WorldWideScience

Sample records for identifying important issues

  1. Important Issues in Ecotoxicological Investigations Using Earthworms.

    Science.gov (United States)

    Velki, Mirna; Ečimović, Sandra

    The importance and beneficial effects of earthworms on soil structure and quality is well-established. In addition, earthworms have proved to be important model organisms for investigation of pollutant effects on soil ecosystems. In ecotoxicological investigations effects of various pollutants on earthworms were assessed. But some important issues regarding the effects of pollutants on earthworms still need to be comprehensively addressed. In this review several issues relevant to soil ecotoxicological investigations using earthworms are emphasized and guidelines that should be adopted in ecotoxicological investigations using earthworms are given. The inclusion of these guidelines in ecotoxicological studies will contribute to the better quantification of impacts of pollutants and will allow more accurate prediction of the real field effects of pollutants to earthworms.

  2. Leading change: 1--identifying the issue.

    Science.gov (United States)

    Kerridge, Joanna

    To enable sustainable change, nurses need to take the lead in managing it. Recent national initiatives have emphasised the importance of frontline staff in service improvement. The ability to influence and manage change has been identified as an essential skill for delivering new models of care. This article is the first in a three-part series designed to help nurses at all levels develop the knowledge and skills they will need to initiate and manage change. This article focuses on identifying what needs to be changed and why.

  3. Identifying Crucial Issues in Climate Science

    Science.gov (United States)

    Ikeda, Motoyoshi; Greve, Ralf; Hara, Toshika; Watanabe, Yutaka W.; Ohmura, Atsumu; Ito, Akihiko; Kawamiya, Michio

    2009-01-01

    Drastic Change in the Earth System During Global Warming; Sapporo, Japan, 24 June 2008; The Nobel Peace Prize awarded to the Intergovernmental Panel on Climate Change (IPCC) and former U.S. vice president Al Gore indicates that global warming is recognized as a real phenomenon critical to human beings. However, humanity's knowledge concerning global warming is based on an uncertainty larger than 50% in the warming rate during the past century. Therefore, scientific clarification is needed to understand important mechanisms that potentially produce positive feedbacks in the Earth system-such mechanisms must be better understood before scientists can develop more reliable predictions. To plan for the future, a symposium was organized at Japan's Hokkaido University in association with the G8 Summit, where the most recent updates on the five urgent issues in climate science were discussed. These issues, considered to be crucial as severe impacts on human society continue to rise, included (1) causes and magnitude of sea level rise; (2) decay of glaciers and the Greenland and Antarctic ice sheets; (3) disappearance of the summer Arctic sea ice; (4) carbon uptake or emission by the terrestrial ecosystem; and (5) marine ecosystem change resulting in carbon emissions.

  4. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  5. Imports/exports issues and options : discussion paper

    International Nuclear Information System (INIS)

    2001-01-01

    The Alberta marketplace is ideally located for connections to British Columbia, the Pacific Northwest, Saskatchewan, Manitoba and the Mid-Continental Area Power Pool (MAPP). Alignment with other markets becomes an important issue and provides challenges that must be overcome. It provides an opportunity for expanded trade in Alberta based loads and generation. The Real Time (RT) market for the trading of physical, dispatchable energy and the forwards markets (financial and intended to go to delivery through the RT market) are comprised in the Alberta marketplace. The development of a complete marketplace for electricity is fully supported by the Power Poll of Alberta. Developments in those two markets allow greater opportunity for a review of the interconnections in the Alberta electricity market. In this document, an attempt is made to identify issues relating to the imports and exports and develop alternative mechanisms to resolve these issues. Three main objectives were put forth: identify a better mechanism to meet the requirements of the Pool Price Deficiency Regulation (PPDR), identify a better mechanism to allow imports and exports to participate in the Alberta market that takes into consideration the impact of transmission constraints, and to better align with external markets. An hour ahead firm market for interconnections was one option that addresses the issues under consideration

  6. Identifying Human Factors Issues in Aircraft Maintenance Operations

    Science.gov (United States)

    Veinott, Elizabeth S.; Kanki, Barbara G.; Shafto, Michael G. (Technical Monitor)

    1995-01-01

    Maintenance operations incidents submitted to the Aviation Safety Reporting System (ASRS) between 1986-1992 were systematically analyzed in order to identify issues relevant to human factors and crew coordination. This exploratory analysis involved 95 ASRS reports which represented a wide range of maintenance incidents. The reports were coded and analyzed according to the type of error (e.g, wrong part, procedural error, non-procedural error), contributing factors (e.g., individual, within-team, cross-team, procedure, tools), result of the error (e.g., aircraft damage or not) as well as the operational impact (e.g., aircraft flown to destination, air return, delay at gate). The main findings indicate that procedural errors were most common (48.4%) and that individual and team actions contributed to the errors in more than 50% of the cases. As for operational results, most errors were either corrected after landing at the destination (51.6%) or required the flight crew to stop enroute (29.5%). Interactions among these variables are also discussed. This analysis is a first step toward developing a taxonomy of crew coordination problems in maintenance. By understanding what variables are important and how they are interrelated, we may develop intervention strategies that are better tailored to the human factor issues involved.

  7. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  8. Topic A. Have all the relevant issues been identified

    International Nuclear Information System (INIS)

    Bernero, R.M.

    1994-01-01

    This work is an answer to the question : have all the relevant issues been identified? The author tries to answer more particularly to the following three points : 1) can risk or responsibility for action be imposed on future generations. 2) Are current safety norms suitable for the future? 3) what controls are appropriate for inter generational cost/benefit evaluations. (O.L.)

  9. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  10. Important issues for perioperative systemic antimicrobial prophylaxis in surgery

    NARCIS (Netherlands)

    Sinha, Bhanu; van Assen, Sander; Friedrich, Alexander W.

    PURPOSE OF REVIEW: Prevention of surgical site infections is a key issue to patient safety and the success of surgical interventions. Systemic antimicrobial prophylaxis is one important component of a perioperative infection prevention bundle. This review focuses on selected recent developments and

  11. Privatisation electric power sector in Pakistan: some important issues

    International Nuclear Information System (INIS)

    Ghafoor, A.; Weiss, J.

    1998-01-01

    This discussion paper highlights important issues relating to the privatisation of Pakistan's electric power sector. Salient features of the electric power sector in Pakistan, factors affecting the economic performance of this sector, the partial privatisation policy adopted by Pakistan, ongoing private power projects, and current privatisation policy are examined. The arguments for competition are raised, and alternative policy reforms the are considered

  12. Post discharge issues identified by a call-back program: identifying improvement opportunities.

    Science.gov (United States)

    Ojeda, Patricia I; Kara, Areeba

    2017-12-01

    The period following discharge from the hospital is one of heightened vulnerability. Discharge instructions serve as a guide during this transition. Yet, clinicians receive little feedback on the quality of this document that ties into the patients' experience. We reviewed the issues voiced by discharged patients via a call-back program and compared them to the discharge instructions they had received. At our institution, patients receive an automated call forty-eight hours following discharge inquiring about progress. If indicated by the response to the call, they are directed to a nurse who assists with problem solving. We reviewed the nursing documentation of these encounters for a period of nine months. The issues voiced were grouped into five categories: communication, medications, durable medical equipment/therapies, follow up and new or ongoing symptoms. The discharge instructions given to each patient were reviewed. We retrieved data on the number of discharges from each specialty from the hospital over the same period. A total of 592 patients voiced 685 issues. The numbers of patients discharged from medical or surgical services identified as having issues via the call-back line paralleled the proportions discharged from medical and surgical services from the hospital during the same period. Nearly a quarter of the issues discussed had been addressed in the discharge instructions. The most common category of issues was related to communication deficits including missing or incomplete information which made it difficult for the patient to enact or understand the plan of care. Medication prescription related issues were the next most common. Resource barriers and questions surrounding medications were often unaddressed. Post discharge issues affect patients discharged from all services equally. Data from call back programs may provide actionable targets for improvement, identify the inpatient team's 'blind spots' and be used to provide feedback to clinicians.

  13. Issues in identifying germ tube positive yeasts by conventional methods.

    Science.gov (United States)

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  14. A scoping review identifying contemporary issues in rural nursing leadership.

    Science.gov (United States)

    Bish, Melanie; Kenny, Amanda; Nay, Rhonda

    2012-12-01

    Rural nurse leaders on a global scale are being challenged to create structures and processes to enable excellence in nursing care. The purpose of this scoping review is to offer an indication of the available literature relating to contemporary issues in rural nursing leadership. A review of contemporary issues facing rural nurse leaders is timely to assist strategy development that will achieve the goal of excellence in nursing. An interpretative scoping literature review methodological framework has been used with an emphasis on thematic construction. Literature published between 2008 and 2012 was reviewed from five electronic databases using the key words rural, nursing, and leadership. Four themes have been identified: expectations of rural nursing leadership, a highly educated workforce, competing interests, and partnering within rural healthcare systems. The content may resonate with rural nurse leaders and encourage a greater awareness of their relevance to leadership practices. The findings provide a greater awareness and understanding of contemporary issues facing rural nurse leaders and may assist with the development of context-sensitive leadership strategies to facilitate excellence in nursing care. © 2012 Sigma Theta Tau International.

  15. Some important issues in evaluating the availability of passive systems

    International Nuclear Information System (INIS)

    Kafka, P.; Kelemen, I.; Krzykacz, B.

    1993-01-01

    In some countries new reactor concepts based on a broader use of passive safety features are under development. The term 'passive' as used here refers to systems which rely heavily on natural heat transfer process such as natural circulation to perform their function rather than on decidedly 'active' components like pumps. The paper deals with important issues in evaluating the availability of passive systems, e.g. the assessment of the active components, the assessment of passive components and structures and the probabilistic assessment of the physical function of the natural processes. Based on an outlined assessment process for the entire system and on an exercised simulation process for the assessment of passive components e.g. pipes insights and important issues are presented. A follow-up study will refine and expand the concept to a full scope assessment procedure of passive systems. (author)

  16. Neutrino physics today, important issues and the future

    Energy Technology Data Exchange (ETDEWEB)

    Parke, Stephen J.; /Fermilab

    2010-10-01

    The status and the most important issues in neutrino physics will be summarized as well as how the current, pressing questions will be addressed by future experiments. Since the discovery of neutrino flavor transitions by the SuperKamiokande experiment in 1998, which demonstrates that neutrinos change and hence their clocks tick, i.e. they are not traveling at the speed of light and hence are not massless, the field of neutrino physics has made remarkable progress in untangling the nature of the neutrino. However, there are still many important questions to answer.

  17. Performance testing of supercapacitors: Important issues and uncertainties

    Science.gov (United States)

    Zhao, Jingyuan; Gao, Yinghan; Burke, Andrew F.

    2017-09-01

    Supercapacitors are a promising technology for high power energy storage, which have been used in some industrial and vehicles applications. Hence, it is important that information concerning the performance of supercapacitors be detailed and reliable so system designers can make rational decisions regarding the selection of the energy storage components. This paper is concerned with important issues and uncertainties regarding the performance testing of supercapacitors. The effect of different test procedures on the measured characteristics of both commercial and prototype supercapacitors including hybrid supercapacitors have been studied. It was found that the test procedure has a relatively minor effect on the capacitance of carbon/carbon devices and a more significant effect on the capacitance of hybrid supercapacitors. The device characteristic with the greatest uncertainty is the resistance and subsequently the claimed power capability of the device. The energy density should be measured by performing constant power discharges between appropriate voltage limits. This is particularly important in the case of hybrid supercapacitors for which the energy density is rate dependent and the simple relationship E = ½CV2 does not yield accurate estimates of the energy stored. In general, most of the important issues for testing carbon/carbon devices become more serious for hybrid supercapacitors.

  18. Important issues in disposal of L/ILW

    International Nuclear Information System (INIS)

    McCombie, C.

    1987-01-01

    Today waste disposal is a challenging technical and political issue. In many countries the acceptance of nuclear power has been tied formally or informally to the convincing demonstration that we can dispose of all radioactive wastes with a very high degree of safety exceeding the expected for other toxic or hazardous wastes. The importance of the public acceptance aspects and the more obviously striking characteristics of high-level wastes (HLW) - in particular their high initial radiation, their heat emission and their long decay times - led to an early concentration of effort on planning and analyzing HLW disposal. On the other hand, the problems of disposing of low- and inter-mediate-level wastes (L/ILW) are in many ways more immediate. These wastes are arising today in quantities which can make continued storge troublesome; accordingly increased effort is being expended in many countries on organizing the safe, final disposal of L/ILW. Some of the technical issues of importance which arise in the corresponding planning and analysis of repository projects for L/ILW are discussed in this paper

  19. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  20. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  1. Preservation of Agricultural Land as an Issue of Societal Importance

    Directory of Open Access Journals (Sweden)

    Elin Slätmo

    2017-12-01

    Full Text Available Based on concerns about food security and food sovereignty, it is appropriate to scrutinise societal measures for protecting agricultural land from conversion to other uses. Changes from agricultural to urban land use are particularly problematic, as they are largely irreversible. By analysing relevant Swedish policy, the present study investigated how the protection of agricultural land is framed as an issue of societal importance. Protection of agricultural land is enshrined in Swedish law, but its use is still continually changing to housing and other constructions. In a structured policy analysis, two questions were examined: (1 what are the societal motives for protecting agricultural land in Sweden, and (2 how do these motives influence the governance of agricultural land? The meaning of ‘national importance’, ‘suitable for cultivation’ and ‘significant national interests’ in Swedish land-use law was also analysed. The results showed that formulations in the law reflect the ambivalent discourses on agricultural land preservation and that the Swedish authorities view other land uses as more important than agriculture. The Swedish governance system is currently built on trust that municipal institutions will make satisfactory decisions concerning land and water use. However, it has been shown that these decisions have not been satisfactory concerning the protection of agricultural land, and it is important to acknowledge that the sum of local decisions can be degrading for these life-supporting resources. The present analysis revealed a looming conflict between the preservation of soils for food production, on one hand, and local participation in decision making, on the other. This raises the question of whether it is more important to defend subsidiarity or to preserve certain resources which are important for food security, such as agricultural land.

  2. Socioscientific issues: topics and importance to the scientific education

    Directory of Open Access Journals (Sweden)

    Díaz Moreno, Naira;

    2012-01-01

    Full Text Available Socioscientific debates arise and become widespread concerning the most popular and innovative issues in our society: transgenics, homeopathy, the impact of mobile phone network and so on. For this reason we believe it is important to analyse the meaning of these debates and the relationship between information processing in newspapers and teaching literature and to determine their possible use in a school context. The common image of scientific news that tends to appear in the media hampers its use in the classroom. On analysing didactic literature, we have selected activities that can be used as a model to plan debates in the science classroom with the objective of developing a series of capacities in students related to scientific literacy, critical thinking and the promotion of a scientific culture.

  3. Consideration of important technical issues for advanced light water reactors

    International Nuclear Information System (INIS)

    Thadani, A.C.; Perch, R.L.

    1993-01-01

    Early in the design and review process of the Advanced Light Water Reactors (ALWR), the US Nuclear Regulatory Commission (NRC) in recognition of the importance of defense-in-depth focused its attention on lessons learned from the operating experience, research and other studies as well as addressing the challenges from severe accidents. The Commission issued the Policy Statement on Safety Goals for the Operations of Nuclear Power Plants on August 4, 1986. This policy statement focused on the risks to the public from nuclear power plant operations with the objective of establishing goals that broadly define an acceptable level of radiological risk that might be imposed on the public as a result of nuclear power plant operation. The Commission recognizes the importance of mitigating the consequences of a core-melt accident and continues to emphasize features such as containment and siting in less populated areas as integral parts of the defense-in-depth concept associated with its accident prevention and mitigation philosophy. In its Severe Accident Policy statement, the Commission expressed its expectation that vendors engage in designing new standard plants should address severe accidents during the design stage to take full advantage of insights gained by providing design features to further reduce the likelihood of severe accidents from occurring and, in the unlikely occurrence of a severe accident, mitigating their consequences. Incorporating insights and design features during the design phase can be cost effective when compared to modifications to existing plants. The staff has used this guidance to apply defense-in-depth philosophy in focusing attention on severe accident considerations. This paper discusses some of the key prevention and mitigation issues the NRC has focused its efforts, including emerging technologies being applied to new reactor designs

  4. Obtaining subjects' consent to publish identifying personal information: current practices and identifying potential issues.

    Science.gov (United States)

    Yoshida, Akiko; Dowa, Yuri; Murakami, Hiromi; Kosugi, Shinji

    2013-11-25

    In studies publishing identifying personal information, obtaining consent is regarded as necessary, as it is impossible to ensure complete anonymity. However, current journal practices around specific points to consider when obtaining consent, the contents of consent forms and how consent forms are managed have not yet been fully examined. This study was conducted to identify potential issues surrounding consent to publish identifying personal information. Content analysis was carried out on instructions for authors and consent forms developed by academic journals in four fields (as classified by Journal Citation Reports): medicine general and internal, genetics and heredity, pediatrics, and psychiatry. An online questionnaire survey of editors working for journals that require the submission of consent forms was also conducted. Instructions for authors were reviewed for 491 academic journals (132 for medicine general and internal, 147 for genetics and heredity, 100 for pediatrics, and 112 for psychiatry). Approximately 40% (203: 74 for medicine general and internal, 31 for genetics and heredity, 58 for pediatrics, and 40 for psychiatry) stated that subject consent was necessary. The submission of consent forms was required by 30% (154) of the journals studied, and 10% (50) provided their own consent forms for authors to use. Two journals mentioned that the possible effects of publication on subjects should be considered. Many journal consent forms mentioned the difficulties in ensuring complete anonymity of subjects, but few addressed the study objective, the subjects' right to refuse consent and the withdrawal of consent. The main reason for requiring the submission of consent forms was to confirm that consent had been obtained. Approximately 40% of journals required subject consent to be obtained. However, differences were observed depending on the fields. Specific considerations were not always documented. There is a need to address issues around the study

  5. Obtaining subjects’ consent to publish identifying personal information: current practices and identifying potential issues

    Science.gov (United States)

    2013-01-01

    Background In studies publishing identifying personal information, obtaining consent is regarded as necessary, as it is impossible to ensure complete anonymity. However, current journal practices around specific points to consider when obtaining consent, the contents of consent forms and how consent forms are managed have not yet been fully examined. This study was conducted to identify potential issues surrounding consent to publish identifying personal information. Methods Content analysis was carried out on instructions for authors and consent forms developed by academic journals in four fields (as classified by Journal Citation Reports): medicine general and internal, genetics and heredity, pediatrics, and psychiatry. An online questionnaire survey of editors working for journals that require the submission of consent forms was also conducted. Results Instructions for authors were reviewed for 491 academic journals (132 for medicine general and internal, 147 for genetics and heredity, 100 for pediatrics, and 112 for psychiatry). Approximately 40% (203: 74 for medicine general and internal, 31 for genetics and heredity, 58 for pediatrics, and 40 for psychiatry) stated that subject consent was necessary. The submission of consent forms was required by 30% (154) of the journals studied, and 10% (50) provided their own consent forms for authors to use. Two journals mentioned that the possible effects of publication on subjects should be considered. Many journal consent forms mentioned the difficulties in ensuring complete anonymity of subjects, but few addressed the study objective, the subjects’ right to refuse consent and the withdrawal of consent. The main reason for requiring the submission of consent forms was to confirm that consent had been obtained. Conclusion Approximately 40% of journals required subject consent to be obtained. However, differences were observed depending on the fields. Specific considerations were not always documented. There is a need

  6. An approach to maintenance optimization where safety issues are important

    Energy Technology Data Exchange (ETDEWEB)

    Vatn, Jorn, E-mail: jorn.vatn@ntnu.n [NTNU, Production and Quality Engineering, 7491 Trondheim (Norway); Aven, Terje [University of Stavanger (Norway)

    2010-01-15

    The starting point for this paper is a traditional approach to maintenance optimization where an object function is used for optimizing maintenance intervals. The object function reflects maintenance cost, cost of loss of production/services, as well as safety costs, and is based on a classical cost-benefit analysis approach where a value of prevented fatality (VPF) is used to weight the importance of safety. However, the rationale for such an approach could be questioned. What is the meaning of such a VPF figure, and is it sufficient to reflect the importance of safety by calculating the expected fatality loss VPF and potential loss of lives (PLL) as being done in the cost-benefit analyses? Should the VPF be the same number for all type of accidents, or should it be increased in case of multiple fatality accidents to reflect gross accident aversion? In this paper, these issues are discussed. We conclude that we have to see beyond the expected values in situations with high safety impacts. A framework is presented which opens up for a broader decision basis, covering considerations on the potential for gross accidents, the type of uncertainties and lack of knowledge of important risk influencing factors. Decisions with a high safety impact are moved from the maintenance department to the 'Safety Board' for a broader discussion. In this way, we avoid that the object function is used in a mechanical way to optimize the maintenance and important safety-related decisions are made implicit and outside the normal arena for safety decisions, e.g. outside the traditional 'Safety Board'. A case study from the Norwegian railways is used to illustrate the discussions.

  7. An approach to maintenance optimization where safety issues are important

    International Nuclear Information System (INIS)

    Vatn, Jorn; Aven, Terje

    2010-01-01

    The starting point for this paper is a traditional approach to maintenance optimization where an object function is used for optimizing maintenance intervals. The object function reflects maintenance cost, cost of loss of production/services, as well as safety costs, and is based on a classical cost-benefit analysis approach where a value of prevented fatality (VPF) is used to weight the importance of safety. However, the rationale for such an approach could be questioned. What is the meaning of such a VPF figure, and is it sufficient to reflect the importance of safety by calculating the expected fatality loss VPF and potential loss of lives (PLL) as being done in the cost-benefit analyses? Should the VPF be the same number for all type of accidents, or should it be increased in case of multiple fatality accidents to reflect gross accident aversion? In this paper, these issues are discussed. We conclude that we have to see beyond the expected values in situations with high safety impacts. A framework is presented which opens up for a broader decision basis, covering considerations on the potential for gross accidents, the type of uncertainties and lack of knowledge of important risk influencing factors. Decisions with a high safety impact are moved from the maintenance department to the 'Safety Board' for a broader discussion. In this way, we avoid that the object function is used in a mechanical way to optimize the maintenance and important safety-related decisions are made implicit and outside the normal arena for safety decisions, e.g. outside the traditional 'Safety Board'. A case study from the Norwegian railways is used to illustrate the discussions.

  8. Change in Water Cycle- Important Issue on Climate Earth System

    Science.gov (United States)

    Singh, Pratik

    Change in Water Cycle- Important Issue on Climate Earth System PRATIK KUMAR SINGH1 1BALDEVRAM MIRDHA INSTITUTE OF TECHNOLOGY,JAIPUR (RAJASTHAN) ,INDIA Water is everywhere on Earth and is the only known substance that can naturally exist as a gas, liquid, and solid within the relatively small range of air temperatures and pressures found at the Earth's surface.Changes in the hydrological cycle as a consequence of climate and land use drivers are expected to play a central role in governing a vast range of environmental impacts.Earth's climate will undergo changes in response to natural variability, including solar variability, and to increasing concentrations of green house gases and aerosols.Further more, agreement is widespread that these changes may profoundly affect atmospheric water vapor concentrations, clouds and precipitation patterns.As we know that ,a warmer climate, directly leading to increased evaporation, may well accelerate the hydrological cycle, resulting in an increase in the amount of moisture circulating through the atmosphere.The Changing Water Cycle programmer will develop an integrated, quantitative understanding of the changes taking place in the global water cycle, involving all components of the earth system, improving predictions for the next few decades of regional precipitation, evapotranspiration, soil moisture, hydrological storage and fluxes.The hydrological cycle involves evaporation, transpiration, condensation, precipitation, and runoff. NASA's Aqua satellite will monitor many aspects of the role of water in the Earth's systems, and will do so at spatial and temporal scales appropriate to foster a more detailed understanding of each of the processes that contribute to the hydrological cycle. These data and the analyses of them will nurture the development and refinement of hydrological process models and a corresponding improvement in regional and global climate models, with a direct anticipated benefit of more accurate weather and

  9. Social sustainability of cod and haddock fisheries in the northeast Atlantic: what issues are important?

    NARCIS (Netherlands)

    Veldhuizen, L.J.L.; Berentsen, P.; Bokkers, E.A.M.; Boer, de I.J.M.

    2015-01-01

    Research on the sustainability of capture fisheries has focused more on environmental and economic sustainability than on social sustainability. To assess social sustainability, first relevant and important social sustainability issues need to be identified. The objective of this study was to

  10. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  11. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  12. Identifying veterinary students' capacity for moral behavior concerning animal ethics issues.

    Science.gov (United States)

    Verrinder, Joy M; Phillips, Clive J C

    2014-01-01

    Veterinarians face unique animal ethics challenges as practitioners and policy advisors to government and industry. Changing societal attitudes, cultural diversity, and the often conflicting needs and interests of patients and clients contribute to moral distress. Yet little has been done to identify veterinarians' capacity to address these animal ethics issues. In this study, first-year and final-year veterinary students in an Australian university were surveyed to explore moral sensitivity, moral motivation, and moral character and their relationship with moral reasoning. The majority of students were concerned about animal ethics issues and had experienced moral distress in relation to the treatment of animals. Most believed that veterinarians should address the wider social issues of animal protection and that veterinary medicine should require a commitment to animals' interests over owners'/caregivers' interests. There was less agreement that the veterinary profession was sufficiently involved in addressing animal ethics issues. The principal motivators for studying veterinary medicine were, in declining importance, enjoyment in working with animals, helping sick and injured animals, and improving the way animals are treated. However, most students had taken little or no action to address animal ethics issues. These results suggest that both first- and fifth-year veterinary students are sensitive to animal ethics issues and are motivated to prioritize the interests of animals but have little experience in taking action to address these issues. Further research is needed to determine ways to identify and assess these moral behavior components in veterinary education to develop veterinarians' capacity to address animal ethics issues.

  13. Identifying palliative care issues in inpatients dying following stroke.

    Science.gov (United States)

    Ntlholang, O; Walsh, S; Bradley, D; Harbison, J

    2016-08-01

    Stroke leads to high mortality and morbidity but often there is a conflict between need for palliative care and avoidance of 'therapeutic nihilism'. We aimed to elicit the palliative care needs of stroke patients at the end of their lives in our unit with a low overall mortality rate (1 month: 8.8 %, inpatient: 12.9 %). We identified consecutive stroke patients who died over 2 years. Their clinical records were used for data collection. Of 54 deaths, 33 (61.1 %) were females, mean (SD) age at death was 79.3 ± 12.9 years. 41 (75.9 %) died after first stroke, 9 (16.7 %) were inpatient strokes, 7 (13.0 %) thrombolysed and 7 (13.0 %) had strokes as treatment complication. There were clear statements recorded in 26 (48.1 %) that patients were dying and death was thought to be due primarily to extent of brain injury in 24 (44.4 %). Palliative needs identified included dyspnoea 21 (38.9 %), pain 17 (31.5 %), respiratory secretions 17 (31.5 %), agitation 14 (25.9 %) and psychological distress 1 (1.9 %). Symptoms were due to premorbid diseases in 6 (11.1 %). Palliative care expertise were sought in 13 (24.1 %) and continuous subcutaneous infusion was used in 18 (33.3 %) to control symptoms. 4 (7.4 %) subjects underwent cardiac arrest calls and 9 (16.7 %) deaths occurred in ICU/HDU. The median Stroke-Death interval was 20 days (range 0-389). Do Not Attempt Resuscitation (DNAR) orders were in place in 86.8 % of patients. The median DNAR-Death interval was 7 days (range 0-311) with 7-day DNAR-Death rate of 53.2 % and 30-day of 78.7 % of the total deaths. Dyspnoea, pain and respiratory secretions were identified as the main palliative care needs.

  14. Important atomic physics issues for ion beam fusion

    International Nuclear Information System (INIS)

    Bangerter, Roger.

    1986-01-01

    The nearly endless variety of interesting and challenging problems makes physics research enjoyable. Most of us would choose to be physicists even if physics had no practical applications. However, physics does have practical applications. This workshop deals with one of those applications, namely ion beam fusion. Not all interesting and challenging atomic physics questions are important for ion beam fusion. This paper suggests some questions that may be important for ion beam fusion. It also suggests some criteria for determining if a question is only interesting, or both interesting and important. Importance is time dependent and, because of some restrictions on the flow of information, also country dependent. In the early days of ion beam fusion, it was important to determine if ion beam fusion made sense. Approximate answers and bounds on various parameters were required. Accurate, detailed answers were not needed. Because of the efforts of many people attending this workshop, we now know that ion beam fusion does make some sense. We must still determine if ion beam fusion truly makes good sense. If it does make good sense, we must determine how to make it work. Accurate detailed answers are becoming increasingly important. (author)

  15. Prenatal imprinting by environmental toxicants: really an important issue?

    Directory of Open Access Journals (Sweden)

    Karl Ernst v. Mühlendahl

    2015-06-01

    Full Text Available Prenatal imprinting of sexual behaviour and of other traits by environmental toxicants has been one important topic in the ongoing discussions in environmental medicine. This review of the literature shows that, so far, concrete data are sparse and, in part, contradictory.

  16. Important atomic physics issues for ion beam fusion

    International Nuclear Information System (INIS)

    Bangerter, R.O.

    1985-01-01

    This paper suggests several current atomic physics questions important to ion beam fusion. Among the topics discussed are beam transport, beam-target interaction, and reactor design. The major part of the report is discussion concerning areas of research necessary to better understand beam-target interactions

  17. Identifying the science and technology dimensions of emerging public policy issues through horizon scanning.

    Science.gov (United States)

    Parker, Miles; Acland, Andrew; Armstrong, Harry J; Bellingham, Jim R; Bland, Jessica; Bodmer, Helen C; Burall, Simon; Castell, Sarah; Chilvers, Jason; Cleevely, David D; Cope, David; Costanzo, Lucia; Dolan, James A; Doubleday, Robert; Feng, Wai Yi; Godfray, H Charles J; Good, David A; Grant, Jonathan; Green, Nick; Groen, Arnoud J; Guilliams, Tim T; Gupta, Sunjai; Hall, Amanda C; Heathfield, Adam; Hotopp, Ulrike; Kass, Gary; Leeder, Tim; Lickorish, Fiona A; Lueshi, Leila M; Magee, Chris; Mata, Tiago; McBride, Tony; McCarthy, Natasha; Mercer, Alan; Neilson, Ross; Ouchikh, Jackie; Oughton, Edward J; Oxenham, David; Pallett, Helen; Palmer, James; Patmore, Jeff; Petts, Judith; Pinkerton, Jan; Ploszek, Richard; Pratt, Alan; Rocks, Sophie A; Stansfield, Neil; Surkovic, Elizabeth; Tyler, Christopher P; Watkinson, Andrew R; Wentworth, Jonny; Willis, Rebecca; Wollner, Patrick K A; Worts, Kim; Sutherland, William J

    2014-01-01

    Public policy requires public support, which in turn implies a need to enable the public not just to understand policy but also to be engaged in its development. Where complex science and technology issues are involved in policy making, this takes time, so it is important to identify emerging issues of this type and prepare engagement plans. In our horizon scanning exercise, we used a modified Delphi technique. A wide group of people with interests in the science and policy interface (drawn from policy makers, policy adviser, practitioners, the private sector and academics) elicited a long list of emergent policy issues in which science and technology would feature strongly and which would also necessitate public engagement as policies are developed. This was then refined to a short list of top priorities for policy makers. Thirty issues were identified within broad areas of business and technology; energy and environment; government, politics and education; health, healthcare, population and aging; information, communication, infrastructure and transport; and public safety and national security.

  18. Identifying the Science and Technology Dimensions of Emerging Public Policy Issues through Horizon Scanning

    Science.gov (United States)

    Parker, Miles; Acland, Andrew; Armstrong, Harry J.; Bellingham, Jim R.; Bland, Jessica; Bodmer, Helen C.; Burall, Simon; Castell, Sarah; Chilvers, Jason; Cleevely, David D.; Cope, David; Costanzo, Lucia; Dolan, James A.; Doubleday, Robert; Feng, Wai Yi; Godfray, H. Charles J.; Good, David A.; Grant, Jonathan; Green, Nick; Groen, Arnoud J.; Guilliams, Tim T.; Gupta, Sunjai; Hall, Amanda C.; Heathfield, Adam; Hotopp, Ulrike; Kass, Gary; Leeder, Tim; Lickorish, Fiona A.; Lueshi, Leila M.; Magee, Chris; Mata, Tiago; McBride, Tony; McCarthy, Natasha; Mercer, Alan; Neilson, Ross; Ouchikh, Jackie; Oughton, Edward J.; Oxenham, David; Pallett, Helen; Palmer, James; Patmore, Jeff; Petts, Judith; Pinkerton, Jan; Ploszek, Richard; Pratt, Alan; Rocks, Sophie A.; Stansfield, Neil; Surkovic, Elizabeth; Tyler, Christopher P.; Watkinson, Andrew R.; Wentworth, Jonny; Willis, Rebecca; Wollner, Patrick K. A.; Worts, Kim; Sutherland, William J.

    2014-01-01

    Public policy requires public support, which in turn implies a need to enable the public not just to understand policy but also to be engaged in its development. Where complex science and technology issues are involved in policy making, this takes time, so it is important to identify emerging issues of this type and prepare engagement plans. In our horizon scanning exercise, we used a modified Delphi technique [1]. A wide group of people with interests in the science and policy interface (drawn from policy makers, policy adviser, practitioners, the private sector and academics) elicited a long list of emergent policy issues in which science and technology would feature strongly and which would also necessitate public engagement as policies are developed. This was then refined to a short list of top priorities for policy makers. Thirty issues were identified within broad areas of business and technology; energy and environment; government, politics and education; health, healthcare, population and aging; information, communication, infrastructure and transport; and public safety and national security. PMID:24879444

  19. Identifying the science and technology dimensions of emerging public policy issues through horizon scanning.

    Directory of Open Access Journals (Sweden)

    Miles Parker

    Full Text Available Public policy requires public support, which in turn implies a need to enable the public not just to understand policy but also to be engaged in its development. Where complex science and technology issues are involved in policy making, this takes time, so it is important to identify emerging issues of this type and prepare engagement plans. In our horizon scanning exercise, we used a modified Delphi technique. A wide group of people with interests in the science and policy interface (drawn from policy makers, policy adviser, practitioners, the private sector and academics elicited a long list of emergent policy issues in which science and technology would feature strongly and which would also necessitate public engagement as policies are developed. This was then refined to a short list of top priorities for policy makers. Thirty issues were identified within broad areas of business and technology; energy and environment; government, politics and education; health, healthcare, population and aging; information, communication, infrastructure and transport; and public safety and national security.

  20. Some important issues on population and sustainable development in China.

    Science.gov (United States)

    Zeng, Y

    1994-12-01

    A workshop was held in October 1993, at which time the Director of the Institute of Population Research at Peking University proposed that basic education for Chinese children be promoted, that the social, economic, and family status of Chinese women be improved, and that the social security of the elderly be improved. Sustainable development would be dependent upon the accomplishment of these three objectives. The evidence from 1982 and 1990 censuses showed that fertility was higher by as much as 2.4 times among women with no education compared to women with just a primary education. The education law should be strictly implemented. Rural families still disrupt their children's schooling in order to increase farming production. Theoretical support is insufficient. Many rural women still maintain son preference, which has increased fertility and contributed to an imbalanced sex ratio. In 1989 the male/female sex ratio was 113.8:100 compared to the normal ratio of 106:100. Undercounting of female births has accounted for 50% to 75% of the difference between the reported and the expected values. The high sex ratio of births delivered at hospitals is accounted for by prenatal selective screening and sex-selective abortion. A change in son preference ideology could be achieved by promoting the principle of equity between men and women and practicing economic policies that protect the rights of women and children. Regulations prohibiting sex-selective screening prenatally for nonmedical reasons should be enforced. Laws against infanticide and abandonment and neglect of females should be enforced. Family planning should emphasize good counseling and service delivery on a fully voluntary basis. The quality of data collection should be improved. The issues relating to prenatal sex determination should be researched and addressed with appropriate policy. China will continue to undergo rapid population aging. The old age security program currently operating in 700 counties

  1. Breast cancer in Mongolia: an increasingly important health policy issue

    Directory of Open Access Journals (Sweden)

    Demchig D

    2017-01-01

    Full Text Available Delgermaa Demchig, Claudia Mello-Thoms, Patrick C Brennan Medical Image Optimization and Perception Group (MIOPeG, Faculty of Health Science, The University of Sydney, Sydney, NSW, Australia Abstract: Breast cancer is a leading cause of cancer-related death for women in both developed and developing countries. The incidence and mortality of breast cancer in Mongolia, while low compared with other counties, has been increasing on an annual basis. In addition, in Mongolia, approximately 90% of the patients are diagnosed at a late stage, resulting in high mortality, with the majority of individuals diagnosed with breast cancer dying within 5 years of diagnosis. Breast cancer screening plays an important role in reducing mortality in Western countries and has been adopted by a number of Asian countries; however, no such approach exists in Mongolia. In a country of limited resources, implementation of expensive health strategies such as screening requires effective allocations of resources and the identification of the most effective imaging methods. This requirement relies on recent accurate data; however, at this time, there is a paucity of information around breast cancer in Mongolia. Until data around features of the disease are available, effective strategies to diagnose breast cancer that recognize the economic climate in Mongolia cannot be implemented and the impact of breast cancer is likely to increase. Keywords: incidence, mortality, breast screening, Mongolia

  2. Selenium's importance in regulatory issues regarding mercury

    Energy Technology Data Exchange (ETDEWEB)

    Raymond, Laura J.; Ralston, Nicholas V.C. [University of North Dakota Energy and Environmental Research Center, 15 North 23rd Street, Stop 9018, Grand Forks, ND 58202-9018 (United States)

    2009-11-15

    Current seafood safety and health risk assessment criteria use mercury concentrations as their sole basis. This unfortunate limitation omits consideration of selenium, an essential trace element that appears to be the primary molecular target of mercury toxicity. Although selenium has been recognized for decades as a means of counteracting mercury toxicity, its effects have often been overlooked or misunderstood. Experimental animal studies have demonstrated that increasing concentrations of selenium throughout the normal dietary range increasingly counteracts methylmercury toxicity. Dietary concentrations of selenium that are slightly less than the average amount present in ocean fish have been shown to completely prevent the onset of toxic symptoms of mercury toxicity, while animals fed lesser amounts of selenium rapidly sickened and died. Dietary selenium from a variety of sources including ocean fish such as tuna, swordfish, menhaden, and rockfish has been shown to counteract mercury toxicity. Since ocean fish are among the richest sources of dietary selenium, it is important to include selenium concentration measurements in future mercury risk assessments and seafood safety criteria. Mercury:selenium molar ratios in blood provide far more consistent and physiologically meaningful risk assessments. Comprehensive seafood safety criteria such as the Selenium Health Benefit Value enable clear differentiation between seafoods that are safe and those that are hazardous for human consumption. Use of parameters that integrate mercury-selenium relationships also make it easy to understand the differences between the findings of maternal mercury exposure studies that have been performed in New Zealand, the Faroes, the Seychelles, and the United Kingdom. Development of criteria for evaluating mercury-selenium interactions will enhance environmental protection and improve public safety. (author)

  3. Interdependence, issue importance, and the 2009 Russia-Ukraine gas conflict

    International Nuclear Information System (INIS)

    Lee, Yusin

    2017-01-01

    The primary aim of this paper is to explain the 2009 Russia-Ukraine gas conflict. In particular, it attempts to identify the causal mechanisms between their interdependence in the gas sphere and the gas conflict. The paper first shows that existing theories in the study of international relations have limitations in accounting for that conflict. Therefore, a theoretical framework drawing insights from Armstrong's model on dependence-political compliance and Crescenzi's exit model is proposed to explain it. Relying on this framework, this paper demonstrates that the 2009 Russia-Ukraine gas conflict took place through two critical causal mechanisms. In the contexts of the 2008 global financial crisis and Ukraine's anti-Russian policy, Russia and Ukraine both considered issues involved in the gas trade such as debts, prices, transit tariffs, and Ukraine's pipeline system to be very important. Therefore, when Russia issued demands with economic threats, Ukraine refused to comply. - Highlights: • This paper explains the 2009 Russia-Ukraine gas conflict. • It shows the causal mechanisms between their interdependent gas relations and the conflict. • The conflict took place through two critical causal mechanisms. • Russia and Ukraine considered the issues involved in the gas trade to be critical. • Thus, when Russia issued demands with economic threats, Ukraine refused to comply.

