WorldWideScience

Sample records for identifying candidate genotypes

  1. Application of pooled genotyping to scan candidate regions for association with HDL cholesterol levels

    Directory of Open Access Journals (Sweden)

    Hinds David A

    2004-11-01

    Full Text Available Abstract Association studies are used to identify genetic determinants of complex human traits of medical interest. With the large number of validated single nucleotide polymorphisms (SNPs currently available, two limiting factors in association studies are genotyping capability and costs. Pooled DNA genotyping has been proposed as an efficient means of screening SNPs for allele frequency differences in case-control studies and for prioritising them for subsequent individual genotyping analysis. Here, we apply quantitative pooled genotyping followed by individual genotyping and replication to identify associations with human serum high-density lipoprotein (HDL cholesterol levels. The DNA from individuals with low and high HDL cholesterol levels was pooled separately, each pool was amplified by polymerase chain reaction in triplicate and each amplified product was separately hybridised to a high-density oligonucleotide array. Allele frequency differences between case and control groups with low and high HDL cholesterol levels were estimated for 7,283 SNPs distributed across 71 candidate gene regions spanning a total of 17.1 megabases. A novel method was developed to take advantage of independently derived haplotype map information to improve the pooled estimates of allele frequency differences. A subset of SNPs with the largest estimated allele frequency differences between low and high HDL cholesterol groups was chosen for individual genotyping in the study population, as well as in a separate replication population. Four SNPs in a single haplotype block within the cholesteryl ester transfer protein (CETP gene interval were significantly associated with HDL cholesterol levels in both populations. Our study is among the first to demonstrate the application of pooled genotyping followed by confirmation with individual genotyping to identify genetic determinants of a complex trait.

  2. Network Based Integrated Analysis of Phenotype-Genotype Data for Prioritization of Candidate Symptom Genes

    Directory of Open Access Journals (Sweden)

    Xing Li

    2014-01-01

    Full Text Available Background. Symptoms and signs (symptoms in brief are the essential clinical manifestations for individualized diagnosis and treatment in traditional Chinese medicine (TCM. To gain insights into the molecular mechanism of symptoms, we develop a computational approach to identify the candidate genes of symptoms. Methods. This paper presents a network-based approach for the integrated analysis of multiple phenotype-genotype data sources and the prediction of the prioritizing genes for the associated symptoms. The method first calculates the similarities between symptoms and diseases based on the symptom-disease relationships retrieved from the PubMed bibliographic database. Then the disease-gene associations and protein-protein interactions are utilized to construct a phenotype-genotype network. The PRINCE algorithm is finally used to rank the potential genes for the associated symptoms. Results. The proposed method gets reliable gene rank list with AUC (area under curve 0.616 in classification. Some novel genes like CALCA, ESR1, and MTHFR were predicted to be associated with headache symptoms, which are not recorded in the benchmark data set, but have been reported in recent published literatures. Conclusions. Our study demonstrated that by integrating phenotype-genotype relationships into a complex network framework it provides an effective approach to identify candidate genes of symptoms.

  3. Immunogenicity of mumps virus vaccine candidates matching circulating genotypes in the United States and China.

    Science.gov (United States)

    Zengel, James; Phan, Shannon I; Pickar, Adrian; Xu, Pei; He, Biao

    2017-07-13

    Mumps virus (MuV) causes acute infection in humans with characteristic swelling of the parotid gland. While vaccination has greatly reduced the incidence of MuV infection, there have been multiple large outbreaks of mumps virus (MuV) in highly vaccinated populations. The most common vaccine strain, Jeryl Lynn, belongs to genotype A, which is no longer a circulating genotype. We have developed two vaccine candidates that match the circulating genotypes in the United States (genotype G) and China (genotype F). We found that there was a significant decrease in the ability of the Jeryl Lynn vaccine to produce neutralizing antibody responses to non-matched viruses, when compared to either of our vaccine candidates. Our data suggests that an updated vaccine may allow for better immunity against the circulating MuV genotypes G and F. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Most of the benefits from genomic selection can be realised by genotyping a proportion of selection candidates

    DEFF Research Database (Denmark)

    Henryon, Mark; Berg, Peer; Sørensen, Anders Christian

    2012-01-01

    allocated to male and female candidates at ratios of 100:0, 75:25, 50:50, 25:75, and 0:100. For genotyped candidates, a direct-genomic value (DGV) was sampled with reliabilities 0.10, 0.50, and 0.90. Ten sires and 300 dams with the highest breeding values after genotyping were selected at each generation......We reasoned that there are diminishing marginal returns from genomic selection as the proportion of genotyped selection candidates is increased and breeding values based on a priori information are used to choose the candidates that are genotyped. We tested this premise by stochastic simulation...... of breeding schemes that resembled those used for pigs. We estimated rates of genetic gain and inbreeding realized by genomic selection in breeding schemes where candidates were phenotyped before genotyping and 0-100% of the candidates were genotyped based on predicted breeding values. Genotypings were...

  5. ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

    Science.gov (United States)

    Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

    2012-01-01

    Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

  6. Identifying and Assessing Dispositions of Educational Leadership Candidates

    Science.gov (United States)

    Melton, Teri; Mallory, Barbara J.; Green, James

    2010-01-01

    The purpose of this study was to identify educational leadership programs' procedures for the identification and assessment of leadership dispositions. The findings of this cross sectional survey indicated that there is little consistency in practice in defining and assessing dispositions of leadership candidates. While findings indicated that the…

  7. 'Omics' approaches in tomato aimed at identifying candidate genes ...

    African Journals Online (AJOL)

    adriana

    2013-12-04

    Dec 4, 2013 ... approaches could be combined in order to identify candidate genes for the genetic control of ascorbic ..... applied to other traits under the complex control of many ... Engineering increased vitamin C levels in ... Chem. Biol. 13:532–538. Giovannucci E, Rimm EB, Liu Y, Stampfer MJ, Willett WC (2002). A.

  8. Procedures for identifying S-allele genotypes of Brassica.

    Science.gov (United States)

    Wallace, D H

    1979-11-01

    Procedures are described for efficient selection of: (1) homozygous and heterozygous S-allele genotypes; (2) homozygous inbreds with the strong self- and sib-incompatibility required for effective seed production of single-cross F1 hybrids; (3) heterozygous genotypes with the high self- and sib-incompatibility required for effective seed production of 3- and 4-way hybrids.From reciprocal crosses between two first generation inbred (I1) plants there are three potential results: both crosses are incompatible; one is incompatible and the other compatible; and both are compatible. Incompatibility of both crosses is useful information only when combined with data from other reciprocal crosses. Each compatible cross, depending on whether its reciprocal is incompatible or compatible, dictates alternative reasoning and additional reciprocal crosses for efficiently and simultaneously identifying: (A) the S-allele genotype of all individual I1 plants, and (B) the expressions of dominance or codominance in pollen and stigma (sexual organs) of an S-allele heterozygous genotype. Reciprocal crosses provide the only efficient means of identifying S-allele genotypes and also the sexual-organ x S-allele-interaction types.Fluorescent microscope assay of pollen tube penetration into the style facilitates quantitation within 24-48 hours of incompatibility and compatibility of the reciprocal crosses. A procedure for quantitating the reciprocal difference is described that maximizes informational content of the data about interactions between S alleles in pollen and stigma of the S-allele-heterozygous genotype.Use of the non-inbred Io generation parent as a 'known' heterozygous S-allele genotype in crosses with its first generation selfed (I1) progeny usually reduces at least 7 fold the effort required for achieving objectives 1, 2, and 3, compared to the method of making reciprocal crosses only among I1 plants.Identifying the heterozygous and both homozygous S-allele genotypes during

  9. Preliminary Evaluation of Some Elicited Apple Genotypes Candidate as Cultivars Using Morphological and Molecular Markers

    Directory of Open Access Journals (Sweden)

    Bayan Muzher

    2016-05-01

    Full Text Available Preliminary evaluation of 5 apple genotypes produced by seed selection in the germplasm of seed rootstocks in Sweida- Syria was carried out between 2005 and 2012, to study date of full flowering, maturity time, morphological characters of tree, shoots, leaves, flowers, and fruits, including chemical analysis. On the other hand, yield efficiency, fruit storability and the susceptibility to pests and physiological disorders were evaluated. Molecular characterization was achieved by using 8 pairs of SSR primers for the 5th genotypes in comparison with the two main commercial cultivars "Golden Delicious" and "Starking Delicious" to determine the genetic relationship between the studied genotypes and cultivars. The results divided the studied genotypes depending on the time of ripening into three groups: early, intermediate and late genotypes. All studied genotypes gave efficient and regular yield, and showed fixable fruit shape and size with variable storability due to maturity time. Molecular characterization reveled the ability of SSR technique to determine the genetic variation between the studied genotypes, the 8 primer pairs produced 22 alleles, 21 of them were polymorphic (95.45%. Cluster analysis divided the studied genotypes into 2 clusters, the first cluster included the two commercial cultivars Starking delicious and Golden delicious with one genotypes, while the second cluster contained the four remaining genotypes. Finally, the studied genotypes revealed high desired quantitative and qualitative traits, which assess to distribute these genotypes as new cultivars, and SSR technique was able to identify and revealed the genetic distance between the studied genotypes and commercial cultivars.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-2, March-May 2016, page: 98-109

  10. A preliminary candidate genotype-intermediate phenotype study of satiation and gastric motor function in obesity.

    Science.gov (United States)

    Papathanasopoulos, Athanasios; Camilleri, Michael; Carlson, Paula J; Vella, Adrian; Nord, Sara J Linker; Burton, Duane D; Odunsi, Suwebatu T; Zinsmeister, Alan R

    2010-06-01

    Stomach motility contributes significantly to fullness sensation while eating and cessation of food intake in humans. Genes controlling adrenergic and serotonergic mechanisms (ADRA2A, GNB3, and SLC6A4) affect gastric emptying (GE), volume (GV), and satiation. Fat mass and obesity-associated gene (FTO) is linked with satiety. Our aim was to examine the association of these candidate genes with stomach functions that signal postprandial fullness: GE, GV, and maximum tolerated volume (MTV). These biomarkers constitute a component of the intermediate phenotype of satiation. A total of 62 overweight or obese participants underwent genotyping of the candidate genes, and validated measurements of GE of solids and liquids by scintigraphy, fasting and postprandial change in GV by SPECT (single photon emission computed tomography), and MTV by nutrient drink test. These markers of satiation were compared for 38 genetic variants in ADRA2A, ADR2C, ADRB3, uncoupling protein (UCP)-2 and -3, GNB3, FTO, and SLC6A4 using a recessive model of inheritance. ADRA2A, ADR2C, UCP-3, GNB3, and FTO loci were significantly associated with the intermediate phenotype markers of satiation: ADR2C (Ins-Del322_325) with accelerated GE; GNB3 (rs1047776) with delayed GE; ADRA2A (rs491589 and rs553668) and GNB3 (rs2269355, rs10849527, and rs3759348) with decreased postprandial GV; ADRA2A (rs3750625) and GNB3 (rs4963517 and rs1129649) with increased postprandial GV; UCP-3 (rs1685356) with increased MTV, and FTO (rs9939609) decreased MTV. Genetic susceptibility to postprandial satiation can be identified through intermediate phenotype markers. With independent validation, these markers may guide patient selection of weight-loss therapies directed at gastric motor functions.

  11. Novel approaches to identify protective malaria vaccine candidates

    Directory of Open Access Journals (Sweden)

    Wan Ni eChia

    2014-11-01

    Full Text Available Efforts to develop vaccines against malaria have been the focus of substantial research activities for decades. Several categories of candidate vaccines are currently being developed for protection against malaria, based on antigens corresponding to the pre-erythrocytic, blood-stage or sexual stages of the parasite. Long lasting sterile protection from Plasmodium falciparum sporozoite challenge has been observed in human following vaccination with whole parasite formulations, clearly demonstrating that a protective immune response targeting predominantly the pre-erythrocytic stages can develop against malaria. However, most of vaccine candidates currently being investigated, which are mostly subunits vaccines, have not been able to induce substantial (>50% protection thus far. This is due to the fact that the antigens responsible for protection against the different parasite stages are still yet to be known and relevant correlates of protection have remained elusive. For a vaccine to be developed in a timely manner, novel approaches are required. In this article, we review the novel approaches that have been developed to identify the antigens for the development of an effective malaria vaccine.

  12. Identifying candidate driver genes by integrative ovarian cancer genomics data

    Science.gov (United States)

    Lu, Xinguo; Lu, Jibo

    2017-08-01

    Integrative analysis of molecular mechanics underlying cancer can distinguish interactions that cannot be revealed based on one kind of data for the appropriate diagnosis and treatment of cancer patients. Tumor samples exhibit heterogeneity in omics data, such as somatic mutations, Copy Number Variations CNVs), gene expression profiles and so on. In this paper we combined gene co-expression modules and mutation modulators separately in tumor patients to obtain the candidate driver genes for resistant and sensitive tumor from the heterogeneous data. The final list of modulators identified are well known in biological processes associated with ovarian cancer, such as CCL17, CACTIN, CCL16, CCL22, APOB, KDF1, CCL11, HNF1B, LRG1, MED1 and so on, which can help to facilitate the discovery of biomarkers, molecular diagnostics, and drug discovery.

  13. Novel Chlamydiales genotypes identified in ticks from Australian wildlife.

    Science.gov (United States)

    Burnard, Delaney; Weaver, Haylee; Gillett, Amber; Loader, Joanne; Flanagan, Cheyne; Polkinghorne, Adam

    2017-01-26

    Members of the order Chlamydiales are known for their potential as human and veterinary bacterial pathogens. Despite this recognition, epidemiological factors such as routes of transmission are yet to be fully defined. Ticks are well known vectors for many other infections with several reports recently describing the presence of bacteria in the order Chlamydiales in these arthropods. Australian wildlife are hosts to an extensive range of tick species. Evidence is also growing that the marsupial hosts these ticks parasitise can also be infected by a number of bacteria in the order Chlamydiales, with at least one species, Chlamydia pecorum, posing a significant conservation threat. In the current study, we investigated the presence and identity of Chlamydiales in 438 ixodid ticks parasitizing wildlife in Australia by screening with a pan-Chlamydiales specific targeting the 16S rRNA gene. Pan-Chlamydiales specific PCR assays confirmed the common presence of Chlamydiales in Australian ticks parasitising a range of native wildlife. Interestingly, we did not detect any Chlamydiaceae, including C. pecorum, the ubiquitous pathogen of the koala. Instead, the Chlamydiales diversity that could be resolved indicated that Australian ticks carry at least six novel Chlamydiales genotypes. Phylogenetic analysis of the 16S rRNA sequences (663 bp) of these novel Chlamydiales suggests that three of these genotypes are associated with the Simkaniaceae and putatively belong to three distinct novel strains of Fritschea spp. and three genotypes are related to the "Ca. Rhabdochlamydiaceae" and putatively belong to a novel genus, Rhabdochlamydia species and strain, respectively. Sequence results suggest Australian wildlife ticks harbour a range of unique Chlamydiales bacteria that belong to families previously identified in a range of arthropod species. The results of this work also suggest that it is unlikely that arthropods act as vectors of pathogenic members of the family

  14. Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

    2017-08-01

    Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

  15. Genome-wide association study identifies candidate genes for starch content regulation in maize kernels

    Directory of Open Access Journals (Sweden)

    Na Liu

    2016-07-01

    Full Text Available Kernel starch content is an important trait in maize (Zea mays L. as it accounts for 65% to 75% of the dry kernel weight and positively correlates with seed yield. A number of starch synthesis-related genes have been identified in maize in recent years. However, many loci underlying variation in starch content among maize inbred lines still remain to be identified. The current study is a genome-wide association study that used a set of 263 maize inbred lines. In this panel, the average kernel starch content was 66.99%, ranging from 60.60% to 71.58% over the three study years. These inbred lines were genotyped with the SNP50 BeadChip maize array, which is comprised of 56,110 evenly spaced, random SNPs. Population structure was controlled by a mixed linear model (MLM as implemented in the software package TASSEL. After the statistical analyses, four SNPs were identified as significantly associated with starch content (P ≤ 0.0001, among which one each are located on chromosomes 1 and 5 and two are on chromosome 2. Furthermore, 77 candidate genes associated with starch synthesis were found within the 100-kb intervals containing these four QTLs, and four highly associated genes were within 20-kb intervals of the associated SNPs. Among the four genes, Glucose-1-phosphate adenylyltransferase (APS1; Gene ID GRMZM2G163437 is known as an important regulator of kernel starch content. The identified SNPs, QTLs, and candidate genes may not only be readily used for germplasm improvement by marker-assisted selection in breeding, but can also elucidate the genetic basis of starch content. Further studies on these identified candidate genes may help determine the molecular mechanisms regulating kernel starch content in maize and other important cereal crops.

  16. Extended tracts of homozygosity identify novel candidate genes associated with late onset Alzheimer’s Disease

    Science.gov (United States)

    Nalls, M. A.; Guerreiro, R. J.; Simon-Sanchez, J.; Bras, J. T.; Traynor, B. J.; Gibbs, J. R.; Launer, L.; Hardy, J.; Singleton, A. B.

    2010-01-01

    Large tracts of extended homozygosity are more prevalent in outbred populations than previously thought. With the advent of high-density genotyping platforms, regions of extended homozygosity can be accurately located allowing for the identification of rare recessive risk variants contributing to disease. We compared measures of extended homozygosity (greater than 1 megabase in length) in a population of 837 late onset Alzheimer’s disease (LOAD) cases and 550 controls. In our analyses, we identify one homozygous region on chromosome 8 that is significantly associated with LOAD after adjusting for multiple testing. This region contains seven genes from which the most biologically plausible candidates are STAR, EIF4EBP1 and ADRB3. We also compared the total numbers of homozygous runs and the total length of these runs between cases and controls, showing a suggestive difference in these measures (p-values 0.052-0.062). This research suggests a recessive component to the etiology of LOAD. PMID:19271249

  17. Genome-Wide Association Study with Sequence Variants Identifies Candidate Genes for Mastitis Resistance in Dairy Cattle

    DEFF Research Database (Denmark)

    Sahana, Goutam; Guldbrandtsen, Bernt; Bendixen, Christian

    Six genomic regions affecting clinical mastitis were identified through a GWAS study with imputed BovineHD chip genotype data in the Nordic Holstein cattle population. The association analyses were carried out using a SNP-by-SNP analysis by fitting the regression of allele dosage and a polygenic...... Effect Predictor (VEP) vers. 2.6 using ENSEMBL vers. 67 databases. Candidate polymorphisms affecting clinical mastitis were selected based on their association with the traits and functional annotations. A strong positional candidate gene for mastitis resistance on chromosome-6 is the NPFFR2 which...... Factor Receptor Alpha (LIFR) emerged as a strong candidate gene for mastitis resistance. The LIFR gene is involved in acute phase response and is expressed in saliva and mammary gland....

  18. Integration of curated databases to identify genotype-phenotype associations

    Directory of Open Access Journals (Sweden)

    Li Jianrong

    2006-10-01

    Full Text Available Abstract Background The ability to rapidly characterize an unknown microorganism is critical in both responding to infectious disease and biodefense. To do this, we need some way of anticipating an organism's phenotype based on the molecules encoded by its genome. However, the link between molecular composition (i.e. genotype and phenotype for microbes is not obvious. While there have been several studies that address this challenge, none have yet proposed a large-scale method integrating curated biological information. Here we utilize a systematic approach to discover genotype-phenotype associations that combines phenotypic information from a biomedical informatics database, GIDEON, with the molecular information contained in National Center for Biotechnology Information's Clusters of Orthologous Groups database (NCBI COGs. Results Integrating the information in the two databases, we are able to correlate the presence or absence of a given protein in a microbe with its phenotype as measured by certain morphological characteristics or survival in a particular growth media. With a 0.8 correlation score threshold, 66% of the associations found were confirmed by the literature and at a 0.9 correlation threshold, 86% were positively verified. Conclusion Our results suggest possible phenotypic manifestations for proteins biochemically associated with sugar metabolism and electron transport. Moreover, we believe our approach can be extended to linking pathogenic phenotypes with functionally related proteins.

  19. Targeting 160 candidate genes for blood pressure regulation with a genome-wide genotyping array.

    Directory of Open Access Journals (Sweden)

    Siim Sõber

    2009-06-01

    Full Text Available The outcome of Genome-Wide Association Studies (GWAS has challenged the field of blood pressure (BP genetics as previous candidate genes have not been among the top loci in these scans. We used Affymetrix 500K genotyping data of KORA S3 cohort (n = 1,644; Southern-Germany to address (i SNP coverage in 160 BP candidate genes; (ii the evidence for associations with BP traits in genome-wide and replication data, and haplotype analysis. In total, 160 gene regions (genic region+/-10 kb covered 2,411 SNPs across 11.4 Mb. Marker densities in genes varied from 0 (n = 11 to 0.6 SNPs/kb. On average 52.5% of the HAPMAP SNPs per gene were captured. No evidence for association with BP was obtained for 1,449 tested SNPs. Considerable associations (P50% of HAPMAP SNPs were tagged. In general, genes with higher marker density (>0.2 SNPs/kb revealed a better chance to reach close to significance associations. Although, none of the detected P-values remained significant after Bonferroni correction (P<0.05/2319, P<2.15 x 10(-5, the strength of some detected associations was close to this level: rs10889553 (LEPR and systolic BP (SBP (P = 4.5 x 10(-5 as well as rs10954174 (LEP and diastolic BP (DBP (P = 5.20 x 10(-5. In total, 12 markers in 7 genes (ADRA2A, LEP, LEPR, PTGER3, SLC2A1, SLC4A2, SLC8A1 revealed considerable association (P<10(-3 either with SBP, DBP, and/or hypertension (HYP. None of these were confirmed in replication samples (KORA S4, HYPEST, BRIGHT. However, supportive evidence for the association of rs10889553 (LEPR and rs11195419 (ADRA2A with BP was obtained in meta-analysis across samples stratified either by body mass index, smoking or alcohol consumption. Haplotype analysis highlighted LEPR and PTGER3. In conclusion, the lack of associations in BP candidate genes may be attributed to inadequate marker coverage on the genome-wide arrays, small phenotypic effects of the loci and/or complex interaction with life-style and metabolic parameters.

  20. A statistical approach to identify candidate cues for nestmate recognition

    DEFF Research Database (Denmark)

    van Zweden, Jelle; Pontieri, Luigi; Pedersen, Jes Søe

    2014-01-01

    normalization, centroid,and distance calculation is most diagnostic to discriminate between NMR cues andother compounds. We find that using a “global centroid” instead of a “colony centroid”significantly improves the analysis. One reason may be that this new approach, unlikeprevious ones, provides...... than forF. exsecta, possibly due to less than ideal datasets. Nonetheless, some compound setsperformed better than others, showing that this approach can be used to identify candidatecompounds to be tested in bio-assays, and eventually crack the sophisticated code thatgoverns nestmate recognition....

  1. NDE of PWR fuel: Identifying candidates for hot cell examination

    International Nuclear Information System (INIS)

    Moon, J.E.; Bury, J.G.; Correal, O.A.; Kunishi, H.; Wilson, H.W.

    1992-05-01

    On-site examinations were performed at the Indian Point 3 and Callaway reactors to attempt to identify the leakage mechanism of several leaking fuel rods. The exams consisted of removing the leaking fuel rods from the assembly and performing a visual examination. These results, combined with other available on-site data on leaking fuel rods, were used to select fuel rods for shipment to a hot cell for detailed root cause examination. Three fuel rods from the Indian Point 3 reactor were found to be leaking due to debris-induced fretting. The examinations at Callaway were terminated prior to completion due to utility scheduler conflicts. Rods from the Callaway reactor were selected for shipment to the hot cell along with the rods from the Byron 1 and 2 and V.C. Summer reactors. The data presented in the report summarize the coolant activity history, the UT examination results, and a summary of the review of the fabrication records. The basis for the selection of the rods to be sent to the hot cells is also summarized

  2. Reverse Vaccinology: An Approach for Identifying Leptospiral Vaccine Candidates

    Directory of Open Access Journals (Sweden)

    Odir A. Dellagostin

    2017-01-01

    Full Text Available Leptospirosis is a major public health problem with an incidence of over one million human cases each year. It is a globally distributed, zoonotic disease and is associated with significant economic losses in farm animals. Leptospirosis is caused by pathogenic Leptospira spp. that can infect a wide range of domestic and wild animals. Given the inability to control the cycle of transmission among animals and humans, there is an urgent demand for a new vaccine. Inactivated whole-cell vaccines (bacterins are routinely used in livestock and domestic animals, however, protection is serovar-restricted and short-term only. To overcome these limitations, efforts have focused on the development of recombinant vaccines, with partial success. Reverse vaccinology (RV has been successfully applied to many infectious diseases. A growing number of leptospiral genome sequences are now available in public databases, providing an opportunity to search for prospective vaccine antigens using RV. Several promising leptospiral antigens were identified using this approach, although only a few have been characterized and evaluated in animal models. In this review, we summarize the use of RV for leptospirosis and discuss the need for potential improvements for the successful development of a new vaccine towards reducing the burden of human and animal leptospirosis.

  3. Effects of vertebral number variations on carcass traits and genotyping of Vertnin candidate gene in Kazakh sheep

    Directory of Open Access Journals (Sweden)

    Zhifeng Zhang

    2017-09-01

    Full Text Available Objective The vertebral number is associated with body length and carcass traits, which represents an economically important trait in farm animals. The variation of vertebral number has been observed in a few mammalian species. However, the variation of vertebral number and quantitative trait loci in sheep breeds have not been well addressed. Methods In our investigation, the information including gender, age, carcass weight, carcass length and the number of thoracic and lumbar vertebrae from 624 China Kazakh sheep was collected. The effect of vertebral number variation on carcass weight and carcass length was estimated by general linear model. Further, the polymorphic sites of Vertnin (VRTN gene were identified by sequencing, and the association of the genotype and vertebral number variation was analyzed by the one-way analysis of variance model. Results The variation of thoracolumbar vertebrae number in Kazakh sheep (18 to 20 was smaller than that in Texel sheep (17 to 21. The individuals with 19 thoracolumbar vertebrae (T13L6 were dominant in Kazakh sheep (79.2%. The association study showed that the numbers of thoracolumbar vertebrae were positively correlated with the carcass length and carcass weight, statistically significant with carcass length. To investigate the association of thoracolumbar vertebrae number with VRTN gene, we genotyped the VRTN gene. A total of 9 polymorphic sites were detected and only a single nucleotide polymorphism (SNP (rs426367238 was suggested to associate with thoracic vertebral number statistically. Conclusion The variation of thoracolumbar vertebrae number positively associated with the carcass length and carcass weight, especially with the carcass length. VRTN gene polymorphism of the SNP (rs426367238 with significant effect on thoracic vertebral number could be as a candidate marker to further evaluate its role in influence of thoracolumbar vertebral number.

  4. Effects of vertebral number variations on carcass traits and genotyping of Vertnin candidate gene in Kazakh sheep.

    Science.gov (United States)

    Zhang, Zhifeng; Sun, Yawei; Du, Wei; He, Sangang; Liu, Mingjun; Tian, Changyan

    2017-09-01

    The vertebral number is associated with body length and carcass traits, which represents an economically important trait in farm animals. The variation of vertebral number has been observed in a few mammalian species. However, the variation of vertebral number and quantitative trait loci in sheep breeds have not been well addressed. In our investigation, the information including gender, age, carcass weight, carcass length and the number of thoracic and lumbar vertebrae from 624 China Kazakh sheep was collected. The effect of vertebral number variation on carcass weight and carcass length was estimated by general linear model. Further, the polymorphic sites of Vertnin ( VRTN ) gene were identified by sequencing, and the association of the genotype and vertebral number variation was analyzed by the one-way analysis of variance model. The variation of thoracolumbar vertebrae number in Kazakh sheep (18 to 20) was smaller than that in Texel sheep (17 to 21). The individuals with 19 thoracolumbar vertebrae (T13L6) were dominant in Kazakh sheep (79.2%). The association study showed that the numbers of thoracolumbar vertebrae were positively correlated with the carcass length and carcass weight, statistically significant with carcass length. To investigate the association of thoracolumbar vertebrae number with VRTN gene, we genotyped the VRTN gene. A total of 9 polymorphic sites were detected and only a single nucleotide polymorphism (SNP) (rs426367238) was suggested to associate with thoracic vertebral number statistically. The variation of thoracolumbar vertebrae number positively associated with the carcass length and carcass weight, especially with the carcass length. VRTN gene polymorphism of the SNP (rs426367238) with significant effect on thoracic vertebral number could be as a candidate marker to further evaluate its role in influence of thoracolumbar vertebral number.

  5. Pilot study on the use of data mining to identify cochlear implant candidates.

    Science.gov (United States)

    Grisel, Jedidiah J; Schafer, Erin; Lam, Anne; Griffin, Terry

    2018-05-01

    The goal of this pilot study was to determine the clinical utility of data-mining software that screens for cochlear implant (CI) candidacy. The Auditory Implant Initiative developed a software module that screens for CI candidates via integration with a software system (Noah 4) that serves as a depository for hearing test data. To identify candidates, patient audiograms from one practice were exported into the screening module. Candidates were tracked to determine if any eventually underwent implantation. After loading 4836 audiograms from the Noah 4 system, the screening module identified 558 potential CI candidates. After reviewing the data for the potential candidates, 117 were targeted and invited to an educational event. Following the event, a total of six candidates were evaluated, and two were implanted. This objective approach to identifying candidates has the potential to address the gross underutilization of CIs by removing any bias or lack of knowledge regarding the management of severe to profound sensorineural hearing loss with CIs. The screening module was an effective tool for identifying potential CI candidates at one ENT practice. On a larger scale, the screening module has the potential to impact thousands of CI candidates worldwide.

  6. Strategies for Enriching Variant Coverage in Candidate Disease Loci on a Multiethnic Genotyping Array.

    Directory of Open Access Journals (Sweden)

    Stephanie A Bien

    Full Text Available Investigating genetic architecture of complex traits in ancestrally diverse populations is imperative to understand the etiology of disease. However, the current paucity of genetic research in people of African and Latin American ancestry, Hispanic and indigenous peoples in the United States is likely to exacerbate existing health disparities for many common diseases. The Population Architecture using Genomics and Epidemiology, Phase II (PAGE II, Study was initiated in 2013 by the National Human Genome Research Institute to expand our understanding of complex trait loci in ethnically diverse and well characterized study populations. To meet this goal, the Multi-Ethnic Genotyping Array (MEGA was designed to substantially improve fine-mapping and functional discovery by increasing variant coverage across multiple ethnicities at known loci for metabolic, cardiovascular, renal, inflammatory, anthropometric, and a variety of lifestyle traits. Studying the frequency distribution of clinically relevant mutations, putative risk alleles, and known functional variants across multiple populations will provide important insight into the genetic architecture of complex diseases and facilitate the discovery of novel, sometimes population-specific, disease associations. DNA samples from 51,650 self-identified African ancestry (17,328, Hispanic/Latino (22,379, Asian/Pacific Islander (8,640, and American Indian (653 and an additional 2,650 participants of either South Asian or European ancestry, and other reference panels have been genotyped on MEGA by PAGE II. MEGA was designed as a new resource for studying ancestrally diverse populations. Here, we describe the methodology for selecting trait-specific content for use in multi-ethnic populations and how enriching MEGA for this content may contribute to deeper biological understanding of the genetic etiology of complex disease.

  7. Identifying Canadian Teacher Candidates' Needs for Training in the Use of Inclusive Classroom Assessment

    Science.gov (United States)

    Lin, Pei-Ying; Lin, Yu-Cheng

    2015-01-01

    To identify teacher candidates' needs for training in inclusive classroom assessment, the present study investigated teacher candidates' beliefs about inclusive classroom assessments for all students educated in regular classrooms, including those with special needs and English language learners. An innovative theoretical assessment model,…

  8. A Generally Applicable Translational Strategy Identifies S100A4 as a Candidate Gene in Allergy

    DEFF Research Database (Denmark)

    Bruhn, Sören; Fang, Yu; Barrenäs, Fredrik

    2014-01-01

    The identification of diagnostic markers and therapeutic candidate genes in common diseases is complicated by the involvement of thousands of genes. We hypothesized that genes co-regulated with a key gene in allergy, IL13, would form a module that could help to identify candidate genes. We identi...

  9. Large-scale evaluation of candidate genes identifies associations between VEGF polymorphisms and bladder cancer risk.

    Directory of Open Access Journals (Sweden)

    Montserrat García-Closas

    2007-02-01

    Full Text Available Common genetic variation could alter the risk for developing bladder cancer. We conducted a large-scale evaluation of single nucleotide polymorphisms (SNPs in candidate genes for cancer to identify common variants that influence bladder cancer risk. An Illumina GoldenGate assay was used to genotype 1,433 SNPs within or near 386 genes in 1,086 cases and 1,033 controls in Spain. The most significant finding was in the 5' UTR of VEGF (rs25648, p for likelihood ratio test, 2 degrees of freedom = 1 x 10(-5. To further investigate the region, we analyzed 29 additional SNPs in VEGF, selected to saturate the promoter and 5' UTR and to tag common genetic variation in this gene. Three additional SNPs in the promoter region (rs833052, rs1109324, and rs1547651 were associated with increased risk for bladder cancer: odds ratio (95% confidence interval: 2.52 (1.06-5.97, 2.74 (1.26-5.98, and 3.02 (1.36-6.63, respectively; and a polymorphism in intron 2 (rs3024994 was associated with reduced risk: 0.65 (0.46-0.91. Two of the promoter SNPs and the intron 2 SNP showed linkage disequilibrium with rs25648. Haplotype analyses revealed three blocks of linkage disequilibrium with significant associations for two blocks including the promoter and 5' UTR (global p = 0.02 and 0.009, respectively. These findings are biologically plausible since VEGF is critical in angiogenesis, which is important for tumor growth, its elevated expression in bladder tumors correlates with tumor progression, and specific 5' UTR haplotypes have been shown to influence promoter activity. Associations between bladder cancer risk and other genes in this report were not robust based on false discovery rate calculations. In conclusion, this large-scale evaluation of candidate cancer genes has identified common genetic variants in the regulatory regions of VEGF that could be associated with bladder cancer risk.

  10. CVExplorer: identifying candidate developers by mining and exploring their open source contributions.

    CSIR Research Space (South Africa)

    Greene, GJ

    2016-09-01

    Full Text Available Open source code contributions contain a large amount of technical skill information about developers, which can help to identify suitable candidates for a particular development job and therefore impact the success of a development team. We develop...

  11. Identifying the Genotypes of Hepatitis B Virus (HBV) with DNA Origami Label.

    Science.gov (United States)

    Liu, Ke; Pan, Dun; Wen, Yanqin; Zhang, Honglu; Chao, Jie; Wang, Lihua; Song, Shiping; Fan, Chunhai; Shi, Yongyong

    2018-02-01

    The hepatitis B virus (HBV) genotyping may profoundly affect the accurate diagnosis and antiviral treatment of viral hepatitis. Existing genotyping methods such as serological, immunological, or molecular testing are still suffered from substandard specificity and low sensitivity in laboratory or clinical application. In a previous study, a set of high-efficiency hybridizable DNA origami-based shape ID probes to target the templates through which genetic variation could be determined in an ultrahigh resolution of atomic force microscopy (AFM) nanomechanical imaging are established. Here, as a further confirmatory research to explore the sensitivity and applicability of this assay, differentially predesigned DNA origami shape ID probes are also developed for precisely HBV genotyping. Through the specific identification of visualized DNA origami nanostructure with clinical HBV DNA samples, the genetic variation information of genotypes can be directly identified under AFM. As a proof-of-concept, five genotype B and six genotype C are detected in 11 HBV-infected patients' blood DNA samples of Han Chinese population in the single-blinded test. The AFM image-based DNA origami shape ID genotyping approach shows high specificity and sensitivity, which could be promising for virus infection diagnosis and precision medicine in the future. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Candidate gene analysis using imputed genotypes: cell cycle single-nucleotide polymorphisms and ovarian cancer risk

    DEFF Research Database (Denmark)

    Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A

    2009-01-01

    Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....

  13. Large-scale genotyping identifies 41 new loci associated with breast cancer risk.

    Science.gov (United States)

    Michailidou, Kyriaki; Hall, Per; Gonzalez-Neira, Anna; Ghoussaini, Maya; Dennis, Joe; Milne, Roger L; Schmidt, Marjanka K; Chang-Claude, Jenny; Bojesen, Stig E; Bolla, Manjeet K; Wang, Qin; Dicks, Ed; Lee, Andrew; Turnbull, Clare; Rahman, Nazneen; Fletcher, Olivia; Peto, Julian; Gibson, Lorna; Dos Santos Silva, Isabel; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Czene, Kamila; Irwanto, Astrid; Liu, Jianjun; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel; van der Luijt, Rob B; Hein, Rebecca; Dahmen, Norbert; Beckman, Lars; Meindl, Alfons; Schmutzler, Rita K; Müller-Myhsok, Bertram; Lichtner, Peter; Hopper, John L; Southey, Melissa C; Makalic, Enes; Schmidt, Daniel F; Uitterlinden, Andre G; Hofman, Albert; Hunter, David J; Chanock, Stephen J; Vincent, Daniel; Bacot, François; Tessier, Daniel C; Canisius, Sander; Wessels, Lodewyk F A; Haiman, Christopher A; Shah, Mitul; Luben, Robert; Brown, Judith; Luccarini, Craig; Schoof, Nils; Humphreys, Keith; Li, Jingmei; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Couch, Fergus J; Wang, Xianshu; Vachon, Celine; Stevens, Kristen N; Lambrechts, Diether; Moisse, Matthieu; Paridaens, Robert; Christiaens, Marie-Rose; Rudolph, Anja; Nickels, Stefan; Flesch-Janys, Dieter; Johnson, Nichola; Aitken, Zoe; Aaltonen, Kirsimari; Heikkinen, Tuomas; Broeks, Annegien; Veer, Laura J Van't; van der Schoot, C Ellen; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Menegaux, Florence; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Burwinkel, Barbara; Zamora, M Pilar; Perez, Jose Ignacio Arias; Pita, Guillermo; Alonso, M Rosario; Cox, Angela; Brock, Ian W; Cross, Simon S; Reed, Malcolm W R; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Mulligan, Anna Marie; Lindblom, Annika; Margolin, Sara; Hooning, Maartje J; Hollestelle, Antoinette; van den Ouweland, Ans M W; Jager, Agnes; Bui, Quang M; Stone, Jennifer; Dite, Gillian S; Apicella, Carmel; Tsimiklis, Helen; Giles, Graham G; Severi, Gianluca; Baglietto, Laura; Fasching, Peter A; Haeberle, Lothar; Ekici, Arif B; Beckmann, Matthias W; Brenner, Hermann; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Brauch, Hiltrud; Hamann, Ute; Brüning, Thomas; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bonanni, Bernardo; Devilee, Peter; Tollenaar, Rob A E M; Seynaeve, Caroline; van Asperen, Christi J; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Bogdanova, Natalia V; Antonenkova, Natalia N; Dörk, Thilo; Kristensen, Vessela N; Anton-Culver, Hoda; Slager, Susan; Toland, Amanda E; Edge, Stephen; Fostira, Florentia; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Sueta, Aiko; Wu, Anna H; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Teo, Soo Hwang; Yip, Cheng Har; Phuah, Sze Yee; Cornes, Belinda K; Hartman, Mikael; Miao, Hui; Lim, Wei Yen; Sng, Jen-Hwei; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Ding, Shian-Ling; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Blot, William J; Signorello, Lisa B; Cai, Qiuyin; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha; Long, Jirong; Simard, Jacques; Garcia-Closas, Montse; Pharoah, Paul D P; Chenevix-Trench, Georgia; Dunning, Alison M; Benitez, Javier; Easton, Douglas F

    2013-04-01

    Breast cancer is the most common cancer among women. Common variants at 27 loci have been identified as associated with susceptibility to breast cancer, and these account for ∼9% of the familial risk of the disease. We report here a meta-analysis of 9 genome-wide association studies, including 10,052 breast cancer cases and 12,575 controls of European ancestry, from which we selected 29,807 SNPs for further genotyping. These SNPs were genotyped in 45,290 cases and 41,880 controls of European ancestry from 41 studies in the Breast Cancer Association Consortium (BCAC). The SNPs were genotyped as part of a collaborative genotyping experiment involving four consortia (Collaborative Oncological Gene-environment Study, COGS) and used a custom Illumina iSelect genotyping array, iCOGS, comprising more than 200,000 SNPs. We identified SNPs at 41 new breast cancer susceptibility loci at genome-wide significance (P breast cancer susceptibility.

  14. Exome Genotyping Identifies Pleiotropic Variants Associated with Red Blood Cell Traits

    NARCIS (Netherlands)

    Chami, N. (Nathalie); M.-H. Chen (Ming-Huei); Slater, A.J. (Andrew J.); Eicher, J.D. (John D.); E. Evangelou (Evangelos); Tajuddin, S.M. (Salman M.); Love-Gregory, L. (Latisha); T. Kacprowski (Tim); U.M. Schick (Ursula); Nomura, A. (Akihiro); Giri, A. (Ayush); Lessard, S. (Samuel); J. Brody (Jennifer); C. Schurmann (Claudia); V.S. Pankratz (Shane); L.R. Yanek (Lisa); A. Manichaikul (Ani); R. Pazoki (Raha); E. Mihailov (Evelin); W.D. Hill (W. David); Raffield, L.M. (Laura M.); A.D. Burt (Alastair); T.M. Bartz (Traci M.); D.M. Becker (Diane); L.C. Becker (Lewis); E.A. Boerwinkle (Eric); J. Bork-Jensen (Jette); E.P. Bottinger (Erwin); M.L. O'Donoghue (Michelle L.); D.R. Crosslin (David); de Denus, S. (Simon); Dubé, M.-P. (Marie-Pierre); P. Elliott (Paul); G. Engström; M. Evans (Michele); J. Floyd (James); M. Fornage (Myriam); Gao, H. (He); A. Greinacher (Andreas); V. Gudnason (Vilmundur); T. Hansen (T.); T.B. Harris (Tamara); C. Hayward (Caroline); Hernesniemi, J. (Jussi); H. Highland (Heather); J.N. Hirschhorn (Joel); Hofman, A. (Albert); Irvin, M.R. (Marguerite R.); M. Kähönen (Mika); E.M. Lange (Ethan); Launer, L.J. (Lenore J.); T. Lehtimäki (Terho); Li, J. (Jin); D.C. Liewald (David C.); A. Linneberg (Allan); Y. Liu (YongMei); Y. Lu (Yingchang); L.-P. Lyytikäinen (Leo-Pekka); R. Mägi (Reedik); J. Mathias (Jasmine); O. Melander (Olle); A. Metspalu (Andres); K. Mononen (Kari); M.A. Nalls (Michael); D.A. Nickerson (Deborah); K. Nikus (Kjell); C.J. O'Donnell (Christopher); M. Orho-Melander (Marju); O. Pedersen (Oluf); A. Petersmann (Astrid); Polfus, L. (Linda); B.M. Psaty (Bruce); O.T. Raitakari (Olli T.); Raitoharju, E. (Emma); Richard, M. (Melissa); K.M. Rice (Kenneth); F. Rivadeneira Ramirez (Fernando); Rotter, J.I. (Jerome I.); Schmidt, F. (Frank); A.V. Smith (Albert Vernon); J.M. Starr (John); K.D. Taylor (Kent); A. Teumer (Alexander); Thuesen, B.H. (Betina H.); Torstenson, E.S. (Eric S.); R.P. Tracy (Russell); I. Tzoulaki; N.A. Zakai (Neil); Vacchi-Suzzi, C. (Caterina); C.M. van Duijn (Cornelia); F.J.A. van Rooij (Frank); M. Cushman (Mary Ann); I.J. Deary (Ian J.); Velez Edwards, D.R. (Digna R.); Vergnaud, A.-C. (Anne-Claire); L.C. Wallentin (Lars); D. Waterworth (Dawn); White, H.D. (Harvey D.); J.F. Wilson (James); A.B. Zonderman; S. Kathiresan (Sekar); N. Grarup (Niels); T. Esko (Tõnu); R.J.F. Loos (Ruth); L.A. Lange (Leslie); Faraday, N. (Nauder); Abumrad, N.A. (Nada A.); T.L. Edwards (Todd L.); S.K. Ganesh (Santhi); P. Auer (Paul); A.D. Johnson (Andrew); A. Reiner (Alexander); G. Lettre (Guillaume)

    2016-01-01

    textabstractRed blood cell (RBC) traits are important heritable clinical biomarkers and modifiers of disease severity. To identify coding genetic variants associated with these traits, we conducted meta-analyses of seven RBC phenotypes in 130,273 multi-ethnic individuals from studies genotyped on an

  15. AcuI identifies water buffalo CSN3 genotypes by RFLP analysis

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Online resources. AcuI identifies water buffalo CSN3 genotypes by RFLP analysis. Soheir M. El Nahas Ahlam A. Abou Mossallam. Volume 93 Online resources 2014 pp e94-e96. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Eliciting, Identifying, Interpreting, and Responding to Students' Ideas: Teacher Candidates' Growth in Formative Assessment Practices

    Science.gov (United States)

    Gotwals, Amelia Wenk; Birmingham, Daniel

    2016-06-01

    With the goal of helping teacher candidates become well-started beginners, it is important that methods courses in teacher education programs focus on high-leverage practices. Using responsive teaching practices, specifically eliciting, identifying, interpreting, and responding to students' science ideas (i.e., formative assessment), can be used to support all students in learning science successfully. This study follows seven secondary science teacher candidates in a yearlong practice-based methods course. Course assignments (i.e., plans for and reflections on teaching) as well as teaching videos were analyzed using a recursive qualitative approach. In this paper, we present themes and patterns in teacher candidates' abilities to elicit, identify, interpret, and respond to students' ideas. Specifically, we found that those teacher candidates who grew in the ways in which they elicited students' ideas from fall to spring were also those who were able to adopt a more balanced reflection approach (considering both teacher and student moves). However, we found that even the teacher candidates who grew in these practices did not move toward seeing students' ideas as nuanced; rather, they saw students' ideas in a dichotomous fashion: right or wrong. We discuss implications for teacher preparation, specifically for how to promote productive reflection and tools for better understanding students' ideas.

  17. Candidate gene linkage approach to identify DNA variants that predispose to preterm birth

    DEFF Research Database (Denmark)

    Bream, Elise N A; Leppellere, Cara R; Cooper, Margaret E

    2013-01-01

    Background:The aim of this study was to identify genetic variants contributing to preterm birth (PTB) using a linkage candidate gene approach.Methods:We studied 99 single-nucleotide polymorphisms (SNPs) for 33 genes in 257 families with PTBs segregating. Nonparametric and parametric analyses were...... through the infant and/or the mother in the etiology of PTB....

  18. The genotypes of Orientia tsutsugamushi, identified in scrub typhus patients in northern Vietnam.

    Science.gov (United States)

    Nguyen, Hang L K; Pham, Hang T T; Nguyen, Tinh V; Hoang, Phuong Vm; Le, Mai T Q; Takemura, Taichiro; Hasebe, Futoshi; Hayasaka, Daisuke; Yamada, Akio; Hotta, Kozue

    2017-03-01

    There are an estimated one million patients with scrub typhus in the Asia-Pacific region. There are few reports describing the incidence of scrub typhus in Vietnam. Blood samples collected from 63 patients clinically diagnosed as having scrub typhus from July 2015 to September 2016 were subjected to genotyping of Orientia tsutsugamushi. Of these patients, 42 (67%) tested positive for O. tsutsugamushi, and the most common genotype was identified to be Karp (55%). Other genotypes, TA763, Gilliam type in Japan variant, and Kato were also found in 17%, 17% and 12% of patients, respectively. To better understand the epidemiological landscape of scrub typhus in Vietnam, a countrywide study is needed. LC110330-LC110333, LC110336-LC110351 and LC214804-LC214825. © The Author 2017. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. A cross-species genetic analysis identifies candidate genes for mouse anxiety and human bipolar disorder

    Directory of Open Access Journals (Sweden)

    David G Ashbrook

    2015-07-01

    Full Text Available Bipolar disorder (BD is a significant neuropsychiatric disorder with a lifetime prevalence of ~1%. To identify genetic variants underlying BD genome-wide association studies (GWAS have been carried out. While many variants of small effect associated with BD have been identified few have yet been confirmed, partly because of the low power of GWAS due to multiple comparisons being made. Complementary mapping studies using murine models have identified genetic variants for behavioral traits linked to BD, often with high power, but these identified regions often contain too many genes for clear identification of candidate genes. In the current study we have aligned human BD GWAS results and mouse linkage studies to help define and evaluate candidate genes linked to BD, seeking to use the power of the mouse mapping with the precision of GWAS. We use quantitative trait mapping for open field test and elevated zero maze data in the largest mammalian model system, the BXD recombinant inbred mouse population, to identify genomic regions associated with these BD-like phenotypes. We then investigate these regions in whole genome data from the Psychiatric Genomics Consortium’s bipolar disorder GWAS to identify candidate genes associated with BD. Finally we establish the biological relevance and pathways of these genes in a comprehensive systems genetics analysis.We identify four genes associated with both mouse anxiety and human BD. While TNR is a novel candidate for BD, we can confirm previously suggested associations with CMYA5, MCTP1 and RXRG. A cross-species, systems genetics analysis shows that MCTP1, RXRG and TNR coexpress with genes linked to psychiatric disorders and identify the striatum as a potential site of action. CMYA5, MCTP1, RXRG and TNR are associated with mouse anxiety and human BD. We hypothesize that MCTP1, RXRG and TNR influence intercellular signaling in the striatum.

  20. Genome-wide association study to identify candidate loci and genes for Mn toxicity tolerance in rice.

    Directory of Open Access Journals (Sweden)

    Asis Shrestha

    Full Text Available Manganese (Mn is an essential micro-nutrient for plants, but flooded rice fields can accumulate high levels of Mn2+ leading to Mn toxicity. Here, we present a genome-wide association study (GWAS to identify candidate loci conferring Mn toxicity tolerance in rice (Oryza sativa L.. A diversity panel of 288 genotypes was grown in hydroponic solutions in a greenhouse under optimal and toxic Mn concentrations. We applied a Mn toxicity treatment (5 ppm Mn2+, 3 weeks at twelve days after transplanting. Mn toxicity caused moderate damage in rice in terms of biomass loss and symptom formation despite extremely high shoot Mn concentrations ranging from 2.4 to 17.4 mg g-1. The tropical japonica subpopulation was more sensitive to Mn toxicity than other subpopulations. Leaf damage symptoms were significantly correlated with Mn uptake into shoots. Association mapping was conducted for seven traits using 416741 single nucleotide polymorphism (SNP markers using a mixed linear model, and detected six significant associations for the traits shoot manganese concentration and relative shoot length. Candidate regions contained genes coding for a heavy metal transporter, peroxidase precursor and Mn2+ ion binding proteins. The significant marker SNP-2.22465867 caused an amino acid change in a gene (LOC_Os02g37170 with unknown function. This study demonstrated significant natural variation in rice for Mn toxicity tolerance and the possibility of using GWAS to unravel genetic factors responsible for such complex traits.

  1. BAYESIAN ANALYSIS TO IDENTIFY NEW STAR CANDIDATES IN NEARBY YOUNG STELLAR KINEMATIC GROUPS

    International Nuclear Information System (INIS)

    Malo, Lison; Doyon, René; Lafrenière, David; Artigau, Étienne; Gagné, Jonathan; Baron, Frédérique; Riedel, Adric

    2013-01-01

    We present a new method based on a Bayesian analysis to identify new members of nearby young kinematic groups. The analysis minimally takes into account the position, proper motion, magnitude, and color of a star, but other observables can be readily added (e.g., radial velocity, distance). We use this method to find new young low-mass stars in the β Pictoris and AB Doradus moving groups and in the TW Hydrae, Tucana-Horologium, Columba, Carina, and Argus associations. Starting from a sample of 758 mid-K to mid-M (K5V-M5V) stars showing youth indicators such as Hα and X-ray emission, our analysis yields 214 new highly probable low-mass members of the kinematic groups analyzed. One is in TW Hydrae, 37 in β Pictoris, 17 in Tucana-Horologium, 20 in Columba, 6 in Carina, 50 in Argus, 32 in AB Doradus, and the remaining 51 candidates are likely young but have an ambiguous membership to more than one association. The false alarm rate for new candidates is estimated to be 5% for β Pictoris and TW Hydrae, 10% for Tucana-Horologium, Columba, Carina, and Argus, and 14% for AB Doradus. Our analysis confirms the membership of 58 stars proposed in the literature. Firm membership confirmation of our new candidates will require measurement of their radial velocity (predicted by our analysis), parallax, and lithium 6708 Å equivalent width. We have initiated these follow-up observations for a number of candidates, and we have identified two stars (2MASSJ01112542+1526214, 2MASSJ05241914-1601153) as very strong candidate members of the β Pictoris moving group and one strong candidate member (2MASSJ05332558-5117131) of the Tucana-Horologium association; these three stars have radial velocity measurements confirming their membership and lithium detections consistent with young age.

  2. An Approach to Identify and Characterize a Subunit Candidate Shigella Vaccine Antigen.

    Science.gov (United States)

    Pore, Debasis; Chakrabarti, Manoj K

    2016-01-01

    Shigellosis remains a serious issue throughout the developing countries, particularly in children under the age of 5. Numerous strategies have been tested to develop vaccines targeting shigellosis; unfortunately despite several years of extensive research, no safe, effective, and inexpensive vaccine against shigellosis is available so far. Here, we illustrate in detail an approach to identify and establish immunogenic outer membrane proteins from Shigella flexneri 2a as subunit vaccine candidates.

