WorldWideScience

Sample records for identifying important rare

  1. Rare copy number variants identified in prune belly syndrome.

    Science.gov (United States)

    Boghossian, Nansi S; Sicko, Robert J; Giannakou, Andreas; Dimopoulos, Aggeliki; Caggana, Michele; Tsai, Michael Y; Yeung, Edwina H; Pankratz, Nathan; Cole, Benjamin R; Romitti, Paul A; Browne, Marilyn L; Fan, Ruzong; Liu, Aiyi; Kay, Denise M; Mills, James L

    2018-03-01

    Prune belly syndrome (PBS), also known as Eagle-Barrett syndrome, is a rare congenital disorder characterized by absence or hypoplasia of the abdominal wall musculature, urinary tract anomalies, and cryptorchidism in males. The etiology of PBS is largely unresolved, but genetic factors are implicated given its recurrence in families. We examined cases of PBS to identify novel pathogenic copy number variants (CNVs). A total of 34 cases (30 males and 4 females) with PBS identified from all live births in New York State (1998-2005) were genotyped using Illumina HumanOmni2.5 microarrays. CNVs were prioritized if they were absent from in-house controls, encompassed ≥10 consecutive probes, were ≥20 Kb in size, had ≤20% overlap with common variants in population reference controls, and had ≤20% overlap with any variant previously detected in other birth defect phenotypes screened in our laboratory. We identified 17 candidate autosomal CNVs; 10 cases each had one CNV and four cases each had two CNVs. The CNVs included a 158 Kb duplication at 4q22 that overlaps the BMPR1B gene; duplications of different sizes carried by two cases in the intron of STIM1 gene; a 67 Kb duplication 202 Kb downstream of the NOG gene, and a 1.34 Mb deletion including the MYOCD gene. The identified rare CNVs spanned genes involved in mesodermal, muscle, and urinary tract development and differentiation, which might help in elucidating the genetic contribution to PBS. We did not have parental DNA and cannot identify whether these CNVs were de novo or inherited. Further research on these CNVs, particularly BMP signaling is warranted to elucidate the pathogenesis of PBS. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  3. Importance sampling of rare events in chaotic systems

    DEFF Research Database (Denmark)

    Leitão, Jorge C.; Parente Lopes, João M.Viana; Altmann, Eduardo G.

    2017-01-01

    space of chaotic systems. As examples of our general framework we compute the distribution of finite-time Lyapunov exponents (in different chaotic maps) and the distribution of escape times (in transient-chaos problems). Our methods sample exponentially rare states in polynomial number of samples (in......Finding and sampling rare trajectories in dynamical systems is a difficult computational task underlying numerous problems and applications. In this paper we show how to construct Metropolis-Hastings Monte-Carlo methods that can efficiently sample rare trajectories in the (extremely rough) phase...... both low- and high-dimensional systems). An open-source software that implements our algorithms and reproduces our results can be found in reference [J. Leitao, A library to sample chaotic systems, 2017, https://github.com/jorgecarleitao/chaospp]....

  4. Politeness as a feature: so important and so rare

    Directory of Open Access Journals (Sweden)

    Corbett, Greville G.

    2012-01-01

    Full Text Available Politeness has a major place in many languages, and is remarkably pervasive in some. Yet we rarely find respect as a morphosyntactic feature, alongside gender, person, number and case. I document this imbalance, and then ask why this is what we find.

  5. [Monogenic and syndromic symptoms of morbid obesity. Rare but important].

    Science.gov (United States)

    Wiegand, S; Krude, H

    2015-02-01

    Monogenic and syndromic obesity are rare diseases with variable manifestation. Therefore diagnosis is difficult and often delayed. The purpose of this work was to develop a clinical diagnostic algorithm for earlier diagnosis. Available publications for clinical symptoms and molecular defects of monogenic and syndromic obesity cases were evaluated. Monogenic and syndromic obesity can be expected in cases with early manifestation before the age of 5 years and a BMI above 40 or above the 99th percentile. Syndromic cases are mostly associated with a low IQ and dwarfism. Monogenic cases are associated with additional endocrine defects. Measurement of serum leptin proves the treatable leptin deficiency. Sequencing of the melanocortin-4 receptor gene (MC4R) allows diagnosis of the most frequent monogenic form of obesity. Treatment with a melanocyte-stimulating hormone (MSH) analog can be expected in the future. Early treatment of children with Prader-Willi syndrome can prevent severe obesity. Because in some cases treatment is available, monogenic and syndromic obesity should be diagnosed early. Based on the disease symptoms, serum leptin, and MC4R sequencing, a diagnostic algorithm is proposed, which can be used to diagnose cases of morbid obesity.

  6. A Rare But Important Entity: Epistaxis in Infants.

    Science.gov (United States)

    DeLaroche, Amy M; Tigchelaar, Helene; Kannikeswaran, Nirupama

    2017-01-01

    Epistaxis is a common emergency department (ED) complaint; however, this entity is rare among children younger than 2 years of age. In this age group, epistaxis may be a presenting sign of a bleeding disorder or nonaccidental trauma. We present a case of a 2-month-old infant who was evaluated in the pediatric ED for epistaxis and discharged home. The infant returned 2 days later with facial swelling and irritability, and was found to have significant head trauma. In this article we review the epidemiology and differential diagnoses for epistaxis among infants, as well as the initial approach to the evaluation of this uncommon clinical entity in this age group. WHY SHOULD AN EMERGENCY PHYSICIAN BE AWARE OF THIS?: Potential etiologies for epistaxis among infants and young children include severe systemic disease and nonaccidental trauma. Given its rarity and possible clinical significance, the approach to epistaxis differs in this age group. Emergency physicians should screen for and exclude a bleeding disorder while also having a very low threshold for a nonaccidental trauma evaluation. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Ovarian vein thrombosis – a rare but important complication of ...

    African Journals Online (AJOL)

    This case study highlights the clinical importance of ovarian vein thrombosis in the context of pelvic surgery for benign gynaecological conditions and the role of imaging, particularly computed tomography with reformatting, in confirming the diagnosis.

  8. The Importance of Rare Subtypes in Diagnosis and Treatment of Peripheral Neuropathy: A Review.

    Science.gov (United States)

    Callaghan, Brian C; Price, Raymond S; Chen, Kevin S; Feldman, Eva L

    2015-12-01

    Peripheral neuropathy is a prevalent condition that usually warrants a thorough history and examination but has limited diagnostic evaluation. However, rare localizations of peripheral neuropathy often require more extensive diagnostic testing and different treatments. To describe rare localizations of peripheral neuropathy, including the appropriate diagnostic evaluation and available treatments. References were identified from PubMed searches conducted on May 29, 2015, with an emphasis on systematic reviews and randomized clinical trials. Articles were also identified through the use of the authors' own files. Search terms included common rare neuropathy localizations and their causes, as well as epidemiology, pathophysiology, diagnosis, and treatment. Diffuse, nonlength-dependent neuropathies, multiple mononeuropathies, polyradiculopathies, plexopathies, and radiculoplexus neuropathies are rare peripheral neuropathy localizations that often require extensive diagnostic testing. Atypical neuropathy features, such as acute/subacute onset, asymmetry, and/or motor predominant signs, are frequently present. The most common diffuse, nonlength-dependent neuropathies are Guillain-Barré syndrome, chronic inflammatory demyelinating polyneuropathy, multifocal motor neuropathy, and amyotrophic lateral sclerosis. Effective disease-modifying therapies exist for many diffuse, nonlength-dependent neuropathies including Guillain-Barré syndrome, chronic inflammatory demyelinating polyneuropathy, multifocal motor neuropathy, and some paraprotein-associated demyelinating neuropathies. Vasculitic neuropathy (multiple mononeuropathy) also has efficacious treatment options, but definitive evidence of a treatment effect for IgM anti-MAG neuropathy and diabetic amyotrophy (radiculoplexus neuropathy) is lacking. Recognition of rare localizations of peripheral neuropathy is essential given the implications for diagnostic testing and treatment. Electrodiagnostic studies are an important

  9. Ovarian vein thrombosis – a rare but important complication of ...

    African Journals Online (AJOL)

    hysterectomy and oophorectomy. The clinical importance relates to the possible complications and requirement for lifelong anticoagulation. Radiological investigation is integral in making the diagnosis; in particular, computed tomography (CT) with reformatting demonstrates the thrombosed vessels directly. The decision to ...

  10. Retroperitoneal extra-adrenal paraganglioma: a rare but important diagnosis.

    LENUS (Irish Health Repository)

    Ahmad, S

    2012-01-31

    BACKGROUND: Extra-adrenal paragangliomas of the retroperitonium are infrequently diagnosed. Their malignant behaviour cannot be predicted on initial clinical and histological assessment. These tumours have higher propensity for subsequent metastasis compared with pargangliomas at other sites. AIM: We aim to describe a case report of an incidental finding of left retroperitoneal paraganglioma in a young man who presented with right flank pain. We also aim to emphasize the importance of diagnosis and the malignant potential of these tumours. METHOD: Patient\\'s clinical notes, operative findings, imaging studies and laboratory investigations including histology results were reviewed. A literature search was done to look into the incidence, presentation, follow-up plan and treatment options for these tumours. CONCLUSION: Surgical resection is the only available curative option for extra-adrenal paragangliomas. Metastasis is observed years after surgery, hence long-term follow-up is required.

  11. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  12. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  13. Stakeholder perspectives on the importance of rare-species research for deep-sea environmental management

    Science.gov (United States)

    Turner, Phillip J.; Campbell, Lisa M.; Van Dover, Cindy L.

    2017-07-01

    The apparent prevalence of rare species (rarity) in the deep sea is a concern for environmental management and conservation of biodiversity. Rare species are often considered at risk of extinction and, in terrestrial and shallow water environments, have been shown to play key roles within an ecosystem. In the deep-sea environment, current research focuses primarily on abundant species and deep-sea stakeholders are questioning the importance of rare species in ecosystem functioning. This study asks whether deep-sea stakeholders (primarily scientists) view rare-species research as a priority in guiding environmental management. Delphi methodology (i.e., an iterative survey approach) was used to understand views about whether or not 'deep-sea scientists should allocate more resources to research on rare species in the deep sea, even if this means less resources might be available for abundant-species research.' Results suggest little consensus regarding the prioritization of resources for rare-species research. From Survey 1 to Survey 3, the average participant response shifted toward a view that rare-species research is not a priority if it comes at a cost to research on abundant species. Participants pointed to the need for a balanced approach and highlighted knowledge gaps about even the most fundamental questions, including whether rare species are truly 'rare' or simply under-sampled. Participants emphasized the lack of basic biological knowledge for rare and abundant species, particularly abundant meio- and microscopic species, as well as uncertainty in the roles rare and abundant species play in ecosystem processes. Approaches that jointly consider the role of rare and abundant species in ecosystem functioning (e.g., biological trait analysis) may help to clarify the extent to which rare species need to be incorporated into deep-sea environment management in order to maintain ecosystem functioning.

  14. Using Extreme Phenotype Sampling to Identify the Rare Causal Variants of Quantitative Traits in Association Studies

    OpenAIRE

    Li, Dalin; Lewinger, Juan Pablo; Gauderman, William J.; Murcray, Cassandra Elizabeth; Conti, David

    2011-01-01

    Variants identified in recent genome-wide association studies based on the common-disease common-variant hypothesis are far from fully explaining the hereditability of complex traits. Rare variants may, in part, explain some of the missing hereditability. Here, we explored the advantage of the extreme phenotype sampling in rare-variant analysis and refined this design framework for future large-scale association studies on quantitative traits. We first proposed a power calculation approach fo...

  15. The importance of international collaboration for rare diseases research: a European perspective.

    Science.gov (United States)

    Julkowska, D; Austin, C P; Cutillo, C M; Gancberg, D; Hager, C; Halftermeyer, J; Jonker, A H; Lau, L P L; Norstedt, I; Rath, A; Schuster, R; Simelyte, E; van Weely, S

    2017-09-01

    Over the last two decades, important contributions were made at national, European and international levels to foster collaboration into rare diseases research. The European Union (EU) has put much effort into funding rare diseases research, encouraging national funding organizations to collaborate together in the E-Rare program, setting up European Reference Networks for rare diseases and complex conditions, and initiating the International Rare Diseases Research Consortium (IRDiRC) together with the National Institutes of Health in the USA. Co-ordination of the activities of funding agencies, academic researchers, companies, regulatory bodies, and patient advocacy organizations and partnerships with, for example, the European Research Infrastructures maximizes the collective impact of global investments in rare diseases research. This contributes to accelerating progress, for example, in faster diagnosis through enhanced discovery of causative genes, better understanding of natural history of rare diseases through creation of common registries and databases and boosting of innovative therapeutic approaches. Several examples of funded pre-clinical and clinical gene therapy projects show that integration of multinational and multidisciplinary expertize generates new knowledge and can result in multicentre gene therapy trials. International collaboration in rare diseases research is key to improve the life of people living with a rare disease.

  16. Enhancing Important Fluctuations: Rare Events and Metadynamics from a Conceptual Viewpoint

    Science.gov (United States)

    Valsson, Omar; Tiwary, Pratyush; Parrinello, Michele

    2016-05-01

    Atomistic simulations play a central role in many fields of science. However, their usefulness is often limited by the fact that many systems are characterized by several metastable states separated by high barriers, leading to kinetic bottlenecks. Transitions between metastable states are thus rare events that occur on significantly longer timescales than one can simulate in practice. Numerous enhanced sampling methods have been introduced to alleviate this timescale problem, including methods based on identifying a few crucial order parameters or collective variables and enhancing the sampling of these variables. Metadynamics is one such method that has proven successful in a great variety of fields. Here we review the conceptual and theoretical foundations of metadynamics. As demonstrated, metadynamics is not just a practical tool but can also be considered an important development in the theory of statistical mechanics.

  17. Whole-exome sequencing identifies rare and low-frequency coding variants associated with LDL cholesterol

    NARCIS (Netherlands)

    L.A. Lange (Leslie); Y. Hu (Youna); H. Zhang (He); C. Xue (Chenyi); E.M. Schmidt (Ellen); Z.-Z. Tang (Zheng-Zheng); C. Bizon (Chris); E.M. Lange (Ethan); G.D. Smith; E.H. Turner (Emily); Y. Jun (Yang); H.M. Kang (Hyun Min); G.M. Peloso (Gina); P. Auer (Paul); K.-P. Li (Kuo-Ping); J. Flannick (Jason); J. Zhang (Ji); C. Fuchsberger (Christian); K. Gaulton (Kyle); C.M. Lindgren (Cecilia); A. Locke (Adam); A.K. Manning (Alisa); X. Sim (Xueling); M.A. Rivas (Manuel); O.L. Holmen (Oddgeir); R.F. Gottesman (Rebecca); Y. Lu (Yingchang); D. Ruderfer (Douglas); E.A. Stahl (Eli); Q. Duan (Qing); Y. Li (Yun); P. Durda (Peter); S. Jiao (Shuo); A.J. Isaacs (Aaron); A. Hofman (Albert); J.C. Bis (Joshua); D.D. Correa; M.D. Griswold (Michael); M. Jakobsdottir (Margret); G.D. Smith; P.J. Schreiner (Pamela); M.F. Feitosa (Mary Furlan); Q. Zhang (Qunyuan); J.E. Huffman (Jennifer); S. Crosby; C.L. Wassel (Christina); R. Do (Ron); N. Franceschini (Nora); L.W. Martin (Lisa); J.G. Robinson (Jennifer); T.L. Assimes (Themistocles); D.R. Crosslin (David); E.A. Rosenthal (Elisabeth); M.Y. Tsai (Michael); M. Rieder (Mark); D.N. Farlow (Deborah); A.R. Folsom (Aaron); T. Lumley (Thomas); E.R. Fox (Ervin); C.S. Carlson (Christopher); U. Peters (Ulrike); R.D. Jackson (Rebecca); C.M. van Duijn (Cornelia); A.G. Uitterlinden (André); D. Levy (Daniel); J.I. Rotter (Jerome); H.A. Taylor (Herman); V. Gudnason (Vilmundur); D.S. Siscovick (David); M. Fornage (Myriam); I.B. Borecki (Ingrid); C. Hayward (Caroline); I. Rudan (Igor); Y.E. Chen (Y. Eugene); E.P. Bottinger (Erwin); R.J.F. Loos (Ruth); P. Sætrom (Pål); K. Hveem (Kristian); M. Boehnke (Michael); L. Groop (Leif); M.I. McCarthy (Mark); T. Meitinger (Thomas); C. Ballantyne (Christie); S.B. Gabriel (Stacey); C.J. O'Donnell (Christopher); W.S. Post (Wendy S.); K.E. North (Kari); A. Reiner (Alexander); E.A. Boerwinkle (Eric); B.M. Psaty (Bruce); D. Altshuler (David); S. Kathiresan (Sekar); D.Y. Lin (Dan); G.P. Jarvik (Gail); L.A. Cupples (Adrienne); C. Kooperberg (Charles); J.G. Wilson (James); D.A. Nickerson (Deborah); G.R. Abecasis (Gonçalo); S.S. Rich (Stephen); R.P. Tracy (Russell); C.J. Willer (Cristen)

    2014-01-01

    textabstractElevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency

  18. Exome genotyping arrays to identify rare and low frequency variants associated with epithelial ovarian cancer risk

    DEFF Research Database (Denmark)

    Permuth, Jennifer B; Pirie, Ailith; Ann Chen, Y

    2016-01-01

    Rare and low frequency variants are not well covered in most germline genotyping arrays and are understudied in relation to epithelial ovarian cancer (EOC) risk. To address this gap, we used genotyping arrays targeting rarer protein-coding variation in 8,165 EOC cases and 11,619 controls from...... that is in LD (r(2 )=( )0.90) with a previously identified 'best hit' (rs7651446) mapping to an intron of TIPARP. Suggestive associations (5.0 × 10 (-)  (5 )>( )P≥5.0 ×10 (-)  (7)) were detected for rare and low-frequency variants at 16 novel loci. Four rare missense variants were identified (ACTBL2 rs73757391.......67 × 10 (-)  (4); PSKAT-o = 1.07 × 10 (-)  (5)), reaffirming variant-level analysis. In summary, this large study identified several rare and low-frequency variants and genes that may contribute to EOC susceptibility, albeit with possible small effects. Future studies that integrate epidemiology...

  19. Whole-Exome Sequencing Identifies Rare and Low-Frequency Coding Variants Associated with LDL Cholesterol

    Science.gov (United States)

    Lange, Leslie A.; Hu, Youna; Zhang, He; Xue, Chenyi; Schmidt, Ellen M.; Tang, Zheng-Zheng; Bizon, Chris; Lange, Ethan M.; Smith, Joshua D.; Turner, Emily H.; Jun, Goo; Kang, Hyun Min; Peloso, Gina; Auer, Paul; Li, Kuo-ping; Flannick, Jason; Zhang, Ji; Fuchsberger, Christian; Gaulton, Kyle; Lindgren, Cecilia; Locke, Adam; Manning, Alisa; Sim, Xueling; Rivas, Manuel A.; Holmen, Oddgeir L.; Gottesman, Omri; Lu, Yingchang; Ruderfer, Douglas; Stahl, Eli A.; Duan, Qing; Li, Yun; Durda, Peter; Jiao, Shuo; Isaacs, Aaron; Hofman, Albert; Bis, Joshua C.; Correa, Adolfo; Griswold, Michael E.; Jakobsdottir, Johanna; Smith, Albert V.; Schreiner, Pamela J.; Feitosa, Mary F.; Zhang, Qunyuan; Huffman, Jennifer E.; Crosby, Jacy; Wassel, Christina L.; Do, Ron; Franceschini, Nora; Martin, Lisa W.; Robinson, Jennifer G.; Assimes, Themistocles L.; Crosslin, David R.; Rosenthal, Elisabeth A.; Tsai, Michael; Rieder, Mark J.; Farlow, Deborah N.; Folsom, Aaron R.; Lumley, Thomas; Fox, Ervin R.; Carlson, Christopher S.; Peters, Ulrike; Jackson, Rebecca D.; van Duijn, Cornelia M.; Uitterlinden, André G.; Levy, Daniel; Rotter, Jerome I.; Taylor, Herman A.; Gudnason, Vilmundur; Siscovick, David S.; Fornage, Myriam; Borecki, Ingrid B.; Hayward, Caroline; Rudan, Igor; Chen, Y. Eugene; Bottinger, Erwin P.; Loos, Ruth J.F.; Sætrom, Pål; Hveem, Kristian; Boehnke, Michael; Groop, Leif; McCarthy, Mark; Meitinger, Thomas; Ballantyne, Christie M.; Gabriel, Stacey B.; O’Donnell, Christopher J.; Post, Wendy S.; North, Kari E.; Reiner, Alexander P.; Boerwinkle, Eric; Psaty, Bruce M.; Altshuler, David; Kathiresan, Sekar; Lin, Dan-Yu; Jarvik, Gail P.; Cupples, L. Adrienne; Kooperberg, Charles; Wilson, James G.; Nickerson, Deborah A.; Abecasis, Goncalo R.; Rich, Stephen S.; Tracy, Russell P.; Willer, Cristen J.; Gabriel, Stacey B.; Altshuler, David M.; Abecasis, Gonçalo R.; Allayee, Hooman; Cresci, Sharon; Daly, Mark J.; de Bakker, Paul I.W.; DePristo, Mark A.; Do, Ron; Donnelly, Peter; Farlow, Deborah N.; Fennell, Tim; Garimella, Kiran; Hazen, Stanley L.; Hu, Youna; Jordan, Daniel M.; Jun, Goo; Kathiresan, Sekar; Kang, Hyun Min; Kiezun, Adam; Lettre, Guillaume; Li, Bingshan; Li, Mingyao; Newton-Cheh, Christopher H.; Padmanabhan, Sandosh; Peloso, Gina; Pulit, Sara; Rader, Daniel J.; Reich, David; Reilly, Muredach P.; Rivas, Manuel A.; Schwartz, Steve; Scott, Laura; Siscovick, David S.; Spertus, John A.; Stitziel, Nathaniel O.; Stoletzki, Nina; Sunyaev, Shamil R.; Voight, Benjamin F.; Willer, Cristen J.; Rich, Stephen S.; Akylbekova, Ermeg; Atwood, Larry D.; Ballantyne, Christie M.; Barbalic, Maja; Barr, R. Graham; Benjamin, Emelia J.; Bis, Joshua; Boerwinkle, Eric; Bowden, Donald W.; Brody, Jennifer; Budoff, Matthew; Burke, Greg; Buxbaum, Sarah; Carr, Jeff; Chen, Donna T.; Chen, Ida Y.; Chen, Wei-Min; Concannon, Pat; Crosby, Jacy; Cupples, L. Adrienne; D’Agostino, Ralph; DeStefano, Anita L.; Dreisbach, Albert; Dupuis, Josée; Durda, J. Peter; Ellis, Jaclyn; Folsom, Aaron R.; Fornage, Myriam; Fox, Caroline S.; Fox, Ervin; Funari, Vincent; Ganesh, Santhi K.; Gardin, Julius; Goff, David; Gordon, Ora; Grody, Wayne; Gross, Myron; Guo, Xiuqing; Hall, Ira M.; Heard-Costa, Nancy L.; Heckbert, Susan R.; Heintz, Nicholas; Herrington, David M.; Hickson, DeMarc; Huang, Jie; Hwang, Shih-Jen; Jacobs, David R.; Jenny, Nancy S.; Johnson, Andrew D.; Johnson, Craig W.; Kawut, Steven; Kronmal, Richard; Kurz, Raluca; Lange, Ethan M.; Lange, Leslie A.; Larson, Martin G.; Lawson, Mark; Lewis, Cora E.; Levy, Daniel; Li, Dalin; Lin, Honghuang; Liu, Chunyu; Liu, Jiankang; Liu, Kiang; Liu, Xiaoming; Liu, Yongmei; Longstreth, William T.; Loria, Cay; Lumley, Thomas; Lunetta, Kathryn; Mackey, Aaron J.; Mackey, Rachel; Manichaikul, Ani; Maxwell, Taylor; McKnight, Barbara; Meigs, James B.; Morrison, Alanna C.; Musani, Solomon K.; Mychaleckyj, Josyf C.; Nettleton, Jennifer A.; North, Kari; O’Donnell, Christopher J.; O’Leary, Daniel; Ong, Frank; Palmas, Walter; Pankow, James S.; Pankratz, Nathan D.; Paul, Shom; Perez, Marco; Person, Sharina D.; Polak, Joseph; Post, Wendy S.; Psaty, Bruce M.; Quinlan, Aaron R.; Raffel, Leslie J.; Ramachandran, Vasan S.; Reiner, Alexander P.; Rice, Kenneth; Rotter, Jerome I.; Sanders, Jill P.; Schreiner, Pamela; Seshadri, Sudha; Shea, Steve; Sidney, Stephen; Silverstein, Kevin; Smith, Nicholas L.; Sotoodehnia, Nona; Srinivasan, Asoke; Taylor, Herman A.; Taylor, Kent; Thomas, Fridtjof; Tracy, Russell P.; Tsai, Michael Y.; Volcik, Kelly A.; Wassel, Chrstina L.; Watson, Karol; Wei, Gina; White, Wendy; Wiggins, Kerri L.; Wilk, Jemma B.; Williams, O. Dale; Wilson, Gregory; Wilson, James G.; Wolf, Phillip; Zakai, Neil A.; Hardy, John; Meschia, James F.; Nalls, Michael; Singleton, Andrew; Worrall, Brad; Bamshad, Michael J.; Barnes, Kathleen C.; Abdulhamid, Ibrahim; Accurso, Frank; Anbar, Ran; Beaty, Terri; Bigham, Abigail; Black, Phillip; Bleecker, Eugene; Buckingham, Kati; Cairns, Anne Marie; Caplan, Daniel; Chatfield, Barbara; Chidekel, Aaron; Cho, Michael; Christiani, David C.; Crapo, James D.; Crouch, Julia; Daley, Denise; Dang, Anthony; Dang, Hong; De Paula, Alicia; DeCelie-Germana, Joan; Drumm, Allen DozorMitch; Dyson, Maynard; Emerson, Julia; Emond, Mary J.; Ferkol, Thomas; Fink, Robert; Foster, Cassandra; Froh, Deborah; Gao, Li; Gershan, William; Gibson, Ronald L.; Godwin, Elizabeth; Gondor, Magdalen; Gutierrez, Hector; Hansel, Nadia N.; Hassoun, Paul M.; Hiatt, Peter; Hokanson, John E.; Howenstine, Michelle; Hummer, Laura K.; Kanga, Jamshed; Kim, Yoonhee; Knowles, Michael R.; Konstan, Michael; Lahiri, Thomas; Laird, Nan; Lange, Christoph; Lin, Lin; Lin, Xihong; Louie, Tin L.; Lynch, David; Make, Barry; Martin, Thomas R.; Mathai, Steve C.; Mathias, Rasika A.; McNamara, John; McNamara, Sharon; Meyers, Deborah; Millard, Susan; Mogayzel, Peter; Moss, Richard; Murray, Tanda; Nielson, Dennis; Noyes, Blakeslee; O’Neal, Wanda; Orenstein, David; O’Sullivan, Brian; Pace, Rhonda; Pare, Peter; Parker, H. Worth; Passero, Mary Ann; Perkett, Elizabeth; Prestridge, Adrienne; Rafaels, Nicholas M.; Ramsey, Bonnie; Regan, Elizabeth; Ren, Clement; Retsch-Bogart, George; Rock, Michael; Rosen, Antony; Rosenfeld, Margaret; Ruczinski, Ingo; Sanford, Andrew; Schaeffer, David; Sell, Cindy; Sheehan, Daniel; Silverman, Edwin K.; Sin, Don; Spencer, Terry; Stonebraker, Jackie; Tabor, Holly K.; Varlotta, Laurie; Vergara, Candelaria I.; Weiss, Robert; Wigley, Fred; Wise, Robert A.; Wright, Fred A.; Wurfel, Mark M.; Zanni, Robert; Zou, Fei; Nickerson, Deborah A.; Rieder, Mark J.; Green, Phil; Shendure, Jay; Akey, Joshua M.; Bustamante, Carlos D.; Crosslin, David R.; Eichler, Evan E.; Fox, P. Keolu; Fu, Wenqing; Gordon, Adam; Gravel, Simon; Jarvik, Gail P.; Johnsen, Jill M.; Kan, Mengyuan; Kenny, Eimear E.; Kidd, Jeffrey M.; Lara-Garduno, Fremiet; Leal, Suzanne M.; Liu, Dajiang J.; McGee, Sean; O’Connor, Timothy D.; Paeper, Bryan; Robertson, Peggy D.; Smith, Joshua D.; Staples, Jeffrey C.; Tennessen, Jacob A.; Turner, Emily H.; Wang, Gao; Yi, Qian; Jackson, Rebecca; Peters, Ulrike; Carlson, Christopher S.; Anderson, Garnet; Anton-Culver, Hoda; Assimes, Themistocles L.; Auer, Paul L.; Beresford, Shirley; Bizon, Chris; Black, Henry; Brunner, Robert; Brzyski, Robert; Burwen, Dale; Caan, Bette; Carty, Cara L.; Chlebowski, Rowan; Cummings, Steven; Curb, J. David; Eaton, Charles B.; Ford, Leslie; Franceschini, Nora; Fullerton, Stephanie M.; Gass, Margery; Geller, Nancy; Heiss, Gerardo; Howard, Barbara V.; Hsu, Li; Hutter, Carolyn M.; Ioannidis, John; Jiao, Shuo; Johnson, Karen C.; Kooperberg, Charles; Kuller, Lewis; LaCroix, Andrea; Lakshminarayan, Kamakshi; Lane, Dorothy; Lasser, Norman; LeBlanc, Erin; Li, Kuo-Ping; Limacher, Marian; Lin, Dan-Yu; Logsdon, Benjamin A.; Ludlam, Shari; Manson, JoAnn E.; Margolis, Karen; Martin, Lisa; McGowan, Joan; Monda, Keri L.; Kotchen, Jane Morley; Nathan, Lauren; Ockene, Judith; O’Sullivan, Mary Jo; Phillips, Lawrence S.; Prentice, Ross L.; Robbins, John; Robinson, Jennifer G.; Rossouw, Jacques E.; Sangi-Haghpeykar, Haleh; Sarto, Gloria E.; Shumaker, Sally; Simon, Michael S.; Stefanick, Marcia L.; Stein, Evan; Tang, Hua; Taylor, Kira C.; Thomson, Cynthia A.; Thornton, Timothy A.; Van Horn, Linda; Vitolins, Mara; Wactawski-Wende, Jean; Wallace, Robert; Wassertheil-Smoller, Sylvia; Zeng, Donglin; Applebaum-Bowden, Deborah; Feolo, Michael; Gan, Weiniu; Paltoo, Dina N.; Sholinsky, Phyliss; Sturcke, Anne

    2014-01-01

    Elevated low-density lipoprotein cholesterol (LDL-C) is a treatable, heritable risk factor for cardiovascular disease. Genome-wide association studies (GWASs) have identified 157 variants associated with lipid levels but are not well suited to assess the impact of rare and low-frequency variants. To determine whether rare or low-frequency coding variants are associated with LDL-C, we exome sequenced 2,005 individuals, including 554 individuals selected for extreme LDL-C (>98th or <2nd percentile). Follow-up analyses included sequencing of 1,302 additional individuals and genotype-based analysis of 52,221 individuals. We observed significant evidence of association between LDL-C and the burden of rare or low-frequency variants in PNPLA5, encoding a phospholipase-domain-containing protein, and both known and previously unidentified variants in PCSK9, LDLR and APOB, three known lipid-related genes. The effect sizes for the burden of rare variants for each associated gene were substantially higher than those observed for individual SNPs identified from GWASs. We replicated the PNPLA5 signal in an independent large-scale sequencing study of 2,084 individuals. In conclusion, this large whole-exome-sequencing study for LDL-C identified a gene not known to be implicated in LDL-C and provides unique insight into the design and analysis of similar experiments. PMID:24507775

  20. Peliosis hepatis and systemic lupus erythematosus: A rare condition identified by magnetic resonance imaging

    Directory of Open Access Journals (Sweden)

    Rafael Alves Cordeiro

    Full Text Available Summary Peliosis hepatis is a rare benign disorder characterized by the presence of multiple cavities filled with blood with no preferential localization in the liver parenchyma. It may be related to several etiologic conditions, especially infections and toxicity of immunosuppressive drugs. To our knowledge, there are only three articles reporting the association between peliosis hepatis and systemic lupus erythematosus. In this report, we describe a case of this rare condition, highlighting the importance of magnetic resonance imaging. A short review of this subject is also presented.

  1. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  2. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  3. Exome genotyping arrays to identify rare and low frequency variants associated with epithelial ovarian cancer risk

    Science.gov (United States)

    Permuth, Jennifer B.; Pirie, Ailith; Ann Chen, Y.; Lin, Hui-Yi; Reid, Brett M.; Chen, Zhihua; Monteiro, Alvaro; Dennis, Joe; Mendoza-Fandino, Gustavo; Anton-Culver, Hoda; Bandera, Elisa V.; Bisogna, Maria; Brinton, Louise; Brooks-Wilson, Angela; Carney, Michael E.; Chenevix-Trench, Georgia; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; D’Aloisio, Aimee A.; Anne Doherty, Jennifer; Earp, Madalene; Edwards, Robert P.; Fridley, Brooke L.; Gayther, Simon A.; Gentry-Maharaj, Aleksandra; Goodman, Marc T.; Gronwald, Jacek; Hogdall, Estrid; Iversen, Edwin S.; Jakubowska, Anna; Jensen, Allan; Karlan, Beth Y.; Kelemen, Linda E.; Kjaer, Suzanne K.; Kraft, Peter; Le, Nhu D.; Levine, Douglas A.; Lissowska, Jolanta; Lubinski, Jan; Matsuo, Keitaro; Menon, Usha; Modugno, Rosemary; Moysich, Kirsten B.; Nakanishi, Toru; Ness, Roberta B.; Olson, Sara; Orlow, Irene; Pearce, Celeste L.; Pejovic, Tanja; Poole, Elizabeth M.; Ramus, Susan J.; Anne Rossing, Mary; Sandler, Dale P.; Shu, Xiao-Ou; Song, Honglin; Taylor, Jack A.; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Tworoger, Shelley S.; Webb, Penelope M.; Wentzensen, Nicolas; Wilkens, Lynne R.; Winham, Stacey; Woo, Yin-Ling; Wu, Anna H.; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Phelan, Catherine M.; Schildkraut, Joellen M.; Berchuck, Andrew; Goode, Ellen L.; Pharoah, Paul D. P.; Sellers, Thomas A.

    2016-01-01

    Rare and low frequency variants are not well covered in most germline genotyping arrays and are understudied in relation to epithelial ovarian cancer (EOC) risk. To address this gap, we used genotyping arrays targeting rarer protein-coding variation in 8,165 EOC cases and 11,619 controls from the international Ovarian Cancer Association Consortium (OCAC). Pooled association analyses were conducted at the variant and gene level for 98,543 variants directly genotyped through two exome genotyping projects. Only common variants that represent or are in strong linkage disequilibrium (LD) with previously-identified signals at established loci reached traditional thresholds for exome-wide significance (P  P≥5.0 ×10 − 7) were detected for rare and low-frequency variants at 16 novel loci. Four rare missense variants were identified (ACTBL2 rs73757391 (5q11.2), BTD rs200337373 (3p25.1), KRT13 rs150321809 (17q21.2) and MC2R rs104894658 (18p11.21)), but only MC2R rs104894668 had a large effect size (OR = 9.66). Genes most strongly associated with EOC risk included ACTBL2 (PAML = 3.23 × 10 − 5; PSKAT-o = 9.23 × 10 − 4) and KRT13 (PAML = 1.67 × 10 − 4; PSKAT-o = 1.07 × 10 − 5), reaffirming variant-level analysis. In summary, this large study identified several rare and low-frequency variants and genes that may contribute to EOC susceptibility, albeit with possible small effects. Future studies that integrate epidemiology, sequencing, and functional assays are needed to further unravel the unexplained heritability and biology of this disease. PMID:27378695

  4. The risk of re-identification versus the need to identify individuals in rare disease research.

    Science.gov (United States)

    Hansson, Mats G; Lochmüller, Hanns; Riess, Olaf; Schaefer, Franz; Orth, Michael; Rubinstein, Yaffa; Molster, Caron; Dawkins, Hugh; Taruscio, Domenica; Posada, Manuel; Woods, Simon

    2016-11-01

    There is a growing concern in the ethics literature and among policy makers that de-identification or coding of personal data and biospecimens is not sufficient for protecting research subjects from privacy invasions and possible breaches of confidentiality due to the possibility of unauthorized re-identification. At the same time, there is a need in medical science to be able to identify individual patients. In particular for rare disease research there is a special and well-documented need for research collaboration so that data and biosamples from multiple independent studies can be shared across borders. In this article, we identify the needs and arguments related to de-identification and re-identification of patients and research subjects and suggest how the different needs may be balanced within a framework of using unique encrypted identifiers.

  5. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  6. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  7. Use of rare earth oxides as tracers to identify sediment source areas for agricultural hillslopes

    Directory of Open Access Journals (Sweden)

    C. Deasy

    2010-11-01

    Full Text Available Understanding sediment sources is essential to enable more effective targeting of in-field mitigation approaches to reduce diffuse pollution from agricultural land. In this paper we report on the application of rare earth element oxides to arable soils at hillslope scale in order to determine sediment source areas and their relative importance, using a non-intrusive method of surface spraying. Runoff, sediments and rare earth elements lost from four arable hillslope lengths at a site in the UK with clay soils were monitored from three rainfall events after tracer application. Measured erosion rates were low, reflecting the typical event conditions occurring at the site, and less than 1% of the applied REO tracers were recovered, which is consistent with the results of comparable studies. Tracer recovery at the base of the hillslope was able to indicate the relative importance of different hillslope sediment source areas, which were found to be consistent between events. The principal source of eroded sediments was the upslope area, implying that the wheel tracks were principally conduits for sediment transport, and not highly active sites of erosion. Mitigation treatments for sediment losses from arable hillslopes should therefore focus on methodologies for trapping mobile sediments within wheel track areas through increasing surface roughness or reducing the connectivity of sediment transport processes.

  8. A model for genetic and epigenetic regulatory networks identifies rare pathways for transcription factor induced pluripotency

    Science.gov (United States)

    Artyomov, Maxim; Meissner, Alex; Chakraborty, Arup

    2010-03-01

    Most cells in an organism have the same DNA. Yet, different cell types express different proteins and carry out different functions. This is because of epigenetic differences; i.e., DNA in different cell types is packaged distinctly, making it hard to express certain genes while facilitating the expression of others. During development, upon receipt of appropriate cues, pluripotent embryonic stem cells differentiate into diverse cell types that make up the organism (e.g., a human). There has long been an effort to make this process go backward -- i.e., reprogram a differentiated cell (e.g., a skin cell) to pluripotent status. Recently, this has been achieved by transfecting certain transcription factors into differentiated cells. This method does not use embryonic material and promises the development of patient-specific regenerative medicine, but it is inefficient. The mechanisms that make reprogramming rare, or even possible, are poorly understood. We have developed the first computational model of transcription factor-induced reprogramming. Results obtained from the model are consistent with diverse observations, and identify the rare pathways that allow reprogramming to occur. If validated, our model could be further developed to design optimal strategies for reprogramming and shed light on basic questions in biology.

  9. Thoracic Outlet Syndrome Caused by Hydatid Cyst of the First Rib-Rare But Important

    OpenAIRE

    Levy Faber, Dan; Best, Lael-Anson; Militianu, Daniela; Ben Nun, Alon

    2010-01-01

    Hydatid cysts are usually located in the liver and lungs. Skeletal echinococcosis is relatively rare and that of the rib is exceptional. Less than 50 cases of costal echinococcosis have been reported in the literature so far. To our knowledge, only one case report of thoracic outlet syndrome due to echinococcal cyst in the first rib was described in 1995. Accurate pre-operative diagnosis is important but may be challenging in some cases. Reported here is a case of echinococcosis of the first ...

  10. The Patient Educator Presentation in Dental Education: Reinforcing the Importance of Learning About Rare Conditions.

    Science.gov (United States)

    Edwards, Paul C; Graham, Jasmine; Oling, Rebecca; Frantz, Kate E

    2016-05-01

    The aim of this study was to determine whether a patient educator presentation (PEP) on pemphigus vulgaris would increase second-year dental students' awareness of the importance of learning about rare conditions and improve their retention of rare disease knowledge. The study involved students' subjective assessments of a PEP experience at two U.S. dental schools. In this mixed methods study, cross-sectional data were obtained by surveys and in-depth interviews. Questions focused on students' assessment of the messages acquired from the PEP and its likely impact on their future clinical care. At University 1, students completed paper surveys with open-ended questions and participated in a focus group. At University 2, students completed an online survey consisting of rating scale and open-ended questions. Responses to open-ended questions were categorized into themes. At University 1, 79 students (out of a possible 102; response rate 77.5%) completed the survey, and an additional ten students participated in a focus group. At University 2, 30 students (out of a possible 104; response rate 28.8%) completed the survey. At Universities 1 and 2, 88% and 100%, respectively, of respondents stated the PEP would influence their future clinical decision making. The vast majority of respondents (94% and 100% at University 1 and University 2, respectively) were of the opinion that the personal testimonial from a patient would help them recall information about pemphigus vulgaris in five years' time. Respondents from both universities commented that the PEP emphasized the importance of not dismissing a patient's concerns. These results suggest that a presentation by a patient with a rare condition can be an effective educational tool for preclinical dental students.

  11. Physicians and Physician Trainees Rarely Identify or Address Overweight/Obesity in Hospitalized Children.

    Science.gov (United States)

    King, Marta A; Nkoy, Flory L; Maloney, Christopher G; Mihalopoulos, Nicole L

    2015-10-01

    To determine how frequently physicians identify and address overweight/obesity in hospitalized children and to compare physician documentation across training level (medical student, intern, resident, attending). We conducted a retrospective chart review. Using an administrative database, Centers for Disease Control and Prevention body mass index calculator, and random sampling technique, we identified a study population of 300 children aged 2-18 years with overweight/obesity hospitalized on the general medical service of a tertiary care pediatric hospital. We reviewed admission, progress, and discharge notes to determine how frequently physicians and physician trainees identified (documented in history, physical exam, or assessment) and addressed (documented in hospital or discharge plan) overweight/obesity. Physicians and physician trainees identified overweight/obesity in 8.3% (n = 25) and addressed it in 4% (n = 12) of 300 hospitalized children with overweight/obesity. Interns were most likely to document overweight/obesity in history (8.3% of the 266 patients they followed). Attendings were most likely to document overweight/obesity in physical examination (8.3%), assessment (4%), and plan (4%) of the 300 patients they followed. Medical students were least likely to document overweight/obesity including it in the assessment (0.4%) and plan (0.4%) of the 244 hospitalized children with overweight/obesity they followed. Physicians and physician trainees rarely identify or address overweight/obesity in hospitalized children. This represents a missed opportunity for both patient care and physician trainee education. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. The UK10K project identifies rare variants in health and disease

    DEFF Research Database (Denmark)

    Walter, Klaudia; Min, Josine L.; Huang, Jie

    2015-01-01

    -marker and rare variant aggregation tests. We describe population structure and functional annotation of rare and low-frequency variants, use the data to estimate the benefits of sequencing for association studies, and summarize lessons from disease-specific collections. Finally, we make available an extensive...

  13. A rare duplication on chromosome 16p11.2 is identified in patients with psychosis in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Xiaojing Zheng

    Full Text Available Epidemiological and genetic studies suggest that schizophrenia and autism may share genetic links. Besides common single nucleotide polymorphisms, recent data suggest that some rare copy number variants (CNVs are risk factors for both disorders. Because we have previously found that schizophrenia and psychosis in Alzheimer's disease (AD+P share some genetic risk, we investigated whether CNVs reported in schizophrenia and autism are also linked to AD+P. We searched for CNVs associated with AD+P in 7 recurrent CNV regions that have been previously identified across autism and schizophrenia, using the Illumina HumanOmni1-Quad BeadChip. A chromosome 16p11.2 duplication CNV (chr16: 29,554,843-30,105,652 was identified in 2 of 440 AD+P subjects, but not in 136 AD subjects without psychosis, or in 593 AD subjects with intermediate psychosis status, or in 855 non-AD individuals. The frequency of this duplication CNV in AD+P (0.46% was similar to that reported previously in schizophrenia (0.46%. This duplication CNV was further validated using the NanoString nCounter CNV Custom CodeSets. The 16p11.2 duplication has been associated with developmental delay, intellectual disability, behavioral problems, autism, schizophrenia (SCZ, and bipolar disorder. These two AD+P patients had no personal of, nor any identified family history of, SCZ, bipolar disorder and autism. To the best of our knowledge, our case report is the first suggestion that 16p11.2 duplication is also linked to AD+P. Although rare, this CNV may have an important role in the development of psychosis.

  14. Alkaptonuria: An example of a "fundamental disease"--A rare disease with important lessons for more common disorders.

    Science.gov (United States)

    Gallagher, James A; Dillon, Jane P; Sireau, Nicolas; Timmis, Oliver; Ranganath, Lakshminarayan R

    2016-04-01

    "Fundamental diseases" is a term introduced by the charity Findacure to describe rare genetic disorders that are gateways to understanding common conditions and human physiology. The concept that rare diseases have important lessons for biomedical science has been recognised by some of the great figures in the history of medical research, including Harvey, Bateson and Garrod. Here we describe some of the recently discovered lessons from the study of the iconic genetic disease alkaptonuria (AKU), which have shed new light on understanding the pathogenesis of osteoarthritis. In AKU, ochronotic pigment is deposited in cartilage when collagen fibrils become susceptible to attack by homogentisic acid (HGA). When HGA binds to collagen, cartilage matrix becomes stiffened, resulting in the aberrant transmission of loading to underlying subchondral bone. Aberrant loading leads to the formation of pathophysiological structures including trabecular excrescences and high density mineralised protrusions (HDMPs). These structures initially identified in AKU have subsequently been found in more common osteoarthritis and appear to play a role in joint destruction in both diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. A Hybrid Monte Carlo importance sampling of rare events in Turbulence and in Turbulent Models

    Science.gov (United States)

    Margazoglou, Georgios; Biferale, Luca; Grauer, Rainer; Jansen, Karl; Mesterhazy, David; Rosenow, Tillmann; Tripiccione, Raffaele

    2017-11-01

    Extreme and rare events is a challenging topic in the field of turbulence. Trying to investigate those instances through the use of traditional numerical tools turns to be a notorious task, as they fail to systematically sample the fluctuations around them. On the other hand, we propose that an importance sampling Monte Carlo method can selectively highlight extreme events in remote areas of the phase space and induce their occurrence. We present a brand new computational approach, based on the path integral formulation of stochastic dynamics, and employ an accelerated Hybrid Monte Carlo (HMC) algorithm for this purpose. Through the paradigm of stochastic one-dimensional Burgers' equation, subjected to a random noise that is white-in-time and power-law correlated in Fourier space, we will prove our concept and benchmark our results with standard CFD methods. Furthermore, we will present our first results of constrained sampling around saddle-point instanton configurations (optimal fluctuations). The research leading to these results has received funding from the EU Horizon 2020 research and innovation programme under Grant Agreement No. 642069, and from the EU Seventh Framework Programme (FP7/2007-2013) under ERC Grant Agreement No. 339032.

  16. Multiplexed resequencing analysis to identify rare variants in pooled DNA with barcode indexing using next-generation sequencer.

    Science.gov (United States)

    Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji

    2010-07-01

    We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.

  17. Functional characterization of rare missense mutations in MLH1 and MSH2 identified in Danish colorectal cancer patients

    DEFF Research Database (Denmark)

    Christensen, Lise Lotte; Kariola, Reetta; Korhonen, Mari K

    2009-01-01

    Recently, we have performed a population based study to analyse the frequency of colorectal cancer related MLH1 and MSH2 missense mutations in the Danish population. Half of the analyzed mutations were rare and most likely only present in the families where they were identified originally. Some...... of the missense mutations were located in conserved regions in the MLH1 and MSH2 proteins indicating a relation to disease development. In the present study, we functionally characterized 10 rare missense mutations in MLH1 and MSH2 identified in 13 Danish CRC families. To elucidate the pathogenicity...