  4. An approach to identify issues affecting ERP implementation in Indian SMEs

    Directory of Open Access Journals (Sweden)

    Rana Basu

    2012-06-01

    Full Text Available Purpose: The purpose of this paper is to present the findings of a study which is based on the results of a comprehensive compilation of literature and subsequent analysis of ERP implementation success issues in context to Indian Small and Medium scale Enterprises (SME’s. This paper attempts to explore the existing literature and highlight those issues on ERP implementation and further to this the researchers applied TOPSIS (Technique for order preference by similarity to ideal solution method to prioritize issues affecting successful implementation of ERP. Design/methodology/approach: Based on the literature review certain issues leading to successful ERP implementation have been identified and to identify key issues Pareto Analysis (80-20 Rule have been applied. Further to extraction of key issues a survey based on TOPSIS was carried out in Indian small and medium scale enterprises. Findings: Based on review of literature 25 issues have been identified and further Pareto analysis has been done to extract key issues which is further prioritized by applying Topsis method. Research limitations/implications: Beside those identified issues there may be other issues that need to be explored. There is scope to enhance this study by taking into consideration different type of industries and by extending number of respondents. Practical implications: By identifying key issues for SMEs, managers can better prioritize issues to make implementation process smooth without disruption. ERP vendors can take inputs from this study to change their implementation approach while targeting small scale enterprises. Originality/value: There is no published literature available which followed a similar approach in identification of the critical issues affecting ERP in small and mid-sized companies in India or in any developing economy.

  5. Enhancing regulatory effectiveness by improving the process for identifying and resolving generic issues

    International Nuclear Information System (INIS)

    Vander Molen, Harold J.

    2001-01-01

    The Generic Issues Program first began formally in response to a Commission directive in October of 1976. In 1983, it became one of the first programs to make successful use of probabilistic risk information to aid in regulatory decision-making. In the 16 years since the program became quantitative, 836 issues have been processed. Of these, 106 reactor safety issues were prioritized as requiring further evaluation to determine the final resolution. Approximately a dozen generic issues remain unresolved. Although there is far less reactor licensing activity than in the 1970s, new issues continue to be identified from research and operational experience. These issues often involve complex and controversial questions of safety and regulation, and an efficient and effective means of addressing these issues is essential for regulatory effectiveness. Issues that involve a significant safety question require swift, effective, enforceable, and cost-effective regulatory actions. Issues that are of little safety significance must be quickly shown to be so and dismissed in an expeditious manner so as to avoid unnecessary expenditure of limited resources and to reduce regulatory uncertainty. Additionally, in the time since the generic issue program began, probabilistic risk assessment techniques have advanced significantly while agency resources have continued to diminish. Accordingly, the paper discusses the steps that have been taken to enhance the effectiveness and efficiency of the generic issue resolution process. Additionally, four resolved issues are discussed, along with key elements of a proposed new procedure for resolving potential generic issues

  6. Ethical issues identified by obstetrics and gynecology learners through a novel ethics curriculum.

    Science.gov (United States)

    Mejia, Rachel B; Shinkunas, Laura A; Ryan, Ginny L

    2015-12-01

    /gyn ethics and professionalism curriculum that highlights important learner-identified ethics and professionalism issues both specific to ob/gyn and common to clinical medicine. Findings will help ob/gyn educators best utilize and refine this flexible curriculum such that it is appropriately focused on topics relevant to each learner level. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. 14 CFR 21.617 - Issue of letters of TSO design approval: import appliances.

    Science.gov (United States)

    2010-01-01

    ...: import appliances. 21.617 Section 21.617 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION... Order Authorizations § 21.617 Issue of letters of TSO design approval: import appliances. (a) A letter of TSO design approval may be issued for an appliance that is manufactured in a foreign country with...

  8. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. The use of human factors methods to identify and mitigate safety issues in radiation therapy

    International Nuclear Information System (INIS)

    Chan, Alvita J.; Islam, Mohammad K.; Rosewall, Tara; Jaffray, David A.; Easty, Anthony C.; Cafazzo, Joseph A.

    2010-01-01

    Background and purpose: New radiation therapy technologies can enhance the quality of treatment and reduce error. However, the treatment process has become more complex, and radiation dose is not always delivered as intended. Using human factors methods, a radiotherapy treatment delivery process was evaluated, and a redesign was undertaken to determine the effect on system safety. Material and methods: An ethnographic field study and workflow analysis was conducted to identify human factors issues of the treatment delivery process. To address specific issues, components of the user interface were redesigned through a user-centered approach. Sixteen radiation therapy students were then used to experimentally evaluate the redesigned system through a usability test to determine the effectiveness in mitigating use errors. Results: According to findings from the usability test, the redesigned system successfully reduced the error rates of two common errors (p < .04 and p < .01). It also improved the mean task completion time by 5.5% (p < .02) and achieved a higher level of user satisfaction. Conclusions: These findings demonstrated the importance and benefits of applying human factors methods in the design of radiation therapy systems. Many other opportunities still exist to improve patient safety in this area using human factors methods.

  10. The importance of health advocacy in Canadian postgraduate medical education: current attitudes and issues.

    Science.gov (United States)

    Poulton, Alexander; Rose, Heather

    2015-01-01

    Health advocacy is currently a key component of medical education in North America. In Canada, Health Advocate is one of the seven roles included in the Royal College of Physicians and Surgeons of Canada's CanMEDS competency framework. A literature search was undertaken to determine the current state of health advocacy in Canadian postgraduate medical education and to identify issues facing educators and learners with regards to health advocacy training. The literature revealed that the Health Advocate role is considered among the least relevant to clinical practice by educators and learners and among the most challenging to teach and assess. Furthermore learners feel their educational needs are not being met in this area. A number of key barriers affecting health advocacy education were identified including limited published material on the subject, lack of clarity within the role, insufficient explicit role modeling in practice, and lack of a gold standard for assessment. Health advocacy is defined and its importance to medical practice is highlighted, using pediatric emergency medicine as an example. Increased published literature and awareness of the role, along with integration of the new 2015 CanMEDS framework, are important going forward to address concerns regarding the quality of postgraduate health advocacy education in Canada.

  11. The importance of health advocacy in Canadian postgraduate medical education: current attitudes and issues

    Directory of Open Access Journals (Sweden)

    Alexander Poulton

    2015-12-01

    Full Text Available Background: Health advocacy is currently a key component of medical education in North America. In Canada, Health Advocate is one of the seven roles included in the Royal College of Physicians and Surgeons of Canada’s CanMEDS competency framework. Method: A literature search was undertaken to determine the current state of health advocacy in Canadian postgraduate medical education and to identify issues facing educators and learners with regards to health advocacy training. Results:  The literature revealed that the Health Advocate role is considered among the least relevant to clinical practice by educators and learners and among the most challenging to teach and assess. Furthermore learners feel their educational needs are not being met in this area. A number of key barriers affecting health advocacy education were identified including limited published material on the subject, lack of clarity within the role, insufficient explicit role modeling in practice, and lack of a gold standard for assessment. Health advocacy is defined and its importance to medical practice is highlighted, using pediatric emergency medicine as an example. Conclusions: Increased published literature and awareness of the role, along with integration of the new 2015 CanMEDS framework, are important going forward to address concerns regarding the quality of postgraduate health advocacy education in Canada.

  12. Importance of health care issues in 2005 presidential elections in Croatia.

    Science.gov (United States)

    Dzakula, Aleksandar; Polasek, Ozren; Sosic, Zvonko; Voncina, Luka; Pavleković, Gordana; Brborović, Ognjen

    2006-06-01

    Health and health care provision are among the most important and politically sensitive public service areas. Politicians carefully incorporate health care program changes in their political agendas to gain votes. However, knowing health care priorities of the electoral body is not useful only to politicians, but also to health policy makers, as it enables them to target the most problematic areas in health care. We conducted a telephone survey of representative sample of voters (n=643) immediately before the presidential elections in Croatia in 2005, to determine the possible differences in health care priorities between left-wing and right-wing voters, and found a high level of homogeneity in their opinions. Health care organization, corruption, and financing issues were identified as the top priorities by both left- and right-wing voters. This agreement in voters' expectations, probably caused by a similar frame of mind of Croatian citizens inherited from pre-democratic times of self-government, could be used by health policy makers to rationally invest the means and efforts in dealing with the most problematic health care issues.

  13. Important project financing by issue of bonds in the Federation of Bosnia and Herzegovina

    Directory of Open Access Journals (Sweden)

    Lazar Dreč

    2016-11-01

    Full Text Available This article deals with the development of the Federation of Bosnia and Herzegovina based on the opening of infrastructure facilities for which funding is proposed to incorporate the issue of securities, primarily government bonds because there is a real basis for its demand deriving by banks, citizens and other organizations and institutions. The basic conditions for the functioning model of financing development and strategic projects by issuing securities herein include: a accelerate reforms and create the legal framework that will allow the establishment of important missing institutions for the business sector, b more efficient functioning of the executive and legislative bodies in Bosnia and Herzegovina on creating a favourable business environment, c the implementation of identified strategic commitment from all levels of government in relation to the creation of a single economic space, labour market, harmonization of entity policies and other policies that influence the overall business environment, d the development of infrastructure projects and power facilities, and e the inclusion of private funding and knowledge aimed at improving the construction and management of roads.

  14. Colostomy Irrigation: Issues Most Important to Wound, Ostomy and Continence Nurses.

    Science.gov (United States)

    Tallman, Nancy J; Cobb, Martha D; Grant, Marcia; Wendel, Christopher S; Colwell, Janice; Ercolano, Elizabeth; Krouse, Robert

    2015-01-01

    The purpose of this study was to describe issues that WOC nurses find most important related to colostomy irrigation (CI). This is an additional analysis of a study focusing on qualitative responses to a survey querying WOC nurses about CI practices. The target population was members of the Wound, Ostomy and Continence Nurses Society. Of the 985 nurses who responded to the survey, 338 (34.3%) answered the optional open-ended question asking for additional comments. A 1-time online survey was conducted. In addition to demographic, educational information, and forced-choice questions about CI, an open-ended question asked for any additional comments about their experience with irrigation and WOC practice. Content analysis was used to identify common themes identified by WOC nurses. Three hundred thirty-eight out of 985 WOC nurses (34.3%) answered the optional open-ended question asking for additional comments; analysis for this study is based on these responses. WOC nurses who responded to the open-ended question had similar characteristics to those who responded to the entire survey but were significantly more experienced (15.1 vs 11.0 years; P irrigation techniques are recommended.

  15. Identifying sustainability issues using participatory SWOT analysis - A case study of egg production in the Netherlands

    NARCIS (Netherlands)

    Mollenhorst, H.; Boer, de I.J.M.

    2004-01-01

    The aim of this paper was to demonstrate how participatory strengths, weaknesses, opportunities and threats (SWOT) analysis can be used to identify relevant economic, ecological and societal (EES) issues for the assessment of sustainable development. This is illustrated by the case of egg production

  16. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  17. Discussing Ethical Issues in the Classroom: Leveraging Pedagogical Moments that May Otherwise Undermine Important Discussions

    Science.gov (United States)

    Simpson, Douglas J.; Hull, William J., Jr.

    2011-01-01

    The authors identify, examine, and clarify three kinds of hindrances (dismissive/evasive tactics, logical stoppers, and ad hominem arguments) to teaching about ethical issues in P-12 schools. In discussing these three types of obstacles, they stress that the barriers themselves provide both challenges and opportunities for teachers. Indeed, they…

  18. Issue on NPP-I and C important to safety-Data Communication

    International Nuclear Information System (INIS)

    Koo, I. S.; Hong, S. B.; Cho, J. W.; Choi, Y. S.; Lee, J. C.

    2010-01-01

    1. Issue on CDV and FDIS of IEC61500 - Nuclear Power Plants - Instrumentation and control important to safety -Data communication - Activities on IEC TC45, SC45A/WGA3. 2. As issue the requirements for safety data communication which is essential part of digital I and C systems, the fundamental technology for IT based nuclear I and C is established. 3. Approval and circulation of IED61500 CDV and FDIS - Issue of the international standard, IEC 61500. 4. Issue one IEC61500, three interim documents, three presentations and five technical support to industry, and participation in IEC TC45 and SC45A plenary meeting and intermediate meeting on SC45A/WGA3. 5. Based on IEC61500, an new project on wireless technologyes application to NPP will be proceeded

  19. Cancerous patients and outbreak of Escherichia coli: an important issue in oncology

    OpenAIRE

    Joob, Beuy; Wiwanitkit, Viroj

    2014-01-01

    The widespread of the Escherichia coli outbreak in Europe becomes an important public concern at global level. The infection can be serious and might result in death. The retrospective literature review on this specific topic is performed. In this specific brief article, the author presented and discussed on the problem of Escherichia coli infection in the cancerous patients. This is an actual important issue in medical oncology for the scenario of Escherichia coli epidemic.

  20. Capital Buffers Based on Banks’ Domestic Systemic Importance:Selected Issues

    OpenAIRE

    Skořepa, Michal; Seidler, Jakub

    2014-01-01

    Regulators in many countries are currently considering ways to impose domestic systemic importance-based capital requirements on banks. Aiming to assist these considerations, this article discusses a number of issues concerning the calculation of a bank’s systemic importance to the domestic banking sector, such as the choice of indicators used and the pros and cons of focusing on an individual or consolidated level. Also, the “equal expected impact” procedure for determining adequate addition...

  1. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  2. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  3. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  4. Important accounting issues for carbon dioxide capture and storage projects under the UNFCCC

    International Nuclear Information System (INIS)

    Haefeli, S.; Bosi, M.; Philibert, C.

    2005-01-01

    Carbon dioxide capture and storage (CCS) provides options for making continued use of fossil fuels more compatible with pollution abatement policies. This paper evaluated policy issues related to CCS, with particular focus on the geological sequestration of carbon dioxide (CO 2 ) into geological storage sites. Before any carbon dioxide (CO 2 ) CCS activities can be included in the portfolio of climate change mitigation activities, several issues need to be resolved such as the development of appropriate accounting and baselines rules and monitoring modalities. Guidance and policies on baselines and the accounting of emission reductions are critical to ensure that CCS projects can benefit from CO 2 markets and are recognized under various mitigation schemes. This paper examined the major issues that should considered along with changes to current accounting approaches. Issues that need to be addressed in order to prepare national inventories for the inclusion of CCS under the United Nations Framework Convention on Climate Change (UNFCCC) and emission reduction schemes such as the European greenhouse gas emissions trading scheme were first presented, followed by an examination of CCS issues under project-based mechanisms such as the Kyoto Protocol's Clean Development Mechanism. The importance of clear definitions and monitoring guidelines for the proper accounting of CCS were also highlighted. 12 refs., 2 figs

  5. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  6. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  7. Concerning the Importance of Ontological Issues for Cultural Psychology: a Reply to Comments.

    Science.gov (United States)

    Mironenko, Irina A

    2017-09-01

    The paper continues the "ontological" discussion in IBPS, addressing the question of the importance of ontological issues for contemporary development of cultural psychology. The language psychological science speaks is considered as an ontological issue and a most topical one for cultural psychology, aiming at "constructing a psychology that is universal while being culture-inclusive" (Valsiner 2009, p.2). Ontological issues could stay implicit and neglected, as long as the 'etant, "the mode of being", "the particularities" were discussed within the circle of adherents of one and the same school, who implicitly had in mind the same 'entre. However, as soon as the discussion involves representatives of different schools, ontological issues become crucial for mutual understanding and meanings of the words have to be explicated. Same words like "psyche", "subjectivity", "social", "culture", etc., - often mean different things when they are pronounces or written by representatives of different theoretical trends. The discussion of the 'etant without clear indicating of the 'entre under consideration is likely to turn into a Babel. Global modernity requires constant efforts and insistent desire for mutual understanding across the diversified global scientific community. Thus, creative collaboration in epistemological developments has to ground on clear comprehension of the ontological stances of the debaters.

  8. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  9. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Exploration of Important Issues for the Safety of SFR 1 using Performance Assessment Calculations

    International Nuclear Information System (INIS)

    Maul, P.R.; Robinson, P.C.

    2002-06-01

    SKB has produced a revised safety case for the SFR 1 disposal facility for low and intermediate level radioactive wastes at Forsmark: project SAFE. This assessment includes a Performance Assessment (PA) for the long term post-closure safety of the facility. SKI has a responsibility to scrutinise SKB's safety case that is shared with SSI. Quintessa has undertaken a review of SKB's case for the long term safety of SFR 1 to assist SKI's evaluation of SAFE, and this is given in SKI-R--02-61, henceforth referred to as the Quintessa Review. The current report describes the independent PA calculations that provided an input to that review. Since 1999 SKI has been developing a PA capability for SFR 1 using the AMBER software. Two key features of the approach taken have been: To represent the whole system in a single model; and To allow the time-dependency of all key features, events and processes to be represented. These capabilities allow a better understanding of the key features of the system to be obtained for different future evolutions (scenarios). This report presents a summary of the work undertaken to provide SKI with a PA capability for SFR 1 and the calculations undertaken with it. Calculations have been undertaken for radionuclides transported in groundwater and gas, but not for direct intrusion by humans into the wastes. It should be emphasised that the purpose of the Performance Assessment calculations described in this report is not to provide an alternative assessment of potential radiological impacts to that produced by SKB. The aim is to use the models that have been developed to investigate the important features of the system and to help SKI scrutinise the case put to them by SKB. The PA calculations that have been undertaken are by no means comprehensive, and various issues could be investigated further if required. The key issues that have been identified can be summarised as follows: 1. The SFR 1 system has a number of different timescales that can

  11. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  12. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  13. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  14. Summary of SMIRT20 Preconference Topical Workshop - Identifying Structural Issues in Advanced Reactors

    International Nuclear Information System (INIS)

    Richins, William; Novascone, Stephen; O'Brien, Cheryl

    2009-01-01

    The Idaho National Laboratory (INL, USA) and IASMiRT sponsored an international forum Nov 5-6, 2008 in Porvoo, Finland for nuclear industry, academic, and regulatory representatives to identify structural issues in current and future advanced reactor design, especially for extreme conditions and external threats. The purpose of this Topical Workshop was to articulate research, engineering, and regulatory Code development needs. The topics addressed by the Workshop were selected to address critical industry needs specific to advanced reactor structures that have long lead times and can be the subject of future SMiRT technical sessions. The topics were; (1) structural/materials needs for extreme conditions and external threats in contemporary (Gen. III) and future (Gen. IV and NGNP) advanced reactors and (2) calibrating simulation software and methods that address topic 1. The workshop discussions and research needs identified are presented. The Workshop successfully produced interactive discussion on the two topics resulting in a list of research and technology needs. It is recommended that IASMiRT communicate the results of the discussion to industry and researchers to encourage new ideas and projects. In addition, opportunities exist to retrieve research reports and information that currently exists, and encourage more international cooperation and collaboration. It is recommended that IASMiRT continue with an off-year workshop series on select topics.

  15. Transcranial Direct Current Stimulation: Five Important Issues We Aren’t Discussing (But Probably Should Be

    Directory of Open Access Journals (Sweden)

    Jared Cooney Horvath

    2014-01-01

    Full Text Available Transcranial Direct Current Stimulation (tDCS is a neuromodulatory device often publicized for its ability to enhance cognitive and behavioral performance. These enhancement claims, however, are predicated upon electrophysiological evidence and descriptions which are far from conclusive. In fact, a review of the literature reveals a number of important experimental and technical issues inherent with this device that are simply not being discussed in any meaningful manner. In this paper, we will consider five of these topics. The first, inter-subject variability, explores the extensive between- and within-group differences found within the tDCS literature and highlights the need to properly examine stimulatory response at the individual level. The second, intra-subject reliability, reviews the lack of data concerning tDCS response reliability over time and emphasizes the importance of this knowledge for appropriate stimulatory application. The third, sham stimulation and blinding, draws attention to the importance (yet relative lack of proper control and blinding practices in the tDCS literature. The fourth, motor and cognitive interference, highlights the often overlooked body of research that suggests typical behaviors and cognitions undertaken during or following tDCS can impair or abolish the effects of stimulation. Finally, the fifth, electric current influences, underscores several largely ignored variables (such as hair thickness and electrode attachments methods influential to tDCS electric current density and flow.Through this paper, we hope to increase awareness and start an ongoing dialogue of these important issues which speak to the efficacy, reliability, and mechanistic foundations of tDCS.

  16. Human Resource Management in Sports: A Critical Review of its Importance and Pertaining Issues

    Directory of Open Access Journals (Sweden)

    Weerakoon Ranjan Kumara

    2016-03-01

    Full Text Available This paper will illustrate the meaning and importance of human resource management (HRM, human resource planning, and strategic human resource management, which are critically important for an organization’s effectiveness and must be effectively managed (Doherty, 1998. This study used the literature review method to acquire its final results. The relevant HRM literature review was done according to the purpose of the study. It used the purposive random sample method for selecting relevant literature. This study shows the current economic environment in the sports industry; the second part of the study critically analyzes the value of the strategic management of employees for the effective and efficient operation of sports organizations. It also critically evaluates human resource planning and other pertinent issues in terms of legislation, recruitment, selection, training, induction, and reward management from different international examples in sports management. Over the past few decades, increasing competition, globalization, and continuous changes in the market and in technology have emphasized the need to rethink the management of the organization and of human resources for the sake of overcoming significant challenges (Taylor et al., 2006. Therefore, managers should use strategic human resource management to overcome significant issues and to form well-planned strategies so that the organization may succeed.

  17. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  18. Ethical issues in identifying and recruiting participants for familial genetic research.

    Science.gov (United States)

    Beskow, Laura M; Botkin, Jeffrey R; Daly, Mary; Juengst, Eric T; Lehmann, Lisa Soleymani; Merz, Jon F; Pentz, Rebecca; Press, Nancy A; Ross, Lainie Friedman; Sugarman, Jeremy; Susswein, Lisa R; Terry, Sharon F; Austin, Melissa A; Burke, Wylie

    2004-11-01

    Family-based research is essential to understanding the genetic and environmental etiology of human disease. The success of family-based research often depends on investigators' ability to identify, recruit, and achieve a high participation rate among eligible family members. However, recruitment of family members raises ethical concerns due to the tension between protecting participants' privacy and promoting research quality, and guidelines for these activities are not well established. The Cancer Genetics Network Bioethics Committee assembled a multidisciplinary group to explore the scientific and ethical issues that arise in the process of family-based recruitment. The group used a literature review as well as expert opinion to develop recommendations about appropriate approaches to identifying, contacting, and recruiting family members. We conclude that there is no single correct approach, but recommend a balanced approach that takes into account the nature of the particular study as well as its recruitment goals. Recruitment of family members should be viewed as part of the research protocol and should require appropriate informed consent of the already-enrolled participant. Investigators should inform prospective participants why they are being contacted, how information about them was obtained, and what will happen to that information if they decide not to participate. The recruitment process should also be sensitive to the fact that some individuals from families at increased genetic risk will have no prior knowledge of their risk status. These recommendations are put forward to promote further discussion about the advantages and disadvantages of various approaches to family-based recruitment. They suggest a framework for considering alternative recruitment strategies and their implications, as well as highlight areas in need of further empirical research. (c) 2004 Wiley-Liss, Inc.

  19. Safety issues for LMFBR: important features drawn from the assessments of Superphenix

    International Nuclear Information System (INIS)

    Natta, M.

    2002-01-01

    Superphenix, which is built on the site of Creys-Malville, is still the biggest LMFBR plant that has been in operation. It is a pool type reactor, as Phenix and the RNR 1 500 and EFR projects. After the analysis of the preliminary safety (1974-1975), the construction was authorised by decree of the Prime Minister in 1977, the authorization for fuel loading and star-up to 3% was given by the minister of industry in July 1985 and full power was achieved in December 1986. The plant was operated until the end of December 1996, producing the equivalent of 320 EFPD, corresponding to half of the maximum barn-up of the first core. The plant was definitively stopped on the 20. of April 1998 by a decision of the French government. During this period of 25 years of licensing, construction and operation of Superphenix, others discussions and preliminary licensing procedures were started for new projects, mainly the RNR 1500 French project and the EFR European project. The operation of Superphenix was also marked by several incidents, which led to additional licensing procedures and important modifications. This period was also marked by an important work of research and development in the safety field, mostly related to the issues concerning hypothetical core disruptive accidents (HCDA) and sodium fires; further, this period was marked by the Three Mile Island accident in 1979 and the Chernobyl accident in 1986. The purpose of this paper is to present some items which were discussed during this period of 25 years and which should be of interest for future LMFBRs. In this presentation, we shall discuss the key issues concerning the safety criteria and options taken with respect to severe accidents, i.e. core melt accidents, giving details on some specific which are less known since they were assessed only lately for Superphenix, sometimes in connection with the on-going safety researches. (author)

  20. Czech teachers’ attitudes toward typical characteristics of intellectually gifted learners with dyslexia and the issue of identifying and educating them

    Directory of Open Access Journals (Sweden)

    Šárka Portešová

    2010-06-01

    Full Text Available The presented study deals with the issue of basic school teachers’ attitudestowards selected behavioral and cognitive characteristics of intellectually gifted lear-ners with dyslexia and the issue of identifying and educating these learners. Researchis being conducted at the time as a Greek-Czech intercultural study. However, in thepresented contribution only Czech research data are analyzed and interpreted. In theresearch, we used Attitudes Toward Giftedness/Learning disability – Dyslexia Scale byGreek authors Gari, Panagiota, Nikolopoulou (2006. This method was administeredto 158 teachers from all over the Czech Republic. Based on statistical analysis, thepresented empirical examination reached some important conclusions. It became clearthat Czech teachers are good at identifying characteristics related to manifestations ofa “gifted learner” and a “learner with a learning disability”. Moreover, they are able toidentify also the so-called duality in learning abilities, i.e. the simultaneousness of abi-lity and handicap in the learning process manifested in a particular cognitive domain.However, they identify this duality especially within Czech language. The most proble-matic appears to be the accepting of the existence of this typical characteristic of thegiven population of learners in other academic subjects, for example in mathematics.It is here in particular where teachers tend to expect nothing but exceptional perfor-mance, without a possibility of partial failure (they derive it from giftedness. It seemsthat due to the refusal of the existence of duality in learning ability intervening in allacademic subjects, it can lead to a wrong identification of this minority group of thegifted. Nevertheless, this fact must be confirmed in further empiric research.

  1. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  2. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  3. External evaluation of the Radiation Therapy Oncology Group brachial plexus contouring protocol: several issues identified

    International Nuclear Information System (INIS)

    Min, Myo; Carruthers, Scott; Zanchetta, Lydia; Roos, Daniel; Keating, Elly; Shakeshaft, John; Baxi, Siddhartha; Penniment, Michael; Wong, Karen

    2014-01-01

    The aims of the study were to evaluate interobserver variability in contouring the brachial plexus (BP) using the Radiation Therapy Oncology Group (RTOG)-approved protocol and to analyse BP dosimetries. Seven outliners independently contoured the BPs of 15 consecutive patients. Interobserver variability was reviewed qualitatively (visually by using planning axial computed-tomography images and anteroposterior digitally reconstructed radiographs) and quantitatively (by volumetric and statistical analyses). Dose–volume histograms of BPs were calculated and compared. We found significant interobserver variability among outliners in both qualitative and quantitative analyses. These were most pronounced for the T1 nerve roots on visual inspection and for the BP volume on statistical analysis. The BP volumes were smaller than those described in the RTOG atlas paper, with a mean volume of 20.8cc (range 11–40.7 cc) compared with 33±4cc (25.1–39.4cc). The average values of mean dose, maximum dose, V60Gy, V66Gy and V70Gy for patients treated with conventional radiotherapy and IMRT were 42.2Gy versus 44.8Gy, 64.5Gy versus 68.5Gy, 6.1% versus 7.6%, 2.9% versus 2.4% and 0.6% versus 0.3%, respectively. This is the first independent external evaluation of the published protocol. We have identified several issues, including significant interobserver variation. Although radiation oncologists should contour BPs to avoid dose dumping, especially when using IMRT, the RTOG atlas should be used with caution. Because BPs are largely radiologically occult on CT, we propose the term brachial-plexus regions (BPRs) to represent regions where BPs are likely to be present. Consequently, BPRs should in principle be contoured generously.

  4. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  5. Brand names of Portuguese medication: understanding the importance of their linguistic structure and regulatory issues.

    Science.gov (United States)

    Pires, Carla; Vigário, Marina; Cavaco, Afonso

    2015-08-01

    Among other regulatory requirements, medicine brands should be composed of single names without abbreviations to prevent errors in prescription of medication. The purposes of the study were to investigate the compliance of a sam ple of Portuguese medicine brand names with Portuguese pharmaceutical regulations. This includes identifying their basic linguistic characteristics and comparing these features and their frequency of occurrence with benchmark values of the colloquial or informal language. A sample of 474 brand names was selected. Names were analyzed using manual (visual analyses) and computer methods (FreP - Frequency Patterns of Phonological Objects in Portuguese and MS word). A significant number of names (61.3%) failed to comply with the Portuguese phonologic system (related to the sound of words) and/or the spelling system (related to the written form of words) contained more than one word, comprised a high proportion of infrequent syllable types or stress patterns and included abbreviations. The results suggest that some of the brand names of Portuguese medication should be reevaluated, and that regulation on this issue should be enforced and updated, taking into consideration specific linguistic and spelling codes.

  6. Biometric Identifiers and Border Security: 9/11 Commission Recommendations and Related Issues

    National Research Council Canada - National Science Library

    Morgan, Daniel; Krouse, William

    2005-01-01

    .... This report provides an overview of biometric technologies and the major U.S. biometric border screening systems, including US-VISIT, and discusses issues such as cost, performance, and user acceptance...

  7. "Business Ethics Everywhere": An Experiential Exercise to Develop Students' Ability to Identify and Respond to Ethical Issues in Business

    Science.gov (United States)

    Baker, Susan D.; Comer, Debra R.

    2012-01-01

    This article introduces an experiential exercise that enhances students' ability to identify ethical issues and to respond to them in ways that consider the relationship between organizational factors and ethical action. Students identify a required number of ethical incidents in their workplaces during a specified period. Students submit a…

  8. Which issue is important for nuclear energy: sustainability, competition, climate change?

    International Nuclear Information System (INIS)

    Dragusin, Octavian

    2003-01-01

    This paper tries to explore the implications of three important energy policy issues: sustainability, global climate change, and competition in electricity markets. We know that nuclear energy is another way to generate electricity, so it is impossible to discuss the outlook for nuclear without understanding the need for electricity. The issue for society is how to produce electricity at reasonable costs without damaging the environment. Unfortunately, there are no perfect alternatives. Key considerations include the capital and operating costs of electrical generating facilities, reliability, safety, environmental impact as well as assumptions on future economic growth. Nuclear energy offers good solution. Nuclear power energy scores very well against the three criteria for electricity generation, which matter most to our society - availability, affordability and sustainability. Nuclear power has proven to be highly reliable as shown by the performance of more than 400 reactors now operating in the world. These reactors compete with coal or gas- generated electricity and often offer a significant cost advantage. New reactor designs will be faster to build, safer and competitive with the best clean coal or gas-burning technologies now available. Nuclear power is also sustainable, not only because it contains all the waste it generates but also because the safety of the technology is now well established. The disposal of used fuel, despite the claims of those who are ideologically opposed to nuclear energy, is in my opinion not a problem without solution. The public should have confidence in the feasibility of long-term storage and the eventual safe disposal of radioactive wastes. What are the views for short- and for long-term? Reactor owners are seeking increased power output and plant life extensions, encouraged by the competitive cost of electricity produced and improving operational performance. However, while the lifetime for present reactors is extended and

  9. To twist or poke? A method for identifying usability issues with the rotary controller and touch screen for control of in-vehicle information systems.

    Science.gov (United States)

    Harvey, Catherine; Stanton, Neville A; Pickering, Carl A; McDonald, Mike; Zheng, Pengjun

    2011-07-01

    In-vehicle information systems (IVIS) can be controlled by the user via direct or indirect input devices. In order to develop the next generation of usable IVIS, designers need to be able to evaluate and understand the usability issues associated with these two input types. The aim of this study was to investigate the effectiveness of a set of empirical usability evaluation methods for identifying important usability issues and distinguishing between the IVIS input devices. A number of usability issues were identified and their causal factors have been explored. These were related to the input type, the structure of the menu/tasks and hardware issues. In particular, the translation between inputs and on-screen actions and a lack of visual feedback for menu navigation resulted in lower levels of usability for the indirect device. This information will be useful in informing the design of new IVIS, with improved usability. STATEMENT OF RELEVANCE: This paper examines the use of empirical methods for distinguishing between direct and indirect IVIS input devices and identifying usability issues. Results have shown that the characteristics of indirect input devices produce more serious usability issues, compared with direct devices and can have a negative effect on the driver-vehicle interaction.

  10. Republic Scientific-practical Conference 'The Youth Role in solving the most important issues of globalization process' Proceedings

    International Nuclear Information System (INIS)

    2015-01-01

    Present collection comprises of materials of Republic Scientific-practical Conference 'The Youth Role in solving the most important issues of globalization process'. Present collection is intended for scientific and technical staff, postgraduates, and students of institutes of higher education.

  11. Pharmaceutical care issues identified by pharmacists in patients with diabetes, hypertension or hyperlipidaemia in primary care settings.

    Science.gov (United States)

    Chua, Siew Siang; Kok, Li Ching; Yusof, Faridah Aryani Md; Tang, Guang Hui; Lee, Shaun Wen Huey; Efendie, Benny; Paraidathathu, Thomas

    2012-11-12

    The roles of pharmacists have evolved from product oriented, dispensing of medications to more patient-focused services such as the provision of pharmaceutical care. Such pharmacy service is also becoming more widely practised in Malaysia but is not well documented. Therefore, this study is warranted to fill this information gap by identifying the types of pharmaceutical care issues (PCIs) encountered by primary care patients with diabetes mellitus, hypertension or hyperlipidaemia in Malaysia. This study was part of a large controlled trial that evaluated the outcomes of multiprofessional collaboration which involved medical general practitioners, pharmacists, dietitians and nurses in managing diabetes mellitus, hypertension and hyperlipidaemia in primary care settings. A total of 477 patients were recruited by 44 general practitioners in the Klang Valley. These patients were counselled by the various healthcare professionals and followed-up for 6 months. Of the 477 participants, 53.7% had at least one PCI, with a total of 706 PCIs. These included drug-use problems (33.3%), insufficient awareness and knowledge about disease condition and medication (20.4%), adverse drug reactions (15.6%), therapeutic failure (13.9%), drug-choice problems (9.5%) and dosing problems (3.4%). Non-adherence to medications topped the list of drug-use problems, followed by incorrect administration of medications. More than half of the PCIs (52%) were classified as probably clinically insignificant, 38.9% with minimal clinical significance, 8.9% as definitely clinically significant and could cause patient harm while one issue (0.2%) was classified as life threatening. The main causes of PCIs were deterioration of disease state which led to failure of therapy, and also presentation of new symptoms or indications. Of the 338 PCIs where changes were recommended by the pharmacist, 87.3% were carried out as recommended. This study demonstrates the importance of pharmacists working in

  12. Pharmaceutical care issues identified by pharmacists in patients with diabetes, hypertension or hyperlipidaemia in primary care settings

    Directory of Open Access Journals (Sweden)

    Chua Siew

    2012-11-01

    demonstrates the importance of pharmacists working in collaboration with other healthcare providers especially the medical doctors in identifying and resolving pharmaceutical care issues to provide optimal care for patients with chronic diseases.

  13. Using in-depth investigations to identify transportation safety issues for wheelchair-seated occupants of motor vehicles.

    Science.gov (United States)

    Schneider, Lawrence W; Klinich, Kathleen D; Moore, Jamie L; MacWilliams, Joel B

    2010-04-01

    In-depth investigations of motor-vehicle crashes involve detailed inspection, measurement, and photodocumentation of vehicle exterior and interior damage, evidence of belt-restraint use, and evidence of occupant contacts with the vehicle interior. Results of in-depth investigations thereby provide the most objective way to identify current and emerging injury problems and issues in occupant safety and crash protection, and provide important feedback on the real-world performance of the latest restraint-system and vehicle crashworthiness technologies. To provide an objective understanding of real-world transportation safety issues for wheelchair-seated travelers, the University of Michigan Transportation Research Institute (UMTRI) has been conducting and assembling data from in-depth investigations of motor-vehicle crashes and non-crash adverse moving-vehicle incidents, such as emergency vehicle braking, turning, and swerving, in which there was at least one vehicle occupant sitting in a wheelchair. The results of 39 investigations involving 42 wheelchair-seated occupants have been assembled and entered into a wheelchair-occupant crash/injury database. In addition, a biomechanical analysis of each case has been performed to identify key safety issues for wheelchair-seated travelers. The wheelchairs of 34 of the 42 occupants who were seated in wheelchairs while traveling in motor vehicles were effectively secured by either a four-point, strap-type tiedown system or a docking securement device, and all but one of these properly secured wheelchairs remained in place during the crash or non-collision event. However, 30 of the 42 occupants were improperly restrained, either because of non-use or incomplete use of available belt restraints, or because the belt restraints were improperly positioned on the occupant's body. Twenty-six of the 42 occupants sustained significant injuries and 10 of these occupants died as a direct result of injuries sustained, or from

  14. Identifying usability issues for personalization during formative evaluations: a comparisons of three methods

    NARCIS (Netherlands)

    van Velsen, Lex Stefan; van der Geest, Thea; Klaassen, R.F.

    2011-01-01

    A personalized system is one that generates unique output for each individual. As a result, personalization has transformed the interaction between the user and the system, and specific new usability issues have arisen. Methods used for evaluating personalized systems should be able to reveal the

  15. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  16. Current issues in dental practice management. Part 1. The importance of shared values.

    Science.gov (United States)

    Newsome, Philip R H

    2003-04-01

    /1997 when NHS fees stood at 1.6 billion Pounds (71%) and private fees at 0.6 billion Pounds (29%) and it can be seen that while the size of the whole market has grown NHS fees have risen by around 18% while private sector fees have gone up by 64% during the same period. It cannot be said therefore that NHS dentistry has disappeared although it is clear that access to NHS dentistry has been and may still be difficult in some parts of the country. The Department of Health in England has responded by developing 'access centres' and in the recently published Options for Change sets out sweeping proposals to revitalise NHS dentistry and delegate decisions over funding to a local level. It is far from clear what the consequences of these changes will be. However, one possible scenario is that in many parts of the UK, although relief of pain, prevention and restoration of function will be funded by the NHS, other than in 'special circumstances' such as after trauma and inherited conditions 'cosmetic embellishment' will not be funded. In which case, ever increasing public interest in personal appearance may well lead to further growth in private dentistry. Against a background of change and uncertainty, this series of articles explores some of the issues facing dentists coming to terms with working in this brave new world. This first part examines an aspect of dental practice that is seldom discussed openly and yet is of such fundamental importance that it is the cornerstone of all successful practices and the main fault line in unsuccessful ones, namely the nature and strength of practice values.

  17. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  18. A digest of the Nuclear Safety Division report on the Fukushima Dai-ichi accident seminar (4). Issues identified by the accident

    International Nuclear Information System (INIS)

    Moriyama, Kumiaki; Abe, Kiyoharu

    2013-01-01

    AESJ Nuclear Safety Division published 'Report on the Fukushima Dai-ichi Accident Seminar - what was wrong and what should been down in future-' which would be published as five special articles of the AESJ journal. The Fukushima Dai-ichi accident identified issues of several activities directly related with nuclear safety in the areas of safety design, severe accident management and safety regulations. PRA, operational experiences and safety research could not always contribute safety assurance of nuclear power plant so much. This article (4) summarized technical issues based on related facts of the accident as much as possible and discussed' what was wrong and what should be down in future'. Important issues were identified from defense-in-depth philosophy and lessons learned on safety design were obtained from accident progression analysis. Activities against external events and continuous improvements of safety standards based on latest knowledge were most indispensable. Strong cooperation among experts in different areas was also needed. (T. Tanaka)

  19. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  20. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  1. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  2. Issues Identified During September 2016 IBM OpenMP 4.5 Hackathon

    Energy Technology Data Exchange (ETDEWEB)

    Richards, David F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-03-15

    In September, 2016 IBM hosted an OpenMP 4.5 Hackathon at the TJ Watson Research Center. Teams from LLNL, ORNL, SNL, LANL, and LBNL attended the event. As with the 2015 hackathon, IBM produced an extremely useful and successful event with unmatched support from compiler team, applications staff, and facilities. Approximately 24 IBM staff supported 4-day hackathon and spent significant time 4-6 weeks out to prepare environment and become familiar with apps. This hackathon was also the first event to feature LLVM & XL C/C++ and Fortran compilers. This report records many of the issues encountered by the LLNL teams during the hackathon.

  3. Virtual Reality and Its Potential Use in Special Education. Identifying Emerging Issues and Trends in Technology for Special Education.