  3. Using Upland Rice Root Traits to Identify N Use Efficient Genotypes for Limited Soil Nutrient Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Traore, K.; Traore, O. [INERA / Station de Farakoba, Bobo-Dioulasso (Burkina Faso); Bado, V. B. [Africa Rice Center (AfricaRice), Saint Louis (Senegal)

    2013-11-15

    Crop production in the Sahelian countries of Africa is limited by many factors. The most important are low potential yields of local varieties, low inherent soil fertility and low applications of external inputs (organic and mineral fertilizers). A field experiment was conducted from 2007 to 2008 with the objective to develop and validate screening protocols for plant traits that enhance N acquisition and utilization in upland rice grown in low N soils of two hundred (200) upland rice (Oryza sativa L.) genotypes from WAB, NERICA, CNA, CNAX, IRAT and IR lines. An experiment in small pots was carried out in a greenhouse of Farakoba research center. The pots were filled with a sandy soil and upland rice genotypes were grown during three weeks, harvested and studied for their root characteristics (seminal root length, adventitious root number, lateral root length and number and roots hair density). The small pot method was reliable for root trait characterisation at the seedling stage. A large variability among genotypes was exhibited for the root characteristics. The variability was larger within the NERICA and WAB lines compared to the other lines. The length of the seminal roots varied from 10 to 40 cm, the lateral root number ranged between 3 and 15 and the number of adventitious roots varied between 2 and 7. The selected root traits can be used to identify high nutrients and water use efficient genotypes. (author)

  4. Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers.

    Directory of Open Access Journals (Sweden)

    Elena Vigorito

    Full Text Available Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2 mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases BRCA1 and 8,211 (631 ovarian cancer cases BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively, within a retrospective cohort analytical framework. In BRCA1 mutation carriers one set of eight correlated candidate causal variants for ovarian cancer risk modification was identified (top SNP rs10124837, HR: 0.73, 95%CI: 0.68 to 0.79, p-value 2× 10-16. These variants were located up to 20 kb upstream of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10-6. The candidate causal in BRCA1 mutation carriers did not include the strongest associated variant at this locus in the general population. In sum, we identified a set of candidate causal variants in a region that encompasses the BNC2 transcription start site. The ovarian cancer association at 9p22.2 may be mediated by different variants in BRCA1 mutation carriers and in the general population. Thus, potentially different mechanisms may underlie ovarian cancer risk for mutation carriers and the general population.

  5. Exome genotyping arrays to identify rare and low frequency variants associated with epithelial ovarian cancer risk

    Science.gov (United States)

    Permuth, Jennifer B.; Pirie, Ailith; Ann Chen, Y.; Lin, Hui-Yi; Reid, Brett M.; Chen, Zhihua; Monteiro, Alvaro; Dennis, Joe; Mendoza-Fandino, Gustavo; Anton-Culver, Hoda; Bandera, Elisa V.; Bisogna, Maria; Brinton, Louise; Brooks-Wilson, Angela; Carney, Michael E.; Chenevix-Trench, Georgia; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; D’Aloisio, Aimee A.; Anne Doherty, Jennifer; Earp, Madalene; Edwards, Robert P.; Fridley, Brooke L.; Gayther, Simon A.; Gentry-Maharaj, Aleksandra; Goodman, Marc T.; Gronwald, Jacek; Hogdall, Estrid; Iversen, Edwin S.; Jakubowska, Anna; Jensen, Allan; Karlan, Beth Y.; Kelemen, Linda E.; Kjaer, Suzanne K.; Kraft, Peter; Le, Nhu D.; Levine, Douglas A.; Lissowska, Jolanta; Lubinski, Jan; Matsuo, Keitaro; Menon, Usha; Modugno, Rosemary; Moysich, Kirsten B.; Nakanishi, Toru; Ness, Roberta B.; Olson, Sara; Orlow, Irene; Pearce, Celeste L.; Pejovic, Tanja; Poole, Elizabeth M.; Ramus, Susan J.; Anne Rossing, Mary; Sandler, Dale P.; Shu, Xiao-Ou; Song, Honglin; Taylor, Jack A.; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Tworoger, Shelley S.; Webb, Penelope M.; Wentzensen, Nicolas; Wilkens, Lynne R.; Winham, Stacey; Woo, Yin-Ling; Wu, Anna H.; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Phelan, Catherine M.; Schildkraut, Joellen M.; Berchuck, Andrew; Goode, Ellen L.; Pharoah, Paul D. P.; Sellers, Thomas A.

    2016-01-01

    Rare and low frequency variants are not well covered in most germline genotyping arrays and are understudied in relation to epithelial ovarian cancer (EOC) risk. To address this gap, we used genotyping arrays targeting rarer protein-coding variation in 8,165 EOC cases and 11,619 controls from the international Ovarian Cancer Association Consortium (OCAC). Pooled association analyses were conducted at the variant and gene level for 98,543 variants directly genotyped through two exome genotyping projects. Only common variants that represent or are in strong linkage disequilibrium (LD) with previously-identified signals at established loci reached traditional thresholds for exome-wide significance (P  P≥5.0 ×10 − 7) were detected for rare and low-frequency variants at 16 novel loci. Four rare missense variants were identified (ACTBL2 rs73757391 (5q11.2), BTD rs200337373 (3p25.1), KRT13 rs150321809 (17q21.2) and MC2R rs104894658 (18p11.21)), but only MC2R rs104894668 had a large effect size (OR = 9.66). Genes most strongly associated with EOC risk included ACTBL2 (PAML = 3.23 × 10 − 5; PSKAT-o = 9.23 × 10 − 4) and KRT13 (PAML = 1.67 × 10 − 4; PSKAT-o = 1.07 × 10 − 5), reaffirming variant-level analysis. In summary, this large study identified several rare and low-frequency variants and genes that may contribute to EOC susceptibility, albeit with possible small effects. Future studies that integrate epidemiology, sequencing, and functional assays are needed to further unravel the unexplained heritability and biology of this disease. PMID:27378695

  6. Characterization of the Gray Whale Eschrichtius robustus Genome and a Genotyping Array Based on Single-Nucleotide Polymorphisms in Candidate Genes.

    Science.gov (United States)

    DeWoody, J Andrew; Fernandez, Nadia B; Brüniche-Olsen, Anna; Antonides, Jennifer D; Doyle, Jacqueline M; San Miguel, Phillip; Westerman, Rick; Vertyankin, Vladimir V; Godard-Codding, Céline A J; Bickham, John W

    2017-06-01

    Genetic and genomic approaches have much to offer in terms of ecology, evolution, and conservation. To better understand the biology of the gray whale Eschrichtius robustus (Lilljeborg, 1861), we sequenced the genome and produced an assembly that contains ∼95% of the genes known to be highly conserved among eukaryotes. From this assembly, we annotated 22,711 genes and identified 2,057,254 single-nucleotide polymorphisms (SNPs). Using this assembly, we generated a curated list of candidate genes potentially subject to strong natural selection, including genes associated with osmoregulation, oxygen binding and delivery, and other aspects of marine life. From these candidate genes, we queried 92 autosomal protein-coding markers with a panel of 96 SNPs that also included 2 sexing and 2 mitochondrial markers. Genotyping error rates, calculated across loci and across 69 intentional replicate samples, were low (0.021%), and observed heterozygosity was 0.33 averaged over all autosomal markers. This level of variability provides substantial discriminatory power across loci (mean probability of identity of 1.6 × 10 -25 and mean probability of exclusion >0.999 with neither parent known), indicating that these markers provide a powerful means to assess parentage and relatedness in gray whales. We found 29 unique multilocus genotypes represented among our 36 biopsies (indicating that we inadvertently sampled 7 whales twice). In total, we compiled an individual data set of 28 western gray whales (WGSs) and 1 presumptive eastern gray whale (EGW). The lone EGW we sampled was no more or less related to the WGWs than expected by chance alone. The gray whale genomes reported here will enable comparative studies of natural selection in cetaceans, and the SNP markers should be highly informative for future studies of gray whale evolution, population structure, demography, and relatedness.

  7. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

    Science.gov (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

    2018-03-01

    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Identifying Novel Candidate Genes Related to Apoptosis from a Protein-Protein Interaction Network

    Directory of Open Access Journals (Sweden)

    Baoman Wang

    2015-01-01

    Full Text Available Apoptosis is the process of programmed cell death (PCD that occurs in multicellular organisms. This process of normal cell death is required to maintain the balance of homeostasis. In addition, some diseases, such as obesity, cancer, and neurodegenerative diseases, can be cured through apoptosis, which produces few side effects. An effective comprehension of the mechanisms underlying apoptosis will be helpful to prevent and treat some diseases. The identification of genes related to apoptosis is essential to uncover its underlying mechanisms. In this study, a computational method was proposed to identify novel candidate genes related to apoptosis. First, protein-protein interaction information was used to construct a weighted graph. Second, a shortest path algorithm was applied to the graph to search for new candidate genes. Finally, the obtained genes were filtered by a permutation test. As a result, 26 genes were obtained, and we discuss their likelihood of being novel apoptosis-related genes by collecting evidence from published literature.

  9. Transcriptomic Analysis Using Olive Varieties and Breeding Progenies Identifies Candidate Genes Involved in Plant Architecture.

    Science.gov (United States)

    González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R

    2016-01-01

    Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

  10. A Genome Wide Genotyping Study To Find Candidate Genes That Influence Varroa-Sensitive Hygiene (VSH)

    Science.gov (United States)

    Varroa parasitism of honey bees is widely considered by apicultural researchers to be the greatest threat to beekeeping. Varroa-sensitive hygiene (VSH) is one of two identified behaviors that are highly important for controlling the growth of Varroa mite populations in bee hives. Bees exhibiting th...

  11. Cytoplasmic male sterility-associated chimeric open reading frames identified by mitochondrial genome sequencing of four Cajanus genotypes.

    Science.gov (United States)

    Tuteja, Reetu; Saxena, Rachit K; Davila, Jaime; Shah, Trushar; Chen, Wenbin; Xiao, Yong-Li; Fan, Guangyi; Saxena, K B; Alverson, Andrew J; Spillane, Charles; Town, Christopher; Varshney, Rajeev K

    2013-10-01

    The hybrid pigeonpea (Cajanus cajan) breeding technology based on cytoplasmic male sterility (CMS) is currently unique among legumes and displays major potential for yield increase. CMS is defined as a condition in which a plant is unable to produce functional pollen grains. The novel chimeric open reading frames (ORFs) produced as a results of mitochondrial genome rearrangements are considered to be the main cause of CMS. To identify these CMS-related ORFs in pigeonpea, we sequenced the mitochondrial genomes of three C. cajan lines (the male-sterile line ICPA 2039, the maintainer line ICPB 2039, and the hybrid line ICPH 2433) and of the wild relative (Cajanus cajanifolius ICPW 29). A single, circular-mapping molecule of length 545.7 kb was assembled and annotated for the ICPA 2039 line. Sequence annotation predicted 51 genes, including 34 protein-coding and 17 RNA genes. Comparison of the mitochondrial genomes from different Cajanus genotypes identified 31 ORFs, which differ between lines within which CMS is present or absent. Among these chimeric ORFs, 13 were identified by comparison of the related male-sterile and maintainer lines. These ORFs display features that are known to trigger CMS in other plant species and to represent the most promising candidates for CMS-related mitochondrial rearrangements in pigeonpea.

  12. Auto-Vetting Transiting Planet Candidates Identified by the Kepler Pipeline

    Science.gov (United States)

    Jenkins, Jon M.; McCauliff, Sean; Burke, Christopher; Seader, Shawn; Twicken, Joseph; Klaus, Todd; Sanderfer, Dwight; Srivastava, Ashok; Haas, Michael R.

    2014-04-01

    The Kepler Mission simultaneously measures the brightness of more than 150,000 stars every 29.4 minutes primarily for the purpose of transit photometry. Over the course of its 3.5-year primary mission Kepler has observed over 190,000 distinct stars, announcing 2,321 planet candidates, 2,165 eclipsing binaries, and 105 confirmed planets. As Kepler moves into its 4-year extended mission, the total number of transit-like features identified in the light curves has increased to as many as ~18,000. This number of signals has become intractable for human beings to inspect by eye in a thorough and timely fashion. To mitigate this problem we are developing machine learning approaches to perform the task of reviewing the diagnostics for each transit signal candidate to establish a preliminary list of planetary candidates ranked from most credible to least credible. Our preliminary results indicate that random forests can classify potential transiting planet signatures with an accuracy of more than 98.6% as measured by the area under a receiver-operating curve.

  13. Exome Sequencing and Linkage Analysis Identified Novel Candidate Genes in Recessive Intellectual Disability Associated with Ataxia.

    Science.gov (United States)

    Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia

    2015-10-01

    Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).

  14. Epidermal growth factor gene is a newly identified candidate gene for gout

    OpenAIRE

    Lin Han; Chunwei Cao; Zhaotong Jia; Shiguo Liu; Zhen Liu; Ruosai Xin; Can Wang; Xinde Li; Wei Ren; Xuefeng Wang; Changgui Li

    2016-01-01

    Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 re...

  15. Structural identifiability analyses of candidate models for in vitro Pitavastatin hepatic uptake.

    Science.gov (United States)

    Grandjean, Thomas R B; Chappell, Michael J; Yates, James W T; Evans, Neil D

    2014-05-01

    In this paper a review of the application of four different techniques (a version of the similarity transformation approach for autonomous uncontrolled systems, a non-differential input/output observable normal form approach, the characteristic set differential algebra and a recent algebraic input/output relationship approach) to determine the structural identifiability of certain in vitro nonlinear pharmacokinetic models is provided. The Organic Anion Transporting Polypeptide (OATP) substrate, Pitavastatin, is used as a probe on freshly isolated animal and human hepatocytes. Candidate pharmacokinetic non-linear compartmental models have been derived to characterise the uptake process of Pitavastatin. As a prerequisite to parameter estimation, structural identifiability analyses are performed to establish that all unknown parameters can be identified from the experimental observations available. Copyright © 2013. Published by Elsevier Ireland Ltd.

  16. Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    DEFF Research Database (Denmark)

    Vigorito, Elena; Kuchenbaecker, Karoline B; Beesley, Jonathan

    2016-01-01

    Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2...... mutation carriers. Genotype data were available for 15,252 (2,462 ovarian cancer cases) BRCA1 and 8,211 (631 ovarian cancer cases) BRCA2 mutation carriers. Following genotype imputation, ovarian cancer associations were assessed for 4,873 and 5,020 SNPs in BRCA1 and BRCA 2 mutation carriers respectively...... of BNC2. In BRCA2 mutation carriers one region, up to 45 kb upstream of BNC2, and containing 100 correlated SNPs was identified as candidate causal (top SNP rs62543585, HR: 0.69, 95%CI: 0.59 to 0.80, p-value 1.0 × 10-6). The candidate causal in BRCA1 mutation carriers did not include the strongest...

  17. Selection on plant male function genes identifies candidates for reproductive isolation of yellow monkeyflowers.

    Directory of Open Access Journals (Sweden)

    Jan E Aagaard

    Full Text Available Understanding the genetic basis of reproductive isolation promises insight into speciation and the origins of biological diversity. While progress has been made in identifying genes underlying barriers to reproduction that function after fertilization (post-zygotic isolation, we know much less about earlier acting pre-zygotic barriers. Of particular interest are barriers involved in mating and fertilization that can evolve extremely rapidly under sexual selection, suggesting they may play a prominent role in the initial stages of reproductive isolation. A significant challenge to the field of speciation genetics is developing new approaches for identification of candidate genes underlying these barriers, particularly among non-traditional model systems. We employ powerful proteomic and genomic strategies to study the genetic basis of conspecific pollen precedence, an important component of pre-zygotic reproductive isolation among yellow monkeyflowers (Mimulus spp. resulting from male pollen competition. We use isotopic labeling in combination with shotgun proteomics to identify more than 2,000 male function (pollen tube proteins within maternal reproductive structures (styles of M. guttatus flowers where pollen competition occurs. We then sequence array-captured pollen tube exomes from a large outcrossing population of M. guttatus, and identify those genes with evidence of selective sweeps or balancing selection consistent with their role in pollen competition. We also test for evidence of positive selection on these genes more broadly across yellow monkeyflowers, because a signal of adaptive divergence is a common feature of genes causing reproductive isolation. Together the molecular evolution studies identify 159 pollen tube proteins that are candidate genes for conspecific pollen precedence. Our work demonstrates how powerful proteomic and genomic tools can be readily adapted to non-traditional model systems, allowing for genome-wide screens

  18. Identifying Breeding Priorities for Blueberry Flavor Using Biochemical, Sensory, and Genotype by Environment Analyses

    Science.gov (United States)

    Gilbert, Jessica L.; Guthart, Matthew J.; Gezan, Salvador A.; Pisaroglo de Carvalho, Melissa; Schwieterman, Michael L.; Colquhoun, Thomas A.; Bartoshuk, Linda M.; Sims, Charles A.; Clark, David G.; Olmstead, James W.

    2015-01-01

    Breeding for a subjective goal such as flavor is challenging, as many blueberry cultivars are grown worldwide, and identifying breeding targets relating to blueberry flavor biochemistry that have a high degree of genetic control and low environmental variability are priorities. A variety of biochemical compounds and physical characters induce the sensory responses of taste, olfaction, and somatosensation, all of which interact to create what is perceived flavor. The goal of this study was to identify the flavor compounds with a larger genetic versus environmental component regulating their expression over an array of cultivars, locations, and years. Over the course of three years, consumer panelists rated overall liking, texture, sweetness, sourness, and flavor intensity of 19 southern highbush blueberry (Vaccinium corymbosum hybrids) genotypes in 30 sensory panels. Significant positive correlations to overall liking of blueberry fruit (Panalysis was used to identify sugars, acids, and volatile compounds contributing to liking and sensory intensities, and revealed strong effects of fructose, pH, and several volatile compounds upon all sensory parameters measured. To assess the feasibility of breeding for flavor components, a three year study was conducted to compare genetic and environmental influences on flavor biochemistry. Panelists could discern genotypic variation in blueberry sensory components, and many of the compounds affecting consumer favor of blueberries, such as fructose, pH, β-caryophyllene oxide and 2-heptanone, were sufficiently genetically controlled that allocating resources for their breeding is worthwhile. PMID:26378911

  19. Exome genotyping arrays to identify rare and low frequency variants associated with epithelial ovarian cancer risk

    DEFF Research Database (Denmark)

    Permuth, Jennifer B; Pirie, Ailith; Ann Chen, Y

    2016-01-01

    Rare and low frequency variants are not well covered in most germline genotyping arrays and are understudied in relation to epithelial ovarian cancer (EOC) risk. To address this gap, we used genotyping arrays targeting rarer protein-coding variation in 8,165 EOC cases and 11,619 controls from...... that is in LD (r(2 )=( )0.90) with a previously identified 'best hit' (rs7651446) mapping to an intron of TIPARP. Suggestive associations (5.0 × 10 (-)  (5 )>( )P≥5.0 ×10 (-)  (7)) were detected for rare and low-frequency variants at 16 novel loci. Four rare missense variants were identified (ACTBL2 rs73757391.......67 × 10 (-)  (4); PSKAT-o = 1.07 × 10 (-)  (5)), reaffirming variant-level analysis. In summary, this large study identified several rare and low-frequency variants and genes that may contribute to EOC susceptibility, albeit with possible small effects. Future studies that integrate epidemiology...

  20. Novel candidate genes and regions for childhood apraxia of speech identified by array comparative genomic hybridization.

    Science.gov (United States)

    Laffin, Jennifer J S; Raca, Gordana; Jackson, Craig A; Strand, Edythe A; Jakielski, Kathy J; Shriberg, Lawrence D

    2012-11-01

    The goal of this study was to identify new candidate genes and genomic copy-number variations associated with a rare, severe, and persistent speech disorder termed childhood apraxia of speech. Childhood apraxia of speech is the speech disorder segregating with a mutation in FOXP2 in a multigenerational London pedigree widely studied for its role in the development of speech-language in humans. A total of 24 participants who were suspected to have childhood apraxia of speech were assessed using a comprehensive protocol that samples speech in challenging contexts. All participants met clinical-research criteria for childhood apraxia of speech. Array comparative genomic hybridization analyses were completed using a customized 385K Nimblegen array (Roche Nimblegen, Madison, WI) with increased coverage of genes and regions previously associated with childhood apraxia of speech. A total of 16 copy-number variations with potential consequences for speech-language development were detected in 12 or half of the 24 participants. The copy-number variations occurred on 10 chromosomes, 3 of which had two to four candidate regions. Several participants were identified with copy-number variations in two to three regions. In addition, one participant had a heterozygous FOXP2 mutation and a copy-number variation on chromosome 2, and one participant had a 16p11.2 microdeletion and copy-number variations on chromosomes 13 and 14. Findings support the likelihood of heterogeneous genomic pathways associated with childhood apraxia of speech.

  1. Phenotype/genotype correlation in a case series of Stargardt's patients identifies novel mutations in the ABCA4 gene.

    Science.gov (United States)

    Gemenetzi, M; Lotery, A J

    2013-11-01

    To investigate phenotypic variability in terms of best-corrected visual acuity (BCVA) in patients with Stargardt disease (STGD) and confirmed ABCA4 mutations. Entire coding region analysis of the ABCA4 gene by direct sequencing of seven patients with clinical findings of STGD seen in the Retina Clinics of Southampton Eye Unit between 2002 and 2011.Phenotypic variables recorded were BCVA, fluorescein angiographic appearance, electrophysiology, and visual fields. All patients had heterozygous amino acid-changing variants (missense mutations) in the ABCA4 gene. A splice sequence change was found in a 30-year-old patient with severly affected vision. Two novel sequence changes were identified: a missense mutation in a mildly affected 44-year-old patient and a frameshift mutation in a severly affected 34-year-old patient. The identified ABCA4 mutations were compatible with the resulting phenotypes in terms of BCVA. Higher BCVAs were recorded in patients with missense mutations. Sequence changes, predicted to have more deleterious effect on protein function, resulted in a more severe phenotype. This case series of STGD patients demonstrates novel genotype/phenotype correlations, which may be useful to counselling of patients. This information may prove useful in selection of candidates for clinical trials in ABCA4 disease.

  2. Association Analysis Suggests SOD2 as a Newly Identified Candidate Gene Associated With Leprosy Susceptibility.

    Science.gov (United States)

    Ramos, Geovana Brotto; Salomão, Heloisa; Francio, Angela Schneider; Fava, Vinícius Medeiros; Werneck, Renata Iani; Mira, Marcelo Távora

    2016-08-01

    Genetic studies have identified several genes and genomic regions contributing to the control of host susceptibility to leprosy. Here, we test variants of the positional and functional candidate gene SOD2 for association with leprosy in 2 independent population samples. Family-based analysis revealed an association between leprosy and allele G of marker rs295340 (P = .042) and borderline evidence of an association between leprosy and alleles C and A of markers rs4880 (P = .077) and rs5746136 (P = .071), respectively. Findings were validated in an independent case-control sample for markers rs295340 (P = .049) and rs4880 (P = .038). These results suggest SOD2 as a newly identified gene conferring susceptibility to leprosy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  3. Identifying candidate agents for lung adenocarcinoma by walking the human interactome

    Directory of Open Access Journals (Sweden)

    Sun Y

    2016-09-01

    Full Text Available Yajiao Sun,1 Ranran Zhang,2 Zhe Jiang,1 Rongyao Xia,1 Jingwen Zhang,1 Jing Liu,1 Fuhui Chen1 1Department of Respiratory, The Second Affiliated Hospital of Harbin Medical University, 2Department of Respiratory, Harbin First Hospital, Harbin, People’s Republic of China Abstract: Despite recent advances in therapeutic strategies for lung cancer, mortality is still increasing. Therefore, there is an urgent need to identify effective novel drugs. In the present study, we implement drug repositioning for lung adenocarcinoma (LUAD by a bioinformatics method followed by experimental validation. We first identified differentially expressed genes between LUAD tissues and nontumor tissues from RNA sequencing data obtained from The Cancer Genome Atlas database. Then, candidate small molecular drugs were ranked according to the effect of their targets on differentially expressed genes of LUAD by a random walk with restart algorithm in protein–protein interaction networks. Our method identified some potentially novel agents for LUAD besides those that had been previously reported (eg, hesperidin. Finally, we experimentally verified that atracurium, one of the potential agents, could induce A549 cells death in non-small-cell lung cancer-derived A549 cells by an MTT assay, acridine orange and ethidium bromide staining, and electron microscopy. Furthermore, Western blot assays demonstrated that atracurium upregulated the proapoptotic Bad and Bax proteins, downregulated the antiapoptotic p-Bad and Bcl-2 proteins, and enhanced caspase-3 activity. It could also reduce the expression of p53 and p21Cip1/Waf1 in A549 cells. In brief, the candidate agents identified by our approach may provide greater insights into improving the therapeutic status of LUAD. Keywords: lung adenocarcinoma, drug repositioning, bioinformatics, protein–protein interaction network, atracurium

  4. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  5. Candidate genes involved in the biosynthesis of triterpenoid saponins in Platycodon grandiflorum identified by transcriptome analysis

    Directory of Open Access Journals (Sweden)

    Chunhua eMa

    2016-05-01

    Full Text Available Background: Platycodon grandiflorum is the only species in the genus Platycodon of the family Campanulaceae, which has been traditionally used as a medicinal plant for its lung-heat-clearing, antitussive, and expectorant properties in China, Japanese and Korean. Oleanane-type triterpenoid saponins were the main chemical components of P. grandiflorum and platycodin D was the abundant and main bioactive component, but little is known about their biosynthesis in plants. Hence, P. grandiflorum is an ideal medicinal plant for studying the biosynthesis of Oleanane-type saponins. In addition, the genomic information of this important herbal plant is unavailable.Principal Findings:A total of 58,580,566 clean reads were obtained, which were assembled into 34,053 unigenes, with an average length of 936 bp and N50 of 1,661 bp by analyzing the transcriptome data of P. grandiflorum. Among these 34,053 unigenes, 22,409 unigenes (65.80% were annotated based on the information available from public databases, including Nr, NCBI, Swiss-Prot, KOG and KEGG. Furthermore, 21 candidate cytochrome P450 genes and 17 candidate UDP-glycosyltransferase genes most likely involved in triterpenoid saponins biosynthesis pathway were discovered from the transcriptome sequencing of P. grandiflorum. In addition, 10,626 SSRs were identified based on the transcriptome data, which would provide abundant candidates of molecular markers for genetic diversity and genetic map for this medicinal plant.Conclusion:The genomic data obtained from P. grandiflorum, especially the identification of putative genes involved in triterpenoid saponins biosynthesis pathway, will facilitate our understanding of the biosynthesis of triterpenoid saponins at molecular level.

  6. Identifying the Relationship of Teacher Candidates' Humor Styles with Anxiety and Self-Compassion Levels

    Science.gov (United States)

    Aydin, Aydan

    2015-01-01

    Problem Statement: Teacher candidates who will soon be responsible for educating the future generations should possess certain characteristics. Specific teacher candidates should have specific characteristics taken into consideration: pre-school and primary teacher candidates should be seen as role models by younger students; psychological…

  7. Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

    Science.gov (United States)

    Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

    2018-03-01

    A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

  8. Sequence-Based Introgression Mapping Identifies Candidate White Mold Tolerance Genes in Common Bean

    Directory of Open Access Journals (Sweden)

    Sujan Mamidi

    2016-07-01

    Full Text Available White mold, caused by the necrotrophic fungus (Lib. de Bary, is a major disease of common bean ( L.. WM7.1 and WM8.3 are two quantitative trait loci (QTL with major effects on tolerance to the pathogen. Advanced backcross populations segregating individually for either of the two QTL, and a recombinant inbred (RI population segregating for both QTL were used to fine map and confirm the genetic location of the QTL. The QTL intervals were physically mapped using the reference common bean genome sequence, and the physical intervals for each QTL were further confirmed by sequence-based introgression mapping. Using whole-genome sequence data from susceptible and tolerant DNA pools, introgressed regions were identified as those with significantly higher numbers of single-nucleotide polymorphisms (SNPs relative to the whole genome. By combining the QTL and SNP data, WM7.1 was located to a 660-kb region that contained 41 gene models on the proximal end of chromosome Pv07, while the WM8.3 introgression was narrowed to a 1.36-Mb region containing 70 gene models. The most polymorphic candidate gene in the WM7.1 region encodes a BEACH-domain protein associated with apoptosis. Within the WM8.3 interval, a receptor-like protein with the potential to recognize pathogen effectors was the most polymorphic gene. The use of gene and sequence-based mapping identified two candidate genes whose putative functions are consistent with the current model of pathogenicity.

  9. Effect of ovary induction on bread wheat anther culture: ovary genotype and developmental stage, and candidate gene association.

    Directory of Open Access Journals (Sweden)

    Ana María Castillo

    2015-06-01

    Full Text Available Ovary pre-conditioned medium and ovary co-culture increased the efficiency of green doubled haploid plant production in bread wheat anther culture. The positive effect of this medium led to a 6- and 11-fold increase in the numbers of embryos and green plants, respectively, having a greater effect on a medium-low responding cultivar. Ovary genotype and developmental stage significantly affected microspore embryogenesis. By he use of Caramba ovaries it was possible to reach a 2-fold increase in the number of embryos and green plants, and to decrease the rate of albinism. Mature ovaries from flowers containing microspores at a late binucleate stage raised the number of embryos and green plants by 25% and 46% as compared to immature ovaries (excised from flowers with microspores at a mid-late uninucleate stage. The highest numbers of embryos and green plants were produced when using mature Caramba ovaries. Ovaries from Galeón, Tigre and Kilopondio cultivars successfully induced microspore embryogenesis at the same rate as Caramba ovaries. Moreover, Tigre ovaries raised the percentage of spontaneous chromosome doubling up to 71%. Attempts were made to identify molecular mechanisms associated to the inductive effect of the ovaries on microspore embryogenesis. The genes TAA1b, FLA26 and WALI6 associated to wheat microspore embryogenesis, the CGL1 gene involved in glycan biosynthesis or degradation, and the FER gene involved in the ovary signalling process were expressed and/or induced at different rates during ovary culture. The expression pattern of FLA26 and FER could be related to the differences between genotypes and developmental stages in the inductive effect of the ovary. Our results open opportunities for new approaches to increase bread wheat doubled haploid production by anther culture, and to identify the functional components of the ovary inductive effect on microspore embryogenesis.

  10. Identifying Breeding Priorities for Blueberry Flavor Using Biochemical, Sensory, and Genotype by Environment Analyses.

    Directory of Open Access Journals (Sweden)

    Jessica L Gilbert

    Full Text Available Breeding for a subjective goal such as flavor is challenging, as many blueberry cultivars are grown worldwide, and identifying breeding targets relating to blueberry flavor biochemistry that have a high degree of genetic control and low environmental variability are priorities. A variety of biochemical compounds and physical characters induce the sensory responses of taste, olfaction, and somatosensation, all of which interact to create what is perceived flavor. The goal of this study was to identify the flavor compounds with a larger genetic versus environmental component regulating their expression over an array of cultivars, locations, and years. Over the course of three years, consumer panelists rated overall liking, texture, sweetness, sourness, and flavor intensity of 19 southern highbush blueberry (Vaccinium corymbosum hybrids genotypes in 30 sensory panels. Significant positive correlations to overall liking of blueberry fruit (P<0.001 were found with sweetness (R2 = 0.70, texture (R2 = 0.68, and flavor (R2 = 0.63. Sourness had a significantly negative relationship with overall liking (R2 = 0.55. The relationship between flavor and texture liking was also linear (R2 = 0.73, P<0.0001 demonstrating interaction between olfaction and somatosensation. Partial least squares analysis was used to identify sugars, acids, and volatile compounds contributing to liking and sensory intensities, and revealed strong effects of fructose, pH, and several volatile compounds upon all sensory parameters measured. To assess the feasibility of breeding for flavor components, a three year study was conducted to compare genetic and environmental influences on flavor biochemistry. Panelists could discern genotypic variation in blueberry sensory components, and many of the compounds affecting consumer favor of blueberries, such as fructose, pH, β-caryophyllene oxide and 2-heptanone, were sufficiently genetically controlled that allocating resources for their

  11. Genomewide high-density SNP linkage analysis of non-BRCA1/2 breast cancer families identifies various candidate regions and has greater power than microsatellite studies

    Directory of Open Access Journals (Sweden)

    Gonzalez-Neira Anna

    2007-08-01

    Full Text Available Abstract Background The recent development of new high-throughput technologies for SNP genotyping has opened the possibility of taking a genome-wide linkage approach to the search for new candidate genes involved in heredity diseases. The two major breast cancer susceptibility genes BRCA1 and BRCA2 are involved in 30% of hereditary breast cancer cases, but the discovery of additional breast cancer predisposition genes for the non-BRCA1/2 breast cancer families has so far been unsuccessful. Results In order to evaluate the power improvement provided by using SNP markers in a real situation, we have performed a whole genome screen of 19 non-BRCA1/2 breast cancer families using 4720 genomewide SNPs with Illumina technology (Illumina's Linkage III Panel, with an average distance of 615 Kb/SNP. We identified six regions on chromosomes 2, 3, 4, 7, 11 and 14 as candidates to contain genes involved in breast cancer susceptibility, and additional fine mapping genotyping using microsatellite markers around linkage peaks confirmed five of them, excluding the region on chromosome 3. These results were consistent in analyses that excluded SNPs in high linkage disequilibrium. The results were compared with those obtained previously using a 10 cM microsatellite scan (STR-GWS and we found lower or not significant linkage signals with STR-GWS data compared to SNP data in all cases. Conclusion Our results show the power increase that SNPs can supply in linkage studies.

  12. Prespecified candidate biomarkers identify follicular lymphoma patients who achieved longer progression-free survival with bortezomib-rituximab versus rituximab.

    Science.gov (United States)

    Coiffier, Bertrand; Li, Weimin; Henitz, Erin D; Karkera, Jayaprakash D; Favis, Reyna; Gaffney, Dana; Shapiro, Alice; Theocharous, Panteli; Elsayed, Yusri A; van de Velde, Helgi; Schaffer, Michael E; Osmanov, Evgenii A; Hong, Xiaonan; Scheliga, Adriana; Mayer, Jiri; Offner, Fritz; Rule, Simon; Teixeira, Adriana; Romejko-Jarosinska, Joanna; de Vos, Sven; Crump, Michael; Shpilberg, Ofer; Zinzani, Pier Luigi; Cakana, Andrew; Esseltine, Dixie-Lee; Mulligan, George; Ricci, Deborah

    2013-05-01

    Identify subgroups of patients with relapsed/refractory follicular lymphoma deriving substantial progression-free survival (PFS) benefit with bortezomib-rituximab versus rituximab in the phase III LYM-3001 study. A total of 676 patients were randomized to five 5-week cycles of bortezomib-rituximab or rituximab. The primary end point was PFS; this prespecified analysis of candidate protein biomarkers and genes was an exploratory objective. Archived tumor tissue and whole blood samples were collected at baseline. Immunohistochemistry and genetic analyses were completed for 4 proteins and 8 genes. In initial pairwise analyses, using individual single-nucleotide polymorphism genotypes, one biomarker pair (PSMB1 P11A C/G heterozygote, low CD68 expression) was associated with a significant PFS benefit with bortezomib-rituximab versus rituximab, controlling for multiple comparison corrections. The pair was analyzed under dominant, recessive, and additive genetic models, with significant association with PFS seen under the dominant model (G/G+C/G). In patients carrying this biomarker pair [PSMB1 P11A G allele, low CD68 expression (≤50 CD68-positive cells), population frequency: 43.6%], median PFS was 14.2 months with bortezomib-rituximab versus 9.1 months with rituximab (HR 0.47, P < 0.0001), and there was a significant overall survival benefit (HR 0.49, P = 0.0461). Response rates were higher and time to next antilymphoma therapy was longer in the bortezomib-rituximab group. In biomarker-negative patients, no significant efficacy differences were seen between treatment groups. Similar proportions of patients had high-risk features in the biomarker-positive and biomarker-negative subsets. Patients with PSMB1 P11A (G allele) and low CD68 expression seemed to have significantly longer PFS and greater clinical benefit with bortezomib-rituximab versus rituximab. ©2013 AACR.

  13. A Proteomic Approach Identifies Candidate Early Biomarkers to Predict Severe Dengue in Children.

    Directory of Open Access Journals (Sweden)

    Dang My Nhi

    2016-02-01

    Full Text Available Severe dengue with severe plasma leakage (SD-SPL is the most frequent of dengue severe form. Plasma biomarkers for early predictive diagnosis of SD-SPL are required in the primary clinics for the prevention of dengue death.Among 63 confirmed dengue pediatric patients recruited, hospital based longitudinal study detected six SD-SPL and ten dengue with warning sign (DWS. To identify the specific proteins increased or decreased in the SD-SPL plasma obtained 6-48 hours before the shock compared with the DWS, the isobaric tags for relative and absolute quantification (iTRAQ technology was performed using four patients each group. Validation was undertaken in 6 SD-SPL and 10 DWS patients.Nineteen plasma proteins exhibited significantly different relative concentrations (p<0.05, with five over-expressed and fourteen under-expressed in SD-SPL compared with DWS. The individual protein was classified to either blood coagulation, vascular regulation, cellular transport-related processes or immune response. The immunoblot quantification showed angiotensinogen and antithrombin III significantly increased in SD-SPL whole plasma of early stage compared with DWS subjects. Even using this small number of samples, antithrombin III predicted SD-SPL before shock occurrence with accuracy.Proteins identified here may serve as candidate predictive markers to diagnose SD-SPL for timely clinical management. Since the number of subjects are small, so further studies are needed to confirm all these biomarkers.

  14. Exome sequencing in 53 sporadic cases of schizophrenia identifies 18 putative candidate genes.

    Directory of Open Access Journals (Sweden)

    Michel Guipponi

    Full Text Available Schizophrenia (SCZ is a severe, debilitating mental illness which has a significant genetic component. The identification of genetic factors related to SCZ has been challenging and these factors remain largely unknown. To evaluate the contribution of de novo variants (DNVs to SCZ, we sequenced the exomes of 53 individuals with sporadic SCZ and of their non-affected parents. We identified 49 DNVs, 18 of which were predicted to alter gene function, including 13 damaging missense mutations, 2 conserved splice site mutations, 2 nonsense mutations, and 1 frameshift deletion. The average number of exonic DNV per proband was 0.88, which corresponds to an exonic point mutation rate of 1.7×10(-8 per nucleotide per generation. The non-synonymous-to-synonymous mutation ratio of 2.06 did not differ from neutral expectations. Overall, this study provides a list of 18 putative candidate genes for sporadic SCZ, and when combined with the results of similar reports, identifies a second proband carrying a non-synonymous DNV in the RGS12 gene.

  15. Genomic profiling identifies GATA6 as a candidate oncogene amplified in pancreatobiliary cancer.

    Directory of Open Access Journals (Sweden)

    Kevin A Kwei

    2008-05-01

    Full Text Available Pancreatobiliary cancers have among the highest mortality rates of any cancer type. Discovering the full spectrum of molecular genetic alterations may suggest new avenues for therapy. To catalogue genomic alterations, we carried out array-based genomic profiling of 31 exocrine pancreatic cancers and 6 distal bile duct cancers, expanded as xenografts to enrich the tumor cell fraction. We identified numerous focal DNA amplifications and deletions, including in 19% of pancreatobiliary cases gain at cytoband 18q11.2, a locus uncommonly amplified in other tumor types. The smallest shared amplification at 18q11.2 included GATA6, a transcriptional regulator previously linked to normal pancreas development. When amplified, GATA6 was overexpressed at both the mRNA and protein levels, and strong immunostaining was observed in 25 of 54 (46% primary pancreatic cancers compared to 0 of 33 normal pancreas specimens surveyed. GATA6 expression in xenografts was associated with specific microarray gene-expression patterns, enriched for GATA binding sites and mitochondrial oxidative phosphorylation activity. siRNA mediated knockdown of GATA6 in pancreatic cancer cell lines with amplification led to reduced cell proliferation, cell cycle progression, and colony formation. Our findings indicate that GATA6 amplification and overexpression contribute to the oncogenic phenotypes of pancreatic cancer cells, and identify GATA6 as a candidate lineage-specific oncogene in pancreatobiliary cancer, with implications for novel treatment strategies.

  16. Gene expression signature analysis identifies vorinostat as a candidate therapy for gastric cancer.

    Directory of Open Access Journals (Sweden)

    Sofie Claerhout

    Full Text Available Gastric cancer continues to be one of the deadliest cancers in the world and therefore identification of new drugs targeting this type of cancer is thus of significant importance. The purpose of this study was to identify and validate a therapeutic agent which might improve the outcomes for gastric cancer patients in the future.Using microarray technology, we generated a gene expression profile of human gastric cancer-specific genes from human gastric cancer tissue samples. We used this profile in the Broad Institute's Connectivity Map analysis to identify candidate therapeutic compounds for gastric cancer. We found the histone deacetylase inhibitor vorinostat as the lead compound and thus a potential therapeutic drug for gastric cancer. Vorinostat induced both apoptosis and autophagy in gastric cancer cell lines. Pharmacological and genetic inhibition of autophagy however, increased the therapeutic efficacy of vorinostat, indicating that a combination of vorinostat with autophagy inhibitors may therapeutically be more beneficial. Moreover, gene expression analysis of gastric cancer identified a collection of genes (ITGB5, TYMS, MYB, APOC1, CBX5, PLA2G2A, and KIF20A whose expression was elevated in gastric tumor tissue and downregulated more than 2-fold by vorinostat treatment in gastric cancer cell lines. In contrast, SCGB2A1, TCN1, CFD, APLP1, and NQO1 manifested a reversed pattern.We showed that analysis of gene expression signature may represent an emerging approach to discover therapeutic agents for gastric cancer, such as vorinostat. The observation of altered gene expression after vorinostat treatment may provide the clue to identify the molecular mechanism of vorinostat and those patients likely to benefit from vorinostat treatment.

  17. Gene Expression Signature Analysis Identifies Vorinostat as a Candidate Therapy for Gastric Cancer

    Science.gov (United States)

    Choi, Woonyoung; Park, Yun-Yong; Kim, KyoungHyun; Kim, Sang-Bae; Lee, Ju-Seog; Mills, Gordon B.; Cho, Jae Yong

    2011-01-01

    Background Gastric cancer continues to be one of the deadliest cancers in the world and therefore identification of new drugs targeting this type of cancer is thus of significant importance. The purpose of this study was to identify and validate a therapeutic agent which might improve the outcomes for gastric cancer patients in the future. Methodology/Principal Findings Using microarray technology, we generated a gene expression profile of human gastric cancer–specific genes from human gastric cancer tissue samples. We used this profile in the Broad Institute's Connectivity Map analysis to identify candidate therapeutic compounds for gastric cancer. We found the histone deacetylase inhibitor vorinostat as the lead compound and thus a potential therapeutic drug for gastric cancer. Vorinostat induced both apoptosis and autophagy in gastric cancer cell lines. Pharmacological and genetic inhibition of autophagy however, increased the therapeutic efficacy of vorinostat, indicating that a combination of vorinostat with autophagy inhibitors may therapeutically be more beneficial. Moreover, gene expression analysis of gastric cancer identified a collection of genes (ITGB5, TYMS, MYB, APOC1, CBX5, PLA2G2A, and KIF20A) whose expression was elevated in gastric tumor tissue and downregulated more than 2-fold by vorinostat treatment in gastric cancer cell lines. In contrast, SCGB2A1, TCN1, CFD, APLP1, and NQO1 manifested a reversed pattern. Conclusions/Significance We showed that analysis of gene expression signature may represent an emerging approach to discover therapeutic agents for gastric cancer, such as vorinostat. The observation of altered gene expression after vorinostat treatment may provide the clue to identify the molecular mechanism of vorinostat and those patients likely to benefit from vorinostat treatment. PMID:21931799

  18. Prediction potential of candidate biomarker sets identified and validated on gene expression data from multiple datasets

    Directory of Open Access Journals (Sweden)

    Karacali Bilge

    2007-10-01

    Full Text Available Abstract Background Independently derived expression profiles of the same biological condition often have few genes in common. In this study, we created populations of expression profiles from publicly available microarray datasets of cancer (breast, lymphoma and renal samples linked to clinical information with an iterative machine learning algorithm. ROC curves were used to assess the prediction error of each profile for classification. We compared the prediction error of profiles correlated with molecular phenotype against profiles correlated with relapse-free status. Prediction error of profiles identified with supervised univariate feature selection algorithms were compared to profiles selected randomly from a all genes on the microarray platform and b a list of known disease-related genes (a priori selection. We also determined the relevance of expression profiles on test arrays from independent datasets, measured on either the same or different microarray platforms. Results Highly discriminative expression profiles were produced on both simulated gene expression data and expression data from breast cancer and lymphoma datasets on the basis of ER and BCL-6 expression, respectively. Use of relapse-free status to identify profiles for prognosis prediction resulted in poorly discriminative decision rules. Supervised feature selection resulted in more accurate classifications than random or a priori selection, however, the difference in prediction error decreased as the number of features increased. These results held when decision rules were applied across-datasets to samples profiled on the same microarray platform. Conclusion Our results show that many gene sets predict molecular phenotypes accurately. Given this, expression profiles identified using different training datasets should be expected to show little agreement. In addition, we demonstrate the difficulty in predicting relapse directly from microarray data using supervised machine

  19. Identifying the Administrative Dispositions Most Preferred by Urban School Leaders and School Leadership Candidates

    Science.gov (United States)

    Pregot, Michael

    2016-01-01

    This research study delves into the newly crafted ISSLC national school leadership standards asking current school leaders and school leadership candidates to prioritize their perceived level of importance of 20 administrative dispositions. 128 school principals and 165 school leadership candidates in the NYC schools responded to an electronic…

  20. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life

    Directory of Open Access Journals (Sweden)

    Reusch Thorsten BH

    2011-01-01

    Full Text Available Abstract Background Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L. Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. Results In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. Conclusions These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  1. Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder

    Science.gov (United States)

    Yuen, Ryan KC; Merico, Daniele; Bookman, Matt; Howe, Jennifer L; Thiruvahindrapuram, Bhooma; Patel, Rohan V; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A; Walker, Susan; Marshall, Christian R; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D’Abate, Lia; Chan, Ada JS; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R; Nalpathamkalam, Thomas; Sung, Wilson WL; Tsoi, Fiona J; Wei, John; Xu, Lizhen; Tasse, Anne-Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie MacKinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A; Parr, Jeremy R; Spence, Sarah J; Vorstman, Jacob; Frey, Brendan J; Robinson, James T; Strug, Lisa J; Fernandez, Bridget A; Elsabbagh, Mayada; Carter, Melissa T; Hallmayer, Joachim; Knoppers, Bartha M; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H; Glazer, David; Pletcher, Mathew T; Scherer, Stephen W

    2017-01-01

    We are performing whole genome sequencing (WGS) of families with Autism Spectrum Disorder (ASD) to build a resource, named MSSNG, to enable the sub-categorization of phenotypes and underlying genetic factors involved. Here, we report WGS of 5,205 samples from families with ASD, accompanied by clinical information, creating a database accessible in a cloud platform, and through an internet portal with controlled access. We found an average of 73.8 de novo single nucleotide variants and 12.6 de novo insertion/deletions (indels) or copy number variations (CNVs) per ASD subject. We identified 18 new candidate ASD-risk genes such as MED13 and PHF3, and found that participants bearing mutations in susceptibility genes had significantly lower adaptive ability (p=6×10−4). In 294/2,620 (11.2%) of ASD cases, a molecular basis could be determined and 7.2% of these carried CNV/chromosomal abnormalities, emphasizing the importance of detecting all forms of genetic variation as diagnostic and therapeutic targets in ASD. PMID:28263302

  2. Epidermal growth factor gene is a newly identified candidate gene for gout

    Science.gov (United States)

    Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui

    2016-01-01

    Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67–0.88, Padjusted = 6.42 × 10−3). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations. PMID:27506295

  3. Epidermal growth factor gene is a newly identified candidate gene for gout.

    Science.gov (United States)

    Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui

    2016-08-10

    Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67-0.88, Padjusted = 6.42 × 10(-3)). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations.

  4. Whole-exome sequencing identifies novel candidate predisposition genes for familial polycythemia vera.

    Science.gov (United States)

    Hirvonen, Elina A M; Pitkänen, Esa; Hemminki, Kari; Aaltonen, Lauri A; Kilpivaara, Outi

    2017-04-20

    Polycythemia vera (PV), characterized by massive production of erythrocytes, is one of the myeloproliferative neoplasms. Most patients carry a somatic gain-of-function mutation in JAK2, c.1849G > T (p.Val617Phe), leading to constitutive activation of JAK-STAT signaling pathway. Familial clustering is also observed occasionally, but high-penetrance predisposition genes to PV have remained unidentified. We studied the predisposition to PV by exome sequencing (three cases) in a Finnish PV family with four patients. The 12 shared variants (maximum allowed minor allele frequency  G (p.Phe418Leu) in ZXDC, c.1931C > G (p.Pro644Arg) in ATN1, and c.701G > A (p.Arg234Gln) in LRRC3. We also observed a rare, predicted benign germline variant c.2912C > G (p.Ala971Gly) in BCORL1 in all four patients. Somatic mutations in BCORL1 have been reported in myeloid malignancies. We further screened the variants in eight PV patients in six other Finnish families, but no other carriers were found. Exome sequencing provides a powerful tool for the identification of novel variants, and understanding the familial predisposition of diseases. This is the first report on Finnish familial PV cases, and we identified three novel candidate variants that may predispose to the disease.

  5. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life.

    Science.gov (United States)

    Wissler, Lothar; Codoñer, Francisco M; Gu, Jenny; Reusch, Thorsten B H; Olsen, Jeanine L; Procaccini, Gabriele; Bornberg-Bauer, Erich

    2011-01-12

    Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs) of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L.) Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica) and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  6. Identifying Breeding Priorities for Blueberry Flavor Using Biochemical, Sensory, and Genotype by Environment Analyses.

    Science.gov (United States)

    Gilbert, Jessica L; Guthart, Matthew J; Gezan, Salvador A; Pisaroglo de Carvalho, Melissa; Schwieterman, Michael L; Colquhoun, Thomas A; Bartoshuk, Linda M; Sims, Charles A; Clark, David G; Olmstead, James W

    2015-01-01

    Breeding for a subjective goal such as flavor is challenging, as many blueberry cultivars are grown worldwide, and identifying breeding targets relating to blueberry flavor biochemistry that have a high degree of genetic control and low environmental variability are priorities. A variety of biochemical compounds and physical characters induce the sensory responses of taste, olfaction, and somatosensation, all of which interact to create what is perceived flavor. The goal of this study was to identify the flavor compounds with a larger genetic versus environmental component regulating their expression over an array of cultivars, locations, and years. Over the course of three years, consumer panelists rated overall liking, texture, sweetness, sourness, and flavor intensity of 19 southern highbush blueberry (Vaccinium corymbosum hybrids) genotypes in 30 sensory panels. Significant positive correlations to overall liking of blueberry fruit (Pblueberry sensory components, and many of the compounds affecting consumer favor of blueberries, such as fructose, pH, β-caryophyllene oxide and 2-heptanone, were sufficiently genetically controlled that allocating resources for their breeding is worthwhile.

  7. Integrated database for identifying candidate genes for Aspergillus flavus resistance in maize.

    Science.gov (United States)

    Kelley, Rowena Y; Gresham, Cathy; Harper, Jonathan; Bridges, Susan M; Warburton, Marilyn L; Hawkins, Leigh K; Pechanova, Olga; Peethambaran, Bela; Pechan, Tibor; Luthe, Dawn S; Mylroie, J E; Ankala, Arunkanth; Ozkan, Seval; Henry, W B; Williams, W P

    2010-10-07

    Aspergillus flavus Link:Fr, an opportunistic fungus that produces aflatoxin, is pathogenic to maize and other oilseed crops. Aflatoxin is a potent carcinogen, and its presence markedly reduces the value of grain. Understanding and enhancing host resistance to A. flavus infection and/or subsequent aflatoxin accumulation is generally considered an efficient means of reducing grain losses to aflatoxin. Different proteomic, genomic and genetic studies of maize (Zea mays L.) have generated large data sets with the goal of identifying genes responsible for conferring resistance to A. flavus, or aflatoxin. In order to maximize the usage of different data sets in new studies, including association mapping, we have constructed a relational database with web interface integrating the results of gene expression, proteomic (both gel-based and shotgun), Quantitative Trait Loci (QTL) genetic mapping studies, and sequence data from the literature to facilitate selection of candidate genes for continued investigation. The Corn Fungal Resistance Associated Sequences Database (CFRAS-DB) (http://agbase.msstate.edu/) was created with the main goal of identifying genes important to aflatoxin resistance. CFRAS-DB is implemented using MySQL as the relational database management system running on a Linux server, using an Apache web server, and Perl CGI scripts as the web interface. The database and the associated web-based interface allow researchers to examine many lines of evidence (e.g. microarray, proteomics, QTL studies, SNP data) to assess the potential role of a gene or group of genes in the response of different maize lines to A. flavus infection and subsequent production of aflatoxin by the fungus. CFRAS-DB provides the first opportunity to integrate data pertaining to the problem of A. flavus and aflatoxin resistance in maize in one resource and to support queries across different datasets. The web-based interface gives researchers different query options for mining the database

  8. Identification and association analysis of several hundred single nucleotide polymorphisms within candidate genes for back fat thickness in Italian Large White pigs using a selective genotyping approach.

    Science.gov (United States)

    Fontanesi, L; Galimberti, G; Calò, D G; Fronza, R; Martelli, P L; Scotti, E; Colombo, M; Schiavo, G; Casadio, R; Buttazzoni, L; Russo, V

    2012-08-01

    Combining different approaches (resequencing of portions of 54 obesity candidate genes, literature mining for pig markers associated with fat deposition or related traits in 77 genes, and in silico mining of porcine expressed sequence tags and other sequences available in databases), we identified and analyzed 736 SNP within candidate genes to identify markers associated with back fat thickness (BFT) in Italian Large White sows. Animals were chosen using a selective genotyping approach according to their EBV for BFT (276 with most negative and 279 with most positive EBV) within a population of ≈ 12,000 pigs. Association analysis between the SNP and BFT has been carried out using the MAX test proposed for case-control studies. The designed assays were successful for 656 SNP: 370 were excluded (low call rate or minor allele frequency A polymorphism (P(nominal) G polymorphism (P(nominal) = 8.0E-05). The third top SNP (P(nominal) = 6.2E-04) was the intronic TBC1D1 g.219G>A polymorphic site, in agreement with our previous results obtained in an independent study. The list of significant markers also included SNP in additional genes (ABHD16A, ABHD5, ACP2, ALMS1, APOA2, ATP1A2, CALR, COL14A1, CTSF, DARS, DECR1, ENPP1, ESR1, GH1, GHRL, GNMT, IKBKB, JAK3, MTTP, NFKBIA, NT5E, PLAT, PPARG, PPP2R5D, PRLR, RRAGD, RFC2, SDHD, SERPINF1, UBE2H, VCAM1, and WAT). Functional relationships between genes were obtained using the Ingenuity Pathway Analysis (IPA) Knowledge Base. The top scoring pathway included 19 genes with a P(nominal) < 0.1, 2 of which (IKBKB and NFKBIA) are involved in the hypothalamic IKKβ/NFκB program that could represent a key axis to affect fat deposition traits in pigs. These results represent a starting point to plan marker-assisted selection in Italian Large White nuclei for BFT. Because of similarities between humans and pigs, this study might also provide useful clues to investigate genetic factors affecting human obesity.

