectrometry, headed by: Professor Svend Birkelund...

  17. Combinatorial Drug Screening Identifies Ewing Sarcoma-specific Sensitivities

    DEFF Research Database (Denmark)

    Radic-Sarikas, Branka; Tsafou, Kalliopi P; Emdal, Kristina B.

    2017-01-01

    Improvements in survival for Ewing sarcoma pediatric and adolescent patients have been modest over the past 20 years. Combinations of anticancer agents endure as an option to overcome resistance to single treatments caused by compensatory pathways. Moreover, combinations are thought to lessen any...... including approved drugs. We were able to retrieve highly synergistic drug combinations specific for Ewing sarcoma and identified signaling processes important for Ewing sarcoma cell proliferation determined by EWS-FLI1 We generated a molecular target profile of PKC412, a multikinase inhibitor with strong...

  18. Molecular-nuclear transitions

    International Nuclear Information System (INIS)

    Belyaev, V.B.; Miller, M.B.

    2007-01-01

    Full text: The spectra in some light nuclei have one interesting property. For example, in the closed vicinity of some resonance states of such nuclei as 5 He, 8 Be, 18 F, 18 Ne the thresholds exist for two- or three-body decay of those nuclei. Let us consider the lightest of the above nuclei, 5 He. The energy threshold for 5 He > d+t decay is ∼50 keV lower than the energy of 3/2 + state of 5 He nucleus. However, due to a rather large width of this state, ∼70 keV, the nuclear capture of deuterons by tritons in dtm-molecule is highly enhanced in comparison with the process of dd capture in the ddm molecule. The physical reason for the enhancement of the probability of the capture into the resonant state can be associated with a long tail of wave function of the resonant state and, accordingly, with the large value of the overlap integral determining in general the probability of the transition between two systems. Thus, one can expect the enhancement of the molecular-nuclear transitions, and this was indeed observed experimentally for the case of dtm molecule. Now, let us consider some other molecular-nuclear combinations: 18 Ne - H 2 O, 18 F - 17 OH, and 8 Be - 6 LiD molecule. With the high accuracy the energies of the above molecular systems coincide with the energies of the resonant states in the appropriate nuclei. Due to the uncertainty in the experimental nuclear data it is not known at present whether the energies of these thresholds are lower or higher of the corresponding energies of the nuclear resonances. Let us assume that the molecular energy is few keV over the energy of the nuclear resonance. Then, we will deal with a very interesting phenomenon: the molecular-nuclear complex constitutes a two level system, which in some sense is analogous to the two-level atomic system, as in a laser. The crucial difference between this one and the two-level atomic systems consists in a fact that in the molecular-nuclear case no special procedure of pumping up

  19. Molecular imaging in oncology

    International Nuclear Information System (INIS)

    Weber, W.A.

    2007-01-01

    Molecular imaging is generally defined as noninvasive and quantitative imaging of targeted macromolecules and biological processes in living organisms. A characteristic of molecular imaging is the ability to perform repeated studies and assess changes in biological processes over time. Thus molecular imaging lends itself well for monitoring the effectiveness of tumor therapy. In animal models a variety of techniques can be used for molecular imaging. These include optical imaging (bioluminescence and fluorescence imaging), magnetic resonance imaging (MRI) and nuclear medicine techniques. In the clinical setting, however, nuclear medicine techniques predominate, because so far only radioactive tracers provide the necessary sensitivity to study expression and function of macromolecules non-invasively in patients. Nuclear medicine techniques allows to study a variety of biological processes in patients. These include the expression of various receptors (estrogen, androgen, somatostatin receptors and integrins). In addition, tracers are available to study tumor cell proliferation and hypoxia. The by far most commonly used molecular imaging technique in oncology is, however, positron emission tomography (PET) with the glucose analog [ 18 F]fluorodeoxyglucose (FDG-PET). FDG-PET permits non-invasive quantitative assessment of the accelerated exogenous glucose use of malignant tumors. Numerous studies have now shown that reduction of tumor FDG-uptake during therapy allows early prediction of tumor response and patient survival. Clinical studies are currently underway to determine whether FDG-PET can be used to individualize tumor therapy by signaling early in the course of therapy the need for therapeutic adjustments in patients with likely non-responding tumors. (orig.)

  20. Molecular diagnostics in the management of rhabdomyosarcoma.

    Science.gov (United States)

    Arnold, Michael A; Barr, Fredric G

    2017-02-01

    A classification of rhabdomyosarcoma (RMS) with prognostic relevance has primarily relied on clinical features and histologic classification as either embryonal or alveolar RMS. The PAX3-FOXO1 and PAX7-FOXO1 gene fusions occur in 80% of cases with the alveolar subtype and are more predictive of outcome than histologic classification. Identifying additional molecular hallmarks that further subclassify RMS is an active area of research. Areas Covered: The authors review the current state of the PAX3-FOXO1 and PAX7-FOXO1 fusions as prognostic biomarkers. Emerging biomarkers, including mRNA expression profiling, MYOD1 mutations, RAS pathway mutations and gene fusions involving NCOA2 or VGLL2 are also reviewed. Expert commentary: Strategies for modifying RMS risk stratification based on molecular biomarkers are emerging with the potential to transform the clinical management of RMS, ultimately improving patient outcomes by tailoring therapy to predicted patient risk and identifying targets for novel therapies.

  1. Conformation analysis of trehalose. Molecular dynamics simulation and molecular mechanics

    International Nuclear Information System (INIS)

    Donnamaira, M.C.; Howard, E.I.; Grigera, J.R.

    1992-09-01

    Conformational analysis of the disaccharide trehalose is done by molecular dynamics and molecular mechanics. In spite of the different force fields used in each case, comparison between the molecular dynamics trajectories of the torsional angles of glycosidic linkage and energy conformational map shows a good agreement between both methods. By molecular dynamics it is observed a moderate mobility of the glycosidic linkage. The demands of computer time is comparable in both cases. (author). 6 refs, 4 figs

  2. Heat-induced changes to lipid molecular structure in Vimy flaxseed: Spectral intensity and molecular clustering

    Science.gov (United States)

    Yu, Peiqiang; Damiran, Daalkhaijav

    2011-06-01

    Autoclaving was used to manipulate nutrient utilization and availability. The objectives of this study were to characterize any changes of the functional groups mainly associated with lipid structure in flaxseed ( Linum usitatissimum, cv. Vimy), that occurred on a molecular level during the treatment process using infrared Fourier transform molecular spectroscopy. The parameters included lipid CH 3 asymmetric (ca. 2959 cm -1), CH 2 asymmetric (ca. 2928 cm -1), CH 3 symmetric (ca. 2871 cm -1) and CH 2 symmetric (ca. 2954 cm -1) functional groups, lipid carbonyl C dbnd O ester group (ca. 1745 cm -1), lipid unsaturation group (CH attached to C dbnd C) (ca. 3010 cm -1) as well as their ratios. Hierarchical cluster analysis (CLA) and principal components analysis (PCA) were conducted to identify molecular spectral differences. Flaxseed samples were kept raw for the control or autoclaved in batches at 120 °C for 20, 40 or 60 min for treatments 1, 2 and 3, respectively. Molecular spectral analysis of lipid functional group ratios showed a significant decrease ( P 0.05) on lipid carbonyl C dbnd O ester group and lipid unsaturation group (CH attached to C dbnd C) (with average spectral peak area intensities of 138.3 and 68.8 IR intensity units, respectively). Multivariate molecular spectral analyses, CLA and PCA, were unable to make distinctions between the different treatment original spectra at the CH 3 and CH 2 asymmetric and symmetric region (ca. 2988-2790 cm -1). The results indicated that autoclaving had an impact to the mid-infrared molecular spectrum of flaxseed to identify heat-induced changes in lipid conformation. A future study is needed to quantify the relationship between lipid molecular structure changes and functionality/availability.