    Science.gov (United States)

    Woodward, John

    As part of a 3-year study to identify emerging issues and trends in technology for special education, this paper addresses the possible contributions of virtual reality technology to educational services for students with disabilities. An example of the use of virtual reality in medical imaging introduces the paper and leads to a brief review of…

  4. Identifying Ethical Issues in Mental Health Research with Minors Adolescents: Results of a Delphi Study

    Directory of Open Access Journals (Sweden)

    Elisabeta Ioana Hiriscau

    2016-05-01

    Full Text Available Research with minors, especially for preventive purposes, e.g., suicide prevention, investigating risk or self-destructive behaviors such as deviance, drug abuse, or suicidal behavior, is ethically sensitive. We present a Delphi study exploring the ethical implications of the needs formulated by researchers in an international pre-conference who would benefit from ethics support and guidance in conducting Mental Health Research with minors. The resulting List of Ethical Issues (LEI was submitted to a 2-rounds Delphi process via the Internet, including 34 multidisciplinary experts. In the first round, the experts reviewed the LEI and completed a questionnaire. Results from this round were analyzed and grouped in nine categories comprising 40 items. In the second round, the experts had to agree/disagree with the needs expressed in the LEI leading to a final list of 25 ethical issues considered relevant for Mental Health Research with minors such as: confidentiality of the sensitive data, competence for consenting alone and risk of harm and stigma related to the methodology used in research. It was shown that studies like SEYLE (Saving and Empowering Young Lives in Europe trigger among researchers wishes to obtain specific recommendations helping to comply with standards for good practice in conducting research with minors.

  5. Identifying Ethical Issues in Mental Health Research with Minors Adolescents: Results of a Delphi Study.

    Science.gov (United States)

    Hiriscau, Elisabeta Ioana; Stingelin-Giles, Nicola; Wasserman, Danuta; Reiter-Theil, Stella

    2016-05-11

    Research with minors, especially for preventive purposes, e.g., suicide prevention, investigating risk or self-destructive behaviors such as deviance, drug abuse, or suicidal behavior, is ethically sensitive. We present a Delphi study exploring the ethical implications of the needs formulated by researchers in an international pre-conference who would benefit from ethics support and guidance in conducting Mental Health Research with minors. The resulting List of Ethical Issues (LEI) was submitted to a 2-rounds Delphi process via the Internet, including 34 multidisciplinary experts. In the first round, the experts reviewed the LEI and completed a questionnaire. Results from this round were analyzed and grouped in nine categories comprising 40 items. In the second round, the experts had to agree/disagree with the needs expressed in the LEI leading to a final list of 25 ethical issues considered relevant for Mental Health Research with minors such as: confidentiality of the sensitive data, competence for consenting alone and risk of harm and stigma related to the methodology used in research. It was shown that studies like SEYLE (Saving and Empowering Young Lives in Europe) trigger among researchers wishes to obtain specific recommendations helping to comply with standards for good practice in conducting research with minors.

  6. Identifying Ethical Issues in Mental Health Research with Minors Adolescents: Results of a Delphi Study

    Science.gov (United States)

    Hiriscau, Elisabeta Ioana; Stingelin-Giles, Nicola; Wasserman, Danuta; Reiter-Theil, Stella

    2016-01-01

    Research with minors, especially for preventive purposes, e.g., suicide prevention, investigating risk or self-destructive behaviors such as deviance, drug abuse, or suicidal behavior, is ethically sensitive. We present a Delphi study exploring the ethical implications of the needs formulated by researchers in an international pre-conference who would benefit from ethics support and guidance in conducting Mental Health Research with minors. The resulting List of Ethical Issues (LEI) was submitted to a 2-rounds Delphi process via the Internet, including 34 multidisciplinary experts. In the first round, the experts reviewed the LEI and completed a questionnaire. Results from this round were analyzed and grouped in nine categories comprising 40 items. In the second round, the experts had to agree/disagree with the needs expressed in the LEI leading to a final list of 25 ethical issues considered relevant for Mental Health Research with minors such as: confidentiality of the sensitive data, competence for consenting alone and risk of harm and stigma related to the methodology used in research. It was shown that studies like SEYLE (Saving and Empowering Young Lives in Europe) trigger among researchers wishes to obtain specific recommendations helping to comply with standards for good practice in conducting research with minors. PMID:27187425

  7. Labont? Identifies Key Issues for Health Promoters in the New World Order

    OpenAIRE

    Raphael, Dennis

    2016-01-01

    For over 35 years Ronald Labonté has been critically analyzing the state of health promotion in Canada and the world. In 1981, he identified the shortcomings of the groundbreaking Lalonde Report by warning of the seductive appeal of so-called lifestyle approaches to health. Since then, he has left a trail of critical work identifying the barriers to — and opportunities for —health promotion work. More recently, he has shown how the rise of economic globalization and acceptance of neo-liberal ...

  8. A Detailed Analysis over Some Important Issues towards Using Computer Technology into the EFL Classrooms

    Science.gov (United States)

    Gilakjani, Abbas Pourhosein

    2014-01-01

    Computer technology has changed the ways we work, learn, interact and spend our leisure time. Computer technology has changed every aspect of our daily life--how and where we get our news, how we order goods and services, and how we communicate. This study investigates some of the significant issues concerning the use of computer technology…

  9. Rational use of medicines--an important issue in pharmaceutical policy

    DEFF Research Database (Denmark)

    Almarsdóttir, Anna Birna; Traulsen, Janine Marie

    2005-01-01

    to adapt its way of thinking to include the issue of context. They point out that clinical pharmacists today already adapt their decisons to each patient and patient group. Policy-makers are encouraged to adopt a similar approach because populations as well as particular market situations vary...

  10. Journal of Transdisciplinary Environmental Studies : Special Issue on The Importance of Local Knowledge and Interdisciplinary Research

    DEFF Research Database (Denmark)

    For this special issue of TES we have selected four articles on constraints and options for managing trees in Africa. The articles have been produced within a larger multidisciplinary research programme on People, Trees and Agriculture in Africa (Petrea) funded by the Danish Development Research ...

  11. Identifying critical issues in recreation planning and management: improving the management-research partnership

    Science.gov (United States)

    John H. Schomaker; David W. Lime

    1988-01-01

    The "nominal group" process is a proven technique to systematically arrive at a consensus about critical information needs in recreation planning and management. Using this process, 41 managers who attended a 1983 conference on river management identified 114 specific information needs grouped under 11 general questions. Clearly, some concerns of...

  12. Key Issues in Empirically Identifying Chronically Low-Performing and Turnaround Schools

    Science.gov (United States)

    Hansen, Michael

    2012-01-01

    One of the US Department of Education's key priorities is turning around the nation's persistently low-achieving schools, yet exactly how to identify low-performing schools is a task left to state policy makers, and a myriad of definitions have been utilized. In addition, exactly how to recognize when a school begins to turn around is not well…

  13. Organisational Issues for E-Learning: Critical Success Factors as Identified by HE Practitioners

    Science.gov (United States)

    McPherson, Maggie; Nunes, Miguel Baptista

    2006-01-01

    Purpose: The purpose of this paper is to report on a research project that identified organisational critical success factors (CSFs) for e-learning implementation in higher education (HE). These CSFs can be used as a theoretical foundation upon which to base decision-making and strategic thinking about e-learning. Design/methodology/approach: The…

  14. Single window for issuing licenses for export and import of ionizing radiation sources and transit of radioactive sources

    International Nuclear Information System (INIS)

    Sandev, T.; Stamenov, R.; Misevska, A.; Georgievska-Dimitrevski, B.; Angelovski, G.

    2009-01-01

    In this paper we present the electronic system for application and issuing licenses for export, import and transit of goods (EXIM), particularly for ionizing radiation sources, in the Republic of Macedonia. This system is a modern and helpful tool for simple issuing licenses, for establishing a unique database and it represents a harmonized system for exchanging information between the governmental, public and private legal persons in the Republic of Macedonia. (author)

  15. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  16. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Identifying Students with Mental Health Issues: A Guide for Classroom Teachers

    Science.gov (United States)

    Marsh, Robbie J.

    2016-01-01

    Child and adolescent mental health is a growing concern in schools. Students suffering from mental health conditions struggle in the school environment if their needs are not being met. Teachers play an important role in the identification of these students. This article highlights the distinctions between externalizing and internalizing behaviors…

  18. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  19. Important Issues to Quality of Life Among Norwegian Older Adults: An Exploratory Study

    OpenAIRE

    Kalfoss, Mary; Halvorsrud, Liv

    2009-01-01

    The increasing numbers of older people and higher expectations of a ?good life? within societies, has lead to international interest in the enhancement of quality of life (QoL) among older adults. Understanding whether the same aspects of life are equally important to the life quality of subgroups of older people is important in helping health professionals plan social and health care policy and caring strategies. The purpose of this study was to describe the importance given to 38 areas of Q...

  20. Identifying Issues in Applying Integrated Project Delivery to Domestic Nuclear Power Plant Construction Projects

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Joo [Korean Nuclear Society, Daejeon (Korea, Republic of)

    2016-05-15

    Integrated Project Delivery (IPD) is defined as that people, systems, business structures, and practices of key stakeholders are incorporated into a single-team, with a single process, which executes a project in a way of optimizing the project's outcome, increasing values delivered to the end user, reducing waste, and maximizing efficiency throughout the phases of engineering to construction. The researcher had carried out literature review in terms of IPD to identify major characteristics of IPD which are presented in the following section and had compared such characteristics against peculiarities of nuclear power plant (NPP) construction projects in order to shed light on obstacles in possible application of IPD method to domestic NPP construction projects in the coming days. In this research, three (3) major characteristics of IPD were identified: 1) key stakeholders signing one balanced contract, forming de facto one body, sharing risk and reward 2) an integrated project team being formed in the early stage of a project and providing input to minimize time and cost loss from rework downstream 3) team members co-locating, having open and direct communication, making decisions on time, and pursuing the success of the project itself.

  1. Identifying Key Issues and Potential Solutions for Integrated Arrival, Departure, Surface Operations by Surveying Stakeholder Preferences

    Science.gov (United States)

    Aponso, Bimal; Coppenbarger, Richard A.; Jung, Yoon; Quon, Leighton; Lohr, Gary; O’Connor, Neil; Engelland, Shawn

    2015-01-01

    NASA's Aeronautics Research Mission Directorate (ARMD) collaborates with the FAA and industry to provide concepts and technologies that enhance the transition to the next-generation air-traffic management system (NextGen). To facilitate this collaboration, ARMD has a series of Airspace Technology Demonstration (ATD) sub-projects that develop, demonstrate, and transitions NASA technologies and concepts for implementation in the National Airspace System (NAS). The second of these sub-projects, ATD-2, is focused on the potential benefits to NAS stakeholders of integrated arrival, departure, surface (IADS) operations. To determine the project objectives and assess the benefits of a potential solution, NASA surveyed NAS stakeholders to understand the existing issues in arrival, departure, and surface operations, and the perceived benefits of better integrating these operations. NASA surveyed a broad cross-section of stakeholders representing the airlines, airports, air-navigation service providers, and industry providers of NAS tools. The survey indicated that improving the predictability of flight times (schedules) could improve efficiency in arrival, departure, and surface operations. Stakeholders also mentioned the need for better strategic and tactical information on traffic constraints as well as better information sharing and a coupled collaborative planning process that allows stakeholders to coordinate IADS operations. To assess the impact of a potential solution, NASA sketched an initial departure scheduling concept and assessed its viability by surveying a select group of stakeholders for a second time. The objective of the departure scheduler was to enable flights to move continuously from gate to cruise with minimal interruption in a busy metroplex airspace environment using strategic and tactical scheduling enhanced by collaborative planning between airlines and service providers. The stakeholders agreed that this departure concept could improve schedule

  2. International legal and political issues associated with the export/import of nuclear power plants

    International Nuclear Information System (INIS)

    Manning Muntzing, L.

    1978-01-01

    The benefits of nuclear power can be achieved by most nations only through international commerce that has been shaped by political considerations and implemented through legal instruments. The end product is a structure of legal agreements designed to implement the basic political and commercial decisions that are required for any nation to enter the nuclear power arena. The IAEA Statute, the Non-Proliferation Treaty and regional nuclear agreements have reflected the international political consensus concerning nuclear power. In recent years, however, events have occurred that in all probability will result in additional international arrangements. It is expected that the increase in terrorist activities will result in greater physical protection commitments, that concern for weapons proliferation will result in further definition of sanctions, and that such troublesome issues as double labelling of materials will be discussed by the international community. In areas such as bilateral agreements between nations, commercial arrangements and export licences, this is a period of rethinking, renegotiating, and readjusting. The result is a degree of uncertainty and lack of stability that could so jeopardize the potential for nuclear transfers that the nuclear energy option may not vest. While there always will be questions and issues, it is essential to settle some of the key problems without delay so that nuclear benefits can be realized. (author)

  3. Application of the Pareto principle to identify and address drug-therapy safety issues.

    Science.gov (United States)

    Müller, Fabian; Dormann, Harald; Pfistermeister, Barbara; Sonst, Anja; Patapovas, Andrius; Vogler, Renate; Hartmann, Nina; Plank-Kiegele, Bettina; Kirchner, Melanie; Bürkle, Thomas; Maas, Renke

    2014-06-01

    Adverse drug events (ADE) and medication errors (ME) are common causes of morbidity in patients presenting at emergency departments (ED). Recognition of ADE as being drug related and prevention of ME are key to enhancing pharmacotherapy safety in ED. We assessed the applicability of the Pareto principle (~80 % of effects result from 20 % of causes) to address locally relevant problems of drug therapy. In 752 cases consecutively admitted to the nontraumatic ED of a major regional hospital, ADE, ME, contributing drugs, preventability, and detection rates of ADE by ED staff were investigated. Symptoms, errors, and drugs were sorted by frequency in order to apply the Pareto principle. In total, 242 ADE were observed, and 148 (61.2 %) were assessed as preventable. ADE contributed to 110 inpatient hospitalizations. The ten most frequent symptoms were causally involved in 88 (80.0 %) inpatient hospitalizations. Only 45 (18.6 %) ADE were recognized as drug-related problems until discharge from the ED. A limited set of 33 drugs accounted for 184 (76.0 %) ADE; ME contributed to 57 ADE. Frequency-based listing of ADE, ME, and drugs involved allowed identification of the most relevant problems and development of easily to implement safety measures, such as wall and pocket charts. The Pareto principle provides a method for identifying the locally most relevant ADE, ME, and involved drugs. This permits subsequent development of interventions to increase patient safety in the ED admission process that best suit local needs.

  4. ON THE ISSUE OF IMPORT SUBSTITUTION OF DEEP PROCESSING PRODUCTS FROM GRAIN AND POTATO

    Directory of Open Access Journals (Sweden)

    N. R. Andreev

    2014-01-01

    Full Text Available Summary. The analysis of structure of starch containing raw materials processing in Russia Federation is provided in the article. There was noted an increase in volumes of corn and wheat processing, however the share of processed potato is still low (below 4%. It was established that Russian starch products and starch sweeteners are on the same level on quality as best European samples and they are very competitive. Market demand in crystalline glucose for food and medical purposes (over 30 thous. tons is fully covered by import. The volume of import of modified starches exceeds 80 % of total consumption. The biggest volume of import among native starches belongs to potato starch – over 60 %. The article provides suggestions on import substitution of mentioned starch products. The growth of starch production in Russia was accompanied by concentration of production at large enterprises. So, in 2013 over 90 % of glucose syrup was produced at six enterprises, over 80 % of dry starch – at five enterprises. Efficiency of corn and wheat processing into starch and starch products is achieved by production and selling of co-products (dry gluten, gluten, corn germ or corn oil, corn extract, feed products.Development of starch sweeteners production from starch could be achieved by expanding the consumption areas of different kinds of glucose syrup and production of glucose-fructose syrups as full substitute of sugar, providing import substitution of sugar, crystalline glucose of food and medicine purpose, deep processing of glucose into polyols (sorbit, maltit, polylactites, aminoacids.

  5. 75 FR 71415 - Notice of Decision To Issue Permits for the Importation of Wall Rocket Leaves From the United...

    Science.gov (United States)

    2010-11-23

    ... DEPARTMENT OF AGRICULTURE Animal and Plant Health Inspection Service [Docket No. APHIS-2010-0027] Notice of Decision To Issue Permits for the Importation of Wall Rocket Leaves From the United Kingdom Into the Continental United States AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION...

  6. Importance of Quality of Life Issues: A Pilot Comparison of Teachers and Parents of Children with Autism Spectrum Disorders

    Science.gov (United States)

    Ivey-Hatz, Julie; Frederick, Karen

    2014-01-01

    Quality of life (QoL) issues for parents and teachers of children with autism spectrum disorders (ASD) are important to investigate. Independence, social functioning, school functioning and participating in leisure activities are some of the quality of life indicators that parents and teachers must agree upon to ensure effective communication and…

  7. 76 FR 8997 - Notice of Decision To Issue Permits for the Importation of Fresh Strawberries From Jordan Into...

    Science.gov (United States)

    2011-02-16

    ...] Notice of Decision To Issue Permits for the Importation of Fresh Strawberries From Jordan Into the... continental United States of fresh strawberries from Jordan. Based on the findings of a pest risk analysis... strawberries from Jordan. DATES: Effective Date: February 16, 2011. FOR FURTHER INFORMATION CONTACT: Ms. Donna...

  8. Stakeholders Perspectives on the Success Drivers in Ghana's National Health Insurance Scheme - Identifying Policy Translation Issues.

    Science.gov (United States)

    Fusheini, Adam; Marnoch, Gordon; Gray, Ann Marie

    2016-10-01

    Ghana's National Health Insurance Scheme (NHIS), established by an Act of Parliament (Act 650), in 2003 and since replaced by Act 852 of 2012 remains, in African terms, unprecedented in terms of growth and coverage. As a result, the scheme has received praise for its associated legal reforms, clinical audit mechanisms and for serving as a hub for knowledge sharing and learning within the context of South-South cooperation. The scheme continues to shape national health insurance thinking in Africa. While the success, especially in coverage and financial access has been highlighted by many authors, insufficient attention has been paid to critical and context-specific factors. This paper seeks to fill that gap. Based on an empirical qualitative case study of stakeholders' views on challenges and success factors in four mutual schemes (district offices) located in two regions of Ghana, the study uses the concept of policy translation to assess whether the Ghana scheme could provide useful lessons to other African and developing countries in their quest to implement social/NHISs. In the study, interviewees referred to both 'hard and soft' elements as driving the "success" of the Ghana scheme. The main 'hard elements' include bureaucratic and legal enforcement capacities; IT; financing; governance, administration and management; regulating membership of the scheme; and service provision and coverage capabilities. The 'soft' elements identified relate to: the background/context of the health insurance scheme; innovative ways of funding the NHIS, the hybrid nature of the Ghana scheme; political will, commitment by government, stakeholders and public cooperation; social structure of Ghana (solidarity); and ownership and participation. Other developing countries can expect to translate rather than re-assemble a national health insurance programme in an incomplete and highly modified form over a period of years, amounting to a process best conceived as germination as opposed

  9. Grid connectivity issues and the importance of GCC. [GCC - Grid Code Compliance

    Energy Technology Data Exchange (ETDEWEB)

    Das, A.; Schwartz, M.-K. [GL Renewable Certification, Malleswaram, Bangalore (India)

    2012-07-01

    In India, the wind energy is concentrated in rural areas with a very high penetration. In these cases, the wind power has an increasing influence on the power quality on the grids. Another aspect is the influence of weak grids on the operation of wind turbines. Hence it becomes very much essential to introduce such a strong grid code which is particularly applicable to wind sector and suitable for Indian environmental grid conditions. This paper focuses on different international grid codes and their requirement with regard to the connection of wind farms to the electric power systems to mitigate the grid connectivity issues. The requirements include the ways to achieve voltage and frequency stability in the grid-tied wind power system. In this paper, comparative overview and analysis of the main grid connecting requirements will be conducted, comprising several national and regional codes from many countries where high wind penetration levels have been achieved or are expected in the future. The objective of these requirements is to provide wind farms with the control and regulation capabilities encountered in conventional power plants and are necessary for the safe, reliable and economic operation of the power system. This paper also provides a brief idea on the Grid Code Compliance (GCC) certification procedure implemented by the leading accredited certifying body like Germanischer Lloyd Renewables Certification (GL RC), who checks the conformity of the wind turbines as per region specific grid codes. (Author)

  10. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  11. Pitfalls and important issues in testing reliability using intraclass correlation coefficients in orthopaedic research.

    Science.gov (United States)

    Lee, Kyoung Min; Lee, Jaebong; Chung, Chin Youb; Ahn, Soyeon; Sung, Ki Hyuk; Kim, Tae Won; Lee, Hui Jong; Park, Moon Seok

    2012-06-01

    Intra-class correlation coefficients (ICCs) provide a statistical means of testing the reliability. However, their interpretation is not well documented in the orthopedic field. The purpose of this study was to investigate the use of ICCs in the orthopedic literature and to demonstrate pitfalls regarding their use. First, orthopedic articles that used ICCs were retrieved from the Pubmed database, and journal demography, ICC models and concurrent statistics used were evaluated. Second, reliability test was performed on three common physical examinations in cerebral palsy, namely, the Thomas test, the Staheli test, and popliteal angle measurement. Thirty patients were assessed by three orthopedic surgeons to explore the statistical methods testing reliability. Third, the factors affecting the ICC values were examined by simulating the data sets based on the physical examination data where the ranges, slopes, and interobserver variability were modified. Of the 92 orthopedic articles identified, 58 articles (63%) did not clarify the ICC model used, and only 5 articles (5%) described all models, types, and measures. In reliability testing, although the popliteal angle showed a larger mean absolute difference than the Thomas test and the Staheli test, the ICC of popliteal angle was higher, which was believed to be contrary to the context of measurement. In addition, the ICC values were affected by the model, type, and measures used. In simulated data sets, the ICC showed higher values when the range of data sets were larger, the slopes of the data sets were parallel, and the interobserver variability was smaller. Care should be taken when interpreting the absolute ICC values, i.e., a higher ICC does not necessarily mean less variability because the ICC values can also be affected by various factors. The authors recommend that researchers clarify ICC models used and ICC values are interpreted in the context of measurement.

  12. [Hygiene in schools - an important issue for the public health services].

    Science.gov (United States)

    Heudorf, U; Voigt, K; Eikmann, Th; Exner, M

    2011-11-01

    According to the Protection against Infection Act (IfSG), schools have to identify their arrangements of standard operating procedures (SOPs) for hygienic conditions, and the public health departments are obliged to check the hygienic conditions in schools. Here, practical experience with these topics in Frankfurt/Main, Germany, is presented.Although all schools had been informed about their duties according to IfSG in 2001, only 44% (80/180 schools) of them were able to present their SOPs when requested to do so by the public health department in 2006. Complaints about bad sanitary hygiene in schools have to be confirmed, often even in recently redeveloped facilities, because of vandalism. The equipment of washing basins was improved very well during the influenza pandemic in 2009. In 2010, however, a tendency to deterioration had been observed. With data on high levels on indoor contamination (particles and CO2) in class rooms in 2006, the city increased the frequency of cleaning and launched a programme on proper ventilation in classrooms. However, a study on ventilation in 29 schools in 2009 resulted in very high levels of CO2; obviously the recommendation to ventilate the classrooms every break are neglected. Large studies on drinking water quality exhibited good data, with the exception of high Legionella contaminations in hot water systems supplying the showers in gymnasiums. Major redevelopment measures were necessary.Hygienic conditions in schools should be improved urgently. The public health departments should increase their consulting services as well as their control visits in schools - with the aim to improve hygiene in schools. Responsibility of the schools as well as of the individuals in the schools is demanded as well. More public attention to this topic seems mandatory, may be via a "signal light - red-yellow-green" for schools? © Georg Thieme Verlag KG Stuttgart · New York.

  13. Women and addiction: the importance of gender issues in substance abuse research.

    Science.gov (United States)

    Tuchman, Ellen

    2010-04-01

    Substance use was considered to be primarily a male problem, and many substance abuse studies are conducted with a predominance of male participants. However, recent substance abuse research indicates significant gender differences in the substance-related epidemiology, social factors and characteristics, biological responses, progressions to dependence, medical consequences, co-occurring psychiatric disorders, and barriers to treatment entry, retention, and completion. The epidemiology of women's drug use presents challenges separate from those raised by men's drug use. A convergence of evidence suggests that women with substance use disorders are more likely than men to face multiple barriers affecting access and entry to substance abuse treatment. Gender-specific medical problems as a result of the interplay of gender-specific drug use patterns and sex-related risk behaviors create an environment in which women are more vulnerable than men to human immunodeficiency virus. Individual characteristics and treatment approaches can differentially affect outcomes by gender. All of these differences have important clinical, treatment, and research implications.

  14. Coronary angiography after successful thrombolysis - Is the recommended time interval of 24h an important issue?

    Science.gov (United States)

    Costa, Cátia; Durão, David; Belo, Adriana; Domingues, Kevin; Santos, Beatriz; Leal, Margarida

    2016-11-01

    Percutaneous coronary intervention (PCI) is currently considered the gold-standard treatment of acute coronary syndromes with ST-segment elevation (STEMI). However, this is not the reality of many European centers, where thrombolysis is performed as primary therapy. To determine, in a STEMI population that performed successful fibrinolytic treatment, if the performance of coronary angiography after the first 24h was associated with more hospital complications, including higher mortality, compared with its performance in the recommended time. Retrospective study, including 1065 patients with STEMI, who performed successful thrombolysis. The population was divided in three groups: A, patients who didn't undergo coronary angiography after successful thrombolysis (n=278; 26.1%); B, patients who underwent coronary angiography in the first 24h after successful thrombolysis (n=127; 11.9%); and C, patients who underwent angiography after the first 24h (n=660; 62.0%). Groups were compared regarding their characteristics and in-hospital complications. Groups B and C had more male patients and had younger patients than group A. Group A presented higher Killip classes at admission, more severe left ventricle dysfunction and a higher number of complications during hospitalization. Logistic regression revealed that: 1) the non-performance of coronary angiography after thrombolysis was an independent predictor of in-hospital mortality; and 2) the performance of angiography after the recommended time wasn't associated with higher mortality. Coronary angiography after thrombolysis constitutes an important strategy, whose non-performance carries worse prognosis. The time interval currently recommended of 24h seems clinically acceptable; however, its realization outside the recommended time doesn't seem to lead to higher mortality. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Organizational culture, team climate, and quality management in an important patient safety issue: nosocomial pressure ulcers.

    Science.gov (United States)

    Bosch, Marije; Halfens, Ruud J G; van der Weijden, Trudy; Wensing, Michel; Akkermans, Reinier; Grol, Richard

    2011-03-01

    Increasingly, policy reform in health care is discussed in terms of changing organizational culture, creating practice teams, and organizational quality management. Yet, the evidence for these suggested determinants of high-quality care is inconsistent. To determine if the type of organizational culture (Competing Values Framework), team climate (Team Climate Inventory), and preventive pressure ulcer quality management at ward level were related to the prevalence of pressure ulcers. Also, we wanted to determine if the type of organizational culture, team climate, or the institutional quality management related to preventive quality management at the ward level. In this cross-sectional observational study multivariate (logistic) regression analyses were performed, adjusting for potential confounders and institution-level clustering. Data from 1274 patients and 460 health care professionals in 37 general hospital wards and 67 nursing home wards in the Netherlands were analyzed. The main outcome measures were nosocomial pressure ulcers in patients at risk for pressure ulcers (Braden score ≤ 18) and preventive quality management at ward level. No associations were found between organizational culture, team climate, or preventive quality management at the ward level and the prevalence of nosocomial pressure ulcers. Institutional quality management was positively correlated with preventive quality management at ward level (adj. β 0.32; p organizational culture, team climate, or preventive quality management at the ward level. These results would therefore not subscribe the widely suggested importance of these factors in improving health care. However, different designs and research methods (that go beyond the cross-sectional design) may be more informative in studying relations between such complex factors and outcomes in a more meaningful way. Copyright ©2010 Sigma Theta Tau International.

  16. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  17. Identifying and Solving Lead Issues from Water Systems with Materials/Device Replacement in Schools and other Buildings

    Science.gov (United States)

    Identifying and assessing lead contamination and exposure potential in single-family residences is difficult enough, but doing the same kind of assessment and remediation in buildings, schools, and day care centers is even more challenging. It is of particular importance because ...

  18. Identifying and Solving Lead Issues from Water Systems with Materials/Device Replacement in Schools and other Buildings - slides

    Science.gov (United States)

    Identifying and assessing lead contamination and exposure potential in single-family residences is difficult enough, but doing the same kind of assessment and remediation in buildings, schools, and day care centers is even more challenging. It is of particular importance because ...

  19. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  20. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  1. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  2. 75 FR 29309 - Notice of Decision to Issue Permits for the Importation of Fresh Male Summer Squash Flowers From...

    Science.gov (United States)

    2010-05-25

    ... findings of a pest risk analysis, which we made available to the public for review and comment through a... announcing the availability of a pest risk analysis that evaluates the risks associated with the importation... identified in the pest risk analysis if: (1) No comments were received on the pest risk analysis; (2) the...

  3. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  4. The Importance of Environment for the Tourism Sector Of Trnc Within The Context of Environmental Issues of the Mediterranean Region

    OpenAIRE

    Okan SAFAKLI

    2001-01-01

    The basic aim of this study is to emphasize the importance and necessity of the environment for the tourism sector of the Turkish Republic of Northern Cyprus (TRNC) within the context of environmental. issues of the Mediterranean region. There are many types of tourism such as sea tourism (sea-sand-sun), ‘congress tourism‘, ‘health tourism‘, ‘yacht tourism‘, ‘cave tourism‘, ‘mountain tourism‘, ‘farm touris’, ‘hunting touris’, ‘golf touris’, ‘caravan touris’, ‘religion tourism’ and ‘history to...

  5. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  6. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  7. Ethical issues in pragmatic randomized controlled trials: a review of the recent literature identifies gaps in ethical argumentation.

    Science.gov (United States)

    Goldstein, Cory E; Weijer, Charles; Brehaut, Jamie C; Fergusson, Dean A; Grimshaw, Jeremy M; Horn, Austin R; Taljaard, Monica

    2018-02-27

    Pragmatic randomized controlled trials (RCTs) are designed to evaluate the effectiveness of interventions in real-world clinical conditions. However, these studies raise ethical issues for researchers and regulators. Our objective is to identify a list of key ethical issues in pragmatic RCTs and highlight gaps in the ethics literature. We conducted a scoping review of articles addressing ethical aspects of pragmatic RCTs. After applying the search strategy and eligibility criteria, 36 articles were included and reviewed using content analysis. Our review identified four major themes: 1) the research-practice distinction; 2) the need for consent; 3) elements that must be disclosed in the consent process; and 4) appropriate oversight by research ethics committees. 1) Most authors reject the need for a research-practice distinction in pragmatic RCTs. They argue that the distinction rests on the presumptions that research participation offers patients less benefit and greater risk than clinical practice, but neither is true in the case of pragmatic RCTs. 2) Most authors further conclude that pragmatic RCTs may proceed without informed consent or with simplified consent procedures when risks are low and consent is infeasible. 3) Authors who endorse the need for consent assert that information need only be disclosed when research participation poses incremental risks compared to clinical practice. Authors disagree as to whether randomization must be disclosed. 4) Finally, all authors view regulatory oversight as burdensome and a practical impediment to the conduct of pragmatic RCTs, and argue that oversight procedures ought to be streamlined when risks to participants are low. The current ethical discussion is framed by the assumption that the function of research oversight is to protect participants from risk. As pragmatic RCTs commonly involve usual care interventions, the risks may be minimal. This leads many to reject the research-practice distinction and question

  8. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  9. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  11. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  12. The development of a concise questionnaire designed to measure perceived outcomes on the issues of greatest importance to patients.

    Science.gov (United States)

    Busby, M; Burke, F J T; Matthews, R; Cyrta, J; Mullins, A

    2012-04-01

    To develop a concise patient feedback audit instrument designed to inform practice development on those issues of greatest importance to patients. A literature review was used to establish the issues which were of greatest importance to patients. Ten core questions were then designed with the help of an experienced survey and polling organisation. A challenging grading of patient responses was utilised in an attempt to differentiate perceived performance within a practice on the different aspects and between practices. A feasibility study was conducted using the interactive voice response mode with seven volunteer practices in 2009. The instrument was then used in the later part of 2010 by 61 practices mostly in paper-based format. Practices received feedback which is primarily based on a bar chart plotting their percentage of top grades received against a national reference sample (NRS) compiled from the results of other participating practices. A statistical analysis was conducted to establish the level at which an individual practice result becomes statistically significant against the NRS. The 61 participating practices each received an average of 121 responses (total 7,381 responses). Seventy-four percent of responses across all ten questions received the top grade, 'ideal'. Statistical analysis indicated that at the level of 121 responses, a score of around 4-9% difference to the National Reference Sample, depending on the specific question, was statistically significant. In keeping with international experience with dental patient feedback surveys this audit suggests high levels of patient satisfaction with their dental service. Nevertheless, by focusing results on the proportion of highest grades received, this instrument is capable of indicating when perceived performance falls significantly below the average. It can therefore inform practice development.

  13. eHealth Literacy and Health Behaviors Affecting Modern College Students: A Pilot Study of Issues Identified by the American College Health Association.

    Science.gov (United States)

    Britt, Rebecca Katherine; Collins, William Bart; Wilson, Kari; Linnemeier, Georgiann; Englebert, Andrew Mark

    2017-12-19

    The eHealth Literacy Scale (eHEALS) has been widely adopted by researchers to understand how eHealth literacy can be put into context. eHealth researchers need to know how to promote positive health behavior changes across college students, given the importance of the Internet to acquire and use health information. The American College Health Association identified a set of key health issues that affect college students today. By understanding how eHEALS might be related to college students' maintenance of their health and their use of online health resources, researchers will be provided with a better understanding of eHealth literacy and its pragmatic implications for health campaigns and future interventions. The goal of the study was to examine what eHEALS reveals about college student health behaviors identified by the American College Health Association. To understand college student current health maintenance and their intentions to maintain their health and use online resources, the theory of planned behavior was used as the theoretical framework for the study. Data were collected via a survey of 422 college students that included the eHEALS measure and questions about health issues based on the recommendations of the American College Health Association. These questions asked about college student current health, subsequent use of online health resources, and their intention to maintain their health and make use of such resources in the future. eHEALS was positively and significantly associated with all 8 areas of health issues identified by the American College Health Association for college student current maintenance of health and use of online health resources and for future intention of health maintenance and use of online resources. Key issues that emerged with eHealth literacy were maintaining safe sex practices and seeking out related information, seeking out information on an exercise regime, information on vaccinations, and maintaining a balanced

  14. eHealth Literacy and Health Behaviors Affecting Modern College Students: A Pilot Study of Issues Identified by the American College Health Association

    Science.gov (United States)

    Collins, William Bart; Wilson, Kari; Linnemeier, Georgiann; Englebert, Andrew Mark

    2017-01-01

    Background The eHealth Literacy Scale (eHEALS) has been widely adopted by researchers to understand how eHealth literacy can be put into context. eHealth researchers need to know how to promote positive health behavior changes across college students, given the importance of the Internet to acquire and use health information. The American College Health Association identified a set of key health issues that affect college students today. By understanding how eHEALS might be related to college students’ maintenance of their health and their use of online health resources, researchers will be provided with a better understanding of eHealth literacy and its pragmatic implications for health campaigns and future interventions. Objective The goal of the study was to examine what eHEALS reveals about college student health behaviors identified by the American College Health Association. To understand college student current health maintenance and their intentions to maintain their health and use online resources, the theory of planned behavior was used as the theoretical framework for the study. Methods Data were collected via a survey of 422 college students that included the eHEALS measure and questions about health issues based on the recommendations of the American College Health Association. These questions asked about college student current health, subsequent use of online health resources, and their intention to maintain their health and make use of such resources in the future. Results eHEALS was positively and significantly associated with all 8 areas of health issues identified by the American College Health Association for college student current maintenance of health and use of online health resources and for future intention of health maintenance and use of online resources. Key issues that emerged with eHealth literacy were maintaining safe sex practices and seeking out related information, seeking out information on an exercise regime, information on

  15. Summary report on the FHWA LTBP Workshop to identify bridge substructure performance issues : March 4-6, 2010, in Orlando, FL.

    Science.gov (United States)

    2013-01-01

    The Long-Term Bridge Performance (LTBP) program was created to identify, collect, and analyze researchquality : data on the most critical aspects of bridge performance. To complete a thorough investigation of bridge : performance issues, the Federal ...

  16. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  17. Mapping the inbound logistics of the refineries & terminals (plants) onshore at StatoilHydro, identify main problems and issues and suggest quick wins and possible solutions

    OpenAIRE

    Julien, Ane Sofie

    2011-01-01

    Master's thesis in Firm management The aim of this paper is to identify main problems and issues in the supply chain of the inbound logistics at StatoilHydro’s onshore plants. The identification will be based on a mapping of the chain, where value added activity is in focus. The problems and issues will be evaluated and prioritized according to suggested quick wins and possible solutions will be identified. The recommended solution will be based on the elaborated theory of muda...

  18. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  19. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  20. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  1. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  2. Mothers' problem-solving skill and use of help with infant-related issues: the role of importance and need for action.

    Science.gov (United States)

    Pridham, K F; Chang, A S; Hansen, M F

    1987-08-01

    Examination was made of the relationship of mothers' appraisal of the importance of and need for action around infant-related issues to maternal experience (parity and time since birth), use of help, and perceived problem-solving competence. Sixty-two mothers (38 primiparae and 24 multiparae) kept for 90 days post-birth a daily log of issues, rated for importance and for need for action, and of help used. Mothers also reported perceived problem-solving competence on an 11-item scale. Findings indicated tentativeness in ratings of importance and action. Ratings of importance were associated with action ratings, except for temperament issues. Action ratings for baby care and illness issues decreased significantly with time. Otherwise, maternal experience had no effect on ratings. More of the variance in perceived competence than use of help was explained by action and importance ratings.

  3. Scientific Issues Relevant to Setting Regulatory Criteria to Identify Endocrine-Disrupting Substances in the European Union.

    Science.gov (United States)

    Slama, Rémy; Bourguignon, Jean-Pierre; Demeneix, Barbara; Ivell, Richard; Panzica, Giancarlo; Kortenkamp, Andreas; Zoeller, R Thomas

    2016-10-01

    Endocrine disruptors (EDs) are defined by the World Health Organization (WHO) as exogenous compounds or mixtures that alter function(s) of the endocrine system and consequently cause adverse effects in an intact organism, or its progeny, or (sub)populations. European regulations on pesticides, biocides, cosmetics, and industrial chemicals require the European Commission to establish scientific criteria to define EDs. We address the scientific relevance of four options for the identification of EDs proposed by the European Commission. Option 1, which does not define EDs and leads to using interim criteria unrelated to the WHO definition of EDs, is not relevant. Options 2 and 3 rely on the WHO definition of EDs, which is widely accepted by the scientific community, with option 3 introducing additional categories based on the strength of evidence (suspected EDs and endocrine-active substances). Option 4 adds potency to the WHO definition, as a decision criterion. We argue that potency is dependent on the adverse effect considered and is scientifically ambiguous, and note that potency is not used as a criterion to define other particularly hazardous substances such as carcinogens and reproductive toxicants. The use of potency requires a context that goes beyond hazard identification and corresponds to risk characterization, in which potency (or, more relevantly, the dose-response function) is combined with exposure levels. There is scientific agreement regarding the adequacy of the WHO definition of EDs. The potency concept is not relevant to the identification of particularly serious hazards such as EDs. As is common practice for carcinogens, mutagens, and reproductive toxicants, a multi-level classification of ED based on the WHO definition, and not considering potency, would be relevant (corresponding to option 3 proposed by the European Commission). Slama R, Bourguignon JP, Demeneix B, Ivell R, Panzica G, Kortenkamp A, Zoeller RT. 2016. Scientific issues relevant

  4. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  5. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  6. Public Health Insurance in Vietnam towards Universal Coverage: Identifying the challenges, issues, and problems in its design and organizational practices

    OpenAIRE

    Midori Matsushima; Hiroyuki Yamada

    2013-01-01

    Vietnam is attempting to achieve universal health insurance coverage by 2014. Despite great progress, the country faces some challenges, issues and problems. This paper reviewed official documents, existing reports, and related literature to address: (1) grand design for achieving universal health coverage, (2) current insurance coverage, (3) health insurance premium and subsidies by the government, (4) benefit package and payment rule, and (5) organizational practices. From the review, it be...

  7. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  8. 78 FR 13304 - Notice of Decision To Issue Permits for the Importation of Strawberry Fruit From Egypt Into the...

    Science.gov (United States)

    2013-02-27

    ... continental United States of fresh strawberry fruit from Egypt. Based on the findings of a pest risk analysis... importation of commodities that, based on the findings of a pest risk analysis (PRA), can be safely imported... risks of introducing or disseminating plant pests or noxious weeds via the importation of fresh...

  9. Quality Issues Identified During the Evaluation of Biosimilars by the European Medicines Agency's Committee for Medicinal Products for Human Use.