  18. The UK10K project identifies rare variants in health and disease

    NARCIS (Netherlands)

    K. Walter (Klaudia); J.L. Min (Josine L.); J. Huang (Jie); L. Crooks (Lucy); Y. Memari (Yasin); S. McCarthy (Shane); J.R.B. Perry (John); C. Xu (Changjiang); M. Futema (Marta); D. Lawson (Daniel); V. Iotchkova (Valentina); S. Schiffels (Stephan); A.E. Hendricks (Audrey E.); P. Danecek (Petr); R. Li (Rui); J. Floyd (James); L.V. Wain (Louise); I.E. Barroso (Inês); S.E. Humphries (Steve); M.E. Hurles (Matthew); E. Zeggini (Eleftheria); J.C. Barrett (Jeffrey); V. Plagnol (Vincent); J.B. Richards (Brent); C.M.T. Greenwood (Celia); N.J. Timpson (Nicholas); R. Durbin (Richard); S. Bala (Senduran); P. Clapham (Peter); G. Coates (Guy); T. Cox (Tony); A. Daly (Allan); Y. Du (Yuanping); T. Edkins (Ted); P. Ellis (Peter); P. Flicek (Paul); X. Guo (Xiaosen); X. Guo (Xueqin); L. Huang (Liren); D.K. Jackson (David K.); C. Joyce (Chris); T. Keane (Thomas); A. Kolb-Kokocinski (Anja); C. Langford (Cordelia); Y. Li (Yingrui); J. Liang (Jieqin); H. Lin (Hong); R. Liu (Ryan); J. Maslen (John); D. Muddyman (Dawn); M.A. Quail (Michael A.); J. Stalker (Jim); J. Sun (Jianping); J. Tian (Jing); G. Wang (Guangbiao); J. Wang (Jun); Y. Wang (Yu); K. Wong (Kim); P. Zhang (Pingbo); E. Birney (Ewan); C. Boustred (Chris); L. Chen (Lu); G. Clement (Gail); M. Cocca (Massimiliano); G.D. Smith; I.N.M. Day (Ian N.M.); A.G. Day-Williams (Aaron); T. Down (Thomas); D.M. Dunham (David); D.M. Evans (David M.); T.R. Gaunt (Tom); M. Geihs (Matthias); D. Hart (Deborah); B. Howie (Bryan); T. Hubbard (Tim); P.G. Hysi (Pirro); Y. Jamshidi (Yalda); K.J. Karczewski (Konrad); J.P. Kemp (John); G. Lachance (Genevieve); M. Lek (Monkol); M.C. Lopes (Margarida); D.G. MacArthur (Daniel G.); J. Marchini (Jonathan); M. Mangino (Massimo); I. Mathieson (Iain); S. Metrustry (Sarah); A. Moayyeri (Alireza); K. Northstone (Kate); K. Panoutsopoulou (Kalliope); L. Paternoster (Lavinia); L. Quaye (Lydia); S. Ring (Susan); G.R.S. Ritchie (Graham R.S.); H.A. Shihab (Hashem A.); S.-Y. Shin (So-Youn); K.S. Small (Kerrin); M.S. Artigas; N. Soranzo (Nicole); L. Southam (Lorraine); T.D. Spector (Timothy); B. St Pourcain (Beate); G. Surdulescu (Gabriela); I. Tachmazidou (Ioanna); M.D. Tobin (Martin); A.M. Valdes; P.M. Visscher (Peter); K. Ward (Kirsten); S.G. Wilson (Scott); J. Yang (Joanna); F. Zhang (Feng); H.-F. Zheng (Hou-Feng); R. Anney (Richard); M. Ayub (Muhammad); D.H.R. Blackwood (Douglas); P.F. Bolton (Patrick F.); G. Breen (Gerome); D.A. Collier (David); N.J. Craddock (Nick); S. Curran (Sarah); D. Curtis (David); L. Gallagher (Louise); D. Geschwind (Daniel); H. Gurling (Hugh); P.A. Holmans (Peter A.); I. Lee (Irene); J. Lönnqvist (Jouko); P. McGuffin (Peter); A.M. McIntosh (Andrew); A.G. McKechanie (Andrew G.); A. McQuillin (Andrew); J. Morris (James); M.C. O'donovan (Michael); M.J. Owen (Michael); A. Palotie (Aarno); J.R. Parr (Jeremy R.); T. Paunio (Tiina); O.P.H. Pietiläinen (Olli); K. Rehnström (Karola); S.I. Sharp (Sally I.); D. Skuse (David); D. St. Clair (David); J. Suvisaari (Jaana); J.T. Walters (James); H.J. Williams (Hywel J.); E. Bochukova (Elena); R. Bounds (Rebecca); A. Dominiczak (Anna); I.S. Farooqi (I. Sadaf); J. Keogh (Julia); G. Marenne (Gaëlle); A.D. Morris (Andrew); S. O'Rahilly (Stephen); D.J. Porteous (David J.); B.H. Smith (Blair); E. Wheeler (Eleanor); S.H. Al Turki (Saeed); C. Anderson (Carl); D. Antony (Dinu); P.L. Beales (Philip); J. Bentham (Jamie); S. Bhattacharya (Shoumo); M. Calissano (Mattia); K. Carss (Keren); K. Chatterjee (Krishna); S. Cirak (Sebahattin); C. Cosgrove (Catherine); D.R. Fitzpatrick (David R.); A.R. Foley (A. Reghan); C.S. Franklin (Christopher S.); D. Grozeva (Detelina); H.M. Mitchison (Hannah M.); F. Muntoni; A. Onoufriadis (Alexandros); V. Parker (Victoria); F. Payne (Felicity); F.L. Raymond (F. Lucy); N. Roberts (Nicola); D.B. Savage (David); P.J. Scambler (Peter); M. Schmidts (Miriam); N. Schoenmakers (Nadia); R.K. Semple (Robert K.); E. Serra (Eva); O. Spasic-Boskovic (Olivera); E. Stevens (Elizabeth); M. Van Kogelenberg (Margriet); P. Vijayarangakannan (Parthiban); K.A. Williamson (Kathleen); C. Wilson (Crispian); T. Whyte (Tamieka); A. Ciampi (Antonio); K. Oualkacha (Karim); M. Bobrow (Martin); H. Griffin (Heather); J. Kaye (Jane); K. Kennedy (Karen); A. Kent (Alastair); C. Smee (Carol); R. Charlton (Ruth); R. Ekong (Rosemary); F. Khawaja (Farrah); L.R. Lopes (Luis R.); N. Migone (Nicola); S.J. Payne (Stewart J.); R.C. Pollitt (Rebecca C.); S. Povey (Sue); C.K. Ridout (Cheryl K.); R.L. Robinson (Rachel L.); R.H. Scott (Richard H.); A. Shaw (Adam); P. Syrris (Petros); R. Taylor (Rohan); A.M. Vandersteen (Anthony M.); A. Amuzu (Antoinette); J.P. Casas (Juan); J.C. Chambers (John); G.V. Dedoussis (George); G. Gambaro (Giovanni); P. Gasparini (Paolo); A. Isaacs (Aaron); J. Johnson (Jon); M.E. Kleber (Marcus); J.S. Kooner (Jaspal S.); C. Langenberg (Claudia); J. Luan; G. Malerba (Giovanni); W. März (Winfried); A. Matchan (Angela); R. Morris (Richard); B.G. Nordestgaard (Børge); M. Benn (Marianne); R.A. Scott (Robert); D. Toniolo (Daniela); M. Traglia (Michela); A. Tybjaerg-Hansen; C.M. van Duijn (Cornelia); E.M. van Leeuwen (Elisa); A. Varbo (Anette); P.H. Whincup (Peter); G. Zaza (Gianluigi); W. Zhang (Weihua)

    2015-01-01

    textabstractThe contribution of rare and low-frequency variants to human traits is largely unexplored. Here we describe insights from sequencing whole genomes (low read depth, 7×) or exomes (high read depth, 80×) of nearly 10,000 individuals from population-based and disease collections. In

  19. Exome sequencing identifies rare LDLR and APOA5 alleles conferring risk for myocardial infarction

    NARCIS (Netherlands)

    Do, Ron; Stitziel, Nathan O.; Won, Hong-Hee; Jørgensen, Anders Berg; Duga, Stefano; Angelica Merlini, Pier; Kiezun, Adam; Farrall, Martin; Goel, Anuj; Zuk, Or; Guella, Illaria; Asselta, Rosanna; Lange, Leslie A.; Peloso, Gina M.; Auer, Paul L.; Girelli, Domenico; Martinelli, Nicola; Farlow, Deborah N.; DePristo, Mark A.; Roberts, Robert; Stewart, Alexander F. R.; Saleheen, Danish; Danesh, John; Epstein, Stephen E.; Sivapalaratnam, Suthesh; Hovingh, G. Kees; Kastelein, John J.; Samani, Nilesh J.; Schunkert, Heribert; Erdmann, Jeanette; Shah, Svati H.; Kraus, William E.; Davies, Robert; Nikpay, Majid; Johansen, Christopher T.; Wang, Jian; Hegele, Robert A.; Hechter, Eliana; Marz, Winfried; Kleber, Marcus E.; Huang, Jie; Johnson, Andrew D.; Li, Mingyao; Burke, Greg L.; Gross, Myron; Liu, Yongmei; Assimes, Themistocles L.; Heiss, Gerardo; Lange, Ethan M.; Folsom, Aaron R.; Taylor, Herman A.; Olivieri, Oliviero; Hamsten, Anders; Clarke, Robert; Reilly, Dermot F.; Yin, Wu; Rivas, Manuel A.; Donnelly, Peter; Rossouw, Jacques E.; Psaty, Bruce M.; Herrington, David M.; Wilson, James G.; Rich, Stephen S.; Bamshad, Michael J.; Tracy, Russell P.; Cupples, L. Adrienne; Rader, Daniel J.; Reilly, Muredach P.; Spertus, John A.; Cresci, Sharon; Hartiala, Jaana; Tang, W. H. Wilson; Hazen, Stanley L.; Allayee, Hooman; Reiner, Alex P.; Carlson, Christopher S.; Kooperberg, Charles; Jackson, Rebecca D.; Boerwinkle, Eric; Lander, Eric S.; Schwartz, Stephen M.; Siscovick, David S.; McPherson, Ruth; Tybjaerg-Hansen, Anne; Abecasis, Goncalo R.; Watkins, Hugh; Nickerson, Deborah A.; Ardissino, Diego; Sunyaev, Shamil R.; O'Donnell, Christopher J.; Altshuler, David; Gabriel, Stacey; Kathiresan, Sekar; Gabriel, Stacey B.; Altshuler, David M.; Abecasis, Gonçalo R.; Daly, Mark J.; de Bakker, Paul I. W.; Fennell, Tim; Garimella, Kiran; Hu, Youna; Jordan, Daniel M.; Jun, Goo; Kang, Hyun Min; Lettre, Guillaume; Li, Bingshan; Newton-Cheh, Christopher H.; Padmanabhan, Sandosh; Peloso, Gina; Pulit, Sara; Reich, David; Schwartz, Steve; Scott, Laura; Stoletzki, Nina; Voight, Benjamin F.; Willer, Cristen J.; Akylbekova, Ermeg; Atwood, Larry D.; Ballantyne, Christie M.; Barbalic, Maja; Barr, R. Graham; Benjamin, Emelia J.; Bis, Joshua; Bowden, Donald W.; Brody, Jennifer; Budoff, Matthew; Burke, Greg; Buxbaum, Sarah; Carr, Jeff; Chen, Donna T.; Chen, Ida Y.; Chen, Wei-Min; Concannon, Pat; Crosby, Jacy; D'Agostino, Ralph; DeStefano, Anita L.; Dreisbach, Albert; Dupuis, Josée; Durda, J. Peter; Ellis, Jaclyn; Fornage, Myriam; Fox, Caroline S.; Fox, Ervin; Funari, Vincent; Ganesh, Santhi K.; Gardin, Julius; Goff, David; Gordon, Ora; Grody, Wayne; Guo, Xiuqing; Hall, Ira M.; Heard-Costa, Nancy L.; Heckbert, Susan R.; Heintz, Nicholas; Hickson, DeMarc; Hwang, Shih-Jen; Jacobs, David R.; Jenny, Nancy S.; Johnson, Craig W.; Kawut, Steven; Kronmal, Richard; Kurz, Raluca; Larson, Martin G.; Lawson, Mark; Lewis, Cora E.; Levy, Daniel; Li, Dalin; Lin, Honghuang; Liu, Chunyu; Liu, Jiankang; Liu, Kiang; Liu, Xiaoming; Longstreth, William T.; Loria, Cay; Lumley, Thomas; Lunetta, Kathryn; Mackey, Aaron J.; Mackey, Rachel; Manichaikul, Ani; Maxwell, Taylor; McKnight, Barbara; Meigs, James B.; Morrison, Alanna C.; Musani, Solomon K.; Mychaleckyj, Josyf C.; Nettleton, Jennifer A.; North, Kari; O'Leary, Daniel; Ong, Frank S.; Palmas, Walter; Pankow, James S.; Pankratz, Nathan D.; Paul, Shom; Perez, Marco; Person, Sharina D.; Polak, Joseph; Post, Wendy S.; Quinlan, Aaron R.; Raffel, Leslie J.; Ramachandran, Vasan S.; Reiner, Alexander P.; Rice, Kenneth; Rotter, Jerome I.; Sanders, Jill P.; Schreiner, Pamela; Seshadri, Sudha; Shea, Steve; Sidney, Stephen; Silverstein, Kevin; Smith, Nicholas L.; Sotoodehnia, Nona; Srinivasan, Asoke; Taylor, Kent; Thomas, Fridtjof; Tsai, Michael Y.; Volcik, Kelly A.; Wassel, Chrstina L.; Watson, Karol; Wei, Gina; White, Wendy; Wiggins, Kerri L.; Wilk, Jemma B.; Williams, O. Dale; Wilson, Gregory; Wolf, Phillip; Zakai, Neil A.; Hardy, John; Meschia, James F.; Nalls, Michael; Singleton, Andrew; Worrall, Brad; Barnes, Kathleen C.; Abdulhamid, Ibrahim; Accurso, Frank; Anbar, Ran; Beaty, Terri; Bigham, Abigail; Black, Phillip; Bleecker, Eugene; Buckingham, Kati; Cairns, Anne Marie; Caplan, Daniel; Chatfield, Barbara; Chidekel, Aaron; Cho, Michael; Christiani, David C.; Crapo, James D.; Crouch, Julia; Daley, Denise; Dang, Anthony; Dang, Hong; de Paula, Alicia; DeCelie-Germana, Joan; Dozor, Allen; Drumm, Mitch; Dyson, Maynard; Emerson, Julia; Emond, Mary J.; Ferkol, Thomas; Fink, Robert; Foster, Cassandra; Froh, Deborah; Gao, Li; Gershan, William; Gibson, Ronald L.; Godwin, Elizabeth; Gondor, Magdalen; Gutierrez, Hector; Hansel, Nadia N.; Hassoun, Paul M.; Hiatt, Peter; Hokanson, John E.; Howenstine, Michelle; Hummer, Laura K.; Jamal, Seema M.; Kanga, Jamshed; Kim, Yoonhee; Knowles, Michael R.; Konstan, Michael; Lahiri, Thomas; Laird, Nan; Lange, Christoph; Lin, Lin; Lin, Xihong; Louie, Tin L.; Lynch, David; Make, Barry; Martin, Thomas R.; Mathai, Steve C.; Mathias, Rasika A.; McNamara, John; McNamara, Sharon; Meyers, Deborah; Millard, Susan; Mogayzel, Peter; Moss, Richard; Murray, Tanda; Nielson, Dennis; Noyes, Blakeslee; O'Neal, Wanda; Orenstein, David; O'Sullivan, Brian; Pace, Rhonda; Pare, Peter; Parker, H. Worth; Passero, Mary Ann; Perkett, Elizabeth; Prestridge, Adrienne; Rafaels, Nicholas M.; Ramsey, Bonnie; Regan, Elizabeth; Ren, Clement; Retsch-Bogart, George; Rock, Michael; Rosen, Antony; Rosenfeld, Margaret; Ruczinski, Ingo; Sanford, Andrew; Schaeffer, David; Sell, Cindy; Sheehan, Daniel; Silverman, Edwin K.; Sin, Don; Spencer, Terry; Stonebraker, Jackie; Tabor, Holly K.; Varlotta, Laurie; Vergara, Candelaria I.; Weiss, Robert; Wigley, Fred; Wise, Robert A.; Wright, Fred A.; Wurfel, Mark M.; Zanni, Robert; Zou, Fei; Rieder, Mark J.; Green, Phil; Shendure, Jay; Akey, Joshua M.; Bustamante, Carlos D.; Crosslin, David R.; Eichler, Evan E.; Fox, P. Keolu; Fu, Wenqing; Gordon, Adam; Gravel, Simon; Jarvik, Gail P.; Johnsen, Jill M.; Kan, Mengyuan; Kenny, Eimear E.; Kidd, Jeffrey M.; Lara-Garduno, Fremiet; Leal, Suzanne M.; Liu, Dajiang J.; McGee, Sean; O'Connor, Timothy D.; Paeper, Bryan; Robertson, Peggy D.; Smith, Joshua D.; Staples, Jeffrey C.; Tennessen, Jacob A.; Turner, Emily H.; Wang, Gao; Yi, Qian; Jackson, Rebecca; Peters, Ulrike; Anderson, Garnet; Anton-Culver, Hoda; Beresford, Shirley; Bizon, Chris; Black, Henry; Brunner, Robert; Brzyski, Robert; Burwen, Dale; Caan, Bette; Carty, Cara L.; Chlebowski, Rowan; Cummings, Steven; Curb, J. David; Eaton, Charles B.; Ford, Leslie; Franceschini, Nora; Fullerton, Stephanie M.; Gass, Margery; Geller, Nancy; Howard, Barbara V.; Hsu, Li; Hutter, Carolyn M.; Ioannidis, John; Jiao, Shuo; Johnson, Karen C.; Kuller, Lewis; LaCroix, Andrea; Lakshminarayan, Kamakshi; Lane, Dorothy; Lasser, Norman; LeBlanc, Erin; Li, Kuo-Ping; Limacher, Marian; Lin, Dan-Yu; Logsdon, Benjamin A.; Hutchinson, Fred; Ludlam, Shari; Manson, JoAnn E.; Margolis, Karen; Martin, Lisa; McGowan, Joan; Monda, Keri L.; Kotchen, Jane Morley; Nathan, Lauren; Ockene, Judith; O'Sullivan, Mary Jo; Phillips, Lawrence S.; Prentice, Ross L.; Robbins, John; Robinson, Jennifer G.; Sangi-Haghpeykar, Haleh; Sarto, Gloria E.; Shumaker, Sally; Simon, Michael S.; Stefanick, Marcia L.; Stein, Evan; Tang, Hua; Taylor, Kira C.; Thomson, Cynthia A.; Thornton, Timothy A.; van Horn, Linda; Vitolins, Mara; Wactawski-Wende, Jean; Wallace, Robert; Wassertheil-Smoller, Sylvia; Zeng, Donglin; Applebaum-Bowden, Deborah; Feolo, Michael; Gan, Weiniu; Paltoo, Dina N.; Sholinsky, Phyliss; Sturcke, Anne

    2015-01-01

    Myocardial infarction (MI), a leading cause of death around the world, displays a complex pattern of inheritance(1,2). When MI occurs early in life, genetic inheritance is a major component to risk(1). Previously, rare mutations in low-density lipoprotein (LDL) genes have been shown to contribute to

  20. Identifying Rare Variation in Cases of Schizophrenia in the Isolated Population of the Faroe Islands using Whole-genome Sequencing

    DEFF Research Database (Denmark)

    Als, Thomas Damm; Lescai, Francesco; Dahl, Hans

    to map risk variants involved in complex traits. We aim at utilizing samples of cases and controls of the isolated population of the Faroe Islands to conduct whole-genome-sequence analysis in order to identify rare genetic variants associated with schizophrenia. We will search for rare genetic variants...... of developing SZ. However, these studies are designed to examining only “the common variant” proportion of the genomic landscape of SZ. Due to increased genetic drift during founding and potential bottlenecks, followed by population expansion, isolated populations may be particularly useful in identifying rare...... disease variants, that may appear at higher frequencies and/or within a more clearly distinct haplotype structure compared to outbred populations. Small isolated populations also typically show reduced phenotypic, genetic and environmental heterogeneity, thus making them advantageous in studies aiming...

  1. Integrative analysis of functional genomic annotations and sequencing data to identify rare causal variants via hierarchical modeling

    Directory of Open Access Journals (Sweden)

    Marinela eCapanu

    2015-05-01

    Full Text Available Identifying the small number of rare causal variants contributing to disease has beena major focus of investigation in recent years, but represents a formidable statisticalchallenge due to the rare frequencies with which these variants are observed. In thiscommentary we draw attention to a formal statistical framework, namely hierarchicalmodeling, to combine functional genomic annotations with sequencing data with theobjective of enhancing our ability to identify rare causal variants. Using simulations weshow that in all configurations studied, the hierarchical modeling approach has superiordiscriminatory ability compared to a recently proposed aggregate measure of deleteriousness,the Combined Annotation-Dependent Depletion (CADD score, supportingour premise that aggregate functional genomic measures can more accurately identifycausal variants when used in conjunction with sequencing data through a hierarchicalmodeling approach

  2. Whole-exome sequencing identifies common and rare variant metabolic QTLs in a Middle Eastern population.

    Science.gov (United States)

    Yousri, Noha A; Fakhro, Khalid A; Robay, Amal; Rodriguez-Flores, Juan L; Mohney, Robert P; Zeriri, Hassina; Odeh, Tala; Kader, Sara Abdul; Aldous, Eman K; Thareja, Gaurav; Kumar, Manish; Al-Shakaki, Alya; Chidiac, Omar M; Mohamoud, Yasmin A; Mezey, Jason G; Malek, Joel A; Crystal, Ronald G; Suhre, Karsten

    2018-01-23

    Metabolomics-genome-wide association studies (mGWAS) have uncovered many metabolic quantitative trait loci (mQTLs) influencing human metabolic individuality, though predominantly in European cohorts. By combining whole-exome sequencing with a high-resolution metabolomics profiling for a highly consanguineous Middle Eastern population, we discover 21 common variant and 12 functional rare variant mQTLs, of which 45% are novel altogether. We fine-map 10 common variant mQTLs to new metabolite ratio associations, and 11 common variant mQTLs to putative protein-altering variants. This is the first work to report common and rare variant mQTLs linked to diseases and/or pharmacological targets in a consanguineous Arab cohort, with wide implications for precision medicine in the Middle East.

  3. Cervical spine fracture in a boxer a rare but important sporting injury ...

    African Journals Online (AJOL)

    Cervical vertebral injuries are rare in boxing. The case of an adult boxer with an isolated vertical fracture of the anterior arch of the atlas is described. The mechanism of injury, clinical presentation, complications and treatment are discussed. Measures to prevent head and neck injury in boxing are discussed.

  4. Pathologic Aerophagia: A Rare but Important Medical Condition in People with Intellectual Disabilities

    Science.gov (United States)

    Wong, Wendy; Sajith, Sreedharan Geetha

    2017-01-01

    Background: Pathologic aerophagia (PA) is characterised by excessive swallowing of air resulting in significant abdominal distension or belching. This is a relatively rare condition in general population but has been reported in up to 8.8% of institutionalised patients with intellectual disability. In severe cases, this can cause volvulus and…

  5. A targeted sequencing panel identifies rare damaging variants in multiple genes in the cranial neural tube defect, anencephaly.

    Science.gov (United States)

    Ishida, M; Cullup, T; Boustred, C; James, C; Docker, J; English, C; Lench, N; Copp, A J; Moore, G E; Greene, N D E; Stanier, P

    2018-04-01

    Neural tube defects (NTDs) affecting the brain (anencephaly) are lethal before or at birth, whereas lower spinal defects (spina bifida) may lead to lifelong neurological handicap. Collectively, NTDs rank among the most common birth defects worldwide. This study focuses on anencephaly, which despite having a similar frequency to spina bifida and being the most common type of NTD observed in mouse models, has had more limited inclusion in genetic studies. A genetic influence is strongly implicated in determining risk of NTDs and a molecular diagnosis is of fundamental importance to families both in terms of understanding the origin of the condition and for managing future pregnancies. Here we used a custom panel of 191 NTD candidate genes to screen 90 patients with cranial NTDs (n = 85 anencephaly and n = 5 craniorachischisis) with a targeted exome sequencing platform. After filtering and comparing to our in-house control exome database (N = 509), we identified 397 rare variants (minor allele frequency, MAF < 1%), 21 of which were previously unreported and predicted damaging. This included 1 frameshift (PDGFRA), 2 stop-gained (MAT1A; NOS2) and 18 missense variations. Together with evidence for oligogenic inheritance, this study provides new information on the possible genetic causation of anencephaly. © 2017 The Authors. Clinical Genetics published by John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Rare earths in uranium compounds and important evidences for nuclear forensic purposes

    International Nuclear Information System (INIS)

    Rosa, Daniele S.; Sarkis, Jorge E.S.

    2011-01-01

    Nuclear forensics mainly focuses on the nuclear or radioactive material and aims to providing indication on the intended use, the history and even the origin of the material. Uranium compounds have isotopic or chemical characteristics that provide unambiguous information concerning their origin and production process. Rare earths elements (REE) are a set of sixteen chemical elements in the periodic table, specifically the fourteen Lanthanides in addition scandium and yttrium. These elements are often found together but in widely variable concentrations in uncommon varieties of igneous rocks. A large amount of uranium is in rare earths deposits, and may be extracted as a by-product. Accordingly, REE in uranium compounds can be used as an evidence of uranium origin. In this study, REE was determined in uranium compounds from different origin. Measurements were carried out using a High resolution inductively coupled plasma mass spectrometer (HR-ICP-MS) Element 2, in low resolution mode (R-300). (author)

  7. Normalized rare earth elements in water, sediments, and wine: identifying sources and environmental redox conditions

    Science.gov (United States)

    Piper, David Z.; Bau, Michael

    2013-01-01

    The concentrations of the rare earth elements (REE) in surface waters and sediments, when normalized on an element-by-element basis to one of several rock standards and plotted versus atomic number, yield curves that reveal their partitioning between different sediment fractions and the sources of those fractions, for example, between terrestrial-derived lithogenous debris and seawater-derived biogenous detritus and hydrogenous metal oxides. The REE of ancient sediments support their partitioning into these same fractions and further contribute to the identification of the redox geochemistry of the sea water in which the sediments accumulated. The normalized curves of the REE that have been examined in several South American wine varietals can be interpreted to reflect the lithology of the bedrock on which the vines may have been grown, suggesting limited fractionation during soil development.

  8. Clozapine-induced interstitial nephritis - a rare but important complication: a case report

    Directory of Open Access Journals (Sweden)

    Hunter Robert

    2009-08-01

    Full Text Available Abstract Introduction Given the limited range of effective drug treatments for patients with schizophrenia, increasing numbers of patients, often termed 'treatment-resistant' are prescribed clozapine. While the induction of neutropenia or agranulocytosis by clozapine is well appreciated, other rare potentially fatal adverse reactions may also occur including acute interstitial nephritis as reported in this case. Case presentation A 57-year-old Caucasian woman with treatment-resistant chronic schizophrenia developed acute renal failure following initiation of treatment with clozapine. The adverse reaction occurred after only four doses of the drug had been administered (titrated from 12.5 to 25 mg per day. After clozapine had been withdrawn, the patient's renal function returned to normal with no other changes to medication. The patient had been exposed to clozapine about 4 years previously when she had developed a similar reaction. Conclusion Renal reactions to clozapine are extremely rare but, if not recognized promptly, may prove fatal. Psychiatrists need to be aware of this possible complication when clozapine is initiated.

  9. Exome-wide rare variant analysis identifies TUBA4A mutations associated with familial ALS

    NARCIS (Netherlands)

    Smith, Bradley N.; Ticozzi, Nicola; Fallini, Claudia; Gkazi, Athina Soragia; Topp, Simon; Kenna, Kevin P.; Scotter, Emma L.; Kost, Jason; Keagle, Pamela; Miller, Jack W.; Calini, Daniela; Vance, Caroline; Danielson, Eric W.; Troakes, Claire; Tiloca, Cinzia; Al-Sarraj, Safa; Lewis, Elizabeth A.; King, Andrew; Colombrita, Claudia; Pensato, Viviana; Castellotti, Barbara; de Belleroche, Jacqueline; Baas, Frank; ten Asbroek, Anneloor L. M. A.; Sapp, Peter C.; McKenna-Yasek, Diane; McLaughlin, Russell L.; Polak, Meraida; Asress, Seneshaw; Esteban-Pérez, Jesús; Muñoz-Blanco, José Luis; Simpson, Michael; van Rheenen, Wouter; Diekstra, Frank P.; Lauria, Giuseppe; Duga, Stefano; Corti, Stefania; Cereda, Cristina; Corrado, Lucia; Sorarù, Gianni; Morrison, Karen E.; Williams, Kelly L.; Nicholson, Garth A.; Blair, Ian P.; Dion, Patrick A.; Leblond, Claire S.; Rouleau, Guy A.; Hardiman, Orla; Veldink, Jan H.; van den Berg, Leonard H.

    2014-01-01

    Exome sequencing is an effective strategy for identifying human disease genes. However, this methodology is difficult in late-onset diseases where limited availability of DNA from informative family members prohibits comprehensive segregation analysis. To overcome this limitation, we performed an

  10. Mixed Adenoneuroendocrine Carcinoma Is a Rare but Important Tumour Found in the Oesophagus

    DEFF Research Database (Denmark)

    Kadhim, Mohammad Murad Kasim; Jespersen, Marie Louise; Pilegaard, Hans Kristian

    2016-01-01

    Mixed adenoneuroendocrine carcinoma (MANEC) is a rare tumour of the gastrointestinal tract that consists of a dual adenocarcinomatous and neuroendocrine differentiation, each component representing at least 30% of the tumour. We report a case of a 68-year-old man who presented with two...... as poorly differentiated neuroendocrine carcinoma of the oesophagus. The patient underwent surgery and lower oesophagus resection was performed. Based on the histopathology and immunohistochemistry of the tumour in the oesophagogastrectomy specimen, a mixed adenoneuroendocrine carcinoma (MANEC......) was diagnosed. The objective of this case report is to advocate for the focus on the MANEC diagnosis as such patients need to be referred to a centre of excellence with expertise in NET tumours, to have the correct diagnostic work-up, treatment, and secondary diagnostic procedures performed at progression...

  11. Gluteal Compartment Syndrome following bariatric surgery: A rare but important complication

    Directory of Open Access Journals (Sweden)

    Bernadette Pereira

    2015-03-01

    Full Text Available Gluteal Compartment Syndrome is a rare condition caused by excessive pressure within the gluteal compartments which leads to a number of potentially serious sequelae including rhabdomyolysis, nerve damage, renal failure and death. As bariatric patients are heavy and during prolonged bariatric procedures lie in one position for extended periods of time, they are especially susceptible to developing this complication. It is therefore essential that bariatric surgeons are aware of this complication and how to minimise the chances of it occurring and how to diagnose it. We describe a case of Gluteal Compartment Syndrome in a patient following a gastric bypass and review the aetiology, pathophysiology, treatment and prevention of this complication.

  12. Osteomalacia with low alkaline phosphatase: a not so rare condition with important consequences.

    Science.gov (United States)

    Belkhouribchia, Jamal; Bravenboer, Bert; Meuwissen, Marije; Velkeniers, Brigitte

    2016-01-28

    Hypophosphatasia is a genetic disorder, characterised by a dysfunctional tissue-non-specific isoenzyme of alkaline phosphatase that impacts bone metabolism and predisposes to osteomalacia or rickets. The clinical presentation is very diverse, depending on the age of onset and the severity of the disease. Several forms of hypophosphatasia are recognised. We present a case of a 50-year-old woman with low impact fractures and loss of teeth at a young age. She also had a low alkaline phosphatase and was diagnosed with adult hypophosphatasia. Although the severe forms of hypophosphatasia are rather rare, the adult form is thought to occur quite frequently. As this condition is not well known by healthcare professionals, the time to diagnosis and initiation of adequate treatment is often postponed. When encountering a patient with low alkaline phosphatase, low bone density or a history of bone fractures, the possibility of hypophosphatasia should be considered. 2016 BMJ Publishing Group Ltd.

  13. Quantifying the Importance of the Rare Biosphere for Microbial Community Response to Organic Pollutants in a Freshwater Ecosystem.

    Science.gov (United States)

    Wang, Yuanqi; Hatt, Janet K; Tsementzi, Despina; Rodriguez-R, Luis M; Ruiz-Pérez, Carlos A; Weigand, Michael R; Kizer, Heidi; Maresca, Gina; Krishnan, Raj; Poretsky, Rachel; Spain, Jim C; Konstantinidis, Konstantinos T

    2017-04-15

    A single liter of water contains hundreds, if not thousands, of bacterial and archaeal species, each of which typically makes up a very small fraction of the total microbial community (biosphere." How often, and via what mechanisms, e.g., clonal amplification versus horizontal gene transfer, the rare taxa and genes contribute to microbial community response to environmental perturbations represent important unanswered questions toward better understanding the value and modeling of microbial diversity. We tested whether rare species frequently responded to changing environmental conditions by establishing 20-liter planktonic mesocosms with water from Lake Lanier (Georgia, USA) and perturbing them with organic compounds that are rarely detected in the lake, including 2,4-dichlorophenoxyacetic acid (2,4-D), 4-nitrophenol (4-NP), and caffeine. The populations of the degraders of these compounds were initially below the detection limit of quantitative PCR (qPCR) or metagenomic sequencing methods, but they increased substantially in abundance after perturbation. Sequencing of several degraders (isolates) and time-series metagenomic data sets revealed distinct cooccurring alleles of degradation genes, frequently carried on transmissible plasmids, especially for the 2,4-D mesocosms, and distinct species dominating the post-enrichment microbial communities from each replicated mesocosm. This diversity of species and genes also underlies distinct degradation profiles among replicated mesocosms. Collectively, these results supported the hypothesis that the rare biosphere can serve as a genetic reservoir, which can be frequently missed by metagenomics but enables community response to changing environmental conditions caused by organic pollutants, and they provided insights into the size of the pool of rare genes and species. IMPORTANCE A single liter of water or gram of soil contains hundreds of low-abundance bacterial and archaeal species, the so called rare biosphere. The

  14. Genetic association study of exfoliation syndrome identifies a protective rare variant at LOXL1 and five new susceptibility loci.

    Science.gov (United States)

    Aung, Tin; Ozaki, Mineo; Lee, Mei Chin; Schlötzer-Schrehardt, Ursula; Thorleifsson, Gudmar; Mizoguchi, Takanori; Igo, Robert P; Haripriya, Aravind; Williams, Susan E; Astakhov, Yury S; Orr, Andrew C; Burdon, Kathryn P; Nakano, Satoko; Mori, Kazuhiko; Abu-Amero, Khaled; Hauser, Michael; Li, Zheng; Prakadeeswari, Gopalakrishnan; Bailey, Jessica N Cooke; Cherecheanu, Alina Popa; Kang, Jae H; Nelson, Sarah; Hayashi, Ken; Manabe, Shin-Ichi; Kazama, Shigeyasu; Zarnowski, Tomasz; Inoue, Kenji; Irkec, Murat; Coca-Prados, Miguel; Sugiyama, Kazuhisa; Järvelä, Irma; Schlottmann, Patricio; Lerner, S Fabian; Lamari, Hasnaa; Nilgün, Yildirim; Bikbov, Mukharram; Park, Ki Ho; Cha, Soon Cheol; Yamashiro, Kenji; Zenteno, Juan C; Jonas, Jost B; Kumar, Rajesh S; Perera, Shamira A; Chan, Anita S Y; Kobakhidze, Nino; George, Ronnie; Vijaya, Lingam; Do, Tan; Edward, Deepak P; de Juan Marcos, Lourdes; Pakravan, Mohammad; Moghimi, Sasan; Ideta, Ryuichi; Bach-Holm, Daniella; Kappelgaard, Per; Wirostko, Barbara; Thomas, Samuel; Gaston, Daniel; Bedard, Karen; Greer, Wenda L; Yang, Zhenglin; Chen, Xueyi; Huang, Lulin; Sang, Jinghong; Jia, Hongyan; Jia, Liyun; Qiao, Chunyan; Zhang, Hui; Liu, Xuyang; Zhao, Bowen; Wang, Ya-Xing; Xu, Liang; Leruez, Stéphanie; Reynier, Pascal; Chichua, George; Tabagari, Sergo; Uebe, Steffen; Zenkel, Matthias; Berner, Daniel; Mossböck, Georg; Weisschuh, Nicole; Hoja, Ursula; Welge-Luessen, Ulrich-Christoph; Mardin, Christian; Founti, Panayiota; Chatzikyriakidou, Anthi; Pappas, Theofanis; Anastasopoulos, Eleftherios; Lambropoulos, Alexandros; Ghosh, Arkasubhra; Shetty, Rohit; Porporato, Natalia; Saravanan, Vijayan; Venkatesh, Rengaraj; Shivkumar, Chandrashekaran; Kalpana, Narendran; Sarangapani, Sripriya; Kanavi, Mozhgan R; Beni, Afsaneh Naderi; Yazdani, Shahin; Lashay, Alireza; Naderifar, Homa; Khatibi, Nassim; Fea, Antonio; Lavia, Carlo; Dallorto, Laura; Rolle, Teresa; Frezzotti, Paolo; Paoli, Daniela; Salvi, Erika; Manunta, Paolo; Mori, Yosai; Miyata, Kazunori; Higashide, Tomomi; Chihara, Etsuo; Ishiko, Satoshi; Yoshida, Akitoshi; Yanagi, Masahide; Kiuchi, Yoshiaki; Ohashi, Tsutomu; Sakurai, Toshiya; Sugimoto, Takako; Chuman, Hideki; Aihara, Makoto; Inatani, Masaru; Miyake, Masahiro; Gotoh, Norimoto; Matsuda, Fumihiko; Yoshimura, Nagahisa; Ikeda, Yoko; Ueno, Morio; Sotozono, Chie; Jeoung, Jin Wook; Sagong, Min; Park, Kyu Hyung; Ahn, Jeeyun; Cruz-Aguilar, Marisa; Ezzouhairi, Sidi M; Rafei, Abderrahman; Chong, Yaan Fun; Ng, Xiao Yu; Goh, Shuang Ru; Chen, Yueming; Yong, Victor H K; Khan, Muhammad Imran; Olawoye, Olusola O; Ashaye, Adeyinka O; Ugbede, Idakwo; Onakoya, Adeola; Kizor-Akaraiwe, Nkiru; Teekhasaenee, Chaiwat; Suwan, Yanin; Supakontanasan, Wasu; Okeke, Suhanya; Uche, Nkechi J; Asimadu, Ifeoma; Ayub, Humaira; Akhtar, Farah; Kosior-Jarecka, Ewa; Lukasik, Urszula; Lischinsky, Ignacio; Castro, Vania; Grossmann, Rodolfo Perez; Sunaric Megevand, Gordana; Roy, Sylvain; Dervan, Edward; Silke, Eoin; Rao, Aparna; Sahay, Priti; Fornero, Pablo; Cuello, Osvaldo; Sivori, Delia; Zompa, Tamara; Mills, Richard A; Souzeau, Emmanuelle; Mitchell, Paul; Wang, Jie Jin; Hewitt, Alex W; Coote, Michael; Crowston, Jonathan G; Astakhov, Sergei Y; Akopov, Eugeny L; Emelyanov, Anton; Vysochinskaya, Vera; Kazakbaeva, Gyulli; Fayzrakhmanov, Rinat; Al-Obeidan, Saleh A; Owaidhah, Ohoud; Aljasim, Leyla Ali; Chowbay, Balram; Foo, Jia Nee; Soh, Raphael Q; Sim, Kar Seng; Xie, Zhicheng; Cheong, Augustine W O; Mok, Shi Qi; Soo, Hui Meng; Chen, Xiao Yin; Peh, Su Qin; Heng, Khai Koon; Husain, Rahat; Ho, Su-Ling; Hillmer, Axel M; Cheng, Ching-Yu; Escudero-Domínguez, Francisco A; González-Sarmiento, Rogelio; Martinon-Torres, Frederico; Salas, Antonio; Pathanapitoon, Kessara; Hansapinyo, Linda; Wanichwecharugruang, Boonsong; Kitnarong, Naris; Sakuntabhai, Anavaj; Nguyn, Hip X; Nguyn, Giang T T; Nguyn, Trình V; Zenz, Werner; Binder, Alexander; Klobassa, Daniela S; Hibberd, Martin L; Davila, Sonia; Herms, Stefan; Nöthen, Markus M; Moebus, Susanne; Rautenbach, Robyn M; Ziskind, Ari; Carmichael, Trevor R; Ramsay, Michele; Álvarez, Lydia; García, Montserrat; González-Iglesias, Héctor; Rodríguez-Calvo, Pedro P; Fernández-Vega Cueto, Luis; Oguz, Çilingir; Tamcelik, Nevbahar; Atalay, Eray; Batu, Bilge; Aktas, Dilek; Kasım, Burcu; Wilson, M Roy; Coleman, Anne L; Liu, Yutao; Challa, Pratap; Herndon, Leon; Kuchtey, Rachel W; Kuchtey, John; Curtin, Karen; Chaya, Craig J; Crandall, Alan; Zangwill, Linda M; Wong, Tien Yin; Nakano, Masakazu; Kinoshita, Shigeru; den Hollander, Anneke I; Vesti, Eija; Fingert, John H; Lee, Richard K; Sit, Arthur J; Shingleton, Bradford J; Wang, Ningli; Cusi, Daniele; Qamar, Raheel; Kraft, Peter; Pericak-Vance, Margaret A; Raychaudhuri, Soumya; Heegaard, Steffen; Kivelä, Tero; Reis, André; Kruse, Friedrich E; Weinreb, Robert N; Pasquale, Louis R; Haines, Jonathan L; Thorsteinsdottir, Unnur; Jonasson, Fridbert; Allingham, R Rand; Milea, Dan; Ritch, Robert; Kubota, Toshiaki; Tashiro, Kei; Vithana, Eranga N; Micheal, Shazia; Topouzis, Fotis; Craig, Jamie E; Dubina, Michael; Sundaresan, Periasamy; Stefansson, Kari; Wiggs, Janey L; Pasutto, Francesca; Khor, Chiea Chuen

    2017-07-01

    Exfoliation syndrome (XFS) is the most common known risk factor for secondary glaucoma and a major cause of blindness worldwide. Variants in two genes, LOXL1 and CACNA1A, have previously been associated with XFS. To further elucidate the genetic basis of XFS, we collected a global sample of XFS cases to refine the association at LOXL1, which previously showed inconsistent results across populations, and to identify new variants associated with XFS. We identified a rare protective allele at LOXL1 (p.Phe407, odds ratio (OR) = 25, P = 2.9 × 10 -14 ) through deep resequencing of XFS cases and controls from nine countries. A genome-wide association study (GWAS) of XFS cases and controls from 24 countries followed by replication in 18 countries identified seven genome-wide significant loci (P < 5 × 10 -8 ). We identified association signals at 13q12 (POMP), 11q23.3 (TMEM136), 6p21 (AGPAT1), 3p24 (RBMS3) and 5q23 (near SEMA6A). These findings provide biological insights into the pathology of XFS and highlight a potential role for naturally occurring rare LOXL1 variants in disease biology.

  15. Systematic Functional Interrogation of Rare Cancer Variants Identifies Oncogenic Alleles | Office of Cancer Genomics

    Science.gov (United States)

    Cancer genome characterization efforts now provide an initial view of the somatic alterations in primary tumors. However, most point mutations occur at low frequency, and the function of these alleles remains undefined. We have developed a scalable systematic approach to interrogate the function of cancer-associated gene variants. We subjected 474 mutant alleles curated from 5,338 tumors to pooled in vivo tumor formation assays and gene expression profiling. We identified 12 transforming alleles, including two in genes (PIK3CB, POT1) that have not been shown to be tumorigenic.

  16. Bicalutamide-Associated Acute Liver Injury and Migratory Arthralgia: A Rare but Clinically Important Adverse Effect

    Directory of Open Access Journals (Sweden)

    Helga M. Gretarsdottir

    2018-06-01

    Full Text Available We describe a case of acute liver injury and migratory arthralgia in a patient receiving bicalutamide treatment for prostate cancer. A 67-year-old male with metastatic prostate cancer presented with a 6-day history of migratory arthralgia. He had been undergoing treatment with bicalutamide for 4 months; 3 weeks prior to symptom appearance the bicalutamide dose had been increased. He had no other symptoms. Liver tests and inflammatory markers were markedly elevated. Serology for hepatitis viruses A, B, and C, CMV, and EBV and autoimmune causes were all negative, and an ultrasound of the upper abdomen was normal. There was no history of blood transfusion, intravenous drug abuse, or alcohol abuse. Due to the suspicion of a drug-induced symptomatology, bicalutamide was discontinued and the patient started on 30 mg prednisolone daily. Three weeks later he was symptom free and after 6 weeks his liver tests were almost normal. The Roussel Uclaf Causality Assessment Method (RUCAM suggested a high probability of liver injury. Bicalutamide has very rarely been reported as a causative agent for liver injury and to our knowledge never for migratory polyarthralgia. The migratory polyarthralgia was attributed to bicalutamide due to the absence of other etiological factors and the disappearance of symptoms after discontinuation of the drug. To our knowledge, this is the first published case report of migratory arthralgia and concomitant liver injury attributed to bicalutamide.

  17. The Importance of Rare-Earth Additions in Zr-Based AB2 Metal Hydride Alloys

    Directory of Open Access Journals (Sweden)

    Kwo-Hsiung Young

    2016-07-01

    Full Text Available Effects of substitutions of rare earth (RE elements (Y, La, Ce, and Nd to the Zr-based AB2 multi-phase metal hydride (MH alloys on the structure, gaseous phase hydrogen storage (H-storage, and electrochemical properties were studied and compared. Solubilities of the RE atoms in the main Laves phases (C14 and C15 are very low, and therefore the main contributions of the RE additives are through the formation of the RENi phase and change in TiNi phase abundance. Both the RENi and TiNi phases are found to facilitate the bulk diffusion of hydrogen but impede the surface reaction. The former is very effective in improving the activation behaviors. −40 °C performances of the Ce-doped alloys are slightly better than the Nd-doped alloys but not as good as those of the La-doped alloys, which gained the improvement through a different mechanism. While the improvement in ultra-low-temperature performance of the Ce-containing alloys can be associated with a larger amount of metallic Ni-clusters embedded in the surface oxide, the improvement in the La-containing alloys originates from the clean alloy/oxide interface as shown in an earlier transmission electron microscopy study. Overall, the substitution of 1 at% Ce to partially replace Zr gives the best electrochemical performances (capacity, rate, and activation and is recommended for all the AB2 MH alloys for electrochemical applications.

  18. Candidate gene resequencing to identify rare, pedigree-specific variants influencing healthy aging phenotypes in the long life family study

    DEFF Research Database (Denmark)

    Druley, Todd E; Wang, Lihua; Lin, Shiow J

    2016-01-01

    from six pedigrees. OBFC1 (chromosome 10) is involved in telomere maintenance, and falls within a linkage peak recently reported from an analysis of telomere length in LLFS families. Two different algorithms for single gene associations identified three genes with an enrichment of variation......BACKGROUND: The Long Life Family Study (LLFS) is an international study to identify the genetic components of various healthy aging phenotypes. We hypothesized that pedigree-specific rare variants at longevity-associated genes could have a similar functional impact on healthy phenotypes. METHODS......: We performed custom hybridization capture sequencing to identify the functional variants in 464 candidate genes for longevity or the major diseases of aging in 615 pedigrees (4,953 individuals) from the LLFS, using a multiplexed, custom hybridization capture. Variants were analyzed individually...

  19. CHEK2 c.1100delC allele is rarely identified in Greek breast cancer cases.

    Science.gov (United States)

    Apostolou, Paraskevi; Fostira, Florentia; Papamentzelopoulou, Myrto; Michelli, Maria; Panopoulos, Christos; Fountzilas, George; Konstantopoulou, Irene; Voutsinas, Gerassimos E; Yannoukakos, Drakoulis

    2015-04-01

    The CHEK2 gene encodes a protein kinase that plays a crucial role in maintenance of genomic integrity and the DNA repair mechanism. CHEK2 germline mutations are associated with increased risk of breast cancer and other malignancies. From a clinical perspective, the most significant mutation identified is the c.1100delC mutation, which is associated with an approximately 25% lifetime breast cancer risk. The distribution of this mutation shows wide geographical variation; it is more prevalent in the Northern European countries and less common, or even absent, in Southern Europe. In order to estimate the frequency of the CHEK2 c.1100delC mutation in Greek breast cancer patients, we genotyped 2,449 patients (2,408 females and 41 males), which was the largest series ever tested for c.1100delC. The mean age of female and male breast cancer diagnosis was 49 and 59 years, respectively. All patients had previously tested negative for the Greek BRCA1 founder and recurrent mutations. The CHEK2 c.1100delC mutation was detected in 0.16% (4 of 2,408) of females, all of whom were diagnosed with breast cancer before the age of 50 years. Only one c.1100delC carrier was reported with breast cancer family history. The present study indicates that the CHEK2 c.1100delC mutation does not contribute substantially to hereditary breast cancer in patients of Greek descent. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  1. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  2. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  3. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  4. Iron overload in HFE C282Y heterozygotes at first genetic testing: a strategy for identifying rare HFE variants.

    Science.gov (United States)

    Aguilar-Martinez, Patricia; Grandchamp, Bernard; Cunat, Séverine; Cadet, Estelle; Blanc, François; Nourrit, Marlène; Lassoued, Kaiss; Schved, Jean-François; Rochette, Jacques

    2011-04-01

    Heterozygotes for the p.Cys282Tyr (C282Y) mutation of the HFE gene do not usually express a hemochromatosis phenotype. Apart from the compound heterozygous state for C282Y and the widespread p.His63Asp (H63D) variant allele, other rare HFE mutations can be found in trans on chromosome 6. We performed molecular investigation of the genes implicated in hereditary hemochromatosis in six patients who presented with iron overload but were simple heterozygotes for the HFE C282Y mutation at first genetic testing. Functional impairment of new variants was deduced from computational methods including molecular modeling studies. We identified four rare HFE mutant alleles, three of which have not been previously described. One mutation is a 13-nucleotide deletion in exon 6 (c.1022_1034del13, p.His341_Ala345 > LeufsX119), which is predicted to lead to an elongated and unstable protein. The second one is a substitution of the last nucleotide of exon 2 (c.340G > A, p.Glu114Lys) which modifies the relative solvent accessibility in a loop interface. The third mutation, p.Arg67Cys, also lies in exon 2 and introduces a destabilization of the secondary structure within a loop of the α1 domain. We also found the previously reported c.548T > C (p.Leu183Pro) missense mutation in exon 3. No other known iron genes were mutated. We present an algorithm at the clinical and genetic levels for identifying patients deserving further investigation. Conclusions Our results suggest that additional mutations in HFE may have a clinical impact in C282Y carriers. In conjunction with results from previously described cases we conclude that an elevated transferrin saturation level and elevated hepatic iron index should indicate the utility of searching for further HFE mutations in C282Y heterozygotes prior to other iron gene studies.

  5. Rare muscular variations identified in a single cadaveric upper limb: a four-headed biceps brachii and muscular elevator of the latissimus dorsi tendon.

    Science.gov (United States)

    Moore, Colin W; Rice, Charles L

    2018-03-01

    Supernumerary or accessory heads of the biceps brachii are persistent muscular structures which can vary in number and location in the arm. Variations in other arm muscles, such as the coracobrachialis, can accompany supernumerary biceps brachii musculature in the upper limb. In this case report, we describe two rare muscular variants in a single adult male: a four-headed biceps brachii and the muscular elevator of the latissimus dorsi tendon. Additionally, accessory muscles of the brachialis and flexor digiti minimi brevis were identified in the upper limb. To our knowledge, the muscular variants identified here are considered rare, and their co-occurrence in a single upper limb has not been described previously. Also, a four-headed biceps brachii consisting of both the infero-medial and infero-lateral humeral heads has not been described previously to our knowledge. We postulate that the simultaneous appearance of several muscular variations may indicate a signaling disruption in embryogenesis during muscle patterning of the ventral limb bud. Knowledge of variant musculature in the arm is important for surgeons and clinicians as these muscles and their aberrant innervation patterns can complicate surgical procedures and may compress arteries and nerves producing upper limb pain and paresthesia. The clinical, functional and embryological implications of the upper limb variants are discussed.

  6. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  7. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  8. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  9. Functional Investigations of HNF1A Identify Rare Variants as Risk Factors for Type 2 Diabetes in the General Population

    Science.gov (United States)

    Najmi, Laeya Abdoli; Aukrust, Ingvild; Flannick, Jason; Molnes, Janne; Burtt, Noel; Molven, Anders; Groop, Leif; Altshuler, David; Johansson, Stefan; Njølstad, Pål Rasmus

    2017-01-01

    Variants in HNF1A encoding hepatocyte nuclear factor 1α (HNF-1A) are associated with maturity-onset diabetes of the young form 3 (MODY 3) and type 2 diabetes. We investigated whether functional classification of HNF1A rare coding variants can inform models of diabetes risk prediction in the general population by analyzing the effect of 27 HNF1A variants identified in well-phenotyped populations (n = 4,115). Bioinformatics tools classified 11 variants as likely pathogenic and showed no association with diabetes risk (combined minor allele frequency [MAF] 0.22%; odds ratio [OR] 2.02; 95% CI 0.73–5.60; P = 0.18). However, a different set of 11 variants that reduced HNF-1A transcriptional activity to diabetes in the general population (combined MAF 0.22%; OR 5.04; 95% CI 1.99–12.80; P = 0.0007). Our functional investigations indicate that 0.44% of the population carry HNF1A variants that result in a substantially increased risk for developing diabetes. These results suggest that functional characterization of variants within MODY genes may overcome the limitations of bioinformatics tools for the purposes of presymptomatic diabetes risk prediction in the general population. PMID:27899486

  10. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  11. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  13. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  14. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  15. Exome sequencing identifies rare deleterious mutations in DNA repair genes FANCC and BLM as potential breast cancer susceptibility alleles.

    Directory of Open Access Journals (Sweden)

    Ella R Thompson

    2012-09-01

    Full Text Available Despite intensive efforts using linkage and candidate gene approaches, the genetic etiology for the majority of families with a multi-generational breast cancer predisposition is unknown. In this study, we used whole-exome sequencing of thirty-three individuals from 15 breast cancer families to identify potential predisposing genes. Our analysis identified families with heterozygous, deleterious mutations in the DNA repair genes FANCC and BLM, which are responsible for the autosomal recessive disorders Fanconi Anemia and Bloom syndrome. In total, screening of all exons in these genes in 438 breast cancer families identified three with truncating mutations in FANCC and two with truncating mutations in BLM. Additional screening of FANCC mutation hotspot exons identified one pathogenic mutation among an additional 957 breast cancer families. Importantly, none of the deleterious mutations were identified among 464 healthy controls and are not reported in the 1,000 Genomes data. Given the rarity of Fanconi Anemia and Bloom syndrome disorders among Caucasian populations, the finding of multiple deleterious mutations in these critical DNA repair genes among high-risk breast cancer families is intriguing and suggestive of a predisposing role. Our data demonstrate the utility of intra-family exome-sequencing approaches to uncover cancer predisposition genes, but highlight the major challenge of definitively validating candidates where the incidence of sporadic disease is high, germline mutations are not fully penetrant, and individual predisposition genes may only account for a tiny proportion of breast cancer families.

  16. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  17. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  19. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  20. Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension

    NARCIS (Netherlands)

    Surendran, Praveen; Drenos, Fotios; Young, Robin; Warren, Helen; Cook, James P; Manning, Alisa K; Grarup, Niels; Sim, Xueling; Barnes, Daniel R; Witkowska, Kate; Staley, James R; Tragante, Vinicius; Tukiainen, Taru; Yaghootkar, Hanieh; Masca, Nicholas; Freitag, Daniel F; Ferreira, Teresa; Giannakopoulou, Olga; Tinker, Andrew; Harakalova, Magdalena; Mihailov, Evelin; Liu, Chunyu; Kraja, Aldi T; Nielsen, Sune Fallgaard; Rasheed, Asif; Samuel, Maria; Zhao, Wei; Bonnycastle, Lori L; Jackson, Anne U; Narisu, Narisu; Swift, Amy J; Southam, Lorraine; Marten, Jonathan; Huyghe, Jeroen R; Stančáková, Alena; Fava, Cristiano; Ohlsson, Therese; Matchan, Angela; Stirrups, Kathleen E; Bork-Jensen, Jette; Gjesing, Anette P; Kontto, Jukka; Perola, Markus; Shaw-Hawkins, Susan; Havulinna, Aki S; Zhang, He; Donnelly, Louise A; Groves, Christopher J; Rayner, N William; Neville, Matt J; Robertson, Neil R; Yiorkas, Andrianos M; Herzig, Karl-Heinz; Kajantie, Eero; Zhang, Weihua; Willems, Sara M; Lannfelt, Lars; Malerba, Giovanni; Soranzo, Nicole; Trabetti, Elisabetta; Verweij, Niek; Evangelou, Evangelos; Moayyeri, Alireza; Vergnaud, Anne-Claire; Nelson, Christopher P; Poveda, Alaitz; Varga, Tibor V; Caslake, Muriel; de Craen, Anton J M; Trompet, Stella; Luan, Jian'an; Scott, Robert A; Harris, Sarah E; Liewald, David C M; Marioni, Riccardo; Menni, Cristina; Farmaki, Aliki-Eleni; Hallmans, Göran; Renström, Frida; Huffman, Jennifer E; Hassinen, Maija; Burgess, Stephen; Vasan, Ramachandran S; Felix, Janine F; Uria-Nickelsen, Maria; Malarstig, Anders; Reilly, Dermot F; Hoek, Maarten; Vogt, Thomas F; Lin, Honghuang; Lieb, Wolfgang; Traylor, Matthew; Markus, Hugh S; Highland, Heather M; Justice, Anne E; Marouli, Eirini; Lindström, Jaana; Uusitupa, Matti; Komulainen, Pirjo; Lakka, Timo A; Rauramaa, Rainer; Polasek, Ozren; Rudan, Igor; Rolandsson, Olov; Franks, Paul W; Dedoussis, George; Spector, Timothy D; Jousilahti, Pekka; Männistö, Satu; Deary, Ian J; Starr, John M; Langenberg, Claudia; Wareham, Nick J; Brown, Morris J; Dominiczak, Anna F; Connell, John M; Jukema, J Wouter; Sattar, Naveed; Ford, Ian; Packard, Chris J; Esko, Tõnu; Mägi, Reedik; Metspalu, Andres; de Boer, Rudolf A; van der Meer, Peter; van der Harst, Pim; Gambaro, Giovanni; Ingelsson, Erik; Lind, Lars; de Bakker, Paul I W; Numans, Mattijs E; Brandslund, Ivan; Christensen, Cramer; Petersen, Eva R B; Korpi-Hyövälti, Eeva; Oksa, Heikki; Chambers, John C; Kooner, Jaspal S; Blakemore, Alexandra I F; Franks, Steve; Jarvelin, Marjo-Riitta; Husemoen, Lise L; Linneberg, Allan; Skaaby, Tea; Thuesen, Betina; Karpe, Fredrik; Tuomilehto, Jaakko; Doney, Alex S F; Morris, Andrew D; Palmer, Colin N A; Holmen, Oddgeir Lingaas; Hveem, Kristian; Willer, Cristen J; Tuomi, Tiinamaija; Groop, Leif; Käräjämäki, AnneMari; Palotie, Aarno; Ripatti, Samuli; Salomaa, Veikko; Alam, Dewan S; Majumder, Abdulla Al Shafi; Di Angelantonio, Emanuele; Chowdhury, Rajiv; McCarthy, Mark I; Poulter, Neil; Stanton, Alice V; Sever, Peter; Amouyel, Philippe; Arveiler, Dominique; Blankenberg, Stefan; Ferrières, Jean; Kee, Frank; Kuulasmaa, Kari; Müller-Nurasyid, Martina; Veronesi, Giovanni; Virtamo, Jarmo; Deloukas, Panos; Elliott, Paul; Zeggini, Eleftheria; Kathiresan, Sekar; Melander, Olle; Kuusisto, Johanna; Laakso, Markku; Padmanabhan, Sandosh; Porteous, David J; Hayward, Caroline; Scotland, Generation; Collins, Francis S; Mohlke, Karen L; Hansen, Torben; Pedersen, Oluf; Boehnke, Michael; Stringham, Heather M; Frossard, Philippe; Newton-Cheh, Christopher; Tobin, Martin D; Nordestgaard, Børge Grønne; Caulfield, Mark J; Mahajan, Anubha; Morris, Andrew P; Tomaszewski, Maciej; Samani, Nilesh J; Saleheen, Danish; Asselbergs, Folkert W; Lindgren, Cecilia M; Danesh, John; Wain, Louise V; Butterworth, Adam S; Howson, Joanna M M; Munroe, Patricia B

    2016-01-01

    High blood pressure is a major risk factor for cardiovascular disease and premature death. However, there is limited knowledge on specific causal genes and pathways. To better understand the genetics of blood pressure, we genotyped 242,296 rare, low-frequency and common genetic variants in up to

  1. Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension

    NARCIS (Netherlands)

    Surendran, P. (Praveen); F. Drenos (Fotios); R. Young (Robin); H. Warren (Helen); Cook, J.P. (James P.); A.K. Manning (Alisa); N. Grarup (Niels); X. Sim (Xueling); D. Barnes (Daniel); H.E. Witkowska (Ewa); J.R. Staley (James R.); V. Tragante (Vinicius); T. Tukiainen (Taru); H. Yaghootkar (Hanieh); Masca, N. (Nicholas); C.M. Freitag (Christine); T. Ferreira (Teresa); O. Giannakopoulou (Olga); Tinker, A. (Andrew); M. Harakalova (Magdalena); E. Mihailov (Evelin); Liu, C. (Chunyu); A. Kraja (Aldi); S.F. Nielsen (Sune); A. Rasheed (Asif); M. Samuel (Maria); W. Zhao (Wei); L.L. Bonnycastle (Lori); A.U. Jackson (Anne); N. Narisu (Narisu); A.J. Swift (Amy); L. Southam (Lorraine); J. Marten (Jonathan); J.R. Huyghe (Jeroen R.); A. Stancáková (Alena); C. Fava (Cristiano); Ohlsson, T. (Therese); A. Matchan (Angela); K. Stirrups (Kathy); J. Bork-Jensen (Jette); A.P. Gjesing (Anette); Kontto, J. (Jukka); M. Perola (Markus); S. Shaw-Hawkins (Sue); A.S. Havulinna (Aki); Zhang, H. (He); L.A. Donnelly (Louise); C.J. Groves (Christopher); N.W. Rayner (Nigel William); M.J. Neville (Matthew); N.R. Robertson (Neil); Yiorkas, A.M. (Andrianos M.); K.H. Herzig; E. Kajantie (Eero); W. Zhang (Weihua); S.M. Willems (Sara); L. Lannfelt (Lars); G. Malerba (Giovanni); N. Soranzo (Nicole); E. Trabetti (Elisabetta); N. Verweij (Niek); E. Evangelou (Evangelos); A. Moayyeri (Alireza); Vergnaud, A.-C. (Anne-Claire); C.P. Nelson (Christopher P.); Poveda, A. (Alaitz); T.V. Varga (Tibor V.); M. Caslake (Muriel); A.J.M. De Craen (Anton J. M.); S. Trompet (Stella); J. Luan (Jian'An); R.A. Scott (Robert); S.E. Harris (Sarah); D.C. Liewald (David C.); R.E. Marioni (Riccardo); C. Menni (Cristina); A.-E. Farmaki (Aliki-Eleni); G. Hallmans (Göran); F. Renström (Frida); J.E. Huffman (Jennifer); Hassinen, M. (Maija); S. Burgess (Stephen); Vasan, R.S. (Ramachandran S.); J.F. Felix (Janine); Uria-Nickelsen, M. (Maria); A. Mälarstig (Anders); Reilly, D.F. (Dermot F.); Hoek, M. (Maarten); Vogt, T.F. (Thomas F.); H. Lin (Honghuang); W. Lieb (Wolfgang); M. Traylor (Matthew); H.S. Markus (Hugh); H. Highland (Heather); A.E. Justice (Anne); E. Marouli (Eirini); J. Lindström (Jaana); M. Uusitupa (Matti); P. Komulainen (Pirjo); T.A. Lakka (Timo); R. Rauramaa (Rainer); O. Polasek (Ozren); I. Rudan (Igor); Rolandsson, O. (Olov); P.W. Franks (Paul); G.V. Dedoussis (George); T.D. Spector (Timothy); P. Jousilahti (Pekka); S. Männistö (Satu); I.J. Deary (Ian J.); J.M. Starr (John); C. Langenberg (Claudia); N.J. Wareham (Nick); M.J. Brown (Morris); A. Dominiczak (Anna); Connell, J.M. (John M.); J.W. Jukema (Jan Wouter); N. Sattar (Naveed); I. Ford (Ian); Packard, C.J. (Chris J.); T. Esko (Tõnu); R. Mägi (Reedik); A. Metspalu (Andres); R.A. de Boer (Rudolf); Van Der Meer, P. (Peter); P. van der Harst (Pim); G. Gambaro (Giovanni); Ingelsson, E. (Erik); W.H.L. Kao (Wen); P.I.W. de Bakker (Paul); M.E. Numans (Mattijs); I. Brandslund (Ivan); Christensen, C. (Cramer); Petersen, E.R.B. (Eva R. B.); E. Korpi-Hyövälti (Eeva); H. Oksa (Heikki); J.C. Chambers (John); J.S. Kooner (Jaspal S.); A.I.F. Blakemore (Alexandra); S. Franks (Steve); M.-R. Jarvelin (Marjo-Riitta); L.L.N. Husemoen (Lise Lotte); Linneberg, A. (Allan); T. Skaaby (Tea); Thuesen, B. (Betina); F. Karpe (Fredrik); J. Tuomilehto (Jaakko); A.S.F. Doney (Alex); A.D. Morris (Andrew); C.N.A. Palmer (Colin); O.L. Holmen (Oddgeir); K. Hveem (Kristian); C.J. Willer (Cristen); T. Tuomi (Tiinamaija); L. Groop (Leif); Käräjämäki, A. (Annemari); A. Palotie (Aarno); S. Ripatti (Samuli); V. Salomaa (Veikko); D.S. Alam (Dewan S.); Majumder, A.A.S. (Abdulla Al Shafi); E. di Angelantonio (Emanuele); R. Chowdhury (Rajiv); M.I. McCarthy (Mark); N.R. Poulter (Neil); A. Stanton (Alice); P. Sever (Peter); P. Amouyel (Philippe); D. Arveiler (Dominique); Blankenberg, S. (Stefan); J. Ferrieres (Jean); F. Kee (Frank); K. Kuulasmaa (Kari); M. Müller-Nurasyid (Martina); G. Veronesi (Giovanni); J. Virtamo (Jarmo); P. Deloukas (Panagiotis); P. Elliott (Paul); E. Zeggini (Eleftheria); S. Kathiresan (Sekar); O. Melander (Olle); J. Kuusisto (Johanna); M. Laakso (Markku); S. Padmanabhan (Sandosh); D. Porteous (David); C. Hayward (Caroline); G. Scotland (Generation); F.S. Collins (Francis); K.L. Mohlke (Karen); T. Hansen (T.); O. Pedersen (Oluf); M. Boehnke (Michael); H.M. Stringham (Heather); R. Frossard; C. Newton-Cheh (Christopher); M.D. Tobin (Martin); B.G. Nordestgaard (Børge); M. Caulfield (Mark); A. Mahajan (Anubha); A.P. Morris (Andrew); Tomaszewski, M. (Maciej); N.J. Samani (Nilesh); Saleheen, D. (Danish); F.W. Asselbergs (Folkert); C.M. Lindgren (Cecilia M.); J. Danesh (John); Wain, L.V. (Louise V.); A.S. Butterworth (Adam); Howson, J.M.M. (Joanna M. M.); P. Munroe (Patricia)

    2016-01-01

    textabstractHigh blood pressure is a major risk factor for cardiovascular disease and premature death. However, there is limited knowledge on specific causal genes and pathways. To better understand the genetics of blood pressure, we genotyped 242,296 rare, low-frequency and common genetic variants

  2. Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension

    DEFF Research Database (Denmark)

    Surendran, Praveen; Drenos, Fotios; Young, Robin

    2016-01-01

    High blood pressure is a major risk factor for cardiovascular disease and premature death. However, there is limited knowledge on specific causal genes and pathways. To better understand the genetics of blood pressure, we genotyped 242,296 rare, low-frequency and common genetic variants in up to ...