  3. [Molecular updates on Usher syndrome].

    Science.gov (United States)

    Roux, A-F

    2005-01-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by the association of sensorineural hearing loss and retinitis pigmentosa (RP). Usher syndrome is both clinically and genetically heterogeneous. Three clinical subtypes are defined with respect to vestibular dysfunction and the degree of hearing loss. Type I (USH1) patients have profound hearing loss and vestibular dysfunction from birth. Type II (USH2) is the most frequent and patients tend to have less severe hearing impairment and normal vestibular response. Type III (USH3) is characterized by a progressive loss of hearing and is found more frequently among Finnish patients. Recently, major breakthroughs have been made in the molecular genetics of Usher syndrome as a number of chromosomal loci and causative genes have been identified in each clinical subtype. Twelve loci are known and the corresponding genes have been cloned for six of them. Although their functions are not always clearly established, a common role is emerging for the proteins identified within each subtype. As a result, each subtype could emanate from defects affecting distinct cellular mechanisms.

  4. Isolation and molecular genetic characterization of a yeast strain ...

    African Journals Online (AJOL)

    The yeast was identified by molecular genetics technique based on sequence analysis of the variable D1/D2 domain of the large subunit (26S) ribosomal DNA. Subsequent 26S rRNA gene sequencing showed 100% base sequence homology and it was identified as Candida viswanathii. The degradation of PAHs

  5. Molecular markers linked to apomixis in Panicum maximum Jacq.

    African Journals Online (AJOL)

    SAM

    2014-05-28

    May 28, 2014 ... The objective of this work was to identify molecular markers linked to apomixis in ... Four RAPD markers linked to apomixis were identified and mapped in this .... Data analysis. The amplification of the potential markers was analyzed as binary, with 1 for presence and 0 for absence of the marker. The binary.

  6. Combinatorial Drug Screening Identifies Ewing Sarcoma-specific Sensitivities

    DEFF Research Database (Denmark)

    Radic-Sarikas, Branka; Tsafou, Kalliopi P; Emdal, Kristina B.

    2017-01-01

    Improvements in survival for Ewing sarcoma pediatric and adolescent patients have been modest over the past 20 years. Combinations of anticancer agents endure as an option to overcome resistance to single treatments caused by compensatory pathways. Moreover, combinations are thought to lessen any...... associated adverse side effects through reduced dosing, which is particularly important in childhood tumors. Using a parallel phenotypic combinatorial screening approach of cells derived from three pediatric tumor types, we identified Ewing sarcoma-specific interactions of a diverse set of targeted agents...... including approved drugs. We were able to retrieve highly synergistic drug combinations specific for Ewing sarcoma and identified signaling processes important for Ewing sarcoma cell proliferation determined by EWS-FLI1 We generated a molecular target profile of PKC412, a multikinase inhibitor with strong...

  7. Hidden chromosomal abnormalities in pleuropulmonary blastomas identified by multiplex FISH

    International Nuclear Information System (INIS)

    Quilichini, Benoit; Andre, Nicolas; Bouvier, Corinne; Chrestian, Marie-Anne; Rome, Angelique; Intagliata, Dominique; Coze, Carole; Lena, Gabriel; Zattara, Helene

    2006-01-01

    Pleuropulmonary blastoma (PPB) is a rare childhood dysontogenetic intrathoracic neoplasm associated with an unfavourable clinical behaviour. We report pathological and cytogenetic findings in two cases of PPB at initial diagnosis and recurrence. Both tumors were classified as type III pneumoblastoma and histological findings were similar at diagnosis and relapse. In both cases, conventional cytogenetic techniques revealed complex numerical and structural chromosomal abnormalities. Molecular cytogenetic analysis (interphase/metaphase FISH and multicolor FISH) identified accurately chromosomal aberrations. In one case, TP53 gene deletion was detected on metaphase FISH. To date, only few cytogenetic data have been published about PPB. The PPB genetic profile remains to be established and compared to others embryonal neoplasia. Our cytogenetic data are discussed reviewing cytogenetics PPBs published cases, illustrating the contribution of multicolor FISH in order to identify pathogenetically important recurrent aberrations in PPB

  8. Common Lung Microbiome Identified among Mechanically Ventilated Surgical Patients.

    Directory of Open Access Journals (Sweden)

    Ashley D Smith

    Full Text Available The examination of the pulmonary microbiome in patients with non-chronic disease states has not been extensively examined. Traditional culture based screening methods are often unable to identify bacteria from bronchoalveolar lavage samples. The advancement of next-generation sequencing technologies allows for a culture-independent molecular based analysis to determine the microbial composition in the lung of this patient population. For this study, the Ion Torrent PGM system was used to assess the microbial complexity of culture negative bronchoalveolar lavage samples. A group of samples were identified that all displayed high diversity and similar relative abundance of bacteria. This group consisted of Hydrogenophaga, unclassified Bacteroidetes, Pedobacter, Thauera, and Acinetobacter. These bacteria may be representative of a common non-pathogenic pulmonary microbiome associated within this population of patients.

  9. Signature molecular descriptor : advanced applications.

    Energy Technology Data Exchange (ETDEWEB)

    Visco, Donald Patrick, Jr. (Tennessee Technological University, Cookeville, TN)

    2010-04-01

    In this work we report on the development of the Signature Molecular Descriptor (or Signature) for use in the solution of inverse design problems as well as in highthroughput screening applications. The ultimate goal of using Signature is to identify novel and non-intuitive chemical structures with optimal predicted properties for a given application. We demonstrate this in three studies: green solvent design, glucocorticoid receptor ligand design and the design of inhibitors for Factor XIa. In many areas of engineering, compounds are designed and/or modified in incremental ways which rely upon heuristics or institutional knowledge. Often multiple experiments are performed and the optimal compound is identified in this brute-force fashion. Perhaps a traditional chemical scaffold is identified and movement of a substituent group around a ring constitutes the whole of the design process. Also notably, a chemical being evaluated in one area might demonstrate properties very attractive in another area and serendipity was the mechanism for solution. In contrast to such approaches, computer-aided molecular design (CAMD) looks to encompass both experimental and heuristic-based knowledge into a strategy that will design a molecule on a computer to meet a given target. Depending on the algorithm employed, the molecule which is designed might be quite novel (re: no CAS registration number) and/or non-intuitive relative to what is known about the problem at hand. While CAMD is a fairly recent strategy (dating to the early 1980s), it contains a variety of bottlenecks and limitations which have prevented the technique from garnering more attention in the academic, governmental and industrial institutions. A main reason for this is how the molecules are described in the computer. This step can control how models are developed for the properties of interest on a given problem as well as how to go from an output of the algorithm to an actual chemical structure. This report

  10. Gender Identification in Date Palm Using Molecular Markers.

    Science.gov (United States)

    Awan, Faisal Saeed; Maryam; Jaskani, Muhammad J; Sadia, Bushra

    2017-01-01

    Breeding of date palm is complicated because of its long life cycle and heterozygous nature. Sexual propagation of date palm does not produce true-to-type plants. Sex of date palms cannot be identified until the first flowering stage. Molecular markers such as random amplified polymorphic DNA (RAPD), sequence-characterized amplified regions (SCAR), and simple sequence repeats (SSR) have successfully been used to identify the sex-linked loci in the plant genome and to isolate the corresponding genes. This chapter highlights the use of three molecular markers including RAPD, SCAR, and SSR to identify the gender of date palm seedlings.