    Science.gov (United States)

    Cilia, Mark; Ruiz, Sol; Richardson, Peter; Salmonson, Tomas; Serracino-Inglott, Anthony; Wirth, Francesca; Borg, John Joseph

    2018-02-01

    The aim of this study was to identify trends in deficiencies raised during the EU evaluation of the quality part of dossiers for marketing authorisation applications of biosimilar medicinal products. All adopted day 120 list of questions on the quality module of 22 marketing authorisation applications for biosimilars submitted to the European Medicines Agency and concluded by the end of October 2015 was analysed. Frequencies of common deficiencies identified were calculated and summarised descriptions included. Frequencies and trends on quality deficiencies were recorded and presented for 22 biosimilar applications. Thirty-two 'major objections' for 9 products were identified from 14 marketing authorisation applications with 15 raised for drug substance and 17 for drug product. In addition, 547 'other concerns' for drug substance and 495 for drug product were also adopted. The frequencies and trends of the identified deficiencies together with their impact were discussed from a regulatory perspective and how these impact key manufacturing processes and key materials used in the production of biosimilars. This study provides an insight to the regulatory challenges prospective companies need to consider when developing biosimilars; it also helps elucidate common pitfalls in the development and production of biosimilars and in the submission of dossiers for their marketing authorisations. The results are expected to be of interest to pharmaceutical companies but also to regulators to obtain consistent information on medicinal products based on transparent rules safeguarding the necessary pharmaceutical quality of medicinal products.

  10. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  11. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  12. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  13. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  14. 77 FR 29588 - Notice of Decision To Issue Permits for the Importation of Fresh Celery, Arugula, and Spinach...

    Science.gov (United States)

    2012-05-18

    ..., arugula, and spinach from Colombia. Based on the findings of three pest risk analyses, which we made..., based on the findings of a pest risk analysis (PRA), can be safely imported subject to one or more of... or disseminating plant pests or noxious weeds via the importation of fresh celery, arugula, and...

  15. Decision tool for clients with medical issues: a framework for identifying driving risk and potential to return to driving.

    Science.gov (United States)

    Dickerson, Anne E; Bédard, Michel

    2014-04-01

    This paper offers occupational therapy generalists and specialists a new framework by which to consider clinical evaluation data and an older adult's driving risk and potential to resume this previously learned skill. Based on Michon's model describing the hierarchy of driving levels, clinical questions identify the factors that may affect a client's fitness to drive. The first part is intended to support clinical judgment of whether a client needs a driving evaluation by a driver rehabilitation specialist. The second part offers a framework to organize clinical data that are already known and determine what other evaluation information is justified and necessary to make a driving recommendation. Methods and rational for use are discussed.

  16. Fuels planning: science synthesis and integration; social issues fact sheet 06: Important considerations for communicating about hazards

    Science.gov (United States)

    Rocky Mountain Research Station USDA Forest Service

    2004-01-01

    Effective public education and communication campaigns about wildland fire and fuels management should have clear objectives, and use the right techniques to achieve these objectives. This fact sheet lists seven important considerations for planning or implementing a hazard communication effort.

  17. 75 FR 56981 - Notice of Decision To Issue Permits for the Importation of Sweet Limes From Mexico Into the...

    Science.gov (United States)

    2010-09-17

    ... United States of sweet limes from Mexico. Based on the findings of a pest risk analysis, which we made... notice in the Federal Register announcing the availability of a pest risk analysis that evaluates the... to the risk-mitigation measures identified in the pest risk analysis if: (1) No comments were...

  18. The prospects for large-scale import of biomass and biofuels to Sweden - A review of critical issues

    International Nuclear Information System (INIS)

    Hansson, Julia; Berndes, Goeran; Boerjesson, Paal

    2006-01-01

    Sweden is one of the biggest consumers of both domestic and imported biofuels in the EU. This paper evaluates the prospects for an increased and large-scale import of biofuels to Sweden in the future. The parameters included are prospective Swedish and global biofuel supply and demand, the cost, energy input and environmental impact of long-distance biofuel transport as well as the capacity of global freight and of Swedish ports to handle increased biofuel flows. The Swedish bioenergy potential seems large enough to accommodate a substantial increase in the domestic use of biofuels. However, an extensive import of biofuel feedstock would be needed for a prospective Swedish biofuel industry to be able to export substantial volumes of biofuels. The costs, including transport, of imported biofuels from regions, where the assessed potential supply of biomass are higher than the estimated future regional demand, are estimated to be equivalent to or lower than current costs of domestic biofuels. But the price is dependent on future competition for biofuels as well as freight and port capacity. Current specialization at Swedish ports may in the short term be an obstacle to a rapid increase in biofuel import. The energy input in long-distance biofuel transport is estimated to be low. However, to make large-scale biofuel trade flows acceptable special attention needs to be paid, e.g., to the impact on biodiversity and socioeconomic conditions in the exporting countries

  19. 76 FR 18511 - Notice of Decision To Issue Permits for the Importation of Fresh Figs From Chile into the...

    Science.gov (United States)

    2011-04-04

    ... United States of fresh figs from Chile. Based on the findings of a pest risk analysis, which we made... the findings of a pest risk analysis, can be safely imported subject to one or more of the designated... the Federal Register announcing the availability of the pest risk analysis that evaluates the risks...

  20. 75 FR 52712 - Notice of Decision To Issue Permits for the Importation of Fresh Mango Fruit From Pakistan Into...

    Science.gov (United States)

    2010-08-27

    ... continental United States of fresh mango fruit from Pakistan. Based on the findings of a pest risk analysis..., based on the findings of a pest risk analysis, can be safely imported subject to one or more of the... publishes a notice in the Federal Register announcing the availability of the pest risk analysis that...

  1. 75 FR 34687 - Notice of Decision to Issue Permits for the Importation of Fresh False Coriander From Panama Into...

    Science.gov (United States)

    2010-06-18

    ... continental United States of fresh false coriander from Panama. Based on the findings of a pest risk analysis..., based on the findings of a pest- risk analysis, can be safely imported subject to one or more of the... publishes a notice in the Federal Register announcing the availability of the pest risk analysis that...

  2. 75 FR 26707 - Notice of Decision to Issue Permits for the Importation of Fresh Pomegranates and Baby Kiwi from...

    Science.gov (United States)

    2010-05-12

    ... commodities that, based on the findings of a pest risk analysis, can be safely imported subject to one or more..., APHIS publishes a notice in the Federal Register announcing the availability of the pest risk analysis... pest risk analysis; (2) the comments on the pest risk analysis revealed that no changes to the pest...

  3. Stakeholders Perspectives on the Success Drivers in Ghana’s National Health Insurance Scheme – Identifying Policy Translation Issues

    Science.gov (United States)

    Fusheini, Adam; Marnoch, Gordon; Gray, Ann Marie

    2017-01-01

    Background: Ghana’s National Health Insurance Scheme (NHIS), established by an Act of Parliament (Act 650), in 2003 and since replaced by Act 852 of 2012 remains, in African terms, unprecedented in terms of growth and coverage. As a result, the scheme has received praise for its associated legal reforms, clinical audit mechanisms and for serving as a hub for knowledge sharing and learning within the context of South-South cooperation. The scheme continues to shape national health insurance thinking in Africa. While the success, especially in coverage and financial access has been highlighted by many authors, insufficient attention has been paid to critical and context-specific factors. This paper seeks to fill that gap. Methods: Based on an empirical qualitative case study of stakeholders’ views on challenges and success factors in four mutual schemes (district offices) located in two regions of Ghana, the study uses the concept of policy translation to assess whether the Ghana scheme could provide useful lessons to other African and developing countries in their quest to implement social/NHISs. Results: In the study, interviewees referred to both ‘hard and soft’ elements as driving the "success" of the Ghana scheme. The main ‘hard elements’ include bureaucratic and legal enforcement capacities; IT; financing; governance, administration and management; regulating membership of the scheme; and service provision and coverage capabilities. The ‘soft’ elements identified relate to: the background/context of the health insurance scheme; innovative ways of funding the NHIS, the hybrid nature of the Ghana scheme; political will, commitment by government, stakeholders and public cooperation; social structure of Ghana (solidarity); and ownership and participation. Conclusion: Other developing countries can expect to translate rather than re-assemble a national health insurance programme in an incomplete and highly modified form over a period of years

  4. Stakeholders Perspectives on the Success Drivers in Ghana’s National Health Insurance Scheme – Identifying Policy Translation Issues

    Directory of Open Access Journals (Sweden)

    Adam Fusheini

    2017-05-01

    Full Text Available Background Ghana’s National Health Insurance Scheme (NHIS, established by an Act of Parliament (Act 650, in 2003 and since replaced by Act 852 of 2012 remains, in African terms, unprecedented in terms of growth and coverage. As a result, the scheme has received praise for its associated legal reforms, clinical audit mechanisms and for serving as a hub for knowledge sharing and learning within the context of South-South cooperation. The scheme continues to shape national health insurance thinking in Africa. While the success, especially in coverage and financial access has been highlighted by many authors, insufficient attention has been paid to critical and context-specific factors. This paper seeks to fill that gap. Methods Based on an empirical qualitative case study of stakeholders’ views on challenges and success factors in four mutual schemes (district offices located in two regions of Ghana, the study uses the concept of policy translation to assess whether the Ghana scheme could provide useful lessons to other African and developing countries in their quest to implement social/NHISs. Results In the study, interviewees referred to both ‘hard and soft’ elements as driving the “success” of the Ghana scheme. The main ‘hard elements’ include bureaucratic and legal enforcement capacities; IT; financing; governance, administration and management; regulating membership of the scheme; and service provision and coverage capabilities. The ‘soft’ elements identified relate to: the background/context of the health insurance scheme; innovative ways of funding the NHIS, the hybrid nature of the Ghana scheme; political will, commitment by government, stakeholders and public cooperation; social structure of Ghana (solidarity; and ownership and participation. Conclusion Other developing countries can expect to translate rather than re-assemble a national health insurance programme in an incomplete and highly modified form over a period

  5. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  6. Identifying issue frames in text.

    Directory of Open Access Journals (Sweden)

    Eyal Sagi

    Full Text Available Framing, the effect of context on cognitive processes, is a prominent topic of research in psychology and public opinion research. Research on framing has traditionally relied on controlled experiments and manually annotated document collections. In this paper we present a method that allows for quantifying the relative strengths of competing linguistic frames based on corpus analysis. This method requires little human intervention and can therefore be efficiently applied to large bodies of text. We demonstrate its effectiveness by tracking changes in the framing of terror over time and comparing the framing of abortion by Democrats and Republicans in the U.S.

  7. Variation in Anatomical Position of Vermiform Appendix among Iranian Population: An Old Issue Which Has Not Lost Its Importance

    Directory of Open Access Journals (Sweden)

    Ahmad Ghorbani

    2014-01-01

    Full Text Available Vermiform appendix has diverse anatomical positions, lengths, and conditions of mesoappendix. Knowing the exact anatomical position of vermiform appendix is important in view of surgeons for on-time diagnosis and management of acute appendicitis. The aim of present study is determination of these characteristics of vermiform appendix among Iranian population. The present study was conducted on 200 bodies, selected from the dead bodies that had been referred to local bureau of legal medicine, Zenjan province, Iran, for medicolegal autopsy since 21 Mar 2010 to 21 Mar 2011. According to the results, the anatomical positions of the appendix were pelvic, subcecal, retroileal, retrocecal, ectopic, and preileal in 55.8%, 19%, 12.5%, 7%, 4.2%, and 1.5% of the bodies, respectively. The mean length of vermiform appendix was 91.2 mm and 80.3 mm in men and women, respectively. Mesoappendix was complete in 79.5% of the bodies. No association was found between sex and anatomical position of vermiform appendix. Anterior anatomical position was the most common position for vermiform appendix. It is inconsistent with most related reports from western countries. It might be possible that some factors, such as race, geographical changes, and dietary habits, play roles in determining the position of vermiform appendix.

  8. Using Community-Based Participatory Research to Identify Environmental Justice Issues in an Inner-City Community and Inform Urban Planning.

    Science.gov (United States)

    Mansyur, Carol Leler; Jeng, Hueiwang Anna; Holloman, Erica; DeBrew, Linwood

    2016-01-01

    The Southeast CARE Coalition has been using community-based participatory research to examine environmental degradation in the Southeast Community, Newport News, Virginia. A survey was developed to collect assessment data. Up to 66% of respondents were concerned about environmental problems in their community. Those with health conditions were significantly more likely to identify specific environmental problems. The top 5 environmental concerns included coal dust, air quality, crime, water quality, and trash. The community-based participatory research process is building community capacity and participation, providing community input into strategic planning, and empowering community members to take control of environmental justice issues in their community.

  9. Molten Salts for High Temperature Reactors: University of Wisconsin Molten Salt Corrosion and Flow Loop Experiments -- Issues Identified and Path Forward

    Energy Technology Data Exchange (ETDEWEB)

    Piyush Sabharwall; Matt Ebner; Manohar Sohal; Phil Sharpe; Thermal Hydraulics Group

    2010-03-01

    Considerable amount of work is going on regarding the development of high temperature liquid salts technology to meet future process needs of Next Generation Nuclear Plant. This report identifies the important characteristics and concerns of high temperature molten salts (with lesson learned at University of Wisconsin-Madison, Molten Salt Program) and provides some possible recommendation for future work

  10. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  11. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  12. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  13. Ascribing beliefs to ingroup and outgroup political candidates: neural correlates of perspective-taking, issue importance and days until the election.

    Science.gov (United States)

    Falk, Emily B; Spunt, Robert P; Lieberman, Matthew D

    2012-03-05

    We used the five weeks leading up to the 2008 presidential election as a backdrop to examine the ways that the brain processes attitudes and beliefs under different circumstances. We examined individual differences in personal issue importance and trait perspective-taking, as well as the temporal context in which attitude representation took place (i.e. number of days until the election). Finally, we examined the extent to which similar or dissimilar processes were recruited when considering the attitudes of political ingroup and outgroup candidates. Brain regions involved in social cognition and theory of mind, and to a lesser extent the limbic system, were modulated by these factors. Higher issue importance led to greater recruitment of neural regions involved in social cognition, across target perspectives. Higher trait perspective-taking was also associated with greater recruitment of several regions involved in social cognition, but differed depending on target perspective; greater activity was observed in prefrontal regions associated with social cognition when considering the perspective of one's own candidate compared with the opponent, and this effect was amplified closer to the election. Taken together, these results highlight ways in which ability and motivational relevance modulate socio-affective processing of the attitudes of others.

  14. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  15. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  16. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  17. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  18. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  19. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  1. Transmission issues

    International Nuclear Information System (INIS)

    Bradford, J.; Wilson, L.; Thon, S.; Millar, N.

    2005-01-01

    This session on transmission issues focused on the role that transmission plays in electricity markets and the importance of getting the market structure right in terms of generation divestiture with buy back contracts, demand side responsive programs, transmission upgrades and long term contracts. The difficulties of distinguishing between market power and scarcity were examined along with some of the complications that ensue if transmission experiences congestion, as exemplified by the August 2003 blackout in eastern North America. The presentations described the best ways to handle transmission issues, and debated whether transmission should be deregulated or follow market forces. Issues of interconnections and reliability of connections were also debated along with the attempt to integrate renewables into the grid. Some presentations identified what new transmission must be built and what must be done to ensure that transmission gets built. The challenges and business opportunities for transmission in Alberta were discussed with reference to plans to invest in new infrastructure, where it is going outside of the province and how it works with other jurisdictions. Manitoba's Conawapa Hydro Project and its 2000 MW tie line to Ontario was also discussed. Some examples of non-optimal use of interconnections in Europe were also discussed in an effort to learn from these mistakes and avoid them in Canada. tabs., figs

  2. A working procedure for identifying emerging food safety issues at an early stage: Implications for European and international risk management practices

    NARCIS (Netherlands)

    Marvin, H.J.P.; Kleter, G.A.; Frewer, L.J.; Cope, S.F.; Wentholt, M.T.A.; Rowe, G.

    2009-01-01

    There is a need for early identification of emerging food safety issues in order to prevent them from developing into health risks. In this paper, various existing methods and procedures which can be used for early identification of safety issues are reviewed, including the monitoring of the

  3. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  4. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  5. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  6. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  7. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  8. A systematic review of methodology applied during preclinical anesthetic neurotoxicity studies: important issues and lessons relevant to the design of future clinical research.

    Science.gov (United States)

    Disma, Nicola; Mondardini, Maria C; Terrando, Niccolò; Absalom, Anthony R; Bilotta, Federico

    2016-01-01

    Preclinical evidence suggests that anesthetic agents harm the developing brain thereby causing long-term neurocognitive impairments. It is not clear if these findings apply to humans, and retrospective epidemiological studies thus far have failed to show definitive evidence that anesthetic agents are harmful to the developing human brain. The aim of this systematic review was to summarize the preclinical studies published over the past decade, with a focus on methodological issues, to facilitate the comparison between different preclinical studies and inform better design of future trials. The literature search identified 941 articles related to the topic of neurotoxicity. As the primary aim of this systematic review was to compare methodologies applied in animal studies to inform future trials, we excluded a priori all articles focused on putative mechanism of neurotoxicity and the neuroprotective agents. Forty-seven preclinical studies were finally included in this review. Methods used in these studies were highly heterogeneous-animals were exposed to anesthetic agents at different developmental stages, in various doses and in various combinations with other drugs, and overall showed diverse toxicity profiles. Physiological monitoring and maintenance of physiological homeostasis was variable and the use of cognitive tests was generally limited to assessment of specific brain areas, with restricted translational relevance to humans. Comparison between studies is thus complicated by this heterogeneous methodology and the relevance of the combined body of literature to humans remains uncertain. Future preclinical studies should use better standardized methodologies to facilitate transferability of findings from preclinical into clinical science. © 2015 John Wiley & Sons Ltd.

  9. The importance of working capital management for hospital profitability: evidence from bond-issuing, not-for-profit U.S. hospitals.

    Science.gov (United States)

    Rauscher, Simone; Wheeler, John R C

    2012-01-01

    Increased financial pressures on hospitals have elevated the importance of working capital management, that is, the management of current assets and current liabilities, for hospitals' profitability. Efficient working capital management allows hospitals to reduce their holdings of current assets, such as inventory and accounts receivable, which earn no interest income and require financing with short-term debt. The resulting cash inflows can be reinvested in interest-bearing financial instruments or used to reduce short-term borrowing, thus improving the profitability of the organization. This study examines the relationship between hospitals' profitability and their performance at managing two components of working capital: accounts receivable, measured in terms of hospitals' average collection periods, and accounts payable, measured in terms of hospitals' average payment periods. Panel data derived from audited financial statements for 1,397 bond-issuing, not-for-profit U.S. hospitals for 2000-2007 were analyzed using hospital-level fixed-effects regression analysis. The results show a negative relationship between hospitals' average collection period and profitability. That is, hospitals that collected on their patient revenue faster reported higher profit margins than did hospitals that have larger balances of accounts receivable outstanding. We also found a negative relationship between hospitals' average payment period and their profitability. Hospital managers did not appear to delay paying their vendors. Rather, the findings indicated that more profitable hospitals paid their suppliers faster, possibly to avoid high effective interest rates on outstanding accounts payable, whereas less profitable hospitals waited longer to pay their bills. The findings of this study suggest that working capital management indeed matters for hospitals' profitability. Efforts aimed at reducing large balances in both accounts receivable and accounts payable may frequently be

  10. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  11. Development and application of the Safe Performance Index as a risk-based methodology for identifying major hazard-related safety issues in underground coal mines

    Science.gov (United States)

    Kinilakodi, Harisha

    The underground coal mining industry has been under constant watch due to the high risk involved in its activities, and scrutiny increased because of the disasters that occurred in 2006-07. In the aftermath of the incidents, the U.S. Congress passed the Mine Improvement and New Emergency Response Act of 2006 (MINER Act), which strengthened the existing regulations and mandated new laws to address the various issues related to a safe working environment in the mines. Risk analysis in any form should be done on a regular basis to tackle the possibility of unwanted major hazard-related events such as explosions, outbursts, airbursts, inundations, spontaneous combustion, and roof fall instabilities. One of the responses by the Mine Safety and Health Administration (MSHA) in 2007 involved a new pattern of violations (POV) process to target mines with a poor safety performance, specifically to improve their safety. However, the 2010 disaster (worst in 40 years) gave an impression that the collective effort of the industry, federal/state agencies, and researchers to achieve the goal of zero fatalities and serious injuries has gone awry. The Safe Performance Index (SPI) methodology developed in this research is a straight-forward, effective, transparent, and reproducible approach that can help in identifying and addressing some of the existing issues while targeting (poor safety performance) mines which need help. It combines three injury and three citation measures that are scaled to have an equal mean (5.0) in a balanced way with proportionate weighting factors (0.05, 0.15, 0.30) and overall normalizing factor (15) into a mine safety performance evaluation tool. It can be used to assess the relative safety-related risk of mines, including by mine-size category. Using 2008 and 2009 data, comparisons were made of SPI-associated, normalized safety performance measures across mine-size categories, with emphasis on small-mine safety performance as compared to large- and

  12. Psychosocial Issues in Geriatric Rehabilitation.

    Science.gov (United States)

    Rodriguez, Ricardo M

    2017-11-01

    Geriatric patients present multiple age-related challenges and needs that must be taken into account during the rehabilitation process to achieve expected goals. This article examines the importance of identifying and managing psychosocial issues commonly observed in older adults and presents strategies to optimize their rehabilitation process. Depression, anxiety, fear of falling, adjustment issues, neurocognitive disorders, and caregiver support are discussed as a selection of factors that are relevant for geriatric patients undergoing rehabilitation. An argument is made for the importance of comprehensive geriatric assessment in older adults to identify salient issues that may impact rehabilitation and quality of life. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. High levels of incorrect use of car seat belts and child restraints in Fife--an important and under-recognised road safety issue.

    Science.gov (United States)

    Campbell, H; Macdonald, S; Richardson, P

    1997-03-01

    To pilot data collection instruments and to make a preliminary estimate of the level of incorrect use of car seat belts and child restraints in Fife, Scotland. Cross sectional survey of cars containing adults and children at a number of public sites across Fife in 1995 to assess use of car occupant restraints. Trained road safety officers assessed whether seat restraints were appropriate for the age of the passengers and whether restraints were used correctly. These assessments were based on standards published by the Child Accident Prevention Trust. The survey gathered data from 596 occupants in 180 cars: 327 adults and 269 children. Ten per cent of drivers who were approached refused to participate. Car occupant restraint was assessed in 180 drivers, 151 front seat passengers, and 265 rear seat passengers. Three hundred and sixty one occupants wore seat belts, 68 were restrained by a seat belt and booster cushion, 63 in toddler seats, 25 in two way seats, and 18 in rear facing infant carriers. Ninety seven per cent of drivers, 95% of front seat passengers, and 77% of rear seat passengers were restrained. However, in 98 (52%) vehicles at least one passenger was restrained by a device that was used incorrectly. Seven per cent of adults and 28% of children were secured incorrectly. The commonest errors were loose seat belts and restraint devices not adequately secured to the seat. Rates of incorrect use were highest in child seat restraints, reaching 60% with two way seats and 44% with rear facing infant seats. The incorrect use of car occupant restraints is an under-recognised problem, both by health professionals, and the general public. Incorrect use has been shown to reduce the effectiveness of restraints, can itself result in injury, and is likely to be an important factor in child passenger injuries. The correct use of car seat restraints merits greater attention in strategies aiming to reduce road traffic casualties. Areas of intervention that could be

  14. Music Therapy and Spiritual Care in End-of-Life: A Qualitative Inquiry into Ethics and Training Issues Identified by Chaplains and Music Therapists.

    Science.gov (United States)

    Masko, Meganne K

    2016-01-01

    Music therapists are increasingly employed by hospices. As such, they are often called upon to provide additional spiritual care to patients receiving end-of-life care. However, researchers have not yet examined the appropriateness of music therapists providing spiritual care as part of the hospice team, or ethics and training issues related to music therapist-led spiritual care. The purpose of this study was to explore the thoughts and attitudes of hospice chaplains and music therapists (MTs) about ethics and training issues related to music therapists providing spiritual care as part of the hospice interdisciplinary team. The study used semi-structured interviews with a purposive sample of music therapists and chaplains specializing in hospice care as part of a larger exploratory mixed methods study. Each interview was recorded, transcribed, and analyzed using a two-step process including both a modified phenomenological inductive approach and thematic analysis. Participants discussed ethics and training issues related to the provision of music therapist-led spiritual care as part of the hospice team. These issues included scope of practice, cultural competence and maintaining personal boundaries, and spiritual care training topics such as educational content and educational methods. While it was clear that both chaplains and music therapists felt it was appropriate for music therapists to provide spiritual care as part of the hospice team, there is a need for formal and informal spiritual care training for music therapists doing this type of work. Training should potentially include information about comparative religions, cultural competence, scope of practice, and maintaining personal boundaries. © the American Music Therapy Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  16. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  17. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  18. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  19. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  20. Identifying important life stages for monitoring and assessing risks from exposures to environmental contaminants: results of a World Health Organization review.

    Science.gov (United States)

    Cohen Hubal, Elaine A; de Wet, Thea; Du Toit, Lilo; Firestone, Michael P; Ruchirawat, Mathuros; van Engelen, Jacqueline; Vickers, Carolyn

    2014-06-01

    In this paper, we summarize exposure-related issues to consider in determining the most appropriate age ranges and life stages for risk assessment. We then propose a harmonized set of age bins for monitoring and assessing risks from exposures to chemicals for global use. The focus is on preconception through adolescence, though the approach should be applicable to additional life stages. A two-tiered set of early life age groups is recommended. The first tier involves the adoption of guidance similar to the childhood age groups recommended by the U.S. Environmental Protection Agency, whereas the second tier consolidates some of those age groups to reduce the burden of developing age-specific exposure factors for different regions. While there is no single "correct" means of choosing a common set of age groups to use internationally in assessing early life exposure and risk, use of a set of defined age groups is recommended to facilitate comparisons of potential exposures and risks around the globe, the collection of data and analyses of aggregate exposure and cumulative risk. Application of these age groups for robust assessment of exposure and risk for specific populations will require region-specific exposure factors as well as local environmental monitoring data. Copyright © 2013 World Health Organization. Published by Elsevier Inc. All rights reserved.

  1. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  2. The transportation issue management system: A tool for issue resolution

    International Nuclear Information System (INIS)

    Branch, K.M.; Boryczka, M.K.

    1987-01-01

    During the last decade, issue management programs have been developed and used by a number of large corporations in the United States. These systems have generally been designed to help senior program managers identify issues, develop strategic plans, and resolve issues. These systems involve scanning and abstracting literature to create a database that is then used for 1) issue identification, 2) issue analysis, 3) priority assessment, 4) development of corporate position/strategic options, and 5) action planning and implementation. Most of the existing systems rely on staff to identify trends in the computerized output, analyze the importance of the issue to the company, and assist in developing corporate responses. The Department of Energy has recently developed an issue management system for the Office of Civilian Radioactive Waste Management's (OCRWM) transportation program. This system is designed to help DOE identify institutional issues related to radioactive waste transportation, analyze the issues, and resolve them in a manner that is responsive to interested parties. The system will contain pertinent information from DOE technical reports, other federal documents, correspondence, professional journals, popular literature, newsclips, legislation and testimony. The program is designed around a number of institutional issues including: prenotification, physical protection procedures; highway, rail, and barge routing; inspections and enforcement of shipments; emergency response; liability, cask design and testing; overweight trucks; rail service; modal mix; infrastructure improvements; training standards, and operational procedures

  3. Identifying and Supporting English Learner Students with Learning Disabilities: Key Issues in the Literature and State Practice. REL 2015-086

    Science.gov (United States)

    Burr, Elizabeth; Haas, Eric; Ferriere, Karen

    2015-01-01

    While the literature on learning disabilities and on second-language acquisition is relatively extensive within the field of education, less is known about the specific characteristics and representation of English learner students with learning disabilities. Because there are no definitive resources and processes for identifying and determining…

  4. Identifying Demographic and Academic Issues that Influence the Passing or Failing of the Physiology Course in the Medicine Study Program of UCIMED (University of Medical Sciences

    Directory of Open Access Journals (Sweden)

    Juan Carlos Vanegas-Pissa

    2015-05-01

    Full Text Available (This paper, product of a research project, analyzes some academic and demographic issues that might influence students passing or failing Physiology in the Licentiate Study Program in Medicine and Surgery at UCIMED (University of Medical Sciences between 2008 and 2011. This was a retrospective cohort study. We analyzed the grades obtained by the students who were taking Physiology for the first, second or third time during the research period, the semesters in which the grades were obtained, who passed or failed the course, their sociodemographic characteristics, and other courses passed or failed previously with their corresponding grades. For the data analysis, we used the Stata 13 software (Data Analysis and Statistical Software with a logistic regression model to determine the variables, which explain the passing or failing of the Physiology course. The results showed that the variables with a greater effect on the probability of p

  5. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  6. A Framework for Identifying and Analyzing Major Issues in Implementing Big Data and Data Analytics in E-Learning: Introduction to Special Issue on Big Data and Data Analytics

    Science.gov (United States)

    Corbeil, Maria Elena; Corbeil, Joseph Rene; Khan, Badrul H.

    2017-01-01

    Due to rapid advancements in our ability to collect, process, and analyze massive amounts of data, it is now possible for educational institutions to gain new insights into how people learn (Kumar, 2013). E-learning has become an important part of education, and this form of learning is especially suited to the use of big data and data analysis,…

  7. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  8. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  9. Green knowledge exchange Turkey-The Netherlands : priority issues identified for cooperation in the field of biodiversity protection and conservation : interviews with experts from Governmental and Non-Governmental Organisations based in Turkey and based in The Netherlands

    NARCIS (Netherlands)

    Klok, C.; Koopmanschap, E.M.J.

    2009-01-01

    As a consequence of its geographical location Turkey is very rich in biodiversity; its flora is richest, both in terms of overall plant diversity and level of endemism compared to Europe, North Africa, or countries in the Middle East. This report gives an overview of important biodiversity issues in

  10. Movement Issues Identified in Movement ABC2 Checklist Parent Ratings for Students with Persisting Dysgraphia, Dyslexia, and OWL LD and Typical Literacy Learners

    Science.gov (United States)

    Nielsen, Kathleen; Henderson, Sheila; Barnett, Anna L.; Abbott, Robert D.; Berninger, Virginia

    2018-01-01

    Movement, which draws on motor skills and executive functions for managing them, plays an important role in literacy learning (e.g., movement of mouth during oral reading and movement of hand and fingers during writing); but relatively little research has focused on movement skills in students with specific learning disabilities as the current…

  11. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  12. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  13. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  14. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  15. Telemedicine: licensing and other legal issues.

    Science.gov (United States)

    Siegal, Gil

    2011-12-01

    The growth of information technology and telecommunications has created promising opportunities for better, faster, more accessible, barrier-free health care; telemedicine (TM). The feasibility of many TM projects depends on resolving legal issues. Mastering technical issues or providing training remain important benchmarks for implementation of TM, but legal issues constrain progress. This article identifies the key legal issues, maps current legislation, and offers a forecast of necessary steps to expedite the dissemination of TM. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  17. Labonté Identifies Key Issues for Health Promoters in the New World Order Comment on "Health Promotion in an Age of Normative Equity and Rampant Inequality".

    Science.gov (United States)

    Raphael, Dennis Raphael

    2016-11-02

    For over 35 years Ronald Labonté has been critically analyzing the state of health promotion in Canada and the world. In 1981, he identified the shortcomings of the groundbreaking Lalonde Report by warning of the seductive appeal of so-called lifestyle approaches to health. Since then, he has left a trail of critical work identifying the barriers to - and opportunities for -health promotion work. More recently, he has shown how the rise of economic globalization and acceptance of neo-liberal ideology has come to threaten the health of those in both developed and developing nations. In his recent commentary, Labonté shows how the United Nations' 2015 Sustainable Development Goals (SDGs) can offer a new direction for health promoters in these difficult times. © 2017 The Author(s); Published by Kerman University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

  18. Issues and Importance of "Good" Starting Points for Nonlinear Regression for Mathematical Modeling with Maple: Basic Model Fitting to Make Predictions with Oscillating Data

    Science.gov (United States)

    Fox, William

    2012-01-01

    The purpose of our modeling effort is to predict future outcomes. We assume the data collected are both accurate and relatively precise. For our oscillating data, we examined several mathematical modeling forms for predictions. We also examined both ignoring the oscillations as an important feature and including the oscillations as an important…

  19. Towards Homo Digitalis: Important Research Issues for Psychology and the Neurosciences at the Dawn of the Internet of Things and the Digital Society

    Directory of Open Access Journals (Sweden)

    Christian Montag

    2018-02-01

    Full Text Available The present article gives an overview on central challenges humans face at the dawn of complex digital societies and the Internet of Things (IoT, i.e., a world completely connected to the Internet. Among the many challenges to be handled in digital societies is a growing fragmented life style leading to loss of productivity as well as moments for self-reflection. In all this, it is of tremendous importance to understand the impact of digital worlds on our brains and psyches and to reveal possible unintended side-effects of technology use. Does human nature change due to constant interactions with virtual realities? In this context, we also face the challenge to design digital worlds according to our mammalian-emotional heritage deeply anchored in subcortical areas of the human brain. Here, we refer to emotional needs as carved out by Panksepp’s Affective Neuroscience Theory and how they can or cannot be fulfilled in digital worlds. Aside from a review of several key studies dealing with the raised challenges, some first solutions to successfully meet the mentioned problems are provided to achieve sustainable and healthy digital worlds, with whom humans can interact carefree on a daily basis.

  20. Progress on resolution of major surety issues

    International Nuclear Information System (INIS)

    Bell, C.R.; Boudreau, J.M.

    1985-01-01

    This paper presents a summary of the major surety issues (safety, environmental protection, sageguards, reliability, quality assurance) that have been identified during Phase I of the SP-100 Program and the progress that has been made in analyzing the most important of these issues in the context of the conceptual design effort. These issues have been identified as inadvertent criticality, toxic material release and dispersion, radiation exposure following end-of-life reentry, potential diversion of special nuclear material, failure to achieve end-of-life neutronic shutdown, and structural predictability for end-of-life re-entry or boost. Because of the complexity of these issues, a simplified conservative approach was taken during Phase I. Progress on these issues has been mainly in the area of increased understanding of the issues, identification of design features to resolve the issues, and quantitative evaluations of the surety characteristics of the various design concepts

  1. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  2. Categorization of reactor safety issues from a risk perspective

    International Nuclear Information System (INIS)

    1985-03-01

    This report presents the results of an effort to identify and rank reactor safety and risk issues identified from past Probabilistic Risk Assessments (PRAs) and other safety analyses. Because of the varied scope of these analyses, the list of issues may be incomplete. Nevertheless, those studies comprised ordered analyses to whatever their respective depths; hence, they warranted scrutiny for whatever insights they could reveal with respect to issue importance. The top-ranked issues in terms of their contribution to the uncertainty in risk are described in some detail. All of these risk issues are compared to the generic safety issues for completeness and omissions

  3. CEPF strategy for climate change issues

    International Nuclear Information System (INIS)

    2004-10-01

    With its strategy for climate change issues CEPF points out the importance of sustainable forest management and the renewable material wood in the context of future climate change policies. Reflecting the view of 16 Million Family forest owners of 23 countries in Europe, on how to combat climate change, this strategy should assist the EU Commission in identifying important issues for consideration in preparing its report for the spring 2005 European Council

  4. ECOPHARMACOVIGILANCE: ITS IMPORTANCE AND CHALLENGES

    OpenAIRE

    Dr. Bhavana Srivastava

    2014-01-01

    Active pharmaceutical ingredients represent a group of emerging environmental contamination. Even in trace amounts, they are of great concern due to then continuous introduction into the environment, their impact an ecosystem and human and vetenery health is of great importance. This has given birth to the science of Ecopharmacovigilance (EPV). It aims to ensure that significant environmental issues associated with pharmaceuticals in the environment are identified and managed appropriately. ...

  5. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  6. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  7. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  8. Liability Issues

    International Nuclear Information System (INIS)

    O’Donoghue, K.

    2016-01-01

    Nuclear liability conventions try to provide a set of rules to govern third party liability. Not all States are parties to one of the existing liability conventions. There are a number of reasons why individual States may choose not to join one of the existing conventions. These include limits of compensation, jurisdiction issues, complexity, cost and definition of damage among others. This paper looks at the existing conventions and identifies some of the main issues in the existing conventions which prevent some States from signing them. The paper attempts to tease out some of the perceived gaps in the existing conventions and give a brief description of the reasons why non-Contracting Parties have difficulty with the provisions of the conventions. The paper recognizes that there has been work done in this area previously by the International Expert Group on Nuclear Liability (INLEX) and others to try to develop the existing frameworks to enhance global adherence by nuclear and non-nuclear States to an effective nuclear liability regime. (author)

  9. Licensing issues

    International Nuclear Information System (INIS)

    Roberts, J.P.; Desell, L.J.; Birch, M.L.; Berkowitz, L.; Bader, J.F.

    1992-01-01

    To provide guidance for the Department of Energy's (DOE) Civilian Radioactive Waste Management Program, the Nuclear Regulatory Commission (NRC) has issued a draft regulatory guide on the Format and Content for the License Application for the High-Level Waste Repository (FCRG). To facilitate the development of the FCRG, NRC suggested that DOE use the draft guide as the basis for preparing an annotated outline for a license application. DOE is doing so using an iterative process called the Annotated Outline Initiative. DOE;s use of the Initiative will assist in achieving the desired incorporation of actual experience in the FCRG, contribute to the development of shared interpretation and understanding of NRC regulations, and provide other important programmatic benefits described in this paper

  10. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  11. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  12. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  13. Current issues and actions

    Energy Technology Data Exchange (ETDEWEB)

    Black, D.G.

    1995-06-01

    This section of the 1994 Hanford Site Environmental Report summarizes the progress that has been made toward achieving full regulatory compliance at the Hanford Site. Ongoing compliance self-assessments, implementation of the Tri-Party Agreement, and public meetings continue to identify environmental compliance issues. These issues are discussed openly with the regulatory agencies and with the public to ensure that all environmental compliance issues are addressed.

  14. Current issues and actions

    International Nuclear Information System (INIS)

    Black, D.G.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report summarizes the progress that has been made toward achieving full regulatory compliance at the Hanford Site. Ongoing compliance self-assessments, implementation of the Tri-Party Agreement, and public meetings continue to identify environmental compliance issues. These issues are discussed openly with the regulatory agencies and with the public to ensure that all environmental compliance issues are addressed

  15. Scientific issues in fuel behaviour

    International Nuclear Information System (INIS)

    1995-01-01

    The current limits on discharge burnup in today's nuclear power stations have proven the fuel to be very reliable in its performance, with a negligibly small rate of failure. However, for reasons of economy, there are moves to increase the fuel enrichment in order to extend both the cycle time and the discharge burnup. But, longer periods of irradiation cause increased microstructural changes in the fuel and cladding, implying a larger degradation of physical and mechanical properties. This degradation may well limit the plant life, hence the NSC concluded that it is of importance to develop a predictive capability of fuel behaviour at extended burnup. This can only be achieved through an improved understanding of the basic underlying phenomena of fuel behaviour. The Task Force on Scientific Issues Related to Fuel Behaviour of the NEA Nuclear Science Committee has identified the most important scientific issues on the subject and has assigned priorities. Modelling aspects are listed in Appendix A and discussed in Part II. In addition, quality assurance process for performing and evaluating new integral experiments is considered of special importance. Main activities on fuel behaviour modelling, as carried out in OECD Member countries and international organisations, are listed in Part III. The aim is to identify common interests, to establish current coverage of selected issues, and to avoid any duplication of efforts between international agencies. (author). refs., figs., tabs

  16. What Is Important During the Selection of Traditional Chinese Medicine (TCM) in a Health Care Reimbursement or Insurance System?" Critical Issues of Assessment from the Perspective of TCM Practitioners.