  3. Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension

    NARCIS (Netherlands)

    Surendran, Praveen; Drenos, Fotios; Young, Robin; Warren, Helen; Cook, James P.; Manning, Alisa K.; Grarup, Niels; Sim, Xueling; Barnes, Daniel R.; Witkowska, Kate; Staley, James R.; Tragante, Vinicius; Tukiainen, Taru; Yaghootkar, Hanieh; Masca, Nicholas; Freitag, Daniel F.; Ferreira, Teresa; Giannakopoulou, Olga; Tinker, Andrew; Harakalova, Magdalena; Mihailov, Evelin; Liu, Chunyu; Kraja, Aldi T.; Nielsen, Sune Fallgaard; Rasheed, Asif; Samue, Maria; Zhao, Wei; Bonnycastle, Lori L.; Jackson, Anne U.; Narisu, Narisu; Swift, Amy J.; Southam, Lorraine; Marten, Jonathan; Huyghe, Jeroen R.; Stancakova, Alena; Fava, Cristiano; Ohlsson, Therese; Matchan, Angela; Stirrups, Kathleen E.; Bork-Jensen, Jette; Gjesing, Anette P.; Kontto, Jukka; Perola, Markus; Shaw-Hawkins, Susan; Havulinna, Aki S.; Verweij, Niek; de Boer, Rudolf A.; van der Meer, Peter; van der Harst, Pim; Asselbergs, Folkert W.

    2016-01-01

    High blood pressure is a major risk factor for cardiovascular disease and premature death. However, there is limited knowledge on specific causal genes and pathways. To better understand the genetics of blood pressure, we genotyped 242,296 rare, low frequency and common genetic variants in up to

  4. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  5. A Rare Case of Retroperitoneal Follicular Dendritic Cell Sarcoma Identified by 99mTc-HYNIC-TOC SPECT/CT.

    Science.gov (United States)

    Li, Yi; Xu, Xiaoping; Xu, Junyan; Huang, Dan

    2018-05-31

    Follicular dendritic cell sarcoma is a very rare neoplasm, which is not lymphoma, but originates from a type of immune cells called follicular dendritic cells. We presented a 37-year-old woman who has suffered from obstructive jaundice, weight loss and right upper abdominal pain for 2 months. The contrast CT revealed masses located in the region of pancreatic head and lots of enlarged retroperitoneal lymph nodes, both of which were enhanced on the artery phase of CT images. Meanwhile, Tc-HYNIC-TOC SPECT/CT revealed high activity in the corresponding lesions. After biopsy, the masses were pathologically confirmed as retroperitoneal follicular dendritic cell sarcoma.

  6. A Comprehensive Analysis of Common and Rare Variants to Identify Adiposity Loci in Hispanic Americans: The IRAS Family Study (IRASFS.

    Directory of Open Access Journals (Sweden)

    Chuan Gao

    Full Text Available Obesity is growing epidemic affecting 35% of adults in the United States. Previous genome-wide association studies (GWAS have identified numerous loci associated with obesity. However, the majority of studies have been completed in Caucasians focusing on total body measures of adiposity. Here we report the results from genome-wide and exome chip association studies focusing on total body measures of adiposity including body mass index (BMI, percent body fat (PBF and measures of fat deposition including waist circumference (WAIST, waist-hip ratio (WHR, subcutaneous adipose tissue (SAT, and visceral adipose tissue (VAT in Hispanic Americans (nmax = 1263 from the Insulin Resistance Atherosclerosis Family Study (IRASFS. Five SNPs from two novel loci attained genome-wide significance (P<5.00x10-8 in IRASFS. A missense SNP in the isocitrate dehydrogenase 1 gene (IDH1 was associated with WAIST (rs34218846, MAF = 6.8%, PDOM = 1.62x10-8. This protein is postulated to play an important role in fat and cholesterol biosynthesis as demonstrated in cell and knock-out animal models. Four correlated intronic SNPs in the Zinc finger, GRF-type containing 1 gene (ZGRF1; SNP rs1471880, MAF = 48.1%, PDOM = 1.00x10-8 were strongly associated with WHR. The exact biological function of ZGRF1 and the connection with adiposity remains unclear. SNPs with p-values less than 5.00x10-6 from IRASFS were selected for replication. Meta-analysis was computed across seven independent Hispanic-American cohorts (nmax = 4156 and the strongest signal was rs1471880 (PDOM = 8.38x10-6 in ZGRF1 with WAIST. In conclusion, a genome-wide and exome chip association study was conducted that identified two novel loci (IDH1 and ZGRF1 associated with adiposity. While replication efforts were inconclusive, when taken together with the known biology, IDH1 and ZGRF1 warrant further evaluation.

  7. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  8. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  9. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  10. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  11. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  12. Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci

    NARCIS (Netherlands)

    Liu, C. (Chunyu); A. Kraja (Aldi); J.A. Smith (Jennifer A); J. Brody (Jennifer); N. Franceschini (Nora); J.C. Bis (Joshua); K.M. Rice (Kenneth); A.C. Morrison (Alanna); Y. Lu (Yingchang); Weiss, S. (Stefan); X. Guo (Xiuqing); W. Palmas (Walter); L.W. Martin (Lisa); Y.D. Chen (Y.); Surendran, P. (Praveen); F. Drenos (Fotios); Cook, J.P. (James P.); P. Auer (Paul); A.Y. Chu (Audrey); Giri, A. (Ayush); Zhao, W. (Wei); M. Jakobsdottir (Margret); Lin, L.-A. (Li-An); J.M. Stafford (Jeanette M.); N. Amin (Najaf); Mei, H. (Hao); J. Yao (Jiefen); J.M. Voorman (Jeanine); M.G. Larson (Martin); M.L. Grove (Megan); A.V. Smith (Albert Vernon); S.J. Hwang; H. Chen (Han); T. Huan (Tianxiao); Kosova, G. (Gulum); N.O. Stitziel (Nathan); S. Kathiresan (Sekar); N.J. Samani (Nilesh); H. Schunkert (Heribert); P. Deloukas (Panagiotis); M. Li (Man); C. Fuchsberger (Christian); C. Pattaro (Cristian); M. Gorski (Mathias); C. Kooperberg (Charles); G. Papanicolaou (George); Rossouw, J.E. (Jacques E.); J.D. Faul (Jessica D.); S.L.R. Kardia (Sharon); C. Bouchard (Claude); L.J. Raffel (Leslie); Uitterlinden, A.G. (André G.); O.H. Franco (Oscar); R. Vasan (Ramachandran); C.J. O'Donnell (Christopher); K.D. Taylor (Kent); K.Y. Liu; E.P. Bottinger (Erwin); R.F. Gottesman (Rebecca); E.W. Daw (E. Warwick); F. Giulianini (Franco); S.K. Ganesh (Santhi); E. Salfati (Elias); T.B. Harris (Tamara); Launer, L.J. (Lenore J.); M. Dörr (Marcus); S.B. Felix (Stephan); R. Rettig (Rainer); H. Völzke (Henry); E. Kim (Eric); W.-J. Lee (Wen-Jane); I.T. Lee; Sheu, W.H.-H. (Wayne H.-H.); Tsosie, K.S. (Krystal S.); Edwards, D.R.V. (Digna R. Velez); Y. Liu (YongMei); Correa, A. (Adolfo); D.R. Weir (David); U. Völker (Uwe); P.M. Ridker (Paul); E.A. Boerwinkle (Eric); V. Gudnason (Vilmundur); A. Reiner (Alexander); Van Duijn, C.M. (Cornelia M.); I.B. Borecki (Ingrid); T.L. Edwards (Todd L.); A. Chakravarti (Aravinda); Rotter, J.I. (Jerome I.); B.M. Psaty (Bruce); R.J.F. Loos (Ruth); M. Fornage (Myriam); G.B. Ehret (Georg); C. Newton-Cheh (Christopher); D. Levy (Daniel); D.I. Chasman (Daniel)

    2016-01-01

    textabstractMeta-analyses of association results for blood pressure using exome-centric single-variant and gene-based tests identified 31 new loci in a discovery stage among 146,562 individuals, with follow-up and meta-analysis in 180,726 additional individuals (total n = 327,288). These blood

  13. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  14. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  16. Exome sequencing in schizophrenic patients with high levels of homozygosity identifies novel and extremely rare mutations in the GABA/glutamatergic pathways.

    Directory of Open Access Journals (Sweden)

    Edoardo Giacopuzzi

    Full Text Available Inbreeding is a known risk factor for recessive Mendelian diseases and previous studies have suggested that it could also play a role in complex disorders, such as psychiatric diseases. Recent inbreeding results in the presence of long runs of homozygosity (ROHs along the genome, which are also defined as autozygosity regions. Genetic variants in these regions have two alleles that are identical by descent, thus increasing the odds of bearing rare recessive deleterious mutations due to a homozygous state. A recent study showed a suggestive enrichment of long ROHs in schizophrenic patients, suggesting that recent inbreeding could play a role in the disease. To better understand the impact of autozygosity on schizophrenia risk, we selected, from a cohort of 180 Italian patients, seven subjects with extremely high numbers of large ROHs that were likely due to recent inbreeding and characterized the mutational landscape within their ROHs using Whole Exome Sequencing and, gene set enrichment analysis. We identified a significant overlap (17%; empirical p-value = 0.0171 between genes inside ROHs affected by low frequency functional homozygous variants (107 genes and the group of most promising candidate genes mutated in schizophrenia. Moreover, in four patients, we identified novel and extremely rare damaging mutations in the genes involved in neurodevelopment (MEGF8 and in GABA/glutamatergic synaptic transmission (GAD1, FMN1, ANO2. These results provide insights into the contribution of rare recessive mutations and inbreeding as risk factors for schizophrenia. ROHs that are likely due to recent inbreeding harbor a combination of predisposing low-frequency variants and extremely rare variants that have a high impact on pivotal biological pathways implicated in the disease. In addition, this study confirms that focusing on patients with high levels of homozygosity could be a useful prioritization strategy for discovering new high-impact mutations in

  17. Exome sequencing in schizophrenic patients with high levels of homozygosity identifies novel and extremely rare mutations in the GABA/glutamatergic pathways.

    Science.gov (United States)

    Giacopuzzi, Edoardo; Gennarelli, Massimo; Minelli, Alessandra; Gardella, Rita; Valsecchi, Paolo; Traversa, Michele; Bonvicini, Cristian; Vita, Antonio; Sacchetti, Emilio; Magri, Chiara

    2017-01-01

    Inbreeding is a known risk factor for recessive Mendelian diseases and previous studies have suggested that it could also play a role in complex disorders, such as psychiatric diseases. Recent inbreeding results in the presence of long runs of homozygosity (ROHs) along the genome, which are also defined as autozygosity regions. Genetic variants in these regions have two alleles that are identical by descent, thus increasing the odds of bearing rare recessive deleterious mutations due to a homozygous state. A recent study showed a suggestive enrichment of long ROHs in schizophrenic patients, suggesting that recent inbreeding could play a role in the disease. To better understand the impact of autozygosity on schizophrenia risk, we selected, from a cohort of 180 Italian patients, seven subjects with extremely high numbers of large ROHs that were likely due to recent inbreeding and characterized the mutational landscape within their ROHs using Whole Exome Sequencing and, gene set enrichment analysis. We identified a significant overlap (17%; empirical p-value = 0.0171) between genes inside ROHs affected by low frequency functional homozygous variants (107 genes) and the group of most promising candidate genes mutated in schizophrenia. Moreover, in four patients, we identified novel and extremely rare damaging mutations in the genes involved in neurodevelopment (MEGF8) and in GABA/glutamatergic synaptic transmission (GAD1, FMN1, ANO2). These results provide insights into the contribution of rare recessive mutations and inbreeding as risk factors for schizophrenia. ROHs that are likely due to recent inbreeding harbor a combination of predisposing low-frequency variants and extremely rare variants that have a high impact on pivotal biological pathways implicated in the disease. In addition, this study confirms that focusing on patients with high levels of homozygosity could be a useful prioritization strategy for discovering new high-impact mutations in genetically

  18. Study of rare neutron induced processes and coincidence analyses to identify and reduce background contributions in the COBRA experiment

    International Nuclear Information System (INIS)

    Timm, Jan Horst Karl

    2015-11-01

    The aim of the COBRA experiment is the observation of neutrinoless double-beta decay, primarily of the isotope 116 Cd. The applied semiconductor detectors of cadmium zinc telluride that are 90% to be enriched enable both the detection and the source of this decay. The half-lives of decays of this kind are expected in the range of more than 10 26 years. Therefore, the reduction of contributions to the background is of decisive importance. The main subjects of this work are, on the one hand, the time synchronization of the data, which provides the basis for coincidence analysis. This analysis method has access not only to identification of contributions to the background, but also to observe decays involving positron annihilation and decays into excited states. In this study, the intrinsic detector contamination of some decay products of 238 U and 232 Th was measured and sensitivities to the half-lives of the decays like 120 Te and 128 Te in each case to the first excited state of daughter products are given. On the other hand, qualitative studies on the importance of neutrons in the COBRA experiment were conducted. These have shown that fast neutrons, thus with energies greater than 10 keV, only result in an insignificant contribution to the background for the detection of neutrinoless double-beta decay of the 116 Cd. Previous studies have also shown that the thermal neutron flux can be in situ determined by coincidence analysis.

  19. Preliminary estimates of the quantities of rare-earth elements contained in selected products and in imports of semimanufactured products to the United States, 2010

    Science.gov (United States)

    Bleiwas, Donald I.; Gambogi, Joseph

    2013-01-01

    Rare-earth elements (REEs) are contained in a wide range of products of economic and strategic importance to the Nation. The REEs may or may not represent a significant component of that product by mass, value, or volume; however, in many cases, the embedded REEs are critical for the device’s function. Domestic sources of primary supply and the manufacturing facilities to produce products are inadequate to meet U.S. requirements; therefore, a significant percentage of the supply of REEs and the products that contain them are imported to the United States. In 2011, mines in China produced roughly 97 percent of the world’s supply of REEs, and the country’s production of these elements will likely dominate global supply until at least 2020. Preliminary estimates of the types and amount of rare-earth elements, reported as oxides, in semimanufactured form and the amounts used for electric vehicle batteries, catalytic converters, computers, and other applications were developed to provide a perspective on the Nation’s use of these elements. The amount of rare-earth metals recovered from recycling, remanufacturing, and reuse is negligible when the tonnage of products that contain REEs deposited in landfills and retained in storage is considered. Under favorable market conditions, the recovery of REEs from obsolete products could potentially displace a portion of the supply from primary sources.

  20. Pooled Sequencing of 531 Genes in Inflammatory Bowel Disease Identifies an Associated Rare Variant in BTNL2 and Implicates Other Immune Related Genes

    Science.gov (United States)

    Prescott, Natalie J.; Lehne, Benjamin; Stone, Kristina; Lee, James C.; Taylor, Kirstin; Knight, Jo; Papouli, Efterpi; Mirza, Muddassar M.; Simpson, Michael A.; Spain, Sarah L.; Lu, Grace; Fraternali, Franca; Bumpstead, Suzannah J.; Gray, Emma; Amar, Ariella; Bye, Hannah; Green, Peter; Chung-Faye, Guy; Hayee, Bu’Hussain; Pollok, Richard; Satsangi, Jack; Parkes, Miles; Barrett, Jeffrey C.; Mansfield, John C.; Sanderson, Jeremy; Lewis, Cathryn M.; Weale, Michael E.; Schlitt, Thomas; Mathew, Christopher G.

    2015-01-01

    The contribution of rare coding sequence variants to genetic susceptibility in complex disorders is an important but unresolved question. Most studies thus far have investigated a limited number of genes from regions which contain common disease associated variants. Here we investigate this in inflammatory bowel disease by sequencing the exons and proximal promoters of 531 genes selected from both genome-wide association studies and pathway analysis in pooled DNA panels from 474 cases of Crohn’s disease and 480 controls. 80 variants with evidence of association in the sequencing experiment or with potential functional significance were selected for follow up genotyping in 6,507 IBD cases and 3,064 population controls. The top 5 disease associated variants were genotyped in an extension panel of 3,662 IBD cases and 3,639 controls, and tested for association in a combined analysis of 10,147 IBD cases and 7,008 controls. A rare coding variant p.G454C in the BTNL2 gene within the major histocompatibility complex was significantly associated with increased risk for IBD (p = 9.65x10−10, OR = 2.3[95% CI = 1.75–3.04]), but was independent of the known common associated CD and UC variants at this locus. Rare (T) or decreased risk (IL12B p.V298F, and NICN p.H191R) of IBD. These results provide additional insights into the involvement of the inhibition of T cell activation in the development of both sub-phenotypes of inflammatory bowel disease. We suggest that although rare coding variants may make a modest overall contribution to complex disease susceptibility, they can inform our understanding of the molecular pathways that contribute to pathogenesis. PMID:25671699

  1. Whole exome sequencing of a consanguineous family identifies the possible modifying effect of a globally rare AK5 allelic variant in celiac disease development among Saudi patients.

    Directory of Open Access Journals (Sweden)

    Jumana Yousuf Al-Aama

    Full Text Available Celiac disease (CD, a multi-factorial auto-inflammatory disease of the small intestine, is known to occur in both sporadic and familial forms. Together HLA and Non-HLA genes can explain up to 50% of CD's heritability. In order to discover the missing heritability due to rare variants, we have exome sequenced a consanguineous Saudi family presenting CD in an autosomal recessive (AR pattern. We have identified a rare homozygous insertion c.1683_1684insATT, in the conserved coding region of AK5 gene that showed classical AR model segregation in this family. Sequence validation of 200 chromosomes each of sporadic CD cases and controls, revealed that this extremely rare (EXac MAF 0.000008 mutation is highly penetrant among general Saudi populations (MAF is 0.62. Genotype and allelic distribution analysis have indicated that this AK5 (c.1683_1684insATT mutation is negatively selected among patient groups and positively selected in the control group, in whom it may modify the risk against CD development [p<0.002]. Our observation gains additional support from computational analysis which predicted that Iso561 insertion shifts the existing H-bonds between 400th and 556th amino acid residues lying near the functional domain of adenylate kinase. This shuffling of amino acids and their H-bond interactions is likely to disturb the secondary structure orientation of the polypeptide and induces the gain-of-function in nucleoside phosphate kinase activity of AK5, which may eventually down-regulates the reactivity potential of CD4+ T-cells against gluten antigens. Our study underlines the need to have population-specific genome databases to avoid false leads and to identify true candidate causal genes for the familial form of celiac disease.

  2. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  3. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  4. The Use of Patient-Specific Induced Pluripotent Stem Cells (iPSCs to Identify Osteoclast Defects in Rare Genetic Bone Disorders

    Directory of Open Access Journals (Sweden)

    I-Ping Chen

    2014-12-01

    Full Text Available More than 500 rare genetic bone disorders have been described, but for many of them only limited treatment options are available. Challenges for studying these bone diseases come from a lack of suitable animal models and unavailability of skeletal tissues for studies. Effectors for skeletal abnormalities of bone disorders may be abnormal bone formation directed by osteoblasts or anomalous bone resorption by osteoclasts, or both. Patient-specific induced pluripotent stem cells (iPSCs can be generated from somatic cells of various tissue sources and in theory can be differentiated into any desired cell type. However, successful differentiation of hiPSCs into functional bone cells is still a challenge. Our group focuses on the use of human iPSCs (hiPSCs to identify osteoclast defects in craniometaphyseal dysplasia. In this review, we describe the impact of stem cell technology on research for better treatment of such disorders, the generation of hiPSCs from patients with rare genetic bone disorders and current protocols for differentiating hiPSCs into osteoclasts.

  5. Meta-analysis of rare and common exome chip variants identifies S1PR4 and other loci influencing blood cell traits

    DEFF Research Database (Denmark)

    Pankratz, Nathan; Schick, Ursula M; Zhou, Yi

    2016-01-01

    with Illumina HumanExome BeadChip genotypes. We then performed replication analyses of new discoveries in 18,018 European-American women and 5,261 Han Chinese. We identified and replicated four new erythrocyte trait-locus associations (CEP89, SHROOM3, FADS2, and APOE) and six new WBC loci for neutrophil count...... (S1PR4), monocyte count (BTBD8, NLRP12, and IL17RA), eosinophil count (IRF1), and total WBC count (MYB). The association of a rare missense variant in S1PR4 supports the role of sphingosine-1-phosphate signaling in leukocyte trafficking and circulating neutrophil counts. Loss-of-function experiments...... for S1pr4 in mouse and s1pr4 in zebrafish demonstrated phenotypes consistent with the association observed in humans and altered kinetics of neutrophil recruitment and resolution in response to tissue injury....

  6. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  7. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  8. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  9. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  10. Fifth Ovarian Cancer Consensus Conference of the Gynecologic Cancer InterGroup (GCIG): clinical trial design for rare ovarian tumours

    NARCIS (Netherlands)

    Leary, A. F.; Quinn, M.; Fujiwara, K.; Coleman, R. L.; Kohn, E.; Sugiyama, T.; Glasspool, R.; Ray-Coquard, I.; Colombo, N.; Bacon, M.; Zeimet, A.; Westermann, A.; Gomez-Garcia, E.; Provencher, D.; Welch, S.; Small, W.; Millan, D.; Okamoto, A.; Stuart, G.; Ochiai, K.

    2017-01-01

    This manuscript reports the consensus statements on designing clinical trials in rare ovarian tumours reached at the fifth Ovarian Cancer Consensus Conference (OCCC) held in Tokyo, November 2015. Three important questions were identified concerning rare ovarian tumours (rare epithelial ovarian

  11. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  12. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  13. Whole Exome Sequencing Identified a Novel Heterozygous Mutation in HMBS Gene in a Chinese Patient With Acute Intermittent Porphyria With Rare Type of Mild Anemia

    Directory of Open Access Journals (Sweden)

    Yongjiang Zheng

    2018-04-01

    Full Text Available Acute intermittent porphyria (AIP is a rare hereditary metabolic disease with an autosomal dominant mode of inheritance. Germline mutations of HMBS gene causes AIP. Mutation of HMBS gene results into the partial deficiency of the heme biosynthetic enzyme hydroxymethylbilane synthase. AIP is clinically manifested with abdominal pain, vomiting, and neurological complaints. Additionally, an extreme phenotypic heterogeneity has been reported in AIP patients with mutations in HMBS gene. Here, we investigated a Chinese patient with AIP. The proband is a 28-year-old Chinese male manifested with severe stomach ache, constipation, nausea and depression. Proband’s father and mother is normal. Proband’s blood sample was collected and genomic DNA was extracted. Whole exome sequencing and Sanger sequencing identified a heterozygous novel single nucleotide deletion (c.809delC in exon 12 of HMBS gene in the proband. This mutation leads to frameshift followed by formation of a truncated (p.Ala270Valfs∗2 HMBS protein with 272 amino acids comparing with the wild type HMBS protein of 361 amino acids. This mutation has not been found in proband’s unaffected parents as well as in 100 healthy normal control. According to the variant interpretation guidelines of American College of Medical Genetics and Genomics (ACMG, this variant is classified as “likely pathogenic” variant. Our findings expand the mutational spectra of HMBS gene related AIP which are significant for screening and genetic diagnosis for AIP.

  14. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  15. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  17. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  18. Rare earth element contents of the Lusi mud: An attempt to identify the environmental origin of the hot mudflow in East Java – Indonesia

    Directory of Open Access Journals (Sweden)

    Agustawijaya Didi Supriadi

    2017-12-01

    Full Text Available The Sidoarjo mudflow in East Java, Indonesia, has been erupting since May 29th, 2006. The eruption has been known as the Lusi (lumpur Sidoarjo, which was previously considered as a remote seismic event consequence, but current geyser-like activities show an association with a geothermal phenomenon. A method of characterizing rare earth elements (REE is commonly an effective tool for recognizing a geothermal system, and here it is adapted to particularly indicate the environmental origin of the Lusi mud. Results show that the Lusi hot mud is made of a porous smectite structure of a shale rock type, which becomes an ideal tank for trapping the REE, especially the light REE. Volcanic activities seem to be an important influence in the eruption; however, since there is a lack of significant isotopic evidences in the mobilization of the REE during the eruption, the chloride neutral pH water of the Lusi may hardly contain the REE. The moderate Ce and Eu anomalies found in the REE patterns of the mud strongly indicate a sea-floor basin as the most probable environment for the REE fractionation during the sedimentary rock formation, in which the weathering processes of volcanic rock origin enriched the Lusi shale with the REE.

  19. Screening for ROS1 gene rearrangements in non-small cell lung cancers using immunohistochemistry with FISH confirmation is an effective method to identify this rare target

    Science.gov (United States)

    Selinger, Christina I; Li, Bob T; Pavlakis, Nick; Links, Matthew; Gill, Anthony J; Lee, Adrian; Clarke, Stephen; Tran, Thang N; Lum, Trina; Yip, Po Yee; Horvath, Lisa; Yu, Bing; Kohonen-Corish, Maija RJ; O’Toole, Sandra A; Cooper, Wendy A

    2016-01-01

    Aims To assess the prevalence of ROS1 rearrangements in a retrospective and prospective diagnostic Australian cohort and evaluate the effectiveness of immunohistochemical screening. Methods A retrospective cohort of 278 early stage lung adenocarcinomas and an additional 104 prospective NSCLC cases referred for routine molecular testing were evaluated. ROS1 immunohistochemistry (IHC) was performed (D4D6 clone, Cell Signaling Technology) on all cases as well as fluorescence in situ hybridisation (FISH) using the ZytoVision and Abbott Molecular ROS1 FISH probes, with ≥15% of cells with split signals considered positive for rearrangement. Results Eighty eight cases (32%) from the retrospective cohort showed staining by ROS1 IHC, and one case (0.4%) showed ROS1 rearrangement by FISH. Nineteen of the prospective diagnostic cases showed ROS1 IHC staining of which 12 (12%) cases were confirmed as ROS1 rearranged by FISH. There were no ROS1 rearranged cases that showed no expression of ROS1 with IHC. The ROS1 rearranged cases in the prospective cohort were all EGFR wildtype and ALK rearrangement negative. The sensitivity of ROS1 IHC in the retrospective cohort was 100% and specificity was 76%. Conclusions ROS1 rearrangements are rare events in lung adenocarcinomas. Selection of cases for ROS1 FISH testing, by excluding EGFR/ALK positive cases and use of IHC to screen for potentially positive cases can be used to enrich for the likelihood of a identifying a ROS1 rearranged lung cancer and prevent the need to undertake expensive and time consuming FISH testing in all cases. PMID:27599111

  20. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  1. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  2. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  3. Mining with Rare Cases

    Science.gov (United States)

    Weiss, Gary M.

    Rare cases are often the most interesting cases. For example, in medical diagnosis one is typically interested in identifying relatively rare diseases, such as cancer, rather than more frequently occurring ones, such as the common cold. In this chapter we discuss the role of rare cases in Data Mining. Specific problems associated with mining rare cases are discussed, followed by a description of methods for addressing these problems.

  4. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  5. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  6. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  7. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  8. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  9. A rare case of important and recurrent abnormal uterine bleeding in a post partum woman caused by cavernous hemangioma: a case report and review of literature.

    Science.gov (United States)

    Aka, Kacou Edele; Apollinaire Horo, Gninlgninrin; Fomba, Minata; Kouyate, Salif; Koffi, Abdoul Koffi; Konan, Seni; Fanny, Mohamed; Effi, Benjamin; Kone, Mamourou

    2017-01-01

    The cavernous hemangioma is a rare benign vascular tumor. About 50 cases of this disease were found in the literature over the last century and only 9 cases of cavernous hemangioma on the pregnant uterus were published it comes into cavernous or capillary form. The symptomatology is not unequivocal and when it occurs during pregnancy or postpartum, it causes life-threatening cataclysmic hemorrhage. Antenatal diagnosis is difficult and requires a multidisciplinary approach with pathologists, radiologists and gynecologists to avoid these complications or unnecessary hysterectomies. The diagnosis is histological. Hysterectomy is possible after failure of conservative treatment means. We report a rare case, a novel mixed cavernous hemangioma of the body associated with a capillary hemangioma of the cervix in a patient of 28 years 5th visors with recurrent genital bleeding in the postpartum period leading to a hysterectomy.

  10. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  11. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  12. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  13. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  14. Rare earths

    Energy Technology Data Exchange (ETDEWEB)

    Cranstone, D A

    1979-01-01

    Rare earth elements are commonly extracted from the minerals monazite, bastnaesite, and xenotine. New uses for these elements are constantly developing; they have found applications in glass polishing, television tube phosphors, high-strength low-alloy steels, magnets, catalysts, refractory ceramics, and hydrogen sponge alloys. In Canada, rare earths have been produced as byproducts of the uranium mining industry, but there was no production of rare earths in 1978 or 1979. The world sources of and markets for the rare earth elements are discussed.

  15. Rare lung cancers

    International Nuclear Information System (INIS)

    Berzinec, P.

    2013-01-01

    The RARECARE Project (Rare Cancers in the Europe) supported by the European Union defined the rare cancers by the incidence rate of less than 6/100 000. There are several variants of lung cancer which are rare according to this definition. From the clinical point of view the most interesting are the rare adenocarcinomas and large cell neuroendocrine carcinoma. There are important differences in the diagnostic probability of EGFR and ALK mutations in the mutinous and non-mucin ous adenocarcinomas, in the signet ring cell adenocarcinomas, and large cell carcinomas. The optimal chemotherapy for neuroendocrine large cell carcinomas remains undefined. There is only very limited number of clinical trials aimed on the rare lung cancers and actually none phase III trial. Rare lung cancers continue to be a challenge both for the laboratory and the clinical research. (author)

  16. Rare earths

    International Nuclear Information System (INIS)

    1984-01-01

    The conference was held from September 12 to 13, 1984 in Jetrichovice, Czechoslovakia. The participants heard 16 papers of which 4 were inputted in INIS. These papers dealt with industrial separation processes of rare earths, the use of chemical methods of separation from the concentrate of apatite and bastnesite, the effect of the relative permittivity of solvents in the elution of rare earth elements from a cation exchanger, and the determination of the content of different rare earth elements using X-ray fluorescence analysis and atomic absorption spectroscopy. (E.S.)

  17. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  18. A rare case of extensive skeletal muscle metastases in adenocarcinoma cervix identified by 18F-fluorodeoxyglucose positron emission tomography/computed tomography scan

    International Nuclear Information System (INIS)

    Vishnoi, Madan Gopal; Jain, Anurag; John, Arun Ravi; Paliwal, Dharmesh

    2016-01-01

    Adenocarcinoma cervix is an uncommon histological subtype of carcinoma cervix; further incidence of skeletal muscle metastases is even rarer. We report the identification of extensive fluorodeoxyglucose (FDG) avid metastatic skeletal muscle deposits in a known case of adenocarcinoma cervix. The largest lesion representative of muscle deposit in the right deltoid was histopathologically confirmed to be metastatic poorly differentiated carcinoma. This report also serves to highlight the importance of 18 F-FDG positron emission tomography/computed tomography (CT) as compared to conventional imaging modalities such as CT and ultrasonography and comments better over the description of invasiveness as well as the extent of disease in carcinoma cervix

  19. Rare particles

    International Nuclear Information System (INIS)

    Kutschera, W.

    1984-01-01

    The use of Accelerator Mass Spectrometry (AMS) to search for hypothetical particles and known particles of rare processes is discussed. The hypothetical particles considered include fractionally charged particles, anomalously heavy isotopes, and superheavy elements. The known particles produced in rare processes discussed include doubly-charged negative ions, counting neutrino-produced atoms in detectors for solar neutrino detection, and the spontaneous emission of 14 C from 223 Ra. 35 references

  20. The use of population viability analysis to identify possible factors contributing to the decline of a rare ungulate population in south-eastern Zimbabwe

    Directory of Open Access Journals (Sweden)

    Simon D. Capon

    2013-02-01

    Full Text Available Populations that are vulnerable to decline are of particular concern to wildlife managers and uncovering the mechanisms responsible for downward trends is a crucial step towards developing future viable populations. The aims of this study were to better understand the mechanisms behind the historic decline of the sable antelope, Hippotragus niger, population at the Malilangwe Wildlife Reserve (MWR, to assess its future viability and to use this analysis to determine key areas of breakdown in population growth and link these to potential limiting factors. VORTEX, a population viability model was used to assess the future viability of the sable antelope population and a sensitivity analysis was applied to identify the key areas of breakdown in growth. The sable population is currently viable, but remains highly vulnerable to changes in adult female survival, a factor which had the greatest influence on overall population fitness. Lion predation, impacting on the adult segment of the population, appeared to be the main factor responsible for the historic decline at the MWR.Conservation implications: Sable generally occur at low densities in the lowveld region of Zimbabwe and, as such, populations are vulnerable to increases in mortality rates. The role of lions in driving the decline at the MWR suggests a need to control their numbers and develop prey refuges through improved management of artificial water.

  1. Electrocardiogram as an important tool in Preventive & Community Medicine - A rare case report of asymptomatic non paroxysmal accelerated junctional rhythm detected on routine ECG

    Directory of Open Access Journals (Sweden)

    Raghavendra Deolalikar

    2015-03-01

    Full Text Available Fifty four year old asymptomatic employee was detected to have Inverted P waves with normal QRS complex on Electrocardiogram [ECG] during his Annual Medical Examination. The ECG reverted to normal after few days. Inverted P is suggestive of retrograde conduct of impulse from A-V Node. Case of Non Paroxysmal Accelerated Junctional Rhythm. Causes are inferior wall myocardial infarction, myocarditis or recent open heart surgery. Troponin T Test was negative, Treadmill test was negative, and 2D Echo showed 55 % ejection fraction with no regional wall motion abnormalities. It needs no treatment if underlying causes are ruled out. Case would have gone un-noticed as patient was asymptomatic, thus emphasizing the importance of ECG in preventive and community medicine.

  2. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  3. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  4. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  5. Rare Events

    Science.gov (United States)

    2009-10-01

    Limited Operational Exercise 1. 1A Limited Operational Exercise is a multiplayer experiment designed to exploit and study information sharing and...1.4 Summary of the Study The “rare event” of interest is an extreme, deliberate act of violence , destruction or socioeconomic disruption, such as an...connection with terrorism inves- tigations. The programs then use some combination of doctrinal revision and rewards to induce the people to abandon violence

  6. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  7. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  8. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  9. Exome-Wide Association Study Identifies New Low-Frequency and Rare UGT1A1 Coding Variants and UGT1A6 Coding Variants Influencing Serum Bilirubin in Elderly Subjects

    Science.gov (United States)

    Oussalah, Abderrahim; Bosco, Paolo; Anello, Guido; Spada, Rosario; Guéant-Rodriguez, Rosa-Maria; Chery, Céline; Rouyer, Pierre; Josse, Thomas; Romano, Antonino; Elia, Maurizzio; Bronowicki, Jean-Pierre; Guéant, Jean-Louis

    2015-01-01

    Abstract Genome-wide association studies (GWASs) have identified loci contributing to total serum bilirubin level. However, no exome-wide approaches have been performed to address this question. Using exome-wide approach, we assessed the influence of protein-coding variants on unconjugated, conjugated, and total serum bilirubin levels in a well-characterized cohort of 773 ambulatory elderly subjects from Italy. Coding variants were replicated in 227 elderly subjects from the same area. We identified 4 missense rare (minor allele frequency, MAF bilirubin level (P = 2.34 × 10−34, P = 7.02 × 10−34, and P = 8.27 × 10−34), as well as unconjugated, and conjugated bilirubin levels. We also identified UGT1A6 variants in association with total (rs6759892, p.Ser7Ala, P = 1.98 × 10−26; rs2070959, p.Thr181Ala, P = 2.87 × 10−27; and rs1105879, p.Arg184Ser, P = 3.27 × 10−29), unconjugated, and conjugated bilirubin levels. All UGT1A1 intronic variants (rs887829, rs6742078, and rs4148325) and UGT1A6 coding variants (rs6759892, rs2070959, and rs1105879) were significantly associated with gallstone-related cholecystectomy risk. The UGT1A6 variant rs2070959 (p.Thr181Ala) was associated with the highest risk of gallstone–related cholecystectomy (OR, 4.58; 95% CI, 1.58–13.28; P = 3.21 × 10−3). Using an exome-wide approach we identified coding variants on UGT1A1 and UGT1A6 genes in association with serum bilirubin level and hyperbilirubinemia risk in elderly subjects. UGT1A1 intronic single-nucleotide polymorphisms (SNPs) (rs6742078, rs887829, rs4148324) serve as proxy markers for the low-frequency and rare UGT1A1 variants, thereby providing mechanistic explanation to the relationship between UGT1A1 intronic SNPs and the UGT1A1 enzyme activity. UGT1A1 and UGT1A6 variants might be potentially associated with gallstone-related cholecystectomy risk. PMID:26039129

  10. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  11. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  12. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  14. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  15. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  16. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  17. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  18. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  19. Rare earths as a future resource

    International Nuclear Information System (INIS)

    Cornell, D.H.

    1988-01-01

    The fourteen rare earth or lanthanide elements have recently emerged as an important natural resource because of the rapidly growing demand in the electronic, chemical and metallurgical industries. The Symposium on rare earth elements as a future resource presented a multidisciplinary review of rare earth chemistry, geology, beneficiation, industrial applications and marketing. Papers by experts in many fields were presented on the following topics: chemical properties of the rare earth elements; the analysis of rare earth elements and minerals; beneficiation and extraction of rare earth elements; economic geochemistry and mineralogy of rare earths; present industrial uses of rare earth elements; the role of rare earth elements in high-temperature superconductors; the technical application of high-temperature superconductors; supply and demand for rare earth products - now and in the future, and the geology of rare earth deposits

  20. Rare events: a state of the art

    International Nuclear Information System (INIS)

    Uppuluri, V.R.R.

    1980-12-01

    The study of rare events has become increasingly important in the context of nuclear safety. Some philosophical considerations, such as the framework for the definition of a rare event, rare events and science, rare events and trans-science, and rare events and public perception, are discussed. The technical work of the Task Force on problems of Rare Events in the Reliability Analysis of Nuclear Plants (1976-1978), sponsored by OECD, is reviewed. Some recent technical considerations are discussed, and conclusions are drawn. The appendix contains an essay written by Anne E. Beachey, under the title: A Study of Rare Events - Problems and Promises

  1. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  2. Importance Sampling for Stochastic Timed Automata

    DEFF Research Database (Denmark)

    Jegourel, Cyrille; Larsen, Kim Guldstrand; Legay, Axel

    2016-01-01

    We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state-wise cha......We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state...

  3. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  4. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  5. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  6. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  7. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  8. China's rare-earth industry

    Science.gov (United States)

    Tse, Pui-Kwan

    2011-01-01

    Introduction China's dominant position as the producer of over 95 percent of the world output of rare-earth minerals and rapid increases in the consumption of rare earths owing to the emergence of new clean-energy and defense-related technologies, combined with China's decisions to restrict exports of rare earths, have resulted in heightened concerns about the future availability of rare earths. As a result, industrial countries such as Japan, the United States, and countries of the European Union face tighter supplies and higher prices for rare earths. This paper briefly reviews China's rare-earth production, consumption, and reserves and the important policies and regulations regarding the production and trade of rare earths, including recently announced export quotas. The 15 lanthanide elements-lanthanum, cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, and lutetium (atomic numbers 57-71)-were originally known as the rare earths from their occurrence in oxides mixtures. Recently, some researchers have included two other elements-scandium and yttrium-in their discussion of rare earths. Yttrium (atomic number 39), which lies above lanthanum in transition group III of the periodic table and has a similar 3+ ion with a noble gas core, has both atomic and ionic radii similar in size to those of terbium and dysprosium and is generally found in nature with lanthanides. Scandium (atomic number 21) has a smaller ionic radius than yttrium and the lanthanides, and its chemical behavior is intermediate between that of aluminum and the lanthanides. It is found in nature with the lanthanides and yttrium. Rare earths are used widely in high-technology and clean-energy products because they impart special properties of magnetism, luminescence, and strength. Rare earths are also used in weapon systems to obtain the same properties.

  9. Rare earths 1998 market update

    International Nuclear Information System (INIS)

    Tourre, J.M.

    1998-01-01

    The rare earth industry has always been a world of rapid change with the emergence of new markets, new ores and new players, as well as the disappearance of old applications. Rare earth based products are used in a great diversity of applications such as hard disk drives, CD drives, batteries, capacitors, pigments, ceramics, polishing powders, fuel cells, flints, catalyst converter, fluid cracking catalysts, etc. South East Asia holds the largest share of the known reserve of rare earth ores and is one of the major markets for rare earth compounds; in the last ten years, China has become the largest producer of rare earth intermediates as well as an important exporter of separated rare earth elements. Today, China has approximately 150 factories producing rare earth compounds, most of which are experiencing financial difficulties due to the lack of knowledge of true market needs, lack of control of their distribution channels and production over-capacity. Recently the Chinese rare earth producers have recognized the situation and efforts are underway to rationalize rare earth production. Japan has dominated many of the major application markets, and is by far the largest market for metal and alloy products. This will remain the case for the next five years; however, new countries are emerging as significant users of rare earth products such as Korea, Taiwan and Malaysia. During the last ten years rare earth producers adjusted to several radical changes that affected the raw materials, the application mix and the price structure. New producers have emerged, especially from China; some have subsequently stopped their activities while others have focused their efforts in a specific market segment

  10. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  11. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  12. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  13. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  14. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  15. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  16. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  17. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  18. Rare metal and rare earth pegmatites of Western India

    International Nuclear Information System (INIS)

    Maithani, P.B.; Nagar, R.K.

    1999-01-01

    Rajasthan Mica Belt in western India is one of the three major mica-producing Proterozoic pegmatite belts of India, the others being in Bihar and Andhra Pradesh. The pegmatites of these mica belts, in general, are associated with the rare metal (RM) and rare earth element (REE)-bearing minerals like columbite-tantalite, beryl, lepidolite and other multiple oxides. RM-REE pegmatites of Gujarat are devoid of commercially workable mica. These pegmatites are geologically characterised in this paper, based on their association with granite plutons geochemistry, and RM and REE potential. In addition to RM and RE-bearing pegmatites, granites of the Umedpur area, Gujarat also show anomalous concentration (0.97 wt%) of rare metals (6431 ppm Nb, 1266 ppm Ta, 454 ppm Sn, 173 ppm W), (1098 ppm Ce 1.36% Y 2 O 3 ) rare earths, and uranium (0.40% eU 3 O 8 ). Eluvial concentrations in the soil and panned concentrate (0.04-0.28 wt%) analysed up to 7.4%Nb 2 O 5 , 836 ppm Ta, and 1.31% Y. Discrete columbite-tantalite and betafite have been identified in these concentrates in addition to other minerals like zircon, rutile, sphene and xenotime. This area with discrete RM R EE mineral phases could be significant as a non-pegmatite source for rare metal and rare earths. (author)

  19. Rare earth mobility in hydrothermal ore-forming systems

    International Nuclear Information System (INIS)

    Cornell, D.H.; Schade, J.; Scheepers, R.; Watkeys, M.K.

    1988-01-01

    Rocks and ores which form by magmatic processes display a range of chondrite-normalised rare earth profiles. One REE (rare earth elements) profile feature which seems unrelated to magmatic processes is the birdwing profile, in which both heavy and light rare earths are enriched relative to the middle rare earths. Birdwing rare earth profiles are an easily identified geochemical anomaly. It is proposed that rare earth geochemistry could be applied in geochemical prospecting for ore formed by hydrothermal processes. 5 figs

  20. Rare Earth Polyoxometalates.

    Science.gov (United States)

    Boskovic, Colette

    2017-09-19

    Longstanding and important applications make use of the chemical and physical properties of both rare earth metals and polyoxometalates of early transition metals. The catalytic, optical, and magnetic features of rare earth metal ions are well-known, as are the reversible multielectron redox and photoredox capabilities of polyoxomolybdates and polyoxotungstates. The combination of rare earth ions and polyoxometalates in discrete molecules and coordination polymers is of interest for the unique combination of chemical and physical properties that can arise. This Account surveys our efforts to synthesize and investigate compounds with rare earth ions and polyoxometalates (RE-POMs), sometimes with carboxylate-based organic coligands. Our general synthetic approach is "bottom-up", which affords well-defined nanoscale molecules, typically in crystalline form and amenable to single-crystal X-ray diffraction for structure determination. Our particular focus is on elucidation of the physical properties conferred by the different structural components with a view to ultimately being able to tune these properties chemically. For this purpose, we employ a variety of spectroscopic, magnetochemical, electrochemical, and scattering techniques in concert with theoretical modeling and computation. Studies of RE-POM single-molecule magnets (SMMs) have utilized magnetic susceptibility, inelastic neutron scattering, and ab initio calculations. These investigations have allowed characterization of the crystal field splitting of the rare earth(III) ions that is responsible for the SMM properties of slow magnetic relaxation and magnetization quantum tunneling. Such SMMs are promising for applications in quantum computing and molecular spintronics. Photophysical measurements of a family of hybrid RE-POMs with organic ligands have afforded insights into sensitization of Tb(III) and Eu(III) emission through both organic and polyoxometalate chromophores in the same molecule. Detailed

  1. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  2. Rare earth germanates

    International Nuclear Information System (INIS)

    Bondar', I.A.; Vinogradova, N.V.; Dem'yanets, L.N.

    1983-01-01

    Rare earth germanates attract close attention both as an independent class of compounds and analogues of a widely spread class of natural and synthetic minerals. The methods of rare earth germanate synthesis (solid-phase, hydrothermal) are considered. Systems on the basis of germanium and rare earth oxides, phase diagrams, phase transformations are studied. Using different chemical analysese the processes of rare earth germanate formation are investigated. IR spectra of alkali and rare earth metal germanates are presented, their comparative analysis being carried out. Crystal structures of the compounds, lattice parameters are studied. Fields of possible application of rare earth germanates are shown

  3. Population structure analysis using rare and common functional variants

    Directory of Open Access Journals (Sweden)

    Ding Lili

    2011-11-01

    Full Text Available Abstract Next-generation sequencing technologies now make it possible to genotype and measure hundreds of thousands of rare genetic variations in individuals across the genome. Characterization of high-density genetic variation facilitates control of population genetic structure on a finer scale before large-scale genotyping in disease genetics studies. Population structure is a well-known, prevalent, and important factor in common variant genetic studies, but its relevance in rare variants is unclear. We perform an extensive population structure analysis using common and rare functional variants from the Genetic Analysis Workshop 17 mini-exome sequence. The analysis based on common functional variants required 388 principal components to account for 90% of the variation in population structure. However, an analysis based on rare variants required 532 significant principal components to account for similar levels of variation. Using rare variants, we detected fine-scale substructure beyond the population structure identified using common functional variants. Our results show that the level of population structure embedded in rare variant data is different from the level embedded in common variant data and that correcting for population structure is only as good as the level one wishes to correct.

  4. Rare earth sulfates

    International Nuclear Information System (INIS)

    Komissarova, L.N.; Shatskij, V.M.; Pokrovskij, A.N.; Chizhov, S.M.; Bal'kina, T.I.; Suponitskij, Yu.L.

    1986-01-01

    Results of experimental works on the study of synthesis conditions, structure and physico-chemical properties of rare earth, scandium and yttrium sulfates, have been generalized. Phase diagrams of solubility and fusibility, thermodynamic and crystallochemical characteristics, thermal stability of hydrates and anhydrous sulfates of rare earths, including normal, double (with cations of alkali and alkaline-earth metals), ternary and anion-mixed sulfates of rare earths, as well as their adducts, are considered. The state of ions of rare earths, scandium and yttrium in aqueous sulfuric acid solutions is discussed. Data on the use of rare earth sulfates are given

  5. Bayesian analysis of rare events

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Daniel, E-mail: straub@tum.de; Papaioannou, Iason; Betz, Wolfgang

    2016-06-01

    In many areas of engineering and science there is an interest in predicting the probability of rare events, in particular in applications related to safety and security. Increasingly, such predictions are made through computer models of physical systems in an uncertainty quantification framework. Additionally, with advances in IT, monitoring and sensor technology, an increasing amount of data on the performance of the systems is collected. This data can be used to reduce uncertainty, improve the probability estimates and consequently enhance the management of rare events and associated risks. Bayesian analysis is the ideal method to include the data into the probabilistic model. It ensures a consistent probabilistic treatment of uncertainty, which is central in the prediction of rare events, where extrapolation from the domain of observation is common. We present a framework for performing Bayesian updating of rare event probabilities, termed BUS. It is based on a reinterpretation of the classical rejection-sampling approach to Bayesian analysis, which enables the use of established methods for estimating probabilities of rare events. By drawing upon these methods, the framework makes use of their computational efficiency. These methods include the First-Order Reliability Method (FORM), tailored importance sampling (IS) methods and Subset Simulation (SuS). In this contribution, we briefly review these methods in the context of the BUS framework and investigate their applicability to Bayesian analysis of rare events in different settings. We find that, for some applications, FORM can be highly efficient and is surprisingly accurate, enabling Bayesian analysis of rare events with just a few model evaluations. In a general setting, BUS implemented through IS and SuS is more robust and flexible.

  6. Spectroscopic properties of rare earths in optical materials

    CERN Document Server

    Parisi, Jürgen; Osgood, R; Warlimont, Hans; Liu, Guokui; Jacquier, Bernard

    2005-01-01

    Aimed at researchers and graduate students, this book provides up-to-date information for understanding electronic interactions that impact the optical properties of rare earth ions in solids. Its goal is to establish a connection between fundamental principles and the materials properties of rare-earth activated luminescent and laser optical materials. The theoretical survey and introduction to spectroscopic properties include electronic energy level structure, intensities of optical transitions, ion-phonon interactions, line broadening, and energy transfer and up-conversion. An important aspect of the book lies in its deep and detailed discussions on materials properties and the potential of new applications such as optical storage, information processing, nanophotonics, and molecular probes that have been identified in recent experimental studies. This volume will be a valuable reference book on advanced topics of rare earth spectroscopy and materials science.