  9. Contig Maps and Genomic Sequencing Identify Candidate Genes in the Usher 1C Locus

    Science.gov (United States)

    Higgins, Michael J.; Day, Colleen D.; Smilinich, Nancy J.; Ni, L.; Cooper, Paul R.; Nowak, Norma J.; Davies, Chris; de Jong, Pieter J.; Hejtmancik, Fielding; Evans, Glen A.; Smith, Richard J.H.; Shows, Thomas B.

    1998-01-01

    Usher syndrome 1C (USH1C) is a congenital condition manifesting profound hearing loss, the absence of vestibular function, and eventual retinal degeneration. The USH1C locus has been mapped genetically to a 2- to 3-cM interval in 11p14–15.1 between D11S899 and D11S861. In an effort to identify the USH1C disease gene we have isolated the region between these markers in yeast artificial chromosomes (YACs) using a combination of STS content mapping and Alu–PCR hybridization. The YAC contig is ∼3.5 Mb and has located several other loci within this interval, resulting in the order CEN-LDHA-SAA1-TPH-D11S1310-(D11S1888/KCNC1)-MYOD1-D11S902D11S921-D11S1890-TEL. Subsequent haplotyping and homozygosity analysis refined the location of the disease gene to a 400-kb interval between D11S902 and D11S1890 with all affected individuals being homozygous for the internal marker D11S921. To facilitate gene identification, the critical region has been converted into P1 artificial chromosome (PAC) clones using sequence-tagged sites (STSs) mapped to the YAC contig, Alu–PCR products generated from the YACs, and PAC end probes. A contig of >50 PAC clones has been assembled between D11S1310 and D11S1890, confirming the order of markers used in haplotyping. Three PAC clones representing nearly two-thirds of the USH1C critical region have been sequenced. PowerBLAST analysis identified six clusters of expressed sequence tags (ESTs), two known genes (BIR,SUR1) mapped previously to this region, and a previously characterized but unmapped gene NEFA (DNA binding/EF hand/acidic amino-acid-rich). GRAIL analysis identified 11 CpG islands and 73 exons of excellent quality. These data allowed the construction of a transcription map for the USH1C critical region, consisting of three known genes and six or more novel transcripts. Based on their map location, these loci represent candidate disease loci for USH1C. The NEFA gene was assessed as the USH1C locus by the sequencing of an amplified NEFA

  10. Multiple gene analyses identify distinct “bois noir” phytoplasma genotypes in the Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Emilija KOSTADINOVSKA

    2015-01-01

    Full Text Available “Bois noir” (BN is a grapevine yellows disease, associated with phytoplasma strains related to ‘Candidatus Phytoplasma solani’, that causes severe losses to viticulture in the Euro-Mediterranean basin. Due to the complex ecological cycle of its etiological agent, BN epidemiology is only partially known, and no effective control strategies have been developed. Numerous studies have focused on molecular characterization of BN phytoplasma strains, to identify molecular markers useful to accurately describe their genetic diversity, geographic distribution and host range. In the present study, a multiple gene analysess were carried out on 16S rRNA, tuf, vmp1, and stamp genes to study the genetic variability among 18 BN phytoplasma strains detected in diverse regions of the Republic of Macedonia. Restriction fragment length polymorphism (RFLP assays showed the presence of one 16S rRNA (16SrXII-A, two tuf (tuf-type a, tuf-type b, five vmp1 (V2-TA, V3, V4, V14, V18, and three stamp (S1, S2, S3 gene patterns among the examined strains. Based on the collective RFLP patterns, seven genotypes (Mac1 to Mac7 were described as evidence for genetic heterogeneity, and highlighting their prevalence and distribution in the investigated regions. Phylogenetic analyses on vmp1 and stamp genes underlined the affiliation of Macedonian BN phytoplasma strains to clusters associated with distinct ecologies.

  11. Mixed models identify physic nut genotypes adapted to environments with different phosphorus availability.

    Science.gov (United States)

    Teodoro, P E; Laviola, B G; Martins, L D; Amaral, J F T; Rodrigues, W N

    2016-08-19

    The aim of this study was to screen physic nut (Jatropha curcas) genotypes that differ in their phosphorous (P) use, using mixed models. The experiment was conducted in a greenhouse located in the experimental area of the Centro de Ciências Agrárias of the Universidade Federal do Espírito Santo, in Alegre, ES, Brazil. The experiment was arranged in a randomized block design, using a 10 x 3-factorial scheme, including ten physic nut genotypes and two environments that differed in their levels of soil P availability (10 and 60 mg/dm 3 ), each with four replications. After 100 days of cultivation, we evaluated the plant height, stem diameter, root volume, root dry matter, aerial part dry matter, total dry matter, as well as the efficiency of absorption, and use. The parameters were estimated for combined selection while considering the studied parameters: stability and adaptability for both environments were obtained using the harmonic mean of the relative performance of the predicted genotypic values. High genotype by environment interactions were observed for most physic nut traits, indicating considerable influences of P availability on the phenotypic value. The genotype Paraíso simultaneously presented high adaptability and stability for aerial part dry matter, total dry matter, and P translocation efficiency. The genotype CNPAE-C2 showed a positive response to P fertilization by increasing both the total and aerial part dry matter.

  12. Gravimetric phenotyping of whole plant transpiration responses to atmospheric vapour pressure deficit identifies genotypic variation in water use efficiency.

    Science.gov (United States)

    Ryan, Annette C; Dodd, Ian C; Rothwell, Shane A; Jones, Ros; Tardieu, Francois; Draye, Xavier; Davies, William J

    2016-10-01

    There is increasing interest in rapidly identifying genotypes with improved water use efficiency, exemplified by the development of whole plant phenotyping platforms that automatically measure plant growth and water use. Transpirational responses to atmospheric vapour pressure deficit (VPD) and whole plant water use efficiency (WUE, defined as the accumulation of above ground biomass per unit of water used) were measured in 100 maize (Zea mays L.) genotypes. Using a glasshouse based phenotyping platform with naturally varying VPD (1.5-3.8kPa), a 2-fold variation in WUE was identified in well-watered plants. Regression analysis of transpiration versus VPD under these conditions, and subsequent whole plant gas exchange at imposed VPDs (0.8-3.4kPa) showed identical responses in specific genotypes. Genotype response of transpiration versus VPD fell into two categories: 1) a linear increase in transpiration rate with VPD with low (high WUE) or high (low WUE) transpiration rate at all VPDs, 2) a non-linear response with a pronounced change point at low VPD (high WUE) or high VPD (low WUE). In the latter group, high WUE genotypes required a significantly lower VPD before transpiration was restricted, and had a significantly lower rate of transpiration in response to VPD after this point, when compared to low WUE genotypes. Change point values were significantly positively correlated with stomatal sensitivity to VPD. A change point in stomatal response to VPD may explain why some genotypes show contradictory WUE rankings according to whether they are measured under glasshouse or field conditions. Furthermore, this novel use of a high throughput phenotyping platform successfully reproduced the gas exchange responses of individuals measured in whole plant chambers, accelerating the identification of plants with high WUE. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. A Systematic Approach to Identify Candidate Transcription Factors that Control Cell Identity

    Directory of Open Access Journals (Sweden)

    Ana C. D’Alessio

    2015-11-01

    Full Text Available Hundreds of transcription factors (TFs are expressed in each cell type, but cell identity can be induced through the activity of just a small number of core TFs. Systematic identification of these core TFs for a wide variety of cell types is currently lacking and would establish a foundation for understanding the transcriptional control of cell identity in development, disease, and cell-based therapy. Here, we describe a computational approach that generates an atlas of candidate core TFs for a broad spectrum of human cells. The potential impact of the atlas was demonstrated via cellular reprogramming efforts where candidate core TFs proved capable of converting human fibroblasts to retinal pigment epithelial-like cells. These results suggest that candidate core TFs from the atlas will prove a useful starting point for studying transcriptional control of cell identity and reprogramming in many human cell types.

  14. Positional RNA-Seq identifies candidate genes for phenotypic engineering of sexual traits

    NARCIS (Netherlands)

    Arbore, Roberto; Sekii, Kiyono; Beisel, Christian; Ladurner, Peter; Berezikov, Eugene; Schaerer, Lukas

    2015-01-01

    Introduction: RNA interference (RNAi) of trait-specific genes permits the manipulation of specific phenotypic traits ("phenotypic engineering") and thus represents a powerful tool to test trait function in evolutionary studies. The identification of suitable candidate genes, however, often relies on

  15. Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the thirteenth MODY gene.

    Science.gov (United States)

    Bonnefond, Amélie; Philippe, Julien; Durand, Emmanuelle; Dechaume, Aurélie; Huyvaert, Marlène; Montagne, Louise; Marre, Michel; Balkau, Beverley; Fajardy, Isabelle; Vambergue, Anne; Vatin, Vincent; Delplanque, Jérôme; Le Guilcher, David; De Graeve, Franck; Lecoeur, Cécile; Sand, Olivier; Vaxillaire, Martine; Froguel, Philippe

    2012-01-01

    Maturity-onset of the young (MODY) is a clinically heterogeneous form of diabetes characterized by an autosomal-dominant mode of inheritance, an onset before the age of 25 years, and a primary defect in the pancreatic beta-cell function. Approximately 30% of MODY families remain genetically unexplained (MODY-X). Here, we aimed to use whole-exome sequencing (WES) in a four-generation MODY-X family to identify a new susceptibility gene for MODY. WES (Agilent-SureSelect capture/Illumina-GAIIx sequencing) was performed in three affected and one non-affected relatives in the MODY-X family. We then performed a high-throughput multiplex genotyping (Illumina-GoldenGate assay) of the putative causal mutations in the whole family and in 406 controls. A linkage analysis was also carried out. By focusing on variants of interest (i.e. gains of stop codon, frameshift, non-synonymous and splice-site variants not reported in dbSNP130) present in the three affected relatives and not present in the control, we found 69 mutations. However, as WES was not uniform between samples, a total of 324 mutations had to be assessed in the whole family and in controls. Only one mutation (p.Glu227Lys in KCNJ11) co-segregated with diabetes in the family (with a LOD-score of 3.68). No KCNJ11 mutation was found in 25 other MODY-X unrelated subjects. Beyond neonatal diabetes mellitus (NDM), KCNJ11 is also a MODY gene ('MODY13'), confirming the wide spectrum of diabetes related phenotypes due to mutations in NDM genes (i.e. KCNJ11, ABCC8 and INS). Therefore, the molecular diagnosis of MODY should include KCNJ11 as affected carriers can be ideally treated with oral sulfonylureas.

  16. Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the thirteenth MODY gene.

    Directory of Open Access Journals (Sweden)

    Amélie Bonnefond

    Full Text Available BACKGROUND: Maturity-onset of the young (MODY is a clinically heterogeneous form of diabetes characterized by an autosomal-dominant mode of inheritance, an onset before the age of 25 years, and a primary defect in the pancreatic beta-cell function. Approximately 30% of MODY families remain genetically unexplained (MODY-X. Here, we aimed to use whole-exome sequencing (WES in a four-generation MODY-X family to identify a new susceptibility gene for MODY. METHODOLOGY: WES (Agilent-SureSelect capture/Illumina-GAIIx sequencing was performed in three affected and one non-affected relatives in the MODY-X family. We then performed a high-throughput multiplex genotyping (Illumina-GoldenGate assay of the putative causal mutations in the whole family and in 406 controls. A linkage analysis was also carried out. PRINCIPAL FINDINGS: By focusing on variants of interest (i.e. gains of stop codon, frameshift, non-synonymous and splice-site variants not reported in dbSNP130 present in the three affected relatives and not present in the control, we found 69 mutations. However, as WES was not uniform between samples, a total of 324 mutations had to be assessed in the whole family and in controls. Only one mutation (p.Glu227Lys in KCNJ11 co-segregated with diabetes in the family (with a LOD-score of 3.68. No KCNJ11 mutation was found in 25 other MODY-X unrelated subjects. CONCLUSIONS/SIGNIFICANCE: Beyond neonatal diabetes mellitus (NDM, KCNJ11 is also a MODY gene ('MODY13', confirming the wide spectrum of diabetes related phenotypes due to mutations in NDM genes (i.e. KCNJ11, ABCC8 and INS. Therefore, the molecular diagnosis of MODY should include KCNJ11 as affected carriers can be ideally treated with oral sulfonylureas.

  17. Quantitative trait loci and candidate genes underlying genotype by environment interaction in the response of Arabidopsis thaliana to drought

    NARCIS (Netherlands)

    El-Soda, M.; Kruijer, Willem; Malosetti, M.; Koornneef, M.; Aarts, M.G.M.

    2015-01-01

    Drought stress was imposed on two sets of Arabidopsis thaliana genotypes grown in sand under short-day conditions and analysed for several shoot and root growth traits. The response to drought was assessed for quantitative trait locus (QTL) mapping in a genetically diverse set of Arabidopsis

  18. Can suitable candidates for levodopa/carbidopa intestinal gel therapy be identified using current evidence?

    Directory of Open Access Journals (Sweden)

    Maria José Catalán

    2017-09-01

    In recent years, strong evidence has supported the use of LCIG in treating motor fluctuations associated with APD, and several clinical studies provide emerging evidence for additional benefits of LCIG treatment in certain patients. This article provides an overview of the published literature on the benefits, limitations, and drawbacks of LCIG in relation to PD symptoms, the psychosocial impact of the disease, and the quality of life of patients, with the aim of determining candidates for whom treatment with LCIG would be beneficial. According to current evidence, patients with APD (defined as inability to achieve optimal control of the disease with conventional oral treatment, a relatively well-preserved cognitive-behavioral status, and good family/caregiver would count as suitable candidates for LCIG treatment. Contraindications in the opinion of the authors are severe dementia and active psychosis.

  19. Candidate luminal B breast cancer genes identified by genome, gene expression and DNA methylation profiling.

    Directory of Open Access Journals (Sweden)

    Stéphanie Cornen

    Full Text Available Breast cancers (BCs of the luminal B subtype are estrogen receptor-positive (ER+, highly proliferative, resistant to standard therapies and have a poor prognosis. To better understand this subtype we compared DNA copy number aberrations (CNAs, DNA promoter methylation, gene expression profiles, and somatic mutations in nine selected genes, in 32 luminal B tumors with those observed in 156 BCs of the other molecular subtypes. Frequent CNAs included 8p11-p12 and 11q13.1-q13.2 amplifications, 7q11.22-q34, 8q21.12-q24.23, 12p12.3-p13.1, 12q13.11-q24.11, 14q21.1-q23.1, 17q11.1-q25.1, 20q11.23-q13.33 gains and 6q14.1-q24.2, 9p21.3-p24,3, 9q21.2, 18p11.31-p11.32 losses. A total of 237 and 101 luminal B-specific candidate oncogenes and tumor suppressor genes (TSGs presented a deregulated expression in relation with their CNAs, including 11 genes previously reported associated with endocrine resistance. Interestingly, 88% of the potential TSGs are located within chromosome arm 6q, and seven candidate oncogenes are potential therapeutic targets. A total of 100 candidate oncogenes were validated in a public series of 5,765 BCs and the overexpression of 67 of these was associated with poor survival in luminal tumors. Twenty-four genes presented a deregulated expression in relation with a high DNA methylation level. FOXO3, PIK3CA and TP53 were the most frequent mutated genes among the nine tested. In a meta-analysis of next-generation sequencing data in 875 BCs, KCNB2 mutations were associated with luminal B cases while candidate TSGs MDN1 (6q15 and UTRN (6q24, were mutated in this subtype. In conclusion, we have reported luminal B candidate genes that may play a role in the development and/or hormone resistance of this aggressive subtype.

  20. AcuI identifies water buffalo CSN3 genotypes by RFLP analysis

    Indian Academy of Sciences (India)

    Water buffalo population amounts to 185 million heads. (http://www.fao.org). They are mainly present in Southeast. Asia. Casein genes among other genes control the milk traits in water buffalo. The role of casein genotypes on composi- tion and coagulation of milk, quality and yield traits has been investigated (Lien et al.

  1. A genotype-first approach identifies an intellectual disability-overweight syndrome caused by PHIP haploinsufficiency

    DEFF Research Database (Denmark)

    Jansen, Sandra; Hoischen, Alexander; Coe, Bradley P

    2018-01-01

    Genotype-first combined with reverse phenotyping has shown to be a powerful tool in human genetics, especially in the era of next generation sequencing. This combines the identification of individuals with mutations in the same gene and linking these to consistent (endo)phenotypes to establish di...

  2. Genome-wide scan for visceral leishmaniasis in mixed-breed dogs identifies candidate genes involved in T helper cells and macrophage signaling

    Science.gov (United States)

    We conducted a genome-wide scan for visceral leishmaniasis in mixed-breed dogs from a highly endemic area in Brazil using 149,648 single nucleotide polymorphism (SNP) markers genotyped in 20 cases and 28 controls. Using a mixed model approach, we found two candidate loci on canine autosomes 1 and 2....

  3. Genomewide high-density SNP linkage analysis of non-BRCA1/2 breast cancer families identifies various candidate regions and has greater power than microsatellite studies

    NARCIS (Netherlands)

    A. González-Neira (Anna); J.M. Rosa-Rosa; A. Osorio (Ana); E. Gonzalez (Emilio); M.C. Southey (Melissa); O. Sinilnikova (Olga); H. Lynch (Henry); R.A. Oldenburg (Rogier); C.J. van Asperen (Christi); N. Hoogerbrugge (Nicoline); G. Pita (Guillermo); P. Devilee (Peter); D. Goldgar (David); J. Benítez (Javier)

    2007-01-01

    textabstractBackground: The recent development of new high-throughput technologies for SNP genotyping has opened the possibility of taking a genome-wide linkage approach to the search for new candidate genes involved in heredity diseases. The two major breast cancer susceptibility genes BRCA1 and

  4. Cancer in silico drug discovery: a systems biology tool for identifying candidate drugs to target specific molecular tumor subtypes.

    Science.gov (United States)

    San Lucas, F Anthony; Fowler, Jerry; Chang, Kyle; Kopetz, Scott; Vilar, Eduardo; Scheet, Paul

    2014-12-01

    Large-scale cancer datasets such as The Cancer Genome Atlas (TCGA) allow researchers to profile tumors based on a wide range of clinical and molecular characteristics. Subsequently, TCGA-derived gene expression profiles can be analyzed with the Connectivity Map (CMap) to find candidate drugs to target tumors with specific clinical phenotypes or molecular characteristics. This represents a powerful computational approach for candidate drug identification, but due to the complexity of TCGA and technology differences between CMap and TCGA experiments, such analyses are challenging to conduct and reproduce. We present Cancer in silico Drug Discovery (CiDD; scheet.org/software), a computational drug discovery platform that addresses these challenges. CiDD integrates data from TCGA, CMap, and Cancer Cell Line Encyclopedia (CCLE) to perform computational drug discovery experiments, generating hypotheses for the following three general problems: (i) determining whether specific clinical phenotypes or molecular characteristics are associated with unique gene expression signatures; (ii) finding candidate drugs to repress these expression signatures; and (iii) identifying cell lines that resemble the tumors being studied for subsequent in vitro experiments. The primary input to CiDD is a clinical or molecular characteristic. The output is a biologically annotated list of candidate drugs and a list of cell lines for in vitro experimentation. We applied CiDD to identify candidate drugs to treat colorectal cancers harboring mutations in BRAF. CiDD identified EGFR and proteasome inhibitors, while proposing five cell lines for in vitro testing. CiDD facilitates phenotype-driven, systematic drug discovery based on clinical and molecular data from TCGA. ©2014 American Association for Cancer Research.

  5. ICSNPathway: identify candidate causal SNPs and pathways from genome-wide association study by one analytical framework.

    Science.gov (United States)

    Zhang, Kunlin; Chang, Suhua; Cui, Sijia; Guo, Liyuan; Zhang, Liuyan; Wang, Jing

    2011-07-01

    Genome-wide association study (GWAS) is widely utilized to identify genes involved in human complex disease or some other trait. One key challenge for GWAS data interpretation is to identify causal SNPs and provide profound evidence on how they affect the trait. Currently, researches are focusing on identification of candidate causal variants from the most significant SNPs of GWAS, while there is lack of support on biological mechanisms as represented by pathways. Although pathway-based analysis (PBA) has been designed to identify disease-related pathways by analyzing the full list of SNPs from GWAS, it does not emphasize on interpreting causal SNPs. To our knowledge, so far there is no web server available to solve the challenge for GWAS data interpretation within one analytical framework. ICSNPathway is developed to identify candidate causal SNPs and their corresponding candidate causal pathways from GWAS by integrating linkage disequilibrium (LD) analysis, functional SNP annotation and PBA. ICSNPathway provides a feasible solution to bridge the gap between GWAS and disease mechanism study by generating hypothesis of SNP → gene → pathway(s). The ICSNPathway server is freely available at http://icsnpathway.psych.ac.cn/.

  6. Identifying a few foot-and-mouth disease virus signature nucleotide strings for computational genotyping

    Directory of Open Access Journals (Sweden)

    Xu Lizhe

    2008-06-01

    Full Text Available Abstract Background Serotypes of the Foot-and-Mouth disease viruses (FMDVs were generally determined by biological experiments. The computational genotyping is not well studied even with the availability of whole viral genomes, due to uneven evolution among genes as well as frequent genetic recombination. Naively using sequence comparison for genotyping is only able to achieve a limited extent of success. Results We used 129 FMDV strains with known serotype as training strains to select as many as 140 most serotype-specific nucleotide strings. We then constructed a linear-kernel Support Vector Machine classifier using these 140 strings. Under the leave-one-out cross validation scheme, this classifier was able to assign correct serotype to 127 of these 129 strains, achieving 98.45% accuracy. It also assigned serotype correctly to an independent test set of 83 other FMDV strains downloaded separately from NCBI GenBank. Conclusion Computational genotyping is much faster and much cheaper than the wet-lab based biological experiments, upon the availability of the detailed molecular sequences. The high accuracy of our proposed method suggests the potential of utilizing a few signature nucleotide strings instead of whole genomes to determine the serotypes of novel FMDV strains.

  7. Next generation sequencing identifies abnormal Y chromosome and candidate causal variants in premature ovarian failure patients.

    Science.gov (United States)

    Lee, Yujung; Kim, Changshin; Park, YoungJoon; Pyun, Jung-A; Kwack, KyuBum

    2016-12-01

    Premature ovarian failure (POF) is characterized by heterogeneous genetic causes such as chromosomal abnormalities and variants in causal genes. Recently, development of techniques made next generation sequencing (NGS) possible to detect genome wide variants including chromosomal abnormalities. Among 37 Korean POF patients, XY karyotype with distal part deletions of Y chromosome, Yp11.32-31 and Yp12 end part, was observed in two patients through NGS. Six deleterious variants in POF genes were also detected which might explain the pathogenesis of POF with abnormalities in the sex chromosomes. Additionally, the two POF patients had no mutation in SRY but three non-synonymous variants were detected in genes regarding sex reversal. These findings suggest candidate causes of POF and sex reversal and show the propriety of NGS to approach the heterogeneous pathogenesis of POF. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. A stratified transcriptomics analysis of polygenic fat and lean mouse adipose tissues identifies novel candidate obesity genes.

    Directory of Open Access Journals (Sweden)

    Nicholas M Morton

    Full Text Available Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L strain.To enrich for adipose tissue obesity genes a 'snap-shot' pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney was performed. Known obesity quantitative trait loci (QTL information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity.A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity.

  9. A comprehensive candidate gene approach identifies genetic variation associated with osteosarcoma

    International Nuclear Information System (INIS)

    Mirabello, Lisa; Grotmol, Tom; Douglass, Chester; Hayes, Richard B; Hoover, Robert N; Savage, Sharon A; Yu, Kai; Berndt, Sonja I; Burdett, Laurie; Wang, Zhaoming; Chowdhury, Salma; Teshome, Kedest; Uzoka, Arinze; Hutchinson, Amy

    2011-01-01

    Osteosarcoma (OS) is a bone malignancy which occurs primarily in adolescents. Since it occurs during a period of rapid growth, genes important in bone formation and growth are plausible modifiers of risk. Genes involved in DNA repair and ribosomal function may contribute to OS pathogenesis, because they maintain the integrity of critical cellular processes. We evaluated these hypotheses in an OS association study of genes from growth/hormone, bone formation, DNA repair, and ribosomal pathways. We evaluated 4836 tag-SNPs across 255 candidate genes in 96 OS cases and 1426 controls. Logistic regression models were used to estimate the odds ratios (OR) and 95% confidence intervals (CI). Twelve SNPs in growth or DNA repair genes were significantly associated with OS after Bonferroni correction. Four SNPs in the DNA repair gene FANCM (ORs 1.9-2.0, P = 0.003-0.004) and 2 SNPs downstream of the growth hormone gene GH1 (OR 1.6, P = 0.002; OR 0.5, P = 0.0009) were significantly associated with OS. One SNP in the region of each of the following genes was significant: MDM2, MPG, FGF2, FGFR3, GNRH2, and IGF1. Our results suggest that several SNPs in biologically plausible pathways are associated with OS. Larger studies are required to confirm our findings

  10. Gene expression differences between Noccaea caerulescens ecotypes help to identify candidate genes for metal phytoremediation.

    Science.gov (United States)

    Halimaa, Pauliina; Lin, Ya-Fen; Ahonen, Viivi H; Blande, Daniel; Clemens, Stephan; Gyenesei, Attila; Häikiö, Elina; Kärenlampi, Sirpa O; Laiho, Asta; Aarts, Mark G M; Pursiheimo, Juha-Pekka; Schat, Henk; Schmidt, Holger; Tuomainen, Marjo H; Tervahauta, Arja I

    2014-03-18

    Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically well-characterized N. caerulescens accessions, i.e., Ganges, La Calamine, and Monte Prinzera. Genes with possible contribution to zinc, cadmium, and nickel hyperaccumulation and hypertolerance were predicted. The most significant differences between the accessions were related to metal ion (di-, trivalent inorganic cation) transmembrane transporter activity, iron and calcium ion binding, (inorganic) anion transmembrane transporter activity, and antioxidant activity. Analysis of correlation between the expression profile of each gene and the metal-related characteristics of the accessions disclosed both previously characterized (HMA4, HMA3) and new candidate genes (e.g., for nickel IRT1, ZIP10, and PDF2.3) as possible contributors to the hyperaccumulation/tolerance phenotype. A number of unknown Noccaea-specific transcripts also showed correlation with Zn(2+), Cd(2+), or Ni(2+) hyperaccumulation/tolerance. This study shows that N. caerulescens populations have evolved great diversity in the expression of metal-related genes, facilitating adaptation to various metalliferous soils. The information will be helpful in the development of improved plants for metal phytoremediation.

  11. Identifying the most promising genotypes in lentil for cultivation in a wide range of environments of Pakistan using various yield stability measures

    International Nuclear Information System (INIS)

    Ali, A.; Zahid, M.A.

    2012-01-01

    The present study was aimed to identify the most promising high yielding lentil genotype for a wide range of environments of Pakistan using 8 stability measures. The experiment consisted of 12 lentil genotypes grown at 11 locations falling in different agro-ecological zones of Pakistan for 2 years during 2006/07 and 2007/08 under national uniform yield testing. The General Linear Model (GLM) of MINITAB (version 15) was used for two-way analysis of variance for lentil yield data to examine the total variation into genotypes, environments and genotype x environment interaction. The percent variation of 2 major contributors, environment and GxE interaction, was permissible to perform stability analysis to evaluate stable genotypes across the environments. The genotype x environment interaction means were used for eight stability measures (genotype mean, genotype variance, coefficient of variation, ecovalence, interaction variance, regression slope, deviation mean square, coefficient of determination). The stability measures depicted that the genotype NARC-06-1 with high mean yield (1140 kg/ha -1/), regression slope (1.09) close to unity and less statistics of remaining stability measures except high value of R/sup 2/ for yield proved to be the best within the pool of studied genotypes. The results clearly suggest that the genotype NARC-06-1 may prove to be a widely adapted high yielding stable variety for a broad spectrum of environments of Pakistan. (author)

  12. In silico analysis to identify vaccine candidates common to multiple serotypes of Shigella and evaluation of their immunogenicity

    KAUST Repository

    Pahil, Sapna

    2017-08-02

    Shigellosis or bacillary dysentery is an important cause of diarrhea, with the majority of the cases occurring in developing countries. Considering the high disease burden, increasing antibiotic resistance, serotype-specific immunity and the post-infectious sequelae associated with shigellosis, there is a pressing need of an effective vaccine against multiple serotypes of the pathogen. In the present study, we used bio-informatics approach to identify antigens shared among multiple serotypes of Shigella spp. This approach led to the identification of many immunogenic peptides. The five most promising peptides based on MHC binding efficiency were a putative lipoprotein (EL PGI I), a putative heat shock protein (EL PGI II), Spa32 (EL PGI III), IcsB (EL PGI IV) and a hypothetical protein (EL PGI V). These peptides were synthesized and the immunogenicity was evaluated in BALB/c mice by ELISA and cytokine assays. The putative heat shock protein (HSP) and the hypothetical protein elicited good humoral response, whereas putative lipoprotein, Spa32 and IcsB elicited good T-cell response as revealed by increased IFN-γ and TNF-α cytokine levels. The patient sera from confirmed cases of shigellosis were also evaluated for the presence of peptide specific antibodies with significant IgG and IgA antibodies against the HSP and the hypothetical protein, bestowing them as potential future vaccine candidates. The antigens reported in this study are novel and have not been tested as vaccine candidates against Shigella. This study offers time and cost-effective way of identifying unprecedented immunogenic antigens to be used as potential vaccine candidates. Moreover, this approach should easily be extendable to find new potential vaccine candidates for other pathogenic bacteria.

  13. In silico analysis to identify vaccine candidates common to multiple serotypes of Shigella and evaluation of their immunogenicity

    KAUST Repository

    Pahil, Sapna; Taneja, Neelam; Ansari, Hifzur Rahman; Raghava, G. P. S.

    2017-01-01

    Shigellosis or bacillary dysentery is an important cause of diarrhea, with the majority of the cases occurring in developing countries. Considering the high disease burden, increasing antibiotic resistance, serotype-specific immunity and the post-infectious sequelae associated with shigellosis, there is a pressing need of an effective vaccine against multiple serotypes of the pathogen. In the present study, we used bio-informatics approach to identify antigens shared among multiple serotypes of Shigella spp. This approach led to the identification of many immunogenic peptides. The five most promising peptides based on MHC binding efficiency were a putative lipoprotein (EL PGI I), a putative heat shock protein (EL PGI II), Spa32 (EL PGI III), IcsB (EL PGI IV) and a hypothetical protein (EL PGI V). These peptides were synthesized and the immunogenicity was evaluated in BALB/c mice by ELISA and cytokine assays. The putative heat shock protein (HSP) and the hypothetical protein elicited good humoral response, whereas putative lipoprotein, Spa32 and IcsB elicited good T-cell response as revealed by increased IFN-γ and TNF-α cytokine levels. The patient sera from confirmed cases of shigellosis were also evaluated for the presence of peptide specific antibodies with significant IgG and IgA antibodies against the HSP and the hypothetical protein, bestowing them as potential future vaccine candidates. The antigens reported in this study are novel and have not been tested as vaccine candidates against Shigella. This study offers time and cost-effective way of identifying unprecedented immunogenic antigens to be used as potential vaccine candidates. Moreover, this approach should easily be extendable to find new potential vaccine candidates for other pathogenic bacteria.

  14. In silico analysis to identify vaccine candidates common to multiple serotypes of Shigella and evaluation of their immunogenicity.

    Science.gov (United States)

    Pahil, Sapna; Taneja, Neelam; Ansari, Hifzur Rahman; Raghava, G P S

    2017-01-01

    Shigellosis or bacillary dysentery is an important cause of diarrhea, with the majority of the cases occurring in developing countries. Considering the high disease burden, increasing antibiotic resistance, serotype-specific immunity and the post-infectious sequelae associated with shigellosis, there is a pressing need of an effective vaccine against multiple serotypes of the pathogen. In the present study, we used bio-informatics approach to identify antigens shared among multiple serotypes of Shigella spp. This approach led to the identification of many immunogenic peptides. The five most promising peptides based on MHC binding efficiency were a putative lipoprotein (EL PGI I), a putative heat shock protein (EL PGI II), Spa32 (EL PGI III), IcsB (EL PGI IV) and a hypothetical protein (EL PGI V). These peptides were synthesized and the immunogenicity was evaluated in BALB/c mice by ELISA and cytokine assays. The putative heat shock protein (HSP) and the hypothetical protein elicited good humoral response, whereas putative lipoprotein, Spa32 and IcsB elicited good T-cell response as revealed by increased IFN-γ and TNF-α cytokine levels. The patient sera from confirmed cases of shigellosis were also evaluated for the presence of peptide specific antibodies with significant IgG and IgA antibodies against the HSP and the hypothetical protein, bestowing them as potential future vaccine candidates. The antigens reported in this study are novel and have not been tested as vaccine candidates against Shigella. This study offers time and cost-effective way of identifying unprecedented immunogenic antigens to be used as potential vaccine candidates. Moreover, this approach should easily be extendable to find new potential vaccine candidates for other pathogenic bacteria.

  15. In silico analysis to identify vaccine candidates common to multiple serotypes of Shigella and evaluation of their immunogenicity.

    Directory of Open Access Journals (Sweden)

    Sapna Pahil

    Full Text Available Shigellosis or bacillary dysentery is an important cause of diarrhea, with the majority of the cases occurring in developing countries. Considering the high disease burden, increasing antibiotic resistance, serotype-specific immunity and the post-infectious sequelae associated with shigellosis, there is a pressing need of an effective vaccine against multiple serotypes of the pathogen. In the present study, we used bio-informatics approach to identify antigens shared among multiple serotypes of Shigella spp. This approach led to the identification of many immunogenic peptides. The five most promising peptides based on MHC binding efficiency were a putative lipoprotein (EL PGI I, a putative heat shock protein (EL PGI II, Spa32 (EL PGI III, IcsB (EL PGI IV and a hypothetical protein (EL PGI V. These peptides were synthesized and the immunogenicity was evaluated in BALB/c mice by ELISA and cytokine assays. The putative heat shock protein (HSP and the hypothetical protein elicited good humoral response, whereas putative lipoprotein, Spa32 and IcsB elicited good T-cell response as revealed by increased IFN-γ and TNF-α cytokine levels. The patient sera from confirmed cases of shigellosis were also evaluated for the presence of peptide specific antibodies with significant IgG and IgA antibodies against the HSP and the hypothetical protein, bestowing them as potential future vaccine candidates. The antigens reported in this study are novel and have not been tested as vaccine candidates against Shigella. This study offers time and cost-effective way of identifying unprecedented immunogenic antigens to be used as potential vaccine candidates. Moreover, this approach should easily be extendable to find new potential vaccine candidates for other pathogenic bacteria.

  16. Proteomics strategy for identifying candidate bioactive proteins in complex mixtures: application to the platelet releasate.

    LENUS (Irish Health Repository)

    O'Connor, Roisin

    2010-01-01

    Proteomic approaches have proven powerful at identifying large numbers of proteins, but there are fewer reports of functional characterization of proteins in biological tissues. Here, we describe an experimental approach that fractionates proteins released from human platelets, linking bioassay activity to identity. We used consecutive orthogonal separation platforms to ensure sensitive detection: (a) ion-exchange of intact proteins, (b) SDS-PAGE separation of ion-exchange fractions and (c) HPLC separation of tryptic digests coupled to electrospray tandem mass spectrometry. Migration of THP-1 monocytes in response to complete or fractionated platelet releasate was assessed and located to just one of the forty-nine ion-exchange fractions. Over 300 proteins were identified in the releasate, with a wide range of annotated biophysical and biochemical properties, in particular platelet activation, adhesion, and wound healing. The presence of PEDF and involucrin, two proteins not previously reported in platelet releasate, was confirmed by western blotting. Proteins identified within the fraction with monocyte promigratory activity and not in other inactive fractions included vimentin, PEDF, and TIMP-1. We conclude that this analytical platform is effective for the characterization of complex bioactive samples.

  17. Exome sequencing identifies three novel candidate genes implicated in intellectual disability.

    Directory of Open Access Journals (Sweden)

    Zehra Agha

    Full Text Available Intellectual disability (ID is a major health problem mostly with an unknown etiology. Recently exome sequencing of individuals with ID identified novel genes implicated in the disease. Therefore the purpose of the present study was to identify the genetic cause of ID in one syndromic and two non-syndromic Pakistani families. Whole exome of three ID probands was sequenced. Missense variations in two plausible novel genes implicated in autosomal recessive ID were identified: lysine (K-specific methyltransferase 2B (KMT2B, zinc finger protein 589 (ZNF589, as well as hedgehog acyltransferase (HHAT with a de novo mutation with autosomal dominant mode of inheritance. The KMT2B recessive variant is the first report of recessive Kleefstra syndrome-like phenotype. Identification of plausible causative mutations for two recessive and a dominant type of ID, in genes not previously implicated in disease, underscores the large genetic heterogeneity of ID. These results also support the viewpoint that large number of ID genes converge on limited number of common networks i.e. ZNF589 belongs to KRAB-domain zinc-finger proteins previously implicated in ID, HHAT is predicted to affect sonic hedgehog, which is involved in several disorders with ID, KMT2B associated with syndromic ID fits the epigenetic module underlying the Kleefstra syndromic spectrum. The association of these novel genes in three different Pakistani ID families highlights the importance of screening these genes in more families with similar phenotypes from different populations to confirm the involvement of these genes in pathogenesis of ID.

  18. Accurately identifying patients who are excellent candidates or unsuitable for a medication: a novel approach

    Directory of Open Access Journals (Sweden)

    South C

    2017-12-01

    Full Text Available Charles South,1–3 A John Rush,4,* Thomas J Carmody,1–3 Manish K Jha,1,2 Madhukar H Trivedi1,2,*1Center for Depression Research and Clinical Care, 2Department of Psychiatry, 3Department of Clinical Sciences, University of Texas Southwestern Medical Center, Dallas, TX, USA; 4Department of Psychiatry and Behavioral Sciences, Duke-National University of Singapore, Singapore; Duke Medical School, Durham, NC, USA*These authors contributed equally to this work Objective: The objective of the study was to determine whether a unique analytic approach – as a proof of concept – could identify individual depressed outpatients (using 30 baseline clinical and demographic variables who are very likely (75% certain to not benefit (NB or to remit (R, accepting that without sufficient certainty, no prediction (NP would be made.Methods: Patients from the Combining Medications to Enhance Depression Outcomes trial treated with escitalopram (S-CIT + placebo (n=212 or S-CIT + bupropion-SR (n=206 were analyzed separately to assess replicability. For each treatment, the elastic net was used to identify subsets of predictive baseline measures for R and NB, separately. Two different equations that estimate the likelihood of remission and no benefit were developed for each patient. The ratio of these two numbers characterized likely outcomes for each patient.Results: The two treatment cells had comparable rates of remission (40% and no benefit (22%. In S-CIT + bupropion-SR, 11 were predicted NB of which 82% were correct; 26 were predicted R – 85% correct (169 had NP. For S-CIT + placebo, 13 were predicted NB – 69% correct; 44 were predicted R – 75% correct (155 were NP. Overall, 94/418 (22% patients were identified with a meaningful degree of certainty (69%–85% correct. Different variable sets with some overlap were predictive of remission and no benefit within and across treatments, despite comparable outcomes.Conclusion: In two separate analyses with two

  19. Multi-Population Selective Genotyping to Identify Soybean [Glycine max (L.) Merr.] Seed Protein and Oil QTLs.

    Science.gov (United States)

    Phansak, Piyaporn; Soonsuwon, Watcharin; Hyten, David L; Song, Qijian; Cregan, Perry B; Graef, George L; Specht, James E

    2016-06-01

    Plant breeders continually generate ever-higher yielding cultivars, but also want to improve seed constituent value, which is mainly protein and oil, in soybean [Glycine max (L.) Merr.]. Identification of genetic loci governing those two traits would facilitate that effort. Though genome-wide association offers one such approach, selective genotyping of multiple biparental populations offers a complementary alternative, and was evaluated here, using 48 F2:3 populations (n = ∼224 plants) created by mating 48 high protein germplasm accessions to cultivars of similar maturity, but with normal seed protein content. All F2:3 progeny were phenotyped for seed protein and oil, but only 22 high and 22 low extreme progeny in each F2:3 phenotypic distribution were genotyped with a 1536-SNP chip (ca 450 bimorphic SNPs detected per mating). A significant quantitative trait locus (QTL) on one or more chromosomes was detected for protein in 35 (73%), and for oil in 25 (52%), of the 48 matings, and these QTL exhibited additive effects of ≥ 4 g kg(-1) and R(2) values of 0.07 or more. These results demonstrated that a multiple-population selective genotyping strategy, when focused on matings between parental phenotype extremes, can be used successfully to identify germplasm accessions possessing large-effect QTL alleles. Such accessions would be of interest to breeders to serve as parental donors of those alleles in cultivar development programs, though 17 of the 48 accessions were not unique in terms of SNP genotype, indicating that diversity among high protein accessions in the germplasm collection is less than what might ordinarily be assumed. Copyright © 2016 Phansak et al.

  20. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin

    2016-08-22

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  1. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin; Abd El Ghany, Moataz; Naeem, Raeece; Lee, Kok-Wei; Tan, Yung-Chie; Pain, Arnab; Nathan, Sheila

    2016-01-01

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  2. Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS

    Directory of Open Access Journals (Sweden)

    Yee-Chin Wong

    2016-08-01

    Full Text Available Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  3. Genome-Wide Association Studies Identify Candidate Genes for Coat Color and Mohair Traits in the Iranian Markhoz Goat.

    Science.gov (United States)

    Nazari-Ghadikolaei, Anahit; Mehrabani-Yeganeh, Hassan; Miarei-Aashtiani, Seyed R; Staiger, Elizabeth A; Rashidi, Amir; Huson, Heather J

    2018-01-01

    The Markhoz goat provides an opportunity to study the genetics underlying coat color and mohair traits of an Angora type goat using genome-wide association studies (GWAS). This indigenous Iranian breed is valued for its quality mohair used in ceremonial garments and has the distinction of exhibiting an array of coat colors including black, brown, and white. Here, we performed 16 GWAS for different fleece (mohair) traits and coat color in 228 Markhoz goats sampled from the Markhoz Goat Research Station in Sanandaj, Kurdistan province, located in western Iran using the Illumina Caprine 50K beadchip. The Efficient Mixed Model Linear analysis was used to identify genomic regions with potential candidate genes contributing to coat color and mohair characteristics while correcting for population structure. Significant associations to coat color were found within or near the ASIP, ITCH, AHCY , and RALY genes on chromosome 13 for black and brown coat color and the KIT and PDGFRA genes on chromosome 6 for white coat color. Individual mohair traits were analyzed for genetic association along with principal components that allowed for a broader perspective of combined traits reflecting overall mohair quality and volume. A multitude of markers demonstrated significant association to mohair traits highlighting potential candidate genes of POU1F1 on chromosome 1 for mohair quality, MREG on chromosome 2 for mohair volume, DUOX1 on chromosome 10 for yearling fleece weight, and ADGRV1 on chromosome 7 for grease percentage. Variation in allele frequencies and haplotypes were identified for coat color and differentiated common markers associated with both brown and black coat color. This demonstrates the potential for genetic markers to be used in future breeding programs to improve selection for coat color and mohair traits. Putative candidate genes, both novel and previously identified in other species or breeds, require further investigation to confirm phenotypic causality and

  4. Genome-Wide Association Studies Identify Candidate Genes for Coat Color and Mohair Traits in the Iranian Markhoz Goat

    Directory of Open Access Journals (Sweden)

    Anahit Nazari-Ghadikolaei

    2018-04-01

    Full Text Available The Markhoz goat provides an opportunity to study the genetics underlying coat color and mohair traits of an Angora type goat using genome-wide association studies (GWAS. This indigenous Iranian breed is valued for its quality mohair used in ceremonial garments and has the distinction of exhibiting an array of coat colors including black, brown, and white. Here, we performed 16 GWAS for different fleece (mohair traits and coat color in 228 Markhoz goats sampled from the Markhoz Goat Research Station in Sanandaj, Kurdistan province, located in western Iran using the Illumina Caprine 50K beadchip. The Efficient Mixed Model Linear analysis was used to identify genomic regions with potential candidate genes contributing to coat color and mohair characteristics while correcting for population structure. Significant associations to coat color were found within or near the ASIP, ITCH, AHCY, and RALY genes on chromosome 13 for black and brown coat color and the KIT and PDGFRA genes on chromosome 6 for white coat color. Individual mohair traits were analyzed for genetic association along with principal components that allowed for a broader perspective of combined traits reflecting overall mohair quality and volume. A multitude of markers demonstrated significant association to mohair traits highlighting potential candidate genes of POU1F1 on chromosome 1 for mohair quality, MREG on chromosome 2 for mohair volume, DUOX1 on chromosome 10 for yearling fleece weight, and ADGRV1 on chromosome 7 for grease percentage. Variation in allele frequencies and haplotypes were identified for coat color and differentiated common markers associated with both brown and black coat color. This demonstrates the potential for genetic markers to be used in future breeding programs to improve selection for coat color and mohair traits. Putative candidate genes, both novel and previously identified in other species or breeds, require further investigation to confirm phenotypic

  5. Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

    Science.gov (United States)

    Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

    2018-06-01

    Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation

  6. Candidate gene resequencing to identify rare, pedigree-specific variants influencing healthy aging phenotypes in the long life family study

    DEFF Research Database (Denmark)

    Druley, Todd E; Wang, Lihua; Lin, Shiow J

    2016-01-01

    from six pedigrees. OBFC1 (chromosome 10) is involved in telomere maintenance, and falls within a linkage peak recently reported from an analysis of telomere length in LLFS families. Two different algorithms for single gene associations identified three genes with an enrichment of variation......BACKGROUND: The Long Life Family Study (LLFS) is an international study to identify the genetic components of various healthy aging phenotypes. We hypothesized that pedigree-specific rare variants at longevity-associated genes could have a similar functional impact on healthy phenotypes. METHODS......: We performed custom hybridization capture sequencing to identify the functional variants in 464 candidate genes for longevity or the major diseases of aging in 615 pedigrees (4,953 individuals) from the LLFS, using a multiplexed, custom hybridization capture. Variants were analyzed individually...

  7. Coalitional game theory as a promising approach to identify candidate autism genes.

    Science.gov (United States)

    Gupta, Anika; Sun, Min Woo; Paskov, Kelley Marie; Stockham, Nate Tyler; Jung, Jae-Yoon; Wall, Dennis Paul

    2018-01-01

    Despite mounting evidence for the strong role of genetics in the phenotypic manifestation of Autism Spectrum Disorder (ASD), the specific genes responsible for the variable forms of ASD remain undefined. ASD may be best explained by a combinatorial genetic model with varying epistatic interactions across many small effect mutations. Coalitional or cooperative game theory is a technique that studies the combined effects of groups of players, known as coalitions, seeking to identify players who tend to improve the performance--the relationship to a specific disease phenotype--of any coalition they join. This method has been previously shown to boost biologically informative signal in gene expression data but to-date has not been applied to the search for cooperative mutations among putative ASD genes. We describe our approach to highlight genes relevant to ASD using coalitional game theory on alteration data of 1,965 fully sequenced genomes from 756 multiplex families. Alterations were encoded into binary matrices for ASD (case) and unaffected (control) samples, indicating likely gene-disrupting, inherited mutations in altered genes. To determine individual gene contributions given an ASD phenotype, a "player" metric, referred to as the Shapley value, was calculated for each gene in the case and control cohorts. Sixty seven genes were found to have significantly elevated player scores and likely represent significant contributors to the genetic coordination underlying ASD. Using network and cross-study analysis, we found that these genes are involved in biological pathways known to be affected in the autism cases and that a subset directly interact with several genes known to have strong associations to autism. These findings suggest that coalitional game theory can be applied to large-scale genomic data to identify hidden yet influential players in complex polygenic disorders such as autism.

  8. Comparative Transcriptome Analysis Identifies Candidate Genes Related to Skin Color Differentiation in Red Tilapia.

    Science.gov (United States)

    Zhu, Wenbin; Wang, Lanmei; Dong, Zaijie; Chen, Xingting; Song, Feibiao; Liu, Nian; Yang, Hui; Fu, Jianjun

    2016-08-11

    Red tilapia is becoming more popular for aquaculture production in China in recent years. However, the pigmentation differentiation in genetic breeding is the main problem limiting its development of commercial red tilapia culture and the genetic basis of skin color variation is still unknown. In this study, we conducted Illumina sequencing of transcriptome on three color variety red tilapia. A total of 224,895,758 reads were generated, resulting in 160,762 assembled contigs that were used as reference contigs. The contigs of red tilapia transcriptome had hits in the range of 53.4% to 86.7% of the unique proteins of zebrafish, fugu, medaka, three-spined stickleback and tilapia. And 44,723 contigs containing 77,423 simple sequence repeats (SSRs) were identified, with 16,646 contigs containing more than one SSR. Three skin transcriptomes were compared pairwise and the results revealed that there were 148 common significantly differentially expressed unigenes and several key genes related to pigment synthesis, i.e. tyr, tyrp1, silv, sox10, slc24a5, cbs and slc7a11, were included. The results will facilitate understanding the molecular mechanisms of skin pigmentation differentiation in red tilapia and accelerate the molecular selection of the specific strain with consistent skin colors.

  9. Candidate chemosensory genes identified in the endoparasitoid Meteorus pulchricornis (Hymenoptera: Braconidae) by antennal transcriptome analysis.

    Science.gov (United States)

    Sheng, Sheng; Liao, Cheng-Wu; Zheng, Yu; Zhou, Yu; Xu, Yan; Song, Wen-Miao; He, Peng; Zhang, Jian; Wu, Fu-An

    2017-06-01

    Meteorus pulchricornis is an endoparasitoid wasp which attacks the larvae of various lepidopteran pests. We present the first antennal transcriptome dataset for M. pulchricornis. A total of 48,845,072 clean reads were obtained and 34,967 unigenes were assembled. Of these, 15,458 unigenes showed a significant similarity (E-value <10 -5 ) to known proteins in the NCBI non-redundant protein database. Gene ontology (GO) and cluster of orthologous groups (COG) analyses were used to classify the functions of M. pulchricornis antennae genes. We identified 16 putative odorant-binding protein (OBP) genes, eight chemosensory protein (CSP) genes, 99 olfactory receptor (OR) genes, 19 ionotropic receptor (IR) genes and one sensory neuron membrane protein (SNMP) gene. BLASTx best hit results and phylogenetic analysis both indicated that these chemosensory genes were most closely related to those found in other hymenopteran species. Real-time quantitative PCR assays showed that 14 MpulOBP genes were antennae-specific. Of these, MpulOBP6, MpulOBP9, MpulOBP10, MpulOBP12, MpulOBP15 and MpulOBP16 were found to have greater expression in the antennae than in other body parts, while MpulOBP2 and MpulOBP3 were expressed predominately in the legs and abdomens, respectively. These results might provide a foundation for future studies of olfactory genes and chemoreception in M. pulchricornis. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Comparison of Expression Profiles in Ovarian Epithelium In Vivo and Ovarian Cancer Identifies Novel Candidate Genes Involved in Disease Pathogenesis

    Science.gov (United States)

    Emmanuel, Catherine; Gava, Natalie; Kennedy, Catherine; Balleine, Rosemary L.; Sharma, Raghwa; Wain, Gerard; Brand, Alison; Hogg, Russell; Etemadmoghadam, Dariush; George, Joshy; Birrer, Michael J.; Clarke, Christine L.; Chenevix-Trench, Georgia; Bowtell, David D. L.; Harnett, Paul R.; deFazio, Anna

    2011-01-01

    Molecular events leading to epithelial ovarian cancer are poorly understood but ovulatory hormones and a high number of life-time ovulations with concomitant proliferation, apoptosis, and inflammation, increases risk. We identified genes that are regulated during the estrous cycle in murine ovarian surface epithelium and analysed these profiles to identify genes dysregulated in human ovarian cancer, using publically available datasets. We identified 338 genes that are regulated in murine ovarian surface epithelium during the estrous cycle and dysregulated in ovarian cancer. Six of seven candidates selected for immunohistochemical validation were expressed in serous ovarian cancer, inclusion cysts, ovarian surface epithelium and in fallopian tube epithelium. Most were overexpressed in ovarian cancer compared with ovarian surface epithelium and/or inclusion cysts (EpCAM, EZH2, BIRC5) although BIRC5 and EZH2 were expressed as highly in fallopian tube epithelium as in ovarian cancer. We prioritised the 338 genes for those likely to be important for ovarian cancer development by in silico analyses of copy number aberration and mutation using publically available datasets and identified genes with established roles in ovarian cancer as well as novel genes for which we have evidence for involvement in ovarian cancer. Chromosome segregation emerged as an important process in which genes from our list of 338 were over-represented including two (BUB1, NCAPD2) for which there is evidence of amplification and mutation. NUAK2, upregulated in ovarian surface epithelium in proestrus and predicted to have a driver mutation in ovarian cancer, was examined in a larger cohort of serous ovarian cancer where patients with lower NUAK2 expression had shorter overall survival. In conclusion, defining genes that are activated in normal epithelium in the course of ovulation that are also dysregulated in cancer has identified a number of pathways and novel candidate genes that may contribute

  11. Comparative transcriptome analysis of stylar canal cells identifies novel candidate genes implicated in the self-incompatibility response of Citrus clementina

    Directory of Open Access Journals (Sweden)

    Caruso Marco

    2012-02-01

    Full Text Available Abstract Background Reproductive biology in citrus is still poorly understood. Although in recent years several efforts have been made to study pollen-pistil interaction and self-incompatibility, little information is available about the molecular mechanisms regulating these processes. Here we report the identification of candidate genes involved in pollen-pistil interaction and self-incompatibility in clementine (Citrus clementina Hort. ex Tan.. These genes have been identified comparing the transcriptomes of laser-microdissected stylar canal cells (SCC isolated from two genotypes differing for self-incompatibility response ('Comune', a self-incompatible cultivar and 'Monreal', a self- compatible mutation of 'Comune'. Results The transcriptome profiling of SCC indicated that the differential regulation of few specific, mostly uncharacterized transcripts is associated with the breakdown of self-incompatibility in 'Monreal'. Among them, a novel F-box gene showed a drastic up-regulation both in laser microdissected stylar canal cells and in self-pollinated whole styles with stigmas of 'Comune' in concomitance with the arrest of pollen tube growth. Moreover, we identify a non-characterized gene family as closely associated to the self-incompatibility genetic program activated in 'Comune'. Three different aspartic-acid rich (Asp-rich protein genes, located in tandem in the clementine genome, were over-represented in the transcriptome of 'Comune'. These genes are tightly linked to a DELLA gene, previously found to be up-regulated in the self-incompatible genotype during pollen-pistil interaction. Conclusion The highly specific transcriptome survey of the stylar canal cells identified novel genes which have not been previously associated with self-pollen rejection in citrus and in other plant species. Bioinformatic and transcriptional analyses suggested that the mutation leading to self-compatibility in 'Monreal' affected the expression of non

  12. adaptation of introduced mungbean genotypes in uganda abstract

    African Journals Online (AJOL)

    ACSS

    locations in Uganda, to determine the adaptability of introduced mungbean genotypes, and identify ... The six test multi-locations were grouped into two candidate mega-environments for ..... interactions: Challenges and opportunities for.