    Science.gov (United States)

    Zhang, Fang; Xie, Jing-Min; Zhang, Yi-Ye; Kong, Lin-Lin; Li, Shu-Chuen

    2013-05-01

    Complementary and alternative medicine (CAM) has gained increasing popularity over the last several decades internationally, leading to an increasing interest from decision makers and researchers as to how to assess the effectiveness of CAM. The attempts, however, have been unsatisfactory. The most important reason is a lack of attention to the theoretical characteristics of CAM, which are completely different from those of allopathic medicine or biomedicine. This study attempted to survey expert Traditional Chinese Medicine (TCM) practitioners in China to elucidate critical issues when assessing the effectiveness of TCM. A questionnaire (with 20 close-ended and 2 open-ended questions) about the influencing factors of measuring the cost and effectiveness of TCM was distributed to TCM practitioners who had been working in the field of research for at least 5 years and had published at least one related scientific article in the last 5 years. Internal consistency test was performed for all questions to verify the reliability of the questionnaire. Principal-component analysis was performed for remaining items after Kaiser-Meyer-Olkin (KMO) index and Bartlett's test of sphericity. A linear combination model was then built to evaluate the contribution of various factors involved for the selection of TCM into the health care reimbursement or insurance system. Of 429 questionnaires issued, 137 were returned from respondents from 31 medical and research institutions, giving a recovery rate of 31.93%. Internal consistency coefficient obtained was 0.745, indicating good reliability of this measurement scale, and the data passed the KMO test and Bartlett's test of sphericity (KMO index = 0.691). In addition, eight common factors were extracted after the rotation of principal-component analysis with a cumulative variance of 70.92%. Our findings suggested that factors to be considered during the selection of TCM in health care reimbursement or insurance system include patient

  17. Advanced alarm systems: Display and processing issues

    Energy Technology Data Exchange (ETDEWEB)

    O`Hara, J.M. [Brookhaven National Lab., Upton, NY (United States); Wachtel, J.; Perensky, J. [US Nuclear Regulatory Commission, Washington, DC (United States). Office of Nuclear Regulatory Research

    1995-05-01

    This paper describes a research program sponsored by the US Nuclear Regulatory Commission to address the human factors engineering (HFE) deficiencies associated with nuclear power plant alarm systems. The overall objective of the study is to develop HFE review guidance for alarm systems. In support of this objective, human performance issues needing additional research were identified. Among the important issues were alarm processing strategies and alarm display techniques. This paper will discuss these issues and briefly describe our current research plan to address them.

  18. Issues engulfed Saudi Arabia construction workers

    Science.gov (United States)

    Al-Emad, N. H.; Rahman, I. A.

    2018-04-01

    This paper presents an exploratory study conducted in Makkah city to uncover issues faced by construction workers from the construction leaders’ perspective. Eleven construction leaders/experts were interviewed to unleash their experiences on handling the foreign workers working in Makkah construction projects. Most of the experts are senior management staffs with more than 10 years’ working experience in Saudi Arabia construction industry. The interviews were carried out in semi structured mode where all the information was captured manually and also electronically. The identified issues were sorted based on its commonality into 10 clusters. Hence in each cluster, the numbers of issue considered by the experts are reflecting the importance of that particular cluster. The result of the clusters according to the number of issues mentioned by the experts are safety issues, restricted government regulation, demotivated issues, lack of quality workers, poor living quality, communication barriers, adaption issues, poor attitudes, lack of logistical arrangements and lack of education. With these identified issues it will assist the construction players in the construction industry of Saudi Arabia in dealing with their workers.

  19. Ethical issues in ageing and biography.

    Science.gov (United States)

    Kenyon, G M

    1996-11-01

    The increasing use of biographical materials in research and intervention in the field of ageing gives rise to significant ethical issues. In this inquiry, four of these issues are explicated. First, the notion of informed consent is explored in relation to selected contexts of research and intervention in ageing and biography. Second, the issues of autonomy and competence are considered from the point of view of identifying contexts where biography is a prerequisite for ethically responsive action. The third ethical issue concerns respecting the groundrules of various biographical approaches. Finally, the notions of authenticity and truth in lifestories are explored in an attempt to clarify the limitations and expectations of ageing and biography. The discussion of these ethical issues proceeds on the basis of an argument that indicates the fundamental importance of biographical ageing or the stories we are.

  20. Nuclear safety - Topical issues

    International Nuclear Information System (INIS)

    1995-01-01

    The following topical issues related to nuclear safety are discussed: steam generators; maintenance strategies; control rod drive nozzle cracks; core shrouds cracks; sump strainer blockage; fire protection; computer software important for safety; safety during shutdown; operational safety experience; external hazards and other site related issues. 5 figs, 5 tabs

  1. Key issues

    International Nuclear Information System (INIS)

    Cook, N.G.W.

    1980-01-01

    Successful modeling of the thermo-mechanical and hydrochemical behavior of radioactive waste repositories in hard rock is possible in principle. Because such predictions lie outside the realm of experience, their adequacy depends entirely upon a thorough understanding of three fundamental questions: an understanding of the chemical and physical processess that determine the behavior of rock and all its complexities; accurate and realistic numerical models of the geologic media within which a repository may be built; and sufficient in-situ data covering the entire geologic region affected by, or effecting the behavior of a repository. At present sufficient is known to be able to identify most of those areas which require further attention. These areas extend all the way from a complete understanding of the chemical and physical processes determining the behavior of rock through to the exploration mapping and testing that must be done during the development of any potential repository. Many of the techniques, laboratory equipment, field instrumentation, and numerical methods needed to accomplish this do not exist at present. Therefore it is necessary to accept that a major investment in scientific research is required to generate this information over the next few years. The spectrum of scientific and engineering activities is wide extending from laboratory measurements through the development of numerical models to the measurement of data in-situ, but there is every prospect that sufficient can be done to resolve these key issues. However, to do so requires overt recognition of the many gaps which exist in our knowledge and abilities today, and of the need to bridge these gaps and of the significant costs involved in doing so

  2. Family Issues

    Science.gov (United States)

    ... es Autismo? Family Issues Home / Living with Autism / Family Issues Stress Siblings A child’s autism diagnosis affects every member of the family in different ways. Parents/caregivers must now place their ... may put stress on their marriage, other children, work, finances, and ...

  3. Special issue: Plasma Conversion

    NARCIS (Netherlands)

    Nozaki, T.; Bogaerts, A.; Tu, X.; van de Sanden, M. C. M.

    2017-01-01

    With growing concern of energy and environmental issues, the combination of plasma and heterogeneous catalysts receives special attention in greenhouse gas conversion, nitrogen fixation and hydrocarbon chemistry. Plasma gas conversion driven by renewable electricity is particularly important for the

  4. Research Article Special Issue

    African Journals Online (AJOL)

    2017-02-15

    Feb 15, 2017 ... One of the important issues in the field of human education is the method of ... Encouragement and punishment method in Islamic management has been ... Concept of education refers to the cultivating human talent, this.

  5. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-03-22

    Mar 22, 2018 ... Voltage decay is an important issue in the power system community. ... of voltage profile, the total real power loss in the system is also determined to ..... Kumar A. Optimal placement of DG in radial distribution systems based.

  6. Global Issues

    Energy Technology Data Exchange (ETDEWEB)

    Seitz, J.L.

    2001-10-15

    Global Issues is an introduction to the nature and background of some of the central issues - economic, social, political, environmental - of modern times. This new edition of this text has been fully updated throughout and features expanded sections on issues such as global warming, biotechnology, and energy. Fully updated throughout and features expanded sections on issues such as global warming, biotechnology, and energy. An introduction to the nature and background of some of the central issues - economic, social, political, environmental - of modern times. Covers a range of perspectives on a variety of societies, developed and developing. Extensively illustrated with diagrams and photographs, contains guides to further reading, media, and internet resources, and includes suggestions for discussion and studying the material. (author)

  7. Editorial, Volume 5, Issue 1

    Directory of Open Access Journals (Sweden)

    Kristy L. Archuleta

    2014-08-01

    Full Text Available Welcome to Volume 5, Issue 1 of the Journal of Financial Therapy! In this issue, four scholarly papers are presented along with two profiles and a book review. These four papers address very important issues, such as mental health therapists’ competency in working with financial issues, financial stress of college students, parental messages about money, and financial advice media.

  8. Identifying Clusters of Complex Urban–Rural Issues as Part of Policy Making Process Using a Network Analysis Approach: A Case Study in Bahía de Los Ángeles, Mexico

    Directory of Open Access Journals (Sweden)

    Javier Sandoval

    2017-06-01

    Full Text Available Improving human settlements diagnosis is a key factor in effective urban planning and the design of efficient policy making. In this paper, we illustrate how network theory concepts can be applied to reveal the topological structure of functional relationships in a network of heterogeneous urban–rural issues. This mapping is done using clustering algorithms and centrality value techniques. By analyzing emergent groups of urban–rural related issues, our methodology was applied to a rural community, considering in this exercise environmental matters and real estate interests as a way to better understand the structure of salient issues in the context of its urban development program design. Results show clusters that arrange themselves not by an obvious similarity in their constituent components, but by relations observed in urban–rural settings that hint on the issues that the urban development program must focus. Due to its complex nature, the classification of these emerging clusters and how they must be treated in traditional planning instruments is a new challenge that this novel methodology reveals.

  9. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  10. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  11. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  12. Workforce Issues.

    Science.gov (United States)

    1996

    This document consists of four papers presented during a symposium on work force issues moderated by Jan DeJong at the 1996 conference of the Academy of Human Resource Development (AHRD). "Rethinking the Ties that Bind: An Exploratory Study of Employee Development in Utilities in Canada and the United States" (Michael Aherne, David…

  13. Sanskrit Issue.

    Science.gov (United States)

    Miller, Barbara Stoler, Ed.

    1971-01-01

    This issue of "Mahfil" is devoted to Sanskrit literature and contains a note on Sanskrit pronunciation and selections of Sanskrit literature. It also contains articles analyzing and discussing various aspects of the literature, including "Sanskrit Rhetoric and Poetic,""The Creative Role of the Goddess Vac in the…

  14. Bond Issues.

    Science.gov (United States)

    Pollack, Rachel H.

    2000-01-01

    Notes trends toward increased borrowing by colleges and universities and offers guidelines for institutions that are considering issuing bonds to raise money for capital projects. Discussion covers advantages of using bond financing, how use of bonds impacts on traditional fund raising, other cautions and concerns, and some troubling aspects of…

  15. Labonté Identifies Key Issues for Health Promoters in the New World Order; Comment on “Health Promotion in an Age of Normative Equity and Rampant Inequality”

    Directory of Open Access Journals (Sweden)

    Dennis Raphael

    2017-07-01

    Full Text Available For over 35 years Ronald Labonté has been critically analyzing the state of health promotion in Canada and the world. In 1981, he identified the shortcomings of the groundbreaking Lalonde Report by warning of the seductive appeal of so-called lifestyle approaches to health. Since then, he has left a trail of critical work identifying the barriers to — and opportunities for —health promotion work. More recently, he has shown how the rise of economic globalization and acceptance of neo-liberal ideology has come to threaten the health of those in both developed and developing nations. In his recent commentary, Labonté shows how the United Nations’ 2015 Sustainable Development Goals (SDGs can offer a new direction for health promoters in these difficult times.

  16. Energy infrastructure of the United States and projected siting needs: Scoping ideas, identifying issues and options. Draft report of the Department of Energy Working Group on Energy Facility Siting to the Secretary

    Energy Technology Data Exchange (ETDEWEB)

    1993-12-01

    A Department of Energy (DOE) Working Group on Energy Facility Siting, chaired by the Policy Office with membership from the major program and staff offices of the Department, reviewed data regarding energy service needs, infrastructure requirements, and constraints to siting. The Working Group found that the expeditious siting of energy facilities has important economic, energy, and environmental implications for key Administration priorities.

  17. Photovoltaic system criteria documents. Volume 3: Environmental issues and evaluation criteria for photovoltaic applications

    Science.gov (United States)

    Koenig, John C.; Billitti, Joseph W.; Tallon, John M.

    1979-01-01

    The environmental issues and evaluation criteria relating to the suitability of sites proposed for photovoltaic (PV) system deployment are identified. The important issues are defined, briefly discussed and then developed into evaluation criteria. System designers are provided with information on the environmental sensitivity of PV systems in realistic applications, background material which indicates the applicability of the siting issues identified, and evaluation criteria are defined to facilitate the selection of sites that maximize PV system operation.

  18. Theoretical Issues

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen

    2007-04-01

    The theoretical issues in the interpretation of the precision measurements of the nucleon-to-Delta transition by means of electromagnetic probes are highlighted. The results of these measurements are confronted with the state-of-the-art calculations based on chiral effective-field theories (EFT), lattice QCD, large-Nc relations, perturbative QCD, and QCD-inspired models. The link of the nucleon-to-Delta form factors to generalized parton distributions (GPDs) is also discussed.

  19. Editorial Volume 5 Issue 1

    Directory of Open Access Journals (Sweden)

    Ciorstan J. Smark

    2011-03-01

    Full Text Available This issue of AABFJ is the first in our fifth year of publication and in recognition we present papers covering the areas of finance, economics-related finance, banking and accounting. In this new research environment of ERA rankings, the ability to publish across all these fields is an important contribution. The finance paper (Lepone & Mistry 2011 examines the question of whether placing disclosed (broker placing order is identified versus undisclosed (no broker identifier given limit orders affects price movements on the Australian Securities Exchange. This study uses miro-trading data from SIRCA (Security Industry Research Centre of Asia-Pacific to provide insights for both academics, regulators and practitioners.

  20. Miscellaneous issues

    International Nuclear Information System (INIS)

    2002-01-01

    The New Brunswick Market Design Committee has examined several issues regarding the restructuring of the province's electricity sector. This report presents issues that require guidance for implementation, with particular focus on options available for their resolutions. The issues include: (1) rate principles for stranded offer service (SOS) supply, (2) the ability of contestable customers to return to SOS after having left it, (3) whether loads embedded in distribution systems are eligible to participate in the bilateral contract market, (4) whether generators or suppliers can offer capacity and energy to SOS suppliers in competition with the SOS supplier, and (5) details for the balancing market, including pricing, bidding protocols, settlements and how intermittent power sources can participate in the market. A section on pricing for SOS explains pricing principles, the use of export profits, pricing for SOS capacity, and time of use pricing. The Committee has made recommendations for the electricity system in the province to have an energy imbalance service that can move towards a market in order to develop an efficient and effective service. This report also explains pricing in the balancing market, penalties, and settlements. 7 refs

  1. Cellular signaling identifiability analysis: a case study.

    Science.gov (United States)

    Roper, Ryan T; Pia Saccomani, Maria; Vicini, Paolo

    2010-05-21

    Two primary purposes for mathematical modeling in cell biology are (1) simulation for making predictions of experimental outcomes and (2) parameter estimation for drawing inferences from experimental data about unobserved aspects of biological systems. While the former purpose has become common in the biological sciences, the latter is less common, particularly when studying cellular and subcellular phenomena such as signaling-the focus of the current study. Data are difficult to obtain at this level. Therefore, even models of only modest complexity can contain parameters for which the available data are insufficient for estimation. In the present study, we use a set of published cellular signaling models to address issues related to global parameter identifiability. That is, we address the following question: assuming known time courses for some model variables, which parameters is it theoretically impossible to estimate, even with continuous, noise-free data? Following an introduction to this problem and its relevance, we perform a full identifiability analysis on a set of cellular signaling models using DAISY (Differential Algebra for the Identifiability of SYstems). We use our analysis to bring to light important issues related to parameter identifiability in ordinary differential equation (ODE) models. We contend that this is, as of yet, an under-appreciated issue in biological modeling and, more particularly, cell biology. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  2. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  3. Theoretical issues in Spheromak research

    International Nuclear Information System (INIS)

    Cohen, R. H.; Hooper, E.B.; LoDestro, L.L.; Mattor, N.; Pearlstein, L.D.; Ryutov, D.D.

    1997-01-01

    This report summarizes the state of theoretical knowledge of several physics issues important to the spheromak. It was prepared as part of the preparation for the Sustained Spheromak Physics Experiment (SSPX), which addresses these goals: energy confinement and the physics which determines it; the physics of transition from a short-pulsed experiment, in which the equilibrium and stability are determined by a conducting wall (''''flux conserver'''') to one in which the equilibrium is supported by external coils. Physics is examined in this report in four important areas. The status of present theoretical understanding is reviewed, physics which needs to be addressed more fully is identified, and tools which are available or require more development are described. Specifically, the topics include: MHD equilibrium and design, review of MHD stability, spheromak dynamo, and edge plasma in spheromaks

  4. Ethical issues with colorectal cancer screening-a systematic review.

    Science.gov (United States)

    Hofmann, Bjørn

    2017-06-01

    Colorectal cancer (CRC) screening is widely recommended and implemented. However, sometimes CRC screening is not implemented despite good evidence, and some types of CRC screening are implemented despite lack of evidence. The objective of this article is to expose and elucidate relevant ethical issues in the literature on CRC screening that are important for open and transparent deliberation on CRC screening. An axiological question-based method is used for exposing and elucidating ethical issues relevant in HTA. A literature search in MEDLINE, Embase, PsycINFO, PubMed Bioethics subset, ISI Web of Knowledge, Bioethics Literature Database (BELIT), Ethics in Medicine (ETHMED), SIBIL Base dati di bioetica, LEWI Bibliographic Database on Ethics in the Sciences and Humanities, and EUROETHICS identified 870 references of which 114 were found relevant according to title and abstract. The content of the included papers were subject to ethical analysis to highlight the ethical issues, concerns, and arguments. A wide range of important ethical issues were identified. The main benefits are reduced relative CRC mortality rate, and potentially incidence rate, but there is no evidence of reduced absolute mortality rate. Potential harms are bleeding, perforation, false test results, overdetection, overdiagnosis, overtreatment (including unnecessary removal of polyps), and (rarely) death. Other important issues are related to autonomy and informed choice equity, justice, medicalization, and expanding disease. A series of important ethical issues have been identified and need to be addressed in open and transparent deliberation on CRC screening. © 2016 John Wiley & Sons, Ltd.

  5. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  6. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  7. CULTURAL ISSUES IN ECONOMICS

    OpenAIRE

    Maciej Meyer

    2012-01-01

    This article has been written with the purpose of attracting attention to the cultural issues, or rather lack of them, in economics. This topic has not been taken frequently into theoretical considerations due to some difficulties, although its practical implications are of great importance. The meaning of institutions which are a part of cultures has been given more coverage in the literature. The following hypothesis is proposed: culture is an important but underestimated component of the e...

  8. Towards Cloud Computing SLA Risk Management: Issues and Challenges

    OpenAIRE

    Morin, Jean-Henry; Aubert, Jocelyn; Gateau, Benjamin

    2012-01-01

    Cloud Computing has become mainstream technology offering a commoditized approach to software, platform and infrastructure as a service over the Internet on a global scale. This raises important new security issues beyond traditional perimeter based approaches. This paper attempts to identify these issues and their corresponding challenges, proposing to use risk and Service Level Agreement (SLA) management as the basis for a service level framework to improve governance, risk and compliance i...

  9. Validation issues for depletion and criticality analysis in burnup credit

    International Nuclear Information System (INIS)

    Parks, C.V.; Broadhead, B.L.; Dehart, M.D.; Gauld, I.C.

    2001-01-01

    This paper reviews validation issues associated with implementation of burnup credit in transport, dry storage, and disposal. The issues discussed are ones that have been identified by one or more constituents of the United States technical community (national laboratories, licensees, and regulators) that have been exploring the use of burnup credit. There is not necessarily agreement on the importance of the various issues, which sometimes is what creates the issue. The broad issues relate to the paucity of available experimental data (radiochemical assays and critical experiments) covering the full range and characteristics of spent nuclear fuel in away-from-reactor systems. The paper will also introduce recent efforts initiated at Oak Ridge National Laboratory (ORNL) to provide technical information that can help better assess the value of different experiments. The focus of the paper is on experience with validation issues related to use of burnup credit for transport and dry storage applications. (author)

  10. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-03-07

    Mar 7, 2018 ... Labor deployment issues play an important role in analyzing their use at the country or regional level .... The growth of employment in the service sector since the 50s, as a result of the rapid ... Hotels and restaurants. 23,0 ..... for the better, its number decreases and the quality of labor resources deteriorates.

  11. Boundary issues

    Science.gov (United States)

    Townsend, Alan R.; Porder, Stephen

    2011-03-01

    -centric boundary (Filippelli 2008, Handoh and Lenton 2003). However, human alteration of the P cycle has multiple potential boundaries (figure 1), including P-driven freshwater eutrophication (Smith and Schindler 2009), the potential for world P supply to place an ultimate limit on food production (Smil 2000, Childers et al 2011), and depletion of soil P stocks in some world regions (MacDonald et al 2011). Carpenter and Bennett revisit the P boundary from the freshwater eutrophication perspective. Given the extraordinary variation in freshwater ecosystems across the globe, this is a challenging task, but the authors strengthen their analysis by using three different boundaries with relevance to eutrophication, along with two water quality targets and a range of estimates of P flow to the sea. In doing so, they make a compelling case that if freshwater eutrophication is indeed a Rubicon, we have already crossed it. Importantly, Carpenter and Bennett go beyond the calculation of new boundaries to make broader points about humanity's relationship with the P cycle. Disruptions of both the P and N cycles are mostly about our need for food (Galloway et al 2008, Cordell et al 2009), but unlike N, P supplies are finite and irreplaceable. Environmental concerns aside, we can fix all the N2 from the atmosphere we want—but deplete our economically viable P reserves and we're in trouble. Figure 1 Figure 1. Human alteration of the global P cycle has multiple possible boundaries. These include the environmental risks posed by freshwater eutrophication and marine anoxic events, and the food security risks that come from depletion of soil P stocks in some world regions, as well as finite global supplies of high-value mineral P reserves. Photo credits beyond authors: upper left, Shelby Riskin; upper right, Pedro Sanchez. In effect, Carpenter and Bennett argue that among P's multiple boundaries, the one for freshwaters is less forgiving of our current activities (but no less important) than is

  12. Transitional issues

    International Nuclear Information System (INIS)

    1998-01-01

    This discussion paper, the fifth in the series developed at the IPPSO Market Design Conference, addressed the issue of the need to prevent Ontario Hydro from taking unfair advantage of independent producers and other stakeholders through activities and investments in new power generating capacity in the transitional period leading up to deregulation. The need for controls is predicated on the assumption that the short-term actions and investments of Ontario Hydro could seriously compromise the position of independent generators, and that without such controls the level playing field essential to the operation of a competitive market, does not exist. Various actual and potential actions of Ontario Hydro were discussed, all of which point to the need for strict controls over Ontario Hydro exercising its dominant market power in an unfair way. It was recommended that as a minimum, the provincial government should no longer provide guarantees for Ontario Hydro capital projects, and that Ontario Hydro be instructed to defer any investment on new or returning generating capacity until the new market is in place. Limits could also be placed on Ontario Hydro's marketing efforts to enter into contracts during the transition period, and Ontario Hydro and municipal utilities should be required to keep separate accounts of their commercial preparation, and to settle such accounts separate from ratepayer revenue

  13. Materials issues in cask development

    International Nuclear Information System (INIS)

    Chapman, R.L.; Sorensen, K.B.

    1987-01-01

    This paper identifies potential new materials as a function of their use in the cask. To the extent that identified materials are not yet qualified for their intended application, this paper identifies probable technical issues and development efforts that may be required to qualify the materials for use in transportation casks. 1 tab

  14. Legal and institutional issues

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    Leaving aside the natural desire to avoid the difficulties imposed by the enormously complex siting and certification process, a utility might decide to forego adding new capacity because of a variety of legal and institutional disincentives. Some of these are discussed in this chapter. The addition of new lines to support a competitive generating market also raises unique institutional issues. Perhaps the most important of these is the question of who should pay for the necessary capital expenditures. This issue also is discussed in this section

  15. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    Published online: 18 April 2018. ABSTRACT ... to identify the dominant factor of workplace relationship from the point of view of Indonesian for MNC ... It has been known that communication is one of the important element, especially within.

  16. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2017-08-08

    Aug 8, 2017 ... identify the factors that affect destination choice of medical tourists. ..... In this regard, running marketing campaigns in media and virtual ... According to two of the studies, another important social factor that international ...

  17. Policy issues in modern cartography

    CERN Document Server

    Taylor, DRF

    1998-01-01

    Policy Issues in Modern Cartography contains the views of national mapping agencies, legal scholars, the library community, the private sector and academia on these and many other important issues. The book begins with perspectives from national mapping agencies in Britain, Canada and the United States followed by a survey of the situation in Asia. The next three chapters deal primarily with legal issues such as copyright and intellectual property from both North American and European perspectives. Chapter 8 presents an important perspective on the key issues by a representative of the privat

  18. Definition of containment issues

    International Nuclear Information System (INIS)

    Walker, D.H.

    1982-01-01

    Public Law 96-567 Nuclear Safety Research, Development and Demonstration Act of 1980, directed the US Department of Energy (DOE) to provide an accelerated and coordinated program for developing practical generic improvements that would enhance the capability for safe, reliable and economical operation of Light Water Nuclear Reactor Power Stations. The DOE approach to defining such a program will consist of two phases, (1) definition of program requirements and (2) implementation of the program plan. This paper summarizes the results of the program definition phase for the containment integrity function. The definition phase effort was carried out by two groups of knowledgeable technical experts from the nuclear industry, one of which addressed containment integrity. Tabulated in the paper are the issues identified by the working groups and their associated priorities. Also tabulated are those high priority issues for which ongoing programs do not appear to provide sufficient information to resolve the issue. The results of this review show that existing programs to a great extent address existing issues in a manner such that the issues should be resolved by the programs

  19. Report of the review of the safety improvement programme for South Ukraine NPP units 1 and 2 and to identify the safety issues of ''small series'' WWER-1000 NPPs. South Ukraine Yuzhnoukrainsk, Nikolaev Region Ukraine, 8 to 19 July 1996. Draft

    International Nuclear Information System (INIS)

    Bastin, S.; Hoehn, J.; Lin, C.; Taylor, R.; Benitez, F.; Dale, H.; Mueller, B.; Rieg, C.Y.

    1996-10-01

    According to the Ukrainian request the purpose of the IAEA experts' mission was to review the safety improvement programme for South Ukraine NPP Units 1 and 2 in order to advise on the completeness and adequacy of safety improvements implemented and/or proposed. Another purpose of the mission was to identify major design and operational deficiencies as a basis to compile a consolidated list of generic safety issues for the units of the 'small series'' of WWER-1000 reactors (''Issue Book for ''small series'' WWER-1000 NPPs). Conclusions and recommendations from the IAEA mission are based on the combined expertise of the international group of experts who composed the team. They are intended to assist national authorities and plant operators who have the sole responsibilities for the regulation and safe operation. tabs

  20. Environmental issues

    International Nuclear Information System (INIS)

    Grove-White, Robin

    1985-01-01

    There is still very little official acceptance that environmental factors will impose major constraints on the development of energy supply options in the United Kingdom in the future. This paper argues that such an acceptance is needed urgently and should begin to affect governmental policies immediately. UK energy policy ought to be to intensify energy efficiency and conservation throughout the economy and hence reduce the need to expand new supply sources. The general energy requirements in the UK are first considered. Problems of energy supply expansion, particularly nuclear power and coal are considered. Resolution of the problems identified in the UK political and administrative context is discussed. Then the environmental aspects are considered. A comment on the paper follows and raises two questions about market-based energy policy; does it preclude intervention to promote economic efficiency in the use of energy and, does it lead to economic efficiency. (U.K.)

  1. Customization Issues

    DEFF Research Database (Denmark)

    Jørgensen, Kaj Asbjørn; Brunø, Thomas Ditlev; Taps, Stig B.

    2014-01-01

    Implementation of mass customization and product configuration in companies requires fundamental considerations about how products can fulfil the demand from customers. In order to support such decision-making, a multi-level model for customization is developed. This model identifies four different...... levels of customization, ranging from the structure level at the bottom, through the performance level and the experience level, to the learning level at the top. The model also has a dual view with customers/demand at one side and product/supplier at the other side. It is a rather general model, which...... can be applied to many types of products, and typically, product designers must decide how far up in levels the customization should aim. In this paper, the four-level customization model is applied to wheel chairs....

  2. Southwest Border Violence: Issues in Identifying and Measuring Spillover Violence

    Science.gov (United States)

    2010-08-24

    business in general. One recent study, for example, examined the impact of surges in violence on businesses in various industries in locations of varying...personal service industries ) and located in typically low-crime areas. Specifically, the impact on business was in terms of a reduction in the number...Attorneys Offices, and state and local law enforcement. The Mexican law enforcement agency Secretaria de Seguridad Publica is a partner along the

  3. Identifying and Addressing Gender Issues in Doing Business

    OpenAIRE

    Aimée Hampel-Milagrosa

    2010-01-01

    Doing Business, the World Bank's annual flagship publication, claims that payoffs for women from regulatory reform are large despite a lack of explicit focus on social factors affecting the economic participation of women. Taking off from our previous findings that discrimination hindering women's economic participation originate at the level of traditions and perpetuate at the level of regulations, this article suggests a combined qualitative and quantitative methodology that addresses gende...

  4. Research Issues in Information Access.

    Science.gov (United States)

    Molholt, Pat

    1989-01-01

    Discusses traditional library approaches to access to information and the possible impact of information technologies, library automation, and artificial intelligence. Access issues raised by these technologies are identified and a research agenda to explore these issues is outlined. (31 references) (CLB)

  5. Malaysia; Selected Issues

    OpenAIRE

    International Monetary Fund

    1998-01-01

    This Selected Issues paper on Malaysia highlights quantitative assessment of additional measures required during the medium term to achieve fiscal targets. The authorities aim to lower the budget deficit to about 3 percent of GDP by 2015, down from 4.0 percent in 2013, and to balance the budget by 2020. It suggests that ranking fiscal instruments under different fiscal policy goals can help policymakers identify the composition of fiscal adjustment based on their preferences. By combining ran...

  6. Norway; Selected Issues

    OpenAIRE

    International Monetary Fund

    2005-01-01

    This Selected Issues paper analyzes inflation in Norway with a view to shedding light on this surprising development and the possible near-term course of inflation, using statistical and econometric analyses. The paper reviews recent developments of monetary policy and inflation in Norway, applies statistical and econometric tools to identify factors influencing inflation, and describes the implications of the analysis for policymaking. Using data for six advanced small open economies explici...

  7. Environmental trends and issues at the research horizon

    International Nuclear Information System (INIS)

    Schwartz, J.H.; Warshaw, C.J.; Stoner, B.; Coerr, S.; O'Neal, J.

    1992-01-01

    This report provides a forecast of environmental trends and issues likely to emerge in the next 5 to 15 years. The report identifies and describes eleven significant emerging tends (i.e., general shifts in environmental policy-making, technology, regulation and public opinion) and - specific environmental issues (i.e., real or perceived environmental problems). The report further describes various debates or key questions that will determine over the next 5 to 15 years the potential government response to these environmental issues. This information is intended to assist the Gas research Institute as a research organization in planning and initiating research projects that will be relevant to important debates in the future

  8. Current Issues for Higher Education Information Resources Management.

    Science.gov (United States)

    CAUSE/EFFECT, 1996

    1996-01-01

    Issues identified as important to the future of information resources management and use in higher education include information policy in a networked environment, distributed computing, integrating information resources and college planning, benchmarking information technology, integrated digital libraries, technology integration in teaching,…

  9. Regulatory issues for nuclear power plant life management

    International Nuclear Information System (INIS)

    Roe, J.

    2000-01-01

    The workshop of 26-27 june 2000, on nuclear power Plant LIfe Management (PLIM), also included working groups in which major issues facing PLIM activities for nuclear power plants were identified and discussed. The second group was on Regulation. The Regulatory Working Group will attempt to identify some of the more pertinent issues affecting nuclear plant regulation in a changing PLIM environment, to identify some possible actions to be taken to address these issues, and to identify some of the parties responsible for taking these actions. Some preliminary regulatory issues are noted below. This is not intended to be a comprehensive list of such issues but rather is intended to stimulate discussion among the experts attending this Workshop. One of the concerns in the regulatory arena is how the structural integrity of the plants can be assured for an extended lifetime. Technological advances directed toward the following are likely to be important factors in the regulatory process of life extension. - Preventive and corrective maintenance (e.g., water chemistry control, pressure vessel annealing, and replacement of core internals). - Ageing and degradation mechanisms and evaluation (e.g., embrittlement, wear, corrosion/erosion, fatigue, and stress corrosion). - Monitoring, surveillance, and inspection (e.g., fatigue monitoring and non-destructive testing). - Optimisation of maintenance (e.g., using risk-based analysis). On the business side, there is concern about technical support by manufacturers, fuel companies, and construction companies. Maintaining a strong technical base and skilled workers in a potentially declining environment is another concern in the regulatory community. Waste management and decommissioning remain significant issue regarding PLIM. These issues affect all three areas of concern - technology, business, and regulation. It is against this background, that the issues put forth in this paper are presented. The objective of presenting these

  10. Use of importance measures in risk-informed regulatory applications

    International Nuclear Information System (INIS)

    Cheok, Michael C.; Parry, Gareth W.; Sherry, Richard R.

    1998-01-01

    The use of importance measures to analyze PRA results is discussed. Commonly used importance measures are defined. Some issues that have been identified as potentially limiting their usefulness are addressed, namely: there is no simple relationship between importance measures evaluated at the single component level and those evaluated at the level of a group of components, and, as a result, some of the commonly used importance measures are not realistic measures of the sensitivity of the overall risk to parameter value changes; and, importance measures do not typically take into account parameter uncertainties which raises the question of the robustness of conclusions drawn from importance analyses. The issues are explored in the context of both ranking and categorization of structures, systems, and components (SSCs) with respect to risk-significance and safety-significance for use in risk-informed regulatory analyses

  11. Urban Transportation: Issue and Solution

    Directory of Open Access Journals (Sweden)

    Haryati Shafii

    2011-10-01

    Full Text Available Generally, quality of life of urban population is heavily dependent on social facilities provided within the environment. One of the most important facilities is transportations. Study on transportation mode in an urban area is especially very important because for almost every individual living in a large and densely populated area, mobility is one of the most crucial issues in everyday life. Enhance mobility, faster journey to work and less pollution from petrol-propelled vehicles can increase the quality of life, which in turn lead to a sustainable urban living. The study present transportation mode usage issues faced by community related to quality of life in an urban area. This study identifies several issues of transportation mode in urban areas and its impact on the quality of life. The study areas are Putrajaya, Kuala Lumpur and Bandar Kajang, Selangor. The methodology used in this research is secondary and primary data. The questionnaires for the survey were distributed from May 2008 to Jun 2008. These researches were conducted on 144 respondents for to evaluate their perception of transportation mode correlated to the quality of life. The collected data were then analyzed using “Statistical Packages for the Social Science” (SPSS. The respondents comprise of 61 males and 84 females from the age group of 18 to 57 years. This study identifies the percentage of public transportation mode usage in urban area, such as buses (16.7%, train (ERL, monorail and commuter-6.4%; which is very low compared to owning personal car (45.8% and motorcycle (25.4%.The result shows owning personal car is the highest (45.8% in three study areas and monorail and taxi are the lowest (1.4%. The Chi Square Test shows that among the mode transportation with traffic jam is quite difference in Kuala Lumpur, Putrajaya and Kajang. Analysis of the Chi Square Test shows the result is 0.000 (two sides to respondent answering “yes” and analysis of Spearman

  12. ADA members weigh in on critical issues.

    Science.gov (United States)

    Burgess, Karen; Ruesch, Jon D; Mikkelsen, Matthew C; Wagner, Karen Schaid

    2003-01-01

    Science, new technology, patient care, dental reimbursement and government regulations all affect today's dental practitioners. To find out more about how such challenges may affect current private practitioners, the American Dental Association conducted the 2000 Membership Needs and Opinions Survey. A questionnaire was sent to 6,310 ADA members in January 2000 with follow-up mailings in February, March and April 2000. Data collection was completed in July 2000. The survey included questions on critical professional issues, and on perceptions of the ADA and ADA priorities. A total of 3,558 completed surveys were received for an adjusted response rate of 59.5 percent. Members rated the identified issues' level of importance to them. The top three issues included "maintaining my ability to recommend the treatment option I feel is most appropriate for my patients," "receiving fair reimbursement for the dental services I provide," and "protecting myself, my staff and my patients from communicable diseases." New dentists found other items to be more significant to them compared with members overall. Although ADA members as a whole had similar views on critical issues facing dentistry and ADA priorities, there were significant differences regarding some issues. New dentists were far more concerned about securing funds for their practice and paying off debt than were all ADA members. Minority dentists expressed greater levels of concern about certain issues than did all ADA members. When planning and implementing ADA activities, the Association should continue to take into account members' relative rankings of professional issues and note issues of special interest to selected membership subgroups.

  13. NIH Researchers Identify OCD Risk Gene

    Science.gov (United States)

    ... News From NIH NIH Researchers Identify OCD Risk Gene Past Issues / Summer 2006 Table of Contents For ... and Alcoholism (NIAAA) have identified a previously unknown gene variant that doubles an individual's risk for obsessive- ...

  14. Information Systems Management: an Australasian view of key issues - 1996

    Directory of Open Access Journals (Sweden)

    Graham Pervan

    1997-11-01

    Full Text Available As part of a longitudinal study of key information systems management issues, a survey of Australasia's largest 500 organisations was conducted to identify which issues were perceived by the IS executives as being important, problematic and critical over the next three to five years. The most critical issues were revealed to be a mix of technology management issues (IT infrastructure, communications, disaster recovery, strategic management issues (competitive advantage, IS planning, aligning the IS organisation, people management issues (organisational learning, educating senior management in IT, systems development and data management issues (effective use of the data resource, and end-user computing. This reflects the need for a balance of business, technical, and people skills in an IS executive. Non-critical issues were mostly related to systems development and the individual technologies which must be integrated and managed to ensure a responsive IT infrastructure. The study also reveals that some issues are much more important than problematic (disaster recovery, competitive advantage, information architecture, and IS alignment while others are much more problematic than important (end-user computing, IS role and contribution, and BPR. The former reflects a growing level of knowledge in handling these issues, while the latter reflects a continuing problem with them. The differences between this study and similar studies conducted in 1988 and 1992 show that there is a growing confidence in the IS executive's ability to manage the strategic issues, a continuing concern about providing a responsive IT infrastructure (especially communications, and a continuing concern with educating all 'customers' in the organisation in the effective use of IT, including senior management.

  15. Wireless ATM : handover issues

    OpenAIRE

    Jiang, Fan; Käkölä, Timo

    1998-01-01

    Basic aspects of cellular systems and the ATM transmission technology are introduced. Wireless ATM is presented as a combination of radio ATM and mobile ATM. Radio ATM is a wireless extension of an ATM connection while mobile ATM contains the necessary extensions to ATM to support mobility. Because the current ATM technology does not support mobility, handover becomes one of the most important research issues for wireless ATM. Wireless ATM handover requirements are thus analysed. A handover s...

  16. New Zealand; Selected Issues

    OpenAIRE

    International Monetary Fund

    2009-01-01

    This Selected Issues paper conducts a comparative analysis of the main determinants of GDP per capita growth in New Zealand and in other OECD countries to assess the relative importance of macroeconomic factors, institutional settings, and geographical location in New Zealand’s growth performance during the last 30 years. The estimation results find strong support for the view that geographical isolation has significantly hampered growth in New Zealand. The paper also reviews the internationa...

  17. The NOAA Dataset Identifier Project

    Science.gov (United States)

    de la Beaujardiere, J.; Mccullough, H.; Casey, K. S.

    2013-12-01

    The US National Oceanic and Atmospheric Administration (NOAA) initiated a project in 2013 to assign persistent identifiers to datasets archived at NOAA and to create informational landing pages about those datasets. The goals of this project are to enable the citation of datasets used in products and results in order to help provide credit to data producers, to support traceability and reproducibility, and to enable tracking of data usage and impact. A secondary goal is to encourage the submission of datasets for long-term preservation, because only archived datasets will be eligible for a NOAA-issued identifier. A team was formed with representatives from the National Geophysical, Oceanographic, and Climatic Data Centers (NGDC, NODC, NCDC) to resolve questions including which identifier scheme to use (answer: Digital Object Identifier - DOI), whether or not to embed semantics in identifiers (no), the level of granularity at which to assign identifiers (as coarsely as reasonable), how to handle ongoing time-series data (do not break into chunks), creation mechanism for the landing page (stylesheet from formal metadata record preferred), and others. Decisions made and implementation experience gained will inform the writing of a Data Citation Procedural Directive to be issued by the Environmental Data Management Committee in 2014. Several identifiers have been issued as of July 2013, with more on the way. NOAA is now reporting the number as a metric to federal Open Government initiatives. This paper will provide further details and status of the project.

  18. Key Research Issues in Clostridium difficile

    Directory of Open Access Journals (Sweden)

    George Zhanel

    2005-01-01

    Full Text Available Clostridium difficile is an emerging pathogen that causes C difficile-associated diarrhea, an important nosocomial infection. Control of this infection remains a challenge, and much needs to be determined about the antimicrobial resistance of the organism, antibiotic stewardship, contamination of the patient environment, and various host factors that determine susceptibility or resistance to infection. A national symposium focusing on C difficile infections, the Clostridium difficile Symposium on Emerging Issues and Research, was hosted on November 23, 2004, by the Department of Medical Microbiology and Infectious Diseases at the University of Manitoba, Winnipeg, Manitoba, in partnership with the Canadian Institutes of Health Research. This symposium, which aimed to summarize key research issues regarding C difficile infections in Canada, had the following objectives: to provide a forum for learning and discussion about C difficile and its impact on the health of Canadians; to identify the key research issues that should be addressed; and to explore potential research funding opportunities and collaboration. The present report summarizes key research issues identified for C difficile infections in Canada by addressing four major themes: diagnosis and surveillance, infection prevention and control, antibiotic stewardship, and clinical management.