  7. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  8. Towards Rare Itemset Mining

    OpenAIRE

    Szathmary , Laszlo; Napoli , Amedeo; Valtchev , Petko

    2007-01-01

    site de la conférence : http://ictai07.ceid.upatras.gr/; International audience; We describe here a general approach for rare itemset mining. While mining literature has been almost exclusively focused on frequent itemsets, in many practical situations rare ones are of higher interest (e.g., in medical databases, rare combinations of symptoms might provide useful insights for the physicians). Based on an examination of the relevant substructures of the mining space, our approach splits the ra...

  9. RARE DISEASES AND GENETIC DISCRIMINATION

    Directory of Open Access Journals (Sweden)

    Mariela Yaneva – Deliverska

    2011-04-01

    Full Text Available Rare diseases are characterised by their low prevalence (less than 1/2,000 and their heterogeneity. They affect both children and adults anywhere in the world. From the medical perspective, rare diseases are characterised by the large number and broad diversity of disorders and symptoms that vary not only from disease to disease, but also within the same disease.Main characteristics of rare diseases include:· Rare diseases are often chronic, progressive, degenerative, and often life-threatening· Rare diseases are disabling: the quality of life of patients is often compromised by the lack or loss of autonomy· High level of pain and suffering for the patient and his/ her family · No existing effective cure· There are between 6000 and 8000 rare diseases· 75% of rare diseases affect children· 30% of rare disease patients die before the age of 5· 80% of rare diseases have identified genetic origins. Other rare diseases are the result of infections (bacterial or viral, allergies and environmental causes, or are degenerative and proliferative.Beyond the diversity of the diseases, rare disease patients and their families are confronted with the same wide range of difficulties arising directly from the rarity of these pathologies. The period between the emergence of the first symptoms and the appropriate diagnosis involves unacceptable and highly risky delays, as well as wrong diagnosis leading to inaccurate treatments. Living with a rare disease has implications in all areas of life, whether school, choice of future work, leisure time with friends, or affective life. It may lead to stigmatisation, isolation, exclusion from social community, discrimination for insurance subscription (health insurance, travel insurance, mortgage, and often reduced professional opportunities.Innovative treatments are often unevenly available in the EU because of delays in price determination and/or reimbursement decision, lack of experience of the treating

  10. Rare earth octacyanomolybdates(4)

    International Nuclear Information System (INIS)

    Zubritskaya, D.I.; Sergeeva, A.N.; Pisak, Yu.V.

    1980-01-01

    Optimal conditions for synthesis of rare-earth octacyanomolybdates(4) of the Ln 4 [Mo(CN) 8 ] 3 xnH 2 O composition (where Ln is a rare-earth element, other than Pr, Pm, Lu, Tb) have been worked out. The synthesis has been accomplished by neutralization with octacianomolybdic acid with rare-earth carbonates. The composition and structure of the compounds synthesized have been studied by infrared-spectroscopy. It has been established that rare-earth octacyanomolybdates(4) form three isostructural groups

  11. Therapeutics for Rare and Neglected Diseases

    Data.gov (United States)

    Federal Laboratory Consortium — There are more than 6,500 identified rare and neglected diseases, yet only about 250 treatments are available for these conditions. The limited numbers of patients...

  12. Os Odontoideum: Rare Cervical Lesion

    Directory of Open Access Journals (Sweden)

    Kristie A Robson

    2011-05-01

    Full Text Available We report the case of a 22-year-old Marine who presented to the emergency department, after a martial arts exercise, with transient weakness and numbness in all extremities. Computed tomography cervical spine radiographs revealed os odontoideum. Lateral flexion–extension radiographs identified atlanto-axillary instability. This abnormality is rare and can be career ending for military members who do not undergo surgical fusion. [West J Emerg Med. 2011;12(4:520–522.

  13. Rare Earth Oxide Thin Films

    CERN Document Server

    Fanciulli, Marco

    2007-01-01

    Thin rare earth (RE) oxide films are emerging materials for microelectronic, nanoelectronic, and spintronic applications. The state-of-the-art of thin film deposition techniques as well as the structural, physical, chemical, and electrical properties of thin RE oxide films and of their interface with semiconducting substrates are discussed. The aim is to identify proper methodologies for the development of RE oxides thin films and to evaluate their effectiveness as innovative materials in different applications.

  14. Why some plant species are rare.

    Science.gov (United States)

    Wieger Wamelink, G W; Wamelink, G W Weiger; Goedhart, Paul W; Frissel, Joep; Frissel, Josep Y

    2014-01-01

    Biodiversity, including plant species diversity, is threatened worldwide as a result of anthropogenic pressures such as an increase of pollutants and climate change. Rare species in particular are on the verge of becoming extinct. It is still unclear as to why some plant species are rare and others are not. Are they rare due to: intrinsic reasons, dispersal capacity, the effects of management or abiotic circumstances? Habitat preference of rare plant species may play an important role in determining why some species are rare. Based on an extensive data set of soil parameters we investigated if rarity is due to a narrow habitat preference for abiotic soil parameters. For 23 different abiotic soil parameters, of which the most influential were groundwater-table, soil-pH and nutrient-contents, we estimated species responses for common and rare species. Based on the responses per species we calculated the range of occurrence, the range between the 5 and 95 percentile of the response curve giving the habitat preference. Subsequently, we calculated the average response range for common and rare species. In addition, we designed a new graphic in order to provide a better means for presentation of the results. The habitat preferences of rare species for abiotic soil conditions are significantly narrower than for common species. Twenty of the twenty-three abiotic parameters showed on average significantly narrower habitat preferences for rare species than for common species; none of the abiotic parameters showed on average a narrower habitat preference for common species. The results have major implications for the conservation of rare plant species; accordingly management and nature development should be focussed on the maintenance and creation of a broad range of environmental conditions, so that the requirements of rare species are met. The conservation of (abiotic) gradients within ecosystems is particularly important for preserving rare species.

  15. Aspergillus Salpingitis: A Rare Case Report

    African Journals Online (AJOL)

    rare entity, the correct diagnosis is of great importance for the indication of proper therapy. KEY WORDS: America ... Salpingitis is the most common serious infection in women .... immune systems, especially those recipients of stem-cell and.

  16. Rare Disease Video Portal

    OpenAIRE

    Sánchez Bocanegra, Carlos Luis

    2011-01-01

    Rare Disease Video Portal (RD Video) is a portal web where contains videos from Youtube including all details from 12 channels of Youtube. Rare Disease Video Portal (RD Video) es un portal web que contiene los vídeos de Youtube incluyendo todos los detalles de 12 canales de Youtube. Rare Disease Video Portal (RD Video) és un portal web que conté els vídeos de Youtube i que inclou tots els detalls de 12 Canals de Youtube.

  17. Rare earth germanates

    International Nuclear Information System (INIS)

    Bondar', I.A.; Vinogradova, N.V.; Dem'yanets, L.N.

    1983-01-01

    From the viewpoint of structural chemistry and general regularities controlling formation reactions of compounds and phases in melts, solid and gaseous states, recent achievements in the chemistry of rare earth germanates are generalized. Methods of synthesizing germanates, systems on the base of germanium oxides and rare earths are considered. The data on crystallochemical characteristics are tabulated. Individual compounds of scandium germanate are also characterized. Processes of germanate formation using the data of IR-spectroscopy, X-ray phase analysis are studied. The structure and morphotropic series of rare earth germanates and silicates are determined. Fields of their present and possible future application are considered

  18. Analysis of rare categories

    CERN Document Server

    He, Jingrui

    2012-01-01

    This book focuses on rare category analysis where the majority classes have smooth distributions and the minority classes exhibit the compactness property. It focuses on challenging cases where the support regions of the majority and minority classes overlap.

  19. SYMPOSIUM: Rare decays

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1989-04-15

    Late last year, a symposium entitled 'Rare Decays' attracted 115 participants to a hotel in Vancouver, Canada. These participants were particle physicists interested in checking conventional selection rules to look for clues of possible new behaviour outside today's accepted 'Standard Model'. For physicists, 'rare decays' include processes that have so far not been seen, explicitly forbidden by the rules of the Standard Model, or processes highly suppressed because the decay is dominated by an easier route, or includes processes resulting from multiple transitions.

  20. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  1. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  2. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  3. Neonatal hemophilia: a rare presentation

    Directory of Open Access Journals (Sweden)

    Nuno Ferreira

    2015-12-01

    Full Text Available Hemophilia A is a X-linked hereditary condition that lead to decreased factor VIII activity, occurs mainly in males. Decreased factor VIII activity leads to increased risk of bleeding events. During neonatal period, diagnosis is made after post-partum bleeding complication or unexpected bleeding after medical procedures. Subgaleal hemorrhage during neonatal period is a rare, severe extracranial bleeding with high mortality and usually related to traumatic labor or coagulation disorders. Subgaleal hemorrhage complications result from massive bleeding. We present a neonate with unremarkable family history and uneventful pregnancy with a vaginal delivery with no instrumentation, presenting with severe subgaleal bleeding at 52 hours of life. Aggressive support measures were implemented and bleeding managed. The unexpected bleeding lead to a coagulation study and the diagnosis of severe hemophilia A. There were no known sequelae. This case shows a rare hemophilia presentation reflecting the importance of coagulation studies when faced with unexplained severe bleeding.

  4. Rare earths and actinides

    International Nuclear Information System (INIS)

    Coqblin, B.

    1982-01-01

    This paper reviews the different properties of rare-earths and actinides, either as pure metals or as in alloys or compounds. Three different cases are considered: (i) First, in the case of 'normal' rare-earths which are characterized by a valence of 3, we discuss essentially the magnetic ordering, the coexistence between superconductivity and magnetism and the properties of amorphous rare-earth systems. (ii) Second, in the case of 'anomalous' rare-earths, we distinguish between either 'intermediate-valence' systems or 'Kondo' systems. Special emphasis is given to the problems of the 'Kondo lattice' (for compounds such as CeAl 2 ,CeAl 3 or CeB 6 ) or the 'Anderson lattice' (for compounds such as TmSe). The problem of neutron diffraction in these systems is also discussed. (iii) Third, in the case of actinides, we can separate between the d-f hybridized and almost magnetic metals at the beginning of the series and the rare-earth like the metals after americium. (orig.)

  5. Rare Z decays and neutrino flavor universality

    Energy Technology Data Exchange (ETDEWEB)

    Durieux, Gauthier [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Cornell Univ. Ithaca, NY (United States). Lab. for Elementary Particle Physics; Univ. Catholique de Louvain, Louvain-la-Neuve (Belgium). Centre for Cosmology, Particle Physics and Phenomenology; Grossman, Yuval; Kuflik, Erik [Cornell Univ. Ithaca, NY (United States). Lab. for Elementary Particle Physics; Koenig, Matthias [Mainz Univ. (Germany). PRISMA Cluster of Excellence; Mainz Univ. (Germany). Mainz Inst. for Theoretical Physics; Ray, Shamayita [Cornell Univ. Ithaca, NY (United States). Lab. for Elementary Particle Physics; Calcutta Univ. (India). Dept. of Physics

    2015-12-15

    We study rare four-body decays of the Z-boson involving at least one neutrino and one charged lepton. Large destructive interferences make these decays very sensitive to the Z couplings to neutrinos. As the identified charged leptons can determine the neutrino flavors, these decays probe the universality of the Z couplings to neutrinos. The rare four-body processes could be accurately measured at future lepton colliders, leading to percent level precision.

  6. Community Assembly Processes of the Microbial Rare Biosphere.

    Science.gov (United States)

    Jia, Xiu; Dini-Andreote, Francisco; Falcão Salles, Joana

    2018-03-14

    Our planet teems with microorganisms that often present a skewed abundance distribution in a local community, with relatively few dominant species coexisting alongside a high number of rare species. Recent studies have demonstrated that these rare taxa serve as limitless reservoirs of genetic diversity, and perform disproportionate types of functions despite their low abundances. However, relatively little is known about the mechanisms controlling rarity and the processes promoting the development of the rare biosphere. Here, we propose the use of multivariate cut-offs to estimate rare species and phylogenetic null models applied to predefined rare taxa to disentangle the relative influences of ecoevolutionary processes mediating the assembly of the rare biosphere. Importantly, the identification of the factors controlling rare species assemblages is critical for understanding the types of rarity, how the rare biosphere is established, and how rare microorganisms fluctuate over spatiotemporal scales, thus enabling prospective predictions of ecosystem responses. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. SYMPOSIUM: Rare decays

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    Late last year, a symposium entitled 'Rare Decays' attracted 115 participants to a hotel in Vancouver, Canada. These participants were particle physicists interested in checking conventional selection rules to look for clues of possible new behaviour outside today's accepted 'Standard Model'. For physicists, 'rare decays' include processes that have so far not been seen, explicitly forbidden by the rules of the Standard Model, or processes highly suppressed because the decay is dominated by an easier route, or includes processes resulting from multiple transitions

  8. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  9. Rare muon processes: Experiment

    International Nuclear Information System (INIS)

    Walter, H.K.

    1998-01-01

    The decay properties of muons, especially their rare decays, can be used to study very accurately deviations from the Standard Model. Muons with extremely low energies and good spatial definition are preferred for the majority of such studies. With the upgrade of the 590-MeV ring accelerator, PSI possesses the most powerful cyclotron in the world. This makes it possible to operate high-intensity beams of secondary pions and muons. A short review on rare muon processes is presented, concerning μ-e conversion and muonium-antimuonium oscillations. A possible new search for μ→eγ is also mentioned

  10. Rare variants in ischemic stroke: an exome pilot study.

    Directory of Open Access Journals (Sweden)

    John W Cole

    Full Text Available The genetic architecture of ischemic stroke is complex and is likely to include rare or low frequency variants with high penetrance and large effect sizes. Such variants are likely to provide important insights into disease pathogenesis compared to common variants with small effect sizes. Because a significant portion of human functional variation may derive from the protein-coding portion of genes we undertook a pilot study to identify variation across the human exome (i.e., the coding exons across the entire human genome in 10 ischemic stroke cases. Our efforts focused on evaluating the feasibility and identifying the difficulties in this type of research as it applies to ischemic stroke. The cases included 8 African-Americans and 2 Caucasians selected on the basis of similar stroke subtypes and by implementing a case selection algorithm that emphasized the genetic contribution of stroke risk. Following construction of paired-end sequencing libraries, all predicted human exons in each sample were captured and sequenced. Sequencing generated an average of 25.5 million read pairs (75 bp×2 and 3.8 Gbp per sample. After passing quality filters, screening the exomes against dbSNP demonstrated an average of 2839 novel SNPs among African-Americans and 1105 among Caucasians. In an aggregate analysis, 48 genes were identified to have at least one rare variant across all stroke cases. One gene, CSN3, identified by screening our prior GWAS results in conjunction with our exome results, was found to contain an interesting coding polymorphism as well as containing excess rare variation as compared with the other genes evaluated. In conclusion, while rare coding variants may predispose to the risk of ischemic stroke, this fact has yet to be definitively proven. Our study demonstrates the complexities of such research and highlights that while exome data can be obtained, the optimal analytical methods have yet to be determined.

  11. Rare kaon, muon, and pion decay

    International Nuclear Information System (INIS)

    Littenberg, L.

    1998-01-01

    The author discusses the status of and prospects for the study of rare decays of kaons, muons, and pions. Studies of rare kaon decays are entering an interesting new phase wherein they can deliver important short-distance information. It should be possible to construct an alternative unitarity triangle to that determined in the B sector, and thus perform a critical check of the Standard Model by comparing the two. Rare muon decays are beginning to constrain supersymmetric models in a significant way, and future experiments should reach sensitivities which this kind of model must show effects, or become far less appealing

  12. Rare-earth elements

    Science.gov (United States)

    Van Gosen, Bradley S.; Verplanck, Philip L.; Seal, Robert R.; Long, Keith R.; Gambogi, Joseph; Schulz, Klaus J.; DeYoung,, John H.; Seal, Robert R.; Bradley, Dwight C.

    2017-12-19

    The rare-earth elements (REEs) are 15 elements that range in atomic number from 57 (lanthanum) to 71 (lutetium); they are commonly referred to as the “lanthanides.” Yttrium (atomic number 39) is also commonly regarded as an REE because it shares chemical and physical similarities and has affinities with the lanthanides. Although REEs are not rare in terms of average crustal abundance, the concentrated deposits of REEs are limited in number.Because of their unusual physical and chemical properties, the REEs have diverse defense, energy, industrial, and military technology applications. The glass industry is the leading consumer of REE raw materials, which are used for glass polishing and as additives that provide color and special optical properties to the glass. Lanthanum-based catalysts are used in petroleum refining, and cerium-based catalysts are used in automotive catalytic converters. The use of REEs in magnets is a rapidly increasing application. Neodymium-iron-boron magnets, which are the strongest known type of magnets, are used when space and weight are restrictions. Nickel-metal hydride batteries use anodes made of a lanthanum-based alloys.China, which has led the world production of REEs for decades, accounted for more than 90 percent of global production and supply, on average, during the past decade. Citing a need to retain its limited REE resources to meet domestic requirements as well as concerns about the environmental effects of mining, China began placing restrictions on the supply of REEs in 2010 through the imposition of quotas, licenses, and taxes. As a result, the global rare-earth industry has increased its stockpiling of REEs; explored for deposits outside of China; and promoted new efforts to conserve, recycle, and substitute for REEs. New mine production began at Mount Weld in Western Australia, and numerous other exploration and development projects noted in this chapter are ongoing throughout the world.The REE-bearing minerals are

  13. Childhood lichen sclerosus is a rare but important diagnosis

    DEFF Research Database (Denmark)

    Jensen, Lise Soldbro; Bygum, Anette

    2012-01-01

    Lichen sclerosus (LS) is a chronic skin disorder with a predilection for the anogenital area. The disease is mostly seen in prepubertal and postmenopausal females. The lesions present as sharply demarcated white plaques encircling the vagina and anus. The atrophic form can lead to scarring...

  14. Rare gases in Samoan xenoliths

    Science.gov (United States)

    Poreda, R. J.; Farley, K. A.

    1992-09-01

    The rare gas isotopic compositions of residual harzburgite xenoliths from Savai'i (SAV locality) and an unnamed seamount south of the Samoan chain (PPT locality) provide important constraints on the rare gas evolution of the mantle and atmosphere. Despite heterogeneous trace element compositions, the rare gas characteristics of the xenoliths from each of the two localities are strikingly similar. SAV and PPT xenoliths have 3He/ 4He ratios of11.1 ± 0.5 R A and21.6 ± 1 R A, respectively; this range is comparable to the 3He/ 4He ratios in Samoan lavas and clearly demonstrates that they have trapped gases from a relatively undegassed reservoir. The neon results are not consistent with mixing between MORB and a plume source with an atmospheric signature. Rather, the neon isotopes reflect either a variably degassed mantle (with a relative order of degassing of Loihi Honda et al. that the 20Ne/ 22Ne ratio in the mantle more closely resembles the solar ratio than the atmospheric one. 40Ar/ 36Ar ratios in the least contaminated samples range from 4,000 to 12,000 with the highest values in the 22 RA PPT xenoliths. There is no evidence for atmospheric 40Ar/ 36Ar ratios in the mantle source of these samples, which indicates that the lower mantle may have 40Ar/ 36Ar ratios in excess of 5,000. Xenon isotopic anomalies in 129Xe and 136Xe are as high as 6%, or about half of the maximum MORB excess and are consistent with the less degassed nature of the Samoan mantle source. These results contradict previous suggestions that the high 3He/ 4He mantle has a near-atmospheric heavy rare gas isotopic composition.

  15. 12 Ministries Control Rare Earth Exports

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    <正>"It is very natural to reserve rare earth as a strategic resource.Many countries do this,including China."On April 8,Sun Lihui,Vice Director of Metal Section of Chemicals Import & Export Commerce Chamber of China Minmetals Corporation told a reporter that as early as 2006,China has launched a strategic plan for rare earth,"but it was interrupted by the subsequent financial crisis."

  16. Rare earth element lithogeochemistry of granitoid mineral deposits

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.P.; Fryer, B.J. (Memorial Univ. of Newfoundland, St. John' s (Canada). Dept. of Earth Sciences)

    1983-12-01

    As a monitor of the processes involved in the formation of granitoid mineral deposits the coherent group behaviour of the rare earth elements (REE) actively reflects changing fluid characteristics. For example, in the porphyry environment, magmatic-hydrothermal fluids produce potassic alteration with strong enrichment in the light rare earth elements, reflecting their high pH, low fluid/rock ratios, and the dominant role of Cl/sup -/ complexing in metal (i.e. Cu, Au) transport. With increasing fluid/rock ratios and decreasing pH accompanying the progressive involvement of meteoric fluids (and the production of propylitic, argillic, and phyllic alteration) anionic species such as F/sup -/ and CO/sub 3//sup 2 -/ become important in metal (e.g. Mo, W) transport through complexing, and their activity in the hydrothermal fluids is illustrated by mobilization of the heavy rare earth elements. The relative involvement of Cl/sup -/ versus F/sup -/ versus CO/sub 3//sup 2 -/ in metal transport in other granite-related systems can also be monitored through REE behaviour. Hence granitoid tin-tungsten mineralization and associated greisenization typically exhibit heavy rare earth enrichment and evidence the importance of F/sup -/ and CO/sub 3//sup 2 -/ in metal transport. Similarly, heavy rare earth element enrichment in hydrothermal uranium deposits can be related to the transport of uranium as carbonate complexes. REE are widely accepted as powerful tools in the study of rock petrogenesis, but their use has been neglected in the investigation of mineral deposits. The recognition of the systematic variation of REE distributions in granitoid mineral deposits suggests that the application of REE geochemistry, particularly when integrated with fluid inclusion and isotope studies, can provide l) an effective method for identifying the physiochemical controls of metal transport and 2) a useful criterion of elucidating metal distribution.

  17. Rare earth element lithogeochemistry of granitoid mineral deposits

    International Nuclear Information System (INIS)

    Taylor, R.P.; Fryer, B.J.

    1983-01-01

    As a monitor of the processes involved in the formation of granitoid mineral deposits the coherent group behaviour of the rare earth elements (REE) actively reflects changing fluid characteristics. For example, in the porphyry environment, magmatic-hydrothermal fluids produce potassic alteration with strong enrichment in the light rare earth elements, reflecting their high pH, low fluid/rock ratios, and the dominant role of Cl - complexing in metal (i.e. Cu, Au) transport. With increasing fluid/rock ratios and decreasing pH accompanying the progressive involvement of meteoric fluids (and the production of propylitic, argillic, and phyllic alteration) anionic species such as F - and CO 3 2- become important in metal (e.g. Mo, W) transport through complexing, and their activity in the hydrothermal fluids is illustrated by mobilization of the heavy rare earth elements. The relative involvement of Cl - versus F - versus CO 3 2- in metal transport in other granite-related systems can also be monitored through REE behaviour. Hence granitoid tin-tungsten mineralization and associated greisenization typically exhibit heavy rare earth enrichment and evidence the importance of F - and CO 3 2- in metal transport. Similarly, heavy rare earth element enrichment in hydrothermal uranium deposits can be related to the transport of uranium as carbonate complexes. REE are widely accepted as powerful tools in the study of rock petrogenesis, but their use has been neglected in the investigation of mineral deposits. The recognition of the systematic variation of REE distributions in granitoid mineral deposits suggests that the application of REE geochemistry, particularly when integrated with fluid inclusion and isotope studies, can provide l) an effective method for identifying the physiochemical controls of metal transport and 2) a useful criterion of elucidating metal distribution

  18. Surveillance of rare cancers

    NARCIS (Netherlands)

    van der Zwan, Johannes Martinus

    2016-01-01

    The widespread incidence and effects of cancer have led to a growing development in cancer prevention in the form of screening and research programs and cancer registries. Because of the low number of patients with rare cancers this improvement is not applied to the same extent to all cancer

  19. Afganistan and rare earths

    Directory of Open Access Journals (Sweden)

    Emilian M. Dobrescu

    2013-05-01

    Full Text Available On our planet, over a quarter of new technologies for the economic production of industrial goods, are using rare earths, which are also called critical minerals and industries that rely on these precious items being worth of an estimated nearly five trillion dollars, or 5 percent of world gross domestic product. In the near future, competition will increase for the control of rare earth minerals embedded in high-tech products. Rare minerals are in the twenty-first century what oil accounted for in the twentieth century and coal in the nineteenth century: the engine of a new industrial revolution. Future energy will be produced increasingly by more sophisticated technological equipment based not just on steel and concrete, but incorporating significant quantities of metals and rare earths. Widespread application of these technologies will result in an exponential increase in demand for such minerals, and what is worrying is that minerals of this type are almost nowhere to be found in Europe and in other industrialized countries in the world, such as U.S. and Japan, but only in some Asian countries, like China and Afghanistan.

  20. Magnetic rare earth superlattices

    DEFF Research Database (Denmark)

    Majkrzak, C.F.; Kwo, J.; Hong, M.

    1991-01-01

    Advances in molecular beam epitaxy deposition techniques have recently made it possible to grow, an atomic plane at a time, single crystalline superlattices composed of alternating layers of a magnetic rare earth, such as Gd, Dy, Ho, or Er, and metallic Y, which has an identical chemical structure...

  1. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  2. Maxillary Osteomyelitis: A Rare Entity

    Directory of Open Access Journals (Sweden)

    Ayaaz Habib

    2016-01-01

    Full Text Available Osteomyelitis of the maxilla is now a rare event with the advent of antibiotics. The two predominant causes are odontogenic infections and sinusitis. Immunocompromised states such as diabetes, HIV, and malnutrition increase the risk of osteomyelitis. It is important to recognize this early as it is a difficult entity to treat with potentially serious consequences. We report an unusual case of right sided maxillary osteomyelitis in a lady with poorly controlled diabetes in rural Lincolnshire. Biopsy of the right maxillary bone showed features of acute osteomyelitis. This responded well to a prolonged course of oral antibiotics.

  3. Rare earth industries: Upstream business

    International Nuclear Information System (INIS)

    2011-01-01

    Evidently, many factors contribute to the rush to invest in the unprecedented revival of rare earths. One major reason has to do with the rapidly growing world demand. The other reason relates to the attractive price of rare earths which is projected to stay strong in the coming years. This is because supply is predicted to have difficulty keeping pace with demand. Experts believe a major driver of global rare earths demand is the forecasted expansion in the green economy. Climate change is a major driver of the green economy. With climate change, there is concern that the uncontrolled emission of the greenhouse gases, especially carbon dioxide, can lead to catastrophic consequences for the world. This has been documented in countless studies and reports. Another important driver of the green economy is the growing shortfall in many resources. The world is now experiencing declines in key resources to meet a growing global demand. With more than 6 billion people now in the world and growing, the pressure exerted on global resources including energy, water and food is a major concern. Recent demand surge in China and India has dented the supply position of major world resources. The much quoted Stern Report from the UK has warned that, unless immediate steps are taken to reduce greenhouse gas emissions, it may be a costly exercise to undertake the corrections later. Since energy use, especially fossil fuels, is a major contributor to climate change, greener options are being sought. Add to that the fact that the fossil energy resources of the world are declining, the need to seek alternatives becomes even more urgent. One option is to change to renewable energy sources. These include such potentials as solar, wind and biomass. Rare earths have somehow become a critical feature of the technologies in such renewable. Another option is to improve the efficient use of energy in transport, buildings and all the other energy intensive industries. Again the technologies in

  4. Rare variants in RTEL1 are associated with familial interstitial pneumonia.

    Science.gov (United States)

    Cogan, Joy D; Kropski, Jonathan A; Zhao, Min; Mitchell, Daphne B; Rives, Lynette; Markin, Cheryl; Garnett, Errine T; Montgomery, Keri H; Mason, Wendi R; McKean, David F; Powers, Julia; Murphy, Elissa; Olson, Lana M; Choi, Leena; Cheng, Dong-Sheng; Blue, Elizabeth Marchani; Young, Lisa R; Lancaster, Lisa H; Steele, Mark P; Brown, Kevin K; Schwarz, Marvin I; Fingerlin, Tasha E; Schwartz, David A; Lawson, William E; Loyd, James E; Zhao, Zhongming; Phillips, John A; Blackwell, Timothy S

    2015-03-15

    Up to 20% of cases of idiopathic interstitial pneumonia cluster in families, comprising the syndrome of familial interstitial pneumonia (FIP); however, the genetic basis of FIP remains uncertain in most families. To determine if new disease-causing rare genetic variants could be identified using whole-exome sequencing of affected members from FIP families, providing additional insights into disease pathogenesis. Affected subjects from 25 kindreds were selected from an ongoing FIP registry for whole-exome sequencing from genomic DNA. Candidate rare variants were confirmed by Sanger sequencing, and cosegregation analysis was performed in families, followed by additional sequencing of affected individuals from another 163 kindreds. We identified a potentially damaging rare variant in the gene encoding for regulator of telomere elongation helicase 1 (RTEL1) that segregated with disease and was associated with very short telomeres in peripheral blood mononuclear cells in 1 of 25 families in our original whole-exome sequencing cohort. Evaluation of affected individuals in 163 additional kindreds revealed another eight families (4.7%) with heterozygous rare variants in RTEL1 that segregated with clinical FIP. Probands and unaffected carriers of these rare variants had short telomeres (RTEL1 function. Rare loss-of-function variants in RTEL1 represent a newly defined genetic predisposition for FIP, supporting the importance of telomere-related pathways in pulmonary fibrosis.

  5. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  6. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  7. Sharing Rare Attitudes Attracts.

    Science.gov (United States)

    Alves, Hans

    2018-04-01

    People like others who share their attitudes. Online dating platforms as well as other social media platforms regularly rely on the social bonding power of their users' shared attitudes. However, little is known about moderating variables. In the present work, I argue that sharing rare compared with sharing common attitudes should evoke stronger interpersonal attraction among people. In five studies, I tested this prediction for the case of shared interests from different domains. I found converging evidence that people's rare compared with their common interests are especially potent to elicit interpersonal attraction. I discuss the current framework's theoretical implications for impression formation and impression management as well as its practical implications for improving online dating services.

  8. Drugs for rare disorders.

    Science.gov (United States)

    Cremers, Serge; Aronson, Jeffrey K

    2017-08-01

    Estimates of the frequencies of rare disorders vary from country to country; the global average defined prevalence is 40 per 100 000 (0.04%). Some occur in only one or a few patients. However, collectively rare disorders are fairly common, affecting 6-8% of the US population, or about 30 million people, and a similar number in the European Union. Most of them affect children and most are genetically determined. Diagnosis can be difficult, partly because of variable presentations and partly because few clinicians have experience of individual rare disorders, although they may be assisted by searching databases. Relatively few rare disorders have specific pharmacological treatments (so-called orphan drugs), partly because of difficulties in designing trials large enough to determine benefits and harms alike. Incentives have been introduced to encourage the development of orphan drugs, including tax credits and research aids, simplification of marketing authorization procedures and exemption from fees, and extended market exclusivity. Consequently, the number of applications for orphan drugs has grown, as have the costs of using them, so much so that treatments may not be cost-effective. It has therefore been suggested that not-for-profit organizations that are socially motivated to reduce those costs should be tasked with producing them. A growing role for patient organizations, improved clinical and translational infrastructures, and developments in genetics have also contributed to successful drug development. The translational discipline of clinical pharmacology is an essential component in drug development, including orphan drugs. Clinical pharmacologists, skilled in basic pharmacology and its links to clinical medicine, can be involved at all stages. They can contribute to the delineation of genetic factors that determine clinical outcomes of pharmacological interventions, develop biomarkers, design and perform clinical trials, assist regulatory decision

  9. RARE BRANCHIAL ARCH ANOMALIES

    Directory of Open Access Journals (Sweden)

    Jayanta Kumar

    2016-03-01

    Full Text Available AIM Amongst the branchial arch anomalies third arch anomaly occurs rarely and more so the fourth arch anomalies. We present our experience with cases of rare branchial arch anomalies. PATIENTS AND METHODS From June 2006 to January 2016, cases having their external opening in the lower third of sternocleidomastoid muscle with the tract going through thyroid gland and directing to pyriform sinus (PFS or cysts with internal opening in the PFS were studied. RESULTS No fourth arch anomaly was encountered. One cyst with internal opening which later on formed a fistula, three fistulae from beginning and two sinuses were encountered. The main stay of diagnosis was the fistula in the PFS and the tract lying posterior to the internal carotid artery. Simple excision technique with a small incision around the external opening was done. There was no recurrence. CONCLUSION Third arch fistula is not very rare as it was thought. Internal fistula is found in most of the cases. Though radiological investigations are helpful, fistulae can be diagnosed clinically and during operation. Extensive operation of the neck, mediastinum and pharynx is not required.

  10. Elephantiasis nostras verrucosa: a rare complication of lower limb lymphoedema.

    Science.gov (United States)

    Kar Keong, Neoh; Siing Ngi, Angelina Tang; Muniandy, Pubalan; Voon Fei, Wong

    2017-08-28

    We reported a case of a 49-year-old man who had chronic lymphoedema of bilateral lower limbs for 30 years, but he did not seek treatment. His disease was complicated with irreversible changes of elephantiasis nostras verrucosa and had recurrent admissions due to infection. He was not keen for surgical intervention. This case report illustrated a rare and non-reversible complication of a common skin disease, lymphoedema and also the importance of identifying and treating it early. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  11. Ethical and social aspects on rare diseases

    Directory of Open Access Journals (Sweden)

    Krajnović Dušanka

    2012-01-01

    Full Text Available Rare diseases are a heterogenic group of disorders with a little in common except of their rarity affecting by less than 5 : 10.000 people. In the world is registered about 6000-8000 rare diseases with 6-8% suffering population only in the European Union. In spite of rarity, they represent an important medical and social problem due to their incidence. For many rare diseases have no treatment, but if it exists and if started on time as being available to patients, there is a good prognosis for them to be able for normal life. The problems of patients affected by rare diseases are related to the lack of diagnosis and timely undergoing as well as their treatment or prevention. Orphan drugs are products intended for treatment, diagnosis or prevention of rare diseases, but for their development and marketing the industry has not been interested in yet because of their marketing reasons. Patients suffering from a rare disease although belonging to the vulnerable group for their specific health needs, is becoming invisible in the health care system due to their additional needs un properly recognized. Ethical problems faced by patients, but also health care professionals are related to the allocation of medical diagnostics, unequal approach to health care, inappropriately specialized social services as well as therapy and rare orphan drugs unavailability. Ethical questions related to clinical trails on orphan drugs, population screening and epidemiology testing on rare diseases will also be discussed in this paper. [Projekat Ministarstva nauke Republike Srbije, br. 41004: Rare diseases: Molecular pathophysiology, the diagnostic and therapeutical modalities, social, ethical and legal aspects

  12. Rare kaon decay: challenges and perspectives

    CERN Document Server

    D'Ambrosio, Giancarlo

    2015-01-01

    I review rare kaon decays. I introduce the flavor problem and p ossible solutions. Very rare kaon decays like K → π ν ̄ ν are very important to this purpose but also K → π l + l − . A new interesting channel is K → π π ee . Chiral dynamics is important to disentangle short distanc e effects. We discuss also the decays K 0 → μ + μ − , which have received recently some attention due to the measurement by LHCB.therefore we will study also K L → π 0 e + e − , K + → π + π 0 γ , K + → π + π 0 e + e − and related channels

  13. Stamina and Clout Define This Rare Breed.

    Science.gov (United States)

    Harrington-Lueker, Donna

    1991-01-01

    Takeover artists are a rare breed. Persons hired to put bankrupt school systems back on the road to academic solvency need stamina, clout, and plenty of experience. For all their state-given powers, takeover superintendents must identify key constituencies, build bridges, and promote belief in change from within. (MLH)

  14. A rare cause of Cushing's syndrome

    DEFF Research Database (Denmark)

    Folkestad, Lars; Andersen, Marianne Skovsager; Nielsen, Anne Lerberg

    2014-01-01

    Excess glucocorticoid levels cause Cushing's syndrome (CS) and may be due to pituitary, adrenal or ectopic tumours. Adrenocorticotropic hormone (ACTH) levels are useful in identifying adrenal tumours. In rare cases, ACTH-producing phaeochromocytomas are the cause of CS. We present two cases of ACTH...

  15. Rare endocrine cancers have novel genetic alterations

    Science.gov (United States)

    A molecular characterization of adrenocortical carcinoma, a rare cancer of the adrenal cortex, analyzed 91 cases for alterations in the tumor genomes and identified several novel genetic mutations as likely mechanisms driving the disease as well as whole genome doubling as a probable driver of the disease.

  16. Rare B decays at LEP

    CERN Document Server

    Kluit, P M

    2001-01-01

    The results of the LEP experiments for rare B decays will be reviewed, covering hadronic final states, radiative and other rare decays and results for the inclusive charmless branching ratio. (8 refs).

  17. Fatal attraction: rare species in the spotlight.

    Science.gov (United States)

    Angulo, Elena; Deves, Anne-Laure; Saint Jalmes, Michel; Courchamp, Franck

    2009-04-07

    The exploitation of rare and endangered species can end in the species's extinction because the increased value people associate with rarity increases the economic incentive to exploit the last individuals, creating a positive feedback loop. This recently proposed concept, called the anthropogenic Allee effect (AAE), relies on the assumption that people do value rarity, but this remains to be established. Moreover, it also remains to be determined whether attraction to rarity is a trait confined to a minority of hobbyists (e.g. wildlife collectors, exotic pet owners) or characteristic of the general public. We estimated how much the general public valued rare species compared with common ones, using five different metrics related to personal investment: time spent, physical effort, unpleasantness, economic investment and risk. We surveyed the visitors of a zoo. To see the rare species, the visitors to the zoo invested more time in searching and contemplation, they were ready to expend more physical effort, they tolerated more unpleasant conditions, they were willing to pay more and, finally, they risked more to obtain (steal) a rare species. Our results provide substantial evidence of how the general public places more value on rare species, compared with common species. This confirms the AAE as an actual process, which in addition concerns a large part of the population. This has important consequences for the conservation of species that are rare now, or that could become so in the future.

  18. Material efficiency: rare and critical metals.

    Science.gov (United States)

    Ayres, Robert U; Peiró, Laura Talens

    2013-03-13

    In the last few decades, progress in electronics, especially, has resulted in important new uses for a number of geologically rare metals, some of which were mere curiosities in the past. Most of them are not mined for their own sake (gold, the platinum group metals and the rare Earth elements are exceptions) but are found mainly in the ores of the major industrial metals, such as aluminium, copper, zinc and nickel. We call these major metals 'attractors' and the rare accompanying metals 'hitch-hikers'. The key implication is that rising prices do not necessarily call forth greater output because that would normally require greater output of the attractor metal. We trace the geological relationships and the functional uses of these metals. Some of these metals appear to be irreplaceable in the sense that there are no known substitutes for them in their current functional uses. Recycling is going to be increasingly important, notwithstanding a number of barriers.

  19. A rare sight

    CERN Multimedia

    Antonella Del Rosso and The LHCb Collaboration

    2012-01-01

    Today, at the Hadron Collider Physics Symposium in Kyoto, the LHCb collaboration has presented the evidence of a very rare B decay, the rarest ever seen. The result further shrinks the region in which scientists can still look for supersymmetry.   The graph showing evidence of the Bs0 → μ+ μ- decay. The result was presented Monday 12 November at the HCP Conference in Kyoto (photo courtesy of the LHCb Collaboration). Particle decays tell us about the inner properties and functioning of Nature’s physics processes. By studying them and their occurrence, physicists infer the rules that control them. Often, it turns out that some rare decays, which are very difficult to observe, are those in which Nature could reveal the presence of new physics. This is the case of some decays of the Bs0 particle (a particle made of a bottom anti-quark bound to a strange quark), and in particular Bs0 → μ+ μ- whose...

  20. Trait space of rare plants in a fire-dependent ecosystem.

    Science.gov (United States)

    Ames, Gregory M; Wall, Wade A; Hohmann, Matthew G; Wright, Justin P

    2017-08-01

    The causes of species rarity are of critical concern because of the high extinction risk associated with rarity. Studies examining individual rare species have limited generality, whereas trait-based approaches offer a means to identify functional causes of rarity that can be applied to communities with disparate species pools. Differences in functional traits between rare and common species may be indicative of the functional causes of species rarity and may therefore be useful in crafting species conservation strategies. However, there is a conspicuous lack of studies comparing the functional traits of rare species and co-occurring common species. We measured 18 important functional traits for 19 rare and 134 common understory plant species from North Carolina's Sandhills region and compared their trait distributions to determine whether there are significant functional differences that may explain species rarity. Flowering, fire, and tissue-chemistry traits differed significantly between rare and common, co-occurring species. Differences in specific traits suggest that fire suppression has driven rarity in this system and that changes to the timing and severity of prescribed fire may improve conservation success. Our method provides a useful tool to prioritize conservation efforts in other systems based on the likelihood that rare species are functionally capable of persisting. © 2016 The Authors. Conservation Biology published by Wiley Periodicals, Inc. on behalf of Society for Conservation Biology.

  1. Rare event simulation using Monte Carlo methods

    CERN Document Server

    Rubino, Gerardo

    2009-01-01

    In a probabilistic model, a rare event is an event with a very small probability of occurrence. The forecasting of rare events is a formidable task but is important in many areas. For instance a catastrophic failure in a transport system or in a nuclear power plant, the failure of an information processing system in a bank, or in the communication network of a group of banks, leading to financial losses. Being able to evaluate the probability of rare events is therefore a critical issue. Monte Carlo Methods, the simulation of corresponding models, are used to analyze rare events. This book sets out to present the mathematical tools available for the efficient simulation of rare events. Importance sampling and splitting are presented along with an exposition of how to apply these tools to a variety of fields ranging from performance and dependability evaluation of complex systems, typically in computer science or in telecommunications, to chemical reaction analysis in biology or particle transport in physics. ...

  2. Rare complications of cesarean scar

    International Nuclear Information System (INIS)

    Mahajan, Divyesh; Kang, Mandeep; Sandhu, Manavjit Singh; Jain, Vanita; Kalra, Naveen; Khandelwal, Niranjan

    2013-01-01

    Cesarean scar pregnancy (CSP) and cesarean scar dehiscence (CSD) are the most dreaded complications of cesarean scar (CS). As the incidence of CS is increasing worldwide, so is the incidence of CSP, especially in cases with assisted reproduction techniques. It is of utmost importance to diagnose CSP in the early first trimester, as it can lead to myometrial rupture with fatal outcome. On the other hand, CSD may be encountered during pregnancy or in the postpartum period. CSD in the postpartum period is very rare and can cause secondary postpartum hemorrhage (PPH) leading to increased maternal morbidity or even death if not diagnosed and managed promptly. Both complications can be diagnosed on ultrasonography (USG) and confirmed on magnetic resonance imaging (MRI). These two conditions carry high morbidity and mortality. In this article, we highlight the role of imaging in the early diagnosis and management of these conditions

  3. Rare complications of cesarean scar

    Directory of Open Access Journals (Sweden)

    Divyesh Mahajan

    2013-01-01

    Full Text Available Cesarean scar pregnancy (CSP and cesarean scar dehiscence (CSD are the most dreaded complications of cesarean scar (CS. As the incidence of CS is increasing worldwide, so is the incidence of CSP, especially in cases with assisted reproduction techniques. It is of utmost importance to diagnose CSP in the early first trimester, as it can lead to myometrial rupture with fatal outcome. On the other hand, CSD may be encountered during pregnancy or in the postpartum period. CSD in the postpartum period is very rare and can cause secondary postpartum hemorrhage (PPH leading to increased maternal morbidity or even death if not diagnosed and managed promptly. Both complications can be diagnosed on ultrasonography (USG and confirmed on magnetic resonance imaging (MRI. These two conditions carry high morbidity and mortality. In this article, we highlight the role of imaging in the early diagnosis and management of these conditions.

  4. Photochemistry in rare gas clusters

    International Nuclear Information System (INIS)

    Moeller, T.; Haeften, K. von; Pietrowski, R. von

    1999-01-01

    In this contribution photochemical processes in pure rare gas clusters will be discussed. The relaxation dynamics of electronically excited He clusters is investigated with luminescence spectroscopy. After electronic excitation of He clusters many sharp lines are observed in the visible and infrared spectral range which can be attributed to He atoms and molecules desorbing from the cluster. It turns out that the desorption of electronically excited He atoms and molecules is an important decay channel. The findings for He clusters are compared with results for Ar clusters. While desorption of electronically excited He atoms is observed for all clusters containing up to several thousand atoms a corresponding process in Ar clusters is only observed for very small clusters (N<10). (orig.)

  5. Photochemistry in rare gas clusters

    Energy Technology Data Exchange (ETDEWEB)

    Moeller, T.; Haeften, K. von; Pietrowski, R. von [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany). Hamburger Synchrotronstrahlungslabor; Laarman, T. [Universitaet Hamburg, II. Institut fuer Experimentalphysik, Luruper Chaussee 149, D-22761 Hamburg (Germany)

    1999-12-01

    In this contribution photochemical processes in pure rare gas clusters will be discussed. The relaxation dynamics of electronically excited He clusters is investigated with luminescence spectroscopy. After electronic excitation of He clusters many sharp lines are observed in the visible and infrared spectral range which can be attributed to He atoms and molecules desorbing from the cluster. It turns out that the desorption of electronically excited He atoms and molecules is an important decay channel. The findings for He clusters are compared with results for Ar clusters. While desorption of electronically excited He atoms is observed for all clusters containing up to several thousand atoms a corresponding process in Ar clusters is only observed for very small clusters (N<10). (orig.)

  6. Rare earth superlattices

    International Nuclear Information System (INIS)

    McMorrow, D.F.

    1997-01-01

    A review is given of recent experiments on the magnetism of rare earth superlattices. Early experiments in this field were concerned mainly with systems formed by combining a magnetic and a non-magnetic element in a superlattice structure. From results gathered on a variety of systems it has been established that the propagation of magnetic order through the non-magnetic spacer can be understood mostly on the basis of an RKKY-like model, where the strength and range of the coupling depends on the details of the conduction electron susceptibility of the spacer. Recent experiments on more complex systems indicate that this model does not provide a complete description. Examples include superlattices where the constituents can either be both magnetic, adopt different crystal structures (Fermi surfaces), or where one of the constituents has a non-magnetic singlet ground state. The results from such systems are presented and discussed in the context of the currently accepted model. (au)

  7. Rare nocturnal headaches.

    Science.gov (United States)

    Cohen, Anna S; Kaube, Holger

    2004-06-01

    This review describes rare headaches that can occur at night or during sleep, with a focus on cluster headaches, paroxysmal hemicrania, short-lasting unilateral neuralgiform headache attacks with conjunctival injection and tearing, hypnic headache and exploding head syndrome. It is known that cluster headaches and hypnic headache are associated with rapid eye movement sleep, as illustrated by recent polysomnographic studies. Functional imaging studies have documented hypothalamic activation that is likely to be of relevance to circadian rhythms. These headache syndromes have been shown to respond to melatonin and lithium therapy, both of which have an indirect impact on the sleep-wake cycle. There is growing evidence that cluster headache and hypnic headache are chronobiological disorders.

  8. Rare earth (3) pivalates

    International Nuclear Information System (INIS)

    Kuz'mina, N.P.; Martynenko, L.I.; Zoan An' Tu; Ch'eu Tkhi Nguet; Troyanov, S.I.; Rykov, A.N.; Korenev, Yu.M.

    1994-01-01

    Depending on synthesis conditions rare earth pivalates can be obtained in the form of either adducts NPiv·HPiv or hydrates MPiv 3 ·mH 2 O. Adducts are the most stable form of pivalates. Heating of adducts result in formation of corresponding MPiv 3 . MPiv 3 ·nHPiv compounds are characterized by IR-spectroscopy and thermal analysis data. Behaviour of MPiv 3 was studied in the regime of vacuum sublemation. Using mass spectroscopy of NdPiv 3 it was shown that gaseous phase above MPiv 3 had complex composition and contained ligomer fragments. X-ray structure analysis of [NdPiv 3 ·3HPiv] was conducted

  9. A Rare Stapes Abnormality

    Directory of Open Access Journals (Sweden)

    Hala Kanona

    2015-01-01

    Full Text Available The aim of this study is to increase awareness of rare presentations, diagnostic difficulties alongside management of conductive hearing loss and ossicular abnormalities. We report the case of a 13-year-old female reporting progressive left-sided hearing loss and high resolution computed tomography was initially reported as normal. Exploratory tympanotomy revealed an absent stapedius tendon and lack of connection between the stapes superstructure and footplate. The footplate was fixed. Stapedotomy and stapes prosthesis insertion resulted in closure of the air-bone gap by 50 dB. A review of world literature was performed using MedLine. Middle ear ossicular discontinuity can result in significant conductive hearing loss. This can be managed effectively with surgery to help restore hearing. However, some patients may not be suitable or decline surgical intervention and can be managed safely conservatively.

  10. Rare Decays at LHCb

    CERN Document Server

    Belyaev, Ivan

    2006-01-01

    Rare loop-induced decays are sensitive to New Physics in many Standard Model extensions. In this paper we discuss the reconstruction of the radiative penguin decays $B^0_d \\to K^{*0} \\gamma, B^0_s \\to \\phi \\gamma , B^0_d \\to \\omega \\gamma, \\Lambda_b \\to \\Lambda \\gamma$, the electroweak penguin decays $B^0_d \\to K^{*0} \\mu^+ \\mu^-, B^+_u \\to K^+ \\mu^+ \\mu^-$, the gluonic penguin decays $B^0_d \\to \\phi K^0_S, B^0_s \\to \\phi \\phi$, and the decay $B^0_s \\to \\mu^+\\mu^-$ at LHCb. The selection criteria, evaluated efficiencies, expected annual yields and $B/S$ estimates are presented.

  11. Rare vertebral metastasis in a case of Hereditary Paraganglioma

    Directory of Open Access Journals (Sweden)

    da Silva Manuel Eduardo

    2012-09-01

    Full Text Available Abstract Paragangliomas are rare tumours with a prevalence of 1/10000 to 1/30000. Tumors arising from the paraganglia are characteristically of low malignant potential. Vertebral metastases are exceedingly rare, and only isolated case reports have described them. The authors present the clinical course of a 47 years-old female patient with a familial paraganglioma [PGL] with vertebral metastastization, who underwent an intralesional tumor excision and corpectomy. Genetic screening demonstrated a new germinal frameshift mutation of the SDHB exon 6 [c.587-591DelC]. After surgery there was normalization of the analytical parameters and imagiologic screening. One year later she presented a new image in the the pedicle of T11 on the contralateral side of the surgical incision. She performed 2 treatments with MIBG and 1 cicle of radiotherapy that made the new lesion regress. Currently the patient does not present any clinical or analytical evidence of new metastasis. This case outlines the clinical course of a patient with a PGL syndrome for whom a rare vertebral metastasis was diagnosed. It highlights the importance of identifying patients with germline SDHB mutations, as these patients are at a high risk of developing malignant disease.

  12. Low-level radioactive waste from rare metals processing facilities

    International Nuclear Information System (INIS)

    Eng, J.; Hendricks, D.W.; Feldman, J.; Giardina, P.A.

    1980-01-01

    This paper reviews the situations at the existing Teledyne Wah Chang Co., Inc. located at Albany, Oregon, and the former Carborundum Corp./Amax Specialty Metals, Inc., facilities located at Parkersburg, West Virginia, and Akron, New York, in order to show the extent of the radioactivity problem at rare metals processing facilities and the need to identify for radiological review other rare metal and rare earth processing sites

  13. Early Intervention in Children (0–6 Years with a Rare Developmental Disability: The Occupational Therapy Role

    Directory of Open Access Journals (Sweden)

    Lucy Dall'Alba

    2014-12-01

    Conclusion: Family-centred practice, play therapy, and individually tailored programmes are identified as key practice areas for this population. The important role occupational therapists play in early intervention teams is highlighted; however, further research is needed to develop the evidence base for best practice with particular rare developmental conditions.

  14. Rare cancers are not so rare: The rare cancer burden in Europe

    NARCIS (Netherlands)

    Gatta, Gemma; van der Zwan, Jan Maarten; Casali, Paolo G.; Siesling, Sabine; Dei Tos, Angelo Paolo; Kunkler, Ian; Otter, Renee; Licitra, Lisa

    2011-01-01

    Purpose: Epidemiologic information on rare cancers is scarce. The project Surveillance of Rare Cancers in Europe (RARECARE) provides estimates of the incidence, prevalence and survival of rare cancers in Europe based on a new and comprehensive list of these diseases. Materials and methods: RARECARE

  15. Two rare cases of laryngeal intralymphatic histiocytosis

    DEFF Research Database (Denmark)

    Reznitsky, Martin; Daugaard, Søren; Charabi, Birgitte Wittenborg

    2016-01-01

    We report two rare cases of intralymphatic histiocytosis causing, respectively, recurrent and persistent episodes of upper airway swelling and breathing difficulties. Case 1 was a 39-year-old man who was referred with recurrent upper airway swelling causing difficulty in breathing. A direct....... Extensive investigations were performed but discovered no abnormal findings. He received CO2 laser treatment twice and the swelling decreased. Intralymphatic histiocytosis is extremely rare in upper airway pathology. It is an important differential diagnosis in patients with recurrent and chronic laryngeal...

  16. Ciliates and the rare biosphere: a review.

    Science.gov (United States)

    Dunthorn, Micah; Stoeck, Thorsten; Clamp, John; Warren, Alan; Mahé, Frédéric

    2014-01-01

    Here we provide a brief review of the rare biosphere from the perspective of ciliates and other microbial eukaryotes. We trace research on rarity from its lack of much in-depth focus in morphological and Sanger sequencing projects, to its central importance in analyses using high throughput sequencing strategies. The problem that the rare biosphere is potentially comprised of mostly errors is then discussed in the light of asking community-comparative, novel-diversity, and ecosystem-functioning questions. © 2014 The Author(s) Journal of Eukaryotic Microbiology © 2014 International Society of Protistologists.

  17. Epitaxial rare-earth superlattices and films

    International Nuclear Information System (INIS)

    Salamon, M.B.; Beach, R.S.; Flynn, C.P.; Matheny, A.; Tsui, F.; Rhyne, J.J.

    1992-01-01

    This paper reports on epitaxial growth of rare-earth superlattices which is demonstrated to have opened important new areas of research on magnetic materials. The propagation magnetic order through non-magnetic elements, including its range and anisotropy, has been studied. The importance of magnetostriction in determining the phase diagram is demonstrated by the changes induced by epitaxial clamping. The cyrstallinity of epitaxial superlattices provides the opportunity to study interfacial magnetism by conventional x-ray and neutron scattering methods

  18. Biosynthesis of rare hexoses using microorganisms and related enzymes

    OpenAIRE

    Li, Zijie; Gao, Yahui; Nakanishi, Hideki; Gao, Xiaodong; Cai, Li

    2013-01-01

    Summary Rare sugars, referred to as monosaccharides and their derivatives that rarely exist in nature, can be applied in many areas ranging from foodstuffs to pharmaceutical and nutrition industry, or as starting materials for various natural products and drug candidates. Unfortunately, an important factor restricting the utilization of rare sugars is their limited availability, resulting from limited synthetic methods. Nowadays, microbial and enzymatic transformations have become a very powe...

  19. Contributions to the rare earths to science and technology

    International Nuclear Information System (INIS)

    Spedding, F.H.

    1975-01-01

    This is a brief summary of some areas of science where the rare earths have already played an important role and of other areas where they are almost certain to be helpful. The discovery, abundance, separation, and properties of rare earths are discussed. It is pointed out that the rare earths comprise almost one-fourth of the known metals, and their alloys a third of the possible alloys

  20. Rare and unexpected beta thalassemic mutations in Qazvin ...

    African Journals Online (AJOL)

    About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTAcontaining venous ...