  13. Evaluation of multiple approaches to identify genome-wide polymorphisms in closely related genotypes of sweet cherry (Prunus avium L.

    Directory of Open Access Journals (Sweden)

    Seanna Hewitt

    Full Text Available Identification of genetic polymorphisms and subsequent development of molecular markers is important for marker assisted breeding of superior cultivars of economically important species. Sweet cherry (Prunus avium L. is an economically important non-climacteric tree fruit crop in the Rosaceae family and has undergone a genetic bottleneck due to breeding, resulting in limited genetic diversity in the germplasm that is utilized for breeding new cultivars. Therefore, it is critical to recognize the best platforms for identifying genome-wide polymorphisms that can help identify, and consequently preserve, the diversity in a genetically constrained species. For the identification of polymorphisms in five closely related genotypes of sweet cherry, a gel-based approach (TRAP, reduced representation sequencing (TRAPseq, a 6k cherry SNParray, and whole genome sequencing (WGS approaches were evaluated in the identification of genome-wide polymorphisms in sweet cherry cultivars. All platforms facilitated detection of polymorphisms among the genotypes with variable efficiency. In assessing multiple SNP detection platforms, this study has demonstrated that a combination of appropriate approaches is necessary for efficient polymorphism identification, especially between closely related cultivars of a species. The information generated in this study provides a valuable resource for future genetic and genomic studies in sweet cherry, and the insights gained from the evaluation of multiple approaches can be utilized for other closely related species with limited genetic diversity in the breeding germplasm. Keywords: Polymorphisms, Prunus avium, Next-generation sequencing, Target region amplification polymorphism (TRAP, Genetic diversity, SNParray, Reduced representation sequencing, Whole genome sequencing (WGS

  14. Proteomic analysis of cerebrospinal fluid from children with central nervous system tumors identifies candidate proteins relating to tumor metastatic spread.

    Science.gov (United States)

    Spreafico, Filippo; Bongarzone, Italia; Pizzamiglio, Sara; Magni, Ruben; Taverna, Elena; De Bortoli, Maida; Ciniselli, Chiara M; Barzanò, Elena; Biassoni, Veronica; Luchini, Alessandra; Liotta, Lance A; Zhou, Weidong; Signore, Michele; Verderio, Paolo; Massimino, Maura

    2017-07-11

    Central nervous system (CNS) tumors are the most common solid tumors in childhood. Since the sensitivity of combined cerebrospinal fluid (CSF) cytology and radiological neuroimaging in detecting meningeal metastases remains relatively low, we sought to characterize the CSF proteome of patients with CSF tumors to identify biomarkers predictive of metastatic spread. CSF samples from 27 children with brain tumors and 13 controls (extra-CNS non-Hodgkin lymphoma) were processed using core-shell hydrogel nanoparticles, and analyzed with reverse-phase liquid chromatography/electrospray tandem mass spectrometry (LC-MS/MS). Candidate proteins were identified with Fisher's exact test and/or a univariate logistic regression model. Reverse phase protein array (RPPA), Western blot (WB), and ELISA were used in the training set and in an independent set of CFS samples (60 cases, 14 controls) to validate our discovery findings. Among the 558 non-redundant proteins identified by LC-MS/MS, 147 were missing from the CSF database at http://www.biosino.org. Fourteen of the 26 final top-candidate proteins were chosen for validation with WB, RPPA and ELISA methods. Six proteins (type 1 collagen, insulin-like growth factor binding protein 4, procollagen C-endopeptidase enhancer 1, glial cell-line derived neurotrophic factor receptor α2, inter-alpha-trypsin inhibitor heavy chain 4, neural proliferation and differentiation control protein-1) revealed the ability to discriminate metastatic cases from controls. Combining a unique dataset of CSFs from pediatric CNS tumors with a novel enabling nanotechnology led us to identify CSF proteins potentially related to metastatic status.

  15. Genome-Wide Association Study Identifies Loci for Salt Tolerance during Germination in Autotetraploid Alfalfa (Medicago sativa L.) Using Genotyping-by-Sequencing

    Science.gov (United States)

    Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping

    2016-01-01

    Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses. PMID:27446182

  16. Exome Genotyping Identifies Pleiotropic Variants Associated with Red Blood Cell Traits

    DEFF Research Database (Denmark)

    Chami, Nathalie; Chen, Ming-Huei; Slater, Andrew J

    2016-01-01

    array. After conditional analyses and replication in 27,480 independent individuals, we identified 16 new RBC variants. We found low-frequency missense variants in MAP1A (rs55707100, minor allele frequency [MAF] = 3.3%, p = 2 × 10(-10) for hemoglobin [HGB]) and HNF4A (rs1800961, MAF = 2.4%, p

  17. Large-scale genotyping identifies 41 new loci associated with breast cancer risk

    DEFF Research Database (Denmark)

    Michailidou, Kyriaki; Hall, Per; Gonzalez-Neira, Anna

    2013-01-01

    Breast cancer is the most common cancer among women. Common variants at 27 loci have been identified as associated with susceptibility to breast cancer, and these account for ∼9% of the familial risk of the disease. We report here a meta-analysis of 9 genome-wide association studies, including 10...

  18. Large-scale genotyping identifies 41 new loci associated with breast cancer risk

    NARCIS (Netherlands)

    Michailidou, Kyriaki; Hall, Per; Gonzalez-Neira, Anna; Ghoussaini, Maya; Dennis, Joe; Milne, Roger L.; Schmidt, Marjanka K.; Chang-Claude, Jenny; Bojesen, Stig E.; Bolla, Manjeet K.; Wang, Qin; Dicks, Ed; Lee, Andrew; Turnbull, Clare; Rahman, Nazneen; Fletcher, Olivia; Peto, Julian; Gibson, Lorna; dos Santos Silva, Isabel; Nevanlinna, Heli; Muranen, Taru A.; Aittomäki, Kristiina; Blomqvist, Carl; Czene, Kamila; Irwanto, Astrid; Liu, Jianjun; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel; van der Luijt, Rob B.; Hein, Rebecca; Dahmen, Norbert; Beckman, Lars; Meindl, Alfons; Schmutzler, Rita K.; Müller-Myhsok, Bertram; Lichtner, Peter; Hopper, John L.; Southey, Melissa C.; Makalic, Enes; Schmidt, Daniel F.; Uitterlinden, Andre G.; Hofman, Albert; Hunter, David J.; Chanock, Stephen J.; Vincent, Daniel; Bacot, François; Tessier, Daniel C.; Canisius, Sander; Wessels, Lodewyk F. A.; Haiman, Christopher A.; Shah, Mitul; Luben, Robert; Brown, Judith; Luccarini, Craig; Schoof, Nils; Humphreys, Keith; Li, Jingmei; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Couch, Fergus J.; Wang, Xianshu; Vachon, Celine; Stevens, Kristen N.; Lambrechts, Diether; Moisse, Matthieu; Paridaens, Robert; Christiaens, Marie-Rose; Rudolph, Anja; Nickels, Stefan; Flesch-Janys, Dieter; Johnson, Nichola; Aitken, Zoe; Aaltonen, Kirsimari; Heikkinen, Tuomas; Broeks, Annegien; van 't Veer, Laura J.; van der Schoot, C. Ellen; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Menegaux, Florence; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Burwinkel, Barbara; Zamora, M. Pilar; Perez, Jose Ignacio Arias; Pita, Guillermo; Alonso, M. Rosario; Cox, Angela; Brock, Ian W.; Cross, Simon S.; Reed, Malcolm W. R.; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Mulligan, Anna Marie; Lindblom, Annika; Margolin, Sara; Hooning, Maartje J.; Hollestelle, Antoinette; van den Ouweland, Ans M. W.; Jager, Agnes; Bui, Quang M.; Stone, Jennifer; Dite, Gillian S.; Apicella, Carmel; Tsimiklis, Helen; Giles, Graham G.; Severi, Gianluca; Baglietto, Laura; Fasching, Peter A.; Haeberle, Lothar; Ekici, Arif B.; Beckmann, Matthias W.; Brenner, Hermann; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Brauch, Hiltrud; Hamann, Ute; Brüning, Thomas; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bonanni, Bernardo; Devilee, Peter; Tollenaar, Rob A. E. M.; Seynaeve, Caroline; van Asperen, Christi J.; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Bogdanova, Natalia V.; Antonenkova, Natalia N.; Dörk, Thilo; Kristensen, Vessela N.; Anton-Culver, Hoda; Slager, Susan; Toland, Amanda E.; Edge, Stephen; Fostira, Florentia; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Sueta, Aiko; Wu, Anna H.; Tseng, Chiu-Chen; van den Berg, David; Stram, Daniel O.; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; teo, Soo Hwang; Yip, Cheng Har; Phuah, Sze Yee; Cornes, Belinda K.; Hartman, Mikael; Miao, Hui; Lim, Wei Yen; Sng, Jen-Hwei; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Ding, Shian-Ling; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Blot, William J.; Signorello, Lisa B.; Cai, Qiuyin; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha; Long, Jirong; Simard, Jacques; Garcia-Closas, Montse; Pharoah, Paul D. P.; Chenevix-Trench, Georgia; Dunning, Alison M.; Benitez, Javier; Easton, Douglas F.

    2013-01-01

    Breast cancer is the most common cancer among women. Common variants at 27 loci have been identified as associated with susceptibility to breast cancer, and these account for ∼9% of the familial risk of the disease. We report here a meta-analysis of 9 genome-wide association studies, including

  19. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color.

    Science.gov (United States)

    Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N

    2013-06-03

    Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

  20. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

    Science.gov (United States)

    2013-01-01

    Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

  1. Identifying the candidate genes involved in the calyx abscission process of 'Kuerlexiangli' (Pyrus sinkiangensis Yu) by digital transcript abundance measurements.

    Science.gov (United States)

    Qi, Xiaoxiao; Wu, Jun; Wang, Lifen; Li, Leiting; Cao, Yufen; Tian, Luming; Dong, Xingguang; Zhang, Shaoling

    2013-10-23

    'Kuerlexiangli' (Pyrus sinkiangensis Yu), a native pear of Xinjiang, China, is an important agricultural fruit and primary export to the international market. However, fruit with persistent calyxes affect fruit shape and quality. Although several studies have looked into the physiological aspects of the calyx abscission process, the underlying molecular mechanisms remain unknown. In order to better understand the molecular basis of the process of calyx abscission, materials at three critical stages of regulation, with 6000 × Flusilazole plus 300 × PBO treatment (calyx abscising treatment) and 50 mg.L-1GA3 treatment (calyx persisting treatment), were collected and cDNA fragments were sequenced using digital transcript abundance measurements to identify candidate genes. Digital transcript abundance measurements was performed using high-throughput Illumina GAII sequencing on seven samples that were collected at three important stages of the calyx abscission process with chemical agent treatments promoting calyx abscission and persistence. Altogether more than 251,123,845 high quality reads were obtained with approximately 8.0 M raw data for each library. The values of 69.85%-71.90% of clean data in the digital transcript abundance measurements could be mapped to the pear genome database. There were 12,054 differentially expressed genes having Gene Ontology (GO) terms and associating with 251 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. The differentially expressed genes correlated with calyx abscission were mainly involved in photosynthesis, plant hormone signal transduction, cell wall modification, transcriptional regulation, and carbohydrate metabolism. Furthermore, candidate calyx abscission-specific genes, e.g. Inflorescence deficient in abscission gene, were identified. Quantitative real-time PCR was used to confirm the digital transcript abundance measurements results. We identified candidate genes that showed highly dynamic changes in

  2. Expression and functional assessment of candidate type 2 diabetes susceptibility genes identify four new genes contributing to human insulin secretion

    Directory of Open Access Journals (Sweden)

    Fatou K. Ndiaye

    2017-06-01

    Full Text Available Objectives: Genome-wide association studies (GWAS have identified >100 loci independently contributing to type 2 diabetes (T2D risk. However, translational implications for precision medicine and for the development of novel treatments have been disappointing, due to poor knowledge of how these loci impact T2D pathophysiology. Here, we aimed to measure the expression of genes located nearby T2D associated signals and to assess their effect on insulin secretion from pancreatic beta cells. Methods: The expression of 104 candidate T2D susceptibility genes was measured in a human multi-tissue panel, through PCR-free expression assay. The effects of the knockdown of beta-cell enriched genes were next investigated on insulin secretion from the human EndoC-βH1 beta-cell line. Finally, we performed RNA-sequencing (RNA-seq so as to assess the pathways affected by the knockdown of the new genes impacting insulin secretion from EndoC-βH1, and we analyzed the expression of the new genes in mouse models with altered pancreatic beta-cell function. Results: We found that the candidate T2D susceptibility genes' expression is significantly enriched in pancreatic beta cells obtained by laser capture microdissection or sorted by flow cytometry and in EndoC-βH1 cells, but not in insulin sensitive tissues. Furthermore, the knockdown of seven T2D-susceptibility genes (CDKN2A, GCK, HNF4A, KCNK16, SLC30A8, TBC1D4, and TCF19 with already known expression and/or function in beta cells changed insulin secretion, supporting our functional approach. We showed first evidence for a role in insulin secretion of four candidate T2D-susceptibility genes (PRC1, SRR, ZFAND3, and ZFAND6 with no previous knowledge of presence and function in beta cells. RNA-seq in EndoC-βH1 cells with decreased expression of PRC1, SRR, ZFAND6, or ZFAND3 identified specific gene networks related to T2D pathophysiology. Finally, a positive correlation between the expression of Ins2 and the

  3. Candidate exome capture identifies mutation of SDCCAG8 as the cause of a retinal-renal ciliopathy.

    NARCIS (Netherlands)

    Otto, E.A.; Hurd, T.W.; Airik, R.; Chaki, M.; Zhou, W.; Stoetzel, C.; Patil, S.B.; Levy, S.; Ghosh, A.K.; Murga-Zamalloa, C.A.; Reeuwijk, J. van; Letteboer, S.J.F.; Sang, L.; Giles, R.H.; Liu, Q.; Coene, K.L.M.; Estrada-Cuzcano, A.; Collin, R.W.J.; McLaughlin, H.M.; Held, S.; Kasanuki, J.M.; Ramaswami, G.; Conte, J.; Lopez, I.; Washburn, J.; Macdonald, J.; Hu, J.; Yamashita, Y.; Maher, E.R.; Guay-Woodford, L.M.; Neumann, H.P.; Obermuller, N.; Koenekoop, R.K.; Bergmann, C.; Bei, X.; Lewis, R.A.; Katsanis, N.; Lopes, V.; Williams, D.S.; Lyons, R.H.; Dang, C.V.; Brito, D.A.; Dias, M.B.; Zhang, X.; Cavalcoli, J.D.; Nurnberg, G.; Nurnberg, P.; Pierce, E.A.; Jackson, P.K.; Antignac, C.; Saunier, S.; Roepman, R.; Dollfus, H.; Khanna, H.; Hildebrandt, F.

    2010-01-01

    Nephronophthisis-related ciliopathies (NPHP-RC) are recessive disorders that feature dysplasia or degeneration occurring preferentially in the kidney, retina and cerebellum. Here we combined homozygosity mapping with candidate gene analysis by performing 'ciliopathy candidate exome capture' followed

  4. Galactosemia: A strategy to identify new biochemical phenotypes and molecular genotypes

    Energy Technology Data Exchange (ETDEWEB)

    Elsas, L.J.; Langley, S.; Steele, E.; Evinger, J.; Brown, A.; Singh, R.; Fernhoff, P.; Hjelm, L.N.; Dembure, P.P.; Fridovich-Keil, J.L. [Emory Univ. School of Medicine, Atlanta, GA (United States)

    1995-03-01

    We describe a stratagem for identifying new mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. GALT enzyme activity and isoforms were defined in erythrocytes from probands and their first-degree relatives. If the biochemical phenotypes segregated in an autosomal recesssive pattern, we screened for common mutations by using multiplex PCR and restriction endonuclease digestions. If common mutant alleles were not present, the 11 exons of the GALT gene were amplified by PCR, and variations from the normal nucleotide sequences were identified by SSCP. The suspected region(s) was then analyzed by direct DNA sequencing. We identified 86 mutant GALT alleles that reduced erythrocyte GALT activity. Seventy-five of these GALT genomes had abnormal SSCP patterns, of which 41 were sequenced, yielding 12 new and 21 previously reported, rare mutations. Among the novel group of 12 new mutations, an unusual biochemical phenotype was found in a family whose newborn proband has classical galactosemia. He had inherited two mutations in cis (N314D-E204K) from his father, whose GALT activity was near normal, and an additional GALT mutation in the splice-acceptor site of intron C (IVSC) from his mother. The substitution of a positively charged E204K mutation created a unique isoform-banding pattern. An asymptomatic sister`s GALT genes carries three mutations (E203K-N314D/N314D) with eight distinct isoform bands. Surprisingly, her erythrocytes have normal GALT activity. We conclude that the synergism of pedigree, biochemical, SSCP, and direct GALT gene analyses is an efficient protocol for identifying new mutations and speculate that E203K and N314D codon changes produce intra-allelic complementation when in cis. 40 refs., 4 figs., 3 tabs.

  5. Effect modification of air pollution on Urinary 8-Hydroxy-2'-Deoxyguanosine by genotypes: an application of the multiple testing procedure to identify significant SNP interactions

    Directory of Open Access Journals (Sweden)

    Christiani David C

    2010-12-01

    Full Text Available Abstract Background Air pollution is associated with adverse human health, but mechanisms through which pollution exerts effects remain to be clarified. One suggested pathway is that pollution causes oxidative stress. If so, oxidative stress-related genotypes may modify the oxidative response defenses to pollution exposure. Methods We explored the potential pathway by examining whether an array of oxidative stress-related genes (twenty single nucleotide polymorphisms, SNPs in nine genes modified associations of pollutants (organic carbon (OC, ozone and sulfate with urinary 8-hydroxy-2-deoxygunosine (8-OHdG, a biomarker of oxidative stress among the 320 aging men. We used a Multiple Testing Procedure in R modified by our team to identify the significance of the candidate genes adjusting for a priori covariates. Results We found that glutathione S-tranferase P1 (GSTP1, rs1799811, M1 and catalase (rs2284367 and group-specific component (GC, rs2282679, rs1155563 significantly or marginally significantly modified effects of OC and/or sulfate with larger effects among those carrying the wild type of GSTP1, catalase, non-wild type of GC and the non-null of GSTM1. Conclusions Polymorphisms of oxidative stress-related genes modified effects of OC and/or sulfate on 8-OHdG, suggesting that effects of OC or sulfate on 8-OHdG and other endpoints may be through the oxidative stress pathway.

  6. Rapid and sensitive method to identify Mycobacterium avium subsp. paratuberculosis in cow's milk by DNA methylase genotyping.

    Science.gov (United States)

    Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José; Lopez, Osvaldo Jorge

    2013-03-01

    Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time.

  7. High-density genotyping of immune loci in Koreans and Europeans identifies eight new rheumatoid arthritis risk loci.

    Science.gov (United States)

    Kim, Kwangwoo; Bang, So-Young; Lee, Hye-Soon; Cho, Soo-Kyung; Choi, Chan-Bum; Sung, Yoon-Kyoung; Kim, Tae-Hwan; Jun, Jae-Bum; Yoo, Dae Hyun; Kang, Young Mo; Kim, Seong-Kyu; Suh, Chang-Hee; Shim, Seung-Cheol; Lee, Shin-Seok; Lee, Jisoo; Chung, Won Tae; Choe, Jung-Yoon; Shin, Hyoung Doo; Lee, Jong-Young; Han, Bok-Ghee; Nath, Swapan K; Eyre, Steve; Bowes, John; Pappas, Dimitrios A; Kremer, Joel M; Gonzalez-Gay, Miguel A; Rodriguez-Rodriguez, Luis; Ärlestig, Lisbeth; Okada, Yukinori; Diogo, Dorothée; Liao, Katherine P; Karlson, Elizabeth W; Raychaudhuri, Soumya; Rantapää-Dahlqvist, Solbritt; Martin, Javier; Klareskog, Lars; Padyukov, Leonid; Gregersen, Peter K; Worthington, Jane; Greenberg, Jeffrey D; Plenge, Robert M; Bae, Sang-Cheol

    2015-03-01

    A highly polygenic aetiology and high degree of allele-sharing between ancestries have been well elucidated in genetic studies of rheumatoid arthritis. Recently, the high-density genotyping array Immunochip for immune disease loci identified 14 new rheumatoid arthritis risk loci among individuals of European ancestry. Here, we aimed to identify new rheumatoid arthritis risk loci using Korean-specific Immunochip data. We analysed Korean rheumatoid arthritis case-control samples using the Immunochip and genome-wide association studies (GWAS) array to search for new risk alleles of rheumatoid arthritis with anticitrullinated peptide antibodies. To increase power, we performed a meta-analysis of Korean data with previously published European Immunochip and GWAS data for a total sample size of 9299 Korean and 45,790 European case-control samples. We identified eight new rheumatoid arthritis susceptibility loci (TNFSF4, LBH, EOMES, ETS1-FLI1, COG6, RAD51B, UBASH3A and SYNGR1) that passed a genome-wide significance threshold (p<5×10(-8)), with evidence for three independent risk alleles at 1q25/TNFSF4. The risk alleles from the seven new loci except for the TNFSF4 locus (monomorphic in Koreans), together with risk alleles from previously established RA risk loci, exhibited a high correlation of effect sizes between ancestries. Further, we refined the number of single nucleotide polymorphisms (SNPs) that represent potentially causal variants through a trans-ethnic comparison of densely genotyped SNPs. This study demonstrates the advantage of dense-mapping and trans-ancestral analysis for identification of potentially causal SNPs. In addition, our findings support the importance of T cells in the pathogenesis and the fact of frequent overlap of risk loci among diverse autoimmune diseases. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  8. A follow-up study for left ventricular mass on chromosome 12p11 identifies potential candidate genes

    Directory of Open Access Journals (Sweden)

    Slifer Susan

    2011-07-01

    Full Text Available Abstract Background Left ventricular mass (LVM is an important risk factor for cardiovascular disease. Previously we found evidence for linkage to chromosome 12p11 in Dominican families, with a significant increase in a subset of families with high average waist circumference (WC. In the present study, we use association analysis to further study the genetic effect on LVM. Methods Association analysis with LVM was done in the one LOD critical region of the linkage peak in an independent sample of 897 Caribbean Hispanics. Genotype data were available on 7085 SNPs from 23 to 53 MB on chromosome 12p11. Adjustment was made for vascular risk factors and population substructure using an additive genetic model. Subset analysis by WC was performed to test for a difference in genetic effects between the high and low WC subsets. Results In the overall analysis, the most significant association was found to rs10743465, downstream of the SOX5 gene (p = 1.27E-05. Also, 19 additional SNPs had nominal p TMTC1. Twelve additional SNPs in or near 6 genes had p Conclusions The current study supports previously identified evidence by linkage for a genetic effect on LVM on chromosome 12p11 using association analysis in population-based Caribbean Hispanic cohort. SOX5 may play an important role in the regulation of LVM. An interaction of TMTC1 with abdominal obesity may contribute to phenotypic variation of LVM.

  9. Global analysis of WRKY transcription factor superfamily in Setaria identifies potential candidates involved in abiotic stress signalling

    Directory of Open Access Journals (Sweden)

    Mehanathan eMuthamilarasan

    2015-10-01

    Full Text Available Transcription factors (TFs are major players in stress signalling and constitute an integral part of signalling networks. Among the major TFs, WRKY proteins play pivotal roles in regulation of transcriptional reprogramming associated with stress responses. In view of this, genome- and transcriptome-wide identification of WRKY TF family was performed in the C4 model plants, Setaria italica (SiWRKY and S. viridis (SvWRKY, respectively. The study identified 105 SiWRKY and 44 SvWRKY proteins that were computationally analysed for their physicochemical properties. Sequence alignment and phylogenetic analysis classified these proteins into three major groups, namely I, II and III with majority of WRKY proteins belonging to group II (53 SiWRKY and 23 SvWRKY, followed by group III (39 SiWRKY and 11 SvWRKY and group I (10 SiWRKY and 6 SvWRKY. Group II proteins were further classified into 5 subgroups (IIa to IIe based on their phylogeny. Domain analysis showed the presence of WRKY motif and zinc finger-like structures in these proteins along with additional domains in a few proteins. All SiWRKY genes were physically mapped on the S. italica genome and their duplication analysis revealed that 10 and 8 gene pairs underwent tandem and segmental duplications, respectively. Comparative mapping of SiWRKY and SvWRKY genes in related C4 panicoid genomes demonstrated the orthologous relationships between these genomes. In silico expression analysis of SiWRKY and SvWRKY genes showed their differential expression patterns in different tissues and stress conditions. Expression profiling of candidate SiWRKY genes in response to stress (dehydration and salinity and hormone treatments (abscisic acid, salicylic acid and methyl jasmonate suggested the putative involvement of SiWRKY066 and SiWRKY082 in stress and hormone signalling. These genes could be potential candidates for further characterization to delineate their functional roles in abiotic stress signalling.

  10. Global analysis of WRKY transcription factor superfamily in Setaria identifies potential candidates involved in abiotic stress signaling.

    Science.gov (United States)

    Muthamilarasan, Mehanathan; Bonthala, Venkata S; Khandelwal, Rohit; Jaishankar, Jananee; Shweta, Shweta; Nawaz, Kashif; Prasad, Manoj

    2015-01-01

    Transcription factors (TFs) are major players in stress signaling and constitute an integral part of signaling networks. Among the major TFs, WRKY proteins play pivotal roles in regulation of transcriptional reprogramming associated with stress responses. In view of this, genome- and transcriptome-wide identification of WRKY TF family was performed in the C4model plants, Setaria italica (SiWRKY) and S. viridis (SvWRKY), respectively. The study identified 105 SiWRKY and 44 SvWRKY proteins that were computationally analyzed for their physicochemical properties. Sequence alignment and phylogenetic analysis classified these proteins into three major groups, namely I, II, and III with majority of WRKY proteins belonging to group II (53 SiWRKY and 23 SvWRKY), followed by group III (39 SiWRKY and 11 SvWRKY) and group I (10 SiWRKY and 6 SvWRKY). Group II proteins were further classified into 5 subgroups (IIa to IIe) based on their phylogeny. Domain analysis showed the presence of WRKY motif and zinc finger-like structures in these proteins along with additional domains in a few proteins. All SiWRKY genes were physically mapped on the S. italica genome and their duplication analysis revealed that 10 and 8 gene pairs underwent tandem and segmental duplications, respectively. Comparative mapping of SiWRKY and SvWRKY genes in related C4 panicoid genomes demonstrated the orthologous relationships between these genomes. In silico expression analysis of SiWRKY and SvWRKY genes showed their differential expression patterns in different tissues and stress conditions. Expression profiling of candidate SiWRKY genes in response to stress (dehydration and salinity) and hormone treatments (abscisic acid, salicylic acid, and methyl jasmonate) suggested the putative involvement of SiWRKY066 and SiWRKY082 in stress and hormone signaling. These genes could be potential candidates for further characterization to delineate their functional roles in abiotic stress signaling.

  11. A multicopy suppressor screening approach as a means to identify antibiotic resistance determinant candidates in Yersinia pestis

    Directory of Open Access Journals (Sweden)

    Moy Richard L

    2008-07-01

    Full Text Available Abstract Background Yersinia pestis is the causative agent of plague and a potential agent of bioterrorism and biowarfare. The plague biothreat and the emergence of multidrug-resistant plague underscore the need to increase our understanding of the intrinsic potential of Y. pestis for developing antimicrobial resistance and to anticipate the mechanisms of resistance that may emerge in Y. pestis. Identification of Y. pestis genes that, when overexpressed, are capable of reducing antibiotic susceptibility is a useful strategy to expose genes that this pathogen may rely upon to evolve antibiotic resistance via a vertical modality. In this study, we explored the use of a multicopy suppressor, Escherichia coli host-based screening approach as a means to expose antibiotic resistance determinant candidates in Y. pestis. Results We constructed a multicopy plasmid-based, Y. pestis genome-wide expression library of nearly 16,000 clones in E. coli and screened the library for suppressors of the antimicrobial activity of ofloxacin, a fluoroquinolone antibiotic. The screen permitted the identification of a transcriptional regulator-encoding gene (robAYp that increased the MIC99 of ofloxacin by 23-fold when overexpressed from a multicopy plasmid in Y. pestis. Additionally, we found that robAYp overexpression in Y. pestis conferred low-level resistance to many other antibiotics and increased organic solvent tolerance. Overexpression of robAYp also upregulated the expression of several efflux pumps in Y. pestis. Conclusion Our study provides proof of principle for the use of multicopy suppressor screening based on the tractable and easy-to-manipulate E. coli host as a means to identify antibiotic resistance determinant candidates of Y. pestis.

  12. Global analysis of WRKY transcription factor superfamily in Setaria identifies potential candidates involved in abiotic stress signaling

    Science.gov (United States)

    Muthamilarasan, Mehanathan; Bonthala, Venkata S.; Khandelwal, Rohit; Jaishankar, Jananee; Shweta, Shweta; Nawaz, Kashif; Prasad, Manoj

    2015-01-01

    Transcription factors (TFs) are major players in stress signaling and constitute an integral part of signaling networks. Among the major TFs, WRKY proteins play pivotal roles in regulation of transcriptional reprogramming associated with stress responses. In view of this, genome- and transcriptome-wide identification of WRKY TF family was performed in the C4model plants, Setaria italica (SiWRKY) and S. viridis (SvWRKY), respectively. The study identified 105 SiWRKY and 44 SvWRKY proteins that were computationally analyzed for their physicochemical properties. Sequence alignment and phylogenetic analysis classified these proteins into three major groups, namely I, II, and III with majority of WRKY proteins belonging to group II (53 SiWRKY and 23 SvWRKY), followed by group III (39 SiWRKY and 11 SvWRKY) and group I (10 SiWRKY and 6 SvWRKY). Group II proteins were further classified into 5 subgroups (IIa to IIe) based on their phylogeny. Domain analysis showed the presence of WRKY motif and zinc finger-like structures in these proteins along with additional domains in a few proteins. All SiWRKY genes were physically mapped on the S. italica genome and their duplication analysis revealed that 10 and 8 gene pairs underwent tandem and segmental duplications, respectively. Comparative mapping of SiWRKY and SvWRKY genes in related C4 panicoid genomes demonstrated the orthologous relationships between these genomes. In silico expression analysis of SiWRKY and SvWRKY genes showed their differential expression patterns in different tissues and stress conditions. Expression profiling of candidate SiWRKY genes in response to stress (dehydration and salinity) and hormone treatments (abscisic acid, salicylic acid, and methyl jasmonate) suggested the putative involvement of SiWRKY066 and SiWRKY082 in stress and hormone signaling. These genes could be potential candidates for further characterization to delineate their functional roles in abiotic stress signaling. PMID:26635818

  13. Genome‐wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma

    Science.gov (United States)

    Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R.; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J.; Almutairi, Bader; Etchevers, Heather C.; McConville, Carmel; Malik, Karim T. A.

    2016-01-01

    Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome‐wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome‐wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down‐regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest‐expressing tumors had reduced relapse‐free survival. Our functional studies showed that knock‐down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. PMID:27862318

  14. A genome-wide association study identifies candidate loci associated to syringomyelia secondary to Chiari-like malformation in Cavalier King Charles Spaniels.

    Science.gov (United States)

    Ancot, Frédéric; Lemay, Philippe; Knowler, Susan P; Kennedy, Karen; Griffiths, Sandra; Cherubini, Giunio Bruto; Sykes, Jane; Mandigers, Paul J J; Rouleau, Guy A; Rusbridge, Clare; Kibar, Zoha

    2018-03-22

    Syringomyelia (SM) is a common condition affecting brachycephalic toy breed dogs and is characterized by the development of fluid-filled cavities within the spinal cord. It is often concurrent with a complex developmental malformation of the skull and craniocervical vertebrae called Chiari-like malformation (CM) characterized by a conformational change and overcrowding of the brain and cervical spinal cord particularly at the craniocervical junction. CM and SM have a polygenic mode of inheritance with variable penetrance. We identified six cranial T1-weighted sagittal MRI measurements that were associated to maximum transverse diameter of the syrinx cavity. Increased syrinx transverse diameter has been correlated previously with increased likelihood of behavioral signs of pain. We next conducted a whole genome association study of these traits in 65 Cavalier King Charles Spaniel (CKCS) dogs (33 controls, 32 with extreme phenotypes). Two loci on CFA22 and CFA26 were found to be significantly associated to two traits associated with a reduced volume and altered orientation of the caudal cranial fossa. Their reconstructed haplotypes defined two associated regions that harbor only two genes: PCDH17 on CFA22 and ZWINT on CFA26. PCDH17 codes for a cell adhesion molecule expressed specifically in the brain and spinal cord. ZWINT plays a role in chromosome segregation and its expression is increased with the onset of neuropathic pain. Targeted genomic sequencing of these regions identified respectively 37 and 339 SNPs with significantly associated P values. Genotyping of tagSNPs selected from these 2 candidate loci in an extended cohort of 461 CKCS (187 unaffected, 274 SM affected) identified 2 SNPs on CFA22 that were significantly associated to SM strengthening the candidacy of this locus in SM development. We identified 2 loci on CFA22 and CFA26 that contained only 2 genes, PCDH17 and ZWINT, significantly associated to two traits associated with syrinx transverse

  15. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  16. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  17. A proteomic analysis identifies candidate early biomarkers to predict ovarian hyperstimulation syndrome in polycystic ovarian syndrome patients.

    Science.gov (United States)

    Wu, Lan; Sun, Yazhou; Wan, Jun; Luan, Ting; Cheng, Qing; Tan, Yong

    2017-07-01

    Ovarian hyperstimulation syndrome (OHSS) is a potentially life‑threatening, iatrogenic complication that occurs during assisted reproduction. Polycystic ovarian syndrome (PCOS) significantly increases the risk of OHSS during controlled ovarian stimulation. Therefore, a more effective early prediction technique is required in PCOS patients. Quantitative proteomic analysis of serum proteins indicates the potential diagnostic value for disease. In the present study, the authors revealed the differentially expressed proteins in OHSS patients with PCOS as new diagnostic biomarkers. The promising proteins obtained from liquid chromatography‑mass spectrometry were subjected to ELISA and western blotting assay for further confirmation. A total of 57 proteins were identified with significant difference, of which 29 proteins were upregulated and 28 proteins were downregulated in OHSS patients. Haptoglobin, fibrinogen and lipoprotein lipase were selected as candidate biomarkers. Receiver operating characteristic curve analysis demonstrated all three proteins may have potential as biomarkers to discriminate OHSS in PCOS patients. Haptoglobin, fibrinogen and lipoprotein lipase have never been reported as a predictive marker of OHSS in PCOS patients, and their potential roles in OHSS occurrence deserve further studies. The proteomic results reported in the present study may gain deeper insights into the pathophysiology of OHSS.

  18. Low/Negative Expression of PDGFR-α Identifies the Candidate Primary Mesenchymal Stromal Cells in Adult Human Bone Marrow

    Directory of Open Access Journals (Sweden)

    Hongzhe Li

    2014-12-01

    Full Text Available Human bone marrow (BM contains a rare population of nonhematopoietic mesenchymal stromal cells (MSCs, which are of central importance for the hematopoietic microenvironment. However, the precise phenotypic definition of these cells in adult BM has not yet been reported. In this study, we show that low/negative expression of CD140a (PDGFR-α on lin−/CD45−/CD271+ BM cells identified a cell population with very high MSC activity, measured as fibroblastic colony-forming unit frequency and typical in vitro and in vivo stroma formation and differentiation capacities. Furthermore, these cells exhibited high levels of genes associated with mesenchymal lineages and HSC supportive function. Moreover, lin−/CD45−/CD271+/CD140alow/− cells effectively mediated the ex vivo expansion of transplantable CD34+ hematopoietic stem cells. Taken together, these data indicate that CD140a is a key negative selection marker for adult human BM-MSCs, which enables to prospectively isolate a close to pure population of candidate human adult stroma stem/progenitor cells with potent hematopoiesis-supporting capacity.

  19. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  20. A family-based association study identified CYP17 as a candidate gene for obesity susceptibility in Caucasians.

    Science.gov (United States)

    Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W

    2012-08-06

    The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.

  1. Analyses of germline variants associated with ovarian cancer survival identify functional candidates at the 1q22 and 19p12 outcome loci

    DEFF Research Database (Denmark)

    Glubb, Dylan M; Johnatty, Sharon E; Quinn, Michael C J

    2017-01-01

    We previously identified associations with ovarian cancer outcome at five genetic loci. To identify putatively causal genetic variants and target genes, we prioritized two ovarian outcome loci (1q22 and 19p12) for further study. Bioinformatic and functional genetic analyses indicated that MEF2D...... and ZNF100 are targets of candidate outcome variants at 1q22 and 19p12, respectively. At 19p12, the chromatin interaction of a putative regulatory element with the ZNF100 promoter region correlated with candidate outcome variants. At 1q22, putative regulatory elements enhanced MEF2D promoter activity...... and haplotypes containing candidate outcome variants modulated these effects. In a public dataset, MEF2D and ZNF100 expression were both associated with ovarian cancer progression-free or overall survival time. In an extended set of 6,162 epithelial ovarian cancer patients, we found that functional candidates...

  2. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  3. Further characterization of field strains of rotavirus from Nigeria VP4 genotype P6 most frequently identified among symptomatically infected children.

    Science.gov (United States)

    Adah, M I; Rohwedder, A; Olaleye, O D; Durojaiye, O A; Werchau, H

    1997-10-01

    Polymerase chain reaction was utilized to characterize the VP4 types of 39 Rotavirus field isolates from symptomatically infected children in Nigeria. Genotype P6 was identified most frequently, occurring in 41.03 per cent of the typed specimens. Genotype P8 was identified as the next most prevalent (33.3% per cent). Genotype p6 was widespread (68.75 per cent) among infected neonates in Southern Nigeria, but mix infection was more prevalent (70 per cent) among Northern Nigerian children. Four distinct strains were identified with four different P genotypes. Overall strain G1P8 predominated (22.22 per cent) followed by G3P6 (17.8 per cent). Strain G1P8 was most prevalent (70 per cent) among infants aged 3.1-9 months, but strain G3P6 was most frequently identified among neonates occurance of mix infection genotype demonstrates the potential for reassortment events among different rotavirus genogroups in Nigeria. The epidemiological implications of these findings for rotavirus vaccine development and application in the country were discussed.

  4. High-density genotyping of immune-related loci identifies new SLE risk variants in individuals with Asian ancestry.

    Science.gov (United States)

    Sun, Celi; Molineros, Julio E; Looger, Loren L; Zhou, Xu-Jie; Kim, Kwangwoo; Okada, Yukinori; Ma, Jianyang; Qi, Yuan-Yuan; Kim-Howard, Xana; Motghare, Prasenjeet; Bhattarai, Krishna; Adler, Adam; Bang, So-Young; Lee, Hye-Soon; Kim, Tae-Hwan; Kang, Young Mo; Suh, Chang-Hee; Chung, Won Tae; Park, Yong-Beom; Choe, Jung-Yoon; Shim, Seung Cheol; Kochi, Yuta; Suzuki, Akari; Kubo, Michiaki; Sumida, Takayuki; Yamamoto, Kazuhiko; Lee, Shin-Seok; Kim, Young Jin; Han, Bok-Ghee; Dozmorov, Mikhail; Kaufman, Kenneth M; Wren, Jonathan D; Harley, John B; Shen, Nan; Chua, Kek Heng; Zhang, Hong; Bae, Sang-Cheol; Nath, Swapan K

    2016-03-01

    Systemic lupus erythematosus (SLE) has a strong but incompletely understood genetic architecture. We conducted an association study with replication in 4,478 SLE cases and 12,656 controls from six East Asian cohorts to identify new SLE susceptibility loci and better localize known loci. We identified ten new loci and confirmed 20 known loci with genome-wide significance. Among the new loci, the most significant locus was GTF2IRD1-GTF2I at 7q11.23 (rs73366469, Pmeta = 3.75 × 10(-117), odds ratio (OR) = 2.38), followed by DEF6, IL12B, TCF7, TERT, CD226, PCNXL3, RASGRP1, SYNGR1 and SIGLEC6. We identified the most likely functional variants at each locus by analyzing epigenetic marks and gene expression data. Ten candidate variants are known to alter gene expression in cis or in trans. Enrichment analysis highlights the importance of these loci in B cell and T cell biology. The new loci, together with previously known loci, increase the explained heritability of SLE to 24%. The new loci share functional and ontological characteristics with previously reported loci and are possible drug targets for SLE therapeutics.

  5. THE CANDIDATE CLUSTER AND PROTOCLUSTER CATALOG (CCPC). II. SPECTROSCOPICALLY IDENTIFIED STRUCTURES SPANNING 2 <  z  < 6.6

    Energy Technology Data Exchange (ETDEWEB)

    Franck, J. R.; McGaugh, S. S. [Case Western Reserve University, 10900 Euclid Ave., Cleveland, OH 44106 (United States)

    2016-12-10

    The Candidate Cluster and Protocluster Catalog (CCPC) is a list of objects at redshifts z  > 2 composed of galaxies with spectroscopically confirmed redshifts that are coincident on the sky and in redshift. These protoclusters are identified by searching for groups in volumes corresponding to the expected size of the most massive protoclusters at these redshifts. In CCPC1 we identified 43 candidate protoclusters among 14,000 galaxies between 2.74 <  z  < 3.71. Here we expand our search to more than 40,000 galaxies with spectroscopic redshifts z  > 2.00, resulting in an additional 173 candidate structures. The most significant of these are 36 protoclusters with overdensities δ {sub gal} > 7. We also identify three large proto-supercluster candidates containing multiple protoclusters at z  = 2.3, 3.5 and z  = 6.56. Eight candidates with N  ≥ 10 galaxies are found at redshifts z  > 4.0. The last system in the catalog is the most distant spectroscopic protocluster candidate known to date at z  = 6.56.

  6. Genotyping-by-sequencing in an orphan plant species Physocarpus opulifolius helps identify the evolutionary origins of the genus Prunus.

    Science.gov (United States)

    Buti, Matteo; Sargent, Daniel J; Mhelembe, Khethani G; Delfino, Pietro; Tobutt, Kenneth R; Velasco, Riccardo

    2016-05-11

    The Rosaceae family encompasses numerous genera exhibiting morphological diversification in fruit types and plant habit as well as a wide variety of chromosome numbers. Comparative genomics between various Rosaceous genera has led to the hypothesis that the ancestral genome of the family contained nine chromosomes, however, the synteny studies performed in the Rosaceae to date encompass species with base chromosome numbers x = 7 (Fragaria), x = 8 (Prunus), and x = 17 (Malus), and no study has included species from one of the many Rosaceous genera containing a base chromosome number of x = 9. A genetic linkage map of the species Physocarpus opulifolius (x = 9) was populated with sequence characterised SNP markers using genotyping by sequencing. This allowed for the first time, the extent of the genome diversification of a Rosaceous genus with a base chromosome number of x = 9 to be performed. Orthologous loci distributed throughout the nine chromosomes of Physocarpus and the eight chromosomes of Prunus were identified which permitted a meaningful comparison of the genomes of these two genera to be made. The study revealed a high level of macro-synteny between the two genomes, and relatively few chromosomal rearrangements, as has been observed in studies of other Rosaceous genomes, lending further support for a relatively simple model of genomic evolution in Rosaceae.

  7. Molecular characterization of the VP4, VP6, VP7, and NSP4 genes of lapine rotaviruses identified in italy: emergence of a novel VP4 genotype

    International Nuclear Information System (INIS)

    Martella, Vito; Ciarlet, Max; Camarda, Antonio; Pratelli, Annamaria; Tempesta, Maria; Greco, Grazia; Cavalli, Alessandra; Elia, Gabriella; Decaro, Nicola; Terio, Valentina; Bozzo, Giancarlo; Camero, Michele; Buonavoglia, Canio

    2003-01-01

    The genes encoding the glycoprotein VP7, the VP8* trypsin-cleavage product of the protein VP4, a fragment of the protein VP6 associated with subgroup (SG) specificity, and the enterotoxin NSP4 of rotavirus strains identified in diarrheic fecal samples of rabbits in Italy were sequenced. The Italian lapine rotavirus (LRV) strains possessed a G3 VP7, SG I VP6, and KUN-like NSP4, a gene constellation typical of LRVs. One LRV strain (30/96), isolated in 1996, shared the closest amino acid (aa) identity (87-96%) with the P[14] genotype, composed of human and LRV strains. Conversely, three LRV strains (160/01, 229/01, and 308/01), identified in 2001, were highly identical (90-95%) among each other, but showed low aa identity (34-77%) to the VP8* genotype-specific sequences of representative rotavirus strains of all remaining P genotypes. This report confirms the worldwide genetic constellations of LRVs and identifies a novel VP4 genotype in rabbits, tentatively proposed as genotype P[22

  8. Gene expression analysis identifies new candidate genes associated with the development of black skin spots in Corriedale sheep.

    Science.gov (United States)

    Peñagaricano, Francisco; Zorrilla, Pilar; Naya, Hugo; Robello, Carlos; Urioste, Jorge I

    2012-02-01

    The white coat colour of sheep is an important economic trait. For unknown reasons, some animals are born with, and others develop with time, black skin spots that can also produce pigmented fibres. The presence of pigmented fibres in the white wool significantly decreases the fibre quality. The aim of this work was to study gene expression in black spots (with and without pigmented fibres) and white skin by microarray techniques, in order to identify the possible genes involved in the development of this trait. Five unrelated Corriedale sheep were used and, for each animal, the three possible comparisons (three different hybridisations) between the three samples of interest were performed. Differential gene expression patterns were analysed using different t-test approaches. Most of the major genes with well-known roles in skin pigmentation, e.g. ASIP, MC1R and C-KIT, showed no significant difference in the gene expression between white skin and black spots. On the other hand, many of the differentially expressed genes (raw P-value spots. The gene expression of C-FOS and KLF4, transcription factors involved in the cellular response to external factors such as ultraviolet light, was validated by quantitative polymerase chain reaction (PCR). This exploratory study provides a list of candidate genes that could be associated with the development of black skin spots that should be studied in more detail. Characterisation of these genes will enable us to discern the molecular mechanisms involved in the development of this feature and, hence, increase our understanding of melanocyte biology and skin pigmentation. In sheep, understanding this phenomenon is a first step towards developing molecular tools to assist in the selection against the presence of pigmented fibres in white wool.

  9. Editor's Highlight: High-Throughput Functional Genomics Identifies Modulators of TCE Metabolite Genotoxicity and Candidate Susceptibility Genes.

    Science.gov (United States)

    De La Rosa, Vanessa Y; Asfaha, Jonathan; Fasullo, Michael; Loguinov, Alex; Li, Peng; Moore, Lee E; Rothman, Nathaniel; Nakamura, Jun; Swenberg, James A; Scelo, Ghislaine; Zhang, Luoping; Smith, Martyn T; Vulpe, Chris D

    2017-11-01

    Trichloroethylene (TCE), an industrial chemical and environmental contaminant, is a human carcinogen. Reactive metabolites are implicated in renal carcinogenesis associated with TCE exposure, yet the toxicity mechanisms of these metabolites and their contribution to cancer and other adverse effects remain unclear. We employed an integrated functional genomics approach that combined functional profiling studies in yeast and avian DT40 cell models to provide new insights into the specific mechanisms contributing to toxicity associated with TCE metabolites. Genome-wide profiling studies in yeast identified the error-prone translesion synthesis (TLS) pathway as an import mechanism in response to TCE metabolites. The role of TLS DNA repair was further confirmed by functional profiling in DT40 avian cell lines, but also revealed that TLS and homologous recombination DNA repair likely play competing roles in cellular susceptibility to TCE metabolites in higher eukaryotes. These DNA repair pathways are highly conserved between yeast, DT40, and humans. We propose that in humans, mutagenic TLS is favored over homologous recombination repair in response to TCE metabolites. The results of these studies contribute to the body of evidence supporting a mutagenic mode of action for TCE-induced renal carcinogenesis mediated by reactive metabolites in humans. Our approach illustrates the potential for high-throughput in vitro functional profiling in yeast to elucidate toxicity pathways (molecular initiating events, key events) and candidate susceptibility genes for focused study. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Determination of the full-genome sequence of hepatitis E virus (HEV) SAAS-FX17 and use as a reference to identify putative HEV genotype 4 virulence determinants.

    Science.gov (United States)

    Zhu, Yumin; Yu, Xiaoming; Huang, Fenfen; Yu, Ruisong; Dong, Shijuan; Si, Fusheng; Zhang, Yuanshu; Li, Zhen

    2012-11-08

    Four major genotypes of hepatitis E virus (HEV), the causative agent of hepatitis E, have so far been recognized. While genotypes 3 and 4 are both zoonotic, the disease symptoms caused by the latter tend to be more severe. To examine if specific nucleotide/amino acid variations between genotypes 3 and 4 play a role in determining the severity of hepatitis E disease, the complete genome of one swine HEV genotype 4 isolate, SAAS-FX17, was determined and compared with other genotype 4 and genotype 3 genomes to identify putative HEV genotype 4 virulence determinants. A total of 42 conformable nt/aa variations between genotype 3 and 4 HEVs were detected, of which 19 were proposed to be potential disease severity determinants for genotype 4 strains. One potential determinant was located in each of the 5'-UTR and 3'-UTR, 3 and 12 within ORF1 and ORF2 respectively, and 2 in the junction region.

  11. Exploring candidate genes for pericarp russet pigmentation of sand pear (Pyrus pyrifolia via RNA-Seq data in two genotypes contrasting for pericarp color.

    Directory of Open Access Journals (Sweden)

    Yue-zhi Wang

    Full Text Available Sand pear (Pyrus pyrifolia russet pericarp is an important trait affecting both the quality and stress tolerance of fruits. This trait is controlled by a relative complex genetic process, with some fundamental biological questions such as how many and which genes are involved in the process remaining elusive. In this study, we explored differentially expressed genes between the russet- and green-pericarp offspring from the sand pear (Pyrus pyrifolia cv. 'Qingxiang' × 'Cuiguan' F1 group by RNA-seq-based bulked segregant analysis (BSA. A total of 29,100 unigenes were identified and 206 of which showed significant differences in expression level (log2fold values>1 between the two types of pericarp pools. Gene Ontology (GO analyses detected 123 unigenes in GO terms related to 'cellular_component' and 'biological_process', suggesting developmental and growth differentiations between the two types. GO categories associated with various aspects of 'lipid metabolic processes', 'transport', 'response to stress', 'oxidation-reduction process' and more were enriched with genes with divergent expressions between the two libraries. Detailed examination of a selected set of these categories revealed repressed expressions of candidate genes for suberin, cutin and wax biosynthesis in the russet pericarps.Genes encoding putative cinnamoyl-CoA reductase (CCR, cinnamyl alcohol dehydrogenase (CAD and peroxidase (POD that are involved in the lignin biosynthesis were suggested to be candidates for pigmentation of sand pear russet pericarps. Nine differentially expressed genes were analyzed for their expressions using qRT-PCR and the results were consistent with those obtained from Illumina RNA-sequencing. This study provides a comprehensive molecular biology insight into the sand pear pericarp pigmentation and appearance quality formation.

  12. Correlation between Waardenburg syndrome phenotype and genotype in a population of individuals with identified PAX3 mutations.