  19. Driving and Epilepsy: a Review of Important Issues.

    Science.gov (United States)

    Kang, Joon Y; Mintzer, Scott

    2016-09-01

    Driving restrictions in people with epilepsy (PWE) is a highly contentious topic. The fundamental difficulty lies in achieving a balance between safety and practicality. The aim of this review is to provide an overview, history, and rationale behind current laws regarding driving restriction in PWE. We also discuss recent findings that may be helpful to practitioners during individual discussions with PWE including seizure recurrence risk after first seizure, recurrent seizure, and anticonvulsant with drawl and driving restrictions in patients with psychogenic non-epileptic seizures (PNES).

  20. Equity crowdfunding in China : Current practice and important legal issues

    NARCIS (Netherlands)

    Li, Jing

    2017-01-01

    By studying two leading Chinese equity crowdfunding portals, namely, Renrentou and Zhongou8, this paper provides the very first empirical evidence on the practice and regulation of equity crowdfunding in China. In the case of Renrentou, I examine a hand-collected sample consisting of the investment

  1. College Student Social Networking: Its Importance and Its Issues

    Science.gov (United States)

    Wihbey, Jean A.

    2010-01-01

    Most traditional age college students communicate regularly on social networking sites such as, MySpace, Facebook, Friendster, Bebo, and LiveJournal. These are member-based internet communities that allow users to create a username, enter personal profile information, post photographs and communicate with others in innovative ways. Since Facebook…

  2. Colostomy irrigation: an important issue for Muslim individuals.

    Science.gov (United States)

    Karadag, Ayise; Baykara, Zehra Göçmen

    2009-01-01

    Colostomy irrigation (CI) is a bowel management method in individuals with permanent colostomy, as an alternative to pouch use, which may provide continence. CI helps the individuals with an artificial stoma to adjust to the stoma and may increase their quality of life (QOL). An uncontrolled intestinal gas discharge invalidates ablution, and noisy gas discharge and smell prevents congregational prayers, which cause problems to Muslims with stomas. Therefore, CI may be an appropriate solution for this patient group. Using the example of one affected individual we discuss how the praying problem can be resolved with teaching to self-perform CI and emphasize the beneficial effects on QOL.

  3. Feasibility: An important but neglected issue in patient hand hygiene.

    Science.gov (United States)

    Knighton, Shanina C; McDowell, Cherese; Rai, Herleen; Higgins, Patricia; Burant, Christopher; Donskey, Curtis J

    2017-06-01

    Patient hand hygiene may be a useful strategy to prevent acquisition of pathogens and to reduce the risk for transmission by colonized patients. Several studies demonstrate that patients and long-term-care facility (LTCF) residents may have difficulty using hand hygiene products that are provided; however, none of them measure feasibility for patients to use different hand hygiene products. A convenience sample of 42 hospitalized patients and 46 LTCF residents was assessed for their ability to use 3 hand sanitizer products (8-oz pushdown pump bottle, 2-oz pocket-sized bottle with a reclosable lid, and alcohol-impregnated hand wipes). The time (seconds) required for accessing each product was compared among acute-care patients and LTCF residents. Participants provided feedback on which product they preferred and found easiest to use. Of 88 participants, 86 (97.7%) preferred the pushdown pump, 2 (2.3%) preferred the bottle with the reclosable lid, and none preferred the hand wipes. For both hospitalized patients and LTCF residents, the average time required to access the pushdown pump was significantly less than the time required to access the other products (pushdown pump, 0.45 seconds; bottle with reclosable lid, 3.86 seconds; and wipes, 5.66 seconds; P hand hygiene products for patients and LTCF residents. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  4. On the importance of PURE - Public Understanding of Renewable Energy

    Energy Technology Data Exchange (ETDEWEB)

    Broman, Lars; Kandpal, Tara C.

    2013-09-15

    Public understanding of science (PUS) is a central concept among science communicators. Public understanding of renewable energy (PURE) is proposed as an important sub-concept of PUS. The aim of this paper is to interest and invite renewable energy scientists to join a PURE research project. Four separate important questions for a PURE research project can be identified: (A) Is PURE important? (B) Which issues of PURE are the most important ones, according to renewable energy scientists? (C) What understanding of renewable energy has the general public today, worldwide? (D) How to achieve PURE?.

  5. Transnational organizing: Issue professionals in environmental sustainability networks.

    Science.gov (United States)

    Henriksen, Lasse Folke; Seabrooke, Leonard

    2016-09-01

    An ongoing question for institutional theory is how organizing occurs transnationally, where institution building occurs in a highly ambiguous environment. This article suggests that at the core of transnational organizing is competition and coordination within professional and organizational networks over who controls issues. Transnational issues are commonly organized through professional battles over how issues are treated and what tasks are involved. These professional struggles are often more important than what organization has a formal mandate over an issue. We highlight how 'issue professionals' operate in two-level professional and organizational networks to control issues. This two-level network provides the context for action in which professionals do their institutional work. The two-level network carries information about professional incentives and also norms about how issues should be treated and governed by organizations. Using network and career sequences methods, we provide a case of transnational organizing through professionals who attempt issue control and network management on transnational environmental sustainability certification. The article questions how transnational organizing happens, and how we can best identify attempts at issue control.

  6. Estudo Transcultural sobre Liderança em Relações Públicas e Gestão da Comunicação: análise quantitativa dos temas de maior importância para os brasileiros / Transcultural Study on Leadership in Public Relations and Communication Management: quantitative analysis of the issues of greatest importance to the Brazilians

    Directory of Open Access Journals (Sweden)

    Andréia Athaydes

    2013-12-01

    Full Text Available Este artigo apresenta o relato parcial de uma investigação realizada em âmbito internacional, sob coordenação da Universidade do Alabama e do The Plank Center Institute (EUA, a fim de compreender como as constantes e rápidas mudanças políticas, econômicas e sociais impactam nas rotinas e no desempenho dos gestores em RP e Comunicação. As impressões foram obtidas através de questionário online e entrevistas em profundidade com gestores de RP e Comunicação de diferentes organizações. Aqui, são detalhados os dados quantitativos referentes à primeira seção do questionário online, que buscou conhecer, entre 10 temas pré-definidos, quais os de maior importância para os participantes. Estar preparado para lidar eficazmente com as crises, lidar com a velocidade e volume do fluxo de informação e melhorar os indicadores de comunicação para demonstrar o valor do trabalho realizado são as principais preocupações dos gestores. / This article presents part of an investigation into an international, coordinated by the University of Alabama and The Plank Center Institute (USA in order to understand how the constant and rapidly changing political, economic and social impact in the routines and performance of managers in PR and Communications. The prints were obtained through online questionnaire and in-depth interviews with managers of PR and Communication of different organizations. Here are detailed quantitative data relating to the first section of the online questionnaire, which sought to know from 10 predefined themes, which are the most important to the participants. Be prepared to deal effectively with crises, handle the speed and volume of information flow and improve communication indicators to demonstrate the value of the work performed are the main concerns of managers.

  7. Energy issues in Africa

    International Nuclear Information System (INIS)

    Farhandi, M.

    1991-01-01

    The topic of the energy sector-and the petroleum sector in particular-in sub-Saharan Africa might well be considered an insignificant issue compared with many of the energy concerns which now command international attention. However, the World Bank believes that it is important for all those in international energy not to forget about the crucial problems facing Africa. They should become informed and concerned about these problems, and, hopefully, work together to bring about a satisfactory solution for an ongoing development dilemma. Simply put, the cost of imported energy to the African economy is exorbitantly high, sapping the resources needed to produce economic growth and social progress. This paper reports that, to address this issue, the World Bank is about to undertake a major initiative-two ground-breaking studies in the field of energy for sub-Saharan Africa. Both of these proposed studies are designed to find ways to reduce the burden of the cost of energy imports, mainly petroleum products, to this continent. One study will examine the design (and, subsequently, the implementation) of a rationalization scheme for the supply and distribution of petroleum products throughout sub-Saharan Africa. The other will consider the feasibility of transporting Nigeria's natural gas to neighbors to the west, all of which presently are importers of energy

  8. Transmission issues in Alberta

    International Nuclear Information System (INIS)

    Levson, D.

    2002-01-01

    This paper outlined the major issues and concerns facing users of the transmission system in Alberta. They include congestion management issues that make investors uncertain about power generation. It is necessary to know the difference between which transmission price signals will be faced by low cost cogeneration at Fort McMurray and Cold Lake coal-fired generation near Edmonton compared to combined cycle gas generation near Calgary. Import and export policy tariffs are another concern. Most new generation opportunities in Alberta require access to export markets, but transmission facilities for export need policy support and appropriate tariffs. It was noted that the past actions of Alberta's Transmission Administrator and balancing pool may be distorting market signals for ancillary service markets, and that loss studies and calculations need upgrading

  9. Teaching nuclear issues

    International Nuclear Information System (INIS)

    Hicks, D.W.

    1986-01-01

    This paper is based on the assumption that the nuclear debate, both globally and within Britain, is one of critical importance in the late twentieth century and that it should therefore, at some juncture, be explored as part of the school curriculum. An essential part of 'good education' in a democratic society is to teach young people how to think about such an issue, but not what to think about it. This paper attempts to set out some of the key issues and dilemmas in relation to what we may call 'nuclear education'. It perhaps asks more questions than it gives answers, but they are all essential questions which teachers must ask themselves if they are to teach sensitively about these matters. Some of these questions are given as examples. (author)

  10. Nuclear standards: current issues and future trends

    International Nuclear Information System (INIS)

    Landis, J.W.

    1985-01-01

    A summary of the important issues that currently face the nuclear standards field is presented and a discussion of how each of these issues is being resolved is given. The economic benefits that properly developed standards produce are listed

  11. Prioritization of motor operated valves based on risk importances

    International Nuclear Information System (INIS)

    Vesely, W.E.; Weidenhamer, G.H.

    1994-01-01

    The plant Probabilistic Risk Assessment (PRA) can be a potentially useful and powerful tool for helping to define an effective response to GL 89-10. The plant PRA can be used to prioritize the Motor Operated Valves (MOV) dynamic test. The plant PRA can also be used to determine test schedules for the MOVs. In order for the PRA to be validly used to respond to GL 89-10, various issues need to be validly addressed. Eleven issues are specifically identified and responses to these issues are outlined. The issues of joint MOV importance, PRA truncation, and validation of the proposed approach are specifically highlighted and more detailed response considerations are described. As in all PRA applications, sensitivity studies and uncertainty considerations should be incorporated in the PRA evaluations. 4 refs, 3 tabs

  12. Ethical and methodological issues in research with Sami experiencing disability.

    Science.gov (United States)

    Melbøe, Line; Hansen, Ketil Lenert; Johnsen, Bjørn-Eirik; Fedreheim, Gunn Elin; Dinesen, Tone; Minde, Gunn-Tove; Rustad, Marit

    2016-01-01

    A study of disability among the indigenous Sami people in Norway presented a number of ethical and methodological challenges rarely addressed in the literature. The main study was designed to examine and understand the everyday life, transitions between life stages and democratic participation of Norwegian Sami people experiencing disability. Hence, the purpose of this article is to increase the understanding of possible ethical and methodological issues in research within this field. The article describes and discusses ethical and methodological issues that arose when conducting our study and identifies some strategies for addressing issues like these. The ethical and methodological issues addressed in the article are based on a qualitative study among indigenous Norwegian Sami people experiencing disability. The data in this study were collected through 31 semi-structured in-depth interviews with altogether 24 Sami people experiencing disability and 13 next of kin of Sami people experiencing disability (8 mothers, 2 fathers, 2 sister and 1 guardian). The researchers identified 4 main areas of ethical and methodological issues. We present these issues chronologically as they emerged in the research process: 1) concept of knowledge when designing the study, 2) gaining access, 3) data collection and 4) analysis and accountability. The knowledge generated from this study has the potential to benefit future health research, specifically of Norwegian Sami people experiencing disability, as well as health research concerning indigenous people in general, providing scientific-based insight into important ethical and methodological issues in research with indigenous people experiencing disability.

  13. Industrial implementation issues of Total Site Heat Integration

    International Nuclear Information System (INIS)

    Chew, Kew Hong; Klemeš, Jiří Jaromír; Wan Alwi, Sharifah Rafidah; Abdul Manan, Zainuddin

    2013-01-01

    Heat Integration has been a well-established energy conservation strategy in the industry. Total Site Heat Integration (TSHI) has received growing interest since its inception in the 90s. The methodology has been used with certain simplifications to solve TSHI problems. This paper investigates the main issues that can influence the practical implementation of TSHI in the industry. The main aim is to provide an assessment and possible guidance for future development and extension of the TSHI methodology from the industrial perspective. Several key issues have been identified as being of vital importance for the industries: design, operation, reliability/availability/maintenance, regulatory/policy and economics. Design issues to consider include plant layout, pressure drop, etc. For operation, issues such as startup and shutdown need to be considered. Reliability, availability and maintenance (RAM) are important as they directly affect the production. Relevant government policy and incentives are also important when considering the options for TSHI. Finally, a TSHI system needs to be economically viable. This paper highlights the key issues to be considered for a successful implementation of TSHI. The impacts of these issues on TS integration are summarised in a matrix, which forms a basis for an improved and closer-to-real-life implementation of the TSHI methodology. Highlights: ► Current TSHI methodology has been used for solving models with certain simplifications. ► Several issues that can influence practical implementation of TSHI are identified. ► Impacts of these issues on safety, environment and economics are evaluated. ► The findings form a basis for an improved and practical implementation of TSHI

  14. Important motivators for buying green products

    Directory of Open Access Journals (Sweden)

    Kamyar Kianpour

    2014-12-01

    Full Text Available Purpose: To addresses the main motivators that influence customers to buy green products as well as well as profiling the decisions that shape their behavior. Design/methodology/approach: The authors have conducted a review of the major research related to consumers to identify motivational factors, to draw conclusions about their impact on buying green products.   Factor analysis is conducted on the collected data to find the underlying factors that motivate consumers to buy green products and most importantly motivational factors were identified by T test. Findings: Results show that 1 Environmental Concern, Perceived Consumer Effectiveness, Consumer Knowledge 2 Laws and regulation and 3 Promotional Tools’ were the most important of motivators. Practical implications: The results could help companies, authorities, governments, producers, sellers to know what motivate customers to buy green products and persuade the customers for buying them. Social implications: Furthermore this research will indirectly contribute to increase the customers and public intention for buying green products which in turn will help to solve some of environmental issues and make less environmental side effect caused by products. It is notable that motivated consumers for buying green product will finally expect to have healthy life and clean environment which leads to a healthy and clean society. Originality/value: This article contributes to the literature on the customers’ intention for buying green products by filling the gap in the concrete issues of the customers’ motivation.

  15. Saudi Arabia; Selected Issues

    OpenAIRE

    International Monetary Fund

    2012-01-01

    This Selected Issues paper on Saudi Arabia assesses Saudi Arabia’s role in the oil market and global economy. Saudi Arabia, the world’s largest producer and exporter of oil, has long played a systemically important role in the global oil market. Short-term fluctuations in Saudi Arabia’s oil production have partially reflected attempts to stabilize the global oil market. Saudi Arabia has on several occasions used its systemic role to raise production to fill global demand gaps created by large...

  16. Environmental certification for more sustainable imports

    International Nuclear Information System (INIS)

    Henry, Lucile; Monnoyer-Smith, Laurence; Demeulenaere, Laurence

    2017-12-01

    As France imports high quantities of products which have environmental impacts abroad due to extraction, transformations, and transports of used materials, and which are not visible for consumers, environmental certification could be a mean to reduce these impacts as it would allow consumers to identify the less polluting products, and incite producers to put such products on the market. After having discussed these issues, the author outlines key factors of success for such a certification, briefly identifies required adjustments at the technical level (requirement level, cost anticipation), and at the social and political level. She also evokes accompanying measures, and outlines that environmental certification is only a tool among others such as partnership agreements currently being negotiated between the European Union and other countries, or a combination of certification and cooperation with extracting countries (as practiced by Germany)

  17. Characterizing Sleep Issues Using Twitter.

    Science.gov (United States)

    McIver, David J; Hawkins, Jared B; Chunara, Rumi; Chatterjee, Arnaub K; Bhandari, Aman; Fitzgerald, Timothy P; Jain, Sachin H; Brownstein, John S

    2015-06-08

    Sleep issues such as insomnia affect over 50 million Americans and can lead to serious health problems, including depression and obesity, and can increase risk of injury. Social media platforms such as Twitter offer exciting potential for their use in studying and identifying both diseases and social phenomenon. Our aim was to determine whether social media can be used as a method to conduct research focusing on sleep issues. Twitter posts were collected and curated to determine whether a user exhibited signs of sleep issues based on the presence of several keywords in tweets such as insomnia, "can't sleep", Ambien, and others. Users whose tweets contain any of the keywords were designated as having self-identified sleep issues (sleep group). Users who did not have self-identified sleep issues (non-sleep group) were selected from tweets that did not contain pre-defined words or phrases used as a proxy for sleep issues. User data such as number of tweets, friends, followers, and location were collected, as well as the time and date of tweets. Additionally, the sentiment of each tweet and average sentiment of each user were determined to investigate differences between non-sleep and sleep groups. It was found that sleep group users were significantly less active on Twitter (P=.04), had fewer friends (Pcost-effective, and customizable data to be gathered.

  18. Environmental licensing issues for cogeneration plants

    International Nuclear Information System (INIS)

    Lipka, G.S.; Bibbo, R.V.

    1990-01-01

    The siting and licensing of cogeneration and independent power production (IPP) facilities is a complex process involving a number of interrelated engineering, economic, and environmental impact considerations. Important considerations for the siting and licensing of such facilities include air quality control and air quality impacts, water supply and wastewater disposal, and applicable noise criteria and noise impact considerations. Air quality control and air quality impact considerations for power generation facilities are commonly reviewed in the public forum, and most project developers are generally aware of the key air quality licensing issues. These issues include Best Available Control Technology (BACT) demonstration requirements, and air quality modeling requirements. BACT is a case-by-case determination, which causes uncertainty, in that developers have difficulty in projecting the cost of required control systems. Continuing developments in control technology may cause this problem to continue in the 1990's. Air quality modeling can be a problem in hilly terrain or within or near an urban environment, which could delay or preclude permitting of a new cogeneration or IPP facility in such locations. This paper discusses several environmental issues which are less frequently addressed than air quality issues, namely water/wastewater and noise. The design features of typical cogeneration and IPP facilities that affect water supply requirements, wastewater volumes, and noise emissions are discussed. Then, the site selection and impact review process are examined to identify typical constraints and trade-offs that can develop relative to water, wastewater, and noise issues. Trends in permit review requirements for water, wastewater, and noise are examined. Finally, innovative approaches that can be used to resolve potential development constraints for water, wastewater, and noise issues are discussed

  19. Issues in Media Ethics. ERIC Digest.

    Science.gov (United States)

    Aiex, Nola Kortner; Gottlieb, Stephen S.

    Noting that over the past decade incidents have occurred and new technologies have appeared which together have raised questions about the ethical values of American journalists, this Digest seeks to identify some of those ethical issues and to point to the work of those who have studied these issues. It addresses issues of plagiarism and…

  20. Public perceptions of energy issues in Ontario

    International Nuclear Information System (INIS)

    2004-11-01

    In October 2004, the Environics Research Group conducted a telephone survey of 608 adult Ontarians to collect information on matters regarding energy; consumer confidence and protection; responsibilities of the Ontario Energy Board; and consumer information preferences. This report summarizes the key findings of the survey. According to the survey, the most important electricity and natural gas issue was identified as being price and cost issues, followed by reliability of supply, conservation, keeping utilities publicly owned, finding renewable sources of energy, and over-consumption. The survey revealed that Ontarians show much interest in conserving energy to save money, to protect the environment and ensure future energy supply, but they are generally sceptical that their interests are being protected on electricity and natural gas price issues. At least 9 in 10 Ontarians consider the tasks of the Ontario Energy Board to be important. The majority of Ontarians prefer to receive energy conservation information through the mail and from public regulators over a government department or a company. 10 tabs

  1. International challenges and public policy issues.

    Science.gov (United States)

    Morris, N

    1999-01-01

    The paper presents an overview of current public policy issues relating to biological standardisation and control, drawing on the extensive background material assembled for two recent international reviews, and previously published work. It identifies a number of factors which are destabilising the current system and promoting a climate for change. These include the squeeze on public sector resources, the growth in volume and complexity of biologicals, developing world needs, concerns about harmonisation and new social and ethical issues. It is argued that this situation presents important opportunities for reviewing the existing boundaries between regulatory scientists, industry, and the public, for international agreement on priorities and for harmonisation and mutual recognition. While considerable progress has already been made on these issues at national, regional and global level, there is a need for fuller international participation and the additional impetus that would come from a higher-profile commitment by governments. Such commitment will also be important for the vital questions of sustaining the scientific base and securing the resource for an effective, truly worldwide programme of standardisation and control. An international approach will also be essential in steering biologicals control through the difficult social and ethical questions of the future. WHO, in collaboration with national authorities, has a key role to play in these developments.

  2. Assessment of Materials Issues for Light-Water Small Modular Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Sandusky, David; Lunceford, Wayne; Bruemmer, Stephen M.; Catalan, Michael A.

    2013-02-01

    The primary objective of this report is to evaluate materials degradation issue unique to the operational environments of LWSMR. Concerns for specific primary system components and materials are identified based on the review of design information shared by mPower and NuScale. Direct comparisons are made to materials issues recognized for advanced large PWRs and research activities are recommended as needed. The issues identified are intended to improve the capability of industry to evaluate the significance of any degradation that might occur during long-term LWSMR operation and by extension affect the importance of future supporting R&D.

  3. Currently important animal disease management issues in sub-Saharan Africa : policy and trade issues

    Directory of Open Access Journals (Sweden)

    G.R. Thomson

    2009-09-01

    Full Text Available The present international approach to management of transboundary animal diseases (TADs is based on the assumption that most can be eradicated ; consequently, that is the usual objective adopted by international organizations concerned with animal health. However, for sub-Saharan Africa and southern Africa more particularly, eradication of most TADs is impossible for the foreseeable future for a variety of technical, financial and logistical reasons. Compounding this, the present basis for access to international markets for products derived from animals requires that the area of origin (country or zone is free from trade-influencing TADs. The ongoing development of transfrontier conservation areas (TFCAs, extending across huge areas of southern Africa, therefore presents a development conundrum because it makes creation of geographic areas free from TADs more difficult and brings development based on wildlife conservation on the one hand and that based on livestock production on the other into sharp conflict. Sub-Saharan Africa is consequently confronted by a complex problem that contributes significantly to retarded rural development which, in turn, impedes poverty alleviation. In southern Africa specifically, foot-and-mouth disease (FMD presents the greatest problem in relation to access to international markets for animal products. However, it is argued that this problem could be overcome by a combination between (1 implementation of a commodity-based approach to trade in products derived from animals and (2 amendment of the international standards for FMD specifically (i.e. the FMD chapter in the Terrestrial Animal Health Code of the World Organisation for Animal Health [OIE] so that occurrence of SAT serotype viruses in free-living African buffalo need not necessarily mean exclusion of areas where buffalo occur from international markets for animal products. This would overcome a presently intractable constraint to market access for southern African countries and enable conservation and livestock production to be more effectively integrated, to the benefit of both.

  4. Professional Emergence on Transnational Issues

    DEFF Research Database (Denmark)

    Seabrooke, Leonard; Tsingou, Eleni

    2015-01-01

    Addressing complex transnational problems requires coordination from different professionals. The emergence of new actors and issues has been addressed by those interested in studies of organizations through concepts and methods that highlight the importance of communities, fields, and networks...... they are conceptually linked by actors and organizations. A linked ecologies approach asks us to displace locating known actors within structures and instead pays attention to professional interactions on how ‘issue distinctions’ are made, the relationship between issue distinctions and professional tasks, and who...

  5. In This Issue

    Science.gov (United States)

    1996-04-01

    Advanced Instrumentation in the Educational Laboratory The instruments that chemists use in their research have changed dramatically in the past decades. The explosion in new techniques and their instrumental counterparts has been made possible by two significant advances. The rapid propagation of computer chips and circuitry provides opportunities to collect more specialized and refined data than ever before. Computer-controlled instruments can detect events that a human researcher would never perceive and can record hundreds of data points in the time that a person could only observe one or two. Coupled with these advances in technology are advances in theory that allow more sophisticated interpretation of data. A hundred years ago a sophisticated instrument was a balance that could weigh minute quantities. Today a sophisticated instrument is one that can identify the composition of that minute sample, determine its molecular weight, or reveal a great deal about its energy states and bonding. This bonanza of new instruments is wonderful for the research chemist but a curricular headache for the chemistry teacher. It takes more time to learn how to run an NMR than to use a balance, and more sophistication on the part of the student is needed to interpret the data. And yet many courses that only a generation ago sported an expensive analytical balance as its prize instrument now require students to understand and operate a whole panoply of complex tools. Teachers faced with accommodating these curricular changes will find several articles in this issue helpful--either providing information on new techniques or descriptions of how to incorporate them into the classroom. Electrospray ionization mass spectrometry is one of the newest tools that has been added to the analytical arsenal. It is an extension of mass spectrometry that overcomes the old barrier that allowed only analysis of low molecular weight, volatile compounds. It is now possible to use MS for

  6. Investigation to identify the inhibitors and facilitators of excessive absenteeism in a mining environment / Dianne Williamson

    OpenAIRE

    Williamson, Dianne

    2013-01-01

    The objective of the study was to identify the facilitators and inhibitors of excessive absenteeism in a mining environment. Absenteeism can be one of the most important human resource issues in any organisation. Absenteeism can be really difficult, but with good understanding of what causes absenteeism and how to reduce it, organisations can limit the negative side effects of employee attendance issues. Absenteeism is not only a behaviour caused by an individual's character...

  7. The importance of interpersonal communication in poison centers.

    Science.gov (United States)

    Crouch, B I; Thomas, K C; Rothwell, E; Planalp, S; Ellington, L; Teemant, K

    2013-11-01

    Poison control center (PCC) personnel face many challenges in communicating with callers and with each other. The purpose of this study was to identify interpersonal communication issues that affect the work environment within PCCs. As part of a larger questionnaire study distributed electronically to members of the American Association of Poison Control Centers (AAPCC) to assess communication training needs for PCCs, three questions were included to assess interpersonal communication within the work environment: (1) How important is interpersonal communication within your center to a positive work environment? (not at all to extremely important, 1-7); (2) How disruptive is interpersonal communication to your work? (not at all to extremely disruptive, 1-7); and (3) What communication issues do you find most disruptive to your work? (free-text response). Descriptive and qualitative content analyses were used to identify themes in responses. A total of 537 responses were received from SPIs, directors, medical directors, and other PCC staff. Interpersonal communication within the PCC was rated as extremely important to a positive work environment (median = 7 and IQR = 6-7; 62.3% rated as extremely important). Interpersonal communication was rated as less than moderately disruptive on average (median = 3 and IQR = 2-4). Free-text responses were received from 335 (62%) respondents. Free-text comments were broadly categorized as relating to PCC personnel and work environment and issues related to PCC callers. Categories that emerged from the PCC personnel and work environment category included the following: poor interpersonal communication (n = 104; 31%); background noise (n = 96; 29%); poor work procedures (n = 51; 15%); and poor management communication (n = 38; 11%). Interpersonal communication within PCCs was considered to be important for a positive work environment. Although not found to be strongly disruptive by most respondents, several specific interpersonal

  8. Top-Ten IT Issues: 2009

    Science.gov (United States)

    Agee, Anne Scrivener; Yang, Catherine

    2009-01-01

    This article presents the top-ten IT-related issues in terms of strategic importance to the institution, as revealed by the tenth annual EDUCAUSE Current Issues Survey. These IT-related issues include: (1) Funding IT; (2) Administrative/ERP Information Systems; (3) Security; (4) Infrastructure/Cyberinfrastructure; (5) Teaching and Learning with…

  9. Risk communication importance

    Energy Technology Data Exchange (ETDEWEB)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de, E-mail: raqueldalledonesiqueira@gmail.com, E-mail: delvonei@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  10. Risk communication importance

    International Nuclear Information System (INIS)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de

    2013-01-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  11. CLOUD COMPUTING SECURITY ISSUES

    Directory of Open Access Journals (Sweden)

    Florin OGIGAU-NEAMTIU

    2012-01-01

    Full Text Available The term “cloud computing” has been in the spotlights of IT specialists the last years because of its potential to transform this industry. The promised benefits have determined companies to invest great sums of money in researching and developing this domain and great steps have been made towards implementing this technology. Managers have traditionally viewed IT as difficult and expensive and the promise of cloud computing leads many to think that IT will now be easy and cheap. The reality is that cloud computing has simplified some technical aspects of building computer systems, but the myriad challenges facing IT environment still remain. Organizations which consider adopting cloud based services must also understand the many major problems of information policy, including issues of privacy, security, reliability, access, and regulation. The goal of this article is to identify the main security issues and to draw the attention of both decision makers and users to the potential risks of moving data into “the cloud”.

  12. Ethical issues in neuroscience.

    Science.gov (United States)

    Fuchs, Thomas

    2006-11-01

    The study gives an overview of ethical questions raised by the progress of neuroscience in identifying and intervening in neural correlates of the mind. Ethical problems resulting from brain research have induced the emergence of a new discipline termed neuroethics. Critical questions concern issues, such as prediction of disease, psychopharmacological enhancement of attention, memory or mood, and technologies such as psychosurgery, deep-brain stimulation or brain implants. Such techniques are capable of affecting the individual's sense of privacy, autonomy and identity. Moreover, reductionist interpretations of neuroscientific results challenge notions of free will, responsibility, personhood and the self which are essential for western culture and society. They may also gradually change psychiatric concepts of mental health and illness. These tendencies call for thorough, philosophically informed analyses of research findings and critical evaluation of their underlying conceptions of humans. Advances in neuroscience raise ethical, social and legal issues in relation to the human person and the brain. Potential benefits of applying neuroimaging, psychopharmacology and neurotechnology to mentally ill and healthy persons have to be carefully weighed against their potential harm. Questions concerning underlying concepts of humans should be actively dealt with by interdisciplinary and public debate.

  13. Counseling Research: Ethics and Issues.

    Science.gov (United States)

    Robinson, Sharon E.; Gross, Douglas R.

    1986-01-01

    Identifies three global areas for reserach study: (a) clinical studies, (b) counselor training investigation, and (c) evaluation. Issues such as competency, informed consent, confidentiality and privacy, cooptation and manipulation, no treatment controls, validity and generalizability of results, and authorship are discussed. (Author/BL)

  14. Communication: an ophthalmic practice issue.

    Science.gov (United States)

    Whitton, S J

    1995-12-01

    In the 1990's communication becomes an ophthalmic practice issue. The present ophthalmic climate of cost containment, downsizing, budget cuts, and lack of appreciation of contributions, results in a low staff morale. Recognition of the effects of job satisfaction and productivity led one group to seek solutions. A communication task force was formed to identify problems and the appropriate interventions.

  15. In This Issue

    Science.gov (United States)

    1996-08-01

    Coda This issue of the Journal, the last to be produced by the editorial staff in Austin, is remarkable only in the sense that each issue of this Journal is remarkable. In it teachers of chemistry share information, advice, and ideas that encompass a range as wide as chemistry itself. The Journal has always been a venue where the only important thread of commonalty was the goal of helping teachers--providing a "living textbook of chemistry", as it was dubbed by its founders. This textbook is different, however--it is written by its own readers and it has a new "edition" each month. This month's edition typifies the range of topics and issues found important by our readers (and authors): information about new ideas and research advances, new ways to look at and present the information we have, experiments and demonstrations to give students a first-hand exposure to chemistry, computer exercises to introduce those things that cannot be (or are too dangerous to be) presented first-hand, and ideas for better teaching techniques and classroom organization. With such a purview, it is no wonder that the articles in this issue range from the second law of thermodynamics (Frohlich, page 716) to building a Tesla coil from a car coil (Hall and Battino, page 817) and touch on such consequential topics as mimicking nature (Dennison and Harrowven, page 697) and the search for a silicon-based LED (Swisher, Richmond, and Sercel, page 738). New information about research is represented by part III of the series on electrospray ionization mass spectrometry (Hop and Bakhtiar, page A162). Senozan and Devore (page 767) look at data already long known about carbon monoxide poisoning and present a more subtle and complex explanation of the process than is usually seen in introductory texts. A really new way of looking at what we already know is the unique approach that Ginebreda (page 708) takes to waste recovery, applying the formalisms of thermodynamics to economic considerations

  16. Issues Raised in Relation to Radioactive Waste Management

    International Nuclear Information System (INIS)

    Atherton, Elizabeth

    2003-01-01

    Nirex has undertaken various consultations with different stakeholders to identify their issues and concerns about radioactive waste management in general and specific aspects of Nirex's work. This paper will outline what dialogue techniques Nirex has undertaken and the issues and concerns that people have raised during the events. It will outline some of the work that Nirex is undertaking to address stakeholders' issues and concerns. Nirex has used a variety of dialogue techniques co-ordinated under the Nirex Involvement Programme to engage with stakeholders about the work we undertake. We are now trying to address the issues, concerns, scenarios and questions raised in our work programme. Key lessons that we have learned in undertaking the dialogues include: The importance of appropriate facilitation and organisation of meetings; The need for a clear purpose for meetings; Being flexible to the needs of the attendees and the issues they raise; Providing feedback to those who participate and following up issues. Through engaging with the public Nirex has learned that: Radioactive waste is not an everyday concern for people; The public can, will and want to engage with the issue of radioactive waste management. This includes engaging with the ethical debate. To facilitate this Nirex and others need to: Provide information in a neutral form outlining the pros and cons and including various people's opinions; Use proactive techniques to allow access and space for people to discuss the issues; Demonstrate how people's opinions have been taken into account. People understand the issues very differently to the way institutions understand them. There is a need for institutions to learn to understand public concerns and the ways in which the public understand issues, as well as for the public to understand the institutional positions better. We are using these insights to develop our future work in this area

  17. Environmental issues in operations management

    Science.gov (United States)

    Muthulingam, Suresh

    Adoption of sustainable operating practices is becoming an increasingly important issue for many organizations in the world today. In this dissertation, I use empirical methods to investigate factors that influence the adoption of sustainable practices and also identify issues that may hinder the adoption of such practices. I explore these issues in two diverse settings. In Chapter 1, I investigate the adoption and non-adoption of energy efficiency initiatives using a database of over 100,000 recommendations provided to more than 13,000 small and medium sized manufacturing firms. Even though the average payback across all recommendations is just over one year, many of these profitable opportunities are not implemented. Using a probit instrumental variable model, I identify four biases in the adoption of these recommendations. First, managers are myopic as they miss out on many profitable opportunities. Second, managers are more influenced by upfront costs than by net benefits when evaluating such initiatives. Third, adoption of a recommendation depends not only on its characteristics but also on the sequence in which the recommendations are presented. Adoption rates are higher for initiatives appearing early in a list of recommendations. Finally, adoption is not influenced by the number of options provided to decision makers. This contributes to the debate about whether or not choice overload occurs. We highlight decision biases previously unobserved in the Operations Management literature using field data rather than experimental data. We draw implications for enhancing adoption of energy efficiency initiatives and for other decision contexts where a collection of process improvement recommendations are made to firms. In Chapter 2, I examine the depth of adoption of the voluntary LEED (Leadership in Energy and Environmental Design) standards for green buildings. Depth of adoption refers to the extent to which the buildings adopt practices related to the standard

  18. THE IMPACT OF REFORMING WHEAT IMPORTING STATE-TRADING ENTERPRISES ON THE QUALITY OF WHEAT IMPORTED

    OpenAIRE

    Lavoie, Nathalie

    2003-01-01

    Recent surveys of wheat importers indicate that countries that import wheat via a state trader are less sensitive to quality issues in import decision making than countries that import wheat through private traders. This study examines conceptually and empirically the impact of the deregulation of wheat imports on the quality and source of wheat imports.

  19. Nurse managers' experience with ethical issues in six government hospitals in Malaysia: a cross-sectional study.

    Science.gov (United States)

    Musa, Maizura binti; Harun-Or-Rashid, M D; Sakamoto, Junichi

    2011-11-16

    Nurse managers have the burden of experiencing frequent ethical issues related to both their managerial and nursing care duties, according to previous international studies. However, no such study was published in Malaysia. The purpose of this study was to explore nurse managers' experience with ethical issues in six government hospitals in Malaysia including learning about the way they dealt with the issues. A cross-sectional study was conducted in August-September, 2010 involving 417 (69.2%) of total 603 nurse managers in the six Malaysian government hospitals. Data were collected using three-part self-administered questionnaire. Part I was regarding participants' demographics. Part II was about the frequency and areas of management where ethical issues were experienced, and scoring of the importance of 11 pre-identified ethical issues. Part III asked how they dealt with ethical issues in general; ways to deal with the 11 pre-identified ethical issues, and perceived stress level. Data were analyzed using descriptive statistics, cross-tabulations and Pearson's Chi-square. A total of 397 (95.2%) participants experienced ethical issues and 47.2% experienced them on weekly to daily basis. Experiencing ethical issues were not associated with areas of practice. Top area of management where ethical issues were encountered was "staff management", but "patient care" related ethical issues were rated as most important. Majority would "discuss with other nurses" in dealing generally with the issues. For pre-identified ethical issues regarding "patient care", "discuss with doctors" was preferred. Only 18.1% referred issues to "ethics committees" and 53.0% to the code of ethics. Nurse managers, regardless of their areas of practice, frequently experienced ethical issues. For dealing with these, team-approach needs to be emphasized. Proper understanding of the code of ethics is needed to provide basis for reasoning.

  20. Pharmacy executive leadership issues and associated skills, knowledge, and abilities.

    Science.gov (United States)

    Meadows, Andrew B; Maine, Lucinda L; Keyes, Elizabeth K; Pearson, Kathy; Finstuen, Kenn

    2005-01-01

    To identify challenges that current and future pharmacy executives are facing or will face in the future and to define what skills, knowledge, and abilities (SKAs) are required to successfully negotiate these challenges. Delphi method for executive decision making. Civilian pharmacy profession. 110 pharmacists who graduated from the GlaxoSmithKline Executive Management Program for Pharmacy Leaders. Two iterations of the Delphi method for executive decision making separated by an expert panel content analysis. Round 1--participants were asked to identify five major issues they believed to be of greatest importance to pharmacy leaders in the next 5-10 years and name specific SKAs that might be needed by future leaders to successfully deal with those issues. An expert panel reviewed the issues, classified issues into specific domains, and titled each domain. Round 2-participants rated the SKAs on a 7-point scale according to their individual assessment of importance in each domain. For Delphi rounds 1 and 2, response rates were 21.8% and 18.2%, respectively. More than 100 total issue statements were identified. The expert panel sorted the issues into five domains: management and development of the pharmacy workforce, pharmacy finance, total quality management of work-flow systems, influences on the practice of pharmacy, and professional pharmacy leadership. Five of the top 15 SKAs-and all four highest ranked items--came from the professional pharmacy leadership domain, including ability to see the big picture, ability to demonstrate the value of pharmacy services, ability to lead and manage in an ethical manner, and skills for influencing an organization's senior leadership. Through successful integration of communication skills, critical thinking, and problem solving techniques, future public-sector pharmacy executives will be better equipped to effectively position their organizations and the profession for the challenges that lie ahead.

  1. Issues in contracting with small minority businesses

    Energy Technology Data Exchange (ETDEWEB)

    Wood, M.T.; Radford, M.L.; Saari, L.M.; Wright, J.

    1986-04-01

    The focus of this investigation was to identify issues central to increasing the involvement of small minority businesses (MBs) in federal or prime contracts with the Department of Energy (DOE), as a foundation for designing a program to assist buyers of contracted goods and services. The approach to determining issues involved interviewing the owners of 15 MBs, representing a range of businesses, and buyers and purchasing officers from three large DOE prime contractors. The interviewees identified issues related to positive working relationships and rated a predetermined set of 27 potential MB-DOE problems regarding their existence and criticalness. The issues identified by MBs were of two broad types. The predominant issues and barriers were associated with their being small businesses. Secondary issues reflected the disadvantaged status of the business (woman and/or minority-owned).

  2. EMERGING LEGAL ISSUES REGARDING CIVILIAN DRONE USAGE

    Directory of Open Access Journals (Sweden)

    Andrei-Alexandru STOICA

    2018-05-01

    Full Text Available Unmanned vehicles are becoming a common sighting in our day-to-day life and are soon going to become an important economic drive in creating workspaces and help achieve new milestones in human activities. As such, the technology revolving around the unmanned vehicles will push itself as much as it’s needed but with each achievement in the field of robotics a legal issue arises around how to use the newly acquired piece of technology in a public or private space and whether or not should such a technology be placed under a strict governmental control. As the saying by Prof. Henry W. Haynes (1879 goes “The possession of great powers and capacity for good implies equally great responsibilities in their employment. Where so much has been given much is required.” so does an unmanned vehicle and its operator must follow a degree of legal guidelines on how to properly use the gadget and to also to understand the legal limitations when interacting with other entities. This paper will focus on identifying and answering some legal issues regarding what is required for a drone to fly over an identifiable space, but also if the operator must have a document that was conferred by a state to acknowledge the skills of the pilot or should a software limitation be in place for national security safeguards. The paper will also tackle the issue of identifying legal documents from different states that can be applied to drone flight operations and also if different states have adopted sanctions to persons who did not abide to said legal norms.

  3. Safety issue resolution strategy plan for inactive miscellaneous underground storage tanks

    International Nuclear Information System (INIS)

    Wang, O.S.; Powers, T.B.

    1994-09-01

    The purpose of this strategy plan is to identify, confirm, and resolve safely issues associated with inactive miscellaneous underground storage tanks (MUSTs) using a risk-based priority approach. Assumptions and processes to assess potential risks and operational concerns are documented in this report. Safety issue priorities are ranked based on a number of considerations including risk ranking and cost effectiveness. This plan specifies work scope and recommends schedules for activities related to resolving safety issues, such as collecting historical data, searching for authorization documents, performing Unreviewed Safety Question (USQ) screening and evaluation, identifying safety issues, imposing operational controls and monitoring, characterizing waste contents, mitigating and resolving safety issues, and fulfilling other remediation requirements consistent with the overall Tank Waste Remediation System strategy. Recommendations for characterization and remediation are also recommended according to the order of importance and practical programmatic consideration

  4. Issues Management Process Course # 38401

    Energy Technology Data Exchange (ETDEWEB)

    Binion, Ula Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2018-02-01

    The purpose of this training it to advise Issues Management Coordinators (IMCs) on the revised Contractor Assurance System (CAS) Issues Management (IM) process. Terminal Objectives: Understand the Laboratory’s IM process; Understand your role in the Laboratory’s IM process. Learning Objectives: Describe the IM process within the context of the CAS; Describe the importance of implementing an institutional IM process at LANL; Describe the process flow for the Laboratory’s IM process; Apply the definition of an issue; Use available resources to determine initial screening risk levels for issues; Describe the required major process steps for each risk level; Describe the personnel responsibilities for IM process implementation; Access available resources to support IM process implementation.

  5. In This Issue

    Science.gov (United States)

    1996-06-01

    Organic Chemistry--New Challenges Perhaps more than any other of the chemical subdisciplines, the scope and focus of organic chemistry has been changed by modern technology and theoretical advances, and these changes have had an equally striking effect on the undergraduate curriculum. The main challenge in organic chemistry classes has shifted, in less than a generation, from memorizing all the groups, naming conventions, and classes of reactions to understanding complex interactions at the structural and electronic orbital level. As biochemistry and polymer chemistry have grown from being the purview of a few specialists to full-blown disciplines of their own, they have also migrated from interesting, but optional, chapters at the back of the book to separate courses in the curriculum. The availability of inexpensive instrumentation means undergraduates routinely use NMR and mass spec instead of melting points to identify their products. And the changes are continuing: segments of biochemistry are metamorphizing into molecular biology and polymer chemistry is finding interconnections with materials science. In fact, as our understanding of chemical reactions at molecular and electronic levels expands, it becomes more and more difficult to decide on demarcations between the subdisciplines. Organic chemistry is an organizational construct that once was useful for segregating certain topics into a coherent two-semester introductory course. Today, it covers so much territory that no one who is an "organic chemist" can know even a small fraction of the territory and faces unique challenges when designing and teaching undergraduate courses. In a wide spectrum of articles in this issue that fall under the "organic" umbrella--from environmental chemistry to new polymer products--teachers share their specific experiences and creative solutions to these challenges, providing their colleagues with new ideas, processes, and pedagogic approaches. To start off, we can examine

  6. Simulation platform developed to study and identify critical cases in a future smart grid

    DEFF Research Database (Denmark)

    Mihet-Popa, Lucian; Zong, Yi; You, Shi

    2016-01-01

    simulation and planning tools, with a particular objective on the challenges faced by the introduction of Smart Grid technologies. Another important issue of the paper is to identify critical load cases, as well as the voltage variations with the highest potential, able to implement the grid model...

  7. [Ethical issues in transfusion medicine].

    Science.gov (United States)

    Tissot, J-D; Danic, B; Cabaud, J-J; Garraud, O

    2016-09-01

    Ethics is on the cross road of off values that are present along the ways of transfusion medicine. This is an important tool to afford opinions as well as debates that always emerge when discussing transfusion medicine. The wording is particularly important; this was one among several others that characterized the soul of Jean-Jacques Lefrère when he opened the doors of the ethical issues of transfusion medicine. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Conventional shell model: some issues

    International Nuclear Information System (INIS)

    Vallieres, M.; Pan, X.W.; Feng, D.H.; Novoselsky, A.

    1997-01-01

    We discuss some important issues in shell-model calculations related to the effective interactions used in different regions of the periodic table; in particular the quality of different interactions is discussed, as well as the mass dependence of the interactions. Mention is made of the recently developed Drexel University shell-model (DUSM). (orig.)

  9. Liquid metal heat transfer issues

    International Nuclear Information System (INIS)

    Hoffman, H.W.; Yoder, G.L.

    1984-01-01

    An alkali liquid metal cooled nuclear reactor coupled with an alkali metal Rankine cycle provides a practicable option for space systems/missions requiring power in the 1 to 100 MW(e) range. Thermal issues relative to the use of alkali liquid metals for this purpose are identified as these result from the nature of the alkali metal fluid itself, from uncertainties in the available heat transfer correlations, and from design and performance requirements for system components operating in the earth orbital microgravity environment. It is noted that, while these issues require further attention to achieve optimum system performance, none are of such magnitude as to invalidate this particular space power concept

  10. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  11. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  12. Geoscience is Important? Show Me Why

    Science.gov (United States)

    Boland, M. A.

    2017-12-01

    "The public" is not homogenous and no single message or form of messaging will connect the entire public with the geosciences. One approach to promoting trust in, and engagement with, the geosciences is to identify specific sectors of the public and then develop interactions and communication products that are immediately relevant to that sector's interests. If the content and delivery are appropriate, this approach empowers people to connect with the geosciences on their own terms and to understand the relevance of the geosciences to their own situation. Federal policy makers are a distinct and influential subgroup of the general public. In preparation for the 2016 presidential election, the American Geosciences Institute (AGI) in collaboration with its 51 member societies prepared Geoscience for America's Critical Needs: Invitation to a National Dialogue, a document that identified major geoscience policy issues that should be addressed in a national policy platform. Following the election, AGI worked with eight other geoscience societies to develop Geoscience Policy Recommendations for the New Administration and the 115th Congress, which outlines specific policy actions to address national issues. State and local decision makers are another important subgroup of the public. AGI has developed online content, factsheets, and case studies with different levels of technical complexity so people can explore societally-relevant geoscience topics at their level of technical proficiency. A related webinar series is attracting a growing worldwide audience from many employment sectors. Partnering with government agencies and other scientific and professional societies has increased the visibility and credibility of these information products with our target audience. Surveys and other feedback show that these products are raising awareness of the geosciences and helping to build reciprocal relationships between geoscientists and decision makers. The core message of all

  13. Research Article Special Issue

    African Journals Online (AJOL)

    2016-05-15

    May 15, 2016 ... Near-fault earthquake issue is almost a new issue in earthquake engineering. ... although those countries had advanced regulations for seismic design of ... allocating the plastic joints according to development guideline and ...

  14. Future accelerators: physics issues

    International Nuclear Information System (INIS)

    Bjorken, J.D.

    1977-11-01

    High energy physics of the future using future accelerators is discussed. The proposed machines and instruments, physics issues and opportunities including brief sketches of outstanding recent results, and the way the proposed machines address these issues are considered. 42 references

  15. Medical Issues: Orthopedics

    Science.gov (United States)

    ... Information Packets Equipment Pool Living With SMA Medical Issues Palliative Breathing Orthopedics Nutrition Equipment Daily Life At ... curesma.org > support & care > living with sma > medical issues > orthopedics Orthopedics In SMA, muscle weakness can cause ...

  16. Medical Issues: Equipment

    Science.gov (United States)

    ... Information Packets Equipment Pool Living With SMA Medical Issues Palliative Breathing Orthopedics Nutrition Equipment Daily Life At ... curesma.org > support & care > living with sma > medical issues > equipment Equipment Individuals with SMA often require a ...

  17. Health Issues and Treatments

    Science.gov (United States)

    ... About Us Information For… Media Policy Makers Health Issues & Treatments Language: English (US) Español (Spanish) Recommend on ... people with spina bifida are exactly alike. Health issues and treatments for people with spina bifida will ...

  18. Medical Issues: Breathing

    Science.gov (United States)

    ... Information Packets Equipment Pool Living With SMA Medical Issues Palliative Breathing Orthopedics Nutrition Equipment Daily Life At ... curesma.org > support & care > living with sma > medical issues > breathing Breathing Breathing problems are the most common ...

  19. Space Station Engineering Design Issues

    Science.gov (United States)

    Mcruer, Duane T.; Boehm, Barry W.; Debra, Daniel B.; Green, C. Cordell; Henry, Richard C.; Maycock, Paul D.; Mcelroy, John H.; Pierce, Chester M.; Stafford, Thomas P.; Young, Laurence R.

    1989-01-01

    Space Station Freedom topics addressed include: general design issues; issues related to utilization and operations; issues related to systems requirements and design; and management issues relevant to design.

  20. Quantifying the perceived risks associated with nuclear energy issues

    International Nuclear Information System (INIS)

    Sandquist, G.M.

    2004-01-01

    A mathematical model is presented for quantifying and assessing perceived risks in an empirical manner. The analytical model provides for the identification and assignment of any number of quantifiable risk perception factors that can be incorporated within standard risk methodology. The set of risk perception factors used to demonstrate the model are those that have been identified by social and behavioural scientists as principal factors influencing people in their perception of risks associated with major technical issues. These same risk factors are commonly associated with nuclear energy issues. A rational means is proposed for determining and quantifying these risk factors for a given application. The model should contribute to improved understanding of the basis and logic of public risk perception and provide practical and effective means for addressing perceived risks when they arise over important technical issues and projects. (author)

  1. Attachment-related mental representations: introduction to the special issue.

    Science.gov (United States)

    Thompson, Ross A

    2008-12-01

    Bowlby's concept of mental working models of self, attachment figures, and the social world has been theoretically generative as a bridge between early relational experience and the beliefs and expectations that color later relationships. Contemporary attachment researchers, following his example, are applying new knowledge of children's conceptual development to their study of attachment-related mental representations in children and adults. The contributors to this special issue highlight recent advances in how the mental representations arising from attachment security should be conceptualized and studied, and identify a number of important directions for future work. This paper introduces the special issue by summarizing the major ideas of Bowlby and his followers concerning the nature and development of mental working models, points of theoretical clarity and uncertainty, and challenges in assessing these representations, as well as profiling each of the contributions to this issue.

  2. Seven Issues, Revisited

    OpenAIRE

    Whitehead, Jim; De Bra, Paul; Grønbæk, Kaj; Larsen, Deena; Legget, John; schraefel, monica m.c.

    2002-01-01

    It has been 15 years since the original presentation by Frank Halasz at Hypertext'87 on seven issues for the next generation of hypertext systems. These issues are: Search and Query Composites Virtual Structures Computation in/over hypertext network Versioning Collaborative Work Extensibility and Tailorability Since that time, these issues have formed the nucleus of multiple research agendas within the Hypertext community. Befitting this direction-setting role, the issues have been revisited ...

  3. Uranium and nuclear issues

    International Nuclear Information System (INIS)

    1983-01-01

    This seminar focussed on the major issues affecting the future of the entire nuclear fuel cycle. In particular it covered issues bearing on the formation of public policy in relation to the use of uranium as an energy source: economic risk, industrial risks, health effects, site selection, environmental issues, and public acceptance

  4. Issues in Data Labelling

    NARCIS (Netherlands)

    Cowie, Roddy; Cox, Cate; Martin, Jeam-Claude; Batliner, Anton; Heylen, Dirk K.J.; Karpouzis, Kostas; Cowie, Roddy; Pelachaud, Catherine; Petta, Paolo

    2011-01-01

    Labelling emotion databases is not a purely technical matter. It is bound up with theoretical issues. Different issues affect labelling of emotional content, labelling of the signs that convey emotion, and labelling of the relevant context. Linked to these are representational issues, involving time

  5. Reproductive issues in anorexia nervosa

    Science.gov (United States)

    Hoffman, Elizabeth R; Zerwas, Stephanie C; Bulik, Cynthia M

    2011-01-01

    Despite a high prevalence of menstrual irregularities, women with anorexia nervosa are becoming pregnant. The physical and psychological demands of pregnancy and motherhood can represent an immense challenge for women already struggling with the medical and psychological stress of an eating disorder. This article summarizes key issues related to reproduction in women with anorexia nervosa, highlighting the importance of preconception counseling, adequate gestational weight gain, and sufficient pre- and post-natal nutrition. Postpartum issues including eating disorder symptom relapse, weight loss, breastfeeding, and risk of perinatal depression and anxiety are also discussed. PMID:22003362

  6. Issues in Canadian LLRW management

    International Nuclear Information System (INIS)

    Charlesworth, D.H.

    1988-01-01

    Some of the issues which are of concern in Canada are similar to those being discussed in the US because Canadian low-level radioactive waste (LLRW) production is similar in quantity and characteristics to that which will be handled by some state compacts. This paper gives a Canadian viewpoint of: the choice between interim storage and permanent disposal; the importance of considering inadvertent intrusion; the role of waste categorization and stability; and the concerns in assessing disposal performance. The discussion is related to Atomic Energy of Canada Limited's LLRW disposal program, and its approach to resolving these issues

  7. Public health and terrorism preparedness: cross-border issues.

    Science.gov (United States)

    Olson, Debra; Leitheiser, Aggie; Atchison, Christopher; Larson, Susan; Homzik, Cassandra

    2005-01-01

    On December 15, 2003, the Centers for Public Health Preparedness at the University of Minnesota and the University of Iowa convened the "Public Health and Terrorism Preparedness: Cross-Border Issues Roundtable." The purpose of the roundtable was to gather public health professionals and government agency representatives at the state, provincial, and local levels to identify unmet cross-border emergency preparedness and response needs and develop strategies for addressing these needs. Representatives from six state and local public health departments and three provincial governments were invited to identify cross-border needs and issues using a nominal group process. The result of the roundtable was identification of the needs considered most important and most doable across all the focus groups. The need to collaborate on and exchange plans and protocols among agencies was identified as most important and most doable across all groups. Development of contact protocols and creation and maintenance of a contact database was also considered important and doable for a majority of groups. Other needs ranked important across the majority of groups included specific isolation and quarantine protocols for multi-state responses; a system for rapid and secure exchange of information; specific protocols for sharing human resources across borders, including emergency credentials for physicians and health care workers; and a specific protocol to coordinate Strategic National Stockpile mechanisms across border communities.

  8. Severe accident issue resolution -- definition and perspective

    International Nuclear Information System (INIS)

    Harper, F.T.

    1995-01-01

    The purpose of this discussion is to introduce the session on the Progress on the Resolution of Severe Accident Issues. There has been much work in the area of resolution of severe accident issues over the past few years. This work has been focused on those issues most important to risk as assessed by comprehensive studies such as NUREG-1150. In particular, issues associated with early containment failure have been analyzed. These efforts to resolve issues have been hampered by the fact that open-quotes issue resolutionclose quotes has not always been well defined. The term open-quotes issue resolutionclose quotes conjures tip different images for the regulator, the accident analyst, the physicist, and the probabalist. In fact it is common to have as many different images of issue resolution as there are people in the room. This issue is complicated by the fact that the uncertainty in severe accident issues is enormous. (When convolved, the quantitative uncertainty in an integrated analysis due to severe accident issues can span several orders of magnitude.) In this summary, hierarchy is presented in an attempt to add some perspective to the resolution of issues in the face of large uncertainties. Recommendations are also made for analysts communicating in the area of issue resolution

  9. Integration of generic issues

    International Nuclear Information System (INIS)

    Thatcher, D.

    1989-01-01

    The NRC has recognized the need to integrate generic issues (GIs). The GI process includes a number of phases, all of which should recognize the potential for overlap and conflict among related issues. In addition to the issues themselves, other related NRC and industry programs and activities need to be factored into the GI process. Integration has taken place, or is taking place, for a number of GIs. Each case of integration involves a specific set of circumstances and, as a result, the way in which integration proceeds can vary. This paper discusses the integration of issues in the generic issue process and provides a number of examples

  10. Issues in Forecasting CMEs

    Science.gov (United States)

    Pizzo, V. J.

    2017-12-01

    I will present my view of the current status of space weather forecasting abilities related to CMEs. This talk will address the large-scale aspects, but specifically not energetic particle phenomena. A key point is that all models, whether sophisticated numerical contraptions or quasi-empirical ones, are only as good as the data you feed them. Hence the emphasis will be on observations and analysis methods. First I will review where we stand with regard to the near-Sun quantitative data needed to drive any model, no matter how complex or simple-minded, and I will discuss technological roadblocks that suggest it may be some time before we see any meaningful improvements beyond what we have today. Then I cover issues related to characterizing CME propagation out through the corona and into interplanetary space, as well as to observational limitations in the vicinity of 1 AU. Since none of these observational constraints are likely to be resolved anytime soon, the real challenge is to make more informed use of what is available. Thus, this talk will focus on how we may identify and pursue the most profitable approaches, for both forecast and research applications. The discussion will highlight a number of promising leads, including those related to inclusion of solar backside information, joint magnetograph observations from L5 and Earth, how to use (not just run) ensembles, more rational use of HI observations, and suggestions for using cube-sats for deep space observations of CMEs and MCs.

  11. Role of Pediatric Emergency Physicians in Identifying Bullying.

    Science.gov (United States)

    Waseem, Muhammad; Paul, Audrey; Schwartz, Gerald; Pauzé, Denis; Eakin, Paul; Barata, Isabel; Holtzman, Doug; Benjamin, Lee S; Wright, Joseph L; Nickerson, Amanda B; Joseph, Madeline

    2017-02-01

    Bullying is an important public health issue with broad implications. Although this issue has been studied extensively, there is limited emergency medicine literature addressing bullying. The emergency department (ED) physician has a unique opportunity to identify children and adolescents that are victims of bullying, and make a difference in their lives. Our aim is to discuss the role of the emergency physician (EP) in identifying patients who have been victims of bullying and how to provide effective management as well as referral for further resources. This document provides a framework for recognizing, stabilizing, and managing children who have experienced bullying. With the advent of social media, bullying behavior is not limited to in-person situations, and often occurs via electronic communication, further complicating recognition because it may not impart any physical harm to the child. Recognition of bullying requires a high level of suspicion, as patients may not offer this history. After the stabilization of any acute or overt indications of physical injury, along with obtaining a history of the mechanism of injury, the EP has the opportunity to identify the existence of bullying as the cause of the injury, and can address the issue in the ED while collaborating with "physician-extenders," such as social workers, toward identifying local resources for further support. The ED is an important arena for the assessment and management of children who have experienced bullying. It is imperative that EPs on the front lines of patient care address this public health epidemic. They have the opportunity to exert a positive impact on the lives of the children and families who are the victims of bullying. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Multicultural Issues and Concerns in Library Education.

    Science.gov (United States)

    Freiband, Susan J.

    1992-01-01

    Identifies multilingual and multicultural issues relevant to library and information science curricula today and outlines the skills, knowledge, and attitudes needed by graduates to address these issues. Aspects of the curriculum, specific programs, and activities on which to focus are discussed. (13 references) (EA)

  13. Macroeconomic Issues Confronting the Next President.

    Science.gov (United States)

    Solow, Robert M.

    1988-01-01

    Identifies economic issues that confronted the United States in the late 1980's and discusses how the president might deal with them. Highlights the following issues: recession, rising price levels, the budget deficit, international trade imbalance, and revival of U.S. long-term growth. (GEA)

  14. Republic of Lithuania; Selected Issues

    OpenAIRE

    International Monetary Fund

    2010-01-01

    This Selected Issues paper reviews public expenditure in Lithuania with a view to identify areas for which deeper reforms may be warranted to improve spending efficiency and contain future spending pressures. The paper benchmarks spending levels and spending composition in Lithuania against those in other European countries. The 31 European countries covered in the benchmarking exercise include the EU-28 plus Iceland, Norway, and Switzerland. Reflecting the tendency for public spending to inc...

  15. Economic issues relating to power sector

    International Nuclear Information System (INIS)

    Nair, S.K.N.; Mohan, Rakesh

    1998-01-01

    Financial distress alongside high rates of growth, stagnant organizations coexistent with upgraded technologies, richly endowed regions marked by low levels of electricity consumption and the long wait for private power in face of mounting shortfalls are among the contradictions marking the power sector. Decades of public financing support could shore up the rates of growth but forms of past intervention failed to address critical institutional and regulatory issues. Key areas that need intervention have now been identified, although several are yet to be tackled. This paper discusses the more important of the problem areas holding up significant economic gains that could be realized through cost reductions, the needed levels of investments, operation of market forces and targeting of resources to promote equitable growth. The slow pace of progress is a matter for concern. Effectiveness of many of the policy initiatives of government is also dependent on providing well thought out policy supports. (author)

  16. Battling with breast cancer - addressing the issues

    Energy Technology Data Exchange (ETDEWEB)

    Amin, S; Wahid, N; Wasim, B; Tabassum, S [Patel Hospital Gulshan-e-Iqbal, Karachi (Pakistan)

    2011-06-15

    In the background of the current situation of breast cancer in Pakistan, with its rising incidence and mortality, non afford ability and inaccessibility to screening, diagnosis and treatment, Patel Hospital took up the task of addressing these issues at a local level, by initiating an annual free breast camp in the year 2006. In 2008 an inclusion criteria was defined to focus on high risk women for breast cancer. A comparative analysis over a period of three years was done. In the focused camps, in which 28% patients were found to have a positive family history. Most women were symptomatic. Total 11 patients were diagnosed to have cancer after evaluation. Six patients underwent definitive treatment. A problem with lack of awareness, regarding screening and treatment protocols was identified. Family history seems to be an important risk factor in our set up signifying the need to introduce extensive screening programmes. (author)

  17. Battling with breast cancer - addressing the issues

    International Nuclear Information System (INIS)

    Amin, S.; Wahid, N.; Wasim, B.; Tabassum, S.

    2011-01-01

    In the background of the current situation of breast cancer in Pakistan, with its rising incidence and mortality, non afford ability and inaccessibility to screening, diagnosis and treatment, Patel Hospital took up the task of addressing these issues at a local level, by initiating an annual free breast camp in the year 2006. In 2008 an inclusion criteria was defined to focus on high risk women for breast cancer. A comparative analysis over a period of three years was done. In the focused camps, in which 28% patients were found to have a positive family history. Most women were symptomatic. Total 11 patients were diagnosed to have cancer after evaluation. Six patients underwent definitive treatment. A problem with lack of awareness, regarding screening and treatment protocols was identified. Family history seems to be an important risk factor in our set up signifying the need to introduce extensive screening programmes. (author)

  18. Colorectal Cancer: The Importance of Early Detection

    Science.gov (United States)

    ... of this page please turn JavaScript on. Feature: Colorectal Cancer The Importance of Early Detection Past Issues / Summer ... Cancer of the colon or rectum is called colorectal cancer. The colon and the rectum are part of ...

  19. PREFACE: CEWQO Topical Issue CEWQO Topical Issue

    Science.gov (United States)

    Bozic, Mirjana; Man'ko, Margarita

    2009-09-01

    This topical issue of Physica Scripta collects selected peer-reviewed contributions based on invited and contributed talks and posters presented at the 15th Central European Workshop on Quantum Optics (CEWQO) which took place in Belgrade 29 May-3 June 2008 (http://cewqo08.phy.bg.ac.yu). On behalf of the whole community took place in Belgrade 29 May-3 June 2008 (http://cewqo08.phy.bg.ac.yu, cewqo08.phy.bg.ac.yu). On behalf of the whole community of the workshop, we thank the referees for their careful reading and useful suggestions which helped to improve all of the submitted papers. A brief description of CEWQO The Central European Workshop on Quantum Optics is a series of conferences started informally in Budapest in 1992. Sometimes small events transform into important conferences, as in the case of CEWQO. Professor Jozsef Janszky, from the Research Institute of Solid State Physics and Optics, is the founder of this series. Margarita Man'ko obtained the following information from Jozsef Janszky during her visit to Budapest, within the framework of cooperation between the Russian and Hungarian Academies of Sciences in 2005. He organized a small workshop on quantum optics in Budapest in 1992 with John Klauder as a main speaker. Then, bearing in mind that a year before Janszky himself was invited by Vladimir Buzek to give a seminar on the same topic in Bratislava, he decided to assign the name 'Central European Workshop on Quantum Optics', considering the seminar in Bratislava to be the first workshop and the one in Budapest the second. The third formal workshop took place in Bratislava in 1993 organized by Vladimir Buzek, then in 1994 (Budapest, by Jozsef Janszky), 1995 and 1996 (Budmerice, Slovakia, by Vladimir Buzek), 1997 (Prague, by Igor Jex), 1999 (Olomouc, Czech Republic, by Zdenek Hradil), 2000 (Balatonfüred, Hungary, by Jozsef Janszky ), 2001 (Prague, by Igor Jex), 2002 (Szeged, Hungary, by Mihaly Benedict), 2003 (Rostock,Germany, by Werner Vogel and

  20. Workplace Issues in Extension--A Delphi Study of Extension Educators

    Science.gov (United States)

    Kroth, Michael; Peutz, Joey

    2011-01-01

    Using the Delphi technique, expert Extension educators identified and prioritized those workplace issues they believe will be the most important to attract, motivate, and retain Extension educators/agents over the next 5 to 7 years. Obtaining and then utilizing a talented, highly motivated workforce during a period when many will be retiring will…

  1. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  2. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  3. A CEO View of Key Issues in Australian Information Systems Management - 1997

    Directory of Open Access Journals (Sweden)

    Graham Pervan

    1998-05-01

    Full Text Available As part of a research programme on key information systems management issues, a survey of Australasia's largest 500 organisations was conducted to identify which issues were perceived by their chief executive officers (CEOs as being important, problematic and critical over the next three to five years. The results reported are based on a relatively low response rate (though perhaps reasonable for the target group so should be regarded as only exploratory. The most critical issues were revealed to be a mix of technology management issues (IT infrastructure, disaster recovery, strategic management issues (BPR, competitive advantage, information architecture, people management issues (organisational learning, systems development and data management issues (effective use of the data resource, effectiveness/productivity of IS, effectiveness of software development, and their own support systems (EIS/DSS. This reflects their interest in a wide range of issues, but all with an organisation-wide focus. Non-critical issues were mostly related to the individual technologies and the place and role of IS in the organisation. While the CEOs showed some agreement with their chief information officers (CIOs on issues such as the IT infrastructure, competitive advantage, and organisational learning some distinct differences exist, particularly in relation to the quality and effectiveness of systems and processes and also how CEOs and CIOs perceive each other.

  4. Critical issues in the history, philosophy, and sociology of astrobiology.

    Science.gov (United States)

    Dick, Steven J

    2012-10-01

    Fifty years after serious scientific research began in the field of exobiology, and forty years after serious historical research began on the subject of extraterrestrial life, this paper identifies and examines some of the most important issues in the history, philosophy, and sociology of what is today known as astrobiology. As in the philosophy of science in general, and in the philosophies of particular sciences, critical issues in the philosophy and sociology of astrobiology are both stimulated and illuminated by history. Among those issues are (1) epistemological issues such as the status of astrobiology as a science, the problematic nature of evidence and inference, and the limits of science; (2) metaphysical/scientific issues, including the question of defining the fundamental concepts of life, mind, intelligence, and culture in a universal context; the role of contingency and necessity in the origin of these fundamental phenomena; and whether or not the universe is in some sense fine-tuned for life and perhaps biocentric; (3) societal issues such as the theological, ethical, and worldview impacts of the discovery of microbial or intelligent life; and the question of whether the search for extraterrestrial life should be pursued at all, and with what precautions; and (4) issues related to the sociology of scientific knowledge, including the diverse attitudes and assumptions of different scientific communities and different cultures to the problem of life beyond Earth, the public "will to believe," and the formation of the discipline of astrobiology. All these overlapping issues are framed by the concept of cosmic evolution-the 13.7 billion year Master Narrative of the Universe-which may result in a physical, biological, or postbiological universe and determine the long-term destiny of humanity.

  5. Ethical issues in exercise psychology.

    Science.gov (United States)

    Pauline, Jeffrey S; Pauline, Gina A; Johnson, Scott R; Gamble, Kelly M

    2006-01-01

    Exercise psychology encompasses the disciplines of psychiatry, clinical and counseling psychology, health promotion, and the movement sciences. This emerging field involves diverse mental health issues, theories, and general information related to physical activity and exercise. Numerous research investigations across the past 20 years have shown both physical and psychological benefits from physical activity and exercise. Exercise psychology offers many opportunities for growth while positively influencing the mental and physical health of individuals, communities, and society. However, the exercise psychology literature has not addressed ethical issues or dilemmas faced by mental health professionals providing exercise psychology services. This initial discussion of ethical issues in exercise psychology is an important step in continuing to move the field forward. Specifically, this article will address the emergence of exercise psychology and current health behaviors and offer an overview of ethics and ethical issues, education/training and professional competency, cultural and ethnic diversity, multiple-role relationships and conflicts of interest, dependency issues, confidentiality and recording keeping, and advertisement and self-promotion.

  6. Issues of environmental (irresponsibility

    Directory of Open Access Journals (Sweden)

    Jana Dundelová

    2013-01-01

    Full Text Available In this paper the author reflects the questions of humans’ relationship to the environment and of their ecological behaviour that becomes together with the development of modern technologies increasingly relevant just as the question whether humans are able to affect fundamentally the environment on the Earth by their activities. According to some authors (e.g. Ehrlich, 1968; Gore, 2006; Wilson, 1995; Winter, Koger, 2009; Šmajs, 2005 human survival is directly connected with people’s relationship to the nature; but other influential authors have contradictory opinions or they are at least afraid of overestimation of ecological activities that can lead to neglecting of other important problems (e.g. Simon, 1981; Goklany, 2007; Lomborg, 2007; Klaus, 2007, 2009.These issues are dealt in this article mainly from the perspective of psychological theories and concepts – the Freud’s concept of unconsciousness is discussed as well as groupthink, theory of dissonance, contingency trap, Milgram’s theory of autonomous and agentic state of consciousness, group and intergroup behaviour, social dilemma – tragedy of the commons. Achieving a sustainable way of life depends on the equilibrium between consumption of individuals and regenerative abilities of the natural environment. However, people still behave as if they were separated from the nature. The linking axis of this article is the question of psychic powers causing individual and collective ecological (irresponsibility and the resulting consequences.

  7. Radioactive waste storage issues

    International Nuclear Information System (INIS)

    Kunz, D.E.

    1994-01-01

    In the United States we generate greater than 500 million tons of toxic waste per year which pose a threat to human health and the environment. Some of the most toxic of these wastes are those that are radioactively contaminated. This thesis explores the need for permanent disposal facilities to isolate radioactive waste materials that are being stored temporarily, and therefore potentially unsafely, at generating facilities. Because of current controversies involving the interstate transfer of toxic waste, more states are restricting the flow of wastes into - their borders with the resultant outcome of requiring the management (storage and disposal) of wastes generated solely within a state's boundary to remain there. The purpose of this project is to study nuclear waste storage issues and public perceptions of this important matter. Temporary storage at generating facilities is a cause for safety concerns and underscores, the need for the opening of permanent disposal sites. Political controversies and public concern are forcing states to look within their own borders to find solutions to this difficult problem. Permanent disposal or retrievable storage for radioactive waste may become a necessity in the near future in Colorado. Suitable areas that could support - a nuclear storage/disposal site need to be explored to make certain the health, safety and environment of our citizens now, and that of future generations, will be protected

  8. Importance of Stretching

    Science.gov (United States)

    ... Kids and Teens Pregnancy and Childbirth Women Men Seniors Your Health Resources Healthcare Management End-of-Life Issues Insurance & Bills Self Care Working With Your Doctor Drugs, Procedures & Devices Over-the- ...

  9. Aviation Safety Issues Database

    Science.gov (United States)

    Morello, Samuel A.; Ricks, Wendell R.

    2009-01-01

    The aviation safety issues database was instrumental in the refinement and substantiation of the National Aviation Safety Strategic Plan (NASSP). The issues database is a comprehensive set of issues from an extremely broad base of aviation functions, personnel, and vehicle categories, both nationally and internationally. Several aviation safety stakeholders such as the Commercial Aviation Safety Team (CAST) have already used the database. This broader interest was the genesis to making the database publically accessible and writing this report.

  10. Environmental issues and wastes

    International Nuclear Information System (INIS)

    Mitamura, Hisayoshi; Banba, Tsunetaka; Maeda, Toshikatsu; Ishiyama, Takashi

    1999-08-01

    All countries in the world are concerned about environmental issues because of their global effects. Developed industrial nations are also confronted with waste issues accompanied by mass production, mass consumption, and mass dump. We have reviewed books and reports to obtain a preliminary knowledge and to understand the trend of technology development before we start R and D for 'environmental monitoring, and environmental remediation and protection'. We lay great emphasis on municipal and industrial wastes in environmental issues and summarize the history of the earth, innovative environmental approaches in advanced nations, waste issues in Japan, and examples of technology development for environmental remediation and protection. (author)

  11. Importance and sensitivity of parameters affecting the Zion Seismic Risk

    International Nuclear Information System (INIS)

    George, L.L.; O'Connell, W.J.

    1985-06-01

    This report presents the results of a study on the importance and sensitivity of structures, systems, equipment, components and design parameters used in the Zion Seismic Risk Calculations. This study is part of the Seismic Safety Margins Research Program (SSMRP) supported by the NRC Office of Nuclear Regulatory Research. The objective of this study is to provide the NRC with results on the importance and sensitivity of parameters used to evaluate seismic risk. These results can assist the NRC in making decisions dealing with the allocation of research resources on seismic issues. This study uses marginal analysis in addition to importance and sensitivity analysis to identify subject areas (input parameter areas) for improvements that reduce risk, estimate how much the improvement dfforts reduce risk, and rank the subject areas for improvements. Importance analysis identifies the systems, components, and parameters that are important to risk. Sensitivity analysis estimates the change in risk per unit improvement. Marginal analysis indicates the reduction in risk or uncertainty for improvement effort made in each subject area. The results described in this study were generated using the SEISIM (Systematic Evaluation of Important Safety Improvement Measures) and CHAIN computer codes. Part 1 of the SEISIM computer code generated the failure probabilities and risk values. Part 2 of SEISIM, along with the CHAIN computer code, generated the importance and sensitivity measures

  12. Importance and sensitivity of parameters affecting the Zion Seismic Risk

    Energy Technology Data Exchange (ETDEWEB)

    George, L.L.; O' Connell, W.J.

    1985-06-01

    This report presents the results of a study on the importance and sensitivity of structures, systems, equipment, components and design parameters used in the Zion Seismic Risk Calculations. This study is part of the Seismic Safety Margins Research Program (SSMRP) supported by the NRC Office of Nuclear Regulatory Research. The objective of this study is to provide the NRC with results on the importance and sensitivity of parameters used to evaluate seismic risk. These results can assist the NRC in making decisions dealing with the allocation of research resources on seismic issues. This study uses marginal analysis in addition to importance and sensitivity analysis to identify subject areas (input parameter areas) for improvements that reduce risk, estimate how much the improvement dfforts reduce risk, and rank the subject areas for improvements. Importance analysis identifies the systems, components, and parameters that are important to risk. Sensitivity analysis estimates the change in risk per unit improvement. Marginal analysis indicates the reduction in risk or uncertainty for improvement effort made in each subject area. The results described in this study were generated using the SEISIM (Systematic Evaluation of Important Safety Improvement Measures) and CHAIN computer codes. Part 1 of the SEISIM computer code generated the failure probabilities and risk values. Part 2 of SEISIM, along with the CHAIN computer code, generated the importance and sensitivity measures.

  13. [DEONTOLOGICAL ISSUES IN RAILWAY HYGIENE].

    Science.gov (United States)

    Kaptsov, V A

    2015-01-01

    There are presented the main ethical and deontological problems encountered in practice and research activities of the hygienist in transport. There is shown the importance of strict compliance with hygienic standards, disregard for the principle of "technical attainability", the necessity of continuous training, improvement of skills of sanitary-educational activity and readiness to solve emerging ethical issues in connection with the development of scientific and technical progress.

  14. Reproductive issues in anorexia nervosa

    OpenAIRE

    Hoffman, Elizabeth R; Zerwas, Stephanie C; Bulik, Cynthia M

    2011-01-01

    Despite a high prevalence of menstrual irregularities, women with anorexia nervosa are becoming pregnant. The physical and psychological demands of pregnancy and motherhood can represent an immense challenge for women already struggling with the medical and psychological stress of an eating disorder. This article summarizes key issues related to reproduction in women with anorexia nervosa, highlighting the importance of preconception counseling, adequate gestational weight gain, and sufficien...

  15. Preterm birth, an unresolved issue

    OpenAIRE

    Beliz?n, Jose M; Hofmeyr, Justus; Buekens, Pierre; Salaria, Natasha

    2013-01-01

    Premature birth is the world?s leading cause of neonatal mortality with worldwide estimates indicating 11.1% of all live births were preterm in 2010. Preterm birth rates are increasing in most countries with continual differences in survival rates amongst rich and poor countries. Preterm birth is currently an important unresolved global issue with research efforts focusing on uterine quiescence and activation, the ?omics? approaches and implementation science in order to reduce the incidence ...

  16. Issues about Human Resources Recruitment

    OpenAIRE

    Aurel Manolescu

    2008-01-01

    As to ensure its success or even for surviving, organizations must settle accordingly some issues regarding the human resources enlistment, presented in great details within the article, whose success settlement ensure, concomitantly, the success of the entire assurance process with personnel, process extremely important, if there are taken into consideration, especially, the effects of some possible errors or hire errors. Therefore, the human resources recruitment tends to become a complex a...

  17. Conflict management: importance and implications.

    Science.gov (United States)

    McKibben, Laurie

    2017-01-26

    Conflict is a consistent and unavoidable issue within healthcare teams. Despite training of nurse leaders and managers around areas of conflict resolution, the problem of staff relations, stress, sickness and retention remain. Conflict arises from issues with interpersonal relationships, change and poor leadership. New members of staff entering an already established healthcare team should be supported and integrated, to encourage mutual role respect between all team members and establish positive working relationships, in order to maximise patient care. This paper explores the concept of conflict, the importance of addressing causes of conflict, effective management, and the relevance of positive approaches to conflict resolution. Good leadership, nurturing positive team dynamics and communication, encourages shared problem solving and acceptance of change. Furthermore mutual respect fosters a more positive working environment for those in healthcare teams. As conflict has direct implications for patients, positive resolution is essential, to promote safe and effective delivery of care, whilst encouraging therapeutic relationships between colleagues and managers.

  18. Introduction: Special issue on Global Lesbian Cinema.

    Science.gov (United States)

    Farr, Daniel

    2012-01-01

    This article offers a brief introduction to this special issue on Global Lesbian Cinema. This issue particularly highlights the importance of recognizing lesbian discourse as a separate, related piece of the discourse of queer transnational and global cinema. Subsequently, brief summaries of the eight articles of this collection are provided.

  19. More Issues in Observed-Score Equating

    Science.gov (United States)

    van der Linden, Wim J.

    2013-01-01

    This article is a response to the commentaries on the position paper on observed-score equating by van der Linden (this issue). The response focuses on the more general issues in these commentaries, such as the nature of the observed scores that are equated, the importance of test-theory assumptions in equating, the necessity to use multiple…

  20. Issues in the Seclusion and Restraint of Juveniles: Policy, Practice and Possibilities

    Directory of Open Access Journals (Sweden)

    Rodney A. Ellis

    2001-05-01

    Full Text Available The appropriate use of seclusion and restraint (S/R is an important issue among juvenile justice professionals. Recent newspaper articles have brought the issue to the attention of the United States Senate, law enforcement agencies, and the general public. The result has been a series of investigations and publications by the Senate, law enforcement, and professional associations. Despite the attention this issue has received, professionals have yet to reach a definitive agreement as to what recent legislation and the professional and popular literature regarding the use of S/R. They identify major issues currently under discussion, highlight areas of consensus, and enumerate several dimensions that require further exploration. Finally, the authors discuss the implications of S/R for social work practitioners, including the importance of education and training, monitoring, hiring, policy advocacy, and ongoin research.

  1. Potential Interface Issues in Spent Fuel Management

    International Nuclear Information System (INIS)

    2015-10-01

    This publication is an output of a series of meetings to identify and evaluate issues and opportunities associated with interfaces in the back end of the fuel cycle (BEFC) and to describe effective management approaches based on the experience of Member States. During the meetings, participants from Member States and other international organizations shared and evaluated the main interfaces and potential interface issues among the spent fuel storage, transport, reprocessing and disposal of the BEFC, and also reviewed the national approaches to addressing these issues. The aim of this publication is to provide an approach to identify the interfaces in the BEFC as well as the potential issues that should be addressed. It also aims at responding to the solutions Member States most often find to be effective and, in some cases, were adjusted or revisited to reach the fixed target. Most of the interfaces and issues are country specific, as evidenced by the variety and diversity of examples provided in this publication

  2. Issues about Human Resources Recruitment

    Directory of Open Access Journals (Sweden)

    Aurel Manolescu

    2008-04-01

    Full Text Available As to ensure its success or even for surviving, organizations must settle accordingly some issues regarding the human resources enlistment, presented in great details within the article, whose success settlement ensure, concomitantly, the success of the entire assurance process with personnel, process extremely important, if there are taken into consideration, especially, the effects of some possible errors or hire errors. Therefore, the human resources recruitment tends to become a complex and expensive activity and, concomitantly, an independent activity, sustained both through the necessary work volume as well as through its importance for the organization.

  3. Securities issues in reserves reporting

    International Nuclear Information System (INIS)

    Legg, M.B.

    1997-01-01

    Securities issues in oil and gas reserves reporting were discussed. Alberta requires specific information regarding important oil and gas properties, plants, facilities and installations. When preparing the reserves report, the following elements are important to consider: (1) the author of the report must be a registered professional engineer or registered professional geologist, (2) the report itself must be an engineering document, (3) the content of the report must be extensive, (4) it should be prepared in accordance with petroleum engineering and evaluation practices, and must include a summary of estimated net reserves

  4. Safeguards and security issues at the MRS facility

    International Nuclear Information System (INIS)

    McGuinn, E.; Birch, M.; Jones, J.; Floyd, W.

    1993-01-01

    The U.S. Department of Energy's (DOE) Office of Civilian Radioactive Waste Management (OCRWM) is responsible for disposing of the nation's high level radioactive waste in a way that ensures the protection of the public from any unacceptable radiological risks and the maintenance of the national security. To achieve these objectives, OCRWM plans to institute a Nuclear Regulatory Commission (NRC)-approved security program at its facilities including the Monitored Retrievable Storage (MRS) facility. This program will safeguard nuclear information and provide not only for the physical protection of facilities but also for the nuclear material being handled and stored. Several key regulatory issues were identified during the development of the safeguards and security (S ampersand S) program for the MRS. These issues relate to developing a realistic definition of the security threat at the MRS and establishing a single set of regulatory requirements. Resolution of these issues is important to implement a realistic S ampersand S program who scope is commensurate with the potential risk at the MRS and complies with all appropriate regulatory requirements. OCRWM is working toward a timely resolution of these issues and on the formulation of an S ampersand S program for implementation at the MRS. As an initial step, DOE has proposed an S ampersand S strategy for the MRS based on a set of assumed resolutions to the key regulatory issues. With this approach, the facility designers will be able to evaluate possible S ampersand S concepts for integration into the MRS early in the design process

  5. Navigating "Thorny" Issues

    Science.gov (United States)

    Hutchinson, Kashema; Gilbert, Aderinsola; Malyukova, Anna

    2016-01-01

    In their article "Mindfulness and discussing 'thorny' issues in the classroom" Konstantinos Alexakos et al. ("Cult Stud Sci Educ," 2016. doi: 10.1007/s11422-015-9718-0) describe "thorny" issues as "difficult topics to discuss because they are more personal to some perhaps even cause pain and violence." As…

  6. Poverty + Hunger = Global Issues.

    Science.gov (United States)

    Schwartz, Richard H.

    1983-01-01

    Geography teachers can use mathematics to teach fourth, fifth, and sixth grade students about critical global issues. Five sample problems concerning population, poverty, waste, the arms race, and hunger are presented. The global issue related to each problem is discussed, and the solution and mathematical skill are provided. (RM)

  7. 19 (Special Issue)

    African Journals Online (AJOL)

    mwakagugu

    19 (Special Issue). Tanzania Dental Journal 2017. 1. PRESIDENTS SPEECH AT THE OPENING CEREMONY OF THE TANZANIA DENTAL. ASSOCIATION 31ST SCIENTIFIC CONFERENCE AND .... awareness on oral health issues, high tooth decay, gum diseases and predominant tooth extraction as consistently reported ...

  8. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  9. An analysis of business issues in a telestroke project.

    Science.gov (United States)

    Cho, Sunyoung; Khasanshina, Elena V; Mathiassen, Lars; Hess, David C; Wang, Sam; Stachura, Max E

    2007-01-01

    A telehealth network based at the Medical College of Georgia was established in 2003 to treat stroke patients in remote hospitals. In the first three years, more than 400 patients were evaluated at nine rural hospitals. A total of 65 patients (16%) were treated with tissue plasminogen activator (approximately half of them in less than 2 h). Although clinically successful, the system reached the point at which it would either further diffuse or die out. We examined the roles played by internal and external factors in the development of the system. We interviewed 25 individuals in five hospitals (the hub hospital and four rural hospitals). Important business issues were identified that would need to be addressed in order to expand the project and make it self-sustaining. The external factors were economic, legal and market issues. The internal factors were organizational, technical and educational issues. Early identification and negotiation of business issues related to project implementation are likely to be important in diffusion and sustainability.

  10. High-level waste issues and resolutions document

    International Nuclear Information System (INIS)

    1994-05-01

    The High-Level Waste (HLW) Issues and Resolutions Document recognizes US Department of Energy (DOE) complex-wide HLW issues and offers potential corrective actions for resolving these issues. Westinghouse Management and Operations (M ampersand O) Contractors are effectively managing HLW for the Department of Energy at four sites: Idaho National Engineering Laboratory (INEL), Savannah River Site (SRS), West Valley Demonstration Project (WVDP), and Hanford Reservation. Each site is at varying stages of processing HLW into a more manageable form. This HLW Issues and Resolutions Document identifies five primary issues that must be resolved in order to reach the long-term objective of HLW repository disposal. As the current M ampersand O contractor at DOE's most difficult waste problem sites, Westinghouse recognizes that they have the responsibility to help solve some of the complexes' HLW problems in a cost effective manner by encouraging the M ampersand Os to work together by sharing expertise, eliminating duplicate efforts, and sharing best practices. Pending an action plan, Westinghouse M ampersand Os will take the initiative on those corrective actions identified as the responsibility of an M ampersand O. This document captures issues important to the management of HLW. The proposed resolutions contained within this document set the framework for the M ampersand Os and DOE work cooperatively to develop an action plan to solve some of the major complex-wide problems. Dialogue will continue between the M ampersand Os, DOE, and other regulatory agencies to work jointly toward the goal of storing, treating, and immobilizing HLW for disposal in an environmentally sound, safe, and cost effective manner

  11. Health Issues for Gay Men: Prevention First

    Science.gov (United States)

    ... Lifestyle Adult health Understand important health issues for gay men and men who have sex with men — ... Staff All men face certain health risks. However, gay men and men who have sex with men ...

  12. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  13. Volume 8 Issue 2

    Directory of Open Access Journals (Sweden)

    Karen Nelson

    2017-06-01

    Full Text Available This issue is our third Students, Transitions, Achievement, Retention and Success (STARS Conference special issue held in July this year in Adelaide, Australia.   As is customary, this issue of the journal publishes the top research papers selected via a peer review process and the top Emerging Initiatives selected by the Conference Committee.    We are delighted to feature in this special  issue —Reflections on Student Persistence—prepared by Advisory Board member Professor Vincent Tinto, Distinguished University Professor Emeritus at Syracuse University, USA.  Vincent is a long-time friend and supporter of STARS and its predecessor FYHE Conferences and Journal.   In his article, Vincent explores the case for motivation to be considered as a significant aspect of the tertiary student psyche by drawing on theoretical frameworks, research and practical experiences related to the issue.

  14. Ethical issues in animal cloning.

    Science.gov (United States)

    Fiester, Autumn

    2005-01-01

    The issue of human reproductive cloning has recently received a great deal attention in public discourse. Bioethicists, policy makers, and the media have been quick to identify the key ethical issues involved in human reproductive cloning and to argue, almost unanimously, for an international ban on such attempts. Meanwhile, scientists have proceeded with extensive research agendas in the cloning of animals. Despite this research, there has been little public discussion of the ethical issues raised by animal cloning projects. Polling data show that the public is decidedly against the cloning of animals. To understand the public's reaction and fill the void of reasoned debate about the issue, we need to review the possible objections to animal cloning and assess the merits of the anti-animal cloning stance. Some objections to animal cloning (e.g., the impact of cloning on the population of unwanted animals) can be easily addressed, while others (e.g., the health of cloned animals) require more serious attention by the public and policy makers.

  15. Materials issues in cask development

    International Nuclear Information System (INIS)

    Chapman, R.L.; Sorenson, K.B.

    1987-01-01

    The Department of Energy Office of Civilian Radioactive Waste Management (DOE-OCRWM) is chartered by Congress under the Nuclear Waste Policy Act (NWPA) to build a permanent repository for commercial spent nuclear fuel and to provide a supporting transportation system. The OCRWM-sponsored From-Reactor Cask Systems Acquisition Program is developing a family of casks suitable for transporting commercial spent fuel. Phase I of the program is in the process of procuring cask designs for further development and eventual licensing. New materials will probably be proposed for various components of the cask system. This paper identifies potential new materials as a function of their use in the cask (containment, shielding, etc). To the extent that the identified materials are new (not yet qualified for their intended application), this paper identifies probable technical issues and development efforts which may be required to qualify the materials for uses in transportation casks

  16. The Importance of Selecting Suitable Components and Apparatus in ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 1. The Importance of Selecting Suitable Components and Apparatus in Physics Laboratories. Vijay H Raybagkar. Classroom Volume 15 Issue 1 January 2010 pp 76-82 ...

  17. Importance of Engineering History Education

    Science.gov (United States)

    Arakawa, Fumio

    It is needless to cite the importance of education for succeed of engineering. IEEJ called for the establishment of ICEE in 1994, where the education is thought highly of, though its discussion has not been well working. Generally speaking, education has been one of the most important national strategies particularly at a time of its political and economical development. The science and technology education is, of course, not the exemption. But in these days around 2000 it seems that the public pays little attention on the science and technology, as they are quite day to day matters. As the results, for instance, such engineering as power systems and electric heavy machines are referred to as “endangered”. So fur, many engineers have tried not to be involved in social issues. But currently they can not help facing with risks of social issues like patent rights, troubles and accidents due to application of high technology, information security in the use of computers and engineering ethics. One of the most appropriate ways for the risk management is to learn lessons in the past, that is, history, so that the idea suggested in it could be made full use for the risk management. The author cited the global importance of education, particularly of engineering history education for engineering ethics, in the ICEE 2010 held in Bussan, Korea, as the 16th anniversary.

  18. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  19. Technical issues in fusion reactors

    International Nuclear Information System (INIS)

    Rohatgi, V.K.; Vijayan, T.

    1989-01-01

    In this paper the issues in fusion reactor technology are examined. Rapid progress in fusion technology research in recent years can be attributed to the advances in various technologies. The commercial generation of fusion power greatly depends on the evolution and improvements in these technologies. With better understanding of plasma physics, fusion reactor designs are becoming more and more realistic and comprehensive. It is now possible to compare various concepts within the framework of established technologies. The technological issues needing better understanding and solutions to problem areas are identified. Various instabilities and energy losses are major problem areas. Extensive developments in reactor-relevant advanced materials, compact and powerful superconducting magnets, high-power systems, and plasma heating drivers need to be undertaken and emphasized

  20. Importance of body image in marketing communication

    OpenAIRE

    Váradyová, Monika

    2012-01-01

    The thesis dedicated to the issue of body image in the context of marketing communication emphasizing female body imaging in advertising. The aim of Master's thesis is to identify differences in the perception of beauty between the German and Czechoslovak culture. The theoretical part is intended to explain the body image issues, including historical development. Furthermore points out the influence of mass media on women's physical self-concept. The practical part deals with content analysis...

  1. What Counts as a 'Social and Ethical Issue' in Nanotechnology?

    OpenAIRE

    Bruce V. Lewenstein

    2005-01-01

    As 'social and ethical issues' becomes a recurring phrase in the community paying attention to nanotechnology research, a crucial question becomes: what counts as a social and ethical issue? A typical list includes privacy, environmental health and safety, media hype, and other apparently unrelated issues. This article surveys those issues and suggests that concerns about fundamental concepts of ethics, such as fairness, justice, equity, and especially power, unite the various issues identifi...

  2. HEDIS Research Identifiable Files

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Healthcare Effectiveness Data and Information Set (HEDIS) is a tool used by more than 90 percent of Americas health plans to measure performance on important...

  3. Special Issue to publish

    OpenAIRE

    Kllogjeri, Pellumb

    2015-01-01

    SciencePG has offered an email poster to help collect papers for our Special Issue and I have uploaded it for you. Please visit http://www.sciencepublishinggroup.com/specialissue/149002  to see our Special Issue announcement. Now, you can do the followings to personally contribute and promote our Special Issue:1. Submit your paper related to the topics of interest 2. Upload it to your personal websites.3. Upload it to the public websites of some universities and academic institutions...

  4. Strategic importance of collaboration

    Energy Technology Data Exchange (ETDEWEB)

    Miller, K.A. [NB Power, Fredericton, New Brunswick (Canada)

    2015-07-01

    In the nuclear industry there is a need to collaborate because of aging equipment, aging people that contribute to dilution of expertise, obsolesce and advances in codes and standards. In the longer term there is a need to focus on operational issues, sustain our suppliers and expertise as well as improve and sustain performance.

  5. Strategic importance of collaboration

    International Nuclear Information System (INIS)

    Miller, K.A.

    2015-01-01

    In the nuclear industry there is a need to collaborate because of aging equipment, aging people that contribute to dilution of expertise, obsolesce and advances in codes and standards. In the longer term there is a need to focus on operational issues, sustain our suppliers and expertise as well as improve and sustain performance.

  6. In This Issue

    Science.gov (United States)

    1996-07-01

    Composing the Curriculum For your summer reading pleasure this month's issue provides a wide range of subjects and activities. Our lead article is a tribute to a chemist-composer, Lejaren A. Hiller, Jr., as well as an examination of the interesting relationship between chemistry (and science) and music. Like Hiller, Wamser and Wamser (page 601) love both chemistry and music, and this comes through loud and clear in their historical perspective on Hiller's work. Much of the rest of the issue impinges on the chemistry curriculum in one form or another. Rettich, Bailey, Frank, and Frick (page 638) describe an integrated first- and second-year curriculum being developed at Illinois Wesleyan University that includes all subdisciplines of chemistry. They describe ways to teach topics such as acids and bases so that the perspectives of (for example) organic and inorganic chemistry are integrated and contemporaneous. Those contemplating a popular reform, group work or cooperative learning, will be interested in Birk and Kurtz's program (page 615) for training teaching assistants using cooperative learning. Surely TAs who have participated in cooperative groups to develop their own techniques for handling discussion and lab sessions will be able to use group learning to better advantage. Several years ago the ACS Division of Chemical Education set up a Task Force on the General Chemistry Curriculum. With support from the National Science Foundation and others, the task force has been quite active. In addition to the summative reports published here (pages 617-636) on four areas in which general chemistry teaching can be improved, they have contributed many Forum columns in earlier issues of the Journal and have published much of their work in New Directions for General Chemistry: A Resource for Curricular Change; Baird W. Lloyd, ed. Our current approach to teaching electron configurations of the atoms is largely based on quantum theory Because of the mathematics required

  7. Understanding Pregnancy and Birth Issues

    Science.gov (United States)

    ... Navigation Bar Home Current Issue Past Issues Understanding Pregnancy and Birth Issues Past Issues / Winter 2008 Table ... turn Javascript on. What is a High-Risk Pregnancy? All pregnancies involve a certain degree of risk ...

  8. Medical Issues: Nutrition

    Science.gov (United States)

    ... support & care > living with sma > medical issues > nutrition Nutrition Good nutrition is essential to health and growth. ... must make decisions based on their own needs. Nutrition Considerations Since we are still waiting for clinical ...

  9. Strategic Issues for Training.

    Science.gov (United States)

    Pollitt, David, Ed.

    1999-01-01

    Contains precis of 18 articles on strategic management issues, including management development, on-the-job training, corporate scholarship, educational technology, coaching, investing in intellectual capital, and knowledge management. (SK)

  10. Pregnancy and Reproductive Issues

    Science.gov (United States)

    ... Health Pregnancy Share this page Facebook Twitter Email Pregnancy and Reproductive Issues Tahirah Diagnosed in 2003 Pregnancy ... in control groups without the disease. Effects of pregnancy on MS Before 1950, most women with MS ...

  11. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-05-16

    May 16, 2018 ... This paper discusses the issues and challenges faced during .... provision of this AELF's office is costly and need permission from the university's management. .... This is to deduct weeks for the assignment and tests because ...

  12. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-03-22

    Mar 22, 2018 ... rameter of computation time and convergence rate. The two scheme have shown ... matrix and its inversion repeatedly for every iteration. This issue causes long ..... Some New Findings on Gauss-Seidel. Technique for Load ...

  13. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-02-01

    Feb 1, 2018 ... The main goal of this article is to analyze methodological issues in .... methodology and theory and historiology (theory of historic process) whose goal is to .... internal branches of sociology and interdisciplinary links of ...

  14. Respiratory Issues in OI

    Science.gov (United States)

    Respiratory Issues in Osteogenesis Imperfecta \\ Introduction The respiratory system’s job is to bring oxygen into the body and remove carbon dioxide, the waste product of breathing. Because oxygen is the fuel ...

  15. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-04-16

    Apr 16, 2018 ... The dimensions to business process strategy factors are .... Investigation pains directed at further exploring these issues are very ... relationship management, material flow management, corporate culture in SMEs' Customer.

  16. Common Mental Health Issues

    Science.gov (United States)

    Stock, Susan R.; Levine, Heidi

    2016-01-01

    This chapter provides an overview of common student mental health issues and approaches for student affairs practitioners who are working with students with mental illness, and ways to support the overall mental health of students on campus.

  17. Fusion Canada issue 11

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-06-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on operation at Tokamak de Varennes, CRITIC irradiations at AECL, Tritium systems at TFTR, physics contribution at ITER. 4 figs.

  18. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2017-11-10

    Nov 10, 2017 ... 1Faculty of Sports Science and Coaching, Universiti Pendidikan ... face obesity issues because of several factors such as changes in diet intake, lifestyle, physical ...... and its implications for policy and intervention strategies.

  19. Fusion Canada issue 23

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-01-01

    A short bulletin from the National Fusion Program highlighting in this issue TdeV tokamak updates, fusion research in Korea, CCFM program review, TdeV divertor plasma, and CFFTP program review. 4 figs.

  20. Sleep Issues and Sundowning

    Science.gov (United States)

    ... Caregiving Middle-Stage Caregiving Late-Stage Caregiving Behaviors Aggression & Anger Anxiety & Agitation Depression Hallucinations Memory Loss & Confusion Repetition Sleep Issues & Sundowning Suspicion & Delusions Wandering Abuse Start Here What You Need to Know Online ...

  1. Fusion Canada issue 27

    International Nuclear Information System (INIS)

    1995-03-01

    A short bulletin from the National Fusion Program highlighting in this issue ITER reactor siting, a major upgrade for TdeV tokamak, Ceramic Breeders: new tritium mapping technique and Joint Fusion Symposium. 2 figs

  2. Research Article Special Issue

    African Journals Online (AJOL)

    2017-02-15

    Feb 15, 2017 ... Research Article. Special Issue ... In myriad studies implemented, the quality of life has been defined in different ways among which the .... service and trading users in living area. ... market, bakery, barber shop, restaurant, etc.

  3. Environmental Compliance Issue Coordination

    Science.gov (United States)

    An order to establish the Department of Energy (DOE) requirements for coordination of significant environmental compliance issues to ensure timely development and consistent application of Departmental environmental policy and guidance

  4. Fusion Canada issue 20

    International Nuclear Information System (INIS)

    1993-03-01

    Fusion Canada's publication of the National Fusion Program. Included in this issue is the CFFTP Industrial Impact Study, CCFM/TdeV Update:helium pumping, research funds, and deuterium in beryllium - high temperature behaviour. 3 figs

  5. Issues in Electronic Publishing.

    Science.gov (United States)

    Meadow, Charles T.

    1997-01-01

    Discusses issues related to electronic publishing. Topics include writing; reading; production, distribution, and commerce; copyright and ownership of intellectual property; archival storage; technical obsolescence; control of content; equality of access; and cultural changes. (Author/LRW)

  6. Research Article Special Issue

    African Journals Online (AJOL)

    2016-05-15

    May 15, 2016 ... Assistant professor, Khorasgan Branch, Islamic Azad University, Isfahan, Iran ... Discussing the issue of knowledge leads inevitably to the problem of beliefs because .... the level of definition from truth at the level of examples.

  7. Male Fertility Issues

    Science.gov (United States)

    Fertility issues are common in boys and men getting cancer treatment. Fertility preservation options include sperm banking, testicular shielding, testicular sperm extraction (TESE), and testicular tissue freezing. Support and clinical trials are listed.

  8. Fusion Canada issue 23

    International Nuclear Information System (INIS)

    1994-01-01

    A short bulletin from the National Fusion Program highlighting in this issue TdeV tokamak updates, fusion research in Korea, CCFM program review, TdeV divertor plasma, and CFFTP program review. 4 figs

  9. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-02-24

    Feb 24, 2018 ... ABSTRACT. Electronic Records and Information Management (e-RIM) framework is paramount for ..... RIM issues and problems that led to information crisis. On the other .... Malaysia: A case study in one government agency”.

  10. Research Article Special Issue

    African Journals Online (AJOL)

    2016-07-16

    Jul 16, 2016 ... investigated and analyzed from various library and documentary ... It is therefore evident that applied research on issues related to ...... [29] Cutter-SL., Burton-CG., Emrich-CT., Disaster resilience indicators for benchmarking.

  11. Fusion Canada issue 10

    International Nuclear Information System (INIS)

    1990-02-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on Fusion Materials Research, ITER physics research, fusion performance record at JET, and design options for reactor building. 4 figs

  12. Fusion Canada issue 6

    International Nuclear Information System (INIS)

    1989-02-01

    A short bulletin from the National Fusion Program. Included in this issue is a funding report for CFFTP, a technical update for Tokamak de Varennes and a network for university research by the National Fusion Program. 4 figs

  13. Research Article Special Issue

    African Journals Online (AJOL)

    pc

    2018-04-18

    Apr 18, 2018 ... selectivity of possible lead compounds prior to clinical trials and ... These computational algorithms had resolved previous issues and .... In similarity with the spatial space degree of the universe, these descriptors are running ...

  14. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  15. Current Issues in Tourism

    OpenAIRE

    Xu, Shi; Martinez, Larry R.; Hubert, Van Hoof; Tews, Michael; Torres, Leonardo; Farfán, Karina

    2015-01-01

    Ram (2015 Ram, Y. (2015). Hostility or hospitality? A review on violence, bullying and sexual harassment in the tourism and hospitality industry. Current Issues in Tourism. doi:10.1080/13683500.2015.1064364 [Taylor & Francis Online], [Google Scholar] . Hostility or hospitality? A review on violence, bullying and sexual harassment in the tourism and hospitality industry. Current Issues in Tourism. doi:10.1080/13683500.2015.1064364) posits that violence and harassment are areas of concern...

  16. Foreword: Biomonitoring Equivalents special issue.

    Science.gov (United States)

    Meek, M E; Sonawane, B; Becker, R A

    2008-08-01

    The challenge of interpreting results of biomonitoring for environmental chemicals in humans is highlighted in this Foreword to the Biomonitoring Equivalents (BEs) special issue of Regulatory Toxicology and Pharmacology. There is a pressing need to develop risk-based tools in order to empower scientists and health professionals to interpret and communicate the significance of human biomonitoring data. The BE approach, which integrates dosimetry and risk assessment methods, represents an important advancement on the path toward achieving this objective. The articles in this issue, developed as a result of an expert panel meeting, present guidelines for derivation of BEs, guidelines for communication using BEs and several case studies illustrating application of the BE approach for specific substances.

  17. Sustainability issues in civil engineering

    CERN Document Server

    Saride, Sireesh; Basha, B

    2017-01-01

    This compilation on sustainability issues in civil engineering comprises contributions from international experts who have been working in the area of sustainability in civil engineering. Many of the contributions have been presented as keynote lectures at the International Conference on Sustainable Civil Infrastructure (ICSCI) held in Hyderabad, India. The book has been divided into core themes of Sustainable Transportation Systems, Sustainable Geosystems, Sustainable Environmental and Water Resources and Sustainable Structural Systems. Use of sustainability principles in engineering has become an important component of the process of design and in this context, design and analysis approaches in civil engineering are being reexamined to incorporate the principles of sustainable designs and construction in practice. Developing economies are on the threshold of rapid infrastructure growth and there is a need to compile the developments in various branches of civil engineering and highlight the issues. It is th...

  18. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  19. Fat: an evolving issue

    Directory of Open Access Journals (Sweden)

    John R. Speakman

    2012-09-01

    Work on obesity is evolving, and obesity is a consequence of our evolutionary history. In the space of 50 years, we have become an obese species. The reasons why can be addressed at a number of different levels. These include separating between whether the primary cause lies on the food intake or energy expenditure side of the energy balance equation, and determining how genetic and environmental effects contribute to weight variation between individuals. Opinion on whether increased food intake or decreased energy expenditure drives the obesity epidemic is still divided, but recent evidence favours the idea that food intake, rather than altered expenditure, is most important. There is more of a consensus that genetics explains most (probably around 65% of weight variation between individuals. Recent advances in genome-wide association studies have identified many polymorphisms that are linked to obesity, yet much of the genetic variance remains unexplained. Finding the causes of this unexplained variation will be an impetus of genetic and epigenetic research on obesity over the next decade. Many environmental factors – including gut microbiota, stress and endocrine disruptors – have been linked to the risk of developing obesity. A better understanding of gene-by-environment interactions will also be key to understanding obesity in the years to come.

  20. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  1. Radiation protection aspects in importing metallic scraps

    International Nuclear Information System (INIS)

    Risica, S.; Di Ciaccio, P.

    1996-09-01

    The meeting deals with radiation protection problems caused by the possibility that radioactive metal scraps or radioactive sources hidden in the scraps, may arrive in a foundry. The importance of this issue and of rational and systematic solutions is showed by several accidents, happened in the past in numerous countries, by many signals in Italy and by some papers published in international scientific journals or reports issued by authorities and institutions in different countries

  2. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  3. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  4. Nuclear Knowledge Management Implementation Issues In Sri Lanka

    International Nuclear Information System (INIS)

    Bandara, H.M.N.R.

    2014-01-01

    About Knowledge Management: Process of organizing and distributing an Organization’s collective wisdom so the right information gets to the right people at the right time. NKM Implementation Problems in Sri Lanka: • Difficulty of identifying nuclear knowledge holders; • NKM has not been given considerable importance; • Many nuclear science experts are in retirement age; • No proper mechanism is available to replace young personnel for their positions; • Unawareness of general public about his technology. • Capacity building through training and education and transferring knowledge from centers of knowledge to centers of growth are key issues. • Development of new courses related to nuclear science is a key issue to be highly considered. • The tendency towards the training and educations of nuclear personnel in the country is becoming less and less

  5. IMPORTANT CONCERN INVESTMENT MANAGEMENT

    Directory of Open Access Journals (Sweden)

    SINTEA (ANGHEL LUCICA

    2014-06-01

    Full Text Available The issue of probabilities, uncertainties and risks has concerned society since ancient times. By probability we can see the possible realization of an act or event under certain conditions. Uncertainty is caused by emotional status of the decision maker due to more subjective factors or to the knowledge to achieve an objective. Risk is a combination of the two elements characterized by a possible description of probabilities under insecurity uncertainty conditions.

  6. Conceptualizing the Limiting Issues Inhibiting Sustainability Embeddedness

    Directory of Open Access Journals (Sweden)

    Catherine le Roux

    2016-04-01

    Full Text Available There can be little doubt that sustainability has become one of the most important issues in business in recent years. In spite of sustainability’s importance, there is agreement amongst leaders and practitioners that sustainability is not as embedded as desired. This study reports a framework on inhibitors that limit sustainability embeddedness in organizations. The framework can assist management to address the non-achievement antecedents of embeddedness specifically and holistically. This study obtained empirical data from employees on all management levels in a stock exchange-listed company. Through in-depth analysis in a case organization, valuable insights about embeddedness were inductively identified, interpreted and presented using descriptive labels, namely: “Professing What Is Right”; “Green Distraction”; the belief of “Not My Job”; “Firefighter”; the “Past Performance Anchor”; “Strategy Discourse” and “Harmony”—a mediator to sustainability embeddedness. All these were also found to be altered by the transformation of culture and the communication of the strategy message by sustainable leadership—the moderator. The findings were also corroborated by related and supporting literature as part of our contribution and pursuit for better understanding of this phenomenon.

  7. Reliability issues : a Canadian perspective

    International Nuclear Information System (INIS)

    Konow, H.

    2004-01-01

    A Canadian perspective of power reliability issues was presented. Reliability depends on adequacy of supply and a framework for standards. The challenges facing the electric power industry include new demand, plant replacement and exports. It is expected that demand will by 670 TWh by 2020, with 205 TWh coming from new plants. Canada will require an investment of $150 billion to meet this demand and the need is comparable in the United States. As trade grows, the challenge becomes a continental issue and investment in the bi-national transmission grid will be essential. The 5 point plan of the Canadian Electricity Association is to: (1) establish an investment climate to ensure future electricity supply, (2) move government and industry towards smart and effective regulation, (3) work to ensure a sustainable future for the next generation, (4) foster innovation and accelerate skills development, and (5) build on the strengths of an integrated North American system to maximize opportunity for Canadians. The CEA's 7 measures that enhance North American reliability were listed with emphasis on its support for a self-governing international organization for developing and enforcing mandatory reliability standards. CEA also supports the creation of a binational Electric Reliability Organization (ERO) to identify and solve reliability issues in the context of a bi-national grid. tabs., figs

  8. Trustworthy persistent identifier systems of the future

    Science.gov (United States)

    Golodoniuc, Pavel; Klump, Jens; Car, Nicholas

    2016-04-01

    Over the last two decades, persistent identifier (PID) systems have seen some significant changes in their governance policies, system capabilities, and technology. The development of most systems was driven by two main application areas, namely archives and libraries. Guidelines and criteria for trustworthy PID systems have been clearly devised (Bütikofer, 2009) and many PID system implementations for the identification of static digital objects have been built (e.g., PURL). However systems delivering persistent identifiers for dynamic datasets are not yet mature. There has been a rapid proliferation of different PID systems caused by the specific technical or organisational requirements of various communities that could not be met by existing systems such as DOI, ISBN, and EAN. Many of these different systems were limited by their inability to provide native means of persistent identifier resolution. This has prompted a decoupling of PID-associated data from the resolution service and this is where the Handle system has played a significant role. The Handle allowed to build a distributed system of independently managed resolver services. A trustworthy PID system must be designed to outlive the objects it provides persistent identifiers for, which may cease to exist or otherwise be deprecated, and the technology used to implement it, which will certainly need to change with time. We propose that such a system should rest on four pillars of agreements - (i) definitions, (ii) policies, (iii) services, and (iv) data services, to ensure longevity. While we believe all four pillars are equally important, we intentionally leave regulating aspects of issuing of identifiers and their registration out of the scope of this paper and focus on the agreements that have to be established between PID resolver services and the data sources indicated by the persistent identifiers. We propose an approach to development of PID systems that combines the use of (a) the Handle system

  9. Key Issues in Global Technological Innovation Projects

    Directory of Open Access Journals (Sweden)

    Roberto Sbragia

    2012-04-01

    Full Text Available This article aimed to identify those issues that were present in global technological innovation projects carried out by Brazilian multinational companies and which performance criterions these undertakings met. We investigated 36 global technological innovation projects from Brazilian multinational enterprises through a web-survey. Findings show that these companies went beyond the traditional iron triangle to evaluate their technological efforts and considered additional performance dimensions such as customer satisfaction, business results, and preparation for the future. Results also show high degree of presence for issues emerging from the industry, moderate degree of presence for issues emerging from both the project and R&D activities, and low degree of presence for issues emerging from the headquarters, the subsidiaries, and the external environment. Further research is needed to find out if and how these issues influenced the performance of the global technological innovation projects studied.DOI:10.5585/gep.v3i1.72

  10. USSR Space Life Sciences Digest, issue 29

    Science.gov (United States)

    Stone, Lydia Razran (Editor); Teeter, Ronald (Editor); Rowe, Joseph (Editor)

    1991-01-01

    This is the twenty-ninth issue of NASA's Space Life Sciences Digest. It is a double issue covering two issues of the Soviet Space Biology and Aerospace Medicine Journal. Issue 29 contains abstracts of 60 journal papers or book chapters published in Russian and of three Soviet monographs. Selected abstracts are illustrated with figures and tables from the original. A review of a book on environmental hygiene and a list of papers presented at a Soviet conference on space biology and medicine are also included. The materials in this issue were identified as relevant to 28 areas of space biology and medicine. The areas are: adaptation, aviation medicine, biological rhythms, body fluids, botany, cardiovascular and respiratory systems, developmental biology, digestive system, endocrinology, equipment and instrumentation, genetics, habitability and environment effects, hematology, human performance, immunology, life support systems, mathematical modeling, metabolism, musculoskeletal system, neurophysiology, nutrition, personnel selection, psychology, radiobiology, reproductive system, space biology and medicine, and the economics of space flight.

  11. U.S. NRC's generic issues program

    International Nuclear Information System (INIS)

    Kauffman, J.V.; Foster, J.W.

    2008-01-01

    The United States Nuclear Regulatory Commission (NRC) has a Generic Issues Program (GIP) to address Generic Issues (GI). A GI is defined as 'a regulatory matter involving the design, construction, operation, or decommissioning of several, or a class of, NRC licensees or certificate holders that is not sufficiently addressed by existing rules, guidance, or programs'. This rather legalistic definition has several practical corollaries: First, a GI must involve safety. Second, the issue must involve at least two plants, or it would be a plant-specific issue rather than a GI. Third, the potential safety question must not be covered by existing regulations and guidance (compliance). Thus, the effect of a GI is to potentially change the body of regulations and associated guidance (e.g., regulatory guides). The GIP was started in 1976, thus it is a relatively mature program. Approximately 850 issues have been processed by the program to date. More importantly, even after 30 years, new GIs continue to be proposed. The entire set of Generic Issues (GIs) is updated annually in NUREG-0933, 'A Prioritization of Generic Safety Issues'. GIs normally involve complex questions of safety and regulation. Efficient and effective means of addressing these issues are very important for regulatory effectiveness. If an issue proves to pose a genuine, significant safety question, then swift, effective, enforceable, and cost-effective action needs to be taken. Conversely, if an issue is of little safety significance, the issue should be dismissed in an expeditious manner, avoiding unnecessary expenditure of resources and regulatory burden or uncertainty. This paper provides a summary of the 5-stage program, from identification through the regulatory assessment stage. The paper also includes a discussion of the program's seven criteria, sources of proposed GIs, recent improvements, publicly available information, historical performance, and status of current GIs. (authors)

  12. Information technology: management issues in outsource contracts.

    OpenAIRE

    2008-01-01

    This study concerns the investigation of management issues within information technology outsourcing contracts. The information technology outsourcing life cycle is used as the flow structure for the investigation. The associated user expectations that occur in each of the phases of the information technology outsourcing life cycle are identified. Following the identification of the management and user expectation issues in each phase of the outsource life cycle, the “Coetzee solution framewo...

  13. Human factors issues in fuel handling

    International Nuclear Information System (INIS)

    Beattie, J.D.; Iwasa-Madge, K.M.; Tucker, D.A.

    1994-01-01

    The staff of the Atomic Energy Control Board wish to further their understanding of human factors issues of potential concern associated with fuel handling in CANDU nuclear power stations. This study contributes to that objective by analysing the role of human performance in the overall fuel handling process at Ontario Hydro's Darlington Nuclear Generating Station, and reporting findings in several areas. A number of issues are identified in the areas of design, operating and maintenance practices, and the organizational and management environment

  14. ORCID: Author Identifiers for Librarians

    Directory of Open Access Journals (Sweden)

    Robyn B. Reed

    2017-10-01

    Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.

  15. The railroad perspective: Issues behind the issues

    International Nuclear Information System (INIS)

    Furber, C.P.; Brobst, W.A.

    1986-01-01

    Rail transportation is a vital segment of DOE's spent fuel program. Most of the shipments from reactors to a repository or to a Monitored Retrievable Storage facility will be by rail, and essentially all of the shipments from an MRS to a repository. Casks must move economically and efficiently, while at the same time providing adequate safety to the public and transport workers, and meeting the legal/institutional constraints. Shippers are faced with the problem of procuring transportation services in a safe manner at a reasonable cost, trying to balance freight charges against cask inventory costs. Carriers are cautious about accepting potentially high hazard materials in routine service, and are worried about uninsured losses in case of accidents. Both shippers and carriers operate under different scheduling and operational criteria. Technical and institutional constraints add to the complexity of the operation. Standardization of shipping casks and rail car design will ease the resolution of the complex problems now existent. This paper discusses the economic, safety, operational, and legal issues surrounding rail transportation

  16. Identifying phenomenal consciousness.

    Science.gov (United States)

    Schier, Elizabeth

    2009-03-01

    This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.

  17. Are All Pixels Equally Important?

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    When we look at our environment, we primarily pay attention to visually distinctive objects. We refer to these objects as visually important or salient. For efficient visual processing, the human visual system identifies salients objects and dedicates most of its processing resources to them. An analogous resource allocation can be performed by salient-object detection algorithms, which identify objects of interest in an image. Consequently, thanks to salient-object detection, complex visual computing operations can focus on the important parts of the visual data and can save time and resources. About the speaker Dr. Gokhan Yildirim is a research assistant in the School of Computer and Communication Sciences (IC) at the École Polytechnique Fédérale de Lausanne (EPFL). His research interests include image understanding, multimedia, pattern recognition, machine learning, salient-object detection on images & videos and its applications on image proces...

  18. STUDY OF IDENTIFYING AND PRIORITIZING THE AFFECTING FACTORS ON BANK BRAND CUSTOMER LOYALTY

    OpenAIRE

    Zahra Aliyari; Yosef Beygzadeh

    2017-01-01

    Today, customer loyalty is the key to business success. By increased customers’ loyalty, market share and profitability level of enterprises will rise. Market perception along with planning and adopting appropriate strategies for making customers loyal and enhancing their rate of loyalty leads to long-term benefits for the enterprises. Given the importance of the issue, the goal of this study was to identify and prioritize the factors affecting loyalty to a banking brand from perspective of K...

  19. Regulatory and legal issues

    International Nuclear Information System (INIS)

    Raisler, K.M.; Gregory, A.M.

    1999-01-01

    This chapter focuses on the legal issues relating to the derivatives market in the USA, and analyses the Commodity Futures Trading Commission's (CFTCs) information on swaps and hybrid instruments. The law and regulation in the USA is examined and the jurisdictional reach of the Securities and Exchange Commission (SEC), CFTC, and the Commodity Exchange Act (CEA) is described. The forward contract exclusion and the case of Transnor (Bermuda) Ltd. versus BP North America Petroleum, state laws, swap policy statement issues by the CFTC, the Futures Trading Practices Act of 1992, swaps exemptions, the exemption of hybrid instruments from the CEA, and energy contract exemption are discussed. Enforceability, derivatives, and issues before regulators are considered

  20. Year 2000 commercial issues

    Energy Technology Data Exchange (ETDEWEB)

    Kratz, M.P.J.; Booth, R.T. [Bennett Jones, Calgary, AB (Canada)

    1998-12-31

    This presentation focused on commercial aspects of the Y2K including: (1) special communication issues, (2) outsourcing transactions, (3) joint ventures and the significance for the oil and gas industry, and (4) contingency planning. Communication issues involve interaction with suppliers and vendors of critical systems, liability for Y2K communications (misrepresentation, defamation, promissory estoppel, statutory liability), securities disclosure (Canadian and US SEC requirements), protected communications, protection for Year 2000 statements. Outsourcing problems highlighted include resistance of suppliers to assume responsibility for Y2K problem remediation, factors which support and negate supplier responsibility, scope of suppliers` obligation, and warranties in respect of third party software. Regarding joint ventures, questions concerning limitations on liability, supply warranties, stand-by arrangements, stockpiling inventory, indemnities, confidentiality, operator compensation versus operator risk, and insurance were raised and addressed. Among contingency planning issues the questions of Y2K legal audit, and disclosure aspects of contingency planning were the featured concerns. figs.