  1. Magnetostriction of rare earth-Fe2 Laves phase compounds

    International Nuclear Information System (INIS)

    Clark, A.E.; Abbundi, R.; Savage, H.T.

    1977-01-01

    Single crystal magnetostriction measurements were made as a function of temperature on TbFe 2 and DyFe 2 . From these, the intrinsic magnetoelastic coupling coefficients were determined for the rare earth-Fe 2 compounds. Employing X-ray techniques, certain multicomponent rare earth-Fe 2 compounds were identified to maximize the magnetostriction to anisotropy ratio. (Auth.)

  2. Rare and unexpected beta thalassemic mutations in Qazvin ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTA-.

  3. Rare copy number deletions predict individual variation in intelligence.

    Directory of Open Access Journals (Sweden)

    Ronald A Yeo

    2011-01-01

    Full Text Available Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in "mutation load" emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent copy number variations (CNVs, and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77 had been administered the Wechsler Abbreviated Scale of Intelligence (WASI. After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = -.30, p = .01. As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES, we also examined the impact of ethnicity (Anglo/White vs. Other, as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed.

  4. Rare Copy Number Deletions Predict Individual Variation in Intelligence

    Science.gov (United States)

    Yeo, Ronald A.; Gangestad, Steven W.; Liu, Jingyu; Calhoun, Vince D.; Hutchison, Kent E.

    2011-01-01

    Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in “mutation load” emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent) copy number variations (CNVs), and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77) had been administered the Wechsler Abbreviated Scale of Intelligence (WASI). After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = −.30, p = .01). As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES), we also examined the impact of ethnicity (Anglo/White vs. Other), as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less) adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed. PMID:21298096

  5. Rare psi decays

    International Nuclear Information System (INIS)

    Partridge, R.

    1986-01-01

    Slightly more than ten years have passed since the psi was discovered, yet the study of psi decays continues to be an active and fruitful area of research. One reason for such longevity is that each successive experiment has increased their sensitivity over previous experiments either by improving detection efficiency or by increasing statistics. This has allowed the observation and, in some cases, detailed studies of rare psi decays. Branching ratios of ≅10-/sup 4/ are now routinely studied, while certain decay channels are beginning to show interesting effects at the 10-/sup 5/ level. Future experiments at the Beijing Electron Positron Collider (BEPC) have the potential for increasing sensitivities by one or two orders of magnitude, thus enabling many interesting studies impossible with current data samples. The author first examines the extent to which psi decays can be used to study electroweak phenomena. The remainder of this work is devoted to the more traditional task of using the psi to study quarks, gluons, and the properties of the strong interaction. Of particular interest is the study of radioactive psi decays, where a number of new particles have been discovered. Recent results regarding two of these particles, the θ(1700) and iota(1450), are discussed, as well as a study of the quark content of the eta and eta' using decays of the psi to vector-pseudoscalar final states

  6. Rare B decays at LHCb

    CERN Document Server

    Puig Navarro, Albert

    2017-01-01

    Rare decays are flavour changing neutral current processes that allow sensitive searches for phenomena beyond the Standard Model (SM). In the SM, rare decays are loop-suppressed and new particles in SM extensions can give significant contributions. The very rare decay $B^0_s\\to\\mu^+\\mu^-$ in addition helicity suppressed and constitutes a powerful probe for new (pseudo) scalar particles. Of particular interest are furthermore tests of lepton universality in rare $b\\to s\\ell^+\\ell^-$ decays. The LHCb experiment is designed for the study of b-hadron decays and ideally suited for the analysis of rare decays due to its high trigger efficiency, as well as excellent tracking and particle identification performance. Recent results from the LHCb experiment in the area of rare decays are presented, including tests of lepton universality and searches for lepton flavour violation.

  7. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  8. Gastric lactobezoar - a rare disorder?

    Directory of Open Access Journals (Sweden)

    Heinz-Erian Peter

    2012-01-01

    Full Text Available Abstract Gastric lactobezoar, a pathological conglomeration of milk and mucus in the stomach of milk-fed infants often causing gastric outlet obstruction, is a rarely reported disorder (96 cases since its first description in 1959. While most patients were described 1975-1985 only 26 children have been published since 1986. Clinically, gastric lactobezoars frequently manifest as acute abdomen with abdominal distension (61.0% of 96 patients, vomiting (54.2%, diarrhea (21.9%, and/or a palpable abdominal mass (19.8%. Respiratory (23.0% and cardiocirculatory (16.7% symptoms are not uncommon. The pathogenesis of lactobezoar formation is multifactorial: exogenous influences such as high casein content (54.2%, medium chain triglycerides (54.2% or enhanced caloric density (65.6% of infant milk as well as endogenous factors including immature gastrointestinal functions (66.0%, dehydration (27.5% and many other mechanisms have been suggested. Diagnosis is easy if the potential presence of a gastric lactobezoar is thought of, and is based on a history of inappropriate milk feeding, signs of acute abdomen and characteristic features of diagnostic imaging. Previously, plain and/or air-, clear fluid- or opaque contrast medium radiography techniques were used to demonstrate a mass free-floating in the lumen of the stomach. This feature differentiates a gastric lactobezoar from intussusception or an abdominal neoplasm. Currently, abdominal ultrasound, showing highly echogenic intrabezoaric air trapping, is the diagnostic method of choice. However, identifying a gastric lactobezoar requires an investigator experienced in gastrointestinal problems of infancy as can be appreciated from the results of our review which show that in not even a single patient gastric lactobezoar was initially considered as a possible differential diagnosis. Furthermore, in over 30% of plain radiographs reported, diagnosis was initially missed although a lactobezoar was clearly

  9. INTUSSUSCEPTION - A RARE ETIOLOGY

    Directory of Open Access Journals (Sweden)

    Mariana Branco

    2017-02-01

    Discussion / Conclusions: The clinical case described is intended to alert to the importance of investigating an underlying disease in some children and adolescents with intussusception. In this case the study led to the diagnosis of cystic fibrosis

  10. Evaluation of Rare Earth Element Extraction from North Dakota Coal-Related Feed Stocks

    Science.gov (United States)

    Laudal, Daniel A.

    The rare earth elements consist of the lanthanide series of elements with atomic numbers from 57-71 and also include yttrium and scandium. Due to their unique properties, rare earth elements are crucial materials in an incredible array of consumer goods, energy system components and military defense applications. However, the global production and entire value chain for rare earth elements is dominated by China, with the U.S. currently 100% import reliant for these critical materials. Traditional mineral ores including previously mined deposits in the U.S., however, have several challenges. Chief among these is that the content of the most critical and valuable of the rare earths are deficient, making mining uneconomical. Further, the supply of these most critical rare earths is nearly 100% produced in China from a single resource that is only projected to last another 10 to 20 years. The U.S. currently considers the rare earths market an issue of national security. It is imperative that alternative domestic sources of rare earths be identified and methods developed to produce them. Recently, coal and coal byproducts have been identified as one of these promising alternative resources. This dissertation details a study on evaluation of the technical and economic feasibility of rare earth element recovery from North Dakota lignite coal and lignite-related feedstocks. There were four major goals of this study: i) identify lignite or lignite-related feedstocks with total rare earth element content above 300 parts per million, a threshold dictated by the agency who funded this research as the minimum for economic viability, ii) determine the geochemistry of the feedstocks and understand the forms and modes of occurrence of the rare earth elements, information necessary to inform the development of extraction and concentration methods, iii) identify processing methods to concentrate the rare earth elements from the feedstocks to a target of two weight percent, a value

  11. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  12. Information Supply Chain System for Managing Rare Infectious Diseases

    Science.gov (United States)

    Gopalakrishna-Remani, Venugopal

    2012-01-01

    Timely identification and reporting of rare infectious diseases has important economic, social and health implications. In this study, we investigate how different stakeholders in the existing reporting system influence the timeliness in identification and reporting of rare infectious diseases. Building on the vision of the information supply…

  13. Advances in chromatography of the rare earth elements (review)

    International Nuclear Information System (INIS)

    Oguma, Koichi; Kuroda, Rokuro; Shimizu, Tsuneo.

    1995-01-01

    A review is presented which covers liquid chromatography, gas chromatography, and related techniques. This article intends to describe the chromatographic methods playing an important role in the separation of the rare earth elements. Special attention is paid to the usefulness of various types of liquid chromatography which enable the complete mutual separation of the rare earth elements. Applications are also discussed. (author) 161 refs

  14. EnviroAtlas - Rare Ecosystems in the Conterminous United States

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset identifies rare ecosystems using base landcover data from the USGS GAP Analysis Program (Version 2, 2011) combined with landscape ecology...

  15. Zebra: searching for rare diseases

    DEFF Research Database (Denmark)

    Dragusin, Radu; Petcu, Paula; Lioma, Christina

    2012-01-01

    disease diagnostic hypotheses in the domain of medical IR. In this work, we build upon an existing vertical medical search engine, Zebra, that is focused on rare disease diagnosis. In previous work, Zebra has been evaluated using real-life medical cases of rare and difficult diseases, and has been found...

  16. Health Systems Sustainability and Rare Diseases.

    Science.gov (United States)

    Ferrelli, Rita Maria; De Santis, Marta; Egle Gentile, Amalia; Taruscio, Domenica

    2017-01-01

    The paper is addressing aspects of health system sustainability for rare diseases in relation to the current economic crisis and equity concerns. It takes into account the results of the narrative review carried out in the framework of the Joint Action for Rare Diseases (Joint RD-Action) "Promoting Implementation of Recommendations on Policy, Information and Data for Rare Diseases", that identified networks as key factors for health systems sustainability for rare diseases. The legal framework of European Reference Networks and their added value is also presented. Networks play a relevant role for health systems sustainability, since they are based upon, pay special attention to and can intervene on health systems knowledge development, partnership, organizational structure, resources, leadership and governance. Moreover, sustainability of health systems can not be separated from the analysis of the context and the action on it, including fiscal equity. As a result of the financial crisis of 2008, cuts of public health-care budgets jeopardized health equity, since the least wealthy suffered from the greatest health effects. Moreover, austerity policies affected economic growth much more adversely than previously believed. Therefore, reducing public health expenditure not only is going to jeopardise citizens' health, but also to hamper fair and sustainable development.

  17. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  18. A Rare Case of Oestrogen Dermatitis.

    Science.gov (United States)

    Bourgeault, Emilie; Bujold, Janie; Doucet, Marie-Eve

    Oestrogen dermatitis is a rare disorder characterised by cyclical eruptions in association with a woman's menstrual cycle. A 43-year-old woman with an 8-year history of cyclical inguinal dermatitis, with a negative patch test, was tested with intradermal progesterone and oestrogen. Intradermal testing was positive for oestrogen only. In a female patient with cyclical dermatitis, it is important to consider oestrogen or progesterone dermatitis in the differential diagnosis.

  19. Galactosemia: a rare case in pediatric practice

    Directory of Open Access Journals (Sweden)

    S. Ya. Volgina

    2015-01-01

    Full Text Available Galactosemia is a rare life-threatening inherited autosomal recessive disease, the differential diagnosis of which has been very difficult up to date, especially if there are no results of neonatal screening for some reasons. The paper describes a clinical case of a 10-day patient with type I classic galactosemia and reflects the importance of a timely diagnostic search and switching him to lactose-free formulas.

  20. [A rarely known headache: Airplane travel headache].

    Science.gov (United States)

    Azman, Filiz; Erkılınç, Büşra; Çabalar, Murat; Çağırıcı, Sultan; Yayla, Vildan

    2017-01-01

    Recently, headache associated with airplane travel has gained importance with case reports and took its place in the classification of headache in 2013. This rare condition has different spesific characteristic from the primary headaches and its pathophysiology is not clear yet. In this case report, a 27-years-old female patient was diagnosed with the headache associated with airplane travel by history, examination and imaging findings. The possible pathophysiology and treatment were discussed.

  1. [Deep mycoses rarely described].

    Science.gov (United States)

    Charles, D

    1986-01-01

    Beside deep mycoses very well known: histoplasmosis, candidosis, cryptococcosis, there are other mycoses less frequently described. Some of them are endemic in some countries: South American blastomycosis in Brazil, coccidioidomycosis in California; some others are cosmopolitan and may affect everyone: sporotrichosis, or may affect only immunodeficient persons: mucormycosis. They do not spare Africa, we may encounter basidiobolomycosis, rhinophycomycosis, dermatophytosis, sporotrichosis and, more recently reported, rhinosporidiosis. Important therapeutic progresses have been accomplished with amphotericin B and with antifungus imidazole compounds (miconazole and ketoconazole). Surgical intervention is sometime recommended in chromomycosis and rhinosporidiosis.

  2. Terminological and methodological aspects in investigating the preservation of rare library materials

    Directory of Open Access Journals (Sweden)

    Damir Hasenay

    2008-07-01

    efficient management and good organization of preservation presupposes a systematic and comprehensive approach applicable independent of the type of institution or type of material. The management and organization issues concerning the preservation of rare library materials is shown as an overview of their most important elements, with a critical evaluation of the most important achievements in theory in practice. The methodological aspect is also very important in investigating the preservation of rare library materials.The special emphasis is placed on the systematic investigation of the status of library holdings and the possibilities offered by the qualitative and quantitative description of holdings on the one hand, and the possibilities offered by the methods of interview and/or questionnaire on the other. Several practical examples that may serve as test models in the approach to this issue have been analyzed.The existing organization of the collection of historical newspapers from the city of Osijek area, and the organization of the collection of old books in the library of the Franciscan monastery in Mostar in relation to their status and protection activities have also been discussed. By comparing these models a significant difference in the material and content characteristics of the analyzed rare library holdings have been identified. This difference calls for the use of different methodologies for investigating the condition of the holdings. The information on the condition of the library holdings and approaches to their preservation serve as a starting point for planning further steps for the efficient preservation of rare library materials. The insights into the problem of preservation presented in this paper should be understood as a foundation for further implementation on similar examples.Key words : preservation of library materials, rare library materials, rare books, historical newspapers, organization and management of preservation, description of the

  3. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  4. Poster "Maladies rares & sciences sociales"

    OpenAIRE

    Duysens, Fanny

    2018-01-01

    Le poster "Maladies rares & sciences sociales" visait à présenter la recherche doctorale de l'auteure au grand public dans le cadre de la Journée des Maladies Rares du Centre Hospitalier Universitaire de Liège dont le thème était "la recherche sur les maladies rares". Réalisé spécialement pour l'occasion, le poster explicitait de manière synthétique le sujet de recherche, la méthodologie, certains résultats, ainsi que les apports possibles des échanges entre chercheurs en sciences et sociales...

  5. Genetic/metabolic effect of iron metabolism and rare anemias

    Directory of Open Access Journals (Sweden)

    Clara Camaschella

    2013-03-01

    Full Text Available Advances in iron metabolism have allowed a novel classification of iron disorders and to identify previously unknown diseases. These disorders include genetic iron overload (hemochromatosis and inherited iron-related anemias, in some cases accompanied by iron overload. Rare inherited anemias may affect the hepcidin pathway, iron absorption, transport, utilization and recycling. Among the genetic iron-related anemias the most common form is likely the iron-refractory iron-deficiency anemia (IRIDA, due to mutations of the hepcidin inhibitor TMPRSS6 encoding the serine protease matriptase-2. IRIDA is characterized by hepcidin up-regulation, decrease iron absorption and macrophage recycling and by microcytic- hypochromic anemia, unresponsive to oral iron. High serum hepcidin levels may suggest the diagnosis, which requires demonstrating the causal TMPRSS6 mutations by gene sequencing. Other rare microcytic hypochromic anemias associated with defects of iron transport-uptake are the rare hypotransferrinemia, and DMT1 and STEAP3 mutations. The degree of anemia is variable and accompanied by secondary iron overload even in the absence of blood transfusions. This is due to the iron-deficient or expanded erythropoiesis that inhibits hepcidin transcription, increases iron absorption, through the erythroid regulator, as in untransfused beta-thalassemia. Sideroblastic anemias are due to decreased mitochondrial iron utilization for heme or sulfur cluster synthesis. Their diagnosis requires demonstrating ringed sideroblasts by Perl’s staining of the bone marrow smears. The commonest X-linked form is due to deltaamino- levulinic-synthase-2-acid (ALAS2 mutations. The recessive, more severe form, affects SLC25A38, which encodes a potential mitochondrial importer of glycine, an amino acid essential for ALA synthesis and thus results in heme deficiency. Two disorders affect iron/sulfur cluster biogenesis: deficiency of the ATP-binding cassette B7 (ABCB7 causes X

  6. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  7. Organizational Learning in Rare Events

    DEFF Research Database (Denmark)

    Andersen, Kristina Vaarst; Tyler, Beverly; Beukel, Karin

    When organizations encounter rare events they often find it challenging to extract learning from the experience. We analyze opportunities for organizational learning in one such rare event, namely Intellectual Property (IP) litigation, i.e., when organizations take disputes regarding their intell......When organizations encounter rare events they often find it challenging to extract learning from the experience. We analyze opportunities for organizational learning in one such rare event, namely Intellectual Property (IP) litigation, i.e., when organizations take disputes regarding...... the organization little discretion to utilize any learning from past litigation success. Thus, learning appears be to most beneficial in infringement cases. Based on statistical analysis of 10,211 litigation court cases in China, we find support for our hypotheses. Our findings suggest that organizations can learn...

  8. Economic aspects of rare diseases.

    Science.gov (United States)

    Borski, Krzysztof

    2015-01-01

    Economic problems related to the prevention, diagnosis and treatment of rare diseases are presented paying particular attention to the costs of financing treatment, including the issue of its refund, which is a fundamental and difficult to solve economic problem of the health care system. Rare diseases, despite the low frequency of occurrence, together cover a large group of diseases being a serious medical, social and economic problem. The adoption of Polish National Plan for Rare Diseases resulting from the recommendations of the Council of the European Union, the extension of institutional activities related to the area of public health and social initiatives seeking innovative solutions to create a model of social support for patients and their families, with very high complexity of the issues regarding rare diseases, results in the need for a coherent, comprehensive, system operations and adoption of comprehensive solutions.

  9. Rare earth metals, rare earth hydrides, and rare earth oxides as thin films

    International Nuclear Information System (INIS)

    Gasgnier, M.

    1980-01-01

    The review deals with pure rare earth materials such as rare earth metals, rare earth hydrides, and rare earth oxides as thin films. Several preparation techniques, control methods, and nature of possible contaminations of thin films are described. These films can now be produced in an extremely well-known state concerning chemical composition, structure and texture. Structural, electric, magnetic, and optical properties of thin films are studied and discussed in comparison with the bulk state. The greatest contamination of metallic rare earth thin films is caused by reaction with hydrogen or with water vapour. The compound with an f.c.c. structure is the dihydride LnH 2 (Ln = lanthanides). The oxygen contamination takes place after annealing at higher temperatures. Then there appears a compound with a b.c.c. structure which is the C-type sesquioxide C-Ln 2 O 3 . At room atmosphere dihydride light rare earth thin films are converted to hydroxide Ln(OH) 3 . For heavy rare earth thin films the oxinitride LnNsub(x)Osub(y) is observed. The LnO-type compound was never seen. The present review tries to set the stage anew for the investigations to be undertaken in the future especially through the new generations of electron microscopes

  10. Rare earth industries: Downstream business

    International Nuclear Information System (INIS)

    2011-01-01

    The value chain of the rare earths business involves mining, extraction, processing, refining and the manufacture of an extensive range of downstream products which find wide applications in such industries including aerospace, consumer electronics, medical, military, automotive, renewable wind and solar energy and telecommunications. In fact the entire gamut of the high-tech industries depends on a sustainable supply of rare earths elements. The explosive demand in mobile phones is an excellent illustration of the massive potential that the rare earths business offers. In a matter of less than 20 years, the number of cell phones worldwide has reached a staggering 5 billion. Soon, going by the report of their growth in sales, the world demand for cell phones may even exceed the global population. Admittedly, the rare earths business does pose certain risks. Top among the risks are the health and safety risks. The mining, extraction and refining of rare earths produce residues and wastes which carry health and safety risks. The residues from the extraction and refining are radioactive, while their effluent waste streams do pose pollution risks to the receiving rivers and waterways. But, as clearly elaborated in a recent report by IAEA experts, there are technologies and systems available to efficiently mitigate such risks. The risks are Rare Earth manageable. However, it is crucial that the risk and waste management procedures are strictly followed and adhered to. This is where effective monitoring and surveillance throughout the life of all such rare earths facilities is crucial. Fortunately, Malaysia's regulatory standards on rare earths follow international standards. In some areas, Malaysia's regulatory regime is even more stringent than the international guidelines. (author)

  11. Rare earth metal alloy magnets

    International Nuclear Information System (INIS)

    Harris, I.R.; Evans, J.M.; Nyholm, P.S.

    1979-01-01

    This invention relates to rare earth metal alloy magnets and to methods for their production. The technique is based on the fact that rare earth metal alloys (for e.g. cerium or yttrium) which have been crumbled to form a powder by hydride formation and decomposition can be used for the fabrication of magnets without the disadvantages inherent in alloy particle size reduction by mechanical milling. (UK)

  12. Rare beauty and charm decays

    International Nuclear Information System (INIS)

    Blake, T.

    2016-01-01

    Rare beauty and charm decays can provide powerful probes of physics beyond the Standard Model. These proceedings summarise the latest measurements of rare beauty and charm decays from the LHCb experiment at the end of Run 1 of the LHC. Whilst the majority of the measurements are consistent with SM predictions, small differences are seen in the rate and angular distribution of b → sℓ"+ℓ"− decay processes.

  13. Rare features associated with Mobius syndrome: Report of two cases

    Directory of Open Access Journals (Sweden)

    Rumela Ghosh

    2017-03-01

    Full Text Available Mobius syndrome is a rare congenital disorder with the preliminary diagnostic criteria of congenital facial and abducent nerve palsy. Involvement of other cranial nerves, too, is common. Prevalence rate of this syndrome is approximately 1 in 100,000 neonates. It is of unknown etiology with sporadic occurrence. However, data regarding the occurrence rate in India is limited. Features such as orofacial malformations, limb defects, and musculoskeletal, behavioral, and cognitive abnormalities might be associated. A thorough evaluation to identify the condition and establishing an adequate treatment plan is of utmost important in this condition. We are reporting clinical and radiographic features of Mobius syndrome in two cases along with unusual findings of limb and neck deformity.

  14. Joubert syndrome with autism in two siblings: A rare presentation.

    Science.gov (United States)

    Raghavan, D Vijaya; Doshi, V Vimal; Nambi, Shanthi

    2016-01-01

    Joubert syndrome is a rare autosomal recessive disorder with partial or complete agenesis of cerebellar vermis. This syndrome is identified mainly by the presence of molar tooth sign in magnetic resonance imaging of the brain since it has a varied phenotypic presentation. Of the 200 cases reported so far in the literature, only three reports show the presence of autistic symptoms in siblings suggesting a link between the cerebellar vermis and autistic spectrum disorders. In this case report of two siblings, the female child satisfied the criterion for autistic spectrum disorder in accordance with Diagnostic and Statistical Manual of Mental Disorders Fifth Editon. The boy showed developmental delay with autistic features (not amounting to diagnostic threshold). This report is important in that it adds evidence to the literature that abnormalities of cerebellum are involved in the cognitive development and autistic symptoms.

  15. Resources, challenges and way forward in rare mitochondrial diseases research.

    Science.gov (United States)

    Rajput, Neeraj Kumar; Singh, Vipin; Bhardwaj, Anshu

    2015-01-01

    Over 300 million people are affected by about 7000 rare diseases globally. There are tremendous resource limitations and challenges in driving research and drug development for rare diseases. Hence, innovative approaches are needed to identify potential solutions. This review focuses on the resources developed over the past years for analysis of genome data towards understanding disease biology especially in the context of mitochondrial diseases, given that mitochondria are central to major cellular pathways and their dysfunction leads to a broad spectrum of diseases. Platforms for collaboration of research groups, clinicians and patients and the advantages of community collaborative efforts in addressing rare diseases are also discussed. The review also describes crowdsourcing and crowdfunding efforts in rare diseases research and how the upcoming initiatives for understanding disease biology including analyses of large number of genomes are also applicable to rare diseases.

  16. Rare Books As Teaching Tools

    Science.gov (United States)

    Gino, M. C.; Wise, G.

    2003-05-01

    The use of historic science illustrations in the classroom offers unique opportunities to meet the National Science Standard that "students should develop understanding of science as a human endeavor, of the nature of scientific knowledge, and of historical perspectives" (Content Standard G, Science Education Standards, 1996, National Academy Press, Washington, DC). The Dudley Observatory has launched an effort to use its outstanding collection of rare astronomy books to meet this challenge. The example featured here is the illustration "Systema Solare et Planetarium" from the book Atlas novus coelestis (1742) by Johann Gabriel Doppelmayr (1671-1750). This illustration is significant in the evolution of astronomy because it is one of the first popular depictions of the solar system picturing the planets in their accurate relative sizes and providing numerical estimates of planetary and solar dimensions and distances. Perhaps at least as important, from the educational viewpoint, it is visually appealing, culturally intriguing and filled with puzzling items that might serve as the basis for inquiry-based learning. For example, why is the page sprinkled with what appear to be appeals to theology ("Ex His Creatorem") and expressions of wonder or even horror ("perceptum horridem")? Why does its map of the world depict California as an island? A structure for using this and other historic illustrations in the classroom might be based on the following general questions: What is the purpose of the illustration? What is included that a modern scientist might leave out, or left out that a modern scientist might include? How accurate are the quantitative results presented? How does the conceptual treatment resemble and differ from modern treatments? Viewing the heavens as an 18th century astronomer wanted his public to see them is an excellent approach to achieving the humanistic and historical perspective that the educational standard seeks.

  17. Resource management plan for the Oak Ridge Reservation. Volume 29, Rare plants on the Oak Ridge Reservation

    Energy Technology Data Exchange (ETDEWEB)

    Cunningham, M. [Science Applications International Corp., Oak Ridge, TN (United States); Pounds, L. [Tennessee Univ., Knoxville, TN (United States); Oberholster, S. [USDA Forest Service, Montgomery, AL (United States); Parr, P.; Mann, L. [Oak Ridge National Lab., TN (United States); Edwards, L. [Clemson Univ., SC (United States). Dept. of Forestry; Rosensteel, B. [JAYCOR Environmental, Vienna, VA (United States)

    1993-08-01

    Rare plant species listed by state or federal agencies and found on or near the Department of Energy`s Oak Ridge Reservation (ORR) are identified. Seventeen species present on the ORR are listed by the Tennessee Department of Environment and Conservation as either endangered, threatened, or of special concern. Four of these are under review by the US Fish and Wildlife Service for possible listing as threatened or endangered species. Ten species listed by the state occur near and may be present on the ORR; four are endangered in Tennessee, and one is a candidate for federal listing. A range of habitats supports the rare taxa on the ORR: River bluffs, calcareous barrens, wetlands, and deciduous forest. Sites for listed rare species on the ORR have been designated as Research Park Natural Areas. Consideration of rare plant habitats is an important component of resource management and land-use planning; protection of rare species in their natural habitat is the best method of ensuring their long-term survival. In addition, the National Environmental Policy Act requires that federally funded projects avoid or mitigate impacts to listed species. The list of rare plant species and their location on the ORR should be considered provisional because the entire ORR has not been surveyed, and state and federal status of all species continues to be updated.

  18. Rare Isotopes Physics in the Multimessenger Era

    Science.gov (United States)

    Schatz, Hendrik

    2018-06-01

    While these isotopes only exist for fractions of seconds, their properties shape the resulting cosmic distribution of elements and the astronomical observables including spectra, neutrinos, and gravitational waves. The long standing challenge in nuclear astrophysics of the production of the relevant isotopes in the laboratory is now overcome with a new generation of rare isotope accelerator facilities now coming online. One example is the FRIB facility under construction at Michigan State University for the US Department of Energy, Office of Science, Office of Nuclear Physics. These new capabilities in nuclear physics coincide with advances in astronomy directly related to the cosmic sites where these isotopes are created, in particular in time domain and gravitational wave astronomy. I will discuss the importance of rare isotope physics in interpreting multi-messenger observations and how advances in nuclear physics and astronomy when combined promise to lead us towards a comprehensive theory of the origin of the elements.

  19. Pollinator networks, alien species and the conservation of rare plants: Trinia glauca as a case study

    NARCIS (Netherlands)

    Carvalheiro, L.G.; Barbosa, E.R.; Memmott, J.

    2008-01-01

    1. Despite the essential role of pollination in the maintenance of many rare plant species, conservation management plans rarely consider the service of pollination. 2. This study identifies the main pollinators of a rare English plant species, Trinia glauca (Apiaceae), and provides recommendations

  20. A Rare Presentation of a Rare Disease: Pulmonary Lymphomatoid Granulomatosis

    Directory of Open Access Journals (Sweden)

    Ghulam Rehman Mohyuddin

    2012-01-01

    Full Text Available A 70-year-old female presented with a 4-week history of dry cough and wheezing. Chest radiograph showed a 10.5 cm mass-like density in the anterior mediastinum which had not been previously visualized. Computed tomography scan (CT of the chest showed a right hilar mass encasing and narrowing right upper lobe bronchus and right mainstem bronchus and secondary atelectatic changes. Biopsy was consistent with a diagnosis of lymphomatoid granulomatosis Grade 3. She responded well clinically and radiologically to therapy. Lymphomatoid granulomatosis is a rare EBV-associated disorder which is considered a lymphoproliferative disease. The most common radiographic feature is multiple lung nodules. An isolated hilar mass is an exceptionally rare presentation of this rare disease.

  1. Rare cancers in The Netherlands: a population-based study.

    Science.gov (United States)

    van der Zwan, Jan M; van Dijk, Boukje A C; Visser, Otto; van Krieken, Han J H J M; Capocaccia, Riccardo; Siesling, Sabine

    2018-07-01

    The conventional definition for rare disease is based on prevalence. Because of differences in prognosis, a definition on the basis of incidence was deemed to be more appropriate for rare cancers. Within the European RARECARE project, a definition was introduced that defines cancers as rare when the crude incidence rate is less than six per 100 000 per year. In this study, we applied the RARECARE definition for rare cancer to the Netherlands; this to identify the usefulness of the definition in a single country and to provide more insight into the burden of rare cancers in the Netherlands. Data for 2004 through 2008 were extracted from the Netherlands Cancer Registry and classified according to the RARECARE entities (tumour groupings). Crude and European standardized incidence rates were calculated. Out of the 260 entities, 223 (86%) were rare according to the definition, accounting for 14 000 cancers (17% of all). Considerable fluctuations in crude rates over years were observed for the major group of cancers. Rare tumours in the Netherlands constituted 17% of all newly diagnosed tumours, but were divided over 223 different entities, indicating the challenge that faces clinicians. To make the definition of rare cancers better applicable, it should be refined by taking into consideration the sex-specific incidence for sex-specific cancer sites. Moreover, a mean incidence over 5 years will provide more solid insight into the burden, eliminating large fluctuations in time of most of the cancers.

  2. A rare metastasis from a rare brain tumour

    DEFF Research Database (Denmark)

    Aabenhus, Kristine; Hahn, Christoffer Holst

    2014-01-01

    This case report presents the story of a patient with an oligodendroglioma metastasizing to the bone marrow and to lymph nodes of the neck. The patient had undergone primary brain surgery 13 years prior to the discovery of metastases and radiotherapy directed at the brain tumour two months prior........ Oligodendroglioma are rare primary brain tumours of which extraneural metastasis is even more rare. The incidence of cases like this may be increasing because of better treatment and thus longer survival of patients with oligodendroglioma....

  3. Rare earth element and rare metal inventory of central Asia

    Science.gov (United States)

    Mihalasky, Mark J.; Tucker, Robert D.; Renaud, Karine; Verstraeten, Ingrid M.

    2018-03-06

    Rare earth elements (REE), with their unique physical and chemical properties, are an essential part of modern living. REE have enabled development and manufacture of high-performance materials, processes, and electronic technologies commonly used today in computing and communications, clean energy and transportation, medical treatment and health care, glass and ceramics, aerospace and defense, and metallurgy and chemical refining. Central Asia is an emerging REE and rare metals (RM) producing region. A newly compiled inventory of REE-RM-bearing mineral occurrences and delineation of areas-of-interest indicate this region may have considerable undiscovered resources.

  4. Anthropogenic Cycles of Rare Earth Elements

    Science.gov (United States)

    Du, X.; Graedel, T. E.

    2009-12-01

    This research will develop quantitatively resolved anthropogenic cycles and in-use stocks for the rare earth metals specifically cerium, lanthanum and dysprosium in Japan, China, and the U.S. for the year of 2007. Rare earth elements (REE) is a group of 17 scare metals widely used in a growing number of emerging technologies and have been in high demand for emerging technologies as raw materials during past the three decades. New market participants from newly industrializing countries, primarily China, have had strong impacts on the demand of share. Consequently, the importance to sustain a reliable, steady, uninterrupted supply on global market triggered comprehensive research to recognize and understand the life cycles of rare earths. Moreover, because China plays a dominant role in mining production since 1990, it requires the assessment for the countries, which are almost completely dependent on imports from China with respect to rare earth resources. The study aims to analyze the flows and stocks of rare earth elements individually as elemental form in spite of their natural geological co-occurrence and mixed composition in applications. By applying the method of Material Flow Analysis (MFA) work has been done on evaluating current and historical flows of specific technologically significant materials, for example, copper, zinc, nickel, etc., determining the stocks available in different types of reservoirs (e.g., lithosphere, in-use) and the flows among the reservoirs, developing scenarios of possible futures of metal use, and assessing the environmental and policy implications of the results. Therefore, REE as a new target deserves inclusion because of its potential demand-supply conflict and importance to secure the competitive advantage of technical innovation in future. This work will generate a quantitatively resolved anthropogenic life cycle and in-use stocks for REE for the main target countries for a chosen year, 2007, providing flows and stocks from

  5. Safety aspects in rare earths recovery

    International Nuclear Information System (INIS)

    Bhattacharya, R.

    2014-01-01

    Recovery of rare earths involves mining of beach sands, mineral separation to obtain monazite and its chemical processing to obtain rare earth composites. The composites are then subjected to further chemical treatment to obtain individual rare earths. Although the separated out rare earths are not radioactive, the process for recovery of rare earths involve both radiological as well as conventional hazards. This paper highlights the safety aspects in the mining, mineral separation and chemical processing of monazite to obtain rare earths

  6. History, rare, and multiple events of mechanical unfolding of repeat proteins

    Science.gov (United States)

    Sumbul, Fidan; Marchesi, Arin; Rico, Felix

    2018-03-01

    Mechanical unfolding of proteins consisting of repeat domains is an excellent tool to obtain large statistics. Force spectroscopy experiments using atomic force microscopy on proteins presenting multiple domains have revealed that unfolding forces depend on the number of folded domains (history) and have reported intermediate states and rare events. However, the common use of unspecific attachment approaches to pull the protein of interest holds important limitations to study unfolding history and may lead to discarding rare and multiple probing events due to the presence of unspecific adhesion and uncertainty on the pulling site. Site-specific methods that have recently emerged minimize this uncertainty and would be excellent tools to probe unfolding history and rare events. However, detailed characterization of these approaches is required to identify their advantages and limitations. Here, we characterize a site-specific binding approach based on the ultrastable complex dockerin/cohesin III revealing its advantages and limitations to assess the unfolding history and to investigate rare and multiple events during the unfolding of repeated domains. We show that this approach is more robust, reproducible, and provides larger statistics than conventional unspecific methods. We show that the method is optimal to reveal the history of unfolding from the very first domain and to detect rare events, while being more limited to assess intermediate states. Finally, we quantify the forces required to unfold two molecules pulled in parallel, difficult when using unspecific approaches. The proposed method represents a step forward toward more reproducible measurements to probe protein unfolding history and opens the door to systematic probing of rare and multiple molecule unfolding mechanisms.

  7. Lectures on rare B decays

    International Nuclear Information System (INIS)

    Masiero, A.

    1989-01-01

    This paper provides a pedagogical presentation of the class of the rare charmless B decays with strange particles in the final state. These processes involve the flavour changing neutral current transition b → s and, thus, they are GIM suppresses. They constitute a specially promising ground to test the Standard Model and the possible presence of new physics beyond it. In particular I show that the radiative decays b → s + π and b → s + g are priviledged places to look for large supersymmetric enhancements. The author reviews both the present experimental and theoretical situations in this field and point out the challenges that we have to meet in the 90's to have rare B physics play a role comparable to that of rare K physics

  8. Rare KL decays at Fermilab

    International Nuclear Information System (INIS)

    Schnetzer, St.

    1997-01-01

    Recent results and the future prospects for rare K L decay at Fermilab are described. A summary of all rare decay results from E799 Phase I (the 1991 run) are presented. Three new results: K L → e + e - μ + μ - , K L → π 0 μe, and π 0 → e + e - e + e - are discussed in detail. Improvements for KTeV (the 1996-1997 run) are discussed and the expected sensitivities listed. Finally, the KAMI program for rare decays with the Main Injector (2000 and beyond) is presented with emphasis on a search for the decay K L → π 0 νν-bar at O(10 -12 ) single-event-sensitivity. (author)

  9. A rare cause of hemoptysis

    Directory of Open Access Journals (Sweden)

    Meghan Aversa

    2014-01-01

    Full Text Available Angiosarcomas are rare, malignant, endothelial-cell tumors of vascular origin that can arise at any body site. They frequently metastasize to the lung, heralded by dyspnea, hemoptysis, chest pain, pneumothoraces, and diffuse pulmonary hemorrhage. However, in most cases lung metastases are discovered after the diagnosis of a primary angiosarcoma has already been established. Very rarely will an undiagnosed metastatic angiosarcoma present as diffuse pulmonary hemorrhage. We describe the case of a 59-year-old male who presented to hospital with dyspnea and hemoptysis. CT chest revealed rapidly progressing nodular changes and broncho-alveolar lavage returns were progressively bloody. Open lung wedge biopsy ultimately revealed metastatic angiosarcoma and extensive pulmonary hemorrhage. Our case highlights the key clinical, radiological, and pathological features of this rare malignancy that frequently metastasizes to the lung and reminds clinicians to consider it as a cause of hemoptysis and pulmonary hemorrhage.

  10. Ainhum - A Rare Case Report.

    Science.gov (United States)

    Prabhu, Ravi; Kannan, Narayanasamy Subbaraju; Vinoth, Sundaresan; Praveen, Chinnappan Balasubramanian

    2016-04-01

    The term 'AINHUM' is derived from the African word meaning 'to saw or cut'. True ainhum otherwise called dactylolysis spontanea is a condition involving soft tissue or digits with constricting rings commonly presenting in fifth toes, usually bilateral. It is to be differentiated from Pseudo-ainhum that occurs secondary to some hereditary and nonhereditary diseases that lead to annular constriction of digits. We report a rare case of true ainhum involving the left fourth toe only. It is a very rare case and a very few were reported worldwide. The highest incidence of ainhum has been reported in South Africa and South America. It is rarely reported in India. Ainhum when diagnosed and treated in early stages can be prevented from progressing to mutilating deformities.

  11. Rare and semi-rare decays at ATLAS

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00213194; The ATLAS collaboration

    2016-01-01

    The measurements of the rare $B^0$-mesons decays processes performed by the ATLAS experiment at LHC are reviewed. Particular attention will be given to the measurement of the branching ratio of the $B^0_s$ and $B^0_d$ mesons decays into a pair of muons with the full Run 1 dataset corresponding to an integrated luminosity of 25 $\\rm{fb^{-1}}$.

  12. Economic Modeling Considerations for Rare Diseases.

    Science.gov (United States)

    Pearson, Isobel; Rothwell, Ben; Olaye, Andrew; Knight, Christopher

    2018-05-01

    To identify challenges that affect the feasibility and rigor of economic models in rare diseases and strategies that manufacturers have employed in health technology assessment submissions to demonstrate the value of new orphan products that have limited study data. Targeted reviews of PubMed, the National Institute for Health and Care Excellence's (NICE's) Highly Specialised Technologies (HST), and the Scottish Medicines Consortium's (SMC's) ultra-orphan submissions were performed. A total of 19 PubMed studies, 3 published NICE HSTs, and 11 ultra-orphan SMC submissions were eligible for inclusion. In rare diseases, a number of different factors may affect the model's ability to comply with good practice recommendations. Many products for the treatment of rare diseases have an incomplete efficacy and safety profile at product launch. In addition, there is often limited available natural history and epidemiology data. Information on the direct and indirect cost burden of an orphan disease also may be limited, making it difficult to estimate the potential economic benefit of treatment. These challenges can prevent accurate estimation of a new product's benefits in relation to costs. Approaches that can address such challenges include using patient and/or clinician feedback to inform model assumptions; data from disease analogues; epidemiological techniques, such as matching-adjusted indirect comparison; and long-term data collection. Modeling in rare diseases is often challenging; however, a number of approaches are available to support the development of model structures and the collation of input parameters and to manage uncertainty. Copyright © 2018 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

  13. Dioctophymiasis: A Rare Case Report.

    Science.gov (United States)

    Chauhan, Sapna; Kaval, Sunil; Tewari, Swati

    2016-02-01

    Dioctophyma renale commonly known as "giant kidney worm' is found in the kidney of carnivorous mammals. Human infestation is rare, but results in destruction of the kidneys. Very few cases have been reported worldwide. We are here reporting a case of Dioctophymiasis in a 35-year-old male patient who presented with retention of urine and subsequent passage of worm and blood in urine. The worm was confirmed as Dioctophyma renale based on its morphology and clinical presentation. This is a very rare case report and to best of our knowledge only two cases have been reported from India.

  14. Rare B decays, rare τ decays, and grand unification

    International Nuclear Information System (INIS)

    Sher, M.; Yuan, Y.

    1991-01-01

    In multi-Higgs-boson extensions of the standard model, tree-level flavor-changing neutral currents exist naturally, unless suppressed by some symmetry. For a given rate, the exchanged scalar or pseudoscalar mass is very sensitive to the flavor-changing coupling between the first two generations. Since the Yukawa couplings of the first two generations are unknown and certainly very small, bounds which rely on some assumed value of this flavor-changing coupling are quite dubious. One might expect the size (and reliability) of the Yukawa couplings involving the third generation to be greater. In this paper, we consider processes involving τ's and B's, and determine the bounds on the flavor-changing couplings which involve third-generation fields. The strongest bound in the quark sector comes from B-bar B mixing and in the lepton sector, surprisingly, from μ→eγ. It is then noted that the flavor-changing couplings in the quark sector are related to those in the lepton sector in many grand unified theories, and one can ask whether an analysis of rare τ decays or rare B decays will provide the strongest constraints. We show that rare B decays provide the strongest bounds, and that no useful information can be obtained from rare τ decays. It is also noted that the most promising decay modes are B→Kμτ and B s →μτ, and we urge experimenters to look for rare decay modes of the B in which a τ is in the final state

  15. Raw materials for advanced ceramics: rare earths separation processes

    International Nuclear Information System (INIS)

    Ricci, D.R.; Nobre, J.S.M.; Paschoal, J.O.A.

    1990-01-01

    The importance of obtaining purified rare earths oxidesis related, mainly to the increasing use of these compounds as raw materials for advanced ceramics. Processes of rare earths separation and purification are almost always based on the solvent extraction, fractional precipitation and ion exchange chromatography techniques, whose association depends on the initial concentrate and on the desired purity. This paper describes some steps of fractionation of didymium carbonate by using the solvent extraction and fractional precipitation techniques. The experimental conditions presented here have enable the production of lantanium, neodimium - praseodimium, samarium - gadolinium and ytrium concentrates, which constitute the intermediate fractions of the overall process to obtain high purity rare earths. (author) [pt

  16. De novo and rare inherited copy-number variations in the hemiplegic form of cerebral palsy.

    Science.gov (United States)

    Zarrei, Mehdi; Fehlings, Darcy L; Mawjee, Karizma; Switzer, Lauren; Thiruvahindrapuram, Bhooma; Walker, Susan; Merico, Daniele; Casallo, Guillermo; Uddin, Mohammed; MacDonald, Jeffrey R; Gazzellone, Matthew J; Higginbotham, Edward J; Campbell, Craig; deVeber, Gabrielle; Frid, Pam; Gorter, Jan Willem; Hunt, Carolyn; Kawamura, Anne; Kim, Marie; McCormick, Anna; Mesterman, Ronit; Samdup, Dawa; Marshall, Christian R; Stavropoulos, Dimitri J; Wintle, Richard F; Scherer, Stephen W

    2018-02-01

    PurposeHemiplegia is a subtype of cerebral palsy (CP) in which one side of the body is affected. Our earlier study of unselected children with CP demonstrated de novo and clinically relevant rare inherited genomic copy-number variations (CNVs) in 9.6% of participants. Here, we examined the prevalence and types of CNVs specifically in hemiplegic CP.MethodsWe genotyped 97 unrelated probands with hemiplegic CP and their parents. We compared their CNVs to those of 10,851 population controls, in order to identify rare CNVs (<0.1% frequency) that might be relevant to CP. We also sequenced exomes of "CNV-positive" trios.ResultsWe detected de novo CNVs and/or sex chromosome abnormalities in 7/97 (7.2%) of probands, impacting important developmental genes such as GRIK2, LAMA1, DMD, PTPRM, and DIP2C. In 18/97 individuals (18.6%), rare inherited CNVs were found, affecting loci associated with known genomic disorders (17p12, 22q11.21) or involving genes linked to neurodevelopmental disorders.ConclusionWe found an increased rate of de novo CNVs in the hemiplegic CP subtype (7.2%) compared to controls (1%). This result is similar to that for an unselected CP group. Combined with rare inherited CNVs, the genomic data impacts the understanding of the potential etiology of hemiplegic CP in 23/97 (23.7%) of participants.

  17. Endangered, rare and endemic medicinal plants of the Kopetdag

    OpenAIRE

    AKMURADOV ALLAMURAD; SHAIYMOV BABAGULY; HALMEDOV BAZAR; YAKUBOV ATABEG; HALLIYEVA GULYAIYM

    2016-01-01

    The article presents some information of the place of growing of the endangered, rare and endemic medicinal plants of the Kopetdag. A monitoring has been carried out and the bioecological peculiarities, resource characteristics and modern state of the natural population of the most important species have been studied. Some scientifically based ways of protection and introduction into culture have been worked out to preserve the endangered, rare and endemic medicinal plants of the region.

  18. Rare pion and kaon decays

    International Nuclear Information System (INIS)

    Bryman, D.

    1983-09-01

    Some rare pion and kaon decays, which provide clues to the generation puzzle, are discussed. The π→ eν/π→μ/ν branching ratio test of universality and the status of searches for K + → π + rho anti rho are reviewed

  19. Cardiofaciocutaneous syndrome: A rare entity

    Directory of Open Access Journals (Sweden)

    S Pavithra

    2012-01-01

    Full Text Available The cardiofaciocutaneous (CFC syndrome is a condition of sporadic occurrence, with patients showing multiple congenital anomalies and mental retardation and characteristic dysmorphic features. We, thus, report a rare case of this syndrome in a 1-year-old child who presented with typical features of CFC syndrome.

  20. Rare Animal Education Usingaugmented Reality

    Directory of Open Access Journals (Sweden)

    Hening Artdias

    2018-01-01

    They are extinction because destruction of forest habitats, a conflict between humans and animals, trade, hunting, the arrests beyond capacity. [1]. Is that the issue of the extinction of the animals is dominated by human behavior and nature of the wrath of them. For that, education game “Rare Animal” become formulations to raise awareness of endangered species.

  1. Rare localisations of osteochondrosis juvenilis

    Energy Technology Data Exchange (ETDEWEB)

    Schumacher, R; Schuster, W; Mueller, U

    1981-04-01

    A survey of rare localisations of osteochondrosis juvenilis is given and illustrated by cases of Morbus Friedrich, Morbus Panner, Vertebra plana Calve, Morbus Blount, Morbus Iselin, Morbus Hegemann and Morbus Thiemann. This is followed by discussion of etiology and differential diagnosis.

  2. Rare diseases and orphan drugs

    Directory of Open Access Journals (Sweden)

    Domenica Taruscio

    2011-01-01

    Full Text Available According to the Regulation (EC N. 141/2000 of the European Parliament and of the Council, rare diseases are life-threatening or chronically debilitating conditions, affecting no more than 5 in 10 000 persons in the European Community. It is estimated that between 6000 to 8000 distinct rare diseases affect up to 6% of the total EU population. Therefore, these conditions can be considered rare if taken individually but they affect a significant proportion of the European population when considered as a single group. Several initiatives have been undertaken at international, European and national level to tackle public health as well as research issues related to the prevention, diagnosis, treatment and surveillance of these diseases. The development of innovative and effective medical products for their diagnosis and treatment is frequently hampered by several factors, including the limited knowledge of their natural history, the difficulties in setting up clinical studies due to the limited numbers of patients affected by a specific disease, the weak interest of sponsors due to the restricted market opportunities. Therefore, incentives and other facilitations have been adopted in many parts of the world, including in the EU, in order to facilitate the development and commercialization of diagnostic tools and treatments devoted to rare diseases. This paper illustrates mainly the European initiatives and will discuss the problematic and controversial aspects surrounding orphan drugs. Finally, activities and measures adopted in Italy are presented.

  3. Funiculitis mimicking appendicitis: A rare culprit

    Directory of Open Access Journals (Sweden)

    Lindsey L. Perea

    2017-01-01

    Full Text Available Acute appendicitis is an extremely common cause for pediatric admissions, most notably presenting with right lower quadrant pain. There are few other etiologies for a young male to have pain aside from appendicitis. We present a young boy who presented with right lower quadrant abdominal pain and fevers, but was found to have funiculitis. Funiculitis, or inflammation of the spermatic cord, is a very rare condition in the pediatric population, almost always occurring in the elderly with urinary flow conditions. We share our case to remind providers the importance of a full differential diagnosis.

  4. Mining rare associations between biological ontologies.

    Science.gov (United States)

    Benites, Fernando; Simon, Svenja; Sapozhnikova, Elena

    2014-01-01

    The constantly increasing volume and complexity of available biological data requires new methods for their management and analysis. An important challenge is the integration of information from different sources in order to discover possible hidden relations between already known data. In this paper we introduce a data mining approach which relates biological ontologies by mining cross and intra-ontology pairwise generalized association rules. Its advantage is sensitivity to rare associations, for these are important for biologists. We propose a new class of interestingness measures designed for hierarchically organized rules. These measures allow one to select the most important rules and to take into account rare cases. They favor rules with an actual interestingness value that exceeds the expected value. The latter is calculated taking into account the parent rule. We demonstrate this approach by applying it to the analysis of data from Gene Ontology and GPCR databases. Our objective is to discover interesting relations between two different ontologies or parts of a single ontology. The association rules that are thus discovered can provide the user with new knowledge about underlying biological processes or help improve annotation consistency. The obtained results show that produced rules represent meaningful and quite reliable associations.

  5. Mining rare associations between biological ontologies.

    Directory of Open Access Journals (Sweden)

    Fernando Benites

    Full Text Available The constantly increasing volume and complexity of available biological data requires new methods for their management and analysis. An important challenge is the integration of information from different sources in order to discover possible hidden relations between already known data. In this paper we introduce a data mining approach which relates biological ontologies by mining cross and intra-ontology pairwise generalized association rules. Its advantage is sensitivity to rare associations, for these are important for biologists. We propose a new class of interestingness measures designed for hierarchically organized rules. These measures allow one to select the most important rules and to take into account rare cases. They favor rules with an actual interestingness value that exceeds the expected value. The latter is calculated taking into account the parent rule. We demonstrate this approach by applying it to the analysis of data from Gene Ontology and GPCR databases. Our objective is to discover interesting relations between two different ontologies or parts of a single ontology. The association rules that are thus discovered can provide the user with new knowledge about underlying biological processes or help improve annotation consistency. The obtained results show that produced rules represent meaningful and quite reliable associations.

  6. Bioleaching of rare earth elements from monazite sand.

    Science.gov (United States)

    Brisson, Vanessa L; Zhuang, Wei-Qin; Alvarez-Cohen, Lisa

    2016-02-01

    Three fungal strains were found to be capable of bioleaching rare earth elements from monazite, a rare earth phosphate mineral, utilizing the monazite as a phosphate source and releasing rare earth cations into solution. These organisms include one known phosphate solubilizing fungus, Aspergillus niger ATCC 1015, as well as two newly isolated fungi: an Aspergillus terreus strain ML3-1 and a Paecilomyces spp. strain WE3-F. Although monazite also contains the radioactive element Thorium, bioleaching by these fungi preferentially solubilized rare earth elements over Thorium, leaving the Thorium in the solid residual. Adjustments in growth media composition improved bioleaching performance measured as rare earth release. Cell-free spent medium generated during growth of A. terreus strain ML3-1 and Paecilomyces spp. strain WE3-F in the presence of monazite leached rare earths to concentrations 1.7-3.8 times those of HCl solutions of comparable pH, indicating that compounds exogenously released by these organisms contribute substantially to leaching. Organic acids released by the organisms included acetic, citric, gluconic, itaconic, oxalic, and succinic acids. Abiotic leaching with laboratory prepared solutions of these acids was not as effective as bioleaching or leaching with cell-free spent medium at releasing rare earths from monazite, indicating that compounds other than the identified organic acids contribute to leaching performance. © 2015 Wiley Periodicals, Inc.

  7. Research on economy and social exclusion: China dolls and rare diseases.

    Science.gov (United States)

    Matsui, Akihiko

    2013-02-01

    The second workshop on "Research on Economy And Social Exclusion (REASE)" was held in the University of Tokyo on January 26, 2013. Focusing on rare diseases and disorders in China, three speakers from China introduced the current status of rare diseases and the challenge of support organizations for patients with rare disease and disorders in China, and especially pointed out some important issues associated with rare diseases and disorders in China. From the viewpoint of economics, this paper discusses some of the important issues of rare diseases and disorders in China raised in this workshop, especially from the aspects of economy of scale and orphan drugs, and the emergence of stigma from discrimination. It was shown that international coordination and cooperation are called for in order to give a proper incentive to the drug industries to create new drugs for rare diseases, and suggested that an important step toward inclusion is to reduce stigma by making rare diseases visible as much as possible.

  8. Rare and semi-rare decays at ATLAS

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00213194; The ATLAS collaboration

    2016-01-01

    The measurements of the rare $B^0$-meson-decay processes performed by the ATLAS experiment at the LHC are reviewed. Particular attention will be given to the measurement of the branching ratio of the $B^0_s$ and $B^0_d$ mesons decays into a pair of muons with the full Run 1 dataset corresponding to an integrated luminosity of 25 $\\rm{fb^{-1}}$.

  9. Twenty-First Century Diseases: Commonly Rare and Rarely Common?

    Science.gov (United States)

    Daunert, Sylvia; Sittampalam, Gurusingham Sitta; Goldschmidt-Clermont, Pascal J

    2017-09-20

    Alzheimer's drugs are failing at a rate of 99.6%, and success rate for drugs designed to help patients with this form of dementia is 47 times less than for drugs designed to help patients with cancers ( www.scientificamerican.com/article/why-alzheimer-s-drugs-keep-failing/2014 ). How can it be so difficult to produce a valuable drug for Alzheimer's disease? Each human has a unique genetic and epigenetic makeup, thus endowing individuals with a highly unique complement of genes, polymorphisms, mutations, RNAs, proteins, lipids, and complex sugars, resulting in distinct genome, proteome, metabolome, and also microbiome identity. This editorial is taking into account the uniqueness of each individual and surrounding environment, and stresses the point that a more accurate definition of a "common" disorder could be simply the amalgamation of a myriad of "rare" diseases. These rare diseases are being grouped together because they share a rather constant complement of common features and, indeed, generally respond to empirically developed treatments, leading to a positive outcome consistently. We make the case that it is highly unlikely that such treatments, despite their statistical success measured with large cohorts using standardized clinical research, will be effective on all patients until we increase the depth and fidelity of our understanding of the individual "rare" diseases that are grouped together in the "buckets" of common illnesses. Antioxid. Redox Signal. 27, 511-516.