    Science.gov (United States)

    DeStefano, A L; Cupples, L A; Arnos, K S; Asher, J H; Baldwin, C T; Blanton, S; Carey, M L; da Silva, E O; Friedman, T B; Greenberg, J; Lalwani, A K; Milunsky, A; Nance, W E; Pandya, A; Ramesar, R S; Read, A P; Tassabejhi, M; Wilcox, E R; Farrer, L A

    1998-05-01

    Waardenburg syndrome (WS) type 1 is an autosomal dominant disorder characterized by sensorineural hearing loss, pigmentary abnormalities of the eye, hair, and skin, and dystopia canthorum. The phenotype is variable and affected individuals may exhibit only one or a combination of several of the associated features. To assess the relationship between phenotype and gene defect, clinical and genotype data on 48 families (271 WS individuals) collected by members of the Waardenburg Consortium were pooled. Forty-two unique mutations in the PAX3 gene, previously identified in these families, were grouped in five mutation categories: amino acid (AA) substitution in the paired domain, AA substitution in the homeodomain, deletion of the Ser-Thr-Pro-rich region, deletion of the homeodomain and the Ser-Thr-Pro-rich region, and deletion of the entire gene. These mutation classes are based on the structure of the PAX3 gene and were chosen to group mutations predicted to have similar defects in the gene product. Association between mutation class and the presence of hearing loss, eye pigment abnormality, skin hypopigmentation, or white forelock was evaluated using generalized estimating equations, which allowed for incorporation of a correlation structure that accounts for potential similarity among members of the same family. Odds for the presence of eye pigment abnormality, white forelock, and skin hypopigmentation were 2, 8, and 5 times greater, respectively, for individuals with deletions of the homeodomain and the Pro-Ser-Thr-rich region compared to individuals with an AA substitution in the homeodomain. Odds ratios that differ significantly from 1.0 for these traits may indicate that the gene products resulting from different classes of mutations act differently in the expression of WS. Although a suggestive association was detected for hearing loss with an odds ratio of 2.6 for AA substitution in the paired domain compared with AA substitution in the homeodomain, this odds

  13. A de novo transcriptome of the Asian tiger mosquito, Aedes albopictus, to identify candidate transcripts for diapause preparation

    Directory of Open Access Journals (Sweden)

    Poelchau Monica F

    2011-12-01

    Full Text Available Abstract Background Many temperate insects survive the harsh conditions of winter by undergoing photoperiodic diapause, a pre-programmed developmental arrest initiated by short day lengths. Despite the well-established ecological significance of photoperiodic diapause, the molecular basis of this crucial adaptation remains largely unresolved. The Asian tiger mosquito, Aedes albopictus (Skuse, represents an outstanding emerging model to investigate the molecular basis of photoperiodic diapause in a well-defined ecological and evolutionary context. Ae. albopictus is a medically significant vector and is currently considered the most invasive mosquito in the world. Traits related to diapause appear to be important factors contributing to the rapid spread of this mosquito. To generate novel sequence information for this species, as well as to discover transcripts involved in diapause preparation, we sequenced the transcriptome of Ae. albopictus oocytes destined to become diapausing or non-diapausing pharate larvae. Results 454 GS-FLX transcriptome sequencing yielded >1.1 million quality-filtered reads, which we assembled into 69,474 contigs (N50 = 1,009 bp. Our contig filtering approach, where we took advantage of strong sequence similarity to the fully sequenced genome of Aedes aegypti, as well as other reference organisms, resulted in 11,561 high-quality, conservative ESTs. Differential expression estimates based on normalized read counts revealed 57 genes with higher expression, and 257 with lower expression under diapause-inducing conditions. Analysis of expression by qPCR for 47 of these genes indicated a high correlation of expression levels between 454 sequence data and qPCR, but congruence of statistically significant differential expression was low. Seven genes identified as differentially expressed based on qPCR have putative functions that are consistent with the insect diapause syndrome; three genes have unknown function and represent

  14. New avian paramyxoviruses type I strains identified in Africa provide new outcomes for phylogeny reconstruction and genotype classification.

    Directory of Open Access Journals (Sweden)

    Renata Servan de Almeida

    Full Text Available Newcastle disease (ND is one of the most lethal diseases of poultry worldwide. It is caused by an avian paramyxovirus 1 that has high genomic diversity. In the framework of an international surveillance program launched in 2007, several thousand samples from domestic and wild birds in Africa were collected and analyzed. ND viruses (NDV were detected and isolated in apparently healthy fowls and wild birds. However, two thirds of the isolates collected in this study were classified as virulent strains of NDV based on the molecular analysis of the fusion protein and experimental in vivo challenges with two representative isolates. Phylogenetic analysis based on the F and HN genes showed that isolates recovered from poultry in Mali and Ethiopia form new groups, herein proposed as genotypes XIV and sub-genotype VIf with reference to the new nomenclature described by Diel's group. In Madagascar, the circulation of NDV strains of genotype XI, originally reported elsewhere, is also confirmed. Full genome sequencing of five African isolates was generated and an extensive phylogeny reconstruction was carried out based on the nucleotide sequences. The evolutionary distances between groups and the specific amino acid signatures of each cluster allowed us to refine the genotype nomenclature.

  15. Dense genotyping of immune-related disease regions identifies nine new risk loci for primary sclerosing cholangitis

    NARCIS (Netherlands)

    Liu, Jimmy Z.; Hov, Johannes Roksund; Folseraas, Trine; Ellinghaus, Eva; Rushbrook, Simon M.; Doncheva, Nadezhda T.; Andreassen, Ole A.; Weersma, Rinse K.; Weismüller, Tobias J.; Eksteen, Bertus; Invernizzi, Pietro; Hirschfield, Gideon M.; Gotthardt, Daniel Nils; Pares, Albert; Ellinghaus, David; Shah, Tejas; Juran, Brian D.; Milkiewicz, Piotr; Rust, Christian; Schramm, Christoph; Müller, Tobias; Srivastava, Brijesh; Dalekos, Georgios; Nöthen, Markus M.; Herms, Stefan; Winkelmann, Juliane; Mitrovic, Mitja; Braun, Felix; Ponsioen, Cyriel Y.; Croucher, Peter J. P.; Sterneck, Martina; Teufel, Andreas; Mason, Andrew L.; Saarela, Janna; Leppa, Virpi; Dorfman, Ruslan; Alvaro, Domenico; Floreani, Annarosa; Onengut-Gumuscu, Suna; Rich, Stephen S.; Thompson, Wesley K.; Schork, Andrew J.; Næss, Sigrid; Thomsen, Ingo; Mayr, Gabriele; König, Inke R.; Hveem, Kristian; Cleynen, Isabelle; Gutierrez-Achury, Javier; Ricaño-Ponce, Isis; van Heel, David; Björnsson, Einar; Sandford, Richard N.; Durie, Peter R.; Melum, Espen; Vatn, Morten H.; Silverberg, Mark S.; Duerr, Richard H.; Padyukov, Leonid; Brand, Stephan; Sans, Miquel; Annese, Vito; Achkar, Jean-Paul; Boberg, Kirsten Muri; Marschall, Hanns-Ulrich; Chazouillères, Olivier; Bowlus, Christopher L.; Wijmenga, Cisca; Schrumpf, Erik; Vermeire, Severine; Albrecht, Mario; Rioux, John D.; Alexander, Graeme; Bergquist, Annika; Cho, Judy; Schreiber, Stefan; Manns, Michael P.; Färkkilä, Martti; Dale, Anders M.; Chapman, Roger W.; Lazaridis, Konstantinos N.; Franke, Andre; Anderson, Carl A.; Karlsen, Tom H.

    2013-01-01

    Primary sclerosing cholangitis (PSC) is a severe liver disease of unknown etiology leading to fibrotic destruction of the bile ducts and ultimately to the need for liver transplantation. We compared 3,789 PSC cases of European ancestry to 25,079 population controls across 130,422 SNPs genotyped

  16. Dense genotyping of immune-related disease regions identifies nine new risk loci for primary sclerosing cholangitis

    NARCIS (Netherlands)

    Liu, Jimmy Z.; Hov, Johannes Roksund; Folseraas, Trine; Ellinghaus, Eva; Rushbrook, Simon M.; Doncheva, Nadezhda T.; Andreassen, Ole A.; Weersma, Rinse K.; Weismueller, Tobias J.; Eksteen, Bertus; Invernizzi, Pietro; Hirschfield, Gideon M.; Gotthardt, Daniel Nils; Pares, Albert; Ellinghaus, David; Shah, Tejas; Juran, Brian D.; Milkiewicz, Piotr; Rust, Christian; Schramm, Christoph; Mueller, Tobias; Srivastava, Brijesh; Dalekos, Georgios; Noethen, Markus M.; Herms, Stefan; Winkelmann, Juliane; Mitrovic, Mitja; Braun, Felix; Ponsioen, Cyriel Y.; Croucher, Peter J. P.; Sterneck, Martina; Teufel, Andreas; Mason, Andrew L.; Saarela, Janna; Leppa, Virpi; Dorfman, Ruslan; Alvaro, Domenico; Floreani, Annarosa; Onengut-Gumuscu, Suna; Rich, Stephen S.; Thompson, Wesley K.; Schork, Andrew J.; Naess, Sigrid; Thomsen, Ingo; Mayr, Gabriele; Koenig, Inke R.; Hveem, Kristian; Cleynen, Isabelle; Gutierrez-Achury, Javier; Ricano-Ponce, Isis; van Heel, David; Bjoernsson, Einar; Sandford, Richard N.; Durie, Peter R.; Melum, Espen; Vatn, Morten H.; Silverberg, Mark S.; Duerr, Richard H.; Padyukov, Leonid; Brand, Stephan; Sans, Miquel; Annese, Vito; Achkar, Jean-Paul; Boberg, Kirsten Muri; Marschall, Hanns-Ulrich; Chazouilleres, Olivier; Bowlus, Christopher L.; Wijmenga, Cisca; Schrumpf, Erik; Vermeire, Severine; Albrecht, Mario; Rioux, John D.; Alexander, Graeme; Bergquist, Annika; Cho, Judy; Schreiber, Stefan; Manns, Michael P.; Farkkila, Martti; Dale, Anders M.; Chapman, Roger W.; Lazaridis, Konstantinos N.; Franke, Andre; Anderson, Carl A.; Karlsen, Tom H.

    Primary sclerosing cholangitis (PSC) is a severe liver disease of unknown etiology leading to fibrotic destruction of the bile ducts and ultimately to the need for liver transplantation(1-3). We compared 3,789 PSC cases of European ancestry to 25,079 population controls across 130,422 SNPs genotyped

  17. Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

    2017-01-01

    Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms

  18. Complete genome sequence analysis identifies a new genotype of brassica yellows virus that infects cabbage and radish in China.

    Science.gov (United States)

    Zhang, Xiao-Yan; Xiang, Hai-Ying; Zhou, Cui-Ji; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2014-08-01

    For brassica yellows virus (BrYV), proposed to be a member of a new polerovirus species, two clearly distinct genotypes (BrYV-A and BrYV-B) have been described. In this study, the complete nucleotide sequences of two BrYV isolates from radish and Chinese cabbage were determined. Sequence analysis suggested that these isolates represent a new genotype, referred to here as BrYV-C. The full-length sequences of the two BrYV-C isolates shared 93.4-94.8 % identity with BrYV-A and BrYV-B. Further phylogenetic analysis showed that the BrYV-C isolates formed a subgroup that was distinct from the BrYV-A and BrYV-B isolates based on all of the proteins except P5.

  19. Derivation and validation of REASON: a risk score identifying candidates to screen for peripheral arterial disease using ankle brachial index.

    Science.gov (United States)

    Ramos, Rafel; Baena-Díez, Jose Miguel; Quesada, Miquel; Solanas, Pascual; Subirana, Isaac; Sala, Joan; Alzamora, Maite; Forès, Rosa; Masiá, Rafel; Elosua, Roberto; Grau, María; Cordón, Ferran; Pera, Guillem; Rigo, Fernando; Martí, Ruth; Ponjoan, Anna; Cerezo, Carlos; Brugada, Ramon; Marrugat, Jaume

    2011-02-01

    The recommendation of screening with ankle brachial index (ABI) in asymptomatic individuals is controversial. The aims of the present study were to develop and validate a pre-screening test to select candidates for ABI measurement in the Spanish population 50-79 years old, and to compare its predictive capacity to current Inter-Society Consensus (ISC) screening criteria. Two population-based cross-sectional studies were used to develop (n = 4046) and validate (n = 3285) a regression model to predict ABI guidelines, and similar sensitivity. This resulted in fewer patients screened per diagnosis of ABI < 0.9 (10.6 vs. 8.75) and a lower proportion of the population aged 50-79 years candidate to ABI screening (63.3% vs. 55.0%). This model provides accurate ABI < 0.9 risk estimates for ages 50-79, with a better predictive capacity than that of ISC criteria. Its use could reduce possible harms and unnecessary work-ups of ABI screening as a risk stratification strategy in primary prevention of peripheral vascular disease. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  20. Using microarrays to identify positional candidate genes for QTL: the case study of ACTH response in pigs.

    Science.gov (United States)

    Jouffe, Vincent; Rowe, Suzanne; Liaubet, Laurence; Buitenhuis, Bart; Hornshøj, Henrik; SanCristobal, Magali; Mormède, Pierre; de Koning, D J

    2009-07-16

    Microarray studies can supplement QTL studies by suggesting potential candidate genes in the QTL regions, which by themselves are too large to provide a limited selection of candidate genes. Here we provide a case study where we explore ways to integrate QTL data and microarray data for the pig, which has only a partial genome sequence. We outline various procedures to localize differentially expressed genes on the pig genome and link this with information on published QTL. The starting point is a set of 237 differentially expressed cDNA clones in adrenal tissue from two pig breeds, before and after treatment with adrenocorticotropic hormone (ACTH). Different approaches to localize the differentially expressed (DE) genes to the pig genome showed different levels of success and a clear lack of concordance for some genes between the various approaches. For a focused analysis on 12 genes, overlapping QTL from the public domain were presented. Also, differentially expressed genes underlying QTL for ACTH response were described. Using the latest version of the draft sequence, the differentially expressed genes were mapped to the pig genome. This enabled co-location of DE genes and previously studied QTL regions, but the draft genome sequence is still incomplete and will contain many errors. A further step to explore links between DE genes and QTL at the pathway level was largely unsuccessful due to the lack of annotation of the pig genome. This could be improved by further comparative mapping analyses but this would be time consuming. This paper provides a case study for the integration of QTL data and microarray data for a species with limited genome sequence information and annotation. The results illustrate the challenges that must be addressed but also provide a roadmap for future work that is applicable to other non-model species.

  1. Genotypic and biological characteristics of non-identified strain of spotted fever group rickettsiae isolated in Crimea.

    Science.gov (United States)

    Balayeva, N M; Demkin, V V; Rydkina, E B; Ignatovich, V F; Artemiev, M I; Lichoded LYa; Genig, V A

    1993-12-01

    A strain of rickettsiae, designated Crimea-108, was isolated from ticks Dermacentor marginatus in the Crimea in 1977. Its immunobiological characteristics involve low pathogenicity for experimental animals, moderate infectivity for chick embryos, and antigenic relatedness to spotted fever group (SFG) rickettsiae (R. sibirica, R. conorii, R. akari), especially to R. sibirica. The genotypic characterization of the strain Crimea-108 was carried out in comparison with SFG and typhus group rickettsiae by using restriction fragment length polymorphism (RFLP) analysis and DNA-probe hybridization. The marked similarity was detected between DNA restriction patterns of the strains Crimea-108, R. sibirica and R. conorii, but each of them besides comigrating fragments had specific ones. Genotypic analysis of the strain Crimea-108, the SFG and typhus group rickettsiae by three independent DNA probes, based on R. prowazekii DNA, gave unique hybridization patterns for the Crimea-108 strain with all probes. The obtained data show that the Crimea-108 isolate does not belong to the species of R. sibirica, R. conorii, R. akari. The strain Crimea-108 is a novel strain of SFG rickettsiae for the Crimea region.

  2. Comparing human pancreatic cell secretomes by in vitro aptamer selection identifies cyclophilin B as a candidate pancreatic cancer biomarker.

    Science.gov (United States)

    Ray, Partha; Rialon-Guevara, Kristy L; Veras, Emanuela; Sullenger, Bruce A; White, Rebekah R

    2012-05-01

    Most cases of pancreatic cancer are not diagnosed until they are no longer curable with surgery. Therefore, it is critical to develop a sensitive, preferably noninvasive, method for detecting the disease at an earlier stage. In order to identify biomarkers for pancreatic cancer, we devised an in vitro positive/negative selection strategy to identify RNA ligands (aptamers) that could detect structural differences between the secretomes of pancreatic cancer and non-cancerous cells. Using this molecular recognition approach, we identified an aptamer (M9-5) that differentially bound conditioned media from cancerous and non-cancerous human pancreatic cell lines. This aptamer further discriminated between the sera of pancreatic cancer patients and healthy volunteers with high sensitivity and specificity. We utilized biochemical purification methods and mass-spectrometric analysis to identify the M9-5 target as cyclophilin B (CypB). This molecular recognition-based strategy simultaneously identified CypB as a serum biomarker and generated a new reagent to recognize it in body fluids. Moreover, this approach should be generalizable to other diseases and complementary to traditional approaches that focus on differences in expression level between samples. Finally, we suggest that the aptamer we identified has the potential to serve as a tool for the early detection of pancreatic cancer.

  3. Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions.

    Science.gov (United States)

    Singh, Anuradha; Mantri, Shrikant; Sharma, Monica; Chaudhury, Ashok; Tuli, Rakesh; Roy, Joy

    2014-01-16

    The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study

  4. Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions

    Science.gov (United States)

    2014-01-01

    Background The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Results Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT

  5. Genetic mapping in mice identifies DMBT1 as a candidate modifier of mammary tumors and breast cancer risk

    DEFF Research Database (Denmark)

    Blackburn, Anneke C; Hill, Linda Z; Roberts, Amy L

    2007-01-01

    Low-penetrance breast cancer susceptibility alleles seem to play a significant role in breast cancer risk but are difficult to identify in human cohorts. A genetic screen of 176 N2 backcross progeny of two Trp53(+/-) strains, BALB/c and C57BL/6, which differ in their susceptibility to mammary...... tumors, identified a modifier of mammary tumor susceptibility in an approximately 25-Mb interval on mouse chromosome 7 (designated SuprMam1). Relative to heterozygotes, homozygosity for BALB/c alleles of SuprMam1 significantly decreased mammary tumor latency from 70.7 to 61.1 weeks and increased risk...

  6. Novel CTL epitopes identified through a Y. pestis proteome-wide analysis in the search for vaccine candidates against plague.

    Science.gov (United States)

    Zvi, Anat; Rotem, Shahar; Zauberman, Ayelet; Elia, Uri; Aftalion, Moshe; Bar-Haim, Erez; Mamroud, Emanuelle; Cohen, Ofer

    2017-10-20

    The causative agent of Plague, Yersinia pestis, is a highly virulent pathogen and a potential bioweapon. Depending on the route of infection, two prevalent occurrences of the disease are known, bubonic and pneumonic. The latter has a high fatality rate. In the absence of a licensed vaccine, intense efforts to develop a safe and efficacious vaccine have been conducted, and humoral-driven subunit vaccines containing the F1 and LcrV antigens are currently under clinical trials. It is well known that a cellular immune response might have an essential additive value to immunity and protection against Y. pestis infection. Nevertheless, very few documented epitopes eliciting a protective T-cell response have been reported. Here, we present a combined high throughput computational and experimental effort towards identification of CD8 T-cell epitopes. All 4067 proteins of Y. pestis were analyzed with state-of-the-art recently developed prediction algorithms aimed at mapping potential MHC class I binders. A compilation of the results obtained from several prediction methods revealed a total of 238,000 peptide candidates, which necessitated downstream filtering criteria. Our previously established and proven approach for enrichment of true positive CTL epitopes, which relies on mapping clusters rich in tandem or overlapping predicted MHC binders ("hotspots"), was applied, as well as considerations of predicted binding affinity. A total of 1532 peptides were tested for their ability to elicit a specific T-cell response by following the production of IFNγ from splenocytes isolated from vaccinated mice. Altogether, the screen resulted in 178 positive responders (11.8%), all novel Y. pestis CTL epitopes. These epitopes span 113 Y. pestis proteins. Substantial enrichment of membrane-associated proteins was detected for epitopes selected from hotspots of predicted MHC binders. These results considerably expand the repertoire of known CTL epitopes in Y. pestis and pave the way to

  7. Efficient Culture Adaptation of Hepatitis C Virus Recombinants with Genotype-Specific Core-NS2 by Using Previously Identified Mutations

    DEFF Research Database (Denmark)

    Scheel, Troels Kasper Høyer; Gottwein, Judith M; Carlsen, Thomas H R

    2011-01-01

    Hepatitis C virus (HCV) is an important cause of chronic liver disease, and interferon-based therapy cures only 40 to 80% of patients, depending on HCV genotype. Research was accelerated by genotype 2a (strain JFH1) infectious cell culture systems. We previously developed viable JFH1-based...... (HC-TN and DH6), 1b (DH1 and DH5), and 3a (DBN) isolates, using previously identified adaptive mutations. Introduction of mutations from isolates of the same subtype either led to immediate efficient virus production or accelerated culture adaptation. The DH6 and DH5 recombinants without introduced...... mutations did not adapt to culture. Universal adaptive effects of mutations in NS3 (Q1247L, I1312V, K1398Q, R1408W, and Q1496L) and NS5A (V2418L) were investigated for JFH1-based genotype 1 to 5 core-NS2 recombinants; several mutations conferred adaptation to H77C (1a), J4 (1b), S52 (3a), and SA13 (5a...

  8. Proteomic profiling of pretreatment serum from HIV-infected patients identifies candidate markers predictive of lymphoma development

    DEFF Research Database (Denmark)

    Vase, Maja Ølholm; Ludvigsen, Maja; Bendix, Knud

    2016-01-01

    . Differentially expressed proteins were identified by liquid chromatography-tandem mass spectrometry. A tissue microarray, containing diagnostic HIV-lymphoma tissue samples (N = 40), was used to investigate immunohistochemical expression of markers in tumoural lesions. RESULTS: Fourteen differentially expressed...... protein spots were detected. Using principal components analysis, spots containing immunoglobulin J chain, apolipoprotein A-I, procollagen C-endopeptidase enhancer-1 and complement C4-A were associated with lymphoma development (P ... with subsequent lymphoma compared with patients without subsequent lymphoma. In the tissue microarray, amyloid A was widely expressed, and high expression showed a tendency towards inferior outcome (log-rank 0.073). CONCLUSION: We identified several differentially expressed protein spots present already...

  9. Global analysis of WRKY transcription factor superfamily in Setaria identifies potential candidates involved in abiotic stress signaling

    OpenAIRE

    Muthamilarasan, Mehanathan; Bonthala, Venkata S.; Khandelwal, Rohit; Jaishankar, Jananee; Shweta, Shweta; Nawaz, Kashif; Prasad, Manoj

    2015-01-01

    Transcription factors (TFs) are major players in stress signalling and constitute an integral part of signalling networks. Among the major TFs, WRKY proteins play pivotal roles in regulation of transcriptional reprogramming associated with stress responses. In view of this, genome- and transcriptome-wide identification of WRKY TF family was performed in the C4 model plants, Setaria italica (SiWRKY) and S. viridis (SvWRKY), respectively. The study identified 105 SiWRKY and 44 SvWRKY proteins t...

  10. Microarray analysis and scale-free gene networks identify candidate regulators in drought-stressed roots of loblolly pine (P. taeda L.

    Directory of Open Access Journals (Sweden)

    Bordeaux John M

    2011-05-01

    Full Text Available Abstract Background Global transcriptional analysis of loblolly pine (Pinus taeda L. is challenging due to limited molecular tools. PtGen2, a 26,496 feature cDNA microarray, was fabricated and used to assess drought-induced gene expression in loblolly pine propagule roots. Statistical analysis of differential expression and weighted gene correlation network analysis were used to identify drought-responsive genes and further characterize the molecular basis of drought tolerance in loblolly pine. Results Microarrays were used to interrogate root cDNA populations obtained from 12 genotype × treatment combinations (four genotypes, three watering regimes. Comparison of drought-stressed roots with roots from the control treatment identified 2445 genes displaying at least a 1.5-fold expression difference (false discovery rate = 0.01. Genes commonly associated with drought response in pine and other plant species, as well as a number of abiotic and biotic stress-related genes, were up-regulated in drought-stressed roots. Only 76 genes were identified as differentially expressed in drought-recovered roots, indicating that the transcript population can return to the pre-drought state within 48 hours. Gene correlation analysis predicts a scale-free network topology and identifies eleven co-expression modules that ranged in size from 34 to 938 members. Network topological parameters identified a number of central nodes (hubs including those with significant homology (E-values ≤ 2 × 10-30 to 9-cis-epoxycarotenoid dioxygenase, zeatin O-glucosyltransferase, and ABA-responsive protein. Identified hubs also include genes that have been associated previously with osmotic stress, phytohormones, enzymes that detoxify reactive oxygen species, and several genes of unknown function. Conclusion PtGen2 was used to evaluate transcriptome responses in loblolly pine and was leveraged to identify 2445 differentially expressed genes responding to severe drought stress in

  11. Microarray analysis and scale-free gene networks identify candidate regulators in drought-stressed roots of loblolly pine (P. taeda L.)

    Science.gov (United States)

    2011-01-01

    Background Global transcriptional analysis of loblolly pine (Pinus taeda L.) is challenging due to limited molecular tools. PtGen2, a 26,496 feature cDNA microarray, was fabricated and used to assess drought-induced gene expression in loblolly pine propagule roots. Statistical analysis of differential expression and weighted gene correlation network analysis were used to identify drought-responsive genes and further characterize the molecular basis of drought tolerance in loblolly pine. Results Microarrays were used to interrogate root cDNA populations obtained from 12 genotype × treatment combinations (four genotypes, three watering regimes). Comparison of drought-stressed roots with roots from the control treatment identified 2445 genes displaying at least a 1.5-fold expression difference (false discovery rate = 0.01). Genes commonly associated with drought response in pine and other plant species, as well as a number of abiotic and biotic stress-related genes, were up-regulated in drought-stressed roots. Only 76 genes were identified as differentially expressed in drought-recovered roots, indicating that the transcript population can return to the pre-drought state within 48 hours. Gene correlation analysis predicts a scale-free network topology and identifies eleven co-expression modules that ranged in size from 34 to 938 members. Network topological parameters identified a number of central nodes (hubs) including those with significant homology (E-values ≤ 2 × 10-30) to 9-cis-epoxycarotenoid dioxygenase, zeatin O-glucosyltransferase, and ABA-responsive protein. Identified hubs also include genes that have been associated previously with osmotic stress, phytohormones, enzymes that detoxify reactive oxygen species, and several genes of unknown function. Conclusion PtGen2 was used to evaluate transcriptome responses in loblolly pine and was leveraged to identify 2445 differentially expressed genes responding to severe drought stress in roots. Many of the

  12. Candidate isolated neutron stars and other optically blank x-ray fields identified from the rosat all-sky and sloan digital sky surveys

    Energy Technology Data Exchange (ETDEWEB)

    Agueros, Marcel A.; Anderson, Scott F.; /Washington U., Seattle, Astron. Dept.; Margon, Bruce; /Baltimore, Space Telescope Sci.; Haberl, Frank; Voges, Wolfgang; /Garching,; Annis, James; /Fermilab; Schneider, Donald P.; /Penn State U., Astron. Astrophys.; Brinkmann, Jonathan; /Apache Point Observ.

    2005-11-01

    Only seven radio-quiet isolated neutron stars (INSs) emitting thermal X rays are known, a sample that has yet to definitively address such fundamental issues as the equation of state of degenerate neutron matter. We describe a selection algorithm based on a cross-correlation of the ROSAT All-Sky Survey (RASS) and the Sloan Digital Sky Survey (SDSS) that identifies X-ray error circles devoid of plausible optical counterparts to the SDSS g {approx} 22 magnitudes limit. We quantitatively characterize these error circles as optically blank; they may host INSs or other similarly exotic X-ray sources such as radio-quiet BL Lacs, obscured AGN, etc. Our search is an order of magnitude more selective than previous searches for optically blank RASS error circles, and excludes the 99.9% of error circles that contain more common X-ray-emitting subclasses. We find 11 candidates, nine of which are new. While our search is designed to find the best INS candidates and not to produce a complete list of INSs in the RASS, it is reassuring that our number of candidates is consistent with predictions from INS population models. Further X-ray observations will obtain pinpoint positions and determine whether these sources are entirely optically blank at g {approx} 22, supporting the presence of likely isolated neutron stars and perhaps enabling detailed follow-up studies of neutron star physics.

  13. An in-depth characterization of the major psoriasis susceptibility locus identifies candidate susceptibility alleles within an HLA-C enhancer element.

    Directory of Open Access Journals (Sweden)

    Alex Clop

    Full Text Available Psoriasis is an immune-mediated skin disorder that is inherited as a complex genetic trait. Although genome-wide association scans (GWAS have identified 36 disease susceptibility regions, more than 50% of the genetic variance can be attributed to a single Major Histocompatibility Complex (MHC locus, known as PSORS1. Genetic studies indicate that HLA-C is the strongest PSORS1 candidate gene, since markers tagging HLA-Cw*0602 consistently generate the most significant association signals in GWAS. However, it is unclear whether HLA-Cw*0602 is itself the causal PSORS1 allele, especially as the role of SNPs that may affect its expression has not been investigated. Here, we have undertaken an in-depth molecular characterization of the PSORS1 interval, with a view to identifying regulatory variants that may contribute to disease susceptibility. By analysing high-density SNP data, we refined PSORS1 to a 179 kb region encompassing HLA-C and the neighbouring HCG27 pseudogene. We compared multiple MHC sequences spanning this refined locus and identified 144 candidate susceptibility variants, which are unique to chromosomes bearing HLA-Cw*0602. In parallel, we investigated the epigenetic profile of the critical PSORS1 interval and uncovered three enhancer elements likely to be active in T lymphocytes. Finally we showed that nine candidate susceptibility SNPs map within a HLA-C enhancer and that three of these variants co-localise with binding sites for immune-related transcription factors. These data indicate that SNPs affecting HLA-Cw*0602 expression are likely to contribute to psoriasis susceptibility and highlight the importance of integrating multiple experimental approaches in the investigation of complex genomic regions such as the MHC.

  14. Label-Free LC-MS/MS Proteomic Analysis of Cerebrospinal Fluid Identifies Protein/Pathway Alterations and Candidate Biomarkers for Amyotrophic Lateral Sclerosis.

    Science.gov (United States)

    Collins, Mahlon A; An, Jiyan; Hood, Brian L; Conrads, Thomas P; Bowser, Robert P

    2015-11-06

    Analysis of the cerebrospinal fluid (CSF) proteome has proven valuable to the study of neurodegenerative disorders. To identify new protein/pathway alterations and candidate biomarkers for amyotrophic lateral sclerosis (ALS), we performed comparative proteomic profiling of CSF from sporadic ALS (sALS), healthy control (HC), and other neurological disease (OND) subjects using label-free liquid chromatography-tandem mass spectrometry (LC-MS/MS). A total of 1712 CSF proteins were detected and relatively quantified by spectral counting. Levels of several proteins with diverse biological functions were significantly altered in sALS samples. Enrichment analysis was used to link these alterations to biological pathways, which were predominantly related to inflammation, neuronal activity, and extracellular matrix regulation. We then used our CSF proteomic profiles to create a support vector machines classifier capable of discriminating training set ALS from non-ALS (HC and OND) samples. Four classifier proteins, WD repeat-containing protein 63, amyloid-like protein 1, SPARC-like protein 1, and cell adhesion molecule 3, were identified by feature selection and externally validated. The resultant classifier distinguished ALS from non-ALS samples with 83% sensitivity and 100% specificity in an independent test set. Collectively, our results illustrate the utility of CSF proteomic profiling for identifying ALS protein/pathway alterations and candidate disease biomarkers.

  15. Low/Negative Expression of PDGFR-α Identifies the Candidate Primary Mesenchymal Stromal Cells in Adult Human Bone Marrow

    DEFF Research Database (Denmark)

    Li, Hongzhe; Ghazanfari, Roshanak; Zacharaki, Dimitra

    2014-01-01

    Human bone marrow (BM) contains a rare population of nonhematopoietic mesenchymal stromal cells (MSCs), which are of central importance for the hematopoietic microenvironment. However, the precise phenotypic definition of these cells in adult BM has not yet been reported. In this study, we show...... exhibited high levels of genes associated with mesenchymal lineages and HSC supportive function. Moreover, lin(-)/CD45(-)/CD271(+)/CD140a(low/-) cells effectively mediated the ex vivo expansion of transplantable CD34(+) hematopoietic stem cells. Taken together, these data indicate that CD140a is a key...... that low/negative expression of CD140a (PDGFR-α) on lin(-)/CD45(-)/CD271(+) BM cells identified a cell population with very high MSC activity, measured as fibroblastic colony-forming unit frequency and typical in vitro and in vivo stroma formation and differentiation capacities. Furthermore, these cells...

  16. The Use of Chemical-Chemical Interaction and Chemical Structure to Identify New Candidate Chemicals Related to Lung Cancer.

    Directory of Open Access Journals (Sweden)

    Lei Chen

    Full Text Available Lung cancer causes over one million deaths every year worldwide. However, prevention and treatment methods for this serious disease are limited. The identification of new chemicals related to lung cancer may aid in disease prevention and the design of more effective treatments. This study employed a weighted network, constructed using chemical-chemical interaction information, to identify new chemicals related to two types of lung cancer: non-small lung cancer and small-cell lung cancer. Then, a randomization test as well as chemical-chemical interaction and chemical structure information were utilized to make further selections. A final analysis of these new chemicals in the context of the current literature indicates that several chemicals are strongly linked to lung cancer.

  17. Metabolite profiling identifies candidate markers reflecting the clinical adaptations associated with Roux-en-Y gastric bypass surgery.

    Directory of Open Access Journals (Sweden)

    David M Mutch

    Full Text Available BACKGROUND: Roux-en-Y gastric bypass (RYGB surgery is associated with weight loss, improved insulin sensitivity and glucose homeostasis, and a reduction in co-morbidities such as diabetes and coronary heart disease. To generate further insight into the numerous metabolic adaptations associated with RYGB surgery, we profiled serum metabolites before and after gastric bypass surgery and integrated metabolite changes with clinical data. METHODOLOGY AND PRINCIPAL FINDINGS: Serum metabolites were detected by gas and liquid chromatography-coupled mass spectrometry before, and 3 and 6 months after RYGB in morbidly obese female subjects (n = 14; BMI = 46.2+/-1.7. Subjects showed decreases in weight-related parameters and improvements in insulin sensitivity post surgery. The abundance of 48% (83 of 172 of the measured metabolites changed significantly within the first 3 months post RYGB (p<0.05, including sphingosines, unsaturated fatty acids, and branched chain amino acids. Dividing subjects into obese (n = 9 and obese/diabetic (n = 5 groups identified 8 metabolites that differed consistently at all time points and whose serum levels changed following RYGB: asparagine, lysophosphatidylcholine (C18:2, nervonic (C24:1 acid, p-Cresol sulfate, lactate, lycopene, glucose, and mannose. Changes in the aforementioned metabolites were integrated with clinical data for body mass index (BMI and estimates for insulin resistance (HOMA-IR. Of these, nervonic acid was significantly and negatively correlated with HOMA-IR (p = 0.001, R = -0.55. CONCLUSIONS: Global metabolite profiling in morbidly obese subjects after RYGB has provided new information regarding the considerable metabolic alterations associated with this surgical procedure. Integrating clinical measurements with metabolomics data is capable of identifying markers that reflect the metabolic adaptations following RYGB.

  18. Inhibition of Thrombopoietin/Mpl Signaling in Adult Hematopoiesis Identifies New Candidates for Hematopoietic Stem Cell Maintenance.

    Science.gov (United States)

    Kohlscheen, Saskia; Wintterle, Sabine; Schwarzer, Adrian; Kamp, Christel; Brugman, Martijn H; Breuer, Daniel C; Büsche, Guntram; Baum, Christopher; Modlich, Ute

    2015-01-01

    Thrombopoietin (Thpo) signals via its receptor Mpl and regulates megakaryopoiesis, hematopoietic stem cell (HSC) maintenance and post-transplant expansion. Mpl expression is tightly controlled and deregulation of Thpo/Mpl-signaling is linked to hematological disorders. Here, we constructed an intracellular-truncated, signaling-deficient Mpl protein which is presented on the cell surface (dnMpl). The transplantation of bone marrow cells retrovirally transduced to express dnMpl into wildtype mice induced thrombocytopenia, and a progressive loss of HSC. The aplastic BM allowed the engraftment of a second BM transplant without further conditioning. Functional analysis of the truncated Mpl in vitro and in vivo demonstrated no internalization after Thpo binding and the inhibition of Thpo/Mpl-signaling in wildtype cells due to dominant-negative (dn) effects by receptor competition with wildtype Mpl for Thpo binding. Intracellular inhibition of Mpl could be excluded as the major mechanism by the use of a constitutive-dimerized dnMpl. To further elucidate the molecular changes induced by Thpo/Mpl-inhibition on the HSC-enriched cell population in the BM, we performed gene expression analysis of Lin-Sca1+cKit+ (LSK) cells isolated from mice transplanted with dnMpl transduced BM cells. The gene expression profile supported the exhaustion of HSC due to increased cell cycle progression and identified new and known downstream effectors of Thpo/Mpl-signaling in HSC (namely TIE2, ESAM1 and EPCR detected on the HSC-enriched LSK cell population). We further compared gene expression profiles in LSK cells of dnMpl mice with human CD34+ cells of aplastic anemia patients and identified similar deregulations of important stemness genes in both cell populations. In summary, we established a novel way of Thpo/Mpl inhibition in the adult mouse and performed in depth analysis of the phenotype including gene expression profiling.

  19. Modelling of genotype by environment interaction and prediction of complex traits across multiple environments as a synthesis of crop growth modelling, genetics and statistics

    OpenAIRE

    Bustos-Korts, Daniela

    2017-01-01

    The main objective of plant breeders is to create and identify genotypes that are well-adapted to the target population of environments (TPE). The TPE corresponds to the future growing conditions in which the varieties produced by a breeding program will be grown. All possible genotypes that could be considered as selection candidates for a specific TPE are said to belong to the target population of genotypes, TPG. Genotypes commonly show different sensitivities to environmental gradients and...

  20. Molecular profiling of aged neural progenitors identifies Dbx2 as a candidate regulator of age-associated neurogenic decline.

    Science.gov (United States)

    Lupo, Giuseppe; Nisi, Paola S; Esteve, Pilar; Paul, Yu-Lee; Novo, Clara Lopes; Sidders, Ben; Khan, Muhammad A; Biagioni, Stefano; Liu, Hai-Kun; Bovolenta, Paola; Cacci, Emanuele; Rugg-Gunn, Peter J

    2018-06-01

    Adult neurogenesis declines with aging due to the depletion and functional impairment of neural stem/progenitor cells (NSPCs). An improved understanding of the underlying mechanisms that drive age-associated neurogenic deficiency could lead to the development of strategies to alleviate cognitive impairment and facilitate neuroregeneration. An essential step towards this aim is to investigate the molecular changes that occur in NSPC aging on a genomewide scale. In this study, we compare the transcriptional, histone methylation and DNA methylation signatures of NSPCs derived from the subventricular zone (SVZ) of young adult (3 months old) and aged (18 months old) mice. Surprisingly, the transcriptional and epigenomic profiles of SVZ-derived NSPCs are largely unchanged in aged cells. Despite the global similarities, we detect robust age-dependent changes at several hundred genes and regulatory elements, thereby identifying putative regulators of neurogenic decline. Within this list, the homeobox gene Dbx2 is upregulated in vitro and in vivo, and its promoter region has altered histone and DNA methylation levels, in aged NSPCs. Using functional in vitro assays, we show that elevated Dbx2 expression in young adult NSPCs promotes age-related phenotypes, including the reduced proliferation of NSPC cultures and the altered transcript levels of age-associated regulators of NSPC proliferation and differentiation. Depleting Dbx2 in aged NSPCs caused the reverse gene expression changes. Taken together, these results provide new insights into the molecular programmes that are affected during mouse NSPC aging, and uncover a new functional role for Dbx2 in promoting age-related neurogenic decline. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  1. Candidate nematicidal proteins in a new Pseudomonas veronii isolate identified by its antagonistic properties against Xiphinema index.

    Science.gov (United States)

    Canchignia, Hayron; Altimira, Fabiola; Montes, Christian; Sánchez, Evelyn; Tapia, Eduardo; Miccono, María; Espinoza, Daniel; Aguirre, Carlos; Seeger, Michael; Prieto, Humberto

    2017-03-17

    The nematode Xiphinema index affects grape vines and transmits important viruses associated with fanleaf degeneration. Pseudomonas spp. are an extensive bacterial group in which important biodegradation and/or biocontrol properties can occur for several strains in the group. The aim of this study was to identify new Pseudomonas isolates with antagonist activity against X. index. Forty bacterial isolates were obtained from soil and root samples from Chilean vineyards. Thirteen new fluorescent pseudomonads were found and assessed for their antagonistic capability. The nematicide Pseudomonas protegens CHA0 was used as a control. Challenges of nematode individuals in King's B semi-solid agar Petri dishes facilitated the identification of the Pseudomonas veronii isolate R4, as determined by a 16S rRNA sequence comparison. This isolate was as effective as CHA0 as an antagonist of X. index, although it had a different lethality kinetic. Milk-induced R4 cultures exhibited protease and lipase activities in cell supernatants using both gelatin/tributyrin Petri dish assays and zymograms. Three proteins with these activities were isolated and subjected to mass spectrometry. Amino acid partial sequences enabled the identification of a 49-kDa protease similar to metalloprotease AprA and two lipases of 50 kDa and 69 kDa similar to LipA and ExoU, respectively. Electron microscopy analyses of challenged nematodes revealed degraded cuticle after R4 supernatant treatment. These results represent a new and unexplored property in this species associated with the presence of secretable lipases and protease, similar to characterized enzymes present in biocontrol pseudomonads.

  2. A Bayesian Framework for Generalized Linear Mixed Modeling Identifies New Candidate Loci for Late-Onset Alzheimer's Disease.

    Science.gov (United States)

    Wang, Xulong; Philip, Vivek M; Ananda, Guruprasad; White, Charles C; Malhotra, Ankit; Michalski, Paul J; Karuturi, Krishna R Murthy; Chintalapudi, Sumana R; Acklin, Casey; Sasner, Michael; Bennett, David A; De Jager, Philip L; Howell, Gareth R; Carter, Gregory W

    2018-03-05

    Recent technical and methodological advances have greatly enhanced genome-wide association studies (GWAS). The advent of low-cost whole-genome sequencing facilitates high-resolution variant identification, and the development of linear mixed models (LMM) allows improved identification of putatively causal variants. While essential for correcting false positive associations due to sample relatedness and population stratification, LMMs have commonly been restricted to quantitative variables. However, phenotypic traits in association studies are often categorical, coded as binary case-control or ordered variables describing disease stages. To address these issues, we have devised a method for genomic association studies that implements a generalized linear mixed model (GLMM) in a Bayesian framework, called Bayes-GLMM Bayes-GLMM has four major features: (1) support of categorical, binary and quantitative variables; (2) cohesive integration of previous GWAS results for related traits; (3) correction for sample relatedness by mixed modeling; and (4) model estimation by both Markov chain Monte Carlo (MCMC) sampling and maximal likelihood estimation. We applied Bayes-GLMM to the whole-genome sequencing cohort of the Alzheimer's Disease Sequencing Project (ADSP). This study contains 570 individuals from 111 families, each with Alzheimer's disease diagnosed at one of four confidence levels. With Bayes-GLMM we identified four variants in three loci significantly associated with Alzheimer's disease. Two variants, rs140233081 and rs149372995 lie between PRKAR1B and PDGFA The coded proteins are localized to the glial-vascular unit, and PDGFA transcript levels are associated with AD-related neuropathology. In summary, this work provides implementation of a flexible, generalized mixed model approach in a Bayesian framework for association studies. Copyright © 2018, Genetics.

  3. Microarray profiling of mononuclear peripheral blood cells identifies novel candidate genes related to chemoradiation response in rectal cancer.

    Directory of Open Access Journals (Sweden)

    Pablo Palma

    Full Text Available Preoperative chemoradiation significantly improves oncological outcome in locally advanced rectal cancer. However there is no effective method of predicting tumor response to chemoradiation in these patients. Peripheral blood mononuclear cells have emerged recently as pathology markers of cancer and other diseases, making possible their use as therapy predictors. Furthermore, the importance of the immune response in radiosensivity of solid organs led us to hypothesized that microarray gene expression profiling of peripheral blood mononuclear cells could identify patients with response to chemoradiation in rectal cancer. Thirty five 35 patients with locally advanced rectal cancer were recruited initially to perform the study. Peripheral blood samples were obtained before neaodjuvant treatment. RNA was extracted and purified to obtain cDNA and cRNA for hybridization of microarrays included in Human WG CodeLink bioarrays. Quantitative real time PCR was used to validate microarray experiment data. Results were correlated with pathological response, according to Mandard´s criteria and final UICC Stage (patients with tumor regression grade 1-2 and downstaging being defined as responders and patients with grade 3-5 and no downstaging as non-responders. Twenty seven out of 35 patients were finally included in the study. We performed a multiple t-test using Significance Analysis of Microarrays, to find those genes differing significantly in expression, between responders (n = 11 and non-responders (n = 16 to CRT. The differently expressed genes were: BC 035656.1, CIR, PRDM2, CAPG, FALZ, HLA-DPB2, NUPL2, and ZFP36. The measurement of FALZ (p = 0.029 gene expression level determined by qRT-PCR, showed statistically significant differences between the two groups. Gene expression profiling reveals novel genes in peripheral blood samples of mononuclear cells that could predict responders and non-responders to chemoradiation in patients with

  4. High-throughput genotyping in metastatic esophageal squamous cell carcinoma identifies phosphoinositide-3-kinase and BRAF mutations.

    Directory of Open Access Journals (Sweden)

    Chi Hoon Maeng

    Full Text Available Given the high incidence of metastatic esophageal squamous cell carcinoma, especially in Asia, we screened for the presence of somatic mutations using OncoMap platform with the aim of defining subsets of patients who may be potential candidate for targeted therapy.We analyzed 87 tissue specimens obtained from 80 patients who were pathologically confirmed with esophageal squamous cell carcinoma and received 5-fluoropyrimidine/platinum-based chemotherapy. OncoMap 4.0, a mass-spectrometry based assay, was used to interrogate 471 oncogenic mutations in 41 commonly mutated genes. Tumor specimens were prepared from primary cancer sites in 70 patients and from metastatic sites in 17 patients. In order to test the concordance between primary and metastatic sites from the patient for mutations, we analyzed 7 paired (primary-metastatic specimens. All specimens were formalin-fixed paraffin embedded tissues and tumor content was >70%.In total, we have detected 20 hotspot mutations out of 80 patients screened. The most frequent mutation was PIK3CA mutation (four E545K, five H1047R and one H1047L (N = 10, 11.5% followed by MLH1 V384D (N = 7, 8.0%, TP53 (R306, R175H and R273C (N = 3, 3.5%, BRAF V600E (N = 1, 1.2%, CTNNB1 D32N (N = 1, 1.2%, and EGFR P733L (N = 1, 1.2%. Distributions of somatic mutations were not different according to anatomic sites of esophageal cancer (cervical/upper, mid, lower. In addition, there was no difference in frequency of mutations between primary-metastasis paired samples.Our study led to the detection of potentially druggable mutations in esophageal SCC which may guide novel therapies in small subsets of esophageal cancer patients.

  5. Tensor decomposition-based unsupervised feature extraction identifies candidate genes that induce post-traumatic stress disorder-mediated heart diseases.

    Science.gov (United States)

    Taguchi, Y-H

    2017-12-21

    Although post-traumatic stress disorder (PTSD) is primarily a mental disorder, it can cause additional symptoms that do not seem to be directly related to the central nervous system, which PTSD is assumed to directly affect. PTSD-mediated heart diseases are some of such secondary disorders. In spite of the significant correlations between PTSD and heart diseases, spatial separation between the heart and brain (where PTSD is primarily active) prevents researchers from elucidating the mechanisms that bridge the two disorders. Our purpose was to identify genes linking PTSD and heart diseases. In this study, gene expression profiles of various murine tissues observed under various types of stress or without stress were analyzed in an integrated manner using tensor decomposition (TD). Based upon the obtained features, ∼ 400 genes were identified as candidate genes that may mediate heart diseases associated with PTSD. Various gene enrichment analyses supported biological reliability of the identified genes. Ten genes encoding protein-, DNA-, or mRNA-interacting proteins-ILF2, ILF3, ESR1, ESR2, RAD21, HTT, ATF2, NR3C1, TP53, and TP63-were found to be likely to regulate expression of most of these ∼ 400 genes and therefore are candidate primary genes that cause PTSD-mediated heart diseases. Approximately 400 genes in the heart were also found to be strongly affected by various drugs whose known adverse effects are related to heart diseases and/or fear memory conditioning; these data support the reliability of our findings. TD-based unsupervised feature extraction turned out to be a useful method for gene selection and successfully identified possible genes causing PTSD-mediated heart diseases.

  6. Transcriptome analysis of the fungal pathogen Fusarium oxysporum f. sp. medicaginis during colonisation of resistant and susceptible Medicago truncatula hosts identifies differential pathogenicity profiles and novel candidate effectors.

    Science.gov (United States)

    Thatcher, Louise F; Williams, Angela H; Garg, Gagan; Buck, Sally-Anne G; Singh, Karam B

    2016-11-03

    Pathogenic members of the Fusarium oxysporum species complex are responsible for vascular wilt disease on many important crops including legumes, where they can be one of the most destructive disease causing necrotrophic fungi. We previously developed a model legume-infecting pathosystem based on the reference legume Medicago truncatula and a pathogenic F. oxysporum forma specialis (f. sp.) medicaginis (Fom). To dissect the molecular pathogenicity arsenal used by this root-infecting pathogen, we sequenced its transcriptome during infection of a susceptible and resistant host accession. High coverage RNA-Seq of Fom infected root samples harvested from susceptible (DZA315) or resistant (A17) M. truncatula seedlings at early or later stages of infection (2 or 7 days post infection (dpi)) and from vegetative (in vitro) samples facilitated the identification of unique and overlapping sets of in planta differentially expressed genes. This included enrichment, particularly in DZA315 in planta up-regulated datasets, for proteins associated with sugar, protein and plant cell wall metabolism, membrane transport, nutrient uptake and oxidative processes. Genes encoding effector-like proteins were identified, including homologues of the F. oxysporum f. sp. lycopersici Secreted In Xylem (SIX) proteins, and several novel candidate effectors based on predicted secretion, small protein size and high in-planta induced expression. The majority of the effector candidates contain no known protein domains but do share high similarity to predicted proteins predominantly from other F. oxysporum ff. spp. as well as other Fusaria (F. solani, F. fujikori, F. verticilloides, F. graminearum and F. pseudograminearum), and from another wilt pathogen of the same class, a Verticillium species. Overall, this suggests these novel effector candidates may play important roles in Fusaria and wilt pathogen virulence. Combining high coverage in planta RNA-Seq with knowledge of fungal pathogenicity

  7. Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species.

    Science.gov (United States)

    Pottorff, Marti; Ehlers, Jeffrey D; Fatokun, Christian; Roberts, Philip A; Close, Timothy J

    2012-06-12

    Cowpea [Vigna unguiculata (L.) Walp] exhibits a considerable variation in leaf shape. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Leaf morphology was studied in the cowpea RIL population, Sanzi (sub-globose leaf shape) x Vita 7 (hastate leaf shape). A QTL for leaf shape, Hls (hastate leaf shape), was identified on the Sanzi x Vita 7 genetic map spanning from 56.54 cM to 67.54 cM distance on linkage group 15. SNP marker 1_0910 was the most significant over the two experiments, accounting for 74.7% phenotypic variance (LOD 33.82) in a greenhouse experiment and 71.5% phenotypic variance (LOD 30.89) in a field experiment. The corresponding Hls locus was positioned on the cowpea consensus genetic map on linkage group 4, spanning from 25.57 to 35.96 cM. A marker-trait association of the Hls region identified SNP marker 1_0349 alleles co-segregating with either the hastate or sub-globose leaf phenotype. High co-linearity was observed for the syntenic Hls region in Medicago truncatula and Glycine max. One syntenic locus for Hls was identified on Medicago chromosome 7 while syntenic regions for Hls were identified on two soybean chromosomes, 3 and 19. In all three syntenic loci, an ortholog for the EZA1/SWINGER (AT4G02020.1) gene was observed and is the candidate gene for the Hls locus. The Hls locus was identified on the cowpea physical map via SNP markers 1_0910, 1_1013 and 1_0992 which were identified in three BAC contigs; contig926, contig821 and contig25. This study has demonstrated how integrated genomic resources can be utilized for a candidate gene approach. Identification of genes which control leaf morphology may be utilized to improve the quality of cowpea leaves for vegetable and or forage markets as well as contribute to more fundamental research understanding the control of leaf shape in legumes.

  8. A comprehensive approach to identify reliable reference gene candidates to investigate the link between alcoholism and endocrinology in Sprague-Dawley rats.

    Directory of Open Access Journals (Sweden)

    Faten A Taki

    Full Text Available Gender and hormonal differences are often correlated with alcohol dependence and related complications like addiction and breast cancer. Estrogen (E2 is an important sex hormone because it serves as a key protein involved in organism level signaling pathways. Alcoholism has been reported to affect estrogen receptor signaling; however, identifying the players involved in such multi-faceted syndrome is complex and requires an interdisciplinary approach. In many situations, preliminary investigations included a straight forward, yet informative biotechniques such as gene expression analyses using quantitative real time PCR (qRT-PCR. The validity of qRT-PCR-based conclusions is affected by the choice of reliable internal controls. With this in mind, we compiled a list of 15 commonly used housekeeping genes (HKGs as potential reference gene candidates in rat biological models. A comprehensive comparison among 5 statistical approaches (geNorm, dCt method, NormFinder, BestKeeper, and RefFinder was performed to identify the minimal number as well the most stable reference genes required for reliable normalization in experimental rat groups that comprised sham operated (SO, ovariectomized rats in the absence (OVX or presence of E2 (OVXE2. These rat groups were subdivided into subgroups that received alcohol in liquid diet or isocalroic control liquid diet for 12 weeks. Our results showed that U87, 5S rRNA, GAPDH, and U5a were the most reliable gene candidates for reference genes in heart and brain tissue. However, different gene stability ranking was specific for each tissue input combination. The present preliminary findings highlight the variability in reference gene rankings across different experimental conditions and analytic methods and constitute a fundamental step for gene expression assays.