  11. Topology in Molecular Biology

    CERN Document Server

    Monastyrsky, Michail Ilych

    2007-01-01

    The book presents a class of new results in molecular biology for which topological methods and ideas are important. These include: the large-scale conformation properties of DNA; computational methods (Monte Carlo) allowing the simulation of large-scale properties of DNA; the tangle model of DNA recombination and other applications of Knot theory; dynamics of supercoiled DNA and biocatalitic properties of DNA; the structure of proteins; and other very recent problems in molecular biology. The text also provides a short course of modern topology intended for the broad audience of biologists and physicists. The authors are renowned specialists in their fields and some of the new results presented here are documented for the first time in monographic form.

  12. Molecular and Cellular Signaling

    CERN Document Server

    Beckerman, Martin

    2005-01-01

    A small number of signaling pathways, no more than a dozen or so, form a control layer that is responsible for all signaling in and between cells of the human body. The signaling proteins belonging to the control layer determine what kinds of cells are made during development and how they function during adult life. Malfunctions in the proteins belonging to the control layer are responsible for a host of human diseases ranging from neurological disorders to cancers. Most drugs target components in the control layer, and difficulties in drug design are intimately related to the architecture of the control layer. Molecular and Cellular Signaling provides an introduction to molecular and cellular signaling in biological systems with an emphasis on the underlying physical principles. The text is aimed at upper-level undergraduates, graduate students and individuals in medicine and pharmacology interested in broadening their understanding of how cells regulate and coordinate their core activities and how diseases ...

  13. Activating the molecular spinterface

    Science.gov (United States)

    Cinchetti, Mirko; Dediu, V. Alek; Hueso, Luis E.

    2017-05-01

    The miniaturization trend in the semiconductor industry has led to the understanding that interfacial properties are crucial for device behaviour. Spintronics has not been alien to this trend, and phenomena such as preferential spin tunnelling, the spin-to-charge conversion due to the Rashba-Edelstein effect and the spin-momentum locking at the surface of topological insulators have arisen mainly from emergent interfacial properties, rather than the bulk of the constituent materials. In this Perspective we explore inorganic/molecular interfaces by looking closely at both sides of the interface. We describe recent developments and discuss the interface as an ideal platform for creating new spin effects. Finally, we outline possible technologies that can be generated thanks to the unique active tunability of molecular spinterfaces.

  14. Measuring Dark Molecular Gas

    Science.gov (United States)

    Li, Di; Heiles, Carl E.

    2017-01-01

    It is now well known that a substantial fraction of Galactic molecular gas cannot be traced by CO emission. The thus dubbed CO dark molecular gas (DMG) occupy a large volume of ISM with intermediate extinction, where CO is either not self-shielded and/or subthermally excited. We explore the utilities of simple hydrides, such OH, CH, etc., in tracing DMG. We mapped and modeled the transition zone cross a cloud boundary and derived emperical OH abundance and DMG distribution formulae. We also obtained absorption measurements of various species using Arecibo, VLA, ATCA, and ALMA. The absorption technique has the potential to provide systematic quantification of DMG in the next few years.

  15. Diagnostic tools to identify black Aspergilli

    DEFF Research Database (Denmark)

    Samson, Robert A.; Noonim, P.; Meijer, M.

    2007-01-01

    The present taxonomy of the black aspergilli reveals that there are 19 accepted taxa. However the identification of species of Aspergillus section Nigri is often problematic in spite of the existence of numerous methods proposed. An overview is provided of phenotypic and molecular methods...... was developed as a selective medium for the isolation of A. carbonarius are also shown. The extrolites produced by each species are listed while the response of the Ehrlich reaction is described. The literature on the various molecular methods to be used for species identification is reviewed and a critical...

  16. Molecular-beam scattering

    International Nuclear Information System (INIS)

    Vernon, M.F.

    1983-07-01

    The molecular-beam technique has been used in three different experimental arrangements to study a wide range of inter-atomic and molecular forces. Chapter 1 reports results of a low-energy (0.2 kcal/mole) elastic-scattering study of the He-Ar pair potential. The purpose of the study was to accurately characterize the shape of the potential in the well region, by scattering slow He atoms produced by expanding a mixture of He in N 2 from a cooled nozzle. Chapter 2 contains measurements of the vibrational predissociation spectra and product translational energy for clusters of water, benzene, and ammonia. The experiments show that most of the product energy remains in the internal molecular motions. Chapter 3 presents measurements of the reaction Na + HCl → NaCl + H at collision energies of 5.38 and 19.4 kcal/mole. This is the first study to resolve both scattering angle and velocity for the reaction of a short lived (16 nsec) electronic excited state. Descriptions are given of computer programs written to analyze molecular-beam expansions to extract information characterizing their velocity distributions, and to calculate accurate laboratory elastic-scattering differential cross sections accounting for the finite apparatus resolution. Experimental results which attempted to determine the efficiency of optically pumping the Li(2 2 P/sub 3/2/) and Na(3 2 P/sub 3/2/) excited states are given. A simple three-level model for predicting the steady-state fraction of atoms in the excited state is included

  17. Molecular Mechanisms of Preeclampsia

    OpenAIRE

    N. Vitoratos; D. Hassiakos; C. Iavazzo

    2012-01-01

    Preeclampsia is a pregnancy-specific disease characterized by new onset hypertension and proteinuria after 20 wk of gestation. It is a leading cause of maternal and fetal morbidity and mortality worldwide. Exciting discoveries in the last decade have contributed to a better understanding of the molecular basis of this disease. Epidemiological, experimental, and therapeutic studies from several laboratories have provided compelling evidence that an antiangiogenic state owing to alterations in ...

  18. Molecular diagnostics of periodontitis

    OpenAIRE

    Izabela Korona-Głowniak; Radosław Siwiec; Marcin Berger; Anna Malm; Jolanta Szymańska

    2017-01-01

    The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host’s health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridi...

  19. Molecular diagnostics in endodontics

    OpenAIRE

    Rechenberg, Dan-Krister; Zehnder, Matthias

    2014-01-01

    Recent systematic reviews have substantiated the fact that current testing methods to assess the inflammatory state of the pulp and the periapical tissues are of limited value. Consequently, it may be time to search for alternative routes in endodontic diagnostics. Molecular assessment methods could be the future. However, in the field of endodontics, the research in that direction is only about to evolve. Because pulpal and periradicular diseases are related to opportunistic infections, diag...

  20. Molecular Diagnostics of ?-Thalassemia

    OpenAIRE

    Atanasovska, B; Bozhinovski, G; Chakalova, L; Kocheva, S; Karanfilski, O; Plaseska-Karanfiska, D

    2012-01-01

    A high-quality hemoglobinopathy diagnosis is based on the results of a number of tests including assays for molecular identification of causative mutations. We describe the current diagnostic strategy for the identification of ?-thalassemias and hemoglobin (Hb) variants at the International Reference Laboratory for Haemoglobinopathies, Research Centre for Genetic Engineering and Biotechnology (RCGEB) ?Georgi D. Efremov,? Skopje, Republic of Macedonia. Our overall approach and most of the meth...

  1. Molecular biomethods handbook

    National Research Council Canada - National Science Library

    Walker, John M; Rapley, Ralph

    2008-01-01

    ... the reader to a selection of analytical and preparative techniques that we considered to be frequently used by research workers in the field of molecular biology. Clearly, within the constraints of a single volume we had to be selective in the techniques we described. Since the first edition was published, science has continued to move on apace. For example, the use of microarray technology is now commonplace, nanotechnology has entered the scientific literature, microfluidic technology has be...