  10. Rare Earth Garnet Selective Emitter

    Science.gov (United States)

    Lowe, Roland A.; Chubb, Donald L.; Farmer, Serene C.; Good, Brian S.

    1994-01-01

    Thin film Ho-YAG and Er-YAG emitters with a platinum substrate exhibit high spectral emittance in the emission band (epsilon(sub lambda) approx. = 0.75, sup 4)|(sub 15/2) - (sup 4)|(sub 13/2),for Er-YAG and epsilon(sub lambda) approx. = 0.65, (sup 5)|(sub 7) - (sup 5)|(sub 8) for Ho-YAG) at 1500 K. In addition, low out-of-band spectral emittance, epsilon(sub lambda) less than 0.2, suggest these materials would be excellent candidates for high efficiency selective emitters in thermophotovoltaic (TPV) systems operating at moderate temperatures (1200-1500 K). Spectral emittance measurements of the thin films were made (1.2 less than lambda less than 3.0 microns) and compared to the theoretical emittances calculated using measured values of the spectral extinction coefficient. In this paper we present the results for a new class of rare earth ion selective emitters. These emitters are thin sections (less than 1 mm) of yttrium aluminum garnet (YAG) single crystal with a rare earth substitutional impurity. Selective emitters in the near IR are of special interest for thermophotovoltaic (TPV) energy conversion. The most promising solid selective emitters for use in a TPV system are rare earth oxides. Early spectral emittance work on rare earth oxides showed strong emission bands in the infrared (0.9 - 3 microns). However, the emittance outside the emission band was also significant and the efficiency of these emitters was low. Recent improvements in efficiency have been made with emitters fabricated from fine (5 - 10 microns) rare earth oxide fibers similar to the Welsbach mantle used in gas lanterns. However, the rare earth garnet emitters are more rugged than the mantle type emitters. A thin film selective emitter on a low emissivity substrate such as gold, platinum etc., is rugged and easily adapted to a wide variety of thermal sources. The garnet structure and its many subgroups have been successfully used as hosts for rare earth ions, introduced as substitutional

  11. Testicular calculus: A rare case.

    Science.gov (United States)

    Sen, Volkan; Bozkurt, Ozan; Demır, Omer; Tuna, Burcin; Yorukoglu, Kutsal; Esen, Adil

    2015-01-01

    Testicular calculus is an extremely rare case with unknown etiology and pathogenesis. To our knowledge, here we report the third case of testicular calculus. A 31-year-old man was admitted to our clinic with painful solid mass in left testis. After diagnostic work-up for a possible testicular tumour, he underwent inguinal orchiectomy and histopathologic examination showed a testicular calculus. Case hypothesis: Solid testicular lesions in young adults generally correspond to testicular cancer. Differential diagnosis should be done carefully. Future implications: In young adults with painful and solid testicular mass with hyperechogenic appearance on scrotal ultrasonography, testicular calculus must be kept in mind in differential diagnosis. Further reports on this topic may let us do more clear recommendations about the etiology and treatment of this rare disease.

  12. Chondroectodermal dysplasia: a rare syndrome.

    Directory of Open Access Journals (Sweden)

    Dana Tahririan

    2014-06-01

    Full Text Available Chondroectodermal dysplasia (Ellis-Van Creveld syndrome is a rare autosomal recessive congenital abnormality. This syndrome is characterized by a spectrum of clinical findings, among which chondrodystrophy, polydactyly, ectodermal dysplasia, and congenital cardiac anomalies are the most common. It is imperative to not overlook the cardiac complications in patients with this syndrome during dental procedures. The case presented here, although quite rare, was detected under normal conditions and can be alarming for dental care providers. Clinical reports outline the classical and unusual oral and dental manifestations, which help health care providers diagnose chondroectodermal dysplasia, and refer patients with this syndrome to appropriate health care professionals to receive treatment to prevent further cardiac complications and bone deformities.

  13. Rare myositis-specific autoantibody associations among Hungarian patients with idiopathic inflammatory myopathy.

    Science.gov (United States)

    Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K

    2015-01-01

    Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.

  14. Carcinoma caecum - a rare presentation

    International Nuclear Information System (INIS)

    Ali, T.; Mudasser, S.; Mudsser, S.; Sarwar, M.

    2010-01-01

    Caecal and right sided colonic cancers mostly present with fatigue, weakness and iron deficiency anemia. Such tumours rarely perforate posteriorly and involve the retroperitoneum. We report a case of an old Omani lady who came with insidious sign and symptoms of perforated caecum leading to retroperitoneal collection and necrotizing fasciitis of abdominal wall due to carcinoma of caecum. She underwent surgery but despite active intervention, she died because of septicemic shock. (author)

  15. Intracranial chondroma: a rare entity.

    Science.gov (United States)

    Maheshwari, Veena; Mehdi, Ghazala; Varshney, Manoranjan; Jain, Anshu; Vashishtha, Sonal; Gaur, Kavita; Srivastava, Vinod Kumar

    2011-05-12

    Intracranial chondroma is a rare benign cartilaginous tumour with an incidence of less than 1% of all primary intracranial tumours. The authors are reporting here a case of intracranial chondroma in a 40-year-old man who presented with 5-month history of headache and gradual diminution of vision. A tentative diagnosis of chondroma was made on imprint cytology which was confirmed on histopathological examination.

  16. Sirenomelia Apus: A Rare Deformity

    Science.gov (United States)

    Kshirsagar, Vinayak Y.; Ahmed, Minhajuddin; Colaco, Sylvia M.

    2012-01-01

    Sirenomelia also known as the mermaid syndrome, is a rare congenital malformation of uncertain etiology. It is characterized by fusion of the lower limbs and commonly associated with severe urogenital and gastrointestinal malformations. There are approximately 300 cases reported in the literature, 15% of which are associated with twinning, most often monozygotic. The syndrome of caudal regression is thought to be the result of injury to the caudal mesoderm early in gestation. PMID:24027712

  17. Sirenomelia apus: a rare deformity.

    Science.gov (United States)

    Kshirsagar, Vinayak Y; Ahmed, Minhajuddin; Colaco, Sylvia M

    2012-07-01

    Sirenomelia also known as the mermaid syndrome, is a rare congenital malformation of uncertain etiology. It is characterized by fusion of the lower limbs and commonly associated with severe urogenital and gastrointestinal malformations. There are approximately 300 cases reported in the literature, 15% of which are associated with twinning, most often monozygotic. The syndrome of caudal regression is thought to be the result of injury to the caudal mesoderm early in gestation.

  18. Macrodystrophia lipomatosa: a rare presentation

    Directory of Open Access Journals (Sweden)

    Sushil G. Kachewar

    2011-07-01

    Full Text Available Macrodystrophia lipomatosa is a rare congenital nonhereditary mesenchymal hamartomatous malformation resulting in localized gigantism of parts of extremities that manifests clinically as macrodactyly or megalodactyly. Radiological and Pathological hallmark is the disproportionate fibroadipose tissue proliferation in subcutaneous tissue, nerve sheaths, and periosteum that leads to soft tissue and bony enlargement. As imaging is the key to early diagnosis, findings on various modalities like plain radiographs, CT scan and MRI are highlighted here.

  19. Genetic analysis of rare disorders

    DEFF Research Database (Denmark)

    van den Berg, Stéphanie M; von Bornemann Hjelmborg, Jacob

    2012-01-01

    Twin concordance rates provide insight into the possibility of a genetic background for a disease. These concordance rates are usually estimated within a frequentistic framework. Here we take a Bayesian approach. For rare diseases, estimation methods based on asymptotic theory cannot be applied due....... The Bayesian method is able to include prior information on both concordance rates and prevalence rates at the same time and is illustrated using twin data on cleft lip and rheumatoid arthritis....

  20. Rare earth niobate coordination polymers

    Science.gov (United States)

    Muniz, Collin N.; Patel, Hiral; Fast, Dylan B.; Rohwer, Lauren E. S.; Reinheimer, Eric W.; Dolgos, Michelle; Graham, Matt W.; Nyman, May

    2018-03-01

    Rare-earth (RE) coordination polymers are infinitely tailorable to yield luminescent materials for various applications. Here we described the synthesis of a heterometallic rare-earth coordination compound ((CH3)2SO)3(RE)NbO(C2O4)3((CH3)2SO) = dimethylsulfoxide, DMSO, (C2O2= oxalate), (RE=La, Ce, Pr, Nd, Sm, Eu, Gd, Tb). The structure was obtained from single crystal X-ray diffraction of the La analogue. The Nb˭O and DMSO terminal-bonding character guides assembly of an open framework structure with noncentrosymmetric RE-coordination geometry, and large spacing between the RE centers. A second structure was observed by PXRD for the smaller rare earths (Dy, Ho, Er, Yb); this structure has not yet been determined. The materials were further characterized using FTIR, and photoluminescence measurements. Characteristic excitation and emission transitions were observed for RE = Nd, Sm, Eu, and Tb. Quantum yield (QY) measurements were performed by exciting Eu and Tb analoges at 394 nm (QY 66%) and 464 nm (QY 71%) for Eu; and 370 nm (QY=40%) for Tb. We attribute the high QY and bright luminescence to two main structure-function properties of the system; namely the absence of water in the structure, and absence of concentration quenching.

  1. Rare earth industry in India

    International Nuclear Information System (INIS)

    Singh, D.S.

    2016-01-01

    Rare Earths (RE) comprises of 17 elements i.e. elements from atomic No. 57-71 (lanthanide series) along with yttrium (atomic No. 39) and scandium (atomic No. 21). They exhibit special electronic, magnetic, optical and catalytic properties. The first 7 elements in the lanthanide series from atomic Nos. 57 to 63 (La to Eu) are called Light Rare Earths (LRE), while the remaining elements from atomic Nos. 64 to 71 (Gd to Lu) are grouped as Heavy Rare Earths (HRE). Scandium and Yttrium have properties similar to HRE. The concentration of the REs in the earth's crust is as high as some other elements including that of copper. The only difference is that REs do not occur as separate minerals amenable for easy exploration and mining and are widely distributed across the earth's surface, hence they are called as REs. Resources In India, monazite has been the principal source of RE. It occurs in association with other heavy minerals, such as ilmenite, rutile, zircon etc. in the beach sands and inland placer deposits. The monazite content in this assemblage varies from negligible quantity to as high as 5%. As per AMD resource estimation, the reported resource of monazite in India is about 11.93 million tons which corresponds with about 6.9 million tons of RE oxides. Although India possesses large deposits of monazite, the heavier RE are not present in sufficient quantities in this mineral. (author)

  2. Biosynthesis of rare hexoses using microorganisms and related enzymes

    Science.gov (United States)

    Li, Zijie; Gao, Yahui; Nakanishi, Hideki

    2013-01-01

    Summary Rare sugars, referred to as monosaccharides and their derivatives that rarely exist in nature, can be applied in many areas ranging from foodstuffs to pharmaceutical and nutrition industry, or as starting materials for various natural products and drug candidates. Unfortunately, an important factor restricting the utilization of rare sugars is their limited availability, resulting from limited synthetic methods. Nowadays, microbial and enzymatic transformations have become a very powerful tool in this field. This article reviews the biosynthesis and enzymatic production of rare ketohexoses, aldohexoses and sugar alcohols (hexitols), including D-tagatose, D-psicose, D-sorbose, L-tagatose, L-fructose, 1-deoxy-L-fructose, D-allose, L-glucose, L-talose, D-gulose, L-galactose, L-fucose, allitol, D-talitol, and L-sorbitol. New systems and robust catalysts resulting from advancements in genomics and bioengineering are also discussed. PMID:24367410

  3. Biosynthesis of rare hexoses using microorganisms and related enzymes

    Directory of Open Access Journals (Sweden)

    Zijie Li

    2013-11-01

    Full Text Available Rare sugars, referred to as monosaccharides and their derivatives that rarely exist in nature, can be applied in many areas ranging from foodstuffs to pharmaceutical and nutrition industry, or as starting materials for various natural products and drug candidates. Unfortunately, an important factor restricting the utilization of rare sugars is their limited availability, resulting from limited synthetic methods. Nowadays, microbial and enzymatic transformations have become a very powerful tool in this field. This article reviews the biosynthesis and enzymatic production of rare ketohexoses, aldohexoses and sugar alcohols (hexitols, including D-tagatose, D-psicose, D-sorbose, L-tagatose, L-fructose, 1-deoxy-L-fructose, D-allose, L-glucose, L-talose, D-gulose, L-galactose, L-fucose, allitol, D-talitol, and L-sorbitol. New systems and robust catalysts resulting from advancements in genomics and bioengineering are also discussed.

  4. Biosynthesis of rare hexoses using microorganisms and related enzymes.

    Science.gov (United States)

    Li, Zijie; Gao, Yahui; Nakanishi, Hideki; Gao, Xiaodong; Cai, Li

    2013-11-12

    Rare sugars, referred to as monosaccharides and their derivatives that rarely exist in nature, can be applied in many areas ranging from foodstuffs to pharmaceutical and nutrition industry, or as starting materials for various natural products and drug candidates. Unfortunately, an important factor restricting the utilization of rare sugars is their limited availability, resulting from limited synthetic methods. Nowadays, microbial and enzymatic transformations have become a very powerful tool in this field. This article reviews the biosynthesis and enzymatic production of rare ketohexoses, aldohexoses and sugar alcohols (hexitols), including D-tagatose, D-psicose, D-sorbose, L-tagatose, L-fructose, 1-deoxy-L-fructose, D-allose, L-glucose, L-talose, D-gulose, L-galactose, L-fucose, allitol, D-talitol, and L-sorbitol. New systems and robust catalysts resulting from advancements in genomics and bioengineering are also discussed.

  5. A case report of acute pediatric bacterial meningitis due to the rare isolate, Pseudomonas putida

    Institute of Scientific and Technical Information of China (English)

    Grishma V. Kulkarni

    2016-01-01

    Acute bacterial meningitis (ABM) is the medical emergency which warrants an early diagnosis and an aggressive therapy. Despite the availability of the potent newer antibiotics, the mortality caused by ABM and its complications remain high in India, ranging from 16% to 32%. The aim of this case report is to present the rare isolation ofPseudomonas putida from cerebrospinal lfuid sample. Besides this, the author also emphasizes the importance of correctly identifying the organism and thus the selection of the most accurate antibiotic from the susceptibility proifle to allow for early recovery and to improve the patient outcome and survival.

  6. Rare Cause of Hip Pain: Transient Osteoporosis of the Hip-Two Case Reports

    Directory of Open Access Journals (Sweden)

    Senem Şaş

    2015-12-01

    Full Text Available Transient osteoporosis of the hip (TOH is a rare disease affecting especially middle-aged men and women in the third trimester of pregnancy with unknown etiology. It has a benign course with spontaneous resolution. Transient osteoporosis may be confused with other diseases such as avascular necrosis. Early diagnosis is important to identify and plan correct treatment. In this report, two male cases with complaint of hip pain and difficulty in walking, which were diagnosed with TOH was presented by reviewing current literature.

  7. Bayesian detection of causal rare variants under posterior consistency.

    KAUST Repository

    Liang, Faming

    2013-07-26

    Identification of causal rare variants that are associated with complex traits poses a central challenge on genome-wide association studies. However, most current research focuses only on testing the global association whether the rare variants in a given genomic region are collectively associated with the trait. Although some recent work, e.g., the Bayesian risk index method, have tried to address this problem, it is unclear whether the causal rare variants can be consistently identified by them in the small-n-large-P situation. We develop a new Bayesian method, the so-called Bayesian Rare Variant Detector (BRVD), to tackle this problem. The new method simultaneously addresses two issues: (i) (Global association test) Are there any of the variants associated with the disease, and (ii) (Causal variant detection) Which variants, if any, are driving the association. The BRVD ensures the causal rare variants to be consistently identified in the small-n-large-P situation by imposing some appropriate prior distributions on the model and model specific parameters. The numerical results indicate that the BRVD is more powerful for testing the global association than the existing methods, such as the combined multivariate and collapsing test, weighted sum statistic test, RARECOVER, sequence kernel association test, and Bayesian risk index, and also more powerful for identification of causal rare variants than the Bayesian risk index method. The BRVD has also been successfully applied to the Early-Onset Myocardial Infarction (EOMI) Exome Sequence Data. It identified a few causal rare variants that have been verified in the literature.

  8. Bayesian detection of causal rare variants under posterior consistency.

    Directory of Open Access Journals (Sweden)

    Faming Liang

    Full Text Available Identification of causal rare variants that are associated with complex traits poses a central challenge on genome-wide association studies. However, most current research focuses only on testing the global association whether the rare variants in a given genomic region are collectively associated with the trait. Although some recent work, e.g., the Bayesian risk index method, have tried to address this problem, it is unclear whether the causal rare variants can be consistently identified by them in the small-n-large-P situation. We develop a new Bayesian method, the so-called Bayesian Rare Variant Detector (BRVD, to tackle this problem. The new method simultaneously addresses two issues: (i (Global association test Are there any of the variants associated with the disease, and (ii (Causal variant detection Which variants, if any, are driving the association. The BRVD ensures the causal rare variants to be consistently identified in the small-n-large-P situation by imposing some appropriate prior distributions on the model and model specific parameters. The numerical results indicate that the BRVD is more powerful for testing the global association than the existing methods, such as the combined multivariate and collapsing test, weighted sum statistic test, RARECOVER, sequence kernel association test, and Bayesian risk index, and also more powerful for identification of causal rare variants than the Bayesian risk index method. The BRVD has also been successfully applied to the Early-Onset Myocardial Infarction (EOMI Exome Sequence Data. It identified a few causal rare variants that have been verified in the literature.

  9. Bayesian detection of causal rare variants under posterior consistency.

    KAUST Repository

    Liang, Faming; Xiong, Momiao

    2013-01-01

    Identification of causal rare variants that are associated with complex traits poses a central challenge on genome-wide association studies. However, most current research focuses only on testing the global association whether the rare variants in a given genomic region are collectively associated with the trait. Although some recent work, e.g., the Bayesian risk index method, have tried to address this problem, it is unclear whether the causal rare variants can be consistently identified by them in the small-n-large-P situation. We develop a new Bayesian method, the so-called Bayesian Rare Variant Detector (BRVD), to tackle this problem. The new method simultaneously addresses two issues: (i) (Global association test) Are there any of the variants associated with the disease, and (ii) (Causal variant detection) Which variants, if any, are driving the association. The BRVD ensures the causal rare variants to be consistently identified in the small-n-large-P situation by imposing some appropriate prior distributions on the model and model specific parameters. The numerical results indicate that the BRVD is more powerful for testing the global association than the existing methods, such as the combined multivariate and collapsing test, weighted sum statistic test, RARECOVER, sequence kernel association test, and Bayesian risk index, and also more powerful for identification of causal rare variants than the Bayesian risk index method. The BRVD has also been successfully applied to the Early-Onset Myocardial Infarction (EOMI) Exome Sequence Data. It identified a few causal rare variants that have been verified in the literature.

  10. Computer-assisted initial diagnosis of rare diseases

    Directory of Open Access Journals (Sweden)

    Rui Alves

    2016-07-01

    Full Text Available Introduction. Most documented rare diseases have genetic origin. Because of their low individual frequency, an initial diagnosis based on phenotypic symptoms is not always easy, as practitioners might never have been exposed to patients suffering from the relevant disease. It is thus important to develop tools that facilitate symptom-based initial diagnosis of rare diseases by clinicians. In this work we aimed at developing a computational approach to aid in that initial diagnosis. We also aimed at implementing this approach in a user friendly web prototype. We call this tool Rare Disease Discovery. Finally, we also aimed at testing the performance of the prototype. Methods. Rare Disease Discovery uses the publicly available ORPHANET data set of association between rare diseases and their symptoms to automatically predict the most likely rare diseases based on a patient’s symptoms. We apply the method to retrospectively diagnose a cohort of 187 rare disease patients with confirmed diagnosis. Subsequently we test the precision, sensitivity, and global performance of the system under different scenarios by running large scale Monte Carlo simulations. All settings account for situations where absent and/or unrelated symptoms are considered in the diagnosis. Results. We find that this expert system has high diagnostic precision (≥80% and sensitivity (≥99%, and is robust to both absent and unrelated symptoms. Discussion. The Rare Disease Discovery prediction engine appears to provide a fast and robust method for initial assisted differential diagnosis of rare diseases. We coupled this engine with a user-friendly web interface and it can be freely accessed at http://disease-discovery.udl.cat/. The code and most current database for the whole project can be downloaded from https://github.com/Wrrzag/DiseaseDiscovery/tree/no_classifiers.

  11. Primary thyroid lymphoma: a rare thyroid malignancy

    International Nuclear Information System (INIS)

    Mukhtar, R.; Khattak, R.; Mateen, A.

    2011-01-01

    Incidence of thyroidal masses is very high with predominance in females. Most of these masses are benign. Malignancy can be of thyroid or non-thyroid origin. Surgery is treatment of choice in the former but not in latter. Primary thyroid lymphoma (PTL) is a rare cause of thyroid malignancy of non-thyroid origin which is highly treatable without surgery but early diagnosis is important requisite to have better outcome. Fine needle aspiration cytology (FNAC) is an important tool in early diagnosis of PTL, which enables doctors to treat patient better without major surgery and its morbidity. Two cases of primary thyroid lymphoma are hereby presented. The patient diagnosed on FNAC had better outcome than the one who had major surgery. (author)

  12. Enhanced separation of rare earth elements

    Energy Technology Data Exchange (ETDEWEB)

    Lyon, K. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Greenhalgh, M. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Herbst, R. S. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Garn, T. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Welty, A. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Soderstrom, M. D. [Cytec Solvay Group, Tempe, AZ (United States); Jakovljevic, B. [Cytec Solvay Group, Niagara Falls, ON (Canada)

    2016-09-01

    Industrial rare earth separation processes utilize PC88A, a phosphonic acid ligand, for solvent extraction separations. The separation factors of the individual rare earths, the equipment requirements, and chemical usage for these flowsheets are well characterized. Alternative ligands such as Cyanex® 572 and the associated flowsheets are being investigated at the pilot scale level to determine if significant improvements to the current separation processes can be realized. These improvements are identified as higher separation factors, reduced stage requirements, or reduced chemical consumption. Any of these improvements can significantly affect the costs associated with these challenging separation proccesses. A mid/heavy rare earth element (REE) separations flowsheet was developed and tested for each ligand in a 30 stage mixer-settler circuit to compare the separation performance of PC88A and Cyanex® 572. The ligand-metal complex strength of Cyanex® 572 provides efficient extraction of REE while significantly reducing the strip acid requirements. Reductions in chemical consumption have a significant impact on process economics for REE separations. Partitioning results summarized Table 1 indicate that Cyanex® 572 offers the same separation performance as PC88A while reducing acid consumption by 30% in the strip section for the mid/heavy REE separation. Flowsheet Effluent Compositions PC88A Cyanex® 572 Raffinate Mid REE Heavy REE 99.40% 0.60% 99.40% 0.60% Rich Mid REE Heavy REE 2.20% 97.80% 0.80% 99.20% Liquor Strip Acid Required 3.4 M 2.3 M Table 1 – Flowsheet results comparing separation performance of PC88A and Cyanex® 572 for a mid/heavy REE separation.

  13. Rare Genome-Wide Copy Number Variation and Expression of Schizophrenia in 22q11.2 Deletion Syndrome.

    Science.gov (United States)

    Bassett, Anne S; Lowther, Chelsea; Merico, Daniele; Costain, Gregory; Chow, Eva W C; van Amelsvoort, Therese; McDonald-McGinn, Donna; Gur, Raquel E; Swillen, Ann; Van den Bree, Marianne; Murphy, Kieran; Gothelf, Doron; Bearden, Carrie E; Eliez, Stephan; Kates, Wendy; Philip, Nicole; Sashi, Vandana; Campbell, Linda; Vorstman, Jacob; Cubells, Joseph; Repetto, Gabriela M; Simon, Tony; Boot, Erik; Heung, Tracy; Evers, Rens; Vingerhoets, Claudia; van Duin, Esther; Zackai, Elaine; Vergaelen, Elfi; Devriendt, Koen; Vermeesch, Joris R; Owen, Michael; Murphy, Clodagh; Michaelovosky, Elena; Kushan, Leila; Schneider, Maude; Fremont, Wanda; Busa, Tiffany; Hooper, Stephen; McCabe, Kathryn; Duijff, Sasja; Isaev, Karin; Pellecchia, Giovanna; Wei, John; Gazzellone, Matthew J; Scherer, Stephen W; Emanuel, Beverly S; Guo, Tingwei; Morrow, Bernice E; Marshall, Christian R

    2017-11-01

    Chromosome 22q11.2 deletion syndrome (22q11.2DS) is associated with a more than 20-fold increased risk for developing schizophrenia. The aim of this study was to identify additional genetic factors (i.e., "second hits") that may contribute to schizophrenia expression. Through an international consortium, the authors obtained DNA samples from 329 psychiatrically phenotyped subjects with 22q11.2DS. Using a high-resolution microarray platform and established methods to assess copy number variation (CNV), the authors compared the genome-wide burden of rare autosomal CNV, outside of the 22q11.2 deletion region, between two groups: a schizophrenia group and those with no psychotic disorder at age ≥25 years. The authors assessed whether genes overlapped by rare CNVs were overrepresented in functional pathways relevant to schizophrenia. Rare CNVs overlapping one or more protein-coding genes revealed significant between-group differences. For rare exonic duplications, six of 19 gene sets tested were enriched in the schizophrenia group; genes associated with abnormal nervous system phenotypes remained significant in a stepwise logistic regression model and showed significant interactions with 22q11.2 deletion region genes in a connectivity analysis. For rare exonic deletions, the schizophrenia group had, on average, more genes overlapped. The additional rare CNVs implicated known (e.g., GRM7, 15q13.3, 16p12.2) and novel schizophrenia risk genes and loci. The results suggest that additional rare CNVs overlapping genes outside of the 22q11.2 deletion region contribute to schizophrenia risk in 22q11.2DS, supporting a multigenic hypothesis for schizophrenia. The findings have implications for understanding expression of psychotic illness and herald the importance of whole-genome sequencing to appreciate the overall genomic architecture of schizophrenia.

  14. Rare earths: occurrence, production and applications

    International Nuclear Information System (INIS)

    Murthy, T.K.S.; Mukherjee, T.K.

    2002-01-01

    The mining and processing of rare earth minerals, particularly of monazite, began in a modest way in 1880s for commercialized production of mantle for gas lighting. For all major applications up to mid-twentieth century- production of lighter flints, misch metal as a metallurgical alloying agent, colouring, decolourizing and polishing agents for glass, petroleum cracking catalysts and arc-carbons, unseparated or partially separated rare earths were adequate. These applications continue till today. With the development and industrial application of powerful techniques like ion exchange and solvent extraction for the separation of rare earths, the decades after 1960 saw increasing utilization of the specific properties of the individual rare earths. Some of these advanced technological applications include: special glass for optical systems including camera lenses, phosphors for colour television, cathode ray tubes and fluorescent lighting, X-ray intensification screens, high intensity permanent magnets, electro optical devices, lasers, hydrogen storage materials, hydride rechargeable batteries, photomagnetic data storage systems, autoexhaust catalysts, special ceramics of unusual toughness, artificial diamonds and nonpoisonous plastic colorants. The topics covered in the book include rare earths: their story identity, rare earth resources, processing of ores and recovery of mixed rare earths products, separation and purification of rare earths, nonmetallic applications of rare earths, rare earth metals: production and applications, rare earth alloys and their applications, analysis of rare earth, processing of rare earth resources in India by Indian Rare Earth Ltd. and availability and market conditions

  15. Persistent Mullerian Duct Syndrome: a rare entity with a rare presentation in need of multidisciplinary management.

    Science.gov (United States)

    Da Aw, Lin; Zain, Murizah M; Esteves, Sandro C; Humaidan, Peter

    2016-01-01

    A typical male looking adolescent with a legal female gender assignment presented with haematuria. Investigations led to the diagnosis of Persistent Mullerian Duct Syndrome. The condition is indeed a rare entity that needs a multidisciplinar team management. Case hypothesis: A case of Persistent Mullerian Duct Syndrome undiagnosed at birth because karyotyping was defaulted, thus resulting in a significant impact on the legal gender assignment and psychosocial aspects. Promising future implications: The reporting of this case is important to create awareness due to its rarity coupled with the rare presentation with hematuria as a possible masquerade to menstruation. There were not only medical implications, but also psychosocial and legal connotations requiring a holistic multidisciplinary management. Copyright® by the International Brazilian Journal of Urology.

  16. Persistent Mullerian Duct Syndrome: a rare entity with a rare presentation in need of multidisciplinary management

    Directory of Open Access Journals (Sweden)

    Lin Da Aw

    Full Text Available ABSTRACT Main findings: A typical male looking adolescent with a legal female gender assignment presented with haematuria. Investigations led to the diagnosis of Persistent Mullerian Duct Syndrome. The condition is indeed a rare entity that needs a multidisciplinary team management. Case hypothesis: A case of Persistent Mullerian Duct Syndrome undiagnosed at birth because karyotyping was defaulted, thus resulting in a significant impact on the legal gender assignment and psychosocial aspects. Promising future implications: The reporting of this case is important to create awareness due to its rarity coupled with the rare presentation with hematuria as a possible masquerade to menstruation. There were not only medical implications, but also psychosocial and legal connotations requiring a holistic multidisciplinary management.

  17. Somatic mutations in histiocytic sarcoma identified by next generation sequencing.

    Science.gov (United States)

    Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo

    2016-08-01

    Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.

  18. Thanatophoric Dysplasia: A Rare Entity

    Directory of Open Access Journals (Sweden)

    N.S. Naveen

    2011-05-01

    Full Text Available Thanatophoric dysplasia is the lethal skeletal dysplasia characterized by marked underdevelopment of the skeleton and short-limb dwarfism. The child will be having a short neck, narrow thoracic cage and protuberant abdomen. Other anatomical features include a relatively enlarged head with frontal bossing, prominent eyes, hypertelorism and the depressed nasal bridge. The diagnosis is usually made with the ultrasonography in the second trimester. In this study we report a case of this rare entity with emphasis on its anatomical features, abnormalities and clinical profile with relevant review of literature.

  19. Microfibrillar cardiomyopathy: A rare case

    Directory of Open Access Journals (Sweden)

    Narender Kumar

    2011-01-01

    Full Text Available Microfibrillar cardiomyopathy is a very rare cause of restrictive cardiomyopathy (RCM. The index case was a male patient who presented with shortness of breath and pedal edema. Further clinical investigations favored a clinical diagnosis of RCM. An endomyocardial biopsy revealed subendocardial and interstitial hyaline eosinophillic material resembling amyloid that did not stain with Congo red. An electron microscopic examination showed that this material was composed of twisted linear and bundles of tangled microfibrils. The etiology of the microfibrillar deposition is currently unknown. The pathologists should entertain the diagnosis of microfibrillar cardiomyopathy in suspected cases of amyloidosis that are negative for Congo red.

  20. Retroperitoneal Schwannoma: A Rare Case

    Directory of Open Access Journals (Sweden)

    Murat Kalaycı

    2011-01-01

    Case Presentation. A 38-year-old woman was admitted to the emergency service with the complaints of progressive abdominal pain and nausea for the last 24 hours. Abdominal examination was compatible with acute abdomen. Acute appendicitis was diagnosed by CT. During CT evaluation, a round shaped soft-tissue mass at the retroperitoneal area inferior to the right kidney was detected, The mass was resected and histology revealed schwannoma. Conclusion. Rare tumoral lesions with benign course such as schwannoma can be detected incidentally.

  1. Innovative research methods for studying treatments for rare diseases: methodological review.

    Science.gov (United States)

    Gagne, Joshua J; Thompson, Lauren; O'Keefe, Kelly; Kesselheim, Aaron S

    2014-11-24

    To examine methods for generating evidence on health outcomes in patients with rare diseases. Methodological review of existing literature. PubMed, Embase, and Academic Search Premier searched for articles describing innovative approaches to randomized trial design and analysis methods and methods for conducting observational research in patients with rare diseases. We assessed information related to the proposed methods, the specific rare disease being studied, and outcomes from the application of the methods. We summarize methods with respect to their advantages in studying health outcomes in rare diseases and provide examples of their application. We identified 46 articles that proposed or described methods for studying patient health outcomes in rare diseases. Articles covered a wide range of rare diseases and most (72%) were published in 2008 or later. We identified 16 research strategies for studying rare disease. Innovative clinical trial methods minimize sample size requirements (n=4) and maximize the proportion of patients who receive active treatment (n=2), strategies crucial to studying small populations of patients with limited treatment choices. No studies describing unique methods for conducting observational studies in patients with rare diseases were identified. Though numerous studies apply unique clinical trial designs and considerations to assess patient health outcomes in rare diseases, less attention has been paid to innovative methods for studying rare diseases using observational data. © Gagne et al 2014.

  2. Kindler′s syndrome: A rare case report

    Directory of Open Access Journals (Sweden)

    Neelam Suman

    2014-01-01

    Full Text Available Kindler syndrome is a rare hereditary disorder, associated with skin fragility. The syndrome involves the skin and mucous membrane with radiological changes. The genetic defect has been identified on the short arm of chromosome 20. This report describes a 16-year-old patient with classical features like blistering and photosensitivity in childhood and the subsequent development of poikiloderma.

  3. Rare event simulation in radiation transport

    International Nuclear Information System (INIS)

    Kollman, C.

    1993-10-01

    This dissertation studies methods for estimating extremely small probabilities by Monte Carlo simulation. Problems in radiation transport typically involve estimating very rare events or the expected value of a random variable which is with overwhelming probability equal to zero. These problems often have high dimensional state spaces and irregular geometries so that analytic solutions are not possible. Monte Carlo simulation must be used to estimate the radiation dosage being transported to a particular location. If the area is well shielded the probability of any one particular particle getting through is very small. Because of the large number of particles involved, even a tiny fraction penetrating the shield may represent an unacceptable level of radiation. It therefore becomes critical to be able to accurately estimate this extremely small probability. Importance sampling is a well known technique for improving the efficiency of rare event calculations. Here, a new set of probabilities is used in the simulation runs. The results are multiple by the likelihood ratio between the true and simulated probabilities so as to keep the estimator unbiased. The variance of the resulting estimator is very sensitive to which new set of transition probabilities are chosen. It is shown that a zero variance estimator does exist, but that its computation requires exact knowledge of the solution. A simple random walk with an associated killing model for the scatter of neutrons is introduced. Large deviation results for optimal importance sampling in random walks are extended to the case where killing is present. An adaptive ''learning'' algorithm for implementing importance sampling is given for more general Markov chain models of neutron scatter. For finite state spaces this algorithm is shown to give with probability one, a sequence of estimates converging exponentially fast to the true solution

  4. Mineral characterisation of Don Pao rare earth deposit in Vietnam

    International Nuclear Information System (INIS)

    XuanBen, T.

    1998-01-01

    Full text: The Don Pao Rare Earth Deposit was discovered in 1959 in Phon Tho district, about 450km North-West of Hanoi capital. Geological work was conducted between 1959-95, resulting in 60 ore bodies of various sizes being identified. The ore bodies are irregularly shaped nests, lenses and veins hosted in the shear zone, at the margin of a Paeleogene aged syenite massif. The mineral composition of Don Pao Deposit is very complex, consisting of more than 50 minerals. Among them, basnaesite, parisite, fluorite and barite are the main constituent minerals of the ore. All the minerals were identified by the modern methods of mineralogical studies. Based on the constituent mineral ratios, four ore types have been distinguished in the deposit: 1. Rare earth ore containing over 5 percent of RE 2 O 3 . 2. Rare Earth-Barite ore containing 0.5 to 30 percent of RE 2 O 3 . 3. Rare Earth-Barite-Fluorite ore containing 1 to 5 percent of RE 2 O 3 . 4. Rare Earth bearing Fluorite ore containing 1 to 5 percent of RE 2 O 3 . According to the benefication test, the ores in Don Pao can be enriched to a concentrate of 60 percent of RE 2 O 3 with a recover of 75 percent

  5. Rare B Meson Decays With Omega Mesons

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Lei; /Colorado U.

    2006-04-24

    Rare charmless hadronic B decays are particularly interesting because of their importance in understanding the CP violation, which is essential to explain the matter-antimatter asymmetry in our universe, and of their roles in testing the ''effective'' theory of B physics. The study has been done with the BABAR experiment, which is mainly designed for the study of CP violation in the decays of neutral B mesons, and secondarily for rare processes that become accessible with the high luminosity of the PEP-II B Factory. In a sample of 89 million produced B{bar B} pairs on the BABAR experiment, we observed the decays B{sup 0} {yields} {omega}K{sup 0} and B{sup +} {yields} {omega}{rho}{sup +} for the first time, made more precise measurements for B{sup +} {yields} {omega}h{sup +} and reported tighter upper limits for B {yields} {omega}K* and B{sup 0} {yields} {omega}{rho}{sup 0}.

  6. Rare malformation of glans penis: arteriovenous malformation.

    Science.gov (United States)

    Akin, Y; Sarac, M; Yucel, S

    2013-01-01

    Pediatric glans penis malformations, especially arteriovenous malformations (AVM), are very rare. Herein, we report two rare cases. A 14-year-old boy attended our outpatient clinic with chief complaints of purple swelling and rapidly growing lesion on the glans penis. The lesion was excised surgically after physical and radiological evaluations. Pathology reported AVM and the patient is being followed up. The second case is a 2-year-old boy who was admitted with a big lesion involving glans penis and genital area that has been present since birth. In physical and radiological evaluations, lesion on the glans penis was pulsatile. Parents of the patient did not want any surgery and patient has been in follow-up. Diagnosis of the vascular lesions on glans penis is very easy by physical and radiological examinations today. Long-term follow-up is very important for AVM. Clinicians must make a careful effort to document new glans lesions in the pediatric population and decrease anxiety in the parents of affected children.

  7. An Efficient Simulation Method for Rare Events

    KAUST Repository

    Rached, Nadhir B.

    2015-01-07

    Estimating the probability that a sum of random variables (RVs) exceeds a given threshold is a well-known challenging problem. Closed-form expressions for the sum distribution do not generally exist, which has led to an increasing interest in simulation approaches. A crude Monte Carlo (MC) simulation is the standard technique for the estimation of this type of probability. However, this approach is computationally expensive, especially when dealing with rare events. Variance reduction techniques are alternative approaches that can improve the computational efficiency of naive MC simulations. We propose an Importance Sampling (IS) simulation technique based on the well-known hazard rate twisting approach, that presents the advantage of being asymptotically optimal for any arbitrary RVs. The wide scope of applicability of the proposed method is mainly due to our particular way of selecting the twisting parameter. It is worth observing that this interesting feature is rarely satisfied by variance reduction algorithms whose performances were only proven under some restrictive assumptions. It comes along with a good efficiency, illustrated by some selected simulation results comparing the performance of our method with that of an algorithm based on a conditional MC technique.

  8. An Efficient Simulation Method for Rare Events

    KAUST Repository

    Rached, Nadhir B.; Benkhelifa, Fatma; Kammoun, Abla; Alouini, Mohamed-Slim; Tempone, Raul

    2015-01-01

    Estimating the probability that a sum of random variables (RVs) exceeds a given threshold is a well-known challenging problem. Closed-form expressions for the sum distribution do not generally exist, which has led to an increasing interest in simulation approaches. A crude Monte Carlo (MC) simulation is the standard technique for the estimation of this type of probability. However, this approach is computationally expensive, especially when dealing with rare events. Variance reduction techniques are alternative approaches that can improve the computational efficiency of naive MC simulations. We propose an Importance Sampling (IS) simulation technique based on the well-known hazard rate twisting approach, that presents the advantage of being asymptotically optimal for any arbitrary RVs. The wide scope of applicability of the proposed method is mainly due to our particular way of selecting the twisting parameter. It is worth observing that this interesting feature is rarely satisfied by variance reduction algorithms whose performances were only proven under some restrictive assumptions. It comes along with a good efficiency, illustrated by some selected simulation results comparing the performance of our method with that of an algorithm based on a conditional MC technique.

  9. Catecholaminergic polymorphic ventricular tachycardia. An important diagnosis in children with syncope and normal heart

    Directory of Open Access Journals (Sweden)

    Luiz Roberto Leite

    2001-01-01

    Full Text Available Syncope in children is primarily related to vagal hyperreactivity, but ventricular tachycardia (VT way rarely be seen. Catecholaminergic polymorphic VT is a rare entity that can occur in children without heart disease and with a normal QT interval, which may cause syncope and sudden cardiac death. In this report, we describe the clinical features, treatment, and clinical follow-up of three children with syncope associated with physical effort or emotion and cathecolaminergic polymorphic VT. Symptoms were controlled with beta-blockers, but one patient died suddenly in the fourth year of follow-up. Despite the rare occurrence, catecholaminergic polymorphic VT is an important cause of syncope and sudden death in children with no identified heart disease and normal QT interval.

  10. Bilateral Supernumerary Kidney: A Very Rare Presentation

    International Nuclear Information System (INIS)

    Keskin, Suat; Batur, Abdussamet; Keskin, Zeynep; Koc, Abdulkadir; Firat Ozcan, Irfan

    2014-01-01

    To our knowledge, bilateral supernumerary kidney is a very rare renal abnormality and there are five cases presented in the literature. It is difficult to diagnose supernumerary kidney and clinicians have not detected most cases preoperatively. Laboratory and imaging studies were acquired and carefully examined. The normal laboratory tests were found. Emergency ultrasonography was performed and they revealed no signs of parenchymal abnormality in both kidneys. Serial imaging study including enhanced computed tomography (CT) was performed. An imaging study identified bilateral supernumerary kidney with expanded collecting systems. On each side, significant rotation anomaly was found. In addition, there were two different renal arteries originating from the aorta. This report presents radiological determinations of supernumerary kidney bilaterally in a young man. We think that CT commonly appears to be enough for the diagnosis of supernumerary kidneys

  11. Bilateral Supernumerary Kidney: A Very Rare Presentation

    Science.gov (United States)

    Keskin, Suat; Batur, Abdussamet; Keskin, Zeynep; Koc, Abdulkadir; Firat Ozcan, Irfan

    2014-01-01

    To our knowledge, bilateral supernumerary kidney is a very rare renal abnormality and there are five cases presented in the literature. It is difficult to diagnose supernumerary kidney and clinicians have not detected most cases preoperatively. Laboratory and imaging studies were acquired and carefully examined. The normal laboratory tests were found. Emergency ultrasonography was performed and they revealed no signs of parenchymal abnormality in both kidneys. Serial imaging study including enhanced computed tomography (CT) was performed. An imaging study identified bilateral supernumerary kidney with expanded collecting systems. On each side, significant rotation anomaly was found. In addition, there were two different renal arteries originating from the aorta. This report presents radiological determinations of supernumerary kidney bilaterally in a young man. We think that CT commonly appears to be enough for the diagnosis of supernumerary kidneys. PMID:25780543

  12. Putting a Face on Rare Diseases

    Science.gov (United States)

    ... who have a rare and potentially dangerous disease, Ehlers-Danlos syndrome. Photo Courtesy of: Patricia Weltin That has been ... daughters with a rare and potentially dangerous disease, Ehlers-Danlos syndrome (EDS), a connective tissue disorder causing joint dislocations, ...

  13. Catalogue of Korean manuscripts and rare books

    DEFF Research Database (Denmark)

    Lerbæk Pedersen, Bent

    2014-01-01

    Catalogue of Korean manuscripts and rare books in The Royal Library, Copenhagen and the National Museum of Denmark......Catalogue of Korean manuscripts and rare books in The Royal Library, Copenhagen and the National Museum of Denmark...

  14. Cost of illness and economic evaluation in rare diseases.

    Science.gov (United States)

    López-Bastida, Julio; Oliva-Moreno, Juan

    2010-01-01

    Rare diseases are a major cause of morbidity and mortality in high income countries and have major repercussions on individuals and health care systems. This chapter examines the health economy of rare diseases from two different perspectives: firstly, the study of the economic impact of rare diseases (Cost of Illness studies); and, secondly, cost-effectiveness evaluation, which evaluates both the costs and results of the health care technologies applied in rare diseases. From the point of view of economics, health resource allocation is based on the principle of scarcity, as there are not - and never will be- sufficient resources for all worthy objectives. Hence, policy makers should balance costs and health outcomes. Rare diseases may well represent a significant societal burden that should rightly receive appropriate prioritisation of health care resources. As new and seemingly expensive health care technologies are developed for rare diseases, it will become increasingly important to evaluate potential and real impact of these new technologies in both dimensions: social costs and health outcomes.

  15. Radioactive rare gas recoverying device

    International Nuclear Information System (INIS)

    Kasai, Shigeo

    1989-01-01

    The apparatus of the present invention comprises a vessel for containing coolants, an introduction valve and an introduction pipe for introducing radioactive rare gases and an adsorption floor disposed in the coolants. A josephson device is disposed being immersed in the coolants between a radiation detector for detecting the radioactive level adsorbed to the adsorption floor and a driving section for driving the introduction valve by the signal from the detector. With this constitution, radioactive rare gases introduced into the coolants and then cooled and liquefied are recovered by the adsorption floor. As the adsorption proceeds and when the radioactivity level exceeds a maximum level in the effective shielding range of the recovery apparatus, the signal current from the radiation detector also exceeds a predetermined level. If radioactivity exceeds the maximum level, the electrical resistance of the josephson device is increased infinitely by the josephson effect to close the introduction valve. Accordingly, the radioactivity is not absorbed beyond the effective shielding range. (I.S.)

  16. Ethical aspects on rare diseases.

    Science.gov (United States)

    Barrera, Luis A; Galindo, Gilberto Cely

    2010-01-01

    In this chapter we discuss several of the most relevant subjects related to ethics on Rare Diseases. Some general aspects are discussed such as the socio-psychological problems that confront the patients and their families that finally lead to marginalization and exclusion of patients affected by these diseases from the health programs, even in wealthy countries. Then we address problems related to diagnosis and some ethical aspects of newborn screening, prenatal, pre-implantation diagnosis and reference centers, as well as some conditions that should be met by the persons and institutions performing such tasks. Alternatives of solutions for the most critical situations are proposed. Subsequently the orphan drugs subject is discussed not only from the availability point of view, prizes, industrial practices, and purchasing power in developed and developing societies. The research related to rare disease in children and other especially vulnerable conditions, the need for informed consent, review boards or ethics comities, confidentiality of the information, biobanks and pharmacogenetics are discussed.

  17. Purdue Rare Isotope Measurement Laboratory

    Science.gov (United States)

    Caffee, M.; Elmore, D.; Granger, D.; Muzikar, P.

    2002-12-01

    The Purdue Rare Isotope Measurement Laboratory (PRIME Lab) is a dedicated research and service facility for accelerator mass spectrometry. AMS is an ultra-sensitive analytical technique used to measure low levels of long-lived cosmic-ray-produced and anthropogenic radionuclides, and rare trace elements. We measure 10Be (T1/2 = 1.5 My), 26Al (.702 My), 36Cl (.301 My), and 129I (16 My), in geologic samples. Applications include dating the cosmic-ray-exposure time of rocks on Earth's surface, determining rock and sediment burial ages, measuring the erosion rates of rocks and soils, and tracing and dating ground water. We perform sample preparation and separation chemistries for these radio-nuclides for our internal research activities and for those external researchers not possessing this capability. Our chemical preparation laboratories also serve as training sites for members of the geoscience community developing these techniques at their institutions. Research at Purdue involves collaborators among members of the Purdue Departments of Physics, Earth and Atmospheric Sciences, Chemistry, Agronomy, and Anthropology. We also collaborate and serve numerous scientists from other institutions. We are currently in the process of modernizing the facility with the goals of higher precision for routinely measured radio-nuclides, increased sample throughput, and the development of new measurement capabilities for the geoscience community.

  18. Metallothermic reduction of rare earth oxides

    International Nuclear Information System (INIS)

    Sharma, R.A.

    1986-01-01

    Rare earth oxides can be reduced to rare earth metals by a novel, high yield, metallothermic process. The oxides are dispersed in a suitable, molten, calcium chloride bath along with sodium metal. The sodium reacts with the calcium chloride to produce calcium metal which reduces the rare earth oxides to rare earth metals. The metals are collected in a discrete layer in the reaction vessel

  19. Rare earth-iron-boron premanent magnets

    International Nuclear Information System (INIS)

    Ghendehari, M.H.

    1988-01-01

    This patent describes a method for producing rare earth-iron-boron permanent magnets containing added rare earth oxide, comprising the steps of: (a) mixing a particulate alloy containing at least one rare earth metal, iron, and boron with at least one particulate rare earth oxide; (b) aligning magnetic domains of the mixture in a magnetic field; (c) compacting the aligned mixture to form a shape; and (d) sintering the compacted shape

  20. Resuscitation of the rare biosphere contributes to pulses of ecosystem activity

    Directory of Open Access Journals (Sweden)

    Zach eAanderud

    2015-01-01

    Full Text Available Dormancy is a life history trait that may have important implications for linking microbial communities to the functioning of natural and managed ecosystems. Rapid changes in environmental cues may resuscitate dormant bacteria and create pulses of ecosystem activity. In this study, we used heavy-water (H218O stable isotope probing (SIP to identify fast-growing bacteria that were associated with pulses of trace gases (CO2, CH4, and N2O from different ecosystems (agricultural site, grassland, deciduous forest, and coniferous forest following a soil-rewetting event. Irrespective of ecosystem type, a large fraction (69 - 74% of the bacteria that responded to rewetting were below detection limits in the dry soils. Based on the recovery of sequences, in just a few days, hundreds of rare taxa increased in abundance and in some cases became dominant members of the rewetted communities, especially bacteria belonging to the Sphingomonadaceae, Comamonadaceae, and Oxalobacteraceae. Resuscitation led to dynamic shifts in the rank abundance of taxa that caused previously rare bacteria to comprise nearly 60% of the sequences that were recovered in rewetted communities. This rapid turnover of the bacterial community corresponded with a 5 20 fold increase in the net production of CO2 and up to a 150% reduction in the net production of CH4 from rewetted soils. Results from our study demonstrate that the rare biosphere may account for a large and dynamic fraction of a community that is important for the maintenance of bacterial biodiversity. Moreover, our findings suggest that the resuscitation of rare taxa from seed banks contribute to ecosystem functioning.

  1. [Anorectal pain in children: rare or rarely recognised?].

    Science.gov (United States)

    Sonneveld, Laura J H; Engelberts, Adèle C; van den Elzen, Annette P M

    2016-01-01

    Anorectal pain is a common symptom, often as part of functional gastrointestinal disorders. Children seldom present with this complaint. Proctalgia fugax and chronic proctalgia are both anorectal pain syndromes but differ in duration and frequency of episodes and in pain characteristics. No research has been conducted on anorectal pain syndromes in children. We present two patients. Firstly, an 8-year-old girl who suffered from anorectal cramps. We found no underlying cause apart from constipation. The symptoms disappeared spontaneously. The second concerned an 8-year-old boy who presented with recurrent anorectal cramps. He was diagnosed with celiac disease. Anorectal dysfunction and visceral hypersensitivity have been described in adult celiac patients. Symptoms of anorectal pain in children are rare probably because it often remains unrecognised. Noninvasive diagnostic methods and interventions are preferred in paediatric medicine. Screening for celiac disease in children with anorectal pain episodes should be considered.

  2. A Rare Cutaneous Adnexal Tumour with a Rare Presentation

    Directory of Open Access Journals (Sweden)

    Vijayalaxmi S. Patil

    2016-04-01

    Full Text Available Proliferating Trichilemmal Tumour (PTT is a rapidly growing large cutaneous adnexal neoplasm. Although biologically considered as benign, it may be locally aggressive. Malignant transformation of these lesions, known as Malignant Proliferating Trichilemmal Tumour (MPTT has rarely been reported. So far in the literature, only 39 well-documented cases of MPTT have been reported. MPTT has been stated to be a neoplasm of the older age group according to review of the literature. We present a case of MPTT in a young male. A 25 year old male presented with a scalp swelling of 2 years duration with a recent rapid enlargement. The swelling was excised and histopathological examination of the excised specimen revealed features of MPTT. The differential diagnosis of MPTTis squamous cell carcinoma as both share common features. Accurate diagnosis of MPTT is essential since it has a tendency to metastasize and recur more frequently than squamous cell carcinoma.

  3. Fiscal 1998 research report on the demand forecast of rare element minerals, recycling technology of rare elements from waste, and substitute rare element minerals; 1998 nendo chosa hokokusho. Kisho genso koseki no juyo yosoku, kisho genso no haikibutsu kara no kaishu gijutsu oyobi daitai kisho genso koseki nado ni kansuru chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    Rare element mineral is indispensable material for functionalization of high-tech raw materials. Its deposit is poor, an increase in its future demand is expected, and its information disclosure is insufficient because of strategic important material. To solve these problems, the following were studied systematically, and urgent research themes on rare element minerals were clarified: (1) High-efficiency recycling technology of rare elements, (2) Waste treatment system after recycling of rare elements from the viewpoint of environmental measures, (3) Establishment of the database of rare element minerals, and development of new substitute rare element minerals, and (4) Design method of substitute materials possible to generate various existing functions without any rare elements. Among them, in particular, precise separation of 46 kinds of rare elements from waste of high-tech raw materials, and recycling of rare elements from zinc refining waste and pyrite ore deposit containing copper were pointed out as important themes. (NEDO)

  4. Rare itemsets mining algorithm based on RP-Tree and spark framework

    Science.gov (United States)

    Liu, Sainan; Pan, Haoan

    2018-05-01

    For the issues of the rare itemsets mining in big data, this paper proposed a rare itemsets mining algorithm based on RP-Tree and Spark framework. Firstly, it arranged the data vertically according to the transaction identifier, in order to solve the defects of scan the entire data set, the vertical datasets are divided into frequent vertical datasets and rare vertical datasets. Then, it adopted the RP-Tree algorithm to construct the frequent pattern tree that contains rare items and generate rare 1-itemsets. After that, it calculated the support of the itemsets by scanning the two vertical data sets, finally, it used the iterative process to generate rare itemsets. The experimental show that the algorithm can effectively excavate rare itemsets and have great superiority in execution time.

  5. Research methods to change clinical practice for patients with rare cancers.

    Science.gov (United States)

    Billingham, Lucinda; Malottki, Kinga; Steven, Neil

    2016-02-01

    Rare cancers are a growing group as a result of reclassification of common cancers by molecular markers. There is therefore an increasing need to identify methods to assess interventions that are sufficiently robust to potentially affect clinical practice in this setting. Methods advocated for clinical trials in rare diseases are not necessarily applicable in rare cancers. This Series paper describes research methods that are relevant for rare cancers in relation to the range of incidence levels. Strategies that maximise recruitment, minimise sample size, or maximise the usefulness of the evidence could enable the application of conventional clinical trial design to rare cancer populations. Alternative designs that address specific challenges for rare cancers with the aim of potentially changing clinical practice include Bayesian designs, uncontrolled n-of-1 trials, and umbrella and basket trials. Pragmatic solutions must be sought to enable some level of evidence-based health care for patients with rare cancers. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Mohs micrographic surgery of rare cutaneous tumours

    NARCIS (Netherlands)

    Flohil, S.C.; Lee, C.B. van; Beisenherz, J.; Mureau, M.A.M.; Overbeek, L.I.H.; Nijsten, T.; Bos, R.R.