  9. Distinct high resolution genome profiles of early onset and late onset colorectal cancer integrated with gene expression data identify candidate susceptibility loci

    Directory of Open Access Journals (Sweden)

    Merok Marianne A

    2010-05-01

    Full Text Available Abstract Background Estimates suggest that up to 30% of colorectal cancers (CRC may develop due to an increased genetic risk. The mean age at diagnosis for CRC is about 70 years. Time of disease onset 20 years younger than the mean age is assumed to be indicative of genetic susceptibility. We have compared high resolution tumor genome copy number variation (CNV (Roche NimbleGen, 385 000 oligo CGH array in microsatellite stable (MSS tumors from two age groups, including 23 young at onset patients without known hereditary syndromes and with a median age of 44 years (range: 28-53 and 17 elderly patients with median age 79 years (range: 69-87. Our aim was to identify differences in the tumor genomes between these groups and pinpoint potential susceptibility loci. Integration analysis of CNV and genome wide mRNA expression data, available for the same tumors, was performed to identify a restricted candidate gene list. Results The total fraction of the genome with aberrant copy number, the overall genomic profile and the TP53 mutation spectrum were similar between the two age groups. However, both the number of chromosomal aberrations and the number of breakpoints differed significantly between the groups. Gains of 2q35, 10q21.3-22.1, 10q22.3 and 19q13.2-13.31 and losses from 1p31.3, 1q21.1, 2q21.2, 4p16.1-q28.3, 10p11.1 and 19p12, positions that in total contain more than 500 genes, were found significantly more often in the early onset group as compared to the late onset group. Integration analysis revealed a covariation of DNA copy number at these sites and mRNA expression for 107 of the genes. Seven of these genes, CLC, EIF4E, LTBP4, PLA2G12A, PPAT, RG9MTD2, and ZNF574, had significantly different mRNA expression comparing median expression levels across the transcriptome between the two groups. Conclusions Ten genomic loci, containing more than 500 protein coding genes, are identified as more often altered in tumors from early onset versus late

  10. The Use of High-Density SNP Array to Map Homozygosity in Consanguineous Families to Efficiently Identify Candidate Genes: Application to Woodhouse-Sakati Syndrome

    Directory of Open Access Journals (Sweden)

    Molly B. Sheridan

    2015-01-01

    Full Text Available Two consanguineous Qatari siblings presented for evaluation: a 17-4/12-year-old male with hypogonadotropic hypogonadism, alopecia, intellectual disability, and microcephaly and his 19-year-old sister with primary amenorrhea, alopecia, and normal cognition. Both required hormone treatment to produce secondary sex characteristics and pubertal development beyond Tanner 1. SNP array analysis of both probands was performed to detect shared regions of homozygosity which may harbor homozygous mutations in a gene causing their common features of abnormal pubertal development, alopecia, and variable cognitive delay. Our patients shared multiple homozygous genomic regions; ten shared regions were >1 Mb in length and constituted 0.99% of the genome. DCAF17, encoding a transmembrane nuclear protein of uncertain function, was the only gene identified in a homozygous region known to cause hypogonadotropic hypogonadism. DCAF17 mutations are associated with Woodhouse-Sakati syndrome, a rare disorder characterized by alopecia, hypogonadotropic hypogonadism, sensorineural hearing loss, diabetes mellitus, and extrapyramidal movements. Sequencing of the coding exons and flanking intronic regions of DCAF17 in the proband revealed homozygosity for a previously described founder mutation (c.436delC. Targeted DCAF17 sequencing of his affected sibling revealed the same homozygous mutation. This family illustrates the utility of SNP array testing in consanguineous families to efficiently and inexpensively identify regions of genomic homozygosity in which genetic candidates for recessive conditions can be identified.

  11. A Genome Wide Study of Copy Number Variation Associated with Nasopharyngeal Carcinoma in Malaysian Chinese Identifies CNVs at 11q14.3 and 6p21.3 as Candidate Loci

    Science.gov (United States)

    Low, Joyce Siew Yong; Chin, Yoon Ming; Mushiroda, Taisei; Kubo, Michiaki; Govindasamy, Gopala Krishnan; Pua, Kin Choo; Yap, Yoke Yeow; Yap, Lee Fah; Subramaniam, Selva Kumar; Ong, Cheng Ai; Tan, Tee Yong; Khoo, Alan Soo Beng; Ng, Ching Ching

    2016-01-01

    Background Nasopharyngeal carcinoma (NPC) is a neoplasm of the epithelial lining of the nasopharynx. Despite various reports linking genomic variants to NPC predisposition, very few reports were done on copy number variations (CNV). CNV is an inherent structural variation that has been found to be involved in cancer predisposition. Methods A discovery cohort of Malaysian Chinese descent (NPC patients, n = 140; Healthy controls, n = 256) were genotyped using Illumina® HumanOmniExpress BeadChip. PennCNV and cnvPartition calling algorithms were applied for CNV calling. Taqman CNV assays and digital PCR were used to validate CNV calls and replicate candidate copy number variant region (CNVR) associations in a follow-up Malaysian Chinese (NPC cases, n = 465; and Healthy controls, n = 677) and Malay cohort (NPC cases, n = 114; Healthy controls, n = 124). Results Six putative CNVRs overlapping GRM5, MICA/HCP5/HCG26, LILRB3/LILRA6, DPY19L2, RNase3/RNase2 and GOLPH3 genes were jointly identified by PennCNV and cnvPartition. CNVs overlapping GRM5 and MICA/HCP5/HCG26 were subjected to further validation by Taqman CNV assays and digital PCR. Combined analysis in Malaysian Chinese cohort revealed a strong association at CNVR on chromosome 11q14.3 (Pcombined = 1.54x10-5; odds ratio (OR) = 7.27; 95% CI = 2.96–17.88) overlapping GRM5 and a suggestive association at CNVR on chromosome 6p21.3 (Pcombined = 1.29x10-3; OR = 4.21; 95% CI = 1.75–10.11) overlapping MICA/HCP5/HCG26 genes. Conclusion Our results demonstrated the association of CNVs towards NPC susceptibility, implicating a possible role of CNVs in NPC development. PMID:26730743

  12. A Genome Wide Study of Copy Number Variation Associated with Nasopharyngeal Carcinoma in Malaysian Chinese Identifies CNVs at 11q14.3 and 6p21.3 as Candidate Loci.

    Directory of Open Access Journals (Sweden)

    Joyce Siew Yong Low

    Full Text Available Nasopharyngeal carcinoma (NPC is a neoplasm of the epithelial lining of the nasopharynx. Despite various reports linking genomic variants to NPC predisposition, very few reports were done on copy number variations (CNV. CNV is an inherent structural variation that has been found to be involved in cancer predisposition.A discovery cohort of Malaysian Chinese descent (NPC patients, n = 140; Healthy controls, n = 256 were genotyped using Illumina® HumanOmniExpress BeadChip. PennCNV and cnvPartition calling algorithms were applied for CNV calling. Taqman CNV assays and digital PCR were used to validate CNV calls and replicate candidate copy number variant region (CNVR associations in a follow-up Malaysian Chinese (NPC cases, n = 465; and Healthy controls, n = 677 and Malay cohort (NPC cases, n = 114; Healthy controls, n = 124.Six putative CNVRs overlapping GRM5, MICA/HCP5/HCG26, LILRB3/LILRA6, DPY19L2, RNase3/RNase2 and GOLPH3 genes were jointly identified by PennCNV and cnvPartition. CNVs overlapping GRM5 and MICA/HCP5/HCG26 were subjected to further validation by Taqman CNV assays and digital PCR. Combined analysis in Malaysian Chinese cohort revealed a strong association at CNVR on chromosome 11q14.3 (Pcombined = 1.54x10-5; odds ratio (OR = 7.27; 95% CI = 2.96-17.88 overlapping GRM5 and a suggestive association at CNVR on chromosome 6p21.3 (Pcombined = 1.29x10-3; OR = 4.21; 95% CI = 1.75-10.11 overlapping MICA/HCP5/HCG26 genes.Our results demonstrated the association of CNVs towards NPC susceptibility, implicating a possible role of CNVs in NPC development.

  13. Cross-species multiple environmental stress responses: An integrated approach to identify candidate genes for multiple stress tolerance in sorghum (Sorghum bicolor (L. Moench and related model species.

    Directory of Open Access Journals (Sweden)

    Adugna Abdi Woldesemayat

    Full Text Available Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations.In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO, Trait Ontology (TO, Plant Ontology (PO, Growth Ontology (GRO and Environment Ontology (EO were used to semantically integrate drought related information.Target genes linked to Quantitative Trait Loci (QTLs controlling yield and stress tolerance in sorghum (Sorghum bicolor (L. Moench and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%, salt (32%, cold (20%, heat (8% and oxidative stress (25% were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs

  14. Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

    Science.gov (United States)

    Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.

    2009-01-01

    Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

  15. A selective genotyping approach identifies single nucleotide polymorphisms in porcine chromosome 2 genes associated with production and carcass traits in Italian heavy pigs

    Directory of Open Access Journals (Sweden)

    Vincenzo Russo

    2011-04-01

    Full Text Available Several studies have shown that porcine chromosome 2 (SSC2 harbors important quantitative trait loci (QTL for production traits. In particular, an imprinted QTL for muscle mass production is determined by a mutation in the IGF2 gene (intron3-g.3072G>A. We recently identified and analysed single nucleotide polymorphisms (SNPs in genes (cathepsin D, CTSD g.70G>A; cathepsin F, CTSF g.22G>C; lactate dehydrogenase A, LDHA g.46G>T localized on SSC2 (including the IGF2 intron3-g.3072G>A SNP showing association with production traits in Italian Large White pigs and/or localizing them on QTL regions. Here we analysed these markers applying a selective genotyping approach based on estimated breeding values (EBVs. Three groups of Italian Large White pigs each made by animals with the most positive (n. 50 and most negative (n. 50 EBVs for average daily gain (ADG, backfat thickness (BFT or weight of lean cuts (LC and one group of Italian Duroc pigs made by 50 animals with most positive and 50 animals with most negative EBV for visible intermuscular fat (VIF were genotyped. In Italian Large White pigs, allele frequency differences for the IGF2 intron3-g.3072G>A SNP between the two extreme tails for all groups were highly significant (considering all analysed animals: P=9.53E-20 for LC; P=3.16E-15 for BFT; P=4.41E-6 for ADG. Significant allele frequency differences were also observed for the CTSD g.70G>A (P=0.0002 for ADG; P=0.00068 and LDHA g.46G>T (P=2.32E-5 for ADG polymorphisms. These results provide further support on the effects of these polymorphisms or genes whose application on marker assisted selection programs could be envisaged.

  16. Deep sequencing analysis of the transcriptomes of peanut aerial and subterranean young pods identifies candidate genes related to early embryo abortion.

    Science.gov (United States)

    Chen, Xiaoping; Zhu, Wei; Azam, Sarwar; Li, Heying; Zhu, Fanghe; Li, Haifen; Hong, Yanbin; Liu, Haiyan; Zhang, Erhua; Wu, Hong; Yu, Shanlin; Zhou, Guiyuan; Li, Shaoxiong; Zhong, Ni; Wen, Shijie; Li, Xingyu; Knapp, Steve J; Ozias-Akins, Peggy; Varshney, Rajeev K; Liang, Xuanqiang

    2013-01-01

    The failure of peg penetration into the soil leads to seed abortion in peanut. Knowledge of genes involved in these processes is comparatively deficient. Here, we used RNA-seq to gain insights into transcriptomes of aerial and subterranean pods. More than 2 million transcript reads with an average length of 396 bp were generated from one aerial (AP) and two subterranean (SP1 and SP2) pod libraries using pyrosequencing technology. After assembly, sets of 49 632, 49 952 and 50 494 from a total of 74 974 transcript assembly contigs (TACs) were identified in AP, SP1 and SP2, respectively. A clear linear relationship in the gene expression level was observed between these data sets. In brief, 2194 differentially expressed TACs with a 99.0% true-positive rate were identified, among which 859 and 1068 TACs were up-regulated in aerial and subterranean pods, respectively. Functional analysis showed that putative function based on similarity with proteins catalogued in UniProt and gene ontology term classification could be determined for 59 342 (79.2%) and 42 955 (57.3%) TACs, respectively. A total of 2968 TACs were mapped to 174 KEGG pathways, of which 168 were shared by aerial and subterranean transcriptomes. TACs involved in photosynthesis were significantly up-regulated and enriched in the aerial pod. In addition, two senescence-associated genes were identified as significantly up-regulated in the aerial pod, which potentially contribute to embryo abortion in aerial pods, and in turn, to cessation of swelling. The data set generated in this study provides evidence for some functional genes as robust candidates underlying aerial and subterranean pod development and contributes to an elucidation of the evolutionary implications resulting from fruit development under light and dark conditions. © 2012 The Authors Plant Biotechnology Journal © 2012 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  17. Integration of sequence data from a Consanguineous family with genetic data from an outbred population identifies PLB1 as a candidate rheumatoid arthritis risk gene.

    Directory of Open Access Journals (Sweden)

    Yukinori Okada

    Full Text Available Integrating genetic data from families with highly penetrant forms of disease together with genetic data from outbred populations represents a promising strategy to uncover the complete frequency spectrum of risk alleles for complex traits such as rheumatoid arthritis (RA. Here, we demonstrate that rare, low-frequency and common alleles at one gene locus, phospholipase B1 (PLB1, might contribute to risk of RA in a 4-generation consanguineous pedigree (Middle Eastern ancestry and also in unrelated individuals from the general population (European ancestry. Through identity-by-descent (IBD mapping and whole-exome sequencing, we identified a non-synonymous c.2263G>C (p.G755R mutation at the PLB1 gene on 2q23, which significantly co-segregated with RA in family members with a dominant mode of inheritance (P = 0.009. We further evaluated PLB1 variants and risk of RA using a GWAS meta-analysis of 8,875 RA cases and 29,367 controls of European ancestry. We identified significant contributions of two independent non-coding variants near PLB1 with risk of RA (rs116018341 [MAF = 0.042] and rs116541814 [MAF = 0.021], combined P = 3.2 × 10(-6. Finally, we performed deep exon sequencing of PLB1 in 1,088 RA cases and 1,088 controls (European ancestry, and identified suggestive dispersion of rare protein-coding variant frequencies between cases and controls (P = 0.049 for C-alpha test and P = 0.055 for SKAT. Together, these data suggest that PLB1 is a candidate risk gene for RA. Future studies to characterize the full spectrum of genetic risk in the PLB1 genetic locus are warranted.

  18. Gene Network Construction from Microarray Data Identifies a Key Network Module and Several Candidate Hub Genes in Age-Associated Spatial Learning Impairment.

    Science.gov (United States)

    Uddin, Raihan; Singh, Shiva M

    2017-01-01

    As humans age many suffer from a decrease in normal brain functions including spatial learning impairments. This study aimed to better understand the molecular mechanisms in age-associated spatial learning impairment (ASLI). We used a mathematical modeling approach implemented in Weighted Gene Co-expression Network Analysis (WGCNA) to create and compare gene network models of young (learning unimpaired) and aged (predominantly learning impaired) brains from a set of exploratory datasets in rats in the context of ASLI. The major goal was to overcome some of the limitations previously observed in the traditional meta- and pathway analysis using these data, and identify novel ASLI related genes and their networks based on co-expression relationship of genes. This analysis identified a set of network modules in the young, each of which is highly enriched with genes functioning in broad but distinct GO functional categories or biological pathways. Interestingly, the analysis pointed to a single module that was highly enriched with genes functioning in "learning and memory" related functions and pathways. Subsequent differential network analysis of this "learning and memory" module in the aged (predominantly learning impaired) rats compared to the young learning unimpaired rats allowed us to identify a set of novel ASLI candidate hub genes. Some of these genes show significant repeatability in networks generated from independent young and aged validation datasets. These hub genes are highly co-expressed with other genes in the network, which not only show differential expression but also differential co-expression and differential connectivity across age and learning impairment. The known function of these hub genes indicate that they play key roles in critical pathways, including kinase and phosphatase signaling, in functions related to various ion channels, and in maintaining neuronal integrity relating to synaptic plasticity and memory formation. Taken together, they

  19. High-Content Screening in hPSC-Neural Progenitors Identifies Drug Candidates that Inhibit Zika Virus Infection in Fetal-like Organoids and Adult Brain.

    Science.gov (United States)

    Zhou, Ting; Tan, Lei; Cederquist, Gustav Y; Fan, Yujie; Hartley, Brigham J; Mukherjee, Suranjit; Tomishima, Mark; Brennand, Kristen J; Zhang, Qisheng; Schwartz, Robert E; Evans, Todd; Studer, Lorenz; Chen, Shuibing

    2017-08-03

    Zika virus (ZIKV) infects fetal and adult human brain and is associated with serious neurological complications. To date, no therapeutic treatment is available to treat ZIKV-infected patients. We performed a high-content chemical screen using human pluripotent stem cell-derived cortical neural progenitor cells (hNPCs) and found that hippeastrine hydrobromide (HH) and amodiaquine dihydrochloride dihydrate (AQ) can inhibit ZIKV infection in hNPCs. Further validation showed that HH also rescues ZIKV-induced growth and differentiation defects in hNPCs and human fetal-like forebrain organoids. Finally, HH and AQ inhibit ZIKV infection in adult mouse brain in vivo. Strikingly, HH suppresses viral propagation when administered to adult mice with active ZIKV infection, highlighting its therapeutic potential. Our approach highlights the power of stem cell-based screens and validation in human forebrain organoids and mouse models in identifying drug candidates for treating ZIKV infection and related neurological complications in fetal and adult patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L. Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

    Directory of Open Access Journals (Sweden)

    Renesh Bedre

    Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

  1. Transcriptomic Analysis Identifies Candidate Genes Related to Intramuscular Fat Deposition and Fatty Acid Composition in the Breast Muscle of Squabs (Columba

    Directory of Open Access Journals (Sweden)

    Manhong Ye

    2016-07-01

    Full Text Available Despite the fact that squab is consumed throughout the world because of its high nutritional value and appreciated sensory attributes, aspects related to its characterization, and in particular genetic issues, have rarely been studied. In this study, meat traits in terms of pH, water-holding capacity, intramuscular fat content, and fatty acid profile of the breast muscle of squabs from two meat pigeon breeds were determined. Breed-specific differences were detected in fat-related traits of intramuscular fat content and fatty acid composition. RNA-Sequencing was applied to compare the transcriptomes of muscle and liver tissues between squabs of two breeds to identify candidate genes associated with the differences in the capacity of fat deposition. A total of 27 differentially expressed genes assigned to pathways of lipid metabolism were identified, of which, six genes belonged to the peroxisome proliferator-activated receptor signaling pathway along with four other genes. Our results confirmed in part previous reports in livestock and provided also a number of genes which had not been related to fat deposition so far. These genes can serve as a basis for further investigations to screen markers closely associated with intramuscular fat content and fatty acid composition in squabs. The data from this study were deposited in the National Center for Biotechnology Information (NCBI’s Sequence Read Archive under the accession numbers SRX1680021 and SRX1680022. This is the first transcriptome analysis of the muscle and liver tissue in Columba using next generation sequencing technology. Data provided here are of potential value to dissect functional genes influencing fat deposition in squabs.

  2. Genome-wide analysis of the CCCH zinc finger family identifies tissue specific and stress responsive candidates in chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Pradhan, Seema; Kant, Chandra; Verma, Subodh; Bhatia, Sabhyata

    2017-01-01

    The CCCH zinc finger is a group of proteins characterised by a typical motif consisting of three cysteine residues and one histidine residue. These proteins have been reported to play important roles in regulation of plant growth, developmental processes and environmental responses. In the present study, genome wide analysis of the CCCH zinc finger gene family was carried out in the available chickpea genome. Various bioinformatics tools were employed to predict 58 CCCH zinc finger genes in chickpea (designated CarC3H1-58), which were analysed for their physio-chemical properties. Phylogenetic analysis classified the proteins into 12 groups in which members of a particular group had similar structural organization. Further, the numbers as well as the types of CCCH motifs present in the CarC3H proteins were compared with those from Arabidopsis and Medicago truncatula. Synteny analysis revealed valuable information regarding the evolution of this gene family. Tandem and segmental duplication events were identified and their Ka/Ks values revealed that the CarC3H gene family in chickpea had undergone purifying selection. Digital, as well as real time qRT-PCR expression analysis was performed which helped in identification of several CarC3H members that expressed preferentially in specific chickpea tissues as well as during abiotic stresses (desiccation, cold, salinity). Moreover, molecular characterization of an important member CarC3H45 was carried out. This study provides comprehensive genomic information about the important CCCH zinc finger gene family in chickpea. The identified tissue specific and abiotic stress specific CCCH genes could be potential candidates for further characterization to delineate their functional roles in development and stress.

  3. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  4. Intermediate phenotype analysis of patients, unaffected siblings, and healthy controls identifies VMAT2 as a candidate gene for psychotic disorder and neurocognition

    NARCIS (Netherlands)

    Simons, C.J.; van Winkel, R.; Bruggeman, R.; Cahn, W.; de Haan, L.; Kahn, R.S.; Krabbendam, L.; Linzen, D.; Myin-Germeys, I.; van Os, J; Wiersma, D.

    2013-01-01

    Psychotic disorders are associated with neurocognitive alterations that aggregate in unaffected family members, suggesting that genetic vulnerability to psychotic disorder impacts neurocognition. The aim of the present study was to investigate whether selected schizophrenia candidate single

  5. Genotyping panel for assessing response to cancer chemotherapy

    Directory of Open Access Journals (Sweden)

    Hampel Heather

    2008-06-01

    Full Text Available Abstract Background Variants in numerous genes are thought to affect the success or failure of cancer chemotherapy. Interindividual variability can result from genes involved in drug metabolism and transport, drug targets (receptors, enzymes, etc, and proteins relevant to cell survival (e.g., cell cycle, DNA repair, and apoptosis. The purpose of the current study is to establish a flexible, cost-effective, high-throughput genotyping platform for candidate genes involved in chemoresistance and -sensitivity, and treatment outcomes. Methods We have adopted SNPlex for genotyping 432 single nucleotide polymorphisms (SNPs in 160 candidate genes implicated in response to anticancer chemotherapy. Results The genotyping panels were applied to 39 patients with chronic lymphocytic leukemia undergoing flavopiridol chemotherapy, and 90 patients with colorectal cancer. 408 SNPs (94% produced successful genotyping results. Additional genotyping methods were established for polymorphisms undetectable by SNPlex, including multiplexed SNaPshot for CYP2D6 SNPs, and PCR amplification with fluorescently labeled primers for the UGT1A1 promoter (TAnTAA repeat polymorphism. Conclusion This genotyping panel is useful for supporting clinical anticancer drug trials to identify polymorphisms that contribute to interindividual variability in drug response. Availability of population genetic data across multiple studies has the potential to yield genetic biomarkers for optimizing anticancer therapy.

  6. Evaluation of candidate stromal epithelial cross-talk genes identifies association between risk of serous ovarian cancer and TERT, a cancer susceptibility "hot-spot".

    Directory of Open Access Journals (Sweden)

    Sharon E Johnatty

    2010-07-01

    Full Text Available We hypothesized that variants in genes expressed as a consequence of interactions between ovarian cancer cells and the host micro-environment could contribute to cancer susceptibility. We therefore used a two-stage approach to evaluate common single nucleotide polymorphisms (SNPs in 173 genes involved in stromal epithelial interactions in the Ovarian Cancer Association Consortium (OCAC. In the discovery stage, cases with epithelial ovarian cancer (n=675 and controls (n=1,162 were genotyped at 1,536 SNPs using an Illumina GoldenGate assay. Based on Positive Predictive Value estimates, three SNPs-PODXL rs1013368, ITGA6 rs13027811, and MMP3 rs522616-were selected for replication using TaqMan genotyping in up to 3,059 serous invasive cases and 8,905 controls from 16 OCAC case-control studies. An additional 18 SNPs with Pper-alleleor=0.5. However genotypes at TERT rs7726159 were associated with ovarian cancer risk in the smaller, five-study replication study (Pper-allele=0.03. Combined analysis of the discovery and replication sets for this TERT SNP showed an increased risk of serous ovarian cancer among non-Hispanic whites [adj. ORper-allele 1.14 (1.04-1.24 p=0.003]. Our study adds to the growing evidence that, like the 8q24 locus, the telomerase reverse transcriptase locus at 5p15.33, is a general cancer susceptibility locus.

  7. Systematic characterisation of disease associated balanced chromosome rearrangements by FISH: cytogenetically and genetically anchored YACs identify microdeletions and candidate regions for mental retardation genes

    DEFF Research Database (Denmark)

    Wirth, J; Nothwang, H G; van der Maarel, S

    1999-01-01

    the Mendelian Cytogenetics Network (MCN), a collaborative effort of, at present, 270 cytogenetic laboratories throughout the world. In this pilot study, we have characterised 10 different MR associated chromosome regions delineating candidate regions for MR. Five of these regions are narrowed to breakpoint...

  8. Identification of candidate genes for dyslexia susceptibility on chromosome 18.

    Directory of Open Access Journals (Sweden)

    Thomas S Scerri

    2010-10-01

    Full Text Available Six independent studies have identified linkage to chromosome 18 for developmental dyslexia or general reading ability. Until now, no candidate genes have been identified to explain this linkage. Here, we set out to identify the gene(s conferring susceptibility by a two stage strategy of linkage and association analysis.Linkage analysis: 264 UK families and 155 US families each containing at least one child diagnosed with dyslexia were genotyped with a dense set of microsatellite markers on chromosome 18. Association analysis: Using a discovery sample of 187 UK families, nearly 3000 SNPs were genotyped across the chromosome 18 dyslexia susceptibility candidate region. Following association analysis, the top ranking SNPs were then genotyped in the remaining samples. The linkage analysis revealed a broad signal that spans approximately 40 Mb from 18p11.2 to 18q12.2. Following the association analysis and subsequent replication attempts, we observed consistent association with the same SNPs in three genes; melanocortin 5 receptor (MC5R, dymeclin (DYM and neural precursor cell expressed, developmentally down-regulated 4-like (NEDD4L.Along with already published biological evidence, MC5R, DYM and NEDD4L make attractive candidates for dyslexia susceptibility genes. However, further replication and functional studies are still required.

  9. Common genotypes of hepatitis B virus

    International Nuclear Information System (INIS)

    Idrees, M.; Khan, S.; Riazuddin, S.

    2004-01-01

    Objective: To find out the frequency of common genotypes of hepatitis-B virus (HBV). Subjects and Methods: HBV genotypes were determined in 112 HBV DNA positive sera by a simple and precise molecular genotyping system base on PCR using type-specific primers for the determination of genotypes of HBV A through H. Results: Four genotypes (A,B,C and D) out of total eight reported genotypes so far were identified. Genotypes A, B and C were predominant. HBV genotype C was the most predominant in this collection, appearing in 46 samples (41.7%). However, the genotypes of a total of 5 (4.46%) samples could not be determined with the present genotyping system. Mixed genotypes were seen in 8(7.14% HBV) isolates. Five of these were infected with genotypes A/D whereas two were with genotypes C/D. One patient was infected with 4 genotypes (A/B/C/D). Genotype A (68%) was predominant in Sindh genotype C was most predominant in North West Frontier Province (NWFP) (68.96) whereas genotype C and B were dominant in Punjab (39.65% and 25.86% respectively). Conclusion: All the four common genotypes of HBV found worldwide (A,B,C and D) were isolated. Genotype C is the predominant Genotypes B and C are predominant in Punjab and N.W.F.P. whereas genotype A is predominant in Sindh. (author)

  10. Optical observations of the nearby galaxy IC342 with narrow band [SII] and hα filters. II - detection of 16 optically-identified supernova remnant candidates

    Directory of Open Access Journals (Sweden)

    Vučetić M.M.

    2015-01-01

    Full Text Available We present the detection of 16 optical supernova remnant (SNR candidates in the nearby spiral galaxy IC342. The candidates were detected by applying the [Sii]/Hα ratio criterion on observations made with the 2 m RCC telescope at Rozhen National Astronomical Observatory in Bulgaria. In this paper, we report the coordinates, diameters, Hα and [S ii] fluxes for 16 SNRs detected in two fields of view in the IC342 galaxy. Also, we estimate the contamination of total Hα flux from SNRs in the observed portion of IC342 to be 1.4%. This would represent the fractional error when the star formation rate (SFR for this galaxy is derived from the total galaxy’s Hα emission.

  11. Robust full-length hepatitis C virus genotype 2a and 2b infectious cultures using mutations identified by a systematic approach applicable to patient strains

    DEFF Research Database (Denmark)

    Li, Yi-Ping; Ramirez, Santseharay; Gottwein, Judith M

    2012-01-01

    Hepatitis C virus (HCV) infection is a leading cause of chronic liver diseases worldwide, but treatment options are limited. Basic HCV research required for vaccine and drug development has been hampered by inability to culture patient isolates, and to date only the JFH1 (genotype 2a) recombinant...... represents an important advance, and the approach used might permit culture development of other isolates, with implications for improved individualized treatments of HCV patients and for development of broadly efficient vaccines....

  12. Combined serial analysis of gene expression and transcription factor binding site prediction identifies novel-candidate-target genes of Nr2e1 in neocortex development.

    Science.gov (United States)

    Schmouth, Jean-François; Arenillas, David; Corso-Díaz, Ximena; Xie, Yuan-Yun; Bohacec, Slavita; Banks, Kathleen G; Bonaguro, Russell J; Wong, Siaw H; Jones, Steven J M; Marra, Marco A; Simpson, Elizabeth M; Wasserman, Wyeth W

    2015-07-24

    Nr2e1 (nuclear receptor subfamily 2, group e, member 1) encodes a transcription factor important in neocortex development. Previous work has shown that nuclear receptors can have hundreds of target genes, and bind more than 300 co-interacting proteins. However, recognition of the critical role of Nr2e1 in neural stem cells and neocortex development is relatively recent, thus the molecular mechanisms involved for this nuclear receptor are only beginning to be understood. Serial analysis of gene expression (SAGE), has given researchers both qualitative and quantitative information pertaining to biological processes. Thus, in this work, six LongSAGE mouse libraries were generated from laser microdissected tissue samples of dorsal VZ/SVZ (ventricular zone and subventricular zone) from the telencephalon of wild-type (Wt) and Nr2e1-null embryos at the critical development ages E13.5, E15.5, and E17.5. We then used a novel approach, implementing multiple computational methods followed by biological validation to further our understanding of Nr2e1 in neocortex development. In this work, we have generated a list of 1279 genes that are differentially expressed in response to altered Nr2e1 expression during in vivo neocortex development. We have refined this list to 64 candidate direct-targets of NR2E1. Our data suggested distinct roles for Nr2e1 during different neocortex developmental stages. Most importantly, our results suggest a possible novel pathway by which Nr2e1 regulates neurogenesis, which includes Lhx2 as one of the candidate direct-target genes, and SOX9 as a co-interactor. In conclusion, we have provided new candidate interacting partners and numerous well-developed testable hypotheses for understanding the pathways by which Nr2e1 functions to regulate neocortex development.

  13. Evaluation of the Morpho-physiology characteristics of maize inbred lines introduced from CIMMYT to identify the best candidates for planting in acidic soil in Jasinga, Indonesia

    Science.gov (United States)

    Lubis, K.; Sutjahjo, S. H.; Syukur, M.; Trikoesoemaningtyas

    2016-08-01

    Technological developments and climate change have affected crop planting strategies. For example, maize production has expanded to sub-optimal lands, including acidic soil common in areas like Indonesia. Breeding programs have created inbred lines of maize introduced from CIMMYT; they were tested locally in acidic soils to determine their adaptability and tolerance mechanisms. Breeds CLA 46 and NEI 9008 were found to be excellent candidates for acidic soil due to their ASI, high number of grains per year, and suitable dry seed weight.

  14. Identification of single nucleotide polymorphisms (SNPs) at candidate genes involved in abiotic stress in two Prosopis species of hybrids

    OpenAIRE

    Maria F. Pomponio; Susana Marcucci Poltri; Diego Lopez Lauenstein; Susana Torales

    2014-01-01

    Aim of the study: Identify and compare SNPs on candidate genes related to abiotic stress in Prosopis chilensis, Prosopis flexuosa and interspecific hybridsArea of the study: Chaco árido, Argentina. Material and Methods: Fragments from 6 candidate genes were sequenced in 60 genotypes. DNA polymorphisms were analyzed.Main Results: The analysis revealed that the hybrids had the highest rate of polymorphism, followed by P. flexuosa and P. chilensis, the values found are comparable to other forest...

  15. The EndoC-βH1 cell line is a valid model of human beta cells and applicable for screenings to identify novel drug target candidates.

    Science.gov (United States)

    Tsonkova, Violeta Georgieva; Sand, Fredrik Wolfhagen; Wolf, Xenia Asbæk; Grunnet, Lars Groth; Kirstine Ringgaard, Anna; Ingvorsen, Camilla; Winkel, Louise; Kalisz, Mark; Dalgaard, Kevin; Bruun, Christine; Fels, Johannes Josef; Helgstrand, Charlotte; Hastrup, Sven; Öberg, Fredrik Kryh; Vernet, Erik; Sandrini, Michael Paolo Bastner; Shaw, Allan Christian; Jessen, Carsten; Grønborg, Mads; Hald, Jacob; Willenbrock, Hanni; Madsen, Dennis; Wernersson, Rasmus; Hansson, Lena; Jensen, Jan Nygaard; Plesner, Annette; Alanentalo, Tomas; Petersen, Maja Borup Kjær; Grapin-Botton, Anne; Honoré, Christian; Ahnfelt-Rønne, Jonas; Hecksher-Sørensen, Jacob; Ravassard, Philippe; Madsen, Ole D; Rescan, Claude; Frogne, Thomas

    2018-02-01

    To characterize the EndoC-βH1 cell line as a model for human beta cells and evaluate its beta cell functionality, focusing on insulin secretion, proliferation, apoptosis and ER stress, with the objective to assess its potential as a screening platform for identification of novel anti-diabetic drug candidates. EndoC-βH1 was transplanted into mice for validation of in vivo functionality. Insulin secretion was evaluated in cells cultured as monolayer and as pseudoislets, as well as in diabetic mice. Cytokine induced apoptosis, glucolipotoxicity, and ER stress responses were assessed. Beta cell relevant mRNA and protein expression were investigated by qPCR and antibody staining. Hundreds of proteins or peptides were tested for their effect on insulin secretion and proliferation. Transplantation of EndoC-βH1 cells restored normoglycemia in streptozotocin induced diabetic mice. Both in vitro and in vivo, we observed a clear insulin response to glucose, and, in vitro, we found a significant increase in insulin secretion from EndoC-βH1 pseudoislets compared to monolayer cultures for both glucose and incretins. Apoptosis and ER stress were inducible in the cells and caspase 3/7 activity was elevated in response to cytokines, but not affected by the saturated fatty acid palmitate. By screening of various proteins and peptides, we found Bombesin (BB) receptor agonists and Pituitary Adenylate Cyclase-Activating Polypeptides (PACAP) to significantly induce insulin secretion and the proteins SerpinA6, STC1, and APOH to significantly stimulate proliferation. ER stress was readily induced by Tunicamycin and resulted in a reduction of insulin mRNA. Somatostatin (SST) was found to be expressed by 1% of the cells and manipulation of the SST receptors was found to significantly affect insulin secretion. Overall, the EndoC-βH1 cells strongly resemble human islet beta cells in terms of glucose and incretin stimulated insulin secretion capabilities. The cell line has an active

  16. The EndoC-βH1 cell line is a valid model of human beta cells and applicable for screenings to identify novel drug target candidates

    Directory of Open Access Journals (Sweden)

    Violeta Georgieva Tsonkova

    2018-02-01

    Full Text Available Objective: To characterize the EndoC-βH1 cell line as a model for human beta cells and evaluate its beta cell functionality, focusing on insulin secretion, proliferation, apoptosis and ER stress, with the objective to assess its potential as a screening platform for identification of novel anti-diabetic drug candidates. Methods: EndoC-βH1 was transplanted into mice for validation of in vivo functionality. Insulin secretion was evaluated in cells cultured as monolayer and as pseudoislets, as well as in diabetic mice. Cytokine induced apoptosis, glucolipotoxicity, and ER stress responses were assessed. Beta cell relevant mRNA and protein expression were investigated by qPCR and antibody staining. Hundreds of proteins or peptides were tested for their effect on insulin secretion and proliferation. Results: Transplantation of EndoC-βH1 cells restored normoglycemia in streptozotocin induced diabetic mice. Both in vitro and in vivo, we observed a clear insulin response to glucose, and, in vitro, we found a significant increase in insulin secretion from EndoC-βH1 pseudoislets compared to monolayer cultures for both glucose and incretins.Apoptosis and ER stress were inducible in the cells and caspase 3/7 activity was elevated in response to cytokines, but not affected by the saturated fatty acid palmitate.By screening of various proteins and peptides, we found Bombesin (BB receptor agonists and Pituitary Adenylate Cyclase-Activating Polypeptides (PACAP to significantly induce insulin secretion and the proteins SerpinA6, STC1, and APOH to significantly stimulate proliferation.ER stress was readily induced by Tunicamycin and resulted in a reduction of insulin mRNA. Somatostatin (SST was found to be expressed by 1% of the cells and manipulation of the SST receptors was found to significantly affect insulin secretion. Conclusions: Overall, the EndoC-βH1 cells strongly resemble human islet beta cells in terms of glucose and incretin stimulated

  17. Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    NARCIS (Netherlands)

    Vigorito, E.; Kuchenbaecker, K.B.; Beesley, J.; Adlard, J.; Agnarsson, B.A.; Andrulis, I.L.; Arun, B.K.; Barjhoux, L.; Belotti, M.; Benitez, J.; Berger, A.; Bojesen, A.; Bonanni, B.; Brewer, C.; Caldes, T.; Caligo, M.A.; Campbell, I.; Chan, S.B.; Claes, K.B.; Cohn, D.E.; Cook, J.; Daly, M.B.; Damiola, F.; Davidson, R.; Pauw, A. de; Delnatte, C.; Diez, O.; Domchek, S.M.; Dumont, M.; Durda, K.; Dworniczak, B.; Easton, D.F.; Eccles, D.; Edwinsdotter Ardnor, C.; Eeles, R.; Ejlertsen, B.; Ellis, S.; Evans, D.G.; Feliubadalo, L.; Fostira, F.; Foulkes, W.D.; Friedman, E.; Frost, D.; Gaddam, P.; Ganz, P.A.; Garber, J.; Garcia-Barberan, V.; Gauthier-Villars, M.; Gehrig, A.; Gerdes, A.M.; Giraud, S.; Godwin, A.K.; Goldgar, D.E.; Hake, C.R.; Hansen, T.V.; Healey, S.; Hodgson, S.; Hogervorst, F.B.; Houdayer, C.; Hulick, P.J.; Imyanitov, E.N.; Isaacs, C.; Izatt, L.; Izquierdo, A.; Jacobs, L; Jakubowska, A.; Janavicius, R.; Jaworska-Bieniek, K.; Jensen, U.B.; John, E.M.; Vijai, J.; Karlan, B.Y.; Kast, K.; Khan, S.; Kwong, A.; Laitman, Y.; Lester, J.; Lesueur, F.; Liljegren, A.; Lubinski, J.; Mai, P.L.; Manoukian, S.; Mazoyer, S.; Meindl, A.; Mensenkamp, A.R.; Montagna, M.; Nathanson, K.L.; Neuhausen, S.L.; Nevanlinna, H.; Niederacher, D.; Olah, E.; Olopade, O.I.; Ong, K.R.; Osorio, A.; Park, S.K.; Paulsson-Karlsson, Y.; Pedersen, I.S.; Peissel, B.; Peterlongo, P.; et al.,

    2016-01-01

    Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2

  18. Fine-Scale Mapping at 9p22.2 Identifies Candidate Causal Variants That Modify Ovarian Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    DEFF Research Database (Denmark)

    Vigorito, Elena; Kuchenbaecker, Karoline B; Beesley, Jonathan

    2016-01-01

    Population-based genome wide association studies have identified a locus at 9p22.2 associated with ovarian cancer risk, which also modifies ovarian cancer risk in BRCA1 and BRCA2 mutation carriers. We conducted fine-scale mapping at 9p22.2 to identify potential causal variants in BRCA1 and BRCA2 ...

  19. BEEF CATTLE MUSCULARITY CANDIDATE GENES

    Directory of Open Access Journals (Sweden)

    Irida Novianti

    2010-04-01

    Full Text Available Muscularity is a potential indicator for the selection of more productive cattle. Mapping quantitative trait loci (QTL for traits related to muscularity is useful to identify the genomic regions where the genes affecting muscularity reside. QTL analysis from a Limousin-Jersey double backcross herd was conducted using QTL Express software with cohort and breed as the fixed effects. Nine QTL suggested to have an association with muscularity were identified on cattle chromosomes BTA 1, 2, 3, 4, 5, 8, 12, 14 and 17. The myostatin gene is located at the centromeric end of chromosome 2 and not surprisingly, the Limousin myostatin F94L variant accounted for the QTL on BTA2. However, when the myostatin F94L genotype was included as an additional fixed effect, the QTL on BTA17 was also no longer significant. This result suggests that there may be gene(s that have epistatic effects with myostatin located on cattle chromosome 17. Based on the position of the QTL in base pairs, all the genes that reside in the region were determined using the Ensembl data base (www.ensembl.org. There were two potential candidate genes residing within these QTL regions were selected. They were Smad nuclear interacting protein 1 (SNIP1 and similar to follistatin-like 5 (FSTL5. (JIIPB 2010 Vol 20 No 1: 1-10

  20. RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

    Science.gov (United States)

    Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

    2015-01-01

    Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

  1. CGMIM: Automated text-mining of Online Mendelian Inheritance in Man (OMIM to identify genetically-associated cancers and candidate genes

    Directory of Open Access Journals (Sweden)

    Jones Steven

    2005-03-01

    Full Text Available Abstract Background Online Mendelian Inheritance in Man (OMIM is a computerized database of information about genes and heritable traits in human populations, based on information reported in the scientific literature. Our objective was to establish an automated text-mining system for OMIM that will identify genetically-related cancers and cancer-related genes. We developed the computer program CGMIM to search for entries in OMIM that are related to one or more cancer types. We performed manual searches of OMIM to verify the program results. Results In the OMIM database on September 30, 2004, CGMIM identified 1943 genes related to cancer. BRCA2 (OMIM *164757, BRAF (OMIM *164757 and CDKN2A (OMIM *600160 were each related to 14 types of cancer. There were 45 genes related to cancer of the esophagus, 121 genes related to cancer of the stomach, and 21 genes related to both. Analysis of CGMIM results indicate that fewer than three gene entries in OMIM should mention both, and the more than seven-fold discrepancy suggests cancers of the esophagus and stomach are more genetically related than current literature suggests. Conclusion CGMIM identifies genetically-related cancers and cancer-related genes. In several ways, cancers with shared genetic etiology are anticipated to lead to further etiologic hypotheses and advances regarding environmental agents. CGMIM results are posted monthly and the source code can be obtained free of charge from the BC Cancer Research Centre website http://www.bccrc.ca/ccr/CGMIM.

  2. LC-QTOF-MS identification of porcine-specific peptide in heat treated pork identifies candidate markers for meat species determination.

    Science.gov (United States)

    Sarah, S A; Faradalila, W N; Salwani, M S; Amin, I; Karsani, S A; Sazili, A Q

    2016-05-15

    The purpose of this study was to identify porcine-specific peptide markers from thermally processed meat that could differentiate pork from beef, chevon and chicken meat. In the initial stage, markers from tryptic digested protein of chilled, boiled and autoclaved pork were identified using LC-QTOF-MS. An MRM method was then established for verification. A thorough investigation of LC-QTOF-MS data showed that only seven porcine-specific peptides were consistently detected. Among these peptides, two were derived from lactate dehydrogenase, one from creatine kinase, and four from serum albumin protein. However, MRM could only detect four peptides (EVTEFAK, LVVITAGAR, FVIER and TVLGNFAAFVQK) that were consistently present in pork samples. In conclusion, meat species determination through a tandem mass spectrometry platform shows high potential in providing scientifically valid and reliable results even at peptide level. Besides, the specificity and selectivity offered by the proteomics approach also provide a robust platform for Halal authentication. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Desmanthus GENOTYPES

    Directory of Open Access Journals (Sweden)

    JOSÉ HENRIQUE DE ALBUQUERQUE RANGEL

    2015-01-01

    Full Text Available Desmanthus is a genus of forage legumes with potential to improve pastures and livestock produc-tion on clay soils of dry tropical and subtropical regions such as the existing in Brazil and Australia. Despite this patterns of natural or enforced after-ripening of Desmanthus seeds have not been well established. Four year old seed banks of nine Desmanthus genotypes at James Cook University were accessed for their patterns of seed softe-ning in response to a range of temperatures. Persistent seed banks were found to exist under all of the studied ge-notypes. The largest seeds banks were found in the genotypes CPI 78373 and CPI 78382 and the smallest in the genotypes CPI’s 37143, 67643, and 83563. An increase in the percentage of softened seeds was correlated with higher temperatures, in two patterns of response: in some accessions seeds were not significantly affected by tempe-ratures below 80º C; and in others, seeds become soft when temperature rose to as little as 60 ºC. At 80 °C the heat started to depress germination. High seed production of Desmanthus associated with dependence of seeds on eleva-ted temperatures to softening can be a very important strategy for plants to survive in dry tropical regions.

  4. Hepatitis C Virus: Virology and Genotypes

    KAUST Repository

    Abdelaziz, Ahmed

    2017-01-01

    Hepatitis C virus (HCV) is a major causative agent of chronic liver disease worldwide. HCV is characterized by genetic heterogeneity, with at least six genotypes identified. The geographic distribution of genotypes has shown variations in different

  5. Dense genotyping of immune-related loci identifies variants associated with clearance of HPV among HIV-positive women in the HIV epidemiology research study (HERS.

    Directory of Open Access Journals (Sweden)

    Staci L Sudenga

    Full Text Available Persistent high-risk human papillomavirus (HR-HPV is a necessary and causal factor of cervical cancer. Most women naturally clear HPV infections; however, the biological mechanisms related to HPV pathogenesis have not been clearly elucidated. Host genetic factors that specifically regulate immune response could play an important role. All HIV-positive women in the HIV Epidemiology Research Study (HERS with a HR-HPV infection and at least one follow-up biannual visit were included in the study. Cervicovaginal lavage samples were tested for HPV using type-specific HPV hybridization assays. Type-specific HPV clearance was defined as two consecutive HPV-negative tests after a positive test. DNA from participants was genotyped for 196,524 variants within 186 known immune related loci using the custom ImmunoChip microarray. To assess the influence of each single-nucleotide polymorphism (SNP with HR-HPV clearance, the Cox proportional hazards model with the Wei-Lin-Weissfeld approach was used, adjusting for CD4+ count, low risk HPV (LR-HPV co-infection, and relevant confounders. Three analytical models were performed: race-specific (African Americans (n = 258, European Americans (n = 87, Hispanics (n = 55, race-adjusted combined analysis, and meta-analysis of pooled independent race-specific analyses. Women were followed for a median time of 1,617 days. Overall, three SNPs (rs1112085, rs11102637, and rs12030900 in the MAGI-3 gene and one SNP (rs8031627 in the SMAD3 gene were associated with HR-HPV clearance (p<10(-6. A variant (rs1633038 in HLA-G were also significantly associated in African American. Results from this study support associations of immune-related genes, having potential biological mechanism, with differential cervical HR-HPV infection outcomes.

  6. Global MicroRNA Profiling in Human Bone Marrow Skeletal—Stromal or Mesenchymal–Stem Cells Identified Candidates for Bone Regeneration

    DEFF Research Database (Denmark)

    Chang, Chi Chih; Venø, Morten T.; Chen, Li

    2018-01-01

    Bone remodeling and regeneration are highly regulated multistep processes involving posttranscriptional regulation by microRNAs (miRNAs). Here, we performed a global profiling of differentially expressed miRNAs in bone-marrow-derived skeletal cells (BMSCs; also known as stromal or mesenchymal stem......RNAs for enhancing bone tissue regeneration. Scaffolds functionalized with miRNA nano-carriers enhanced osteoblastogenesis in 3D culture and retained this ability at least 2 weeks after storage. Additionally, anti-miR-222 enhanced in vivo ectopic bone formation through targeting the cell-cycle inhibitor CDKN1B...... cells) during in vitro osteoblast differentiation. We functionally validated the regulatory effects of several miRNAs on osteoblast differentiation and identified 15 miRNAs, most significantly miR-222 and miR-423, as regulators of osteoblastogenesis. In addition, we tested the possible targeting of mi...

  7. Exploration of 19 serotoninergic candidate genes in adults and children with attention-deficit/hyperactivity disorder identifies association for 5HT2A, DDC and MAOB.

    Science.gov (United States)

    Ribasés, M; Ramos-Quiroga, J A; Hervás, A; Bosch, R; Bielsa, A; Gastaminza, X; Artigas, J; Rodriguez-Ben, S; Estivill, X; Casas, M; Cormand, B; Bayés, M

    2009-01-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common psychiatric disorder in which different genetic and environmental susceptibility factors are involved. Several lines of evidence support the view that at least 30% of ADHD patients diagnosed in childhood continue to suffer the disorder during adulthood and that genetic risk factors may play an essential role in the persistence of the disorder throughout lifespan. Genetic, biochemical and pharmacological studies support the idea that the serotonin system participates in the etiology of ADHD. Based on these data, we aimed to analyze single nucleotide polymorphisms across 19 genes involved in the serotoninergic neurotransmission in a clinical sample of 451 ADHD patients (188 adults and 263 children) and 400 controls using a population-based association study. Several significant associations were found after correcting for multiple testing: (1) the DDC gene was strongly associated with both adulthood (P=0.00053; odds ratio (OR)=2.17) and childhood ADHD (P=0.0017; OR=1.90); (2) the MAOB gene was found specifically associated in the adult ADHD sample (P=0.0029; OR=1.90) and (3) the 5HT2A gene showed evidence of association only with the combined ADHD subtype both in adults (P=0.0036; OR=1.63) and children (P=0.0084; OR=1.49). Our data support the contribution of the serotoninergic system in the genetic predisposition to ADHD, identifying common childhood and adulthood ADHD susceptibility factors, associations that are specific to ADHD subtypes and one variant potentially involved in the continuity of the disorder throughout lifespan.

  8. Multiple nuclear and mitochondrial genotyping identifies emperors and large-eye breams (Teleostei : Lethrinidae) from New Caledonia and reveals new large-eye bream species

    OpenAIRE

    Borsa, Philippe; Collet, Adeline; Carassou, Laure; Ponton, Dominique; Chen, W. J.

    2010-01-01

    International audience; Species identification is fundamental to address questions about community ecology, biodiversity, conservation and resource management, at any life history stage. Current studies on fish larval ecology of tropical species are hampered by the lack of reliable and effective tools for identifying larvae at the species level. Emperors and large-eye breams comprise fish species from the perciform fish family Lethrinidae. They inhabit coastal and coral-reef habitats of the t...

  9. SNP high-throughput screening in grapevine using the SNPlex™ genotyping system

    Directory of Open Access Journals (Sweden)

    Velasco Riccardo

    2008-01-01

    Full Text Available Abstract Background Until recently, only a small number of low- and mid-throughput methods have been used for single nucleotide polymorphism (SNP discovery and genotyping in grapevine (Vitis vinifera L.. However, following completion of the sequence of the highly heterozygous genome of Pinot Noir, it has been possible to identify millions of electronic SNPs (eSNPs thus providing a valuable source for high-throughput genotyping methods. Results Herein we report the first application of the SNPlex™ genotyping system in grapevine aiming at the anchoring of an eukaryotic genome. This approach combines robust SNP detection with automated assay readout and data analysis. 813 candidate eSNPs were developed from non-repetitive contigs of the assembled genome of Pinot Noir and tested in 90 progeny of Syrah × Pinot Noir cross. 563 new SNP-based markers were obtained and mapped. The efficiency rate of 69% was enhanced to 80% when multiple displacement amplification (MDA methods were used for preparation of genomic DNA for the SNPlex assay. Conclusion Unlike other SNP genotyping methods used to investigate thousands of SNPs in a few genotypes, or a few SNPs in around a thousand genotypes, the SNPlex genotyping system represents a good compromise to investigate several hundred SNPs in a hundred or more samples simultaneously. Therefore, the use of the SNPlex assay, coupled with whole genome amplification (WGA, is a good solution for future applications in well-equipped laboratories.

  10. QTLs and potential candidate genes for heat stress tolerance identified from the mapping populations specifically segregating for Fv/Fm in wheat

    DEFF Research Database (Denmark)

    Sharma, Dew Kumari; Torp, Anna Maria; Rosenqvist, Eva

    2017-01-01

    Despite the fact that F-v/F-m (maximum quantum efficiency of photosystem II) is the most widely used parameter for a rapid non-destructive measure of stress detection in plants, there are barely any studies on the genetic understanding of this trait under heat stress. Our aim was to identify...... quantitative trait locus (QTL) and the potential candidate genes linked to F-v/F-m for improved photosynthesis under heat stress in wheat (Triticum aestivum L.). Three bi-parental F-2 mapping populations were generated by crossing three heat tolerant male parents (origin: Afghanistan and Pakistan) selected...... for high F-v/F-m with a common heat susceptible female parent (origin: Germany) selected for lowest F-v/F-m out of a pool of 1274 wheat cultivars of diverse geographic origin. Parents together with 140 F-2 individuals in each population were phenotyped by F-v/F-m under heat stress (40 degrees C for 3 days...

  11. Large-Scale Gene-Centric Meta-Analysis across 39 Studies Identifies Type 2 Diabetes Loci

    NARCIS (Netherlands)

    Saxena, Richa; Elbers, Clara C.; Guo, Yiran; Peter, Inga; Gaunt, Tom R.; Mega, Jessica L.; Lanktree, Matthew B.; Tare, Archana; Almoguera Castillo, Berta; Li, Yun R.; Johnson, Toby; Bruinenberg, Marcel; Gilbert-Diamond, Diane; Rajagopalan, Ramakrishnan; Voight, Benjamin F.; Balasubramanyam, Ashok; Barnard, John; Bauer, Florianne; Baumert, Jens; Bhangale, Tushar; Boehm, Bernhard O.; Braund, Peter S.; Burton, Paul R.; Chandrupatla, Hareesh R.; Clarke, Robert; Cooper-DeHoff, Rhonda M.; Crook, Errol D.; Davey-Smith, George; Day, Ian N.; de Boer, Anthonius; de Groot, Mark C. H.; Drenos, Fotios; Ferguson, Jane; Fox, Caroline S.; Furlong, Clement E.; Gibson, Quince; Gieger, Christian; Gilhuijs-Pederson, Lisa A.; Glessner, Joseph T.; Goel, Anuj; Gong, Yan; Grant, Struan F. A.; Kumari, Meena; van der Harst, Pim; van Vliet-Ostaptchouk, Jana V.; Verweij, Niek; Wolffenbuttel, Bruce H. R.; Hofker, Marten H.; Asselbergs, Folkert W.; Wijmenga, Cisca

    2012-01-01

    To identify genetic factors contributing to type 2 diabetes (T2D), we performed large-scale meta-analyses by using a custom similar to 50,000 SNP genotyping array (the ITMAT-Broad-CARe array) with similar to 2000 candidate genes in 39 multiethnic population-based studies, case-control studies, and

  12. Genotype X/C recombinant (putative genotype I) of hepatitis B virus is rare in Hanoi, Vietnam--genotypes B4 and C1 predominate.

    Science.gov (United States)

    Phung, Thi Bich Thuy; Alestig, Erik; Nguyen, Thanh Liem; Hannoun, Charles; Lindh, Magnus

    2010-08-01

    There are eight known genotypes of hepatitis B virus, A-H, and several subgenotypes, with rather well-defined geographic distributions. HBV genotypes were evaluated in 153 serum samples from Hanoi, Vietnam. Of the 87 samples that could be genotyped, genotype B was found in 67 (77%) and genotype C in 19 (22%). All genotype C strains were of subgenotype C1, and the majority of genotype B strains were B4, while a few were B2. The genotype X/C recombinant strain, identified previously in Swedish patients of indigenous Vietnamese origin, was found in one sample. This variant, proposed to be classified as genotype I, has been found recently also by others in Vietnam and Laos. The current study indicates that the genotype X/C recombinant may represent approximately 1% of the HBV strains circulating in Vietnam. (c) 2010 Wiley-Liss, Inc.

  13. Knowledge Discovery in Biological Databases for Revealing Candidate Genes Linked to Complex Phenotypes.

    Science.gov (United States)

    Hassani-Pak, Keywan; Rawlings, Christopher

    2017-06-13

    Genetics and "omics" studies designed to uncover genotype to phenotype relationships often identify large numbers of potential candidate genes, among which the causal genes are hidden. Scientists generally lack the time and technical expertise to review all relevant information available from the literature, from key model species and from a potentially wide range of related biological databases in a variety of data formats with variable quality and coverage. Computational tools are needed for the integration and evaluation of heterogeneous information in order to prioritise candidate genes and components of interaction networks that, if perturbed through potential interventions, have a positive impact on the biological outcome in the whole organism without producing negative side effects. Here we review several bioinformatics tools and databases that play an important role in biological knowledge discovery and candidate gene prioritization. We conclude with several key challenges that need to be addressed in order to facilitate biological knowledge discovery in the future.

  14. Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

    Science.gov (United States)

    Jespersen, David; Belanger, Faith C; Huang, Bingru

    2017-01-01

    Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

  15. Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

    Directory of Open Access Journals (Sweden)

    David Jespersen

    Full Text Available Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L. x creeping bentgrass (Agrostis stolonifera L. hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease, antioxidant defense (catalase and glutathione-S-transferase, energy metabolism (glyceraldehyde-3-phosphate dehydrogenase, cell expansion (expansin, and stress protection (heat shock proteins HSP26, HSP70, and HSP101. Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

  16. Expression of zinc and cadmium responsive genes in leaves of willow (Salix caprea L.) genotypes with different accumulation characteristics

    International Nuclear Information System (INIS)

    Konlechner, Cornelia; Türktaş, Mine; Langer, Ingrid; Vaculík, Marek; Wenzel, Walter W.; Puschenreiter, Markus; Hauser, Marie-Theres

    2013-01-01

    Salix caprea is well suited for phytoextraction strategies. In a previous survey we showed that genetically distinct S. caprea plants isolated from metal-polluted and unpolluted sites differed in their zinc (Zn) and cadmium (Cd) tolerance and accumulation abilities. To determine the molecular basis of this difference we examined putative homologues of genes involved in heavy metal responses and identified over 200 new candidates with a suppression subtractive hybridization (SSH) screen. Quantitative expression analyses of 20 genes in leaves revealed that some metallothioneins and cell wall modifying genes were induced irrespective of the genotype's origin and metal uptake capacity while a cysteine biosynthesis gene was expressed constitutively higher in the metallicolous genotype. The third and largest group of genes was only induced in the metallicolous genotype. These data demonstrate that naturally adapted woody non-model species can help to discover potential novel molecular mechanisms for metal accumulation and tolerance. -- Highlights: ► The transcriptional Zn/Cd response of the willow Salix caprea was quantified. ► Two genotypes from a highly contaminated and a control environment were compared. ► In addition to candidate genes an SSH library revealed over 200 metal induced genes. ► Constitutive upregulation and isolate-specific induction of genes were revealed. ► Willows adapt to environmental Zn/Cd contamination on the transcriptional level. -- Expression analyzes reveal different responses to Cd and Zn exposure of S. caprea genotypes with different heavy metal accumulation abilities

  17. Hepatitis C Virus: Virology and Genotypes

    KAUST Repository

    Abdelaziz, Ahmed

    2017-12-01

    Hepatitis C virus (HCV) is a major causative agent of chronic liver disease worldwide. HCV is characterized by genetic heterogeneity, with at least six genotypes identified. The geographic distribution of genotypes has shown variations in different parts of the world over the past decade because of variations in population structure, immigration, and routes of transmission. Genotype differences are of epidemiologic interest and help the study of viral transmission dynamics to trace the source of HCV infection in a given population. HCV genotypes are also of considerable clinical importance because they affect response to antiviral therapy and represent a challenging obstacle for vaccine development.

  18. Grain yield stability of early maize genotypes

    Directory of Open Access Journals (Sweden)

    Chitra Bahadur Kunwar

    2016-12-01

    Full Text Available The objective of this study was to estimate grain yield stability of early maize genotypes. Five early maize genotypes namely Pool-17, Arun1EV, Arun-4, Arun-2 and Farmer’s variety were evaluated using Randomized Complete Block Design along with three replications at four different locations namely Rampur, Rajahar, Pakhribas and Kabre districts of Nepal during summer seasons of three consecutive years from 2010 to 2012 under farmer’s fields. Genotype and genotype × environment (GGE biplot was used to identify superior genotype for grain yield and stability pattern. The genotypes Arun-1 EV and Arun-4 were better adapted for Kabre and Pakhribas where as pool-17 for Rajahar environments. The overall findings showed that Arun-1EV was more stable followed by Arun-2 therefore these two varieties can be recommended to farmers for cultivation in both environments.

  19. Genotyping isolates of the entomopathogenic fungus Beauveria ...

    African Journals Online (AJOL)

    Multi-locus denaturing gradient gel electrophoresis (DGGE) analysis was developed to investigate the genotypes of Beauveria bassiana sensu lato. ... These results demonstrated that multi-locus DGGE is a potentially useful molecular marker for genotyping, identifying and tracking the fates of experimentally released ...

  20. Citizen Candidates Under Uncertainty

    OpenAIRE

    Eguia, Jon X.

    2005-01-01

    In this paper we make two contributions to the growing literature on "citizen-candidate" models of representative democracy. First, we add uncertainty about the total vote count. We show that in a society with a large electorate, where the outcome of the election is uncertain and where winning candidates receive a large reward from holding office, there will be a two-candidate equilibrium and no equilibria with a single candidate. Second, we introduce a new concept of equilibrium, which we te...

  1. Genotypic diversity of european Phytophthora ramorum isolates based on SSR analysis

    Science.gov (United States)

    Kris Van Poucke; Annelies Vercauteren; Martine Maes; Sabine Werres; Kurt Heungens

    2013-01-01

    in Scotland were genotyped using seven microsatellite markers as described by Vercauteren et al. (2010). Thirty multilocus genotypes were identified within the Scottish population, with 51 percent of the isolates belonging to the main European genotype EU1MG1 and 13 unique detected genotypes. Ten of those genotypes were site specific, often represented by...

  2. Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

    Science.gov (United States)

    Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

    2017-06-14

    Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

  3. Comparative shoot proteome analysis of two potato (Solanum tuberosum L.) genotypes contrasting in nitrogen deficiency responses in vitro.

    Science.gov (United States)

    Meise, Philipp; Jozefowicz, Anna Maria; Uptmoor, Ralf; Mock, Hans-Peter; Ordon, Frank; Schum, Annegret

    2017-08-23

    Aiming at a better understanding of the physiological and biochemical background of nitrogen use efficiency, alterations in the shoot proteome under N-deficiency were investigated in two contrasting potato genotypes grown in vitro with 60 and 7.5mM N, respectively. A gel based proteomic approach was applied to identify candidate proteins associated with genotype specific responses to N-deficiency. 21% of the detected proteins differed in abundance between the two genotypes. Between control and N-deficiency conditions 19.5% were differentially accumulated in the sensitive and 15% in the tolerant genotype. 93% of the highly N-deficiency responsive proteins were identified by MALDI TOF/TOF mass spectrometry. The major part was associated with photosynthesis, carbohydrate metabolism, stress response and regulation. Differential accumulation of enzymes involved in the Calvin cycle and glycolysis suggest activation of alternative carbohydrate pathways. In the tolerant genotype, increased abundance under N-deficiency was also found for enzymes involved in chlorophyll synthesis and stability of enzymes, which increase photosynthetic carbon fixation efficiency. Out of a total of 106 differentially abundant proteins, only eight were detected in both genotypes. Our findings suggest that mutually responsive proteins reflect universal stress responses while adaptation to N-deficiency in metabolic pathways is more genotype specific. Nitrogen losses from arable farm land considerably contribute to environmental pollution. In potato, this is a special problem due cultivation on light soils, irrigation and the shallow root system. Therefore, breeding of cultivars with improved nitrogen use efficiency and stable yields under reduced N fertilization is an important issue. Knowledge of genotype dependent adaptation to N-deficiency at the proteome level can help to understand regulation of N efficiency and development of N-efficient cultivars. Copyright © 2017 Elsevier B.V. All rights

  4. Dengue virus 2 American-Asian genotype identified during the 2006/2007 outbreak in Piauí, Brazil reveals a Caribbean route of introduction and dissemination of dengue virus in Brazil.

    Directory of Open Access Journals (Sweden)

    Leandra Barcelos Figueiredo

    Full Text Available Dengue virus (DENV is the most widespread arthropod-borne virus, and the number and severity of outbreaks has increased worldwide in recent decades. Dengue is caused by DENV-1, DENV- 2, DENV-3 and DENV-4 which are genetically distant. The species has been subdivided into genotypes based on phylogenetic studies. DENV-2, which was isolated from dengue fever patients during an outbreak in Piaui, Brazil in 2006/2007 was analyzed by sequencing the envelope (E gene. The results indicated a high similarity among the isolated viruses, as well as to other DENV-2 from Brazil, Central America and South America. A phylogenetic and phylogeographic analysis based on DENV-2E gene sequences revealed that these viruses are grouped together with viruses of the American-Asian genotype in two distinct lineages. Our results demonstrate the co-circulation of two American-Asian genotype lineages in northeast Brazil. Moreover, we reveal that DENV-2 lineage 2 was detected in Piauí before it disseminated to other Brazilian states and South American countries, indicating the existence of a new dissemination route that has not been previously described.

  5. The potential of plant viruses to promote genotypic diversity via genotype x environment interactions

    DEFF Research Database (Denmark)

    van Mölken, Tamara; Stuefer, Josef F.

    2011-01-01

    † Background and Aims Genotype by environment (G × E) interactions are important for the long-term persistence of plant species in heterogeneous environments. It has often been suggested that disease is a key factor for the maintenance of genotypic diversity in plant populations. However, empirical...... and the G × E interactions were examined with respect to genotypespecific plant responses to WClMV infection. Thus, the environment is defined as the presence or absence of the virus. † Key Results WClMV had a negative effect on plant performance as shown by a decrease in biomass and number of ramets...... evidence for this contention is scarce. Here virus infection is proposed as a possible candidate for maintaining genotypic diversity in their host plants. † Methods The effects of White clover mosaic virus (WClMV) on the performance and development of different Trifolium repens genotypes were analysed...

  6. Evaluation of promising sweetpotato genotypes for high altitude ...

    African Journals Online (AJOL)

    The trials were set up to identify sweetpotato genotypes with adaptation to highland agroecologies with special reference to resistance to Ahemaria blight ... growth and at harvest, four genotypes and the local check, Magabari, bad high levels of resistance toA/Jemaria blight. Eight genotypes had total storage root yield ...

  7. Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

    Science.gov (United States)

    Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

    2013-01-01

    Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, ppopulation. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

  8. Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

    Directory of Open Access Journals (Sweden)

    Shafat Ali

    Full Text Available Type 2 diabetes (T2D is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E-04 with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08 in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59 when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

  9. Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.

    Science.gov (United States)

    Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne

    2018-01-10

    Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.

  10. Validation of candidate genes associated with cardiovascular risk factors in psychiatric patients

    Science.gov (United States)

    Windemuth, Andreas; de Leon, Jose; Goethe, John W.; Schwartz, Harold I.; Woolley, Stephen; Susce, Margaret; Kocherla, Mohan; Bogaard, Kali; Holford, Theodore R.; Seip, Richard L.; Ruaño, Gualberto

    2016-01-01

    The purpose of this study was to identify genetic variants predictive of cardiovascular risk factors in a psychiatric population treated with second generation antipsychotics (SGA). 924 patients undergoing treatment for severe mental illness at four US hospitals were genotyped at 1.2 million single nucleotide polymorphisms. Patients were assessed for fasting serum lipid (low density lipoprotein cholesterol [LDLc], high density lipoprotein cholesterol [HDLc], and triglycerides) and obesity phenotypes (body mass index, BMI). Thirteen candidate genes from previous studies of the same phenotypes in non-psychiatric populations were tested for association. We confirmed 8 of the 13 candidate genes at the 95% confidence level. An increased genetic effect size was observed for triglycerides in the psychiatric population compared to that in the cardiovascular population. PMID:21851846

  11. Analysis of Polymorphic Membrane Protein Expression in Cultured Cells Identifies PmpA and PmpH of Chlamydia psittaci as Candidate Factors in Pathogenesis and Immunity to Infection.

    Science.gov (United States)

    Van Lent, Sarah; De Vos, Winnok H; Huot Creasy, Heather; Marques, Patricia X; Ravel, Jacques; Vanrompay, Daisy; Bavoil, Patrik; Hsia, Ru-Ching

    2016-01-01

    The polymorphic membrane protein (Pmp) paralogous families of Chlamydia trachomatis, Chlamydia pneumoniae and Chlamydia abortus are putative targets for Chlamydia vaccine development. To determine whether this is also the case for Pmp family members of C. psittaci, we analyzed transcription levels, protein production and localization of several Pmps of C. psittaci. Pmp expression profiles were characterized using quantitative real-time PCR (RT-qPCR), immunofluorescence (IF) and immuno-electron microscopy (IEM) under normal and stress conditions. We found that PmpA was highly produced in all inclusions as early as 12 hpi in all biological replicates. In addition, PmpA and PmpH appeared to be unusually accessible to antibody as determined by both immunofluorescence and immuno-electron microscopy. Our results suggest an important role for these Pmps in the pathogenesis of C. psittaci, and make them promising candidates in vaccine development.

  12. Candidate cave entrances on Mars

    Science.gov (United States)

    Cushing, Glen E.

    2012-01-01

    This paper presents newly discovered candidate cave entrances into Martian near-surface lava tubes, volcano-tectonic fracture systems, and pit craters and describes their characteristics and exploration possibilities. These candidates are all collapse features that occur either intermittently along laterally continuous trench-like depressions or in the floors of sheer-walled atypical pit craters. As viewed from orbit, locations of most candidates are visibly consistent with known terrestrial features such as tube-fed lava flows, volcano-tectonic fractures, and pit craters, each of which forms by mechanisms that can produce caves. Although we cannot determine subsurface extents of the Martian features discussed here, some may continue unimpeded for many kilometers if terrestrial examples are indeed analogous. The features presented here were identified in images acquired by the Mars Odyssey's Thermal Emission Imaging System visible-wavelength camera, and by the Mars Reconnaissance Orbiter's Context Camera. Select candidates have since been targeted by the High-Resolution Imaging Science Experiment. Martian caves are promising potential sites for future human habitation and astrobiology investigations; understanding their characteristics is critical for long-term mission planning and for developing the necessary exploration technologies.

  13. Correlation of Lactobacillus rhamnosus Genotypes and Carbohydrate Utilization Signatures Determined by Phenotype Profiling.

    Science.gov (United States)

    Ceapa, Corina; Lambert, Jolanda; van Limpt, Kees; Wels, Michiel; Smokvina, Tamara; Knol, Jan; Kleerebezem, Michiel

    2015-08-15

    Lactobacillus rhamnosus is a bacterial species commonly colonizing the gastrointestinal (GI) tract of humans and also frequently used in food products. While some strains have been studied extensively, physiological variability among isolates of the species found in healthy humans or their diet is largely unexplored. The aim of this study was to characterize the diversity of carbohydrate utilization capabilities of human isolates and food-derived strains of L. rhamnosus in relation to their niche of isolation and genotype. We investigated the genotypic and phenotypic diversity of 25 out of 65 L. rhamnosus strains from various niches, mainly human feces and fermented dairy products. Genetic fingerprinting of the strains by amplified fragment length polymorphism (AFLP) identified 11 distinct subgroups at 70% similarity and suggested niche enrichment within particular genetic clades. High-resolution carbohydrate utilization profiling (OmniLog) identified 14 carbon sources that could be used by all of the strains tested for growth, while the utilization of 58 carbon sources differed significantly between strains, enabling the stratification of L. rhamnosus strains into three metabolic clusters that partially correlate with the genotypic clades but appear uncorrelated with the strain's origin of isolation. Draft genome sequences of 8 strains were generated and employed in a gene-trait matching (GTM) analysis together with the publicly available genomes of L. rhamnosus GG (ATCC 53103) and HN001 for several carbohydrates that were distinct for the different metabolic clusters: l-rhamnose, cellobiose, l-sorbose, and α-methyl-d-glucoside. From the analysis, candidate genes were identified that correlate with l-sorbose and α-methyl-d-glucoside utilization, and the proposed function of these genes could be confirmed by heterologous expression in a strain lacking the genes. This study expands our insight into the phenotypic and genotypic diversity of the species L. rhamnosus

  14. Hepatitis B virus genotypes circulating in Brazil: molecular characterization of genotype F isolates

    Directory of Open Access Journals (Sweden)

    Virgolino Helaine A

    2007-11-01

    Full Text Available Abstract Background Hepatitis B virus (HBV isolates have been classified in eight genotypes, A to H, which exhibit distinct geographical distributions. Genotypes A, D and F are predominant in Brazil, a country formed by a miscegenated population, where the proportion of individuals from Caucasian, Amerindian and African origins varies by region. Genotype F, which is the most divergent, is considered indigenous to the Americas. A systematic molecular characterization of HBV isolates from different parts of the world would be invaluable in establishing HBV evolutionary origins and dispersion patterns. A large-scale study is needed to map the region-by-region distribution of the HBV genotypes in Brazil. Results Genotyping by PCR-RFLP of 303 HBV isolates from HBsAg-positive blood donors showed that at least two of the three genotypes, A, D, and F, co-circulate in each of the five geographic regions of Brazil. No other genotypes were identified. Overall, genotype A was most prevalent (48.5%, and most of these isolates were classified as subgenotype A1 (138/153; 90.2%. Genotype D was the most common genotype in the South (84.2% and Central (47.6% regions. The prevalence of genotype F was low (13% countrywide. Nucleotide sequencing of the S gene and a phylogenetic analysis of 32 HBV genotype F isolates showed that a great majority (28/32; 87.5% belonged to subgenotype F2, cluster II. The deduced serotype of 31 of 32 F isolates was adw4. The remaining isolate showed a leucine-to-isoleucine substitution at position 127. Conclusion The presence of genotypes A, D and F, and the absence of other genotypes in a large cohort of HBV infected individuals may reflect the ethnic origins of the Brazilian population. The high prevalence of isolates from subgenotype A1 (of African origin indicates that the African influx during the colonial slavery period had a major impact on the circulation of HBV genotype A currently found in Brazil. Although most genotype F

  15. Polymorphisms of candidate genes associated with meat quality and ...

    African Journals Online (AJOL)

    Hung Nguyen

    Abstract. The objectives of this study were to analyse genotype distribution and sequence variations of candidate genes putatively associated with meat quality and disease resistance in exotic and indigenous. Vietnamese pig breeds. For this purpose, 340 pigs from four indigenous and two exotic breeds were included.

  16. Polymorphisms of candidate genes associated with meat quality and ...

    African Journals Online (AJOL)

    The objectives of this study were to analyse genotype distribution and sequence variations of candidate genes putatively associated with meat quality and disease resistance in exotic and indigenous Vietnamese pig breeds. For this purpose, 340 pigs from four indigenous and two exotic breeds were included in the analysis ...

  17. A Public Platform for the Verification of the Phenotypic Effect of Candidate Genes for Resistance to Aflatoxin Accumulation and Aspergillus flavus Infection in Maize

    Directory of Open Access Journals (Sweden)

    Xueyan Shan

    2011-06-01

    Full Text Available A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel and SNP genotyping in the population(s for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

  18. Existence of various human parvovirus B19 genotypes in Chinese plasma pools: genotype 1, genotype 3, putative intergenotypic recombinant variants and new genotypes.

    Science.gov (United States)

    Jia, Junting; Ma, Yuyuan; Zhao, Xiong; Huangfu, Chaoji; Zhong, Yadi; Fang, Chi; Fan, Rui; Lv, Maomin; Zhang, Jingang

    2016-09-17

    Human parvovirus B19 (B19V) is a frequent contaminant of blood and plasma-derived medicinal products. Three distinct genotypes of B19V have been identified. The distribution of the three B19V genotypes has been investigated in various regions or countries. However, in China, data on the existence of different B19V genotypes are limited. One hundred and eighteen B19V-DNA positive source plasma pool samples collected from three Chinese blood products manufacturers were analyzed. The subgenomic NS1/VP1u region junction of B19V was amplified by nested PCR. These amplified products were then cloned and subsequently sequenced. For genotyping, their phylogenetic inferences were constructed based on the NS1/VP1-unique region. Then putative recombination events were analyzed and identified. Phylogenetic analysis of 118 B19V sequences attributed 61.86 % to genotype 1a, 10.17 % to genotype 1b, and 17.80 % to genotype 3b. All the genotype 3b sequences obtained in this study grouped as a specific, closely related cluster with B19V strain D91.1. Four 1a/3b recombinants and 5 new atypical B19V variants with no recombination events were identified. There were at least 3 subtypes (1a, 1b and 3b) of B19V circulating in China. Furthermore, putative B19V 1a/3b recombinants and unclassified strains were identified as well. Such recombinant and unclassified strains may contribute to the genetic diversity of B19V and consequently complicate the B19V infection diagnosis and NAT screening. Further studies will be required to elucidate the biological significance of the recombinant and unclassified strains.

  19. Genotyping of Coxiella burnetii from domestic ruminants in northern Spain

    Directory of Open Access Journals (Sweden)

    Astobiza Ianire

    2012-12-01

    Full Text Available Abstract Background Information on the genotypic diversity of Coxiella burnetii isolates from infected domestic ruminants in Spain is limited. The aim of this study was to identify the C. burnetii genotypes infecting livestock in Northern Spain and compare them to other European genotypes. A commercial real-time PCR targeting the IS1111a insertion element was used to detect the presence of C. burnetii DNA in domestic ruminants from Spain. Genotypes were determined by a 6-loci Multiple Locus Variable number tandem repeat analysis (MLVA panel and Multispacer Sequence Typing (MST. Results A total of 45 samples from 4 goat herds (placentas, N = 4, 12 dairy cattle herds (vaginal mucus, individual milk, bulk tank milk, aerosols, N = 20 and 5 sheep flocks (placenta, vaginal swabs, faeces, air samples, dust, N = 21 were included in the study. Samples from goats and sheep were obtained from herds which had suffered abortions suspected to be caused by C. burnetii, whereas cattle samples were obtained from animals with reproductive problems compatible with C. burnetii infection, or consisted of bulk tank milk (BTM samples from a Q fever surveillance programme. C. burnetii genotypes identified in ruminants from Spain were compared to those detected in other countries. Three MLVA genotypes were found in 4 goat farms, 7 MLVA genotypes were identified in 12 cattle herds and 4 MLVA genotypes were identified in 5 sheep flocks. Clustering of the MLVA genotypes using the minimum spanning tree method showed a high degree of genetic similarity between most MLVA genotypes. Overall 11 different MLVA genotypes were obtained corresponding to 4 different MST genotypes: MST genotype 13, identified in goat, sheep and cattle from Spain; MST genotype 18, only identified in goats; and, MST genotypes 8 and 20, identified in small ruminants and cattle, respectively. All these genotypes had been previously identified in animal and human clinical samples from several

  20. Microbe-ID: An open source toolbox for microbial genotyping and species identification

    Science.gov (United States)

    Development of tools to identify species, genotypes, or novel strains of invasive organisms is critical for monitoring emergence and implementing rapid response measures. Molecular markers, although critical to identifying species or genotypes, require bioinformatic tools for analysis. However, user...

  1. Impact of inter-genotypic recombination and probe cross-reactivity on the performance of the Abbott RealTime HCV Genotype II assay for hepatitis C genotyping.

    Science.gov (United States)

    Sridhar, Siddharth; Yip, Cyril C Y; Chan, Jasper F W; To, Kelvin K W; Cheng, Vincent C C; Yuen, Kwok-Yung

    2018-05-01

    The Abbott RealTime HCV Genotype II assay (Abbott-RT-HCV assay) is a real-time PCR based genotyping method for hepatitis C virus (HCV). This study measured the impact of inter-genotypic recombination and probe cross-reactivity on the performance of the Abbott-RT-HCV assay. 517 samples were genotyped using the Abbott-RT-HCV assay over a one-year period, 34 (6.6%) were identified as HCV genotype 1 without further subtype designation raising the possibility of inaccurate genotyping. These samples were subjected to confirmatory sequencing. 27 of these 34 (79%) samples were genotype 1b while five (15%) were genotype 6. One HCV isolate was an inter-genotypic 1a/4o recombinant. This is a novel natural HCV recombinant that has never been reported. Inter-genotypic recombination and probe cross-reactivity can affect the accuracy of the Abbott-RT-HCV assay, both of which have significant implications on antiviral regimen choice. Confirmatory sequencing of ambiguous results is crucial for accurate genotyping. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Genotyping Sleep Disorders Patients

    OpenAIRE

    Kripke, Daniel F.; Shadan, Farhad F.; Dawson, Arthur; Cronin, John W.; Jamil, Shazia M.; Grizas, Alexandra P.; Koziol, James A.; Kline, Lawrence E.

    2010-01-01

    Objective The genetic susceptibility factors underlying sleep disorders might help us predict prognoses and responses to treatment. Several candidate polymorphisms for sleep disorders have been proposed, but there has as yet inadequate replication or validation that the candidates may be useful in the clinical setting. Methods To assess the validity of several candidate associations, we obtained saliva deoxyribonucleic acid (DNA) samples and clinical information from 360 consenting research p...

  3. APOE Genotyping, Cardiovascular Disease

    Science.gov (United States)

    ... Resources For Health Professionals Subscribe Search APOE Genotyping, Cardiovascular Disease Send Us Your Feedback Choose Topic At a ... help understand the role of genetic factors in cardiovascular disease . However, the testing is sometimes used in clinical ...

  4. Radiosensitivity of fingermillet genotypes

    Energy Technology Data Exchange (ETDEWEB)

    Raveendran, T S; Nagarajan, C; Appadurai, R; Prasad, M N; Sundaresan, N [Tamil Nadu Agricultural Univ., Coimbatore (India)

    1984-07-01

    Varietal differences in radiosensitivity were observed in a study involving 4 genotypes of fingermillet (Eleusine coracana (Linn.) Gaertn.) subjected to gamma-irradiation. Harder seeds were found to tolerate a higher dose of the mutagen.

  5. Identification of Quantitative Trait Loci (QTL) and Candidate Genes for Cadmium Tolerance in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Gancho [West Virginia University; Yin, Tongming [ORNL; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Stephen P [West Virginia University

    2012-01-01

    Knowledge of genetic variation in response of Populus to heavy metals like cadmium (Cd) is an important step in understanding the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa and Populus deltoides was characterized for Cd exposure. The pedigree showed significant variation for Cd tolerance thus enabling the identification of relatively tolerant and susceptible genotypes for intensive characterization. A total of 16 QTLs at logarithm of odds (LOD) ratio > 2.5, were found to be associated with total dry weight, its components, and root volume. Four major QTLs for total dry weight were mapped to different linkage groups in control (LG III) and Cd conditions (LG XVI) and had opposite allelic effects on Cd tolerance, suggesting that these genomic regions were differentially controlled. The phenotypic variation explained by Cd QTL for all traits under study varied from 5.9% to 11.6% and averaged 8.2% across all QTL. Leaf Cd contents also showed significant variation suggesting the phytoextraction potential of Populus genotypes, though heritability of this trait was low (0.22). A whole-genome microarray study was conducted by using two genotypes with extreme responses for Cd tolerance in the above study and differentially expressed genes were identified. Candidate genes including CAD2 (CADMIUM SENSITIVE 2), HMA5 (HEAVY METAL ATPase5), ATGTST1 (Arabidopsis thaliana Glutathione S-Transferase1), ATGPX6 (Glutathione peroxidase 6), and ATMRP 14 (Arabidopsis thaliana Multidrug Resistance associated Protein 14) were identified from QTL intervals and microarray study. Functional characterization of these candidate genes could enhance phytoremediation capabilities of Populus.

  6. Views on Values Education: From Teacher Candidates to Experienced Teachers

    Science.gov (United States)

    Iscan, Canay Demirhan

    2015-01-01

    This study aimed to identify the views of experienced class teachers and class teacher candidates on values education. It conducted standard open-ended interviews with experienced class teachers and teacher candidates. The study group comprised 9 experienced class teachers from different socio-economic levels and 9 teacher candidates with…

  7. Describing the Diapause-Preparatory Proteome of the Beetle Colaphellus bowringi and Identifying Candidates Affecting Lipid Accumulation Using Isobaric Tags for Mass Spectrometry-Based Proteome Quantification (iTRAQ

    Directory of Open Access Journals (Sweden)

    Daniel A. Hahn

    2017-04-01

    Full Text Available Prior to entering diapause, insects must prepare themselves physiologically to withstand the stresses of arresting their development for a lengthy period. While studies describing the biochemical and cellular milieu of the maintenance phase of diapause are accumulating, few studies have taken an “omics” approach to describing molecular events during the diapause preparatory phase. We used isobaric tags and mass spectrometry (iTRAQ to quantitatively compare the expression profiles of proteins identified during the onset of diapause preparation phase in the heads of adult female cabbage beetles, Colaphellus bowringi. A total of 3,175 proteins were identified, 297 of which were differentially expressed between diapause-destined and non-diapause-destined female adults and could therefore be involved in diapause preparation in this species. Comparison of identified proteins with protein function databases shows that many of these differentially expressed proteins enhanced in diapause destined beetles are involved in energy production and conversion, carbohydrate metabolism and transport, and lipid metabolism. Further hand annotation of differentially abundant peptides nominates several associated with stress hardiness, including HSPs and antioxidants, as well as neural development. In contrast, non-diapause destined beetles show substantial increases in cuticle proteins, suggesting additional post-emergence growth. Using RNA interference to silence a fatty acid-binding protein (FABP that was highly abundant in the head of diapause-destined females prevented the accumulation of lipids in the fat body, a common product of diapause preparation in this species and others. Surprisingly, RNAi against the FABP also affected the transcript abundance of several heat shock proteins. These results suggest that the identified differentially expressed proteins that play vital roles in lipid metabolism may also contribute somehow to enhanced hardiness to

  8. Genotype-specific physiological and transcriptomic responses to drought stress in Setaria italica (an emerging model for Panicoideae grasses).

    Science.gov (United States)

    Tang, Sha; Li, Lin; Wang, Yongqiang; Chen, Qiannan; Zhang, Wenying; Jia, Guanqing; Zhi, Hui; Zhao, Baohua; Diao, Xianmin

    2017-08-30

    Understanding drought-tolerance mechanisms and identifying genetic dominance are important for crop improvement. Setaria italica, which is extremely drought-tolerant, has been regarded as a model plant for studying stress biology. Moreover, different genotypes of S. italica have evolved various drought-tolerance/avoidance mechanisms that should be elucidated. Physiological and transcriptomic comparisons between drought-tolerant S. italica cultivar 'Yugu1' and drought-sensitive 'An04' were conducted. 'An04' had higher yields and more efficient photosystem activities than 'Yugu1' under well-watered conditions, and this was accompanied by positive brassinosteroid regulatory actions. However, 'An04's growth advantage was severely repressed by drought, while 'Yugu1' maintained normal growth under a water deficiency. High-throughput sequencing suggested that the S. italica transcriptome was severely remodelled by genotype × environment interactions. Expression profiles of genes related to phytohormone metabolism and signalling, transcription factors, detoxification, and other stress-related proteins were characterised, revealing genotype-dependent and -independent drought responses in different S. italica genotypes. Combining our data with drought-tolerance-related QTLs, we identified 20 candidate genes that contributed to germination and early seedling' drought tolerance in S. italica. Our analysis provides a comprehensive picture of how different S. italica genotypes respond to drought, and may be used for the genetic improvement of drought tolerance in Poaceae crops.

  9. SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

    Science.gov (United States)

    Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon

    2016-01-01

    Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

  10. The Association Study between Twenty One Polymorphisms in Seven Candidate Genes and Coronary Heart Diseases in Chinese Han Population.

    Directory of Open Access Journals (Sweden)

    Barrak F Alobeidy

    Full Text Available Previous genome-wide association studies (GWAS in multiple populations identified several genetic loci for coronary heart diseases (CHD. Here we utilized a 2-stage candidate gene association strategy in Chinese Han population to shed light on the putative association between several metabolic-related candidate genes and CHD. At the 1(st stage, 190 patients with CHD and 190 controls were genotyped through the MassARRAY platform. At the 2(nd stage, a larger sample including 400 patients and 392 controls was genotyped by the High Resolution Melt (HRM method to confirm or rule out the associations with CHD. MLXIP expression level was quantified by the real time PCR in 65 peripheral blood samples. From the 21 studied single nucleotide polymorphisms (SNPs of seven candidate genes: MLXIPL, MLXIP, MLX, ADIPOR1, VDR, SREBF1 and NR1H3, only one tag SNP rs4758685 (T→C was found to be statistically associated with CHD (P-value = 0.02, Odds ratio (OR of 0.83. After adjustment for the age, sex, lipid levels and diabetes, the association remained significant (P-value = 0.03. After adjustment for the hypertension, P-value became 0.20 although there was a significant difference in the allele distribution between the CHD patients with hypertension and the controls (P-value = 0.04, 406 vs 582. In conclusion, among the 21 tested SNPs, we identified a novel association between rs4758685 of MLXIP gene and CHD. The C allele of common variant rs4758685 interacted with hypertension, and was found to be protective against CHD in both allelic and genotypic models in Chinese Han population.

  11. Using RNA-Seq for gene identification, polymorphism detection and transcript profiling in two alfalfa genotypes with divergent cell wall composition in stems

    Science.gov (United States)

    2011-01-01

    Background Alfalfa, [Medicago sativa (L.) sativa], a widely-grown perennial forage has potential for development as a cellulosic ethanol feedstock. However, the genomics of alfalfa, a non-model species, is still in its infancy. The recent advent of RNA-Seq, a massively parallel sequencing method for transcriptome analysis, provides an opportunity to expand the identification of alfalfa genes and polymorphisms, and conduct in-depth transcript profiling. Results Cell walls in stems of alfalfa genotype 708 have higher cellulose and lower lignin concentrations compared to cell walls in stems of genotype 773. Using the Illumina GA-II platform, a total of 198,861,304 expression sequence tags (ESTs, 76 bp in length) were generated from cDNA libraries derived from elongating stem (ES) and post-elongation stem (PES) internodes of 708 and 773. In addition, 341,984 ESTs were generated from ES and PES internodes of genotype 773 using the GS FLX Titanium platform. The first alfalfa (Medicago sativa) gene index (MSGI 1.0) was assembled using the Sanger ESTs available from GenBank, the GS FLX Titanium EST sequences, and the de novo assembled Illumina sequences. MSGI 1.0 contains 124,025 unique sequences including 22,729 tentative consensus sequences (TCs), 22,315 singletons and 78,981 pseudo-singletons. We identified a total of 1,294 simple sequence repeats (SSR) among the sequences in MSGI 1.0. In addition, a total of 10,826 single nucleotide polymorphisms (SNPs) were predicted between the two genotypes. Out of 55 SNPs randomly selected for experimental validation, 47 (85%) were polymorphic between the two genotypes. We also identified numerous allelic variations within each genotype. Digital gene expression analysis identified numerous candidate genes that may play a role in stem development as well as candidate genes that may contribute to the differences in cell wall composition in stems of the two genotypes. Conclusions Our results demonstrate that RNA-Seq can be

  12. Identification Of Protein Vaccine Candidates Using Comprehensive Proteomic Analysis Strategies

    National Research Council Canada - National Science Library

    Rohrbough, James G

    2007-01-01

    Presented in this dissertation are proteomic analysis studies focused on identifying proteins to be used as vaccine candidates against Coccidioidomycosis, a potentially fatal human pulmonary disease...

  13. Specificity of the Linear Array HPV Genotyping Test for detecting human papillomavirus genotype 52 (HPV-52)

    OpenAIRE

    Kocjan, Boštjan; Poljak, Mario; Oštrbenk, Anja

    2015-01-01

    Introduction: HPV-52 is one of the most frequent human papillomavirus (HPV) genotypes causing significant cervical pathology. The most widely used HPV genotyping assay, the Roche Linear Array HPV Genotyping Test (Linear Array), is unable to identify HPV- 52 status in samples containing HPV-33, HPV-35, and/or HPV-58. Methods: Linear Array HPV-52 analytical specificity was established by testing 100 specimens reactive with the Linear Array HPV- 33/35/52/58 cross-reactive probe, but not with the...

  14. Real-Time Determination of Photosynthesis, Transpiration, Water-Use Efficiency and Gene Expression of Two Sorghum bicolor (Moench Genotypes Subjected to Dry-Down

    Directory of Open Access Journals (Sweden)

    Alessandra Fracasso

    2017-05-01

    Full Text Available Plant growth and productivity are strongly affected by limited water availability in drought prone environments. The current climate change scenario, characterized by long periods without precipitations followed by short but intense rainfall, forces plants to implement different strategies to cope with drought stress. Understanding how plants use water during periods of limited water availability is of primary importance to identify and select the best adapted genotypes to a certain environment. Two sorghum genotypes IS22330 and IS20351, previously characterized as drought tolerant and drought sensitive genotypes, were subjected to progressive drought stress through a dry-down experiment. A whole-canopy multi-chamber system was used to determine the in vivo water use efficiency (WUE. This system records whole-canopy net photosynthetic and transpiration rate of 12 chambers five times per hour allowing the calculation of whole-canopy instantaneous WUE daily trends. Daily net photosynthesis and transpiration rates were coupled with gene expression dynamics of five drought related genes. Under drought stress, the tolerant genotype increased expression level for all the genes analyzed, whilst the opposite trend was highlighted by the drought sensitive genotype. Correlation between gene expression dynamics and gas exchange measurements allowed to identify three genes as valuable candidate to assess drought tolerance in sorghum.

  15. Real-Time Determination of Photosynthesis, Transpiration, Water-Use Efficiency and Gene Expression of Two Sorghum bicolor (Moench) Genotypes Subjected to Dry-Down.

    Science.gov (United States)

    Fracasso, Alessandra; Magnanini, Eugenio; Marocco, Adriano; Amaducci, Stefano

    2017-01-01

    Plant growth and productivity are strongly affected by limited water availability in drought prone environments. The current climate change scenario, characterized by long periods without precipitations followed by short but intense rainfall, forces plants to implement different strategies to cope with drought stress. Understanding how plants use water during periods of limited water availability is of primary importance to identify and select the best adapted genotypes to a certain environment. Two sorghum genotypes IS22330 and IS20351, previously characterized as drought tolerant and drought sensitive genotypes, were subjected to progressive drought stress through a dry-down experiment. A whole-canopy multi-chamber system was used to determine the in vivo water use efficiency (WUE). This system records whole-canopy net photosynthetic and transpiration rate of 12 chambers five times per hour allowing the calculation of whole-canopy instantaneous WUE daily trends. Daily net photosynthesis and transpiration rates were coupled with gene expression dynamics of five drought related genes. Under drought stress, the tolerant genotype increased expression level for all the genes analyzed, whilst the opposite trend was highlighted by the drought sensitive genotype. Correlation between gene expression dynamics and gas exchange measurements allowed to identify three genes as valuable candidate to assess drought tolerance in sorghum.

  16. Identification of single nucleotide polymorphisms (SNPs at candidate genes involved in abiotic stress in two Prosopis species of hybrids

    Directory of Open Access Journals (Sweden)

    Maria F. Pomponio

    2014-12-01

    Full Text Available Aim of the study: Identify and compare SNPs on candidate genes related to abiotic stress in Prosopis chilensis, Prosopis flexuosa and interspecific hybridsArea of the study: Chaco árido, Argentina. Material and Methods: Fragments from 6 candidate genes were sequenced in 60 genotypes. DNA polymorphisms were analyzed.Main Results: The analysis revealed that the hybrids had the highest rate of polymorphism, followed by P. flexuosa and P. chilensis, the values found are comparable to other forest tree species.Research highlights: This approach will help to study genetic diversity variation on natural populations for assessing the effects of environmental changes.Keywords: SNPs; abiotic stress; interspecific variation; molecular markers. 

  17. Growth dynamics of the threatened Caribbean staghorn coral Acropora cervicornis: influence of host genotype, symbiont identity, colony size, and environmental setting.

    Science.gov (United States)

    Lirman, Diego; Schopmeyer, Stephanie; Galvan, Victor; Drury, Crawford; Baker, Andrew C; Baums, Iliana B

    2014-01-01

    The drastic decline in the abundance of Caribbean acroporid corals (Acropora cervicornis, A. palmata) has prompted the listing of this genus as threatened as well as the development of a regional propagation and restoration program. Using in situ underwater nurseries, we documented the influence of coral genotype and symbiont identity, colony size, and propagation method on the growth and branching patterns of staghorn corals in Florida and the Dominican Republic. Individual tracking of> 1700 nursery-grown staghorn fragments and colonies from 37 distinct genotypes (identified using microsatellites) in Florida and the Dominican Republic revealed a significant positive relationship between size and growth, but a decreasing rate of productivity with increasing size. Pruning vigor (enhanced growth after fragmentation) was documented even in colonies that lost 95% of their coral tissue/skeleton, indicating that high productivity can be maintained within nurseries by sequentially fragmenting corals. A significant effect of coral genotype was documented for corals grown in a common-garden setting, with fast-growing genotypes growing up to an order of magnitude faster than slow-growing genotypes. Algal-symbiont identity established using qPCR techniques showed that clade A (likely Symbiodinium A3) was the dominant symbiont type for all coral genotypes, except for one coral genotype in the DR and two in Florida that were dominated by clade C, with A- and C-dominated genotypes having similar growth rates. The threatened Caribbean staghorn coral is capable of extremely fast growth, with annual productivity rates exceeding 5 cm of new coral produced for every cm of existing coral. This species benefits from high fragment survivorship coupled by the pruning vigor experienced by the parent colonies after fragmentation. These life-history characteristics make A. cervicornis a successful candidate nursery species and provide optimism for the potential role that active propagation

  18. Growth dynamics of the threatened Caribbean staghorn coral Acropora cervicornis: influence of host genotype, symbiont identity, colony size, and environmental setting.

    Directory of Open Access Journals (Sweden)

    Diego Lirman

    Full Text Available BACKGROUND: The drastic decline in the abundance of Caribbean acroporid corals (Acropora cervicornis, A. palmata has prompted the listing of this genus as threatened as well as the development of a regional propagation and restoration program. Using in situ underwater nurseries, we documented the influence of coral genotype and symbiont identity, colony size, and propagation method on the growth and branching patterns of staghorn corals in Florida and the Dominican Republic. METHODOLOGY/PRINCIPAL FINDINGS: Individual tracking of> 1700 nursery-grown staghorn fragments and colonies from 37 distinct genotypes (identified using microsatellites in Florida and the Dominican Republic revealed a significant positive relationship between size and growth, but a decreasing rate of productivity with increasing size. Pruning vigor (enhanced growth after fragmentation was documented even in colonies that lost 95% of their coral tissue/skeleton, indicating that high productivity can be maintained within nurseries by sequentially fragmenting corals. A significant effect of coral genotype was documented for corals grown in a common-garden setting, with fast-growing genotypes growing up to an order of magnitude faster than slow-growing genotypes. Algal-symbiont identity established using qPCR techniques showed that clade A (likely Symbiodinium A3 was the dominant symbiont type for all coral genotypes, except for one coral genotype in the DR and two in Florida that were dominated by clade C, with A- and C-dominated genotypes having similar growth rates. CONCLUSION/SIGNIFICANCE: The threatened Caribbean staghorn coral is capable of extremely fast growth, with annual productivity rates exceeding 5 cm of new coral produced for every cm of existing coral. This species benefits from high fragment survivorship coupled by the pruning vigor experienced by the parent colonies after fragmentation. These life-history characteristics make A. cervicornis a successful candidate

  19. Genetic determinants of facial clefting: analysis of 357 candidate genes using two national cleft studies from Scandinavia.

    Directory of Open Access Journals (Sweden)

    Astanand Jugessur

    Full Text Available Facial clefts are common birth defects with a strong genetic component. To identify fetal genetic risk factors for clefting, 1536 SNPs in 357 candidate genes were genotyped in two population-based samples from Scandinavia (Norway: 562 case-parent and 592 control-parent triads; Denmark: 235 case-parent triads.We used two complementary statistical methods, TRIMM and HAPLIN, to look for associations across these two national samples. TRIMM tests for association in each gene by using multi-SNP genotypes from case-parent triads directly without the need to infer haplotypes. HAPLIN on the other hand estimates the full haplotype distribution over a set of SNPs and estimates relative risks associated with each haplotype. For isolated cleft lip with or without cleft palate (I-CL/P, TRIMM and HAPLIN both identified significant associations with IRF6 and ADH1C in both populations, but only HAPLIN found an association with FGF12. For isolated cleft palate (I-CP, TRIMM found associations with ALX3, MKX, and PDGFC in both populations, but only the association with PDGFC was identified by HAPLIN. In addition, HAPLIN identified an association with ETV5 that was not detected by TRIMM.Strong associations with seven genes were replicated in the Scandinavian samples and our approach effectively replicated the strongest previously known association in clefting--with IRF6. Based on two national cleft cohorts of similar ancestry, two robust statistical methods and a large panel of SNPs in the most promising cleft candidate genes to date, this study identified a previously unknown association with clefting for ADH1C and provides additional candidates and analytic approaches to advance the field.

  20. Dark matter candidates

    International Nuclear Information System (INIS)

    Turner, M.S.

    1989-01-01

    One of the simplest, yet most profound, questions we can ask about the Universe is, how much stuff is in it, and further what is that stuff composed of? Needless to say, the answer to this question has very important implications for the evolution of the Universe, determining both the ultimate fate and the course of structure formation. Remarkably, at this late date in the history of the Universe we still do not have a definitive answer to this simplest of questions---although we have some very intriguing clues. It is known with certainty that most of the material in the Universe is dark, and we have the strong suspicion that the dominant component of material in the Cosmos is not baryons, but rather is exotic relic elementary particles left over from the earliest, very hot epoch of the Universe. If true, the Dark Matter question is a most fundamental one facing both particle physics and cosmology. The leading particle dark matter candidates are: the axion, the neutralino, and a light neutrino species. All three candidates are accessible to experimental tests, and experiments are now in progress. In addition, there are several dark horse, long shot, candidates, including the superheavy magnetic monopole and soliton stars. 13 refs

  1. Assessing the potential of genotyping-by-sequencing-derived single nucleotide polymorphisms to identify the geographic origins of intercepted gypsy moth (Lymantria dispar) specimens: A proof-of-concept study

    Science.gov (United States)

    Sandrine Picq; Melody Keena; Nathan Havill; Don Stewart; Esther Pouliot; Brian Boyle; Roger C. Levesque; Richard C. Hamelin; Michel Cusson

    2018-01-01

    Forest invasive alien species are a major threat to ecosystem stability and can have enormous economic and social impacts. For this reason, preventing the introduction of Asian gypsy moths (AGM; Lymantria dispar asiatica and L. d. japonica) into North America has been identified as a top priority by North American authorities....

  2. Bioinformatics-driven identification and examination of candidate genes for non-alcoholic fatty liver disease.

    Directory of Open Access Journals (Sweden)

    Karina Banasik

    2011-01-01

    Full Text Available Candidate genes for non-alcoholic fatty liver disease (NAFLD identified by a bioinformatics approach were examined for variant associations to quantitative traits of NAFLD-related phenotypes.By integrating public database text mining, trans-organism protein-protein interaction transferal, and information on liver protein expression a protein-protein interaction network was constructed and from this a smaller isolated interactome was identified. Five genes from this interactome were selected for genetic analysis. Twenty-one tag single-nucleotide polymorphisms (SNPs which captured all common variation in these genes were genotyped in 10,196 Danes, and analyzed for association with NAFLD-related quantitative traits, type 2 diabetes (T2D, central obesity, and WHO-defined metabolic syndrome (MetS.273 genes were included in the protein-protein interaction analysis and EHHADH, ECHS1, HADHA, HADHB, and ACADL were selected for further examination. A total of 10 nominal statistical significant associations (P<0.05 to quantitative metabolic traits were identified. Also, the case-control study showed associations between variation in the five genes and T2D, central obesity, and MetS, respectively. Bonferroni adjustments for multiple testing negated all associations.Using a bioinformatics approach we identified five candidate genes for NAFLD. However, we failed to provide evidence of associations with major effects between SNPs in these five genes and NAFLD-related quantitative traits, T2D, central obesity, and MetS.

  3. Comparative salinity responses among tomato genotypes and rootstocks

    International Nuclear Information System (INIS)

    Oztekin, G.B.; Tuzel, Y.

    2011-01-01

    Salinity is a major constraint limiting agricultural crop productivity in the world. However, plant species and cultivars differ greatly in their response to salinity. This study was conducted in a greenhouse to determine the response of 4 commercial tomato rootstocks, 21 cultivars and 8 candidate varieties to salinity stress. Seeds were germinated in peat and when the plants were at the fifth-true leaf stage, salt treatment was initiated except control treatment. NaCl was added to nutrient solution daily with 25 mM concentration and had been reached to 200 mM final concentration. On harvest day, genotypes were classified based on the severity of leaf symptoms caused by NaCl treatment. After symptom scoring, the plants were harvested and leaf number, root length, stem length and diameter per plant were measured. The plants were separated into shoots and roots for dry matter production. Our results showed that, on average, NaCl stress decreased all parameters and the rootstocks gave the highest performance than genotypes. Among all rootstocks, three varieties (2211 and 2275) and ten genotypes (Astona, Astona RN, Caracas, Deniz, Durinta, Export, Gokce, Target, Yeni Talya and 144 HY) were selected as tolerant with slight chlorosis whereas the genotype Malike was selected as sensitive with severe chlorosis. Candidate varieties 2316 and 1482 were the most sensitive ones. Plant growth and dry matter production differed among the tested genotypes. However no correlation was found between plant growth and dry matter production. Rootstock Beaufort gave the highest shoot dry matter although Heman had highest root dry matter. Newton showed more shoot and root dry matter than other genotypes. It is concluded that screening of genotypes based on severity of symptoms at early stage of development and their dry matter production could be used as a tool to indicate genotypic variation to salt stress. (author)

  4. Candidate gene analyses of 3-dimensional dentoalveolar phenotypes in subjects with malocclusion

    Science.gov (United States)

    Weaver, Cole A.; Miller, Steven F.; da Fontoura, Clarissa S. G.; Wehby, George L.; Amendt, Brad A.; Holton, Nathan E.; Allareddy, Veeratrishul; Southard, Thomas E.; Moreno Uribe, Lina M.

    2017-01-01

    Introduction Genetic studies of malocclusion etiology have identified 4 deleterious mutations in genes, DUSP6, ARHGAP21, FGF23, and ADAMTS1 in familial Class III cases. Although these variants may have large impacts on Class III phenotypic expression, their low frequency (malocclusions. Thus, much of the genetic variation underlying the dentofacial phenotypic variation associated with malocclusion remains unknown. In this study, we evaluated associations between common genetic variations in craniofacial candidate genes and 3-dimensional dentoalveolar phenotypes in patients with malocclusion. Methods Pretreatment dental casts or cone-beam computed tomographic images from 300 healthy subjects were digitized with 48 landmarks. The 3-dimensional coordinate data were submitted to a geometric morphometric approach along with principal component analysis to generate continuous phenotypes including symmetric and asymmetric components of dentoalveolar shape variation, fluctuating asymmetry, and size. The subjects were genotyped for 222 single-nucleotide polymorphisms in 82 genes/loci, and phenotpye-genotype associations were tested via multivariate linear regression. Results Principal component analysis of symmetric variation identified 4 components that explained 68% of the total variance and depicted anteroposterior, vertical, and transverse dentoalveolar discrepancies. Suggestive associations (P eruptions. Suggestive associations were found with TBX1 AJUBA, SNAI3 SATB2, TP63, and 1p22.1. Fluctuating asymmetry was associated with BMP3 and LATS1. Associations for SATB2 and BMP3 with asymmetric variations remained significant after the Bonferroni correction (P malocclusions were identified. PMID:28257739

  5. Candidate gene analyses of 3-dimensional dentoalveolar phenotypes in subjects with malocclusion.

    Science.gov (United States)

    Weaver, Cole A; Miller, Steven F; da Fontoura, Clarissa S G; Wehby, George L; Amendt, Brad A; Holton, Nathan E; Allareddy, Veeratrishul; Southard, Thomas E; Moreno Uribe, Lina M

    2017-03-01

    Genetic studies of malocclusion etiology have identified 4 deleterious mutations in genes DUSP6,ARHGAP21, FGF23, and ADAMTS1 in familial Class III cases. Although these variants may have large impacts on Class III phenotypic expression, their low frequency (common genetic variations in craniofacial candidate genes and 3-dimensional dentoalveolar phenotypes in patients with malocclusion. Pretreatment dental casts or cone-beam computed tomographic images from 300 healthy subjects were digitized with 48 landmarks. The 3-dimensional coordinate data were submitted to a geometric morphometric approach along with principal component analysis to generate continuous phenotypes including symmetric and asymmetric components of dentoalveolar shape variation, fluctuating asymmetry, and size. The subjects were genotyped for 222 single-nucleotide polymorphisms in 82 genes/loci, and phenotpye-genotype associations were tested via multivariate linear regression. Principal component analysis of symmetric variation identified 4 components that explained 68% of the total variance and depicted anteroposterior, vertical, and transverse dentoalveolar discrepancies. Suggestive associations (P centroid size, a proxy for dentoalveolar size variation with 4p16.1 and SNAI1. Specific genetic pathways associated with 3-dimensional dentoalveolar phenotypic variation in malocclusions were identified. Copyright © 2016 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  6. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  7. The Monarch Initiative: an integrative data and analytic platform connecting phenotypes to genotypes across species

    International Nuclear Information System (INIS)

    Mungall, Christopher J.; McMurry, Julie A.; Köhler, Sebastian; Balhoff, James P.; Borromeo, Charles

    2016-01-01

    The correlation of phenotypic outcomes with genetic variation and environmental factors is a core pursuit in biology and biomedicine. Numerous challenges impede our progress: patient phenotypes may not match known diseases, candidate variants may be in genes that have not been characterized, model organisms may not recapitulate human or veterinary diseases, filling evolutionary gaps is difficult, and many resources must be queried to find potentially significant genotype-phenotype associations. Nonhuman organisms have proven instrumental in revealing biological mechanisms. Advanced informatics tools can identify phenotypically relevant disease models in research and diagnostic contexts. Large-scale integration of model organism and clinical research data can provide a breadth of knowledge not available from individual sources and can provide contextualization of data back to these sources. The Monarch Initiative (monarchinitiative.org) is a collaborative, open science effort that aims to semantically integrate genotype-phenotype data from many species and sources in order to support precision medicine, disease modeling, and mechanistic exploration. Our integrated knowledge graph, analytic tools, and web services enable diverse users to explore relationships between phenotypes and genotypes across species.

  8. Candidate gene association analyses for ketosis resistance in Holsteins.

    Science.gov (United States)

    Kroezen, V; Schenkel, F S; Miglior, F; Baes, C F; Squires, E J

    2018-06-01

    High-yielding dairy cattle are susceptible to ketosis, a metabolic disease that negatively affects the health, fertility, and milk production of the cow. Interest in breeding for more robust dairy cattle with improved resistance to disease is global; however, genetic evaluations for ketosis would benefit from the additional information provided by genetic markers. Candidate genes that are proposed to have a biological role in the pathogenesis of ketosis were investigated in silico and a custom panel of 998 putative single nucleotide polymorphism (SNP) markers was developed. The objective of this study was to test the associations of these new markers with deregressed estimated breeding values (EBV) for ketosis. A sample of 653 Canadian Holstein cows that had been previously genotyped with a medium-density SNP chip were regenotyped with the custom panel. The EBV for ketosis in first and later lactations were obtained for each animal and deregressed for use as pseudo-phenotypes for association analyses. Results of the mixed inheritance model for single SNP association analyses suggested 15 markers in 6 unique candidate genes were associated with the studied trait. Genes encoding proteins involved in metabolic processes, including the synthesis and degradation of fatty acids and ketone bodies, gluconeogenesis, lipid mobilization, and the citric acid cycle, were identified to contain SNP associated with ketosis resistance. This work confirmed the presence of previously described quantitative trait loci for dairy cattle, suggested novel markers for ketosis-resistance, and provided insight into the underlying biology of this disease. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

    Directory of Open Access Journals (Sweden)

    Mary Lynn Baniecki

    2015-03-01

    Full Text Available Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs. Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM, we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding. From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana, Africa (Ethiopia and Asia (Sri Lanka. We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1. Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

  10. Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

    Science.gov (United States)

    Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

    2015-01-01

    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

  11. An Affymetrix Microarray Design for Microbial Genotyping

    Science.gov (United States)

    2009-10-01

    les échantillons qui ne se prêtent pas aux méthodes culturales de la microbiologie classique. La puce à ADN est une technologie qui permet la... area of microbial genotyping there are multiple platforms that can identify one or a few microbial targets in a single assay iteration. For most

  12. Human papillomavirus genotyping by multiplex pyrosequencing in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    malignant cervical samples ... low- and high-risk HPV genotypes without identifying ... Since these samples were not from “healthy .... major capsid protein, any variation in its coding sequence is .... worldwide: a meta-analysis; Br. J. Cancer 88 63–73.

  13. (AMMI) and genotype by environment interaction

    African Journals Online (AJOL)

    SARAH

    2014-04-30

    Apr 30, 2014 ... Background and justification: Lack of stable high yielding cultivars is one ... of advanced finger millet genotypes evaluated in multiple environments, and (ii) identify stable high yielding .... for interaction principal component axis (IPCA) n, γgn ..... Table 2: Analysis of variance for grain yield using AMMI model.

  14. Aerobic Bacterial Community of American Cockroach Periplaneta americana,a Step toward Finding Suitable Paratransgenesis Candidates.

    Science.gov (United States)

    Akbari, Sanaz; Oshaghi, Mohammad Ali; Hashemi-Aghdam, Saedeh Sadat; Hajikhani, Sara; Oshaghi, Ghazaleh; Shirazi, Mohammad Hasan

    2015-06-01

    Cockroaches mechanically spread pathogenic agents, however, little is known about their gut microbiota. Identification of midgut microbial community helps targeting novel biological control strategies such as paratransgenesis. Here the bacterial microbiota of Periplaneta americana midgut, were identified and evaluated for finding proper paratransgenesis candidate. Midgut of specimens were dissected and cultivated in different media. The bacterial isolates were then identified using the phenotypic and 16S-rRNA sequencing methods. The analytical profile index (API) kit showed presence of 11 bacterial species including: Escherichia coli, Shigella flexineri, Citrobacter freundii, E. vulneris, Enterobacter cloacae, Yersinia pseudotuberculosis, Y. intermedia, Leclericia adecarboxylata, Klebsiella oxytoca, K. planticola, and Rahnella aquatilis in the cockroach midguts. The first three species are potentially symbiotic whereas others are transient. The conventional plating method revealed presence of only four isolates of Salmonella, E. coli, and Proteus which in three cases mismatched with API and 16S-rRNA genotyping. The API correctly identified the four isolates as Shigella flexneri, Citrobacter freundii, and E. coli (n= 2). 16S-rRNA sequence analysis confirmed the API results; however the C. freundii sequence was identical with C. murliniae indicating lack of genetic variation in the gene between these two closely related species. A low number of potentially symbiotic bacteria were found in the American cockroach midguts. Among them Enterobacter cloacae is a potential candidate for paratransgenesis approach whereas other bacteria are pathogens and are not useful for the approach. Data analysis showed that identification levels increase from the conventional to API and to genotyping respectively.

  15. Aerobic Bacterial Community of American Cockroach Periplaneta americana,a Step toward Finding Suitable Paratransgenesis Candidates

    Directory of Open Access Journals (Sweden)

    Sanaz Akbari

    2015-10-01

    Full Text Available Background: Cockroaches mechanically spread pathogenic agents, however, little is known about their gut microbiota. Identification of midgut microbial community helps targeting novel biological control strategies such as paratransgenesis. Here the bacterial microbiota of Periplaneta americana midgut, were identified and evaluated for finding proper paratransgenesis candidate.Methods: Midgut of specimens were dissected and cultivated in different media. The bacterial isolates were then identified using the phenotypic and 16S-rRNA sequencing methods.Results: The analytical profile index (API kit showed presence of 11 bacterial species including: Escherichia coli, Shigella flexineri, Citrobacter freundii, E. vulneris, Enterobacter cloacae, Yersinia pseudotuberculosis, Y.intermedia, Leclericia adecarboxylata, Klebsiella oxytoca, K. planticola, and Rahnella aquatilis in the cockroach midguts. The first three species are potentially symbiotic whereas others are transient. The conventional platingmethod revealed presence of only four isolates of Salmonella, E. coli, and Proteus which in three cases mismatched with API and 16S-rRNA genotyping. The API correctly identified the four isolates as Shigella flexneri, Citrobacter freundii, and E. coli (n= 2. 16S-rRNA sequence analysis confirmed the API results; however the C. freundii sequencewas identical with C. murliniae indicating lack of genetic variation in the gene between these two closely related species.Conclusion: A low number of potentially symbiotic bacteria were found in the American cockroach midguts. Among them Enterobacter cloacae is a potential candidate for paratransgenesis approach whereas other bacteria are pathogens and are not useful for the approach. Data analysis showed that identification levels increase from the conventional to API and to genotyping respectively.

  16. Identification and development of a promising novel mumps vaccine candidate strain.

    Science.gov (United States)

    Liang, Yan; Ma, Shaohui; Liu, Longding; Zhao, Hongling; Wang, Lichun; Jiang, Li; Xie, Zhongping; Dong, Chenghong; Li, Qihan

    2010-12-01

    Mumps epidemics are usually caused by airborne transmission of mumps virus (MuV) and have high morbidity in non-immunized children. Epidemiological studies in many regions of China show that the genotype F viral strain is the most prevalent. However, the genotype A strain is currently used to prepare vaccines. Regional epidemiological MuV data suggest a significant application for the development of live attenuated mumps vaccines targeting specific genotypes. This article reports the isolation and culture of a genotype F MuV candidate strain that could be used to prepare a live attenuated mumps vaccine. This strain is shown to have good immunological efficacy and stability in neurovirulence evaluations. This work should facilitate the implementation of mumps vaccination in mainland China by targeting the most prevalent MuV genotype, genotype F. Copyright © 2010 Institut Pasteur. Published by Elsevier SAS. All rights reserved.

  17. Genotypic Variation of Early Maturing Soybean Genotypes for Phosphorus Utilization Efficiency under Field Grown Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Abaidoo, R. C. [Kwame Nkrumah University of Technology, Kumasi (Ghana); International Institute of Tropical Agriculture, Ibadan (Nigeria); Opoku, A.; Boahen, S. [Kwame Nkrumah University of Technology, Kumasi (Ghana); Dare, M. O. [Federal University of Agriculture, Abeokuta (Nigeria)

    2013-11-15

    Variability in the utilization of phosphorus (P) by 64 early-maturing soybean (Glycine max L. Merr.) genotypes under low-P soil conditions were evaluated in 2009 and 2010 at Shika, Nigeria. Fifteen phenotypic variables; number of nodules, nodule dry weight, grain yield, plant biomass, total biomass, biomass N and P content, Phosphorus Utilization Index (PUI), shoot P Utilization efficiency (PUIS), grain P Utilization efficiency (PUIG), Harvest Index (HI), Biological N fixed (BNF), total N fixed and N and P uptake were measured. The four clusters revealed by cluster analysis were basically divided along (1) plant biomass and uptake, (2) nutrient acquisition and utilization and (3) nodulation components. Three early maturing genotypes, TGx1842-14E, TGx1912-11F and TGx1913-5F, were identified as having high P utilization index and low P uptake. These genotypes could be a potential source for breeding for P use efficiency in early maturing soybean genotypes. (author)

  18. Identify drug repurposing candidates by mining the protein data bank.

    Science.gov (United States)

    Moriaud, Fabrice; Richard, Stéphane B; Adcock, Stewart A; Chanas-Martin, Laetitia; Surgand, Jean-Sébastien; Ben Jelloul, Marouane; Delfaud, François

    2011-07-01

    Predicting off-targets by computational methods is gaining increasing interest in early-stage drug discovery. Here, we present a computational method based on full 3D comparisons of 3D structures. When a similar binding site is detected in the Protein Data Bank (PDB) (or any protein structure database), it is possible that the corresponding ligand also binds to that similar site. On one hand, this target hopping case is probably rare because it requires a high similarity between the binding sites. On the other hand, it could be a strong rational evidence to highlight possible off-target reactions and possibly a potential undesired side effect. This target-based drug repurposing can be extended a significant step further with the capability of searching the full surface of all proteins in the PDB, and therefore not relying on pocket detection. Using this approach, we describe how MED-SuMo reproduces the repurposing of tadalafil from PDE5A to PDE4A and a structure of PDE4A with tadalafil. Searching for local protein similarities generates more hits than for whole binding site similarities and therefore fragment repurposing is more likely to occur than for drug-sized compounds. In this work, we illustrate that by mining the PDB for proteins sharing similarities with the hinge region of protein kinases. The experimentally validated examples, biotin carboxylase and synapsin, are retrieved. Further to fragment repurposing, this approach can be applied to the detection of druggable sites from 3D structures. This is illustrated with detection of the protein kinase hinge motif in the HIV-RT non-nucleosidic allosteric site.

  19. 'Omics' approaches in tomato aimed at identifying candidate genes ...

    African Journals Online (AJOL)

    adriana

    2013-12-04

    Dec 4, 2013 ... importance for human health and nutrition. This species has ... function to genes, proteins and metabolites is still a daunting task. Major challenges ... relation of the expression pattern of genes with the accu- mulation pattern of ..... M, Gordon JS, Rose, JKC, Martin G, Tanksley SD, Bouzayen M,. Jahn MM ...

  20. 'Omics' approaches in tomato aimed at identifying candidate genes ...

    African Journals Online (AJOL)

    Tomato (Solanum lycopersicum) is one of the most important vegetables in the world with significant importance for human health and nutrition. This species has long served as model system for plant genetics, development, physiology, pathology, and fleshy fruit ripening, resulting in the accumulation of many genetic and ...

  1. A New Way to Confirm Planet Candidates

    Science.gov (United States)

    Kohler, Susanna

    2016-05-01

    What was the big deal behind the Kepler news conference yesterday? Its not just that the number of confirmed planets found by Kepler has more than doubled (though thats certainly exciting news!). Whats especially interesting is the way in which these new planets were confirmed.Number of planet discoveries by year since 1995, including previous non-Kepler discoveries (blue), previous Kepler discoveries (light blue) and the newly validated Kepler planets (orange). [NASA Ames/W. Stenzel; Princeton University/T. Morton]No Need for Follow-UpBefore Kepler, the way we confirmed planet candidates was with follow-up observations. The candidate could be validated either by directly imaging (which is rare) or obtaining a large number radial-velocity measurements of the wobble of the planets host star due to the planets orbit. But once Kepler started producing planet candidates, these approaches to validation became less feasible. A lot of Kepler candidates are small and orbit faint stars, making follow-up observations difficult or impossible.This problem is what inspired the development of whats known as probabilistic validation, an analysis technique that involves assessing the likelihood that the candidates signal is caused by various false-positive scenarios. Using this technique allows astronomers to estimate the likelihood of a candidate signal being a true planet detection; if that likelihood is high enough, the planet candidate can be confirmed without the need for follow-up observations.A breakdown of the catalog of Kepler Objects of Interest. Just over half had previously been identified as false positives or confirmed as candidates. 1284 are newly validated, and another 455 have FPP of1090%. [Morton et al. 2016]Probabilistic validation has been used in the past to confirm individual planet candidates in Kepler data, but now Timothy Morton (Princeton University) and collaborators have taken this to a new level: they developed the first code thats designed to do fully

  2. Candidate innate immune system gene expression in the ecological model Daphnia.

    Science.gov (United States)

    Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J

    2011-10-01

    The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive

  3. Genotypic-dependent effects of N fertilizer, glutathione, silicon, zinc, and selenium on proteomic profiles, amino acid contents, and quality of rice genotypes with contrasting grain Cd accumulation.

    Science.gov (United States)

    Cao, Fangbin; Fu, Manman; Wang, Runfeng; Cheng, Wangda; Zhang, Guoping; Wu, Feibo

    2017-07-01

    Soil heavy metal (HM) contamination has posed a serious problem for safe food production. For restricting the translocation of HM into grain, many proteins were regulated to involve in the process. To identify these proteins, 2D-based proteomic analysis was carried out using different rice genotypes with distinct Cd accumulation in grains and as affected by an alleviating regulator (AR) in field experiments. AR application improved grain quality, with increased contents in Glu, Cys, His, Pro, and protein. Twenty-six low-grain HM accumulation-associated protein species were identified and categorized as physiological functions via two-dimensional gel electrophoresis (2DE) and mass spectrometry. Among these proteins, 8, 9, and 9 proteins exhibited higher accumulation, lower accumulation, and unchanged accumulation, respectively, in Xiushui817 (low accumulator) vs R8097 (high accumulator) under control conditions but showed differential accumulation patterns after AR application. These proteins included sucrose synthase 3, alanine aminotransferase, glutelin, cupin family protein, and zinc finger CCCH domain-containing protein 32. The differential expression of these protein species might contribute to decreased HM accumulation in grain via decreasing the protein accumulation which had high affinity to HM or regulating energy metabolism and signal transduction. Our findings provide valuable insights into the mechanisms of low-grain HM accumulation in rice and possible utilization of candidate protein species in developing low-grain HM accumulation genotypes.

  4. Applications of blood group genotyping

    Directory of Open Access Journals (Sweden)

    Mariza A. Mota

    2006-03-01

    Full Text Available Introduction: The determination of blood group polymorphism atthe genomic level facilitates the resolution of clinical problemsthat cannot be addressed by hemagglutination. They are useful to(a determine antigen types for which currently available antibodiesare weakly reactive; (b type patients who have been recentlytransfused; (c identify fetuses at risk for hemolytic disease of thenewborn; and (d to increase the reliability of repositories of antigennegative RBCs for transfusion. Objectives: This review assessedthe current applications of blood group genotyping in transfusionmedicine and hemolytic disease of the newborn. Search strategy:Blood group genotyping studies and reviews were searched ingeneral database (MEDLINE and references were reviewed.Selection criteria: All published data and reviews were eligible forinclusion provided they reported results for molecular basis ofblood group antigens, DNA analysis for blood group polymorphisms,determination of fetal group status and applications of blood groupgenotyping in blood transfusion. Data collection: All data werecollected based on studies and reviews of blood grouppolymorphisms and their clinical applications.

  5. Discovery of novel variants in genotyping arrays improves genotype retention and reduces ascertainment bias

    Directory of Open Access Journals (Sweden)

    Didion John P

    2012-01-01

    Full Text Available Abstract Background High-density genotyping arrays that measure hybridization of genomic DNA fragments to allele-specific oligonucleotide probes are widely used to genotype single nucleotide polymorphisms (SNPs in genetic studies, including human genome-wide association studies. Hybridization intensities are converted to genotype calls by clustering algorithms that assign each sample to a genotype class at each SNP. Data for SNP probes that do not conform to the expected pattern of clustering are often discarded, contributing to ascertainment bias and resulting in lost information - as much as 50% in a recent genome-wide association study in dogs. Results We identified atypical patterns of hybridization intensities that were highly reproducible and demonstrated that these patterns represent genetic variants that were not accounted for in the design of the array platform. We characterized variable intensity oligonucleotide (VINO probes that display such patterns and are found in all hybridization-based genotyping platforms, including those developed for human, dog, cattle, and mouse. When recognized and properly interpreted, VINOs recovered a substantial fraction of discarded probes and counteracted SNP ascertainment bias. We developed software (MouseDivGeno that identifies VINOs and improves the accuracy of genotype calling. MouseDivGeno produced highly concordant genotype calls when compared with other methods but it uniquely identified more than 786000 VINOs in 351 mouse samples. We used whole-genome sequence from 14 mouse strains to confirm the presence of novel variants explaining 28000 VINOs in those strains. We also identified VINOs in human HapMap 3 samples, many of which were specific to an African population. Incorporating VINOs in phylogenetic analyses substantially improved the accuracy of a Mus species tree and local haplotype assignment in laboratory mouse strains. Conclusion The problems of ascertainment bias and missing

  6. Optimized candidal biofilm microtiter assay

    NARCIS (Netherlands)

    Krom, Bastiaan P.; Cohen, Jesse B.; Feser, Gail E. McElhaney; Cihlar, Ronald L.

    Microtiter based candidal biofilm formation is commonly being used. Here we describe the analysis of factors influencing the development of candidal biofilms such as the coating with serum, growth medium and pH. The data reported here show that optimal candidal biofilm formation is obtained when

  7. JELLYFISH GALAXY CANDIDATES AT LOW REDSHIFT

    Energy Technology Data Exchange (ETDEWEB)

    Poggianti, B. M.; Fasano, G.; Omizzolo, A.; Gullieuszik, M.; Bettoni, D.; Paccagnella, A. [INAF-Astronomical Observatory of Padova (Italy); Moretti, A.; D’Onofrio, M. [Physics and Astronomy Department, University of Padova (Italy); Jaffé, Y. L. [Department of Astronomy, Universidad de Concepción, Concepción (Chile); Vulcani, B. [Kavli Institute for the Physics and Mathematics of the universe (WPI), The University of Tokyo Institutes for Advanced Study (UTIAS), the University of Tokyo, Kashiwa, 277-8582 (Japan); Fritz, J. [Centro de Radioastronomía y Astrofísica, CRyA, UNAM, Michoacán (Mexico); Couch, W. [Australian Astronomical Observatory, North Ryde, NSW 1670 (Australia)

    2016-03-15

    Galaxies that are being stripped of their gas can sometimes be recognized from their optical appearance. Extreme examples of stripped galaxies are the so-called “jellyfish galaxies” that exhibit tentacles of debris material with a characteristic jellyfish morphology. We have conducted the first systematic search for galaxies that are being stripped of their gas at low-z (z = 0.04−0.07) in different environments, selecting galaxies with varying degrees of morphological evidence for stripping. We have visually inspected B- and V-band images and identified 344 candidates in 71 galaxy clusters of the OMEGAWINGS+WINGS sample and 75 candidates in groups and lower mass structures in the PM2GC sample. We present the atlas of stripping candidates and a first analysis of their environment and their basic properties, such as morphologies, star formation rates and galaxy stellar masses. Candidates are found in all clusters and at all clustercentric radii, and their number does not correlate with the cluster velocity dispersion σ or X-ray luminosity L{sub X}. Interestingly, convincing cases of candidates are also found in groups and lower mass halos (10{sup 11}−10{sup 14}M{sub ⊙}), although the physical mechanism at work needs to be securely identified. All the candidates are disky, have stellar masses ranging from log M/M{sub ⊙} < 9 to > 11.5 and the majority of them form stars at a rate that is on average a factor of 2 higher (2.5σ) compared to non-stripped galaxies of similar mass. The few post-starburst and passive candidates have weak stripping evidence. We conclude that disturbed morphologies suggestive of stripping phenomena are ubiquitous in clusters and could be present even in groups and low mass halos. Further studies will reveal the physics of the gas stripping and clarify the mechanisms at work.

  8. Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers

    Science.gov (United States)

    Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B.; Rudolph, Anja; Schmutzler, Rita K.; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A.; Easton, Douglas F.; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A.; Schmidt, Marjanka K; van der Baan, Frederieke H.; Spurdle, Amanda B.; Walker, Logan C.; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B.; Olopade, Olufunmilayo I.; Nussbaum, Robert L.; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K.; Miron, Alex; Southey, Melissa C.; Goldgar, David E.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Ding, Yuan Chun; Neuhausen, Susan L.; Hansen, Thomas V. O.; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E.; Blazer, Kathleen R.; Weitzel, Jeffrey N.; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E.; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D. Gareth R.; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E.; Kennedy, M. John; Rogers, Mark T.; Porteous, Mary E.; Morrison, Patrick J.; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V.; Ellis, Steve; Cole, Trevor; Godwin, Andrew K.; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M.; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L.; Rodriguez, Gustavo C.; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A.M.; Meijers-Heijboer, Hanne E.J.; van der Hout, Annemarie H.; Vreeswijk, Maaike P.G.; Hoogerbrugge, Nicoline; Ausems, Margreet G.E.M.; van Doorn, Helena C.; Collée, J. Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R.; Olswold, Curtis; Couch, Fergus J.; Lindor, Noralane M.; Wang, Xianshu; Szabo, Csilla I.; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E.; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F.; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M.; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L.; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B.; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Friedman, Eitan

    2014-01-01

    Background BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and non-genetic modifying factors. In this study we evaluated the putative role of variants in many candidate modifier genes. Methods Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n=3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. Results The observed p-values of association ranged between 0.005-1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. Conclusion There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Impact Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. PMID:25336561

  9. Candidate genetic modifiers for breast and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers.

    Science.gov (United States)

    Peterlongo, Paolo; Chang-Claude, Jenny; Moysich, Kirsten B; Rudolph, Anja; Schmutzler, Rita K; Simard, Jacques; Soucy, Penny; Eeles, Rosalind A; Easton, Douglas F; Hamann, Ute; Wilkening, Stefan; Chen, Bowang; Rookus, Matti A; Schmidt, Marjanka K; van der Baan, Frederieke H; Spurdle, Amanda B; Walker, Logan C; Lose, Felicity; Maia, Ana-Teresa; Montagna, Marco; Matricardi, Laura; Lubinski, Jan; Jakubowska, Anna; Gómez Garcia, Encarna B; Olopade, Olufunmilayo I; Nussbaum, Robert L; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Orsulic, Sandra; Lester, Jenny; Chung, Wendy K; Miron, Alex; Southey, Melissa C; Goldgar, David E; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Ding, Yuan Chun; Neuhausen, Susan L; Hansen, Thomas V O; Gerdes, Anne-Marie; Ejlertsen, Bent; Jønson, Lars; Osorio, Ana; Martínez-Bouzas, Cristina; Benitez, Javier; Conway, Edye E; Blazer, Kathleen R; Weitzel, Jeffrey N; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Barile, Monica; Ficarazzi, Filomena; Mariette, Frederique; Fortuzzi, Stefano; Viel, Alessandra; Giannini, Giuseppe; Papi, Laura; Martayan, Aline; Tibiletti, Maria Grazia; Radice, Paolo; Vratimos, Athanassios; Fostira, Florentia; Garber, Judy E; Donaldson, Alan; Brewer, Carole; Foo, Claire; Evans, D Gareth R; Frost, Debra; Eccles, Diana; Brady, Angela; Cook, Jackie; Tischkowitz, Marc; Adlard, Julian; Barwell, Julian; Walker, Lisa; Izatt, Louise; Side, Lucy E; Kennedy, M John; Rogers, Mark T; Porteous, Mary E; Morrison, Patrick J; Platte, Radka; Davidson, Rosemarie; Hodgson, Shirley V; Ellis, Steve; Cole, Trevor; Godwin, Andrew K; Claes, Kathleen; Van Maerken, Tom; Meindl, Alfons; Gehrig, Andrea; Sutter, Christian; Engel, Christoph; Niederacher, Dieter; Steinemann, Doris; Plendl, Hansjoerg; Kast, Karin; Rhiem, Kerstin; Ditsch, Nina; Arnold, Norbert; Varon-Mateeva, Raymonda; Wappenschmidt, Barbara; Wang-Gohrke, Shan; Bressac-de Paillerets, Brigitte; Buecher, Bruno; Delnatte, Capucine; Houdayer, Claude; Stoppa-Lyonnet, Dominique; Damiola, Francesca; Coupier, Isabelle; Barjhoux, Laure; Venat-Bouvet, Laurence; Golmard, Lisa; Boutry-Kryza, Nadia; Sinilnikova, Olga M; Caron, Olivier; Pujol, Pascal; Mazoyer, Sylvie; Belotti, Muriel; Piedmonte, Marion; Friedlander, Michael L; Rodriguez, Gustavo C; Copeland, Larry J; de la Hoya, Miguel; Segura, Pedro Perez; Nevanlinna, Heli; Aittomäki, Kristiina; van Os, Theo A M; Meijers-Heijboer, Hanne E J; van der Hout, Annemarie H; Vreeswijk, Maaike P G; Hoogerbrugge, Nicoline; Ausems, Margreet G E M; van Doorn, Helena C; Collée, J Margriet; Olah, Edith; Diez, Orland; Blanco, Ignacio; Lazaro, Conxi; Brunet, Joan; Feliubadalo, Lidia; Cybulski, Cezary; Gronwald, Jacek; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Sukiennicki, Grzegorz; Arason, Adalgeir; Chiquette, Jocelyne; Teixeira, Manuel R; Olswold, Curtis; Couch, Fergus J; Lindor, Noralane M; Wang, Xianshu; Szabo, Csilla I; Offit, Kenneth; Corines, Marina; Jacobs, Lauren; Robson, Mark E; Zhang, Liying; Joseph, Vijai; Berger, Andreas; Singer, Christian F; Rappaport, Christine; Kaulich, Daphne Geschwantler; Pfeiler, Georg; Tea, Muy-Kheng M; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Rennert, Gad; Mulligan, Anna Marie; Glendon, Gord; Tchatchou, Sandrine; Andrulis, Irene L; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Thomassen, Mads; Jensen, Uffe Birk; Laitman, Yael; Rantala, Johanna; von Wachenfeldt, Anna; Ehrencrona, Hans; Askmalm, Marie Stenmark; Borg, Åke; Kuchenbaecker, Karoline B; McGuffog, Lesley; Barrowdale, Daniel; Healey, Sue; Lee, Andrew; Pharoah, Paul D P; Chenevix-Trench, Georgia; Antoniou, Antonis C; Friedman, Eitan

    2015-01-01

    BRCA1 and BRCA2 mutation carriers are at substantially increased risk for developing breast and ovarian cancer. The incomplete penetrance coupled with the variable age at diagnosis in carriers of the same mutation suggests the existence of genetic and nongenetic modifying factors. In this study, we evaluated the putative role of variants in many candidate modifier genes. Genotyping data from 15,252 BRCA1 and 8,211 BRCA2 mutation carriers, for known variants (n = 3,248) located within or around 445 candidate genes, were available through the iCOGS custom-designed array. Breast and ovarian cancer association analysis was performed within a retrospective cohort approach. The observed P values of association ranged between 0.005 and 1.000. None of the variants was significantly associated with breast or ovarian cancer risk in either BRCA1 or BRCA2 mutation carriers, after multiple testing adjustments. There is little evidence that any of the evaluated candidate variants act as modifiers of breast and/or ovarian cancer risk in BRCA1 or BRCA2 mutation carriers. Genome-wide association studies have been more successful at identifying genetic modifiers of BRCA1/2 penetrance than candidate gene studies. ©2014 American Association for Cancer Research.

  10. Towards Treating Chemistry Teacher Candidates as Human

    Science.gov (United States)

    Lewthwaite, Brian Ellis

    2008-01-01

    This research inquiry investigates the factors influencing chemistry teacher candidates' development during their extended practica in the second and final year of an After-Degree Bachelor of Education at a university in central Canada. A variety of data sources are used to identify the risk and protective factors impeding and contributing to the…

  11. Cluster analysis in severe emphysema subjects using phenotype and genotype data: an exploratory investigation

    Directory of Open Access Journals (Sweden)

    Martinez Fernando J

    2010-03-01

    Full Text Available Abstract Background Numerous studies have demonstrated associations between genetic markers and COPD, but results have been inconsistent. One reason may be heterogeneity in disease definition. Unsupervised learning approaches may assist in understanding disease heterogeneity. Methods We selected 31 phenotypic variables and 12 SNPs from five candidate genes in 308 subjects in the National Emphysema Treatment Trial (NETT Genetics Ancillary Study cohort. We used factor analysis to select a subset of phenotypic variables, and then used cluster analysis to identify subtypes of severe emphysema. We examined the phenotypic and genotypic characteristics of each cluster. Results We identified six factors accounting for 75% of the shared variability among our initial phenotypic variables. We selected four phenotypic variables from these factors for cluster analysis: 1 post-bronchodilator FEV1 percent predicted, 2 percent bronchodilator responsiveness, and quantitative CT measurements of 3 apical emphysema and 4 airway wall thickness. K-means cluster analysis revealed four clusters, though separation between clusters was modest: 1 emphysema predominant, 2 bronchodilator responsive, with higher FEV1; 3 discordant, with a lower FEV1 despite less severe emphysema and lower airway wall thickness, and 4 airway predominant. Of the genotypes examined, membership in cluster 1 (emphysema-predominant was associated with TGFB1 SNP rs1800470. Conclusions Cluster analysis may identify meaningful disease subtypes and/or groups of related phenotypic variables even in a highly selected group of severe emphysema subjects, and may be useful for genetic association studies.

  12. Genomic Variants Revealed by Invariably Missing Genotypes in Nelore Cattle.

    Directory of Open Access Journals (Sweden)

    Joaquim Manoel da Silva

    Full Text Available High density genotyping panels have been used in a wide range of applications. From population genetics to genome-wide association studies, this technology still offers the lowest cost and the most consistent solution for generating SNP data. However, in spite of the application, part of the generated data is always discarded from final datasets based on quality control criteria used to remove unreliable markers. Some discarded data consists of markers that failed to generate genotypes, labeled as missing genotypes. A subset of missing genotypes that occur in the whole population under study may be caused by technical issues but can also be explained by the presence of genomic variations that are in the vicinity of the assayed SNP and that prevent genotyping probes from annealing. The latter case may contain relevant information because these missing genotypes might be used to identify population-specific genomic variants. In order to assess which case is more prevalent, we used Illumina HD Bovine chip genotypes from 1,709 Nelore (Bos indicus samples. We found 3,200 missing genotypes among the whole population. NGS re-sequencing data from 8 sires were used to verify the presence of genomic variations within their flanking regions in 81.56% of these missing genotypes. Furthermore, we discovered 3,300 novel SNPs/Indels, 31% of which are located in genes that may affect traits of importance for the genetic improvement of cattle production.

  13. Phosphorus use efficiency in pima cotton (Gossypium barbadense L. genotypes

    Directory of Open Access Journals (Sweden)

    Elcio Santos

    2015-06-01

    Full Text Available In the Brazilian Cerrado, P deficiency restricts cotton production, which requires large amounts of phosphate fertilizer. To improve the yield of cotton crops, genotypes with high P use efficiency must be identified and used. The present study evaluated P uptake and use efficiency of different Gossypium barbadense L. genotypes grown in the Cerrado. The experiment was carried out in a greenhouse with a completely randomized design, 15 x 2 factorial treatment structure (15 genotypes x 2 P levels, and four replicates. The genotypes were MT 69, MT 70, MT 87, MT 91, MT 92, MT 94, MT 101, MT 102, MT 103, MT 105, MT 106, MT 110, MT 112, MT 124, and MT 125; P levels were sufficient (1000 mg pot-1, PS treatment or deficient (PD treatment. Dry matter (DM and P levels were determined in cotton plant parts and used to calculate plant P content and use efficiency. In general, DM and P content were higher in the PS than in the PD treatment, with the exception of root DM and total DM in some genotypes. Genotypes also differed in terms of P uptake and use capacity. In the PS treatment, genotypes MT 92 and MT 102 had the highest response to phosphate fertilization. Genotype MT 69 exhibited the most efficient P uptake in the PD treatment. Genotype MT 124 showed the best shoot physiological efficiency, apparent recovery efficiency, and utilization efficiency, whereas MT 110 exhibited the highest root physiological efficiency.

  14. A Multidisciplinary Phenotyping and Genotyping Analysis of a Mapping Population Enables Quality to Be Combined with Yield in Rice

    Directory of Open Access Journals (Sweden)

    Mariafe Calingacion

    2017-05-01

    Full Text Available In this study a mapping population (F8 of ca 200 progeny from a cross between the commercial rice varieties Apo and IR64 has been both genotyped and phenotyped. A genotyping-by-sequencing approach was first used to identify 2,681 polymorphic SNP markers which gave dense coverage of the genome with a good distribution across all 12 chromosomes. The coefficient of parentage was also low, at 0.13, confirming that the parents are genetically distant from each other. The progeny, together with both parents, were grown under irrigated and water restricted conditions in a randomised block design. All grain was harvested to determine variation in yield across the population. The grains were then polished following standard procedures prior to performing the phenotyping analyses. A Gas Chromatography—Mass Spectrometry approach was used to determine the volatile biochemical profiles of each line and after data curation and processing, discriminatory metabolites were putatively identified based on in-house and commercial spectral libraries. These data were used to predict the potential role of these metabolites in determining differences in aroma between genotypes. A number of QTLs for yield and for individual metabolites have been identified. Following these combined multi-disciplinary analyses, it proved possible to identify a number of lines which appeared to combine the favourable aroma attributes of IR64 with the favourable (higher yield potential of Apo. As such, these lines are excellent candidates to assess further as potential genotypes to work up into a new variety of rice which has both good yield and good quality, thus meeting the needs of both farmer and consumer alike.

  15. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L. Gaertn. Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Directory of Open Access Journals (Sweden)

    M Ramakrishnan

    Full Text Available Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX for tiller production, calmodulin (CaM binding protein for seed yield and pectin methylesterase inhibitor (PMEI for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of

  16. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L.) Gaertn.) Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Science.gov (United States)

    Ramakrishnan, M; Antony Ceasar, S; Duraipandiyan, V; Vinod, K K; Kalpana, Krishnan; Al-Dhabi, N A; Ignacimuthu, S

    2016-01-01

    Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs) for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX) for tiller production, calmodulin (CaM) binding protein for seed yield and pectin methylesterase inhibitor (PMEI) for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of fungal

  17. Selection of radio pulsar candidates using artificial neural networks

    OpenAIRE

    Eatough, R. P.; Molkenthin, N.; Kramer, M.; Noutsos, A.; Keith, M. J.; Stappers, B. W.; Lyne, A. G.

    2010-01-01

    Radio pulsar surveys are producing many more pulsar candidates than can be inspected by human experts in a practical length of time. Here we present a technique to automatically identify credible pulsar candidates from pulsar surveys using an artificial neural network. The technique has been applied to candidates from a recent re-analysis of the Parkes multi-beam pulsar survey resulting in the discovery of a previously unidentified pulsar.

  18. TGIF1 is a potential candidate gene for high myopia in ethnic Kashmiri population.

    Science.gov (United States)

    Ahmed, Ishfaq; Rasool, Shabhat; Jan, Tariq; Qureshi, Tariq; Naykoo, Niyaz A; Andrabi, Khurshid I

    2014-03-01

    High myopia is a complex disorder that imposes serious consequences on ocular health. Linkage analysis has identified several genetic loci with a series of potential candidate genes that reveal an ambiguous pattern of association with high myopia due to population heterogeneity. We have accordingly chosen to examine the prospect of association of one such gene [transforming growth β-induced factor 1 (TGIF1)] in population that is purely ethnic (Kashmiri) and represents a homogeneous cohort from Northern India. Cases with high myopia with a spherical equivalent of ≥-6 diopters (D) and emmetropic controls with spherical equivalent within ±0.5 D in one or both eyes represented by a sample size of 212 ethnic Kashmiri subjects and 239 matched controls. Genomic DNA was genotyped for sequence variations in TGIF1 gene and allele frequencies tested for Hardy-Weinberg disequilibrium. Potential association was evaluated using χ(2) or Fisher's exact test. Two previously reported missense variations C > T, rs4468717 (first base of codon 143) changing proline to serine and rs2229333 (second base of codon 143) changing proline to leucine were identified in exon 10 of TGIF1. Both variations exhibited possibly significant (p population. In silico predictions show that substitutions are likely to have an impact on the structure and functional properties of the protein, making it imperative to understand their functional consequences in relation to high myopia. TGIF1 is a relevant candidate gene with potential to contribute in the genesis of high myopia.

  19. Scalar tetraquark candidates on the lattice

    International Nuclear Information System (INIS)

    Berlin, Joshua

    2017-01-01

    The topic of this thesis is the investigation of scalar tetraquark candidates from lattice QCD. It is motivated by a previous study originating in the twisted mass collaboration. The initial tetraquark candidate of choice is the a 0 (980), an isovector in the nonet of light scalars (J P =0 + ). This channel is still poorly understood. It displays an inverted mass hierarchy to what is expected from the conventional quark model and the a 0 (980) and f 0 (980) feature a surprising mass degeneracy. For this reasons the a 0 (980) is a long assumed tetraquark candidate in the literature. We follow a methodological approach by studying the sensitivity of the scalar spectrum with fully dynamical quarks to a large basis of two-quark and four-quark creation operators. Ultimately, the candidate has to be identified in the direct vicinity of two two-particles states, which is understandably inevitable for a tetraquark candidate. To succeed in this difficult task two-meson creation operators are essential to employ in this channel. By localized four-quark operators we intend to probe the Hamiltonian on eigenstates with a closely bound four-quark structure.

  20. Scalar tetraquark candidates on the lattice

    Energy Technology Data Exchange (ETDEWEB)

    Berlin, Joshua

    2017-07-01

    The topic of this thesis is the investigation of scalar tetraquark candidates from lattice QCD. It is motivated by a previous study originating in the twisted mass collaboration. The initial tetraquark candidate of choice is the a{sub 0}(980), an isovector in the nonet of light scalars (J{sup P}=0{sup +}). This channel is still poorly understood. It displays an inverted mass hierarchy to what is expected from the conventional quark model and the a{sub 0}(980) and f{sub 0}(980) feature a surprising mass degeneracy. For this reasons the a{sub 0}(980) is a long assumed tetraquark candidate in the literature. We follow a methodological approach by studying the sensitivity of the scalar spectrum with fully dynamical quarks to a large basis of two-quark and four-quark creation operators. Ultimately, the candidate has to be identified in the direct vicinity of two two-particles states, which is understandably inevitable for a tetraquark candidate. To succeed in this difficult task two-meson creation operators are essential to employ in this channel. By localized four-quark operators we intend to probe the Hamiltonian on eigenstates with a closely bound four-quark structure.

  1. Evaluation of some Phenological and Pomological Characteristics of Selected Walnut Genotypes from Shahroud-Iran

    Directory of Open Access Journals (Sweden)

    Sara Akhiani

    2017-05-01

    Full Text Available The first step in walnut breeding programs is to identify and evaluate superior genotypes of fruit trees. Hence, there are various walnut breeding programs in various areas of Iran. A study aimed to evaluate the morphological and chemical characteristics of selected superior genotypes of walnut was conducted in the Shahroud region in 2011-2012.  The following genotypes were selected in this study as the best walnut genotypes:  X-18 homogamous genotypes due to desirable late leafing;   genotype X-11 for its high percentage of kernel production, easily removal of shell, thin shell; genotype X-52 due to its kernel plumpness compared to other genotypes, thin shell and high percentage of kernel and genotype X-70 for its kernel brightness, easily kernel extracting and high percentage of kernels. The X-49 and X-5 genotypes had the highest amount of linoleic and linolenic fatty acids and higher nutritional quality compared to other genotypes. Three genotypes, X-3, X-11 and X-22, had the highest amount of oil. Genotypes X-9 and X-45 had the highest amount of protein. The difference between oil content and fatty acid compositions was presumably due to genetic diversity and ecological conditions of the studied genotypes cultivation.

  2. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

    Science.gov (United States)

    Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza

    2015-01-01

    Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  3. Five kepler target stars that show multiple transiting exoplanet candidates

    DEFF Research Database (Denmark)

    Steffen..[], Jason H.; Batalha, N. M.; Broucki, W J.

    2010-01-01

    We present and discuss five candidate exoplanetary systems identified with the Kepler spacecraft. These five systems show transits from multiple exoplanet candidates. Should these objects prove to be planetary in nature, then these five systems open new opportunities for the field of exoplanets a...

  4. Convergent functional genomics in addiction research - a translational approach to study candidate genes and gene networks.

    Science.gov (United States)

    Spanagel, Rainer

    2013-01-01

    Convergent functional genomics (CFG) is a translational methodology that integrates in a Bayesian fashion multiple lines of evidence from studies in human and animal models to get a better understanding of the genetics of a disease or pathological behavior. Here the integration of data sets that derive from forward genetics in animals and genetic association studies including genome wide association studies (GWAS) in humans is described for addictive behavior. The aim of forward genetics in animals and association studies in humans is to identify mutations (e.g. SNPs) that produce a certain phenotype; i.e. "from phenotype to genotype". Most powerful in terms of forward genetics is combined quantitative trait loci (QTL) analysis and gene expression profiling in recombinant inbreed rodent lines or genetically selected animals for a specific phenotype, e.g. high vs. low drug consumption. By Bayesian scoring genomic information from forward genetics in animals is then combined with human GWAS data on a similar addiction-relevant phenotype. This integrative approach generates a robust candidate gene list that has to be functionally validated by means of reverse genetics in animals; i.e. "from genotype to phenotype". It is proposed that studying addiction relevant phenotypes and endophenotypes by this CFG approach will allow a better determination of the genetics of addictive behavior.

  5. A Multiple Interaction Analysis Reveals ADRB3 as a Potential Candidate for Gallbladder Cancer Predisposition via a Complex Interaction with Other Candidate Gene Variations

    Directory of Open Access Journals (Sweden)

    Rajani Rai

    2015-11-01

    Full Text Available Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactions contributing towards genetic susceptibility of GBC. Here, we performed Multifactor-Dimensionality Reduction (MDR and Classification and Regression Tree Analysis (CRT to investigate the gene–gene interactions and the combined effect of 14 SNPs in nine genes (DR4 (rs20576, rs6557634; FAS (rs2234767; FASL (rs763110; DCC (rs2229080, rs4078288, rs7504990, rs714; PSCA (rs2294008, rs2978974; ADRA2A (rs1801253; ADRB1 (rs1800544; ADRB3 (rs4994; CYP17 (rs2486758 involved in various signaling pathways. Genotyping was accomplished by PCR-RFLP or Taqman allelic discrimination assays. SPSS software version 16.0 and MDR software version 2.0 were used for all the statistical analysis. Single locus investigation demonstrated significant association of DR4 (rs20576, rs6557634, DCC (rs714, rs2229080, rs4078288 and ADRB3 (rs4994 polymorphisms with GBC risk. MDR analysis revealed ADRB3 (rs4994 to be crucial candidate in GBC susceptibility that may act either alone (p < 0.0001, CVC = 10/10 or in combination with DCC (rs714 and rs2229080, p < 0.0001, CVC = 9/10. Our CRT results are in agreement with the above findings. Further, in-silico results of studied SNPs advocated their role in splicing, transcriptional and/or protein coding regulation. Overall, our result suggested complex interactions amongst the studied SNPs and ADRB3 rs4994 as candidate influencing GBC susceptibility.

  6. FRUIT QUALITY CHARACTERISTICS OF SOME BLUEBERRY GENOTYPES

    Directory of Open Access Journals (Sweden)

    Irina Ancu

    2013-12-01

    Full Text Available In Romania the blueberry breeding program started in 1982 and till now was conducted by dr. Paulina Mladin. For inducing the variability, different genetic resources of American blueberry cultivars (V. corymbosum, V. angustifolium were involved in a high number of crosses. For identify the genotype with the best fruit quality, some biometric quality indicators (average fruit weight, size index and basically chemical compounds of fruits including ascorbic acid, dry matter, ash, soluble solids, total sugar, titratable acidity, tanoid substances, pectic substances, protein crude, phosphorus and potassium were determined. Of the eleven chemical studied properties who reflected the fruits quality, for five of them were found no statistically significant differences. The purpose of this paper work was to evaluate fruit quality and to identify the valuable genotypes resulted from Romanian blueberry breeding program.

  7. Comparative analysis of miRNAs of two rapeseed genotypes in response to acetohydroxyacid synthase-inhibiting herbicides by high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Maolong Hu

    Full Text Available Acetohydroxyacid synthase (AHAS, also called acetolactate synthase, is a key enzyme involved in the first step of the biosynthesis of the branched-chain amino acids valine, isoleucine and leucine. Acetohydroxyacid synthase-inhibiting herbicides (AHAS herbicides are five chemical families of herbicides that inhibit AHAS enzymes, including imidazolinones (IMI, sulfonylureas (SU, pyrimidinylthiobenzoates, triazolinones and triazolopyrimidines. Five AHAS genes have been identified in rapeseed, but little information is available regarding the role of miRNAs in response to AHAS herbicides. In this study, an AHAS herbicides tolerant genotype and a sensitive genotype were used for miRNA comparative analysis. A total of 20 small RNA libraries were obtained of these two genotypes at three time points (0h, 24 h and 48 h after spraying SU and IMI herbicides with two replicates. We identified 940 conserved miRNAs and 1515 novel candidate miRNAs in Brassica napus using high-throughput sequencing methods combined with computing analysis. A total of 3284 genes were predicted to be targets of these miRNAs, and their functions were shown using GO, KOG and KEGG annotations. The differentiation expression results of miRNAs showed almost twice as many differentiated miRNAs were found in tolerant genotype M342 (309 miRNAs after SU herbicide application than in sensitive genotype N131 (164 miRNAs. In additiond 177 and 296 miRNAs defined as differentiated in sensitive genotype and tolerant genotype in response to SU herbicides. The miR398 family was observed to be associated with AHAS herbicide tolerance because their expression increased in the tolerant genotype but decreased in the sensitive genotype. Moreover, 50 novel miRNAs from 39 precursors were predicted. There were 8 conserved miRNAs, 4 novel miRNAs and 3 target genes were validated by quantitative real-time PCR experiment. This study not only provides novel insights into the miRNA content of AHAS herbicides

  8. Physicochemical and sensorial quality of banana genotypes

    Directory of Open Access Journals (Sweden)

    Ronielli Cardoso Reis

    2016-03-01

    Full Text Available Despite the diversity of banana varieties in Brazil, only a few cultivars have the proper agronomic traits and fruit quality for commercial exploitation. This study aimed at evaluating the physicochemical traits and sensorial acceptance of banana genotypes, in order to identify those with potential for commercial growing. Six improved banana genotypes were assessed (BRS Maravilha, PC 0101, FHIA 18, TM 2803, YB 4203 and BRS Caipira, as well as three commercial cultivars (Grand Naine, Pacovan and Prata Anã. Analyses of peel and pulp color, peel thickness, pulp yield, moisture, pH, soluble solids, titratable acidity, total carotenoids and sensorial acceptance were performed. The BRS Maravilha, FHIA 18, YB 4203 and BRS Caipira genotypes presented physicochemical traits similar to the Grand Naine, Pacovan and Prata Anã commercial cultivars. The BRS Maravilha and TM 2803 genotypes had sensorial acceptance similar to the Prata Anã and Grand Naine cultivars, and are therefore promising for commercial growing, with the advantage of being resistant to the black Sigatoka and Panama disease.

  9. The genotype-phenotype map of an evolving digital organism.

    Directory of Open Access Journals (Sweden)

    Miguel A Fortuna

    2017-02-01

    Full Text Available To understand how evolving systems bring forth novel and useful phenotypes, it is essential to understand the relationship between genotypic and phenotypic change. Artificial evolving systems can help us understand whether the genotype-phenotype maps of natural evolving systems are highly unusual, and it may help create evolvable artificial systems. Here we characterize the genotype-phenotype map of digital organisms in Avida, a platform for digital evolution. We consider digital organisms from a vast space of 10141 genotypes (instruction sequences, which can form 512 different phenotypes. These phenotypes are distinguished by different Boolean logic functions they can compute, as well as by the complexity of these functions. We observe several properties with parallels in natural systems, such as connected genotype networks and asymmetric phenotypic transitions. The likely common cause is robustness to genotypic change. We describe an intriguing tension between phenotypic complexity and evolvability that may have implications for biological evolution. On the one hand, genotypic change is more likely to yield novel phenotypes in more complex organisms. On the other hand, the total number of novel phenotypes reachable through genotypic change is highest for organisms with simple phenotypes. Artificial evolving systems can help us study aspects of biological evolvability that are not accessible in vastly more complex natural systems. They can also help identify properties, such as robustness, that are required for both human-designed artificial systems and synthetic biological systems to be evolvable.

  10. The genotype-phenotype map of an evolving digital organism.

    Science.gov (United States)

    Fortuna, Miguel A; Zaman, Luis; Ofria, Charles; Wagner, Andreas

    2017-02-01

    To understand how evolving systems bring forth novel and useful phenotypes, it is essential to understand the relationship between genotypic and phenotypic change. Artificial evolving systems can help us understand whether the genotype-phenotype maps of natural evolving systems are highly unusual, and it may help create evolvable artificial systems. Here we characterize the genotype-phenotype map of digital organisms in Avida, a platform for digital evolution. We consider digital organisms from a vast space of 10141 genotypes (instruction sequences), which can form 512 different phenotypes. These phenotypes are distinguished by different Boolean logic functions they can compute, as well as by the complexity of these functions. We observe several properties with parallels in natural systems, such as connected genotype networks and asymmetric phenotypic transitions. The likely common cause is robustness to genotypic change. We describe an intriguing tension between phenotypic complexity and evolvability that may have implications for biological evolution. On the one hand, genotypic change is more likely to yield novel phenotypes in more complex organisms. On the other hand, the total number of novel phenotypes reachable through genotypic change is highest for organisms with simple phenotypes. Artificial evolving systems can help us study aspects of biological evolvability that are not accessible in vastly more complex natural systems. They can also help identify properties, such as robustness, that are required for both human-designed artificial systems and synthetic biological systems to be evolvable.

  11. Drill Sergeant Candidate Transformation

    Science.gov (United States)

    2009-02-01

    leadership styles of NCOs entering Drill Sergeant School (DSS). ARI also developed and administered a prototype DS Assessment Battery to assess...preferred leadership styles . DSS training increases both the degree to which the DSC feels obligated to and identifies with the Army. DSS training...4 TABLE 3. PREFERRED LEADERSHIP STYLES DEFINITIONS .............................................6 TABLE 