  2. Molecular Vaccines for Malaria

    Science.gov (United States)

    2010-01-01

    Removing inhibitory plasm ids from the cock- with the radiation-attenuated sporozoite (RAS) vaccine36•37 (see tail restored the immunogenicity of the...relative increased in vitro growth inhibitory activity against homologous to the P. folciparum antigen expressing plasm ids alone, and none parasites...25nm and have a molecular weight of 14.8 kDa. (C) Transmission electron microscopy image of P4c-Mal nanoparticles at 242 OOOx. The sample was

  3. Designing the molecular future

    OpenAIRE

    Schneider Gisbert

    2011-01-01

    Approximately 25 years ago the first computer applications were conceived for the purpose of automated 'de novo' drug design prominent pioneering tools being ALADDIN CAVEAT GENOA and DYLOMMS. Many of these early concepts were enabled by innovative techniques for ligand receptor interaction modeling like GRID MCSS DOCK and CoMFA which still provide the theoretical framework for several more recently developed molecular design algorithms. After a first wave of software tools and groundbreaking ...

  4. Atomic and molecular theory

    International Nuclear Information System (INIS)

    Inokuti, Mitio.

    1990-01-01

    The multifaceted role of theoretical physics in understanding the earliest stages of radiation action is discussed. Scientific topics chosen for the present discourse include photoabsorption, electron collisions, and ionic collisions, and electron transport theory, Connections of atomic and molecular physics with condensed-matter physics are also discussed. The present article includes some historical perspective and an outlook for the future. 114 refs., 3 figs

  5. Molecular ecological network analyses.

    Science.gov (United States)

    Deng, Ye; Jiang, Yi-Huei; Yang, Yunfeng; He, Zhili; Luo, Feng; Zhou, Jizhong

    2012-05-30

    Understanding the interaction among different species within a community and their responses to environmental changes is a central goal in ecology. However, defining the network structure in a microbial community is very challenging due to their extremely high diversity and as-yet uncultivated status. Although recent advance of metagenomic technologies, such as high throughout sequencing and functional gene arrays, provide revolutionary tools for analyzing microbial community structure, it is still difficult to examine network interactions in a microbial community based on high-throughput metagenomics data. Here, we describe a novel mathematical and bioinformatics framework to construct ecological association networks named molecular ecological networks (MENs) through Random Matrix Theory (RMT)-based methods. Compared to other network construction methods, this approach is remarkable in that the network is automatically defined and robust to noise, thus providing excellent solutions to several common issues associated with high-throughput metagenomics data. We applied it to determine the network structure of microbial communities subjected to long-term experimental warming based on pyrosequencing data of 16 S rRNA genes. We showed that the constructed MENs under both warming and unwarming conditions exhibited topological features of scale free, small world and modularity, which were consistent with previously described molecular ecological networks. Eigengene analysis indicated that the eigengenes represented the module profiles relatively well. In consistency with many other studies, several major environmental traits including temperature and soil pH were found to be important in determining network interactions in the microbial communities examined. To facilitate its application by the scientific community, all these methods and statistical tools have been integrated into a comprehensive Molecular Ecological Network Analysis Pipeline (MENAP), which is open

  6. Molecular Gastronomy in Spain

    OpenAIRE

    García-Segovia, Purificación; Garrido, María Dolores; Vercet Tormo, Antonio; Arboleya, Juan Carlos; FISZMAN DAL SANTO, SUSANA; Martínez Monzó, Javier; Laguarda, Sergio; Palacios, Victor; Ruiz Carrascal, Jorge

    2014-01-01

    [EN] Beyond the overwhelming international success of Ferrán Adria, Spain has been one of the countries with a more active implication in molecular gastronomy as a scientific discipline but also in the use of ingredients, technologies, and equipment from the scientificand technological universe in the culinary area. Nowadays, this is a well-established discipline in Spain, with a number of research groups covering related topics, several companies commercializing appliances and additives worl...

  7. Communication: Molecular gears

    Energy Technology Data Exchange (ETDEWEB)

    Burnell, E. Elliott, E-mail: elliott.burnell@ubc.ca [Chemistry Department, University of British Columbia, 2036 Main Mall, Vancouver, British Columbia V6T 1Z1 (Canada); Lange, Cornelis A. de, E-mail: c.a.de.lange@vu.nl [Atomic, Molecular and Laser Physics, Vrije Universiteit, De Boelelaan 1081, 1081 HV Amsterdam (Netherlands); Meerts, W. Leo, E-mail: leo.meerts@science.ru.nl [Atomic, Molecular and Laser Physics, Vrije Universiteit, De Boelelaan 1081, 1081 HV Amsterdam (Netherlands); Institute for Molecules and Materials, Radboud University Nijmegen, Heyendaalseweg 135, NL-6525 AJ Nijmegen (Netherlands)

    2016-09-07

    The {sup 1}H nuclear magnetic resonance spectrum of hexamethylbenzene orientationally ordered in the nematic liquid crystal ZLI-1132 is analysed using covariance matrix adaptation evolution strategy. The spectrum contains over 350 000 lines with many overlapping transitions, from which four independent direct dipolar couplings are obtained. The rotations of the six methyl groups appear to be correlated due to mutual steric hindrance. Adjacent methyl groups show counter-rotating or geared motion. Hexamethylbenzene thus behaves as a molecular hexagonal gear.

  8. Atomic and molecular theory

    Energy Technology Data Exchange (ETDEWEB)

    Inokuti, Mitio.

    1990-01-01

    The multifaceted role of theoretical physics in understanding the earliest stages of radiation action is discussed. Scientific topics chosen for the present discourse include photoabsorption, electron collisions, and ionic collisions, and electron transport theory, Connections of atomic and molecular physics with condensed-matter physics are also discussed. The present article includes some historical perspective and an outlook for the future. 114 refs., 3 figs.

  9. Molecular methods for diagnosis of odontogenic infections.

    Science.gov (United States)

    Flynn, Thomas R; Paster, Bruce J; Stokes, Lauren N; Susarla, Srinivas M; Shanti, Rabie M

    2012-08-01

    Historically, the identification of microorganisms has been limited to species that could be cultured in the microbiology laboratory. The purpose of the present study was to apply molecular techniques to identify microorganisms in orofacial odontogenic infections (OIs). Specimens were obtained from subjects with clinical evidence of OI. To identify the microorganisms involved, 16S rRNA sequencing methods were used on clinical specimens. The name and number of the clones of each species identified and the combinations of species present were recorded for each subject. Descriptive statistics were computed for the study variables. Specimens of pus or wound fluid were obtained from 9 subjects. A mean of 7.4 ± 3.7 (standard deviation) species per case were identified. The predominant species detected in the present study that have previously been associated with OIs were Fusobacterium spp, Parvimonas micra, Porphyromonas endodontalis, and Prevotella oris. The predominant species detected in our study that have not been previously associated with OIs were Dialister pneumosintes and Eubacterium brachy. Unculturable phylotypes accounted for 24% of the species identified in our study. All species detected were obligate or facultative anaerobes. Streptococci were not detected. Molecular methods have enabled us to detect previously cultivated and not-yet-cultivated species in OIs; these methods could change our understanding of the pathogenic flora of orofacial OIs. Copyright © 2012 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  10. Molecular basis of alcoholism.

    Science.gov (United States)

    Most, Dana; Ferguson, Laura; Harris, R Adron

    2014-01-01

    Acute alcohol intoxication causes cellular changes in the brain that last for hours, while chronic alcohol use induces widespread neuroadaptations in the nervous system that can last a lifetime. Chronic alcohol use and the progression into dependence involve the remodeling of synapses caused by changes in gene expression produced by alcohol. The progression of alcohol use, abuse, and dependence can be divided into stages, which include intoxication, withdrawal, and craving. Each stage is associated with specific changes in gene expression, cellular function, brain circuits, and ultimately behavior. What are the molecular mechanisms underlying the transition from recreational use (acute) to dependence (chronic)? What cellular adaptations result in drug memory retention, leading to the persistence of addictive behaviors, even after prolonged drug abstinence? Research into the neurobiology of alcoholism aims to answer these questions. This chapter will describe the molecular adaptations caused by alcohol use and dependence, and will outline key neurochemical participants in alcoholism at the molecular level, which are also potential targets for therapy. © 2014 Elsevier B.V. All rights reserved.