    2017-01-01

    BACKGROUND: Recurrence rates after Mohs micrographic surgery (MMS) for rare cutaneous tumours are poorly defined. OBJECTIVE: To investigate the recurrence rate after MMS for rare cutaneous tumours at a university centre. METHODS & MATERIALS: Retrospective review of all rare cutaneous tumours treated

  7. 75 FR 47458 - TRICARE; Rare Diseases Definition

    Science.gov (United States)

    2010-08-06

    ... tribal governments, in aggregate or by the private sector, of $100 million or more in any one year... TRICARE; Rare Diseases Definition AGENCY: Office of the Secretary, DoD. ACTION: Final rule. SUMMARY: This final rule revises the definition of rare diseases to adopt the definition of a rare disease as...

  8. [Rare diseases and their patient organization: the Hungarian Federation of People with Rare and Congenital Diseases].

    Science.gov (United States)

    Pogány, Gábor

    2014-03-02

    The aim of the author is to discuss special issues of rare diseases, with emphasis on circumstances present in Hungary, including those leading to the foundation of the non-governmental organization, the Hungarian Federation of People with Rare and Congenital Diseases. The author briefly reviews the most important findings of current international surveys which have been performed with or without the involvement of member associations of the Hungarian Federation of People with Rare and Congenital Diseases. At the level of medical and social services in Hungary, it is still "incidental" to get to the appropriate expert or centre providing the diagnosis or treatment. It is difficult to find the still very few existing services due to the lack of suitable "pathways" and referrals. There are long delays in obtaining the first appointment, resulting in vulnerability and inequality along the regions. The overall consequence is the insufficiency or lack of access to medical and social services. There are also difficulties related to the supply of orphan medication and the long duration of hospitalization. At the level of patient organizations financial scarcity and uncertainty are typical, combined with inappropriate infrastructural background and human resources. The poor quality of organization of patient bodies along with insufficient cooperation among them are characteristic as well. The author concludes that a National Plan or Strategy is needed to improve the current fragmentation of services which would enable patients and health, social and educational professionals to provide and use the best care in the practice. This would ensure all patients with rare diseases to be diagnosed within a possible shortest time allowing access to the care and support needed in time resulting in a decrease in burden of families and society.

  9. Prune Belly syndrome: A rare case report.

    Science.gov (United States)

    Samal, Sunil Kumar; Rathod, Setu

    2015-01-01

    Prune Belly syndrome (PBS) is a rare congenital anomaly of uncertain etiology almost exclusive to males. We report a case of term male baby born to a 39-year-old grand multipara with previous four normal vaginal births. There was no history of genetic or congenital anomaly in her family. Examination of the baby revealed hypotonia, deficient abdominal muscle, cryptorchidism, palpable kidney, and bladder. Ultrasound examination of the abdomen revealed bilateral gross hydronephrosis and megaureter. Provisional diagnosis of PBS was made and the baby was admitted in neonatal intensive care units for further management. Routine antenatal care with ultrasonography will help in detecting renal anomalies, which can be followed postnatally. Early diagnosis of this syndrome and determining its optimal treatment are very important in helping to avoid its fatal course.

  10. Multifocal bilateral metatarsal tuberculosis: a rare presentation.

    Science.gov (United States)

    Vijay, Vipul; Sud, Alok; Mehtani, Anil

    2015-01-01

    Tuberculosis, or phthisis (consumption) as it was popularly known in the Greek era, has been endemic in Southeast Asia and Sub-Saharan Africa; however, the human immunodeficiency virus epidemic has seen the re-emergence of this disease in the areas in which it was not very commonly reported. With this, the need for understanding and treatment of rare presentations of tuberculosis has become of paramount importance to achieve the World Health Organization millennium goal of a "reversal of incidence by 2015." Foot involvement has been reported in 0.1% to 0.3% of extrapulmonary cases. Multifocal lesions have an incidence of histopathologic owing to the paucibacillary nature of the disease. Early identification and treatment with antitubercular drugs will normally result in a good cosmetic and functional result. Copyright © 2015 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  11. Gasoline ingestion: a rare cause of pancytopenia.

    Science.gov (United States)

    Rahman, Ifad; Narasimhan, Kanakasabai; Aziz, Shahid; Owens, William

    2009-11-01

    The majority of reported cases of gasoline intoxication involves inhalation or percutaneous absorption. Data are scarce on complications and outcomes after gasoline poisoning by oral ingestion. The major cause of mortality and morbidity associated with the ingestion of gasoline is related to pulmonary aspiration. Despite the high frequency of the ingestions, there is little documentation of nonpulmonary toxic effects of gasoline. After ingestion, the principal toxicity is aspiration pneumonia, but any documented extra pulmonary manifestations of this condition may be important in the overall management of these patients. We are reporting a rare case of pancytopenia along with aspiration pneumonia and multisystem organ failure in a 58-year-old male after prolonged intentional ingestion of gasoline. To our knowledge, this is the only reported case of gasoline toxicity causing pancytopenia.

  12. Pseudoachondroplasia: A rare cause of rhizomelic dwarfism

    Directory of Open Access Journals (Sweden)

    Tandon Anupama

    2008-01-01

    Full Text Available Pseudoachondroplasia is a rare rhizomelic short-limbed skeletal dysplasia. Its inheritance is varied; autosomal dominant pattern and germline or somatic mutations can occur. Children at 2-3 years of age present with short height, gait disturbances, or limb deformities. Characteristic skeletal changes include shortening of long bones, predominantly of femur and humerus with irregular, flared metaphysis and fragmented epiphysis. Platyspondyly is also present, but the interpedicular distance is normal. The diagnosis is essentially based on imaging, and thus, it is important to be aware of the radiological features. Here, we report a case of two brothers where the elder sibling had classical radiological features of pseudoachondroplasia, whereas the younger one had early changes of this disorder.

  13. Hidden chromosomal abnormalities in pleuropulmonary blastomas identified by multiplex FISH

    International Nuclear Information System (INIS)

    Quilichini, Benoit; Andre, Nicolas; Bouvier, Corinne; Chrestian, Marie-Anne; Rome, Angelique; Intagliata, Dominique; Coze, Carole; Lena, Gabriel; Zattara, Helene

    2006-01-01

    Pleuropulmonary blastoma (PPB) is a rare childhood dysontogenetic intrathoracic neoplasm associated with an unfavourable clinical behaviour. We report pathological and cytogenetic findings in two cases of PPB at initial diagnosis and recurrence. Both tumors were classified as type III pneumoblastoma and histological findings were similar at diagnosis and relapse. In both cases, conventional cytogenetic techniques revealed complex numerical and structural chromosomal abnormalities. Molecular cytogenetic analysis (interphase/metaphase FISH and multicolor FISH) identified accurately chromosomal aberrations. In one case, TP53 gene deletion was detected on metaphase FISH. To date, only few cytogenetic data have been published about PPB. The PPB genetic profile remains to be established and compared to others embryonal neoplasia. Our cytogenetic data are discussed reviewing cytogenetics PPBs published cases, illustrating the contribution of multicolor FISH in order to identify pathogenetically important recurrent aberrations in PPB

  14. Innovative measures to combat rare diseases in China: The national rare diseases registry system, larger-scale clinical cohort studies, and studies in combination with precision medicine research.

    Science.gov (United States)

    Song, Peipei; He, Jiangjiang; Li, Fen; Jin, Chunlin

    2017-02-01

    China is facing the great challenge of treating the world's largest rare disease population, an estimated 16 million patients with rare diseases. One effort offering promise has been a pilot national project that was launched in 2013 and that focused on 20 representative rare diseases. Another government-supported special research program on rare diseases - the "Rare Diseases Clinical Cohort Study" - was launched in December 2016. According to the plan for this research project, the unified National Rare Diseases Registry System of China will be established as of 2020, and a large-scale cohort study will be conducted from 2016 to 2020. The project plans to develop 109 technical standards, to establish and improve 2 national databases of rare diseases - a multi-center clinical database and a biological sample library, and to conduct studies on more than 50,000 registered cases of 50 different rare diseases. More importantly, this study will be combined with the concept of precision medicine. Chinese population-specific basic information on rare diseases, clinical information, and genomic information will be integrated to create a comprehensive predictive model with a follow-up database system and a model to evaluate prognosis. This will provide the evidence for accurate classification, diagnosis, treatment, and estimation of prognosis for rare diseases in China. Numerous challenges including data standardization, protecting patient privacy, big data processing, and interpretation of genetic information still need to be overcome, but research prospects offer great promise.

  15. Magnetic properties of rare-earth intermetallics

    International Nuclear Information System (INIS)

    Kirchmayr, H.

    1978-01-01

    A review is given of the concepts at present used to explain the magnetic properties of rare-earth intermetallics which have been the subject of numerous investigations in recent years. Rare-earth intermetallics with the formula Rsub(a)Bsub(b) are divided according to the magnetic moment of the B atom(s). If there is no magnetic moment present at the B-site, the exchange is only between the magnetic moments at the R-sites, which can only be of indirect character. One possible model is still the RKKY model, although it usually gives in practice only a qualitative description of the magnetic properties. Typical R-B compounds with the B-moment equal to zero are (for instance) the RA1 2 compounds, and related compounds such as the RZn and RCd compounds as well as compounds of the general formula RB 2 (B = Ni, Os, Ir, Pd, Ru or Rh). Of all intermetallics with nonzero B-moment, the R-3d intermetallics are the most important. These intermetallics can be formed with Mn, Fe, Co and Ni. In these systems there exist in principle three interactions, namely between the R-R, R-3d and 3d-3d atoms. The most important is usually the latter interaction. After a short discussion of the crystal structures which occur with R-3d intermetallics, the basic magnetic properties of R-3d intermetallics are presented. These properties are discussed with respect to the formation of a magnetic moment at the 3d site in the framework of present band theories. Special emphasis is given to a discussion of the localized or itinerant character of 3d electrons. (author)

  16. Preventing gatekeeping delays in the diagnosis of rare diseases

    NARCIS (Netherlands)

    de Vries, E.; Fransen, L.; van den Aker, M.; Meijboom, B.R.

    2018-01-01

    GPs acting as gatekeepers render a healthcare system easily accessible as well as affordable. However, gatekeeping can have an important drawback: it may hamper timely diagnosis and treatment of patients suffering from a rare disease (incidence <1:2000),1 especially if patients present with common

  17. A rare aetiology of small intestinal volvulus in an infant

    Directory of Open Access Journals (Sweden)

    Elroy P. Weledji

    2017-10-01

    Full Text Available The rare intestinal duplication cyst may be the cause of small intestinal obstruction in an infant. It is an important differential diagnosis for recurrent abdominal pain in the paediatric age group. The clinical diagnosis is often difficult and the diagnosis may sometimes be made only at laparotomy.

  18. Structural and functional analysis of rare missense mutations in human chorionic gonadotrophin β-subunit

    DEFF Research Database (Denmark)

    Nagirnaja, Liina; Venclovas, Česlovas; Rull, Kristiina

    2012-01-01

    Heterodimeric hCG is one of the key hormones determining early pregnancy success. We have previously identified rare missense mutations in hCGβ genes with potential pathophysiological importance. The present study assessed the impact of these mutations on the structure and function of hCG by appl...... of intact hCG as also supported by an in silico analysis. In summary, the accumulated data indicate that only mutations with neutral or mild functional consequences might be tolerated in the major hCGβ genes CGB5 and CGB8.......Heterodimeric hCG is one of the key hormones determining early pregnancy success. We have previously identified rare missense mutations in hCGβ genes with potential pathophysiological importance. The present study assessed the impact of these mutations on the structure and function of h......CG by applying a combination of in silico (sequence and structure analysis, molecular dynamics) and in vitro (co-immunoprecipitation, immuno- and bioassays) approaches. The carrier status of each mutation was determined for 1086 North-Europeans [655 patients with recurrent miscarriage (RM)/431 healthy controls...

  19. Waardenburg syndrome: A rare case

    Directory of Open Access Journals (Sweden)

    Shivlal M Rawlani

    2018-01-01

    Full Text Available Waardenburg Syndrome is a rare disorder of neural crest cell development. It is genetically inherited. Varying in prevalence from 1:42000 to 1:50,000, it compromises approximately 2-5% of congenital deaf children. The syndrome is not expressed in its complete form, in about 20% cases, which adds for its heterogenisity . Even among people affected in the same family,the features do vary. Unilateral heterochromia that manifests as lighter pigmentation of one iris is associated with Waardenburg syndrome and Parry-Romberg syndrome and less commonly with Hirschsprung disease. A case of ten yrs. old boy with a typical facial profile and hearing loss is reported.

  20. Ultra-Rare B Decays

    International Nuclear Information System (INIS)

    Grinstein, Benjamin

    2004-01-01

    A good place to look for deviations from the Standard Model is in decay modes of B mesons, like purely leptonic decays B → lv, for which a very long Standard Model lifetime is due to an accidental suppression of the decay amplitude. For other rare decay modes involving no hadrons in the final state (e.g., B → γl+l-, B → γlvl and B → vv-barγ) new results on QCD factorization in exclusive processes show that all the decay rates are given in terms of a single universal form factor. Hence, trustworthy relations between different processes can be used to test the Standard Model of electroweak interactions. Sometimes, surprisingly, a large energy expansion may allow computation when a hadron is in the final state. An example is B → πl+l- which can be used to settle the ambiguity in α from a measurement of sin2α from CP asymmetries

  1. Splenic abscess: a rare presentation

    Directory of Open Access Journals (Sweden)

    Mohit Bhatia

    2015-01-01

    Full Text Available Splenic abscess is a rare clinical entity with an incidence of 0.2-0.7% in autopsy-based studies. When untreated, splenic abscess is associated with nearly 100% mortality; in treated patients, the mortality rate is 16.6% during the first 90 days. It mostly occurs in patients with neoplasia, immunodeficiency, trauma, diabetes or splenic infarct. The incidence of splenic abscess is thought to be growing because of the increase in the number of immunocompromised patients who are particularly at risk for this disease and also because of the widespread use of diagnostic modalities. However, the optimal treatment for this remains unclear. We present a case of a 42-year-old man diagnosed with multiloculated splenic abscess and was subjected to splenectomy.

  2. WHY ARE PULSAR PLANETS RARE?

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Rebecca G.; Livio, Mario; Palaniswamy, Divya [Department of Physics and Astronomy, University of Nevada, Las Vegas, 4505 South Maryland Parkway, Las Vegas, NV 89154 (United States)

    2016-12-01

    Pulsar timing observations have revealed planets around only a few pulsars. We suggest that the rarity of these planets is due mainly to two effects. First, we show that the most likely formation mechanism requires the destruction of a companion star. Only pulsars with a suitable companion (with an extreme mass ratio) are able to form planets. Second, while a dead zone (a region of low turbulence) in the disk is generally thought to be essential for planet formation, it is most probably rare in disks around pulsars, because of the irradiation from the pulsar. The irradiation strongly heats the inner parts of the disk, thus pushing the inner boundary of the dead zone out. We suggest that the rarity of pulsar planets can be explained by the low probability for these two requirements to be satisfied: a very low-mass companion and a dead zone.

  3. Liposarcome dorsal: aspect clinique rare

    Science.gov (United States)

    Agbessi, Odry; Arrob, Adil; Fiqhi, Kamal; Khalfi, Lahcen; Nassih, Mohammed; El Khatib, Karim

    2015-01-01

    Décrit la première fois par Virchow en 1860, le liposarcome est une tumeur mésenchymateuse rare. Cette rareté est relative car les liposarcomes représentent quand même 14 à 18% de l'ensemble des tumeurs malignes des parties molles et ils constituent le plus fréquent des sarcomes des parties molles. Pour la majorité des auteurs, il ne se développerait jamais sur un lipome ou une lipomatose préexistant. Nous rapportons un cas de volumineux liposarcome de la face dorsale du tronc. L'histoire de la maladie, l'aspect clinique inhabituel « de tumeur dans tumeur », l'aspect de la pièce opératoire nous fait évoquer la possibilité de la transformation maligne d'un lipome bénin préexistant. PMID:26113914

  4. A rare case of langerhans cell histiocytosis of the gastrointestinal tract

    Institute of Scientific and Technical Information of China (English)

    Uday Shankar; Monika Prasad; Om P Chaurasia

    2012-01-01

    Langerhans cell histiocytosis (LCH) is a group of idiopathic disorders characterized by the proliferation of specialized,bone marrow-derived langerhans cells and mature eosinophils.The clinical spectrum ranges from an acute,fulminant,disseminated disease called LettererSiwe disease to solitary or few,indolent and chronic lesions of the bone or other organs called eosinophilic granuloma.Involvement of the gastrointestinal tract is very rare in LCH.We present the case of a 53-year-old woman referred by her primary care physician for a screening colonoscopy.A single sessile polyp,measuring 4 mm in size,was found in the rectum.Histopathological examination revealed that the lesion was relatively well circumscribed and comprised mainly a mixture of polygonal cells with moderate-to-abundant pink slightly granular cytoplasm.The nuclei within these cells had frequent grooves and were occasionally folded.Immunohistochemical staining was positive for CD-1a which confirmed the diagnosis of LCH.On further workup,there was no evidence of involvement of any other organ.On follow up colonoscopy one year later,there was no evidence of disease recurrence.Review of the published literature revealed that LCH presenting as solitary colonic polyp is rare.However,with the increasing rates of screening colonoscopy,more colonic polyps may be identified as LCH on histopathology.This underscores the importance of recognizing this rare condition and ensuring proper follow-up to rule out systemic disease.

  5. Rare earth elements: end use and recyclability

    Science.gov (United States)

    Goonan, Thomas G.

    2011-01-01

    Rare earth elements are used in mature markets (such as catalysts, glassmaking, lighting, and metallurgy), which account for 59 percent of the total worldwide consumption of rare earth elements, and in newer, high-growth markets (such as battery alloys, ceramics, and permanent magnets), which account for 41 percent of the total worldwide consumption of rare earth elements. In mature market segments, lanthanum and cerium constitute about 80 percent of rare earth elements used, and in new market segments, dysprosium, neodymium, and praseodymium account for about 85 percent of rare earth elements used. Regardless of the end use, rare earth elements are not recycled in large quantities, but could be if recycling became mandated or very high prices of rare earth elements made recycling feasible.

  6. The Chinese Society of Rare Earth is Studying The Feasibility of Marketing Rare Earth Futures

    Institute of Scientific and Technical Information of China (English)

    2015-01-01

    Lin Donglu,secretary-general of the Chinese Society of Rare Earth recently said,the Chinese Society of Rare Earth undertook the research on subject of the National Social Science Fund Foundation on the reform of Chinese rare earth trading pricing mechanism on promoting RMB globalization,and is focusing on studying the feasibility of marketing rare earth futures variety.

  7. Unique Migraine Subtypes, Rare Headache Disorders, and Other Disturbances.

    Science.gov (United States)

    Goadsby, Peter J

    2015-08-01

    The medical aphorism that common things happen commonly makes unique (and less common) migraine subtypes especially appropriate to review for the general neurologist. This article also identifies some rare headache disorders and other disturbances, and offers strategies to manage them. This article discusses migraine with brainstem aura, which is troublesome clinically and has had a change in terminology in the International Classification of Headache Disorders, Third Edition, beta version (ICHD-3 beta), and hemiplegic migraine, which is also troublesome in practice. The rare headache disorder hypnic headache and the exploding head syndrome are also discussed. When hypnic headache is recognized, it is eminently treatable, while exploding head syndrome is a benign condition with no reported consequences. Unique migraine subtypes, rare headache disorders, and other disturbances present to neurologists. When recognized, they can often be managed very well, which offers significant benefits to patients and practice satisfaction to neurologists.

  8. Geological research on rare earth elements, results and outlook

    International Nuclear Information System (INIS)

    Fortin, H

    1999-01-01

    This is a report of the geological investigation of rare earth elements carried out by CCHEN and ENAMI (Empresa Nacional de Mineria) over 70,000 square kilometers in Chile's northern coastal mountain range. Twenty areas were identified with sphena, davidite, ilmenite, pyroxene, anatase and magnetite minerals containing 0.3 kg/t to 6.0 kg/t of rare earth elements. Additional research on Cerro Carmen Prospect, located near Diego de Almagro, define it as a metasomatic deposit, hosted in metamorphic contact rocks, between andesites (Pliensbachian to early Jurassic) and intrusive monzonitic rocks. This information increases knowledge about the metallogenesis of Chile's copper - iron - rare earth - uranium deposits and the application of this geological model of ore deposits as defined in Australia's Olympic Dam

  9. Solubility limits of importance to leaching

    International Nuclear Information System (INIS)

    Ogard, A.; Bentley, G.; Bryant, E.; Duffy, C.; Grisham, J.; Norris, E.; Orth, C.; Thomas, K.

    1981-01-01

    The solubilities of some radionuclides, especially rare earths and actinides, may be an important and controlling factor in leaching of waste forms. These solubilities should be measured accurately as a function of pH and not as a part of a multicomponent system. Individual solubilities should be measured as a function of temperature to determine if a kinetic effect is being observed in the data. A negative temperature coefficient of solubility for actinides and rare earths in water would have important consequences for nuclear reactor safety and for the management of nuclear wastes

  10. Menkes Kinky Hair Syndrome: A Rare Neurodegenerative Disease

    Directory of Open Access Journals (Sweden)

    Rozil Gandhi

    2012-01-01

    Full Text Available Menkes kinky hair disease is a rare X-linked recessive disease nearly exclusively affecting males who present at 2-3 months of age due to abnormal functioning of copper-dependent enzymes due to deficiency of copper. Here, we describe a completely worked-up case of a 4-month-old male infant with very typical history and radiological features confirmed by biochemical and trichoanalysis. The initially seen asymmetric cortical and subcortical T2 hyperintensities in cerebral and cerebellar hemispheres converted into symmetrical diffuse cerebral and predominantly cerebellar atrophy with uniform loss of both white and grey matter on follow-up MRI. Also, subdural hemorrhages of various sizes and different stages and tortuosity of larger proximal intracranial vessels with distal narrowing were identified. Ours is a completely worked-up proven case of Menkes kinky hair disease (MKHD with history, electroencephalography, biochemical, trichoanalysis, and MRI findings. This is a good teaching case and shows importance of clinical examination and biochemistry as complimentary to MRI. Tortuous intracranial arteries with blocked major vessels are found only in this disease, thus stressing the value of MR Angiography in these patients.

  11. Functional significance of rare neuroligin 1 variants found in autism.

    Directory of Open Access Journals (Sweden)

    Moe Nakanishi

    2017-08-01

    Full Text Available Genetic mutations contribute to the etiology of autism spectrum disorder (ASD, a common, heterogeneous neurodevelopmental disorder characterized by impairments in social interaction, communication, and repetitive and restricted patterns of behavior. Since neuroligin3 (NLGN3, a cell adhesion molecule at the neuronal synapse, was first identified as a risk gene for ASD, several additional variants in NLGN3 and NLGN4 were found in ASD patients. Moreover, synaptopathies are now known to cause several neuropsychiatric disorders including ASD. In humans, NLGNs consist of five family members, and neuroligin1 (NLGN1 is a major component forming a complex on excitatory glutamatergic synapses. However, the significance of NLGN1 in neuropsychiatric disorders remains unknown. Here, we systematically examine five missense variants of NLGN1 that were detected in ASD patients, and show molecular and cellular alterations caused by these variants. We show that a novel NLGN1 Pro89Leu (P89L missense variant found in two ASD siblings leads to changes in cellular localization, protein degradation, and to the impairment of spine formation. Furthermore, we generated the knock-in P89L mice, and we show that the P89L heterozygote mice display abnormal social behavior, a core feature of ASD. These results, for the first time, implicate rare variants in NLGN1 as functionally significant and support that the NLGN synaptic pathway is of importance in the etiology of neuropsychiatric disorders.

  12. Rare platelet GPCR variants: what can we learn?

    Science.gov (United States)

    Nisar, S P; Jones, M L; Cunningham, M R; Mumford, A D; Mundell, S J

    2015-07-01

    Platelet-expressed GPCRs are critical regulators of platelet function. Pharmacological blockade of these receptors forms a powerful therapeutic tool in the treatment and prevention of arterial thrombosis associated with coronary atherosclerosis and ischaemic stroke. However, anti-thrombotic drug therapy is associated with high inter-patient variability in therapeutic response and adverse bleeding side effects. In order to optimize the use of existing anti-platelet drugs and to develop new therapies, more detailed knowledge is required relating to the molecular mechanisms that regulate GPCR and therefore platelet function. One approach has been to identify rare, function-disrupting mutations within key platelet proteins in patients with bleeding disorders. In this review, we describe how an integrated functional genomics strategy has contributed important structure-function information about platelet GPCRs with specific emphasis upon purinergic and thromboxane A2 receptors. We also discuss the potential implications these findings have for pharmacotherapy and for understanding the molecular basis of mild bleeding disorders. © 2014 The British Pharmacological Society.

  13. Telephone health services in the field of rare diseases: a qualitative interview study examining the needs of patients, relatives, and health care professionals in Germany.

    Science.gov (United States)

    Babac, Ana; Frank, Martin; Pauer, Frédéric; Litzkendorf, Svenja; Rosenfeldt, Daniel; Lührs, Verena; Biehl, Lisa; Hartz, Tobias; Storf, Holger; Schauer, Franziska; Wagner, Thomas O F; Graf von der Schulenburg, J-Matthias

    2018-02-09

    Rare diseases are, by definition, very serious and chronic diseases with a high negative impact on quality of life. Approximately 350 million people worldwide live with rare diseases. The resulting high disease burden triggers health information search, but helpful, high-quality, and up-to-date information is often hard to find. Therefore, the improvement of health information provision has been integrated in many national plans for rare diseases, discussing the telephone as one access option. In this context, this study examines the need for a telephone service offering information for people affected by rare diseases, their relatives, and physicians. In total, 107 individuals participated in a qualitative interview study conducted in Germany. Sixty-eight individuals suffering from a rare disease or related to somebody with rare diseases and 39 health care professionals took part. Individual interviews were conducted using a standardized semi-structured questionnaire. Interviews were analysed using the qualitative content analysis, triangulating patients, relatives, and health care professionals. The fulfilment of qualitative data processing standards has been controlled for. Out of 68 patients and relatives and 39 physicians, 52 and 18, respectively, advocated for the establishment of a rare diseases telephone service. Interviewees expected a helpline to include expert staffing, personal contact, good availability, low technical barriers, medical and psychosocial topics of counselling, guidance in reducing information chaos, and referrals. Health care professionals highlighted the importance of medical topics of counselling-in particular, differential diagnostics-and referrals. Therefore, the need for a national rare diseases helpline was confirmed in this study. Due to limited financial resources, existing offers should be adapted in a stepwise procedure in accordance with the identified attributes.

  14. China’s Rare Earths Production Forecasting and Sustainable Development Policy Implications

    Directory of Open Access Journals (Sweden)

    Xibo Wang

    2017-06-01

    Full Text Available Because of their unique physical and chemical properties, Rare earth elements (REEs perform important functions in our everyday lives, with use in a range of products. Recently, the study of China’s rare earth elements production has become a hot topic of worldwide interest, because of its dominant position in global rare earth elements supply, and an increasing demand for rare earth elements due to the constant use of rare earth elements in high-tech manufacturing industries. At the same time, as an exhaustible resource, the sustainable development of rare earth elements has received extensive attention. However, most of the study results are based on a qualitative analysis of rare earth elements distribution and production capacity, with few studies using quantitative modeling. To achieve reliable results with more factors being taken into consideration, this paper applies the generic multivariant system dynamics model to forecast China’s rare earth elements production trend and Hubbert peak, using Vensim software based on the Hubbert model. The results show that the peak of China’s rare earth elements production will appear by 2040, and that production will slowly decline afterwards. Based on the results, the paper proposes some policy recommendations for the sustainable development of China’s—and the world’s—rare earth elements market and rare earth-related industries.

  15. THE FRAMING OF RARE DISEASES IN SPANISH PRESS

    Directory of Open Access Journals (Sweden)

    Sebastián Sánchez Castillo

    2014-06-01

    Full Text Available The news frame analysis has become a basic tool to understand the cognitive structures that construct social reality in its many facets. The objective of this research is to reveal the basic frames and generic frames that define the treatment of rare diseases in the Spanish press. The content analysis of 216 news items about rare diseases published in El País, El Mundo and ABC from August 2010 to September 2012 has been determined to a large extent the problem is presented as a complex social reality rather than how a disease more. Human interest based on personalization of information is the most important generic framing. These results may contribute to greater social visibility of the Rare Diseases.

  16. A rare cause of ischemic stroke: Intravasculer B cell lymphoma

    Directory of Open Access Journals (Sweden)

    Şeyma Çiftçi

    2014-08-01

    Full Text Available Intravascular B cell lymphoma is rare and an agressive form of large B cell lymphoma which can affect central nervous system. Because of its varied clinical symptoms and the absence of lymphadenopathy, it is generally diagnosed postmortem. Cerebral infarction due to occlusion of arteries can be seen as a rare clinical form of central nervous system involvement. Large artery atherosclerosis, cardiyoembolism and small artery occlusion are the important causes of ischemic stroke but no any cause is detected in %15-40 of all cases. In this report, with the discussion of a case with ischemia like encephalopathy and multiple cerebral ischemic lesions at different stages in cranial MRI which was diagnosed by the help of brain biopsy as a intravascular B cell lymphoma, it is aimed to take attention intravascular lymphoma as a rare cause of ischemic stroke.

  17. Influential factors of red-light running at signalized intersection and prediction using a rare events logistic regression model.

    Science.gov (United States)

    Ren, Yilong; Wang, Yunpeng; Wu, Xinkai; Yu, Guizhen; Ding, Chuan

    2016-10-01

    Red light running (RLR) has become a major safety concern at signalized intersection. To prevent RLR related crashes, it is critical to identify the factors that significantly impact the drivers' behaviors of RLR, and to predict potential RLR in real time. In this research, 9-month's RLR events extracted from high-resolution traffic data collected by loop detectors from three signalized intersections were applied to identify the factors that significantly affect RLR behaviors. The data analysis indicated that occupancy time, time gap, used yellow time, time left to yellow start, whether the preceding vehicle runs through the intersection during yellow, and whether there is a vehicle passing through the intersection on the adjacent lane were significantly factors for RLR behaviors. Furthermore, due to the rare events nature of RLR, a modified rare events logistic regression model was developed for RLR prediction. The rare events logistic regression method has been applied in many fields for rare events studies and shows impressive performance, but so far none of previous research has applied this method to study RLR. The results showed that the rare events logistic regression model performed significantly better than the standard logistic regression model. More importantly, the proposed RLR prediction method is purely based on loop detector data collected from a single advance loop detector located 400 feet away from stop-bar. This brings great potential for future field applications of the proposed method since loops have been widely implemented in many intersections and can collect data in real time. This research is expected to contribute to the improvement of intersection safety significantly. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Rare and very rare adverse effects of clozapine

    Directory of Open Access Journals (Sweden)

    De Fazio P

    2015-08-01

    knowledge of the drug, clinical vigilance, and rapid intervention can drastically reduce the morbidity and mortality related to CLZ treatment. Keywords: clozapine, rare adverse effects, schizophrenia, atypical antipsychotic

  19. Celiac crisis: a rare or rarely recognized disease

    International Nuclear Information System (INIS)

    Waheed, N.; Cheema, H.A.; Suleman, H.; Fayyaz, Z.; Mushtaq, I.

    2017-01-01

    Celiac crisis is a serious life threatening complication of celiac disease characterized by profuse diarrhoea, severe dehydration and metabolic disturbances leading to neuromuscular weakness, cardiac arrhythmias and sudden death. It has been described as rare condition and not well documented in the literature. To improve awareness and facilitate diagnosis of this condition, we studied risk factors, pattern of presentation and management plans of celiac crisis. Methods: It was a descriptive cross sectional study. Patients presenting in emergency room(ER) with profuse diarrhoea leading to severe dehydration, neuromuscular weakness, and metabolic acidosis and electrolyte abnormalities enrolled in the studies after positive serology and small bowel biopsy suggestive of celiac disease. Results: Total 126 patients out of 350 fulfilled the criteria including 54 (42.8 percent) male and 71 (56.3 percent) female. The mean age at presentation was 5.25+-1.18 years. Risk factors were poor social status (97.60 percent), consanguinity (96.77 percent), early weaning with gluten contained diet (93.54 percent), and Presenting complaints were loose motion (100 percent), loss of neck holding (96.77 percent), dehydration (96.77 percent), polyuria (95.96 percent), inability to walk (67.74 percent), abdominal distension (85.86 percent). Electrolytes imbalances were hypokalaemia (2.4+-0.55), hypocalcaemia (7.29+-0.66), hypomagnesaemia (1.89+-0.50), hypophosphatemia (2.8+-0.68), hypoalbuminemia (3.05+-0.48) and metabolic acidosis (96 percent). One hundred and twenty patients were stabilized with GFD and correction of dehydration, acidosis and electrolyte imbalance. Six patients needed parenteral steroids ant total parenteral nutrition (TPN). Recovery time from crisis was mean 5.4+-2.73 days (range 3-20 days). Conclusion: Celiac crisis is a common but under recognized problem in developing countries. Commonest presenting feature is neuromuscular paralysis and biochemical abnormality is

  20. Computing return times or return periods with rare event algorithms

    Science.gov (United States)

    Lestang, Thibault; Ragone, Francesco; Bréhier, Charles-Edouard; Herbert, Corentin; Bouchet, Freddy

    2018-04-01

    The average time between two occurrences of the same event, referred to as its return time (or return period), is a useful statistical concept for practical applications. For instance insurances or public agencies may be interested by the return time of a 10 m flood of the Seine river in Paris. However, due to their scarcity, reliably estimating return times for rare events is very difficult using either observational data or direct numerical simulations. For rare events, an estimator for return times can be built from the extrema of the observable on trajectory blocks. Here, we show that this estimator can be improved to remain accurate for return times of the order of the block size. More importantly, we show that this approach can be generalised to estimate return times from numerical algorithms specifically designed to sample rare events. So far those algorithms often compute probabilities, rather than return times. The approach we propose provides a computationally extremely efficient way to estimate numerically the return times of rare events for a dynamical system, gaining several orders of magnitude of computational costs. We illustrate the method on two kinds of observables, instantaneous and time-averaged, using two different rare event algorithms, for a simple stochastic process, the Ornstein–Uhlenbeck process. As an example of realistic applications to complex systems, we finally discuss extreme values of the drag on an object in a turbulent flow.

  1. Rare diseases in clinical endocrinology: a taxonomic classification system.

    Science.gov (United States)

    Marcucci, G; Cianferotti, L; Beck-Peccoz, P; Capezzone, M; Cetani, F; Colao, A; Davì, M V; degli Uberti, E; Del Prato, S; Elisei, R; Faggiano, A; Ferone, D; Foresta, C; Fugazzola, L; Ghigo, E; Giacchetti, G; Giorgino, F; Lenzi, A; Malandrino, P; Mannelli, M; Marcocci, C; Masi, L; Pacini, F; Opocher, G; Radicioni, A; Tonacchera, M; Vigneri, R; Zatelli, M C; Brandi, M L

    2015-02-01

    Rare endocrine-metabolic diseases (REMD) represent an important area in the field of medicine and pharmacology. The rare diseases of interest to endocrinologists involve all fields of endocrinology, including rare diseases of the pituitary, thyroid and adrenal glands, paraganglia, ovary and testis, disorders of bone and mineral metabolism, energy and lipid metabolism, water metabolism, and syndromes with possible involvement of multiple endocrine glands, and neuroendocrine tumors. Taking advantage of the constitution of a study group on REMD within the Italian Society of Endocrinology, consisting of basic and clinical scientists, a document on the taxonomy of REMD has been produced. This document has been designed to include mainly REMD manifesting or persisting into adulthood. The taxonomy of REMD of the adult comprises a total of 166 main disorders, 338 including all variants and subtypes, described into 11 tables. This report provides a complete taxonomy to classify REMD of the adult. In the future, the creation of registries of rare endocrine diseases to collect data on cohorts of patients and the development of common and standardized diagnostic and therapeutic pathways for each rare endocrine disease is advisable. This will help planning and performing intervention studies in larger groups of patients to prove the efficacy, effectiveness, and safety of a specific treatment.

  2. Rare Earth Elements - A New Challenge for the World Economy

    Directory of Open Access Journals (Sweden)

    Cristina Bumbac

    2013-01-01

    Full Text Available Rare Earth Elements or Rare Earth Metals (REM are a collection of seventeen chemical elements in the periodic table, namely scandium, yttrium and fifteen lanthanides. The term "rare earth" arises from the rare earth minerals from which they were first isolated. They are uncommon oxide-type minerals (earths found in Gandolinite extracted from one mine in Sweden. The first discovery was made in 1794, but it was only in 1940 that the scientist Frank Spedding developed an ion exchange procedure for separating and purifying the REM. For the next decades, they were hardly used in some "minor" industrial fields. Only after 2000 their importance grew, once the multitude of possibilities to use them was discovered due to technological progress. Now REM are incorporated into almost all modern technological devices: superconductors, magnets, electronic polishers, refining catalysts hybrid car components and military techniques. They are used in small quantities, but due to their extraordinary properties the prices are very high. The main problem is that China dominates this market, with 97% of total global supply. The highest concentration of rare earth metals are in Inner Mongolia in China, Mountain Pass in California U.S.A. and in Mount Weld in Australia. The developed countries are far behind China regarding production and are indeed depending on Chinese exports. Hence, there is a difficult situation on this particular market, with an uncertain future.

  3. New physics from rare beauty

    CERN Document Server

    AUTHOR|(CDS)2077817; Hulsbergen, W

    2010-01-01

    The Standard Model (SM) of particle physics offers a framework to describe sub-nuclear physics processes. Despite its success in describing a large variety of sub-nuclear phenomena, the SM leaves open a number of questions and is regarded by particle physicists as an effective quantum field theory, rather than a credible candidate to be the ultimate theory of fundamental interactions. Particle physicists postulates the existence of New Physics (NP) beyond the SM. This would result into the creation of new particles that could then be observed at higher energy regimes than hitherto explored. These particles could be observed directly or indirectly, through their contributions to quantum loops. A promising ground to look for NP are the Flavor Changing Neutral Currents (FCNCs). Due to its precise theoretical prediction, one of the most promising rare decay channel is the $B_s$ meson decaying into two muons. In this dissertation the strategy for an early measurement of the $B_{s} \\rightarrow \\mu \\mu$ branching ra...

  4. Recycling of Rare Earth Elements

    Science.gov (United States)

    Lorenz, Tom; Bertau, Martin

    2017-01-01

    Any development of an effective process for rare earth (RE) recycling has become more and more challenging, especially in recent years. Since 2011, when commodity prices of REs had met their all-time maximum, prices have dropped rapidly by more than 90 %. An economic process able to offset these fluctuations has to take unconventional methods into account beside well-known strategies like acid/basic leaching or solvent extraction. The solid-state chlorination provides such an unconventional method for mobilizing RE elements from waste streams. Instead of hydrochloric acid this kind of chlorination decomposes NH4Cl thermally to release up to 400 °C hot HCl gas. After cooling the resulting solid metal chlorides may be easily dissolved in pH-adjusted water. Without producing strongly acidic wastes and with NH4Cl as cheap source for hydrogen chloride, solid-state chlorination provides various advantages in terms of costs and disposal. In the course of the SepSELSA project this method was examined, adjusted and optimized for RE recycling from fluorescent lamp scraps as well as Fe14Nd2B magnets. Thereby many surprising influences and trends required various analytic methods to examine the reasons and special mechanisms behind them.

  5. Rare stable isotopes in meteorites

    International Nuclear Information System (INIS)

    Wilson, G.C.

    1981-01-01

    Secondary Ion Mass Spectrometry (SIMS) using accelerators has been applied with success to cosmic ray exposure ages and terrestrial residence times of meteorites by measuring cosmogenic nuclides of Be, Cl, and I. It is proposed to complement this work with experiments on rare stable isotopes, in the hope of setting constraints on the processes of solar nebula/meteoritic formation. The relevant species can be classified as: a) daughter products of extinct nuclides (halflife less than or equal to 2 x 10 8 y) -chronology of the early solar system; b) products of high temperature astrophysical processes - different components incorporated into the solar nebula; and c) products of relatively low temperature processes, stellar winds and cosmic ray reactions - early solar system radiation history. The use of micron-scale primary ion beams will allow detailed sampling of phases within meteorites. Strategies of charge-state selection, molecular disintegration and detection should bring a new set of targets within analytical range. The developing accelerator field is compared to existing (keV energy) ion microprobes

  6. Rare primary headaches: clinical insights.

    Science.gov (United States)

    Casucci, G; d'Onofrio, F; Torelli, P

    2004-10-01

    So-called "rare" headaches, whose prevalence rate is lower than 1% or is not known at all and have been reported in only a few dozen cases to date, constitute a very heterogeneous group. Those that are best characterised from the clinical point of view can be classified into forms with prominent autonomic features and forms with sparse or no autonomic features. Among the former are trigeminal autonomic cephalalgias (TACs) and hemicrania continua, while the latter comprise classical trigeminal neuralgia, hypnic headache, primary thunderclap headache, and exploding head syndrome. The major clinical discriminating factor for the differential diagnosis of TACs is the relationship between duration and frequency of attacks: the forms in which pain is shorter lived are those with the higher frequency of daily attacks. Other aspects to be considered are the time pattern of symptoms, intensity and timing of attacks, the patient's behaviour during the attacks, the presence of any triggering factors and of the refractory period after an induced attack, and response to therapy, especially with indomethacin. Often these are little known clinical entities, which are not easily detected in clinical practice. For some of them, e. g., thunderclap headache, it is always necessary to perform instrumental tests to exclude the presence of underlying organic diseases.

  7. RARE METASTASES OF MALIGNANT MELANOMA

    Directory of Open Access Journals (Sweden)

    Marija Trenkić-Božinović

    2014-09-01

    Full Text Available Melanomas are malignant neoplasms that originate from melanocytes. The most common are on the skin and mucous membranes. Choroidal melanomas are quite different from cutaneous melanomas with regard to presentation, metastases, and treatment. We report two cases of metastatic gastric malignant melanoma of the eye and skin, with reference to the literature. The first patient was a woman aged 23 years, who underwent gastrectomy 22 months after enucleation of the eye due to malignant choroid melanoma. The second patient was a man, 72 years old, who underwent surgery 28 months before because of malignant melanoma of the skin of the forehead. Paraffin sections, 4 μm thick were stained using a classic method, as well as immunohistochemical DAKO APAAP method, using a specific S - 100 antibody and Melan A antibodies. The stomach is considered a rare place for the development of metastases. Metastases in the stomach are often limited to the submucosal as well as the serousmuscular layer, as noted in one of our patients. Metastatic melanoma of the gastrointestinal tract should be suspected in any patient with a history of malignant melanoma and new gastrointestinal symptoms. Because of the similarity between certain common histopathological types of malignant melanoma, primarily achromatic, and types of primary cancers of the stomach, the following immunohistochemical studies are needed: Melan A and S - 100 protein ( markers of malignant melanoma , as well as mucins: MUC5AC, MUC2 and CDX2 ( markers of different types of primary gastric carcinoma.

  8. Tale of two rare diseases

    Directory of Open Access Journals (Sweden)

    Ravindra Shukla

    2013-01-01

    Full Text Available Idiopathic Hypogonadotropic hypogonadism (IHH phenotype is variable & various genes have been decribed in association with IHH.We describe association of IHH with mosaic trisomy 13. A 20 year old male presented with lack of development of secondary sexual characters, normal height, micropenis, small testes, gynaecomastia, absence of axillary and pubic hairs, hyposmia,synkinesis, bilateral horizontal nystagmus and high arched palate. Investigations showed low gonadotropin,low total testosterone, LH after stimulation with 100 mcg tryptorelin sc was 11.42 mU/mL at 40 min. MRI of hypothalamo-pituitary region showed normal olfactory bulb and tract but shallow olfactory sulcus . Karyotype showed homologous Robertsonian translocation of chromosome 13. This case fits classical IHH except for LH rise on stimulation.Features of Patau syndrome which is associated with trisomy 13 are absent in our case. Mosaic trisomy 13, which can otherwise be rare incidental finding , has not been described in association with IHH.Causal association of novel mutation on chromosome 13 leading to aforementioned phenotype cannot be rule out.

  9. Pachyonychia congenita: A rare genodermatosis

    Directory of Open Access Journals (Sweden)

    Puneet Agarwal

    2013-01-01

    Full Text Available Pachyonychia congenita (PC is a rare genodermatosis with only 450 cases reported since 1906. It is of two types, type I due to mutation in genes 6a and 16, and 6b and 17 in type II with an autosomal dominant inheritance in both types. A 22 yr old female patient presented in our OPD with hypertrophy of finger and toe nails, palmoplantar keratoderma, oral punctuate leukokeratosis, hyperhidrosis in palms and soles with maceration and malodour since childhood. She had a positive family history with father and grandfather affected but less severely. Microscopy and culture of nail clippings and scrapping were done to rule out fungal infection. On biopsy acanthotic epidermis, parakeratosis, orthokeratosis were seen. No evidence of any associated malignancy was found after thorough workup. She was diagnosed as PC Type 1. She was put on topical steroids and orally on acetretin 25 mg OD. Paring of the nails was done too reduce the thickness of nails & to provide symptomatic relief. She was on a regular treatment for 3-4 months and showed some improvement in the form of reduced palmoplantar hyperkeratosis and reduced oral punctate keratosis but was later lost on followup. She showed no adverse effect to therapy during this period. This case is being reported because of its rarity.

  10. Expert services for rare anaemias across Europe

    Directory of Open Access Journals (Sweden)

    Beatrice Gulbis

    2013-03-01

    Full Text Available New challenges and priorities are given in the EU Health programme 2007-2013. The objectives of the programme are to improve citizens’ health security, to promote health to improve prosperity and solidarity, and to generate and disseminate health knowledge. If challenges and priorities have been defined globally for rare diseases by the European Commission, persons involved in rare anaemias have taken the opportunity to contribute to the empowerment of patients with rare anaemias. One of the ENERCA partners objectives was the mapping of existing centres that take care of patients with rare anaemias in Europe. Another goal was to obtain a directory of facilities available per centre for patients with rare anaemias. We thought that with those results it could realistically help to define a consensus regarding the criteria to be recognised as a centre of expertise for haemoglobinopathies and very rare anaemias.

  11. Raman scattering of rare earth hexaborides

    International Nuclear Information System (INIS)

    Ogita, Norio; Hasegawa, Takumi; Udagawa, Masayuki; Iga, Fumitoshi; Kunii, Satoru

    2009-01-01

    Raman scattering spectra were measured for the rare-earth hexaborides RB 6 (R = Ce, Gd, or Dy). All Raman-active phonons due to B 6 vibrations were observed in the range 600 - 1400 cm -1 . Anomalous peaks were detected below 200 cm -1 , which correspond to vibrations of rare-earth ion excited by second-order Raman scattering process. The intensity and energy of the rare-earth mode decrease with decreasing temperature. This suggests that the rare-earth ion vibrates in a shallow and anharmonic potential due to the boron cage. Using the reported values of mean square displacement of rare-earth ion, we estimated the anharmonic contribution for the rare-earth vibrations.

  12. Rare Event Simulation in Radiation Transport

    Science.gov (United States)

    Kollman, Craig

    This dissertation studies methods for estimating extremely small probabilities by Monte Carlo simulation. Problems in radiation transport typically involve estimating very rare events or the expected value of a random variable which is with overwhelming probability equal to zero. These problems often have high dimensional state spaces and irregular geometries so that analytic solutions are not possible. Monte Carlo simulation must be used to estimate the radiation dosage being transported to a particular location. If the area is well shielded the probability of any one particular particle getting through is very small. Because of the large number of particles involved, even a tiny fraction penetrating the shield may represent an unacceptable level of radiation. It therefore becomes critical to be able to accurately estimate this extremely small probability. Importance sampling is a well known technique for improving the efficiency of rare event calculations. Here, a new set of probabilities is used in the simulation runs. The results are multiplied by the likelihood ratio between the true and simulated probabilities so as to keep our estimator unbiased. The variance of the resulting estimator is very sensitive to which new set of transition probabilities are chosen. It is shown that a zero variance estimator does exist, but that its computation requires exact knowledge of the solution. A simple random walk with an associated killing model for the scatter of neutrons is introduced. Large deviation results for optimal importance sampling in random walks are extended to the case where killing is present. An adaptive "learning" algorithm for implementing importance sampling is given for more general Markov chain models of neutron scatter. For finite state spaces this algorithm is shown to give, with probability one, a sequence of estimates converging exponentially fast to the true solution. In the final chapter, an attempt to generalize this algorithm to a continuous

  13. Rare earth ion controlled crystallization of mica glass-ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Garai, Mrinmoy; Karmakar, Basudeb, E-mail: basudebk@cgcri.res.in

    2016-09-05

    In understanding the effects of rare earth ions to control the crystallization and microstructure of alkaline boroaluminosilicate system, the CeO{sub 2}, Nd{sub 2}O{sub 3}, Sm{sub 2}O{sub 3} and Gd{sub 2}O{sub 3} doped K{sub 2}O−MgO−B{sub 2}O{sub 3}−Al{sub 2}O{sub 3}−SiO{sub 2}−F glasses were synthesized by melt-quenching at 1550 °C. Higher density (2.82–3.06 g cm{sup −3}) and thermal stability (glass phase) is experiential on addition of rare earth content, which also affects in increasing the glass transition temperature (T{sub g}) and crystallization temperature (T{sub c}). Decrease of thermal expansion in glasses with rare earth ion content is maintained by the stabilization of glass matrix owing to their large cationic field strength. A significant change in the non-isothermal DSC thermogram observed at 750–1050 °C is attributed to fluorophlogopite crystallization. Opaque glass-ceramics were prepared from such glasses by single step heat-treatment at 1050 °C; and the predominant crystalline phases are identified as fluorophlogopite mica, KMg{sub 3}(AlSi{sub 3}O{sub 10})F{sub 2} by XRD and EDX analysis. The compact glass-ceramic microstructure by the agglomeration of fluorophlogopite mica crystallites (crystal size ∼ 100–500 nm, FESEM) is achieved in attendance of rare earth ion; and such microstructure controlled the variation of density, thermal expansion and microhardness value. Higher thermal expansion (11.11–14.08 × 10{sup −6}/K at 50–800 °C and 50–900 °C) of such glass-ceramics approve that these rare earth containing glasses can be useful for high temperature vacuum sealing application with metal or solid electrolyte. The increase of Vickers microhardness (5.27–5.61 GPa) in attendance of rare earth ions is attributed to the compact crystallinity of fluorophlogopite mica glass-ceramic microstructure. - Highlights: • Synthesis of rare earth oxide doped alkaline boroaluminosilicate glasses. • Development of opaque

  14. Rare earth ion controlled crystallization of mica glass-ceramics

    International Nuclear Information System (INIS)

    Garai, Mrinmoy; Karmakar, Basudeb

    2016-01-01

    In understanding the effects of rare earth ions to control the crystallization and microstructure of alkaline boroaluminosilicate system, the CeO_2, Nd_2O_3, Sm_2O_3 and Gd_2O_3 doped K_2O−MgO−B_2O_3−Al_2O_3−SiO_2−F glasses were synthesized by melt-quenching at 1550 °C. Higher density (2.82–3.06 g cm"−"3) and thermal stability (glass phase) is experiential on addition of rare earth content, which also affects in increasing the glass transition temperature (T_g) and crystallization temperature (T_c). Decrease of thermal expansion in glasses with rare earth ion content is maintained by the stabilization of glass matrix owing to their large cationic field strength. A significant change in the non-isothermal DSC thermogram observed at 750–1050 °C is attributed to fluorophlogopite crystallization. Opaque glass-ceramics were prepared from such glasses by single step heat-treatment at 1050 °C; and the predominant crystalline phases are identified as fluorophlogopite mica, KMg_3(AlSi_3O_1_0)F_2 by XRD and EDX analysis. The compact glass-ceramic microstructure by the agglomeration of fluorophlogopite mica crystallites (crystal size ∼ 100–500 nm, FESEM) is achieved in attendance of rare earth ion; and such microstructure controlled the variation of density, thermal expansion and microhardness value. Higher thermal expansion (11.11–14.08 × 10"−"6/K at 50–800 °C and 50–900 °C) of such glass-ceramics approve that these rare earth containing glasses can be useful for high temperature vacuum sealing application with metal or solid electrolyte. The increase of Vickers microhardness (5.27–5.61 GPa) in attendance of rare earth ions is attributed to the compact crystallinity of fluorophlogopite mica glass-ceramic microstructure. - Highlights: • Synthesis of rare earth oxide doped alkaline boroaluminosilicate glasses. • Development of opaque fluorophlogopite mica glass-ceramics by single-step heat treatment. • Nanocrystalline glass

  15. Rare earth metals for automotive exhaust catalysts

    International Nuclear Information System (INIS)

    Shinjoh, Hirohumi

    2006-01-01

    The usage of rare earth metals for automotive exhaust catalysts is demonstrated in this paper. Rare earth metals have been widely used in automotive catalysts. In particular, three-way catalysts require the use of ceria compounds as oxygen storage materials, and lanthana as both a stabilizer of alumina and a promoter. The application for diesel catalysts is also illustrated. Effects of inclusion of rare earth metals in automotive catalysts are discussed

  16. Rare earth industries: Strategies for Malaysia

    International Nuclear Information System (INIS)

    2011-01-01

    Evidently, many reports cite Malaysia as having reasonably substantial amounts of rare earths elements. In fact, based on the rare earths found in the residual tin deposits alone, Malaysia has about 30,000 tonnes. This does not take into account unmapped deposits which experts believe may offer more tonnages of rare earths. Brazil which is reported to have about 48,000 tonnes has announced plans to invest aggressively in the rare earths business. China has on record the largest reserves with about 36 million tonnes. This explains why China has invested heavily in the entire value chain of the rare earths business. Chinas committed investment in rare earths started many years ago when the country's foremost leaders proclaimed the strategic position of rare earths in the world economy. That forecast is now a reality where the rise in the green high-tech economy is seen driving global demand for rare earths in a big way. Malaysia needs to discover and venture into new economic growth areas. This will help fuel the country's drive to achieve a high income status by 2020 as articulated in the New Economic Model (NEM) and the many supporting Economic Transformation Plans that the Government has recently launched. Rare earths may be the new growth area for Malaysia. However, the business opportunities should not just be confined to the mining, extraction and production of rare earths elements alone if Malaysia is to maximise benefits from this industry. The industry's gold mine is in the downstream products. This is also the sector that China wants to expand. Japan which now controls about 50 % of the global market for downstream rare earths-based high-tech components is desperately looking for partners to grow their stake in the business. Malaysia needs to embark on the right strategies in order to build the rare earths industry in the country. What are the strategies? (author)

  17. Expert services for rare anaemias across Europe

    OpenAIRE

    Beatrice Gulbis

    2013-01-01

    New challenges and priorities are given in the EU Health programme 2007-2013. The objectives of the programme are to improve citizens’ health security, to promote health to improve prosperity and solidarity, and to generate and disseminate health knowledge. If challenges and priorities have been defined globally for rare diseases by the European Commission, persons involved in rare anaemias have taken the opportunity to contribute to the empowerment of patients with rare anaemias. One o...

  18. Rare earth - no case for government intervention

    OpenAIRE

    Georg Zachmann

    2010-01-01

    China has officially restricted exports of rare earth for several years and announced this year it will further tighten exports. Rare earth is a group of 17 different metals, usually found clustered together. These metals have hundreds of different industry applications. For example, they are used in certain high capacity magnets, batteries and lasers. As the rare earth elements are used in sectors that are assumed to have an over-proportionate growth potential (eg. green-technology), policy ...