  11. Molecular symmetry and spectroscopy

    CERN Document Server

    Bunker, Philip; Jensen, Per

    2006-01-01

    The first edition, by P.R. Bunker, published in 1979, remains the sole textbook that explains the use of the molecular symmetry group in understanding high resolution molecular spectra. Since 1979 there has been considerable progress in the field and a second edition is required; the original author has been joined in its writing by Per Jensen. The Material of the first edition has been reorganized and much has been added. The molecular symmetry group is now introduced early on, and the explanation of how to determine nuclear spin statistical weights has been consolidated in one chapter, after groups, symmetry groups, character tables and the Hamiltonian have been introduced. A description of the symmetry in the three-dimensional rotation group K(spatial), irreducible spherical tensor operators, and vector coupling coefficients is now included. The chapters on energy levels and selection rules contain a great deal of material that was not in the first edition (much of it was undiscovered in 1979), concerning ...

  12. Combinatorial Drug Screening Identifies Ewing Sarcoma-specific Sensitivities.

    Science.gov (United States)

    Radic-Sarikas, Branka; Tsafou, Kalliopi P; Emdal, Kristina B; Papamarkou, Theodore; Huber, Kilian V M; Mutz, Cornelia; Toretsky, Jeffrey A; Bennett, Keiryn L; Olsen, Jesper V; Brunak, Søren; Kovar, Heinrich; Superti-Furga, Giulio

    2017-01-01

    Improvements in survival for Ewing sarcoma pediatric and adolescent patients have been modest over the past 20 years. Combinations of anticancer agents endure as an option to overcome resistance to single treatments caused by compensatory pathways. Moreover, combinations are thought to lessen any associated adverse side effects through reduced dosing, which is particularly important in childhood tumors. Using a parallel phenotypic combinatorial screening approach of cells derived from three pediatric tumor types, we identified Ewing sarcoma-specific interactions of a diverse set of targeted agents including approved drugs. We were able to retrieve highly synergistic drug combinations specific for Ewing sarcoma and identified signaling processes important for Ewing sarcoma cell proliferation determined by EWS-FLI1 We generated a molecular target profile of PKC412, a multikinase inhibitor with strong synergistic propensity in Ewing sarcoma, revealing its targets in critical Ewing sarcoma signaling routes. Using a multilevel experimental approach including quantitative phosphoproteomics, we analyzed the molecular rationale behind the disease-specific synergistic effect of simultaneous application of PKC412 and IGF1R inhibitors. The mechanism of the drug synergy between these inhibitors is different from the sum of the mechanisms of the single agents. The combination effectively inhibited pathway crosstalk and averted feedback loop repression, in EWS-FLI1-dependent manner. Mol Cancer Ther; 16(1); 88-101. ©2016 AACR. ©2016 American Association for Cancer Research.

  13. Journey of a molecular biologist.

    Science.gov (United States)

    Nomura, Masayasu

    2011-01-01

    My journey into a research career began in fermentation biochemistry in an applied science department during the difficult post-World War II time in Japan. Subsequently, my desire to do research in basic science developed. I was fortunate to be a postdoctoral fellow in the United States during the early days of molecular biology. From 1957 to 1960, I worked with three pioneers of molecular biology, Sol Spiegelman, James Watson, and Seymour Benzer. These experiences helped me develop into a basic research scientist. My initial research projects at Osaka University, and subsequently at the University of Wisconsin, Madison, were on the mode of action of colicins as well as on mRNA and ribosomes. Following success in the reconstitution of ribosomal subunits, my efforts focused more on ribosomes, initially on the aspects of structure, function, and in vitro assembly, such as the construction of the 30S subunit assembly map. After this, my laboratory studied the regulation of the synthesis of ribosomes and ribosomal components in Escherichia coli. Our achievements included the discovery of translational feedback regulation of ribosomal protein synthesis and the identification of several repressor ribosomal proteins used in this regulation. In 1984, I moved to the University of California, Irvine, and initiated research on rRNA transcription by RNA polymerase I in the yeast Saccharomyces cerevisiae. The use of yeast genetics combined with biochemistry allowed us to identify genes uniquely involved in rRNA synthesis and to elucidate the mechanism of initiation of transcription. This essay is a reflection on my life as a research scientist.

  14. HPV: Molecular pathways and targets.

    Science.gov (United States)

    Gupta, Shilpi; Kumar, Prabhat; Das, Bhudev C

    2018-04-05

    Infection of high-risk human papillomaviruses (HPVs) is a prerequisite for the development of cervical carcinoma. HPV infections are also implicated in the development of other types of carcinomas. Chronic or persistent infection of HPV is essential but HPV alone is inadequate, additional endogenous or exogenous cues are needed along with HPV to induce cervical carcinogenesis. The strategies that high-risk HPVs have developed in differentiating epithelial cells to reach a DNA-synthesis competent state leading to tumorigenic transformation are basically due to overexpression of the E6 and E7 oncoproteins and the activation of diverse cellular regulatory or signaling pathways that are targeted by them. Moreover, the Wnt/β-catenin/Notch and phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathways are deregulated in various cancers, and have also been implicated in HPV-induced cancers. These are basically related to the "cancer hallmarks," and include sustaining proliferative signals, the evasion of growth suppression and immune destruction, replicative immortality, inflammation, invasion, metastasis and angiogenesis, as well as genome instability, resisting cell death, and deregulation of cellular energetics. These information could eventually aid in identifying or developing new diagnostic, prognostic biomarkers, and may contribute to design more effective targeted therapeutics and treatment strategies. Although surgery, chemotherapy and radiotherapy can cure more than 90% of women with early stage cervical cancer, the recurrent and metastatic disease remains a major cause of cancer mortality. Numerous efforts have been made to design new drugs and develop gene therapies to treat cervical cancer. In recent years, research on treatment strategies has proposed several options, including the role of HPV E5, E6, and E7 oncogenes, which are retained and overexpressed in most of the cervical cancers and whose respective oncoproteins are critical to the induction

  15. A Novel Mechanistic Approach to Identify New Antifungal Lead ...

    African Journals Online (AJOL)

    AmB) molecular architecture. Methods: The strategy employed was molecular similarity search and screening based on the molecular constraints of polyene macrolide antibiotics, as well as docking experiments. Several new compounds were ...

  16. NIH Researchers Identify OCD Risk Gene

    Science.gov (United States)

    ... News From NIH NIH Researchers Identify OCD Risk Gene Past Issues / Summer 2006 Table of Contents For ... and Alcoholism (NIAAA) have identified a previously unknown gene variant that doubles an individual's risk for obsessive- ...

  17. Molecular characterisation of sinonasal carcinomas and their clinical implications.

    Science.gov (United States)

    López, Fernando; Llorente, José Luis; Costales, María; García-Inclán, Cristina; Pérez-Escuredo, Jhudit; Alvarez-Marcos, César; Hermsen, Mario; Suárez, Carlos

    2013-01-01

    Sinonasal carcinomas are rare tumours with an unfavourable prognosis whose management is difficult and complex, leading to high morbidity and mortality despite improvements in the field of surgery and radiotherapy. An elevated number of these tumours can be attributed to occupational exposure. In comparison with other head and neck malignancies, studies of molecular changes in these tumours are infrequent. This review was focused on findings about the epidemiology and molecular and phenotypic characterisation of sinonasal carcinomas, which can potentially be useful for diagnosis and treatment. The increasing knowledge about the molecular biology that underlies their carcinogenesis may help to identify precursor lesions, prognostic markers and markers that predict chemoradiotherapy response and, finally, to identify potential molecular targets that will expand treatment options. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  18. Red blood cell phenotype prevalence in blood donors who self-identify as Hispanic

    DEFF Research Database (Denmark)

    Sheppard, Chelsea A; Bolen, Nicole L; Eades, Beth

    2017-01-01

    CONCLUSIONS: Molecular genotyping platforms provide a quick, high-throughput method for identifying red blood cell units for patients on extended phenotype-matching protocols, such as those with sickle cell disease or thalassemia. Most of the antigen prevalence data reported are for non-Hispanic ......CONCLUSIONS: Molecular genotyping platforms provide a quick, high-throughput method for identifying red blood cell units for patients on extended phenotype-matching protocols, such as those with sickle cell disease or thalassemia. Most of the antigen prevalence data reported are for non...

  19. Ability of Slovakian Pupils to Identify Birds

    Science.gov (United States)

    Prokop, Pavol; Rodak, Rastislav

    2009-01-01

    A pupil's ability to identify common organisms is necessary for acquiring further knowledge of biology. We investigated how pupils were able to identify 25 bird species following their song, growth habits, or both features presented simultaneously. Just about 19% of birds were successfully identified by song, about 39% by growth habit, and 45% of…

  20. Cooling of molecular ion beams

    International Nuclear Information System (INIS)

    Wolf, A.; Krohn, S.; Kreckel, H.; Lammich, L.; Lange, M.; Strasser, D.; Grieser, M.; Schwalm, D.; Zajfman, D.

    2004-01-01

    An overview of the use of stored ion beams and phase space cooling (electron cooling) is given for the field of molecular physics. Emphasis is given to interactions between molecular ions and electrons studied in the electron cooler: dissociative recombination and, for internally excited molecular ions, electron-induced ro-vibrational cooling. Diagnostic methods for the transverse ion beam properties and for the internal excitation of the molecular ions are discussed, and results for phase space cooling and internal (vibrational) cooling are presented for hydrogen molecular ions

  1. Tiered High-Throughput Screening Approach to Identify ...

    Science.gov (United States)

    High-throughput screening (HTS) for potential thyroid–disrupting chemicals requires a system of assays to capture multiple molecular-initiating events (MIEs) that converge on perturbed thyroid hormone (TH) homeostasis. Screening for MIEs specific to TH-disrupting pathways is limited in the US EPA ToxCast screening assay portfolio. To fill one critical screening gap, the Amplex UltraRed-thyroperoxidase (AUR-TPO) assay was developed to identify chemicals that inhibit TPO, as decreased TPO activity reduces TH synthesis. The ToxCast Phase I and II chemical libraries, comprised of 1,074 unique chemicals, were initially screened using a single, high concentration to identify potential TPO inhibitors. Chemicals positive in the single concentration screen were retested in concentration-response. Due to high false positive rates typically observed with loss-of-signal assays such as AUR-TPO, we also employed two additional assays in parallel to identify possible sources of nonspecific assay signal loss, enabling stratification of roughly 300 putative TPO inhibitors based upon selective AUR-TPO activity. A cell-free luciferase inhibition assay was used to identify nonspecific enzyme inhibition among the putative TPO inhibitors, and a cytotoxicity assay using a human cell line was used to estimate the cellular tolerance limit. Additionally, the TPO inhibition activities of 150 chemicals were compared between the AUR-TPO and an orthogonal peroxidase oxidation assay using

  2. Identifying a Small Molecule Blocking Antigen Presentation in Autoimmune Thyroiditis.

    Science.gov (United States)

    Li, Cheuk Wun; Menconi, Francesca; Osman, Roman; Mezei, Mihaly; Jacobson, Eric M; Concepcion, Erlinda; David, Chella S; Kastrinsky, David B; Ohlmeyer, Michael; Tomer, Yaron

    2016-02-19

    We previously showed that an HLA-DR variant containing arginine at position 74 of the DRβ1 chain (DRβ1-Arg74) is the specific HLA class II variant conferring risk for autoimmune thyroid diseases (AITD). We also identified 5 thyroglobulin (Tg) peptides that bound to DRβ1-Arg74. We hypothesized that blocking the binding of these peptides to DRβ1-Arg74 could block the continuous T-cell activation in thyroiditis needed to maintain the autoimmune response to the thyroid. The aim of the current study was to identify small molecules that can block T-cell activation by Tg peptides presented within DRβ1-Arg74 pockets. We screened a large and diverse library of compounds and identified one compound, cepharanthine that was able to block peptide binding to DRβ1-Arg74. We then showed that Tg.2098 is the dominant peptide when inducing experimental autoimmune thyroiditis (EAT) in NOD mice expressing human DRβ1-Arg74. Furthermore, cepharanthine blocked T-cell activation by thyroglobulin peptides, in particular Tg.2098 in mice that were induced with EAT. For the first time we identified a small molecule that can block Tg peptide binding and presentation to T-cells in autoimmune thyroiditis. If confirmed cepharanthine could potentially have a role in treating human AITD. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Nonadiabatic electron wavepacket dynamics behind molecular autoionization

    Science.gov (United States)

    Matsuoka, Takahide; Takatsuka, Kazuo

    2018-01-01

    A theoretical method for real-time dynamics of nonadiabatic reorganization of electronic configurations in molecules is developed, with dual aim that the intramolecular electron dynamics can be probed by means of direct and/or indirect photoionizations and that the physical origins behind photoionization signals attained in the time domain can be identified in terms of the language of time-dependent quantum chemistry. In doing so, we first formulate and implement a new computational scheme for nonadiabatic electron dynamics associated with molecular ionization, which well fits in the general theory of nonadiabatic electron dynamics. In this method, the total nonadiabatic electron wavepackets are propagated in time directly with complex natural orbitals without referring to Hartree-Fock molecular orbitals, and the amount of electron flux from a molecular region leading to ionization is evaluated in terms of the relevant complex natural orbitals. In the second half of this paper, we apply the method to electron dynamics in the elementary processes consisting of the Auger decay to demonstrate the methodological significance. An illustrative example is taken from an Auger decay starting from the 2a1 orbital hole-state of H2O+. The roles of nuclear momentum (kinetic) couplings in electronic-state mixing during the decay process are analyzed in terms of complex natural orbitals, which are schematically represented in the conventional language of molecular symmetry of the Hartree-Fock orbitals.

  4. Molecular mechanisms of curcumin action: gene expression.

    Science.gov (United States)

    Shishodia, Shishir

    2013-01-01

    Curcumin derived from the tropical plant Curcuma longa has a long history of use as a dietary agent, food preservative, and in traditional Asian medicine. It has been used for centuries to treat biliary disorders, anorexia, cough, diabetic wounds, hepatic disorders, rheumatism, and sinusitis. The preventive and therapeutic properties of curcumin are associated with its antioxidant, anti-inflammatory, and anticancer properties. Extensive research over several decades has attempted to identify the molecular mechanisms of curcumin action. Curcumin modulates numerous molecular targets by altering their gene expression, signaling pathways, or through direct interaction. Curcumin regulates the expression of inflammatory cytokines (e.g., TNF, IL-1), growth factors (e.g., VEGF, EGF, FGF), growth factor receptors (e.g., EGFR, HER-2, AR), enzymes (e.g., COX-2, LOX, MMP9, MAPK, mTOR, Akt), adhesion molecules (e.g., ELAM-1, ICAM-1, VCAM-1), apoptosis related proteins (e.g., Bcl-2, caspases, DR, Fas), and cell cycle proteins (e.g., cyclin D1). Curcumin modulates the activity of several transcription factors (e.g., NF-κB, AP-1, STAT) and their signaling pathways. Based on its ability to affect multiple targets, curcumin has the potential for the prevention and treatment of various diseases including cancers, arthritis, allergies, atherosclerosis, aging, neurodegenerative disease, hepatic disorders, obesity, diabetes, psoriasis, and autoimmune diseases. This review summarizes the molecular mechanisms of modulation of gene expression by curcumin. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.

  5. Physics through the 1990s: Atomic, molecular, and optical physics

    International Nuclear Information System (INIS)

    1986-01-01

    This report was prepared by the Panel on Atomic, Molecular, and Optical Physics of the Physics Survey Committee in response to its charge to describe the field, to characterize the recent advances, and to identify the current frontiers of research. Some of the areas discussed are: atomic structure, atomic dynamics, accelerator-based atomic physics, molecular photoionization and electron-molecule scattering, astrophysics, laser spectroscopy, atmospheric physics, plasma physics, and applications

  6. Computational methods for molecular imaging

    CERN Document Server

    Shi, Kuangyu; Li, Shuo

    2015-01-01

    This volume contains original submissions on the development and application of molecular imaging computing. The editors invited authors to submit high-quality contributions on a wide range of topics including, but not limited to: • Image Synthesis & Reconstruction of Emission Tomography (PET, SPECT) and other Molecular Imaging Modalities • Molecular Imaging Enhancement • Data Analysis of Clinical & Pre-clinical Molecular Imaging • Multi-Modal Image Processing (PET/CT, PET/MR, SPECT/CT, etc.) • Machine Learning and Data Mining in Molecular Imaging. Molecular imaging is an evolving clinical and research discipline enabling the visualization, characterization and quantification of biological processes taking place at the cellular and subcellular levels within intact living subjects. Computational methods play an important role in the development of molecular imaging, from image synthesis to data analysis and from clinical diagnosis to therapy individualization. This work will bring readers fro...

  7. Molecular Mechanisms of Preeclampsia.

    Science.gov (United States)

    Hod, Tammy; Cerdeira, Ana Sofia; Karumanchi, S Ananth

    2015-08-20

    Preeclampsia is a pregnancy-specific disease characterized by new onset hypertension and proteinuria after 20 wk of gestation. It is a leading cause of maternal and fetal morbidity and mortality worldwide. Exciting discoveries in the last decade have contributed to a better understanding of the molecular basis of this disease. Epidemiological, experimental, and therapeutic studies from several laboratories have provided compelling evidence that an antiangiogenic state owing to alterations in circulating angiogenic factors leads to preeclampsia. In this review, we highlight the role of key circulating antiangiogenic factors as pathogenic biomarkers and in the development of novel therapies for preeclampsia. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  8. De novo molecular design

    CERN Document Server

    Schneider, Gisbert

    2013-01-01

    Systematically examining current methods and strategies, this ready reference covers a wide range of molecular structures, from organic-chemical drugs to peptides, Proteins and nucleic acids, in line with emerging new drug classes derived from biomacromolecules. A leader in the field and one of the pioneers of this young discipline has assembled here the most prominent experts from across the world to provide first-hand knowledge. While most of their methods and examples come from the area of pharmaceutical discovery and development, the approaches are equally applicable for chemical probes an

  9. Molecular water oxidation catalysis

    CERN Document Server

    Llobet, Antoni

    2014-01-01

    Photocatalytic water splitting is a promising strategy for capturing energy from the sun by coupling light harvesting and the oxidation of water, in order to create clean hydrogen fuel. Thus a deep knowledge of the water oxidation catalysis field is essential to be able to come up with useful energy conversion devices based on sunlight and water splitting. Molecular Water Oxidation Catalysis: A Key Topic for New Sustainable Energy Conversion Schemes presents a comprehensive and state-of-the-art overview of water oxidation catalysis in homogeneous phase, describing in detail the most importan

  10. Nuclear molecular states

    International Nuclear Information System (INIS)

    Abe, Y.

    1975-01-01

    The effects of polarization on the stability of α-cluster structures in 8 Be and 12 C nuclei are studied in the intrinsic states. The extent of the polarization of α-clusters is investigated by employing a molecular-orbital model. Two α-cluster structure of 8 Be is shown to be extremely stable, and a triangular configuration of three α-clusters is also shown to be stable, but the polarizations of α-clusters are found rather large. Gruemmer--Faessler's method is discussed and their results are shown to be trivial

  11. Molecular epidemiology of ascariasis

    DEFF Research Database (Denmark)

    Betson, Martha; Halstead, Fennella; Nejsum, Peter

      We are using molecular epidemiology techniques to study the population structure of Ascaris obtained from humans and pigs. Worms were obtained from human hosts on Zanzibar and in Uganda, Bangladesh, Guatemala and Nepal and Ascaris from pigs were collected from in Uganda, Tanzania, Denmark......, Guatemala and the Philippines. Genomic DNA was extracted from each worm and a 450 base pair fragment of the mitochondrial cytochrome oxidase gene subunit 1 (COI) was PCR amplified. The products were sequenced from both strands and sequences were manually edited. Fifty different Ascaris CO1 haplotypes were...

  12. Molecular collision theory

    CERN Document Server

    Child, M S

    2010-01-01

    This high-level monograph offers an excellent introduction to the theory required for interpretation of an increasingly sophisticated range of molecular scattering experiments. There are five helpful appendixes dealing with continuum wavefunctions, Green's functions, semi-classical connection formulae, curve-crossing in the momentum representation, and elements of classical mechanics.The contents of this volume have been chosen to emphasize the quantum mechanical and semi-classical nature of collision events, with little attention given to purely classical behavior. The treatment is essentiall

  13. The nonequilibrium molecular dynamics

    International Nuclear Information System (INIS)

    Hoover, W.G.

    1992-03-01

    MOLECULAR DYNAMICS has been generalized in order to simulate a variety of NONEQUILIBRIUM systems. This generalization has been achieved by adopting microscopic mechanical definitions of macroscopic thermodynamic and hydrodynamic variables, such as temperature and stress. Some of the problems already treated include rapid plastic deformation, intense heat conduction, strong shockwaves simulation, and far-from-equilibrium phase transformations. Continuing advances in technique and in the modeling of interatomic forces, coupled with qualitative improvements in computer hardware, are enabling such simulations to approximate real-world microscale and nanoscale experiments

  14. Molecular Mechanisms of Preeclampsia

    Science.gov (United States)

    Hod, Tammy; Cerdeira, Ana Sofia; Karumanchi, S. Ananth

    2015-01-01

    Preeclampsia is a pregnancy-specific disease characterized by new onset hypertension and proteinuria after 20 wk of gestation. It is a leading cause of maternal and fetal morbidity and mortality worldwide. Exciting discoveries in the last decade have contributed to a better understanding of the molecular basis of this disease. Epidemiological, experimental, and therapeutic studies from several laboratories have provided compelling evidence that an antiangiogenic state owing to alterations in circulating angiogenic factors leads to preeclampsia. In this review, we highlight the role of key circulating antiangiogenic factors as pathogenic biomarkers and in the development of novel therapies for preeclampsia. PMID:26292986

  15. Introduction to basic molecular biologic techniques for molecular imaging researches

    International Nuclear Information System (INIS)

    Kang, Joo Hyun

    2004-01-01

    Molecular imaging is a rapidly growing field due to the advances in molecular biology and imaging technologies. With the introduction of imaging reporter genes into the cell, diverse cellular processes can be monitored, quantified and imaged non-invasively in vivo. These processes include the gene expression, protein-protein interactions, signal transduction pathways, and monitoring of cells such as cancer cells, immune cells, and stem cells. In the near future, molecular imaging analysis will allow us to observe the incipience and progression of the disease. These will make us easier to give a diagnosis in the early stage of intractable diseases such as cancer, neuro-degenerative disease, and immunological disorders. Additionally, molecular imaging method will be a valuable tool for the real-time evaluation of cells in molecular biology and the basic biological studies. As newer and more powerful molecular imaging tools become available, it will be necessary to corporate clinicians, molecular biologists and biochemists for the planning, interpretation, and application of these techniques to their fullest potential. In order for such a multidisciplinary team to be effective, it is essential that a common understanding of basic biochemical and molecular biologic techniques is achieved. Basic molecular techniques for molecular imaging methods are presented in this paper

  16. [When history meets molecular medicine: molecular history of human tuberculosis].

    Science.gov (United States)

    Ottini, Laura; Falchetti, Mario

    2010-01-01

    Tuberculosis represents one of the humankind's most socially devastating diseases. Despite a long history of medical research and the development of effective therapies, this disease remains a global health danger even in the 21st century. Tuberculosis may cause death but infected people with effective immunity may remain healthy for years, suggesting long-term host-pathogen co-existence. Because of its antiquity, a supposed association with human settlements and the tendency to leave typical lesions on skeletal and mummified remains, tuberculosis has been the object of intensive multidisciplinary studies, including paleo-pathological research. During the past 10 years molecular paleo-pathology developed as a new scientific discipline allowing the study of ancient pathogens by direct detection of their DNA. In this work, we reviewed evidences for tuberculosis in ancient human remains, current methods for identifying ancient mycobacterial DNA and explored current theories of Mycobacterium tuberculosis evolution and their implications in the global development of tuberculosis looking into the past and present at the same time.

  17. Photoinduced diffusion molecular transport

    Energy Technology Data Exchange (ETDEWEB)

    Rozenbaum, Viktor M., E-mail: vik-roz@mail.ru, E-mail: litrakh@gmail.com [Chuiko Institute of Surface Chemistry, National Academy of Sciences of Ukraine, Generala Naumova St. 17, Kiev 03164 (Ukraine); Dekhtyar, Marina L. [Institute of Organic Chemistry, National Academy of Sciences of Ukraine, Murmanskaya St. 5, Kiev 02094 (Ukraine); Lin, Sheng Hsien [Department of Applied Chemistry, National Chiao Tung University, 1001 Ta Hsuen Road, Hsinchu 300, Taiwan (China); Trakhtenberg, Leonid I., E-mail: vik-roz@mail.ru, E-mail: litrakh@gmail.com [Semenov Institute of Chemical Physics, Russian Academy of Sciences, Kosygin Street 4, Moscow 119991, Russia and Moscow Institute of Physics and Technology (State University), Institutskii Per. 9, Dolgoprudnyi, Moscow Region 141700 (Russian Federation)

    2016-08-14

    We consider a Brownian photomotor, namely, the directed motion of a nanoparticle in an asymmetric periodic potential under the action of periodic rectangular resonant laser pulses which cause charge redistribution in the particle. Based on the kinetics for the photoinduced electron redistribution between two or three energy levels of the particle, the time dependence of its potential energy is derived and the average directed velocity is calculated in the high-temperature approximation (when the spatial amplitude of potential energy fluctuations is small relative to the thermal energy). The thus developed theory of photoinduced molecular transport appears applicable not only to conventional dichotomous Brownian motors (with only two possible potential profiles) but also to a much wider variety of molecular nanomachines. The distinction between the realistic time dependence of the potential energy and that for a dichotomous process (a step function) is represented in terms of relaxation times (they can differ on the time intervals of the dichotomous process). As shown, a Brownian photomotor has the maximum average directed velocity at (i) large laser pulse intensities (resulting in short relaxation times on laser-on intervals) and (ii) excited state lifetimes long enough to permit efficient photoexcitation but still much shorter than laser-off intervals. A Brownian photomotor with optimized parameters is exemplified by a cylindrically shaped semiconductor nanocluster which moves directly along a polar substrate due to periodically photoinduced dipole moment (caused by the repetitive excited electron transitions to a non-resonant level of the nanocylinder surface impurity).

  18. Chemoradiotherapy and molecular biology

    International Nuclear Information System (INIS)

    Hasegawa, Masatoshi; Mitsuhashi, Norio; Niibe, Hideo

    2000-01-01

    The current status of chemoradiotherapy was reviewed from the standpoint of molecular biology. Chemoradiotherapy was conducted to achieve systemic tumor control, to intensify the response to irradiation, and to reduce adverse reactions. The mechanisms of the efficacy of chemoradiotherapy were: modification of dose-response relationships, inhibition of tumor cell recovery from sublethal damage or potential lethal damage, effects on cell dynamics and the cell cycle, improvement of blood flow or reoxygenation, recruitment, improvement of drug uptake, increased cell damage. Cell death (necrosis and apoptosis) and cancer-related genes were described, as the essential points, because they are involved in the response to chemoradiotherapy. Cisplatin (platinum compound), 5-fluorouracil, etoposide, and taxoid (paclitaxel, docetaxel) were the principal anticancer agents used for chemoradiotherapy, and they enhanced the effects of irradiation. However, even when good responses or synergism between anticancer drug and radiotherapy was observed in in vitro studies, there was little therapeutic advantage clinically. Data from in vitro and in vivo studies should be collected and systemized, and ''molecular biology in chemotherapy'' that can be applied clinically may become established. (K.H.)

  19. Molecular beam kinetics

    International Nuclear Information System (INIS)

    Behrens, R. Jr.

    1975-11-01

    The design of a crossed molecular beam ''supermachine'' for neutral--neutral collisions is discussed. The universal electron bombardment ionizer, mass filter, and ion detection system of the detector, the supersonic nozzle sources, the differential pumping arrangement for the sources and detector, the time-of-flight detection of scattered products, and the overall configuration of the apparatus are described. The elastic scattering of two systems, CH 4 + Ar and NH 3 + Ar, has been measured using the supermachine with two supersonic nozzle sources. The rainbow structure and the interference oscillations are seen in each system. The best fit to the data was found using a Morse--Spline--Van der Waals (MSV) potential. The three potential parameters epsilon, r/sub m/, and β were found to be 2.20(+-0.04) x 10 -14 ergs, 3.82(+-0.04)A, and 7.05 +- 0.20 for CH 4 + Ar, and 2.21(+-0.04) x 10 -14 ergs 3.93 (+-0.05)A, and 8.45 +- 0.30 for NH 3 + Ar. A new phenomenon in crossed molecular beams of condensation of a molecule on a cluster to form a complex was observed. A bromine molecule condensed on clusters of chlorine (Cl 2 )/sub chi/ and ammonia (NH 3 )/sub chi/. The value of chi for measurements in these experiments ranges from 7 to 40 for chlorine clusters and from 10 to 70 ammonia clusters

  20. Molecular biology of potyviruses.

    Science.gov (United States)

    Revers, Frédéric; García, Juan Antonio

    2015-01-01

    Potyvirus is the largest genus of plant viruses causing significant losses in a wide range of crops. Potyviruses are aphid transmitted in a nonpersistent manner and some of them are also seed transmitted. As important pathogens, potyviruses are much more studied than other plant viruses belonging to other genera and their study covers many aspects of plant virology, such as functional characterization of viral proteins, molecular interaction with hosts and vectors, structure, taxonomy, evolution, epidemiology, and diagnosis. Biotechnological applications of potyviruses are also being explored. During this last decade, substantial advances have been made in the understanding of the molecular biology of these viruses and the functions of their various proteins. After a general presentation on the family Potyviridae and the potyviral proteins, we present an update of the knowledge on potyvirus multiplication, movement, and transmission and on potyvirus/plant compatible interactions including pathogenicity and symptom determinants. We end the review providing information on biotechnological applications of potyviruses. © 2015 Elsevier Inc. All rights reserved.