  19. [Imported diseases in Switzerland: development and perspectives].

    Science.gov (United States)

    Degrémont, A; Lorenz, N

    1990-10-01

    During the last years, imported diseases have become more frequent in Switzerland. This is easily explained by the enormous increase of tourism to tropical and subtropical countries. Immigration from these countries has equally seen an important augmentation. The principal imported diseases are still malaria and gastrointestinal infections. Viral infections are rarely diagnosed, with the exception of hepatitis and HIV infection. The prevalence of sexually transmitted diseases is most certainly underestimated. The differential diagnosis of imported skin diseases is still difficult. Rare tropical diseases will probably become more frequent in the coming years as travellers leave more and more the traditional tourist paths. Practitioners have to look out for such problems, and continuous training programmes for them will have to take these new problems into account. Referral centres of infectious diseases should be established in all regions of Switzerland. High priority should be given to the prevention of imported diseases.

  20. Alaska's rare earth deposits and resource potential

    Science.gov (United States)

    Barker, James C.; Van Gosen, Bradley S.

    2012-01-01

    Alaska’s known mineral endowment includes some of the largest and highest grade deposits of various metals, including gold, copper and zinc. Recently, Alaska has also been active in the worldwide search for sources of rare earth elements (REE) to replace exports now being limitedby China. Driven by limited supply of the rare earths, combined with their increasing use in new ‘green’ energy, lighting, transportation, and many other technological applications, the rare earth metals neodymium, europium and, in particular, the heavy rare earth elements terbium, dysprosium and yttrium are forecast to soon be in critical short supply (U.S. Department of Energy, 2010).

  1. Genetic and Rare Diseases Information Center (GARD)

    Data.gov (United States)

    Federal Laboratory Consortium — NCATS collaborates with the National Human Genome Research Institute (NHGRI) to support GARD, a center designed to provide comprehensive information about rare and...

  2. Comprehensive genotyping in dyslipidemia: mendelian dyslipidemias caused by rare variants and Mendelian randomization studies using common variants.

    Science.gov (United States)

    Tada, Hayato; Kawashiri, Masa-Aki; Yamagishi, Masakazu

    2017-04-01

    Dyslipidemias, especially hyper-low-density lipoprotein cholesterolemia and hypertriglyceridemia, are important causal risk factors for coronary artery disease. Comprehensive genotyping using the 'next-generation sequencing' technique has facilitated the investigation of Mendelian dyslipidemias, in addition to Mendelian randomization studies using common genetic variants associated with plasma lipids and coronary artery disease. The beneficial effects of low-density lipoprotein cholesterol-lowering therapies on coronary artery disease have been verified by many randomized controlled trials over the years, and subsequent genetic studies have supported these findings. More recently, Mendelian randomization studies have preceded randomized controlled trials. When the on-target/off-target effects of rare variants and common variants exhibit the same direction, novel drugs targeting molecules identified by investigations of rare Mendelian lipid disorders could be promising. Such a strategy could aid in the search for drug discovery seeds other than those for dyslipidemias.

  3. Ciliates and the rare biosphere-community ecology and population dynamics.

    Science.gov (United States)

    Weisse, Thomas

    2014-01-01

    Application of deep sequencing technologies to environmental samples and some detailed morphological studies suggest that there is a vast, yet unexplored rare ciliate biosphere, tentatively defined in terms of operational taxonomic units. However, very few studies complemented molecular and phylogenetic data with morphological and ecological descriptions of the species inventory. This is mainly because the sampling effort increases strongly with decreasing species abundance. In spite of this limited knowledge, it is clear that species that are rare under certain environmental conditions (temporal rare biosphere) may become abundant when the physical, chemical, and biological variables of their habitat change. Furthermore, some species may always be present in low numbers if their dispersal rates are exceedingly high (accidental rare biosphere). An intriguing question is whether there are some species that are always rare, i.e., in every suitable environment. This permanent rare biosphere is conceptually different from the temporal rare biosphere. This review characterizes typical aquatic habitats of the rare ciliate biosphere, portrays different scenarios under which some or even many species may be permanently rare (background fauna), and identifies some fundamental questions that need to be addressed to achieve a better understanding of the population dynamics of the rare ciliate biosphere. © 2014 The Authors The Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  4. Study of charmonium rare decays

    International Nuclear Information System (INIS)

    Brient, J.C.

    1986-09-01

    This thesis presents the study of rare decays of charmonium states formed in the interaction of an antiproton beam with an hydrogen gas jet target. Electromagnetic final states are used to sign the charmonium state formation (e + e - , e + e - + Χ, γγ). The selection of events used a two arms non magnetic spectrometer, with a charged track system, a threshold Cerenkov counter to tag the electron (positron), and an e.m. calorimeter. Energy scan technic have been used to observe the resonant formation through the excitation curves. Parameters of the states (mass, total and partial widths) are extracted from these curves using a statistical analysis. Two types of decays have been studied in this thesis: 1 P 1 charmonium state decay to the ψ (signed by its e + e - decay). In the energy scan around the center of gravity of the P charmonium states, we observe a cluster of 5 events, in a narrow mass range. This cluster correspond to a 2.7 σ signal. The most probable interpretation of this signal is given by a narrow resonance, with a mass of 3526. MeV. Due to the properties (mass, width and decay) of this signal, this could be interpreted as the 1 P 1 charmonium state. 2 photons decay of the η c and Χ 2 . 22 γγ events are observed, 15 in the η c region, and 7 in the Χ 2 region. This sample is interpreted as a direct observation of η c and Χ 2 decay into γγ. Parameters of these decays, (γγ partial width), are extracted using a maximum likekihood analysis. Theoretical models of charmonium explain correctly the properties of the charmonium, including the results presented in this thesis. 57 refs [fr

  5. A rare cause of osteonecrosis

    Directory of Open Access Journals (Sweden)

    Paolo Agostinis

    2012-01-01

    Full Text Available IntroductionHereditary hemochromatosis (HH is an autosomal recessive disorder caused by mutations in the HFE gene, which increase intestinal iron absorption. The prevalence of C282Y homozygosity, which causes the disorder, is 0.5% in Caucasian populations. The clinical manifestations are related to excess iron in the tissues, especially the liver, heart, pancreas, pituitary, and skin. They include fatigue, loss of libido or impotence in males, liver disease, skin pigmentation, diabetes mellitus, cardiac enlargement—with or without heart failure, and conduction defects. The classic triad of cirrhosis, diabetes mellitus, and skin pigmentation (“bronze diabetes” results from a combination of iron deposits and melanin. It occurs late in the disease, when the total body iron content is more than five times the normal value, about 20 grams. Left untreated, approximately half of all patients with HH eventually develop arthralgia or arthropathy. Chondrocalcinosis, chronic pseudo-osteoarthritis, and osteoporosis are the major rheumatic manifestations of HH. The cause of the arthropathy is still unknown. Iron deposits within joints may trigger a number of pathologic events, such as free radical generation and crystal deposition, which stimulate immune complex formation and inflammation.Materials and methodsWe describe the case of a 48-year-old male suffering from chronic bilateral ankle pain.ResultsThe work-up revealed osteonecrosis of ankle. The patient also presented high plasma ferritin levels and homozygosity for the C282Y mutation. Other than HH, which was confirmed by liver biopsy, the patient had no other risk factors for osteonecrosis.DiscussionHH represents a rare cause of osteonecrosis, and there are no prior reports of aseptic osteonecrosis of the ankle in a patient with this disease. The pathogenetic mechanism remains unknown.

  6. Rare Earths and Clean Energy: analyzing China's upper hand

    International Nuclear Information System (INIS)

    Seaman, J.

    2010-01-01

    recycling programs, increased efficiency in resource use and the development of alternatives to rare earths are important endeavors and should be pursued, but they should not be substitutes for developing rare earth supplies outside of China today. (author)

  7. Perceived Benefits and Factors that Influence the Ability to Establish and Maintain Patient Support Groups in Rare Diseases: A Scoping Review.

    Science.gov (United States)

    Delisle, Vanessa C; Gumuchian, Stephanie T; Rice, Danielle B; Levis, Alexander W; Kloda, Lorie A; Körner, Annett; Thombs, Brett D

    2017-06-01

    Support groups are an important resource for many people living with rare diseases. The perceived benefits of participating in support groups for people with rare diseases and factors that may influence the ability to successfully establish and maintain these groups are not well understood. Thus, the objective of this scoping review was to provide a mapping of the available evidence on the (1) benefits or perceived benefits of participating in rare disease support groups and (2) barriers and facilitators of establishing and maintaining these groups. CINAHL and PubMed were searched from January 2000 to August 2015, with no language restrictions. Publications that described the benefits or perceived benefits of participating in rare disease support groups or the barriers and facilitators of establishing and maintaining them were eligible for inclusion. Two investigators independently evaluated titles/abstracts and full-text publications for eligibility, and extracted data from each included publication. Ten publications were included in the scoping review. There was no trial evidence on support group benefits. All ten publications reported on the perceived benefits of participating in rare disease support groups. Three reported on barriers and facilitators of establishing and maintaining them. Overall, seven different perceived benefits of participating in rare disease support groups were identified: (1) meeting and befriending other people with the same rare disease and similar experiences; (2) learning about the disease and related treatments; (3) giving and receiving emotional support; (4) having a place to speak openly about the disease and one's feelings; (5) learning coping skills; (6) feeling empowered and hopeful; and (7) advocating to improve healthcare for other rare disease patients. Several facilitators (e.g., meeting via teleconference) and barriers (e.g., getting patients and/or family members to lead the group) of establishing and maintaining these

  8. Adaptive Importance Sampling Simulation of Queueing Networks

    NARCIS (Netherlands)

    de Boer, Pieter-Tjerk; Nicola, V.F.; Rubinstein, N.; Rubinstein, Reuven Y.

    2000-01-01

    In this paper, a method is presented for the efficient estimation of rare-event (overflow) probabilities in Jackson queueing networks using importance sampling. The method differs in two ways from methods discussed in most earlier literature: the change of measure is state-dependent, i.e., it is a

  9. Brown′s syndrome with ocular albinism: Case report of a rare presentation and literature review

    Directory of Open Access Journals (Sweden)

    Soumya Nambiar

    2015-01-01

    Full Text Available We report a rare case of Brown′s syndrome associated with ocular albinism in a 10-year-old boy. This report highlights the importance of further analysis of cases of Brown′s syndrome and throws some light on the etiology and association of this rare condition.

  10. Retroperitoneal Malignant Peripheral Nerve Sheath Tumour: A Rare Case Report.

    Science.gov (United States)

    Deger, Ayse Nur; Bayar, Mehmet Akif; Caydere, Muzaffer; Deger, Hakki; Tayfur, Mahir

    2015-09-01

    Malignant nerve sheath tumours (MPNST) are rare neoplasias and retroperitoneal cases are fairly rare and clinically difficult to be detected, but they are very agressive neoplasias. MPNST are frequently seen in head, neck and upper extremities. In patients with NF1; MPNST, a poor-prognostic lesion, may result from a malignant degeneration of a former plexiform neurofibroma. It is necessary to be aware of a potential malignancy in patients diagnosed with plexiform neurofibroma. We present a 21-year-old female with a diagnosis of MPNST. The patient was admited to the hospital because of a tumour in the subcutaneous region on her left buttock. The surgeon's clinical diagnosis was lipoma. After the pathological examination of biopsy specimen, the lesion was identified as "plexiform neurofibroma" and then the patient was diagnosed with Neurofibromatosis Type 1 (NF1). Simultaneously, another mass on the retroperitoneal region was identified as malignant peripheral nerve sheath tumour (MPNST).

  11. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  12. Oxygen stabilized rare-earth iron intermetallic compounds

    International Nuclear Information System (INIS)

    Dariel, M.P.; Malekzadeh, M.; Pickus, M.R.

    1975-10-01

    A new, oxygen-stabilized intermetallic compound was identified in sintered, pre-alloyed rare-earth iron powder samples. Its composition corresponds to formula R 12 Fe 32 O 2 and its crystal structure belongs to space group Im3m. The presence of these compounds was observed, so far, in several R--Fe--O systems, with R = Gd, Tb, Dy, Ho, Er, and Y

  13. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  14. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  15. Rare human diseases: 9p deletion syndrome

    Directory of Open Access Journals (Sweden)

    Galagan V.O.

    2014-09-01

    Full Text Available Objective of the study was to review the anamnesis, pheno - and genotype in patients with rare chromosome disorders such as 9p deletion syndrome. Genetic methods of investigation (clinical and genealogical, cytogenetic, FISH- method, paraclinical and instrumental methods of examination were used. Karyotyping was performed by the G-method of differential staining of chromosomes. Only three cases of pathology were diagnosed in the Medical Genetics Center over the last 10 years. By anamnesis data nobody in the probands’ families had bad habits, was exposed to occupational hazards, took part in the elimination of the Chernobyl accident or lived in contaminated areas. Clinical signs of diseases have not been identified in probands’ parents. All probands had trigonocephaly, bilateral epicanthal folds, ocular hypertelorism, downslanting palpebral fissures, long philtrum, flat face and nasal bridge, low set ears with malformed auricles. Two patients of three ones had exophthalmos, contracture of the second and third fingers, abnormal external genitalia. In all three cases there was monosomy of chromosome 9 of critical segment p 24. Normal karyotypes were seen in all parents, so there were three cases of new mutations of 9p deletion syndrome. Retardation of physical, psycho-spech, mental development in proband with or without congenital anomalies requires medical genetic counseling in a specialized institution. Cases of reproductive loss in anamnesis require cytogenetic investigation of fetal membranes and amniotic fluid.

  16. Chemical analysis of rare earth elements

    International Nuclear Information System (INIS)

    Tsukahara, Ryoichi; Sakoh, Takefumi; Nagai, Iwao

    1994-01-01

    Recently attention has been paid to ICP-AES or ICP-MS, and the reports on the analysis of rare earth elements by utilizing these methods continue to increase. These reports have become to take about 30% of the reports on rare earth analysis, and this is because these methods are highly sensitive to rare earth elements, and also these methods have spread widely. In ICP-AES and ICP-MS, mostly solution samples are measured, therefore, solids must be made into solution. At the time of quantitatively determining the rare earth elements of low concentration, separation and concentration are necessary. Referring to the literatures reported partially in 1990 and from 1991 to 1993, the progress of ICP-AES and ICP-MS is reported. Rare earth oxides and the alloys containing rare earth elements are easily decomposed with acids, but the decomposition of rocks is difficult, and its method is discussed. The separation of the rare earth elements from others in geochemical samples, cation exchange process is frequently utilized. Also solvent extraction process has been studied. For the separation of rare earth elements mutually, chromatography is used. The spectral interference in spectral analysis was studied. The comparison of these methods with other methods is reported. (K.I)

  17. Rare earth oxyhydrides and preparation process

    International Nuclear Information System (INIS)

    Diaz, H.

    1986-01-01

    Rare earth oxyhydrides of formula RE 1-q Th q Ni 5-p M p O x H y are claimed. RE is a rare earth, Th can be replaced by Yt, M is Cu, Mn, Al, Fe, Cr or Co, o O C and the hydrides are oxidized. They are catalysts for various chemical reactions [fr

  18. Process for lead removal from rare earth

    International Nuclear Information System (INIS)

    Bollat, A.; Sabot, J.L.

    1987-01-01

    An aqueous solution of rare earth chlorides and lead chlorides, with a chloride concentration of at least 2 moles/liter and a pH between 2 and 4, is extracted by an alkylphosphonic acid ester and rare earth(s) is (are) recovered from the organic phase [fr

  19. [A rare form of granuloma annulare].

    Science.gov (United States)

    Bogdanowski, T; Wygledowska-Kania, M

    1995-01-01

    We present a four-year-old girl with a doubly rare form of granuloma annulare with non-typical localisation of superficial nodules on the palms and predisposition to ulceration which is very rare in this type of superficial nodules. The diagnosis was proved by histological examination. After the local cryotherapy (ethyl chloride) the lesions almost completely disappeared.

  20. Pseudomyxoma peritonei (PMP) – a rare entity

    African Journals Online (AJOL)

    Department of Radiology, University of Pretoria. Corresponding author: Z Ebrahim (zaeem@iafrica.com). Pseudomyxoma peritonei (PMP) is a rare complication of mucinous tumours of appendiceal or ovarian origin that results in peritoneal and omental implants. In addition to the appendix and the ovary, other rare.

  1. Theory of Rare-Earth Alloys

    DEFF Research Database (Denmark)

    Lindgård, Per-Anker

    1977-01-01

    A mean-field random alloy theory combined with a simple calculation of the exchange interaction J(c,Q) is shown to quantitatively account for the phase diagrams for alloys of rare-earth metals with Y, Lu, Sc, and other rare-earth metals. A concentration-dependent J(c,Q) explains the empirical 2...

  2. Rare Earth Elements Distribution in Beryl

    International Nuclear Information System (INIS)

    El Gawish, H.K.; Nada, N.; Ghaly, W.A.; Helal, A.I.

    2012-01-01

    Laser ablation method is applied to a double focusing inductively coupled plasma mass spectrometer to determine the rare earth element distribution in some selected beryl samples. White, green and blue beryl samples are selected from the Egyptian eastern desert. Distributions of chondrite- normalized plot for the rare earth element in the selected beryl samples are investigated

  3. Omphalocele with Dextrocardia - A Rare Association

    OpenAIRE

    Vikal Chandra Shakya; C S Agrawal; N R Shrestha; K Dhungel; S Adhikary

    2009-01-01

    Omphalocele is frequently associated with many other congenital malformations. In cardiac anomalies, association of omphalocele with dextrocardia has been rarely noticed before. We present here a child with dextrocardia and omphalocele alongwith a brief review of the literature on this rare association. Key Words: congenital malformations, dextrocardia, omphalocele

  4. Rare thoracic cancers, including peritoneum mesothelioma

    NARCIS (Netherlands)

    Siesling, Sabine; van der Zwan, Jan Maarten; Izarzugaza, Isabel; Jaal, Jana; Treasure, Tom; Foschi, Roberto; Ricardi, Umberto; Groen, Harry; Tavilla, Andrea; Ardanaz, Eva

    Rare thoracic cancers include those of the trachea, thymus and mesothelioma (including peritoneum mesothelioma). The aim of this study was to describe the incidence, prevalence and survival of rare thoracic tumours using a large database, which includes cancer patients diagnosed from 1978 to 2002,

  5. Rare thoracic cancers, including peritoneum mesothelioma

    NARCIS (Netherlands)

    Siesling, Sabine; Zwan, J.M.V.D.; Izarzugaza, I.; Jaal, J.; Treasure, T.; Foschi, R.; Ricardi, U.; Groen, H.; Tavilla, A.; Ardanaz, E.

    2012-01-01

    Rare thoracic cancers include those of the trachea, thymus and mesothelioma (including peritoneum mesothelioma). The aim of this study was to describe the incidence, prevalence and survival of rare thoracic tumours using a large database, which includes cancer patients diagnosed from 1978 to 2002,

  6. Rare Earth Metals: Resourcefulness and Recovery

    Science.gov (United States)

    Wang, Shijie

    2013-10-01

    When we appreciate the digital revolution carried over from the twentieth century with mobile communication and the Internet, and when we enjoy our high-tech lifestyle filled with iDevices, hybrid cars, wind turbines, and solar cells in this new century, we should also appreciate that all of these advanced products depend on rare earth metals to function. Although there are only 136,000 tons of annual worldwide demand, (Cho, Rare Earth Metals, Will We Have Enough?)1 rare earth metals are becoming such hot commodities on international markets, due to not only to their increasing uses, including in most critical military hardware, but also to Chinese growth, which accounts for 95% of global rare earth metal production. Hence, the 2013 technical calendar topic, planned by the TMS/Hydrometallurgy and Electrometallurgy Committee, is particularly relevant, with four articles (including this commentary) contributed to the JOM October Issue discussing rare earth metals' resourcefulness and recovery.

  7. Family studies to find rare high risk variants in migraine.

    Science.gov (United States)

    Hansen, Rikke Dyhr; Christensen, Anne Francke; Olesen, Jes

    2017-12-01

    Migraine has long been known as a common complex disease caused by genetic and environmental factors. The pathophysiology and the specific genetic susceptibility are poorly understood. Common variants only explain a small part of the heritability of migraine. It is thought that rare genetic variants with bigger effect size may be involved in the disease. Since migraine has a tendency to cluster in families, a family approach might be the way to find these variants. This is also indicated by identification of migraine-associated loci in classical linkage-analyses in migraine families. A single migraine study using a candidate-gene approach was performed in 2010 identifying a rare mutation in the TRESK potassium channel segregating in a large family with migraine with aura, but this finding has later become questioned. The technologies of next-generation sequencing (NGS) now provides an affordable tool to investigate the genetic variation in the entire exome or genome. The family-based study design using NGS is described in this paper. We also review family studies using NGS that have been successful in finding rare variants in other common complex diseases in order to argue the promising application of a family approach to migraine. PubMed was searched to find studies that looked for rare genetic variants in common complex diseases through a family-based design using NGS, excluding studies looking for de-novo mutations, or using a candidate-gene approach and studies on cancer. All issues from Nature Genetics and PLOS genetics 2014, 2015 and 2016 (UTAI June) were screened for relevant papers. Reference lists from included and other relevant papers were also searched. For the description of the family-based study design using NGS an in-house protocol was used. Thirty-two successful studies, which covered 16 different common complex diseases, were included in this paper. We also found a single migraine study. Twenty-three studies found one or a few family specific

  8. Managing complications of fillers: Rare and not-so-rare

    Directory of Open Access Journals (Sweden)

    Eckart Haneke

    2015-01-01

    Full Text Available Fillers belong to the most frequently used beautifying products. They are generally well tolerated, but any one of them may occasionally produce adverse side effects. Adverse effects usually last as long as the filler is in the skin, which means that short-lived fillers have short-term side effects and permanent fillers may induce life-long adverse effects. The main goal is to prevent them, however, this is not always possible. Utmost care has to be given to the prevention of infections and the injection technique has to be perfect. Treatment of adverse effects is often with hyaluronidase or steroid injections and in some cases together with 5-fluorouracil plus allopurinol orally. Histological examination of biopsy specimens often helps to identify the responsible filler allowing a specific treatment to be adapted.

  9. Rare earths and rare earth alloys electrolytic preparation process and device for this process

    International Nuclear Information System (INIS)

    Seon, F.; Barthole, G.

    1986-01-01

    Electrolysis of a molten salt of rare earth or rare earth alloy for preparation of the metal or alloy is described. The molten salt bath comprises at least a rare earth chloride, at least an alkaline or alkaline earth chloride and at least an alkaline or alkaline earth fluoride [fr

  10. PATIENT-REPORTED OUTCOMES IN RARE LYSOSOMAL STORAGE DISEASES: KEY INFORMANT INTERVIEWS AND A SYSTEMATIC REVIEW PROTOCOL.

    Science.gov (United States)

    Miller, Patricia A; Mulla, Sohail M; Adams-Webber, Thomasin; Sivji, Yasmin; Guyatt, Gordon H; Johnston, Bradley C

    2016-01-01

    To investigate the use, challenges and opportunities associated with using patient-reported outcomes (PROs) in studies with patients with rare lysosomal storage diseases (LSDs), we conducted interviews with researchers and health technology assessment (HTA) experts, and developed the methods for a systematic review of the literature. The purpose of the review is to identify the psychometrically sound generic and disease-specific PROs used in studies with patients with five LSDs of interest: Fabry, Gaucher (Type I), Niemann-Pick (Type B) and Pompe diseases, and mucopolysaccharidosis (Types I and II). Researchers and HTA experts who responded to an email invitation participated in a telephone interview. We used qualitative content analysis to analyze the anonymized transcripts. We conducted a comprehensive literature search for studies that used PROs to investigate burden of disease or to assess the impact of interventions across the five LSDs of interest. Interviews with seven researchers and six HTA experts representing eight countries revealed five themes. These were: (i) the importance of using psychometrically sound PROs in studies with rare diseases, (ii) the paucity of disease-specific PROs, (iii) the importance of having PRO data for economic analyses, (iv) practical and psychometric limitations of existing PROs, and (v) suggestions for new PROs. The systematic review has been completed. The interviews highlight current challenges and opportunities experienced by researchers and HTA experts involved in work with rare LSDs. The ongoing systematic review will highlight the experience, opportunities, and limitations of PROs in LSDs and provide suggestions for future research.

  11. Direct current electroluminescence in rare-earth-doped zinc sulphide

    International Nuclear Information System (INIS)

    Bryant, F.J.; Krier, A.

    1984-01-01

    Some of the properties and characteristics of rare-earth-doped zinc sulphide DCEL devices are reported. Two types of devices are discussed, co-evaporated ZnS:RE thin films and ion implanted ZnS:RE single crystal diodes. The thin film devices exhibit bright DCEL of various colours at low applied voltages (typically approximately 12 V). A study of the spectral intensities and lifetimes of the Er 3+ ion in ZnS:Er 3+ thin films is consistent with a Boltzmann energy distribution amongst the conduction electrons present in these devices. The ZnS:RE single crystal diodes fabricated in this laboratory by ion implantation are also capable of various colour DCEL. By comparing the EL emission obtained from the different rare earth dopants, erbium and neodymium are identified as the most efficient luminescence centres. Further consideration of the EL emission spectra gives evidence for the presence of inter-conduction band hot electron transitions in those devices containing rare earth dopants which are inefficent electroluminescence centres. These findings can be explained in terms of Auger processes occurring in rare earth complexes. (author)

  12. Atresia of the bilateral pulmonary veins: a rare and dismal anomaly identified on cardiac CT

    Energy Technology Data Exchange (ETDEWEB)

    Goo, Hyun Woo; Park, Sang-Hyub; Koo, Hyun Jung; Cho, Young Hoon; Lee, Eunsol [University of Ulsan College of Medicine, Asan Medical Center, Department of Radiology and Research Institute of Radiology, Seoul (Korea, Republic of)

    2014-08-15

    Imaging findings of bilateral pulmonary vein atresia have not been described. To describe cardiac CT findings and clinical outcomes of bilateral pulmonary vein atresia. Three newborns with bilateral pulmonary vein atresia were encountered at our institution during a period of 8 years. We evaluated prenatal echocardiographic findings, clinical presentations, postnatal echocardiographic findings, chest radiographic findings, cardiac CT findings and clinical outcomes. All newborns presented immediately after birth with severe cyanosis, respiratory distress and acidosis that were unresponsive to medical management. Prenatal and postnatal echocardiographic studies and chest radiography were misleading, inconclusive or nonspecific in making the diagnosis in these children; however cardiac CT clearly demonstrated atresia of the bilateral pulmonary veins with multiple small mediastinal collateral veins and pulmonary edema. Surgical treatments were not feasible for this anomaly. Their clinical outcomes were universally dismal and all infants died within 3 days. Cardiac CT provides an accurate diagnosis of bilateral pulmonary vein atresia and leads to prompt treatment decision in these children. (orig.)

  13. Atresia of the bilateral pulmonary veins: a rare and dismal anomaly identified on cardiac CT

    International Nuclear Information System (INIS)

    Goo, Hyun Woo; Park, Sang-Hyub; Koo, Hyun Jung; Cho, Young Hoon; Lee, Eunsol

    2014-01-01

    Imaging findings of bilateral pulmonary vein atresia have not been described. To describe cardiac CT findings and clinical outcomes of bilateral pulmonary vein atresia. Three newborns with bilateral pulmonary vein atresia were encountered at our institution during a period of 8 years. We evaluated prenatal echocardiographic findings, clinical presentations, postnatal echocardiographic findings, chest radiographic findings, cardiac CT findings and clinical outcomes. All newborns presented immediately after birth with severe cyanosis, respiratory distress and acidosis that were unresponsive to medical management. Prenatal and postnatal echocardiographic studies and chest radiography were misleading, inconclusive or nonspecific in making the diagnosis in these children; however cardiac CT clearly demonstrated atresia of the bilateral pulmonary veins with multiple small mediastinal collateral veins and pulmonary edema. Surgical treatments were not feasible for this anomaly. Their clinical outcomes were universally dismal and all infants died within 3 days. Cardiac CT provides an accurate diagnosis of bilateral pulmonary vein atresia and leads to prompt treatment decision in these children. (orig.)

  14. Usefulness of the SNP microarray technology to identify rare mutations in the case of perinatal death

    DEFF Research Database (Denmark)

    Hoeffding, L. K.; Kock, K. F.; Johnsen, Iben Birgit Gade

    2015-01-01

    The single nucleotide polymorphism (SNP) microarray technology has emerged as a powerful tool to screen the whole genome for sub-microscopic duplications and deletions that are not detectable by traditional cytogenetic analysis. Case: We report a case of a female twin born at 27th week of gestation...

  15. Rare Decays Probing Physics Beyond the Standard Theory

    CERN Document Server

    Teubert, Frederic

    2016-01-01

    In the last 50 years we have seen how an initially ad-hoc and not widely accepted theory of the strong and electroweak interactions (Standard Theory: ST) has correctly predicted the entire accelerator based experimental observations with incredible accuracy (with the important exception of neutrino oscillation experiments). Decays of the ST particles (quarks and leptons), which are rare due to some symmetry of the theory, have played an important role in the formalism of the ST. These rare decays have been powerful tools to search for new particle interactions with the ST particles, which may not necessarily have the same symmetries. In this article, I will describe the indirect search for evidence of new physics (NP) using quark and lepton flavour changing neutral decays, which are highly suppressed within the ST, and constitute strong probes of potential new flavour structures.

  16. Recommendations for the tuning of rare event probability estimators

    International Nuclear Information System (INIS)

    Balesdent, Mathieu; Morio, Jérôme; Marzat, Julien

    2015-01-01

    Being able to accurately estimate rare event probabilities is a challenging issue in order to improve the reliability of complex systems. Several powerful methods such as importance sampling, importance splitting or extreme value theory have been proposed in order to reduce the computational cost and to improve the accuracy of extreme probability estimation. However, the performance of these methods is highly correlated with the choice of tuning parameters, which are very difficult to determine. In order to highlight recommended tunings for such methods, an empirical campaign of automatic tuning on a set of representative test cases is conducted for splitting methods. It allows to provide a reduced set of tuning parameters that may lead to the reliable estimation of rare event probability for various problems. The relevance of the obtained result is assessed on a series of real-world aerospace problems

  17. Rare species support vulnerable functions in high-diversity ecosystems.

    Science.gov (United States)

    Mouillot, David; Bellwood, David R; Baraloto, Christopher; Chave, Jerome; Galzin, Rene; Harmelin-Vivien, Mireille; Kulbicki, Michel; Lavergne, Sebastien; Lavorel, Sandra; Mouquet, Nicolas; Paine, C E Timothy; Renaud, Julien; Thuiller, Wilfried

    2013-01-01

    Around the world, the human-induced collapses of populations and species have triggered a sixth mass extinction crisis, with rare species often being the first to disappear. Although the role of species diversity in the maintenance of ecosystem processes has been widely investigated, the role of rare species remains controversial. A critical issue is whether common species insure against the loss of functions supported by rare species. This issue is even more critical in species-rich ecosystems where high functional redundancy among species is likely and where it is thus often assumed that ecosystem functioning is buffered against species loss. Here, using extensive datasets of species occurrences and functional traits from three highly diverse ecosystems (846 coral reef fishes, 2,979 alpine plants, and 662 tropical trees), we demonstrate that the most distinct combinations of traits are supported predominantly by rare species both in terms of local abundance and regional occupancy. Moreover, species that have low functional redundancy and are likely to support the most vulnerable functions, with no other species carrying similar combinations of traits, are rarer than expected by chance in all three ecosystems. For instance, 63% and 98% of fish species that are likely to support highly vulnerable functions in coral reef ecosystems are locally and regionally rare, respectively. For alpine plants, 32% and 89% of such species are locally and regionally rare, respectively. Remarkably, 47% of fish species and 55% of tropical tree species that are likely to support highly vulnerable functions have only one individual per sample on average. Our results emphasize the importance of rare species conservation, even in highly diverse ecosystems, which are thought to exhibit high functional redundancy. Rare species offer more than aesthetic, cultural, or taxonomic diversity value; they disproportionately increase the potential breadth of functions provided by ecosystems across

  18. Rare species support vulnerable functions in high-diversity ecosystems.

    Directory of Open Access Journals (Sweden)

    David Mouillot

    Full Text Available Around the world, the human-induced collapses of populations and species have triggered a sixth mass extinction crisis, with rare species often being the first to disappear. Although the role of species diversity in the maintenance of ecosystem processes has been widely investigated, the role of rare species remains controversial. A critical issue is whether common species insure against the loss of functions supported by rare species. This issue is even more critical in species-rich ecosystems where high functional redundancy among species is likely and where it is thus often assumed that ecosystem functioning is buffered against species loss. Here, using extensive datasets of species occurrences and functional traits from three highly diverse ecosystems (846 coral reef fishes, 2,979 alpine plants, and 662 tropical trees, we demonstrate that the most distinct combinations of traits are supported predominantly by rare species both in terms of local abundance and regional occupancy. Moreover, species that have low functional redundancy and are likely to support the most vulnerable functions, with no other species carrying similar combinations of traits, are rarer than expected by chance in all three ecosystems. For instance, 63% and 98% of fish species that are likely to support highly vulnerable functions in coral reef ecosystems are locally and regionally rare, respectively. For alpine plants, 32% and 89% of such species are locally and regionally rare, respectively. Remarkably, 47% of fish species and 55% of tropical tree species that are likely to support highly vulnerable functions have only one individual per sample on average. Our results emphasize the importance of rare species conservation, even in highly diverse ecosystems, which are thought to exhibit high functional redundancy. Rare species offer more than aesthetic, cultural, or taxonomic diversity value; they disproportionately increase the potential breadth of functions provided by

  19. Upper cervical bronchogenic cyst: A rare condition at a rare location

    Directory of Open Access Journals (Sweden)

    Ranjeet Kumar Jha

    2018-01-01

    Full Text Available Intraspinal bronchogenic cyst (SBC is a rare but important cause of spinal cord compression, commonly seen in the cervicothoracic spine. We report a case of a 43-year-old male, presenting with complaints of neck pain, radiating to right shoulder, with numbness of right hand and fingers. Magnetic resonance imaging of the cervical spine revealed an intradural extramedullary, ventral cystic lesion extending from C2 to C4 vertebral levels. Complete surgical excision was performed, and the patient had a complete relief of symptoms postoperatively. Only 11 cases of SBCs have been reported in literature. We discuss the peculiar location of this lesion, possible embryological reasons and the overall surgical outcome of SBC.

  20. New physics in CP asymmetries and rare B decays

    International Nuclear Information System (INIS)

    Gronau, M.; London, D.

    1997-01-01

    We review and update the effects of physics beyond the standard model on CP asymmetries in B decays. These asymmetries can be significantly altered if there are important new-physics contributions to B q 0 -B q 0 mixing. This same new physics will, therefore, also contribute to rare, flavor-changing B decays. Through a study of such decays, we show that it is possible to partially distinguish the different models of new physics. copyright 1997 The American Physical Society

  1. Random magnetism in amorphous rare-earth alloys (invited)

    Science.gov (United States)

    Sellmyer, D. J.; Nafis, S.

    1985-04-01

    Several aspects of the magnetic transitions seen in rare-earth metallic glasses are discussed, particularly with reference to recent theoretical work. These include: (a) apparent double transitions observed in Gd glasses where exchange fluctuations are important, (b) evidence for a correlated speromagnetic state recently predicted by Chudnovsky and Serota, and (c) the analysis of a Tb glass with strong random anisotropy in terms of an Ising-type spin-glass transition.

  2. Sensing Using Rare-Earth-Doped Upconversion Nanoparticles

    OpenAIRE

    Hao, Shuwei; Chen, Guanying; Yang, Chunhui

    2013-01-01

    Optical sensing plays an important role in theranostics due to its capability to detect hint biochemical entities or molecular targets as well as to precisely monitor specific fundamental psychological processes. Rare-earth (RE) doped upconversion nanoparticles (UCNPs) are promising for these endeavors due to their unique frequency converting capability; they emit efficient and sharp visible or ultraviolet (UV) luminescence via use of ladder-like energy levels of RE ions when excited at near ...

  3. Bifid mandibular canal: a rare or underestimated entity?

    Directory of Open Access Journals (Sweden)

    Ibrahim Nasseh

    2016-10-01

    Full Text Available One of the rare anatomical variations that can be of significant importance for the dentist is the bifid mandibular canal. Many complications can occur from this condition such as failure of anesthesia when performing inferior alveolar nerve block, difficulties during the surgical extraction of the third mandibular molar, and during implants placement. Therefore, good knowledge of this condition is essential. In this report, we describe the radiographic finding of a unilateral bifid mandibular canal.

  4. Understanding rare disease pathogenesis: a grand challenge for model organisms.

    Science.gov (United States)

    Hieter, Philip; Boycott, Kym M

    2014-10-01

    In this commentary, Philip Hieter and Kym Boycott discuss the importance of model organisms for understanding pathogenesis of rare human genetic diseases, and highlight the work of Brooks et al., "Dysfunction of 60S ribosomal protein L10 (RPL10) disrupts neurodevelopment and causes X-linked microcephaly in humans," published in this issue of GENETICS. Copyright © 2014 by the Genetics Society of America.

  5. Rare Copy Number Variants in a Population Based Investigation of Hypoplastic Right Heart Syndrome

    Science.gov (United States)

    Dimopoulos, Aggeliki; Sicko, Robert J.; Kay, Denise M.; Rigler, Shannon L.; Druschel, Charlotte M.; Caggana, Michele; Browne, Marilyn L.; Fan, Ruzong; Romitti, Paul A.; Brody, Lawrence C.; Mills, James L.

    2016-01-01

    Background Hypoplastic right heart syndrome (HRHS) is a rare congenital defect characterized by underdevelopment of the right heart structures commonly accompanied by an atrial septal defect. Familial HRHS reports suggest genetic factor involvement. We examined the role of copy number variants (CNVs) in HRHS. Methods We genotyped 32 HRHS cases identified from all New York State live births (1998–2005) using Illumina HumanOmni2.5 microarrays. CNVs were called with PennCNV and prioritized if they were ≥20Kb, contained ≥10 SNPs and had minimal overlap with CNVs from in-house controls, the Database of Genomic Variants, HapMap3 and CHOP database. Results We identified 28 CNVs in 17 cases; several encompassed genes important for right heart development. One case had a 2p16–2p23 duplication spanning LBH, a limb and heart development transcription factor. Lbh mis-expression results in right ventricular hypoplasia and pulmonary valve defects. This duplication also encompassed SOS1, a factor associated with pulmonary valve stenosis in Noonan syndrome. Sos1−/− mice display thin and poorly trabeculated ventricles. In another case, we identified a 1.5Mb deletion associated with Williams Beuren syndrome, a disorder that includes valvular malformations. A third case had a 24Kb deletion upstream of the TGFβ ligand ITGB8. Embryos genetically null for Itgb8, and its intracellular interactant Band 4.1B, display lethal cardiac phenotypes. Conclusions To our knowledge, this is the first study of CNVs in HRHS. We identified several rare CNVs that overlap genes related to right ventricular wall and valve development, suggesting that genetics plays a role in HRHS and providing clues for further investigation. PMID:28009100

  6. Analyzing rare diseases terms in biomedical terminologies

    Directory of Open Access Journals (Sweden)

    Erika Pasceri

    2012-03-01

    Full Text Available Rare disease patients too often face common problems, including the lack of access to correct diagnosis, lack of quality information on the disease, lack of scientific knowledge of the disease, inequities and difficulties in access to treatment and care. These things could be changed by implementing a comprehensive approach to rare diseases, increasing international cooperation in scientific research, by gaining and sharing scientific knowledge about and by developing tools for extracting and sharing knowledge. A significant aspect to analyze is the organization of knowledge in the biomedical field for the proper management and recovery of health information. For these purposes, the sources needed have been acquired from the Office of Rare Diseases Research, the National Organization of Rare Disorders and Orphanet, organizations that provide information to patients and physicians and facilitate the exchange of information among different actors involved in this field. The present paper shows the representation of rare diseases terms in biomedical terminologies such as MeSH, ICD-10, SNOMED CT and OMIM, leveraging the fact that these terminologies are integrated in the UMLS. At the first level, it was analyzed the overlap among sources and at a second level, the presence of rare diseases terms in target sources included in UMLS, working at the term and concept level. We found that MeSH has the best representation of rare diseases terms.

  7. A rare case of unifocal, unilateral pigmented paravenous retinochoroidal atrophy (PPRCA

    Directory of Open Access Journals (Sweden)

    Meleha Ahmad

    2016-12-01

    Conclusions and importance: PPRCA is typically bilateral and symmetric, affecting primarily the outer retina and choroid. However, in rare cases, this disease can present unilaterally and/or unifocally, with degeneration extending to the inner retinal layers.

  8. Thermochemistry of rare-earth trifluorides

    International Nuclear Information System (INIS)

    Kim, K.Y.; Johnson, C.E.

    1981-01-01

    Using the most recent crystallographic data, the Born-Lande equation was employed to calculate lattice energies of the rare-earth trifluorides. The excellent agreement ( 0 sub(f)(MX 3 ,c,298.15K) can be estimated. The magnitude of the monotonic change of ΔH 0 sub(f)(MX 3 ) for the rare-earth trihalides series (14 4f electrons) is comparable to the energy change between Sc and Ti in which only one 3d electron is added. This energy change is consistent with the chemical evidence that the electrons in the f-orbitals of rare earths contribute negligibly to the bonding. (author)

  9. Ecology and exploration of the rare biosphere.

    Science.gov (United States)

    Lynch, Michael D J; Neufeld, Josh D

    2015-04-01

    The profound influence of microorganisms on human life and global biogeochemical cycles underlines the value of studying the biogeography of microorganisms, exploring microbial genomes and expanding our understanding of most microbial species on Earth: that is, those present at low relative abundance. The detection and subsequent analysis of low-abundance microbial populations—the 'rare biosphere'—have demonstrated the persistence, population dynamics, dispersion and predation of these microbial species. We discuss the ecology of rare microbial populations, and highlight molecular and computational methods for targeting taxonomic 'blind spots' within the rare biosphere of complex microbial communities.

  10. Recovery of rare earths from red mud

    International Nuclear Information System (INIS)

    Bautista, R.G.

    1992-01-01

    The prospect for the recovery of rare earths from red mud, the bauxite tailings from the production of alumina is examined. The Jamaican red mud by far has the higher trace concentrations of lanthanum, cerium, neodymium, and yttrium. Scandium is also present. The dissolution of the rare earth is a major extraction problem because of the large volume of other materials. The recovery processes that have been proposed include the production of co-products such as iron, alumina, and titanium concentrates, with the rare earths going with the titanium. In this paper a critical examination of the possible processes are presented with the recommended research projects to be carried out

  11. Bilateral olecranon bursitis – A rare clinical presentation of gout

    Directory of Open Access Journals (Sweden)

    Betul Sargın

    2018-04-01

    Full Text Available Background: Gout is the most common form of crystal arthropathy. Monoarthritis affecting the first metatarsophalangeal joint is the common initial presentation. Bilateral olecranon bursitis is a rare presentation of gout. Aim of the work: To describe the clinical features of bilateral olecranon bursitis as an initial presentation of gout. Case report: A 62-year old male patient presented to the rheumatology clinic , Adnan Menderes University with sudden bilateral elbow pain and swelling for three months . Swellings gradually increased to the size of a golf ball with minimal restriction in the elbow extension (170°. He didn’t have arthritis in the elbows. The patient had medical history of heart failure and chronic obstructive pulmonary disease and medications received included acetylsalicylic acid and diuretics. Blood tests revealed elevated serum uric acid (12.6 mg/dL, with normal renal function tests, erythrocyte sedimentation rate (ESR 43 mm/h and C-reactive protein (CRP 8.8 mg/L. Rheumatoid factor and hepatitis markers were negative. Diagnostic bursal aspiration excluded septic bursitis and under polarized microscopy monosodium urate (MSU crystals were identified with typical negative birefringence. A diagnosis of gout was established. ESR and CRP were normalized after diclofenac potassium (100 mg and colchicine (1.5 mg. Allopurinol 300 mg was added when his joint pain was relieved. Conclusion: This is the first gout case initially presenting with bilateral olecranon bursitis. Bursal fluid analysis is important in such atypical presentation to look for MSU crystals and establish a diagnosis. Keywords: Olecranon bursitis, Gout, Crystal arthropathy, Monosodium urate

  12. Research on manufacturing aluminum - rare earth alloy with a high content of rare earth (> 20% RE) from total rare earth oxides by thermit reduction

    International Nuclear Information System (INIS)

    Ngo Trong Hiep; Dam Van Tien; Tran Duy Hai; Ngo Xuan Hung and Ly Thanh Vu

    2004-01-01

    In this report, several theoretical principles of thermit reduction method used for metal oxides to obtain metals, ferroalloys and ligatua with technical purity are presented. Manufacture of aluminum-rare earth alloys by thermit reduction is also described in the report. Data that are generalized based on thermo-kinetic calculation of the thermit reduction and selection of technological flow-sheet based on thermal effect will partly clarify research results in investigating typical features of the process and identify measures to reduce metal loss in discharged slags. (author)

  13. Developing alternative resources of rare earth elements in Europe - EURARE and the red mud challenge

    Science.gov (United States)

    Deady, Eimear; Mouchos, Evangelos; Goodenough, Kathryn; Wall, Frances; Williamson, Ben

    2015-04-01

    Rare earth elements (REE) are considered to be highly "critical" by the European Commission [1], owing to the concentration of global supply [2] and their use in a wide range of emerging technologies (e.g. smart phones, electric cars and wind turbines). The main source of REE is the mineral bastnäsite, which is primarily extracted from carbonatites. Alternative resources of REE have been identified in a variety of other environments such as alluvial placers, bauxites and ore tailings. The EURARE project (www.eurare.eu), funded by the European Commission, aims to improve understanding of potential REE resources in Europe with the overall objective of establishing the basis for a European REE industry. As a part of this project, alternative sources of rare earth elements in Europe are being considered. REE have been identified as being particularly enriched in karst-bauxites and hence in the red muds generated as a waste product from the processing of these bauxites to alumina through the Bayer process [3]. Karst-bauxites are widely distributed with deposits known across the Mediterranean and with intermittent exploitation occurring over many decades. REE become concentrated in the bauxite deposits by the bauxitisation process and are retained due to the geochemical barrier created by the limestone bedrock below. This can result in several processes, including the crystallisation of authigenic REE-bearing minerals, the accumulation of residual phases and the adsorption of ions onto clays and other mineral surfaces [4]. Red muds produced from alumina processing represent a potentially important concentration of REE as it has been demonstrated that the REE pass through the alumina extraction process into the waste, and the total REE concentrations are typically enriched by a factor of two compared with the original bauxite ore [5]. Bauxites and red muds from the Parnassus Ghiona region of Greece [6] and the Seydişehir-Akseki region of Turkey have been assessed as

  14. Functionally significant, rare transcription factor variants in tetralogy of Fallot.

    Directory of Open Access Journals (Sweden)

    Ana Töpf

    Full Text Available Rare variants in certain transcription factors involved in cardiac development cause Mendelian forms of congenital heart disease. The purpose of this study was to systematically assess the frequency of rare transcription factor variants in sporadic patients with the cardiac outflow tract malformation tetralogy of Fallot (TOF.We sequenced the coding, 5'UTR, and 3'UTR regions of twelve transcription factor genes implicated in cardiac outflow tract development (NKX2.5, GATA4, ISL1, TBX20, MEF2C, BOP/SMYD1, HAND2, FOXC1, FOXC2, FOXH, FOXA2 and TBX1 in 93 non-syndromic, non-Mendelian TOF cases. We also analysed Illumina Human 660W-Quad SNP Array data for copy number variants in these genes; none were detected. Four of the rare variants detected have previously been shown to affect transactivation in in vitro reporter assays: FOXC1 p.P297S, FOXC2 p.Q444R, FOXH1 p.S113T and TBX1 p.P43_G61del PPPPRYDPCAAAAPGAPGP. Two further rare variants, HAND2 p.A25_A26insAA and FOXC1 p.G378_G380delGGG, A488_491delAAAA, affected transactivation in in vitro reporter assays. Each of these six functionally significant variants was present in a single patient in the heterozygous state; each of the four for which parental samples were available were maternally inherited. Thus in the 93 TOF cases we identified six functionally significant mutations in the secondary heart field transcriptional network.This study indicates that rare genetic variants in the secondary heart field transcriptional network with functional effects on protein function occur in 3-13% of patients with TOF. This is the first report of a functionally significant HAND2 mutation in a patient with congenital heart disease.

  15. A variational Bayes discrete mixture test for rare variant association.

    Science.gov (United States)

    Logsdon, Benjamin A; Dai, James Y; Auer, Paul L; Johnsen, Jill M; Ganesh, Santhi K; Smith, Nicholas L; Wilson, James G; Tracy, Russell P; Lange, Leslie A; Jiao, Shuo; Rich, Stephen S; Lettre, Guillaume; Carlson, Christopher S; Jackson, Rebecca D; O'Donnell, Christopher J; Wurfel, Mark M; Nickerson, Deborah A; Tang, Hua; Reiner, Alexander P; Kooperberg, Charles

    2014-01-01

    Recently, many statistical methods have been proposed to test for associations between rare genetic variants and complex traits. Most of these methods test for association by aggregating genetic variations within a predefined region, such as a gene. Although there is evidence that "aggregate" tests are more powerful than the single marker test, these tests generally ignore neutral variants and therefore are unable to identify specific variants driving the association with phenotype. We propose a novel aggregate rare-variant test that explicitly models a fraction of variants as neutral, tests associations at the gene-level, and infers the rare-variants driving the association. Simulations show that in the practical scenario where there are many variants within a given region of the genome with only a fraction causal our approach has greater power compared to other popular tests such as the Sequence Kernel Association Test (SKAT), the Weighted Sum Statistic (WSS), and the collapsing method of Morris and Zeggini (MZ). Our algorithm leverages a fast variational Bayes approximate inference methodology to scale to exome-wide analyses, a significant computational advantage over exact inference model selection methodologies. To demonstrate the efficacy of our methodology we test for associations between von Willebrand Factor (VWF) levels and VWF missense rare-variants imputed from the National Heart, Lung, and Blood Institute's Exome Sequencing project into 2,487 African Americans within the VWF gene. Our method suggests that a relatively small fraction (~10%) of the imputed rare missense variants within VWF are strongly associated with lower VWF levels in African Americans.

  16. Challenges of developing and conducting clinical trials in rare disorders.

    Science.gov (United States)

    Kempf, Lucas; Goldsmith, Jonathan C; Temple, Robert

    2018-04-01

    Rare disease drug development is a rapidly expanding field. Clinical researchers in rare diseases face many challenges when conducting trials in small populations. Disease natural history is often poorly understood and the ability to detect clinically meaningful outcomes requires understanding of their rate of occurrence and variability, both of which contribute to difficulties in powering a study. Standard trial designs are not optimized to obtain adequate safety and efficacy data from small numbers of patients, so alternative designs (enrichment, crossover, adaptive, N-of 1) need to be considered. The affected patients can be hard to identify, especially early in the course of their disease, are generally geographically dispersed, and are often children. Trials are frequently conducted on an international scale and may be subject to complex or multiple regulatory agency oversights and may be affected by local customs, cultures, and practices. A basic understanding of the FDA programs supporting development of drugs for rare diseases is provided by this review and the role of early consultation with the FDA is emphasized. Of recent FDA New Molecular Entities (NME) approvals, 41% (17 approvals) in 2014, 47% (21 approvals) in 2015, and 41% (9 approvals) in 2016 were for rare disease indications. Through effective interactions and collaborations with physicians, institutions, and patient groups, sponsors have been successful in bringing new treatments to market for individuals affected by rare diseases. Challenges to drug development have been overcome through the focused efforts of patients/families, non-profit patient advocacy groups, drug developers, and regulatory authorities. © 2017 Wiley Periodicals, Inc.

  17. Investigation of the role of TCF4 rare sequence variants in schizophrenia.

    Science.gov (United States)

    Basmanav, F Buket; Forstner, Andreas J; Fier, Heide; Herms, Stefan; Meier, Sandra; Degenhardt, Franziska; Hoffmann, Per; Barth, Sandra; Fricker, Nadine; Strohmaier, Jana; Witt, Stephanie H; Ludwig, Michael; Schmael, Christine; Moebus, Susanne; Maier, Wolfgang; Mössner, Rainald; Rujescu, Dan; Rietschel, Marcella; Lange, Christoph; Nöthen, Markus M; Cichon, Sven

    2015-07-01

    Transcription factor 4 (TCF4) is one of the most robust of all reported schizophrenia risk loci and is supported by several genetic and functional lines of evidence. While numerous studies have implicated common genetic variation at TCF4 in schizophrenia risk, the role of rare, small-sized variants at this locus-such as single nucleotide variants and short indels which are below the resolution of chip-based arrays requires further exploration. The aim of the present study was to investigate the association between rare TCF4 sequence variants and schizophrenia. Exon-targeted resequencing was performed in 190 German schizophrenia patients. Six rare variants at the coding exons and flanking sequences of the TCF4 gene were identified, including two missense variants and one splice site variant. These six variants were then pooled with nine additional rare variants identified in 379 European participants of the 1000 Genomes Project, and all 15 variants were genotyped in an independent German sample (n = 1,808 patients; n = 2,261 controls). These data were then analyzed using six statistical methods developed for the association analysis of rare variants. No significant association (P power analyses suggest that further research into the possible involvement of rare TCF4 sequence variants in schizophrenia risk is warranted by the assessment of larger cohorts with higher statistical power to identify rare variant associations. © 2015 Wiley Periodicals, Inc.

  18. Rare Complications of Cervical Spine Surgery: Horner's Syndrome.

    Science.gov (United States)

    Traynelis, Vincent C; Malone, Hani R; Smith, Zachary A; Hsu, Wellington K; Kanter, Adam S; Qureshi, Sheeraz A; Cho, Samuel K; Baird, Evan O; Isaacs, Robert E; Rahman, Ra'Kerry K; Polevaya, Galina; Smith, Justin S; Shaffrey, Christopher; Tortolani, P Justin; Stroh, D Alex; Arnold, Paul M; Fehlings, Michael G; Mroz, Thomas E; Riew, K Daniel

    2017-04-01

    A multicenter retrospective case series. Horner's syndrome is a known complication of anterior cervical spinal surgery, but it is rarely encountered in clinical practice. To better understand the incidence, risks, and neurologic outcomes associated with Horner's syndrome, a multicenter study was performed to review a large collective experience with this rare complication. We conducted a retrospective multicenter case series study involving 21 high-volume surgical centers from the AOSpine North America Clinical Research Network. Medical records for 17 625 patients who received subaxial cervical spine surgery from 2005 to 2011 were reviewed to identify occurrence of 21 predefined treatment complications. Descriptive statistics were provided for baseline patient characteristics. Paired t test was used to analyze changes in clinical outcomes at follow-up compared to preoperative status. In total, 8887 patients who underwent anterior cervical spine surgery at the participating institutions were screened. Postoperative Horner's syndrome was identified in 5 (0.06%) patients. All patients experienced the complication following anterior cervical discectomy and fusion. The sympathetic trunk appeared to be more vulnerable when operating on midcervical levels (C5, C6), and most patients experienced at least a partial recovery without further treatment. This collective experience suggests that Horner's syndrome is an exceedingly rare complication following anterior cervical spine surgery. Injury to the sympathetic trunk may be limited by maintaining a midline surgical trajectory when possible, and performing careful dissection and retraction of the longus colli muscle when lateral exposure is necessary, especially at caudal cervical levels.

  19. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  20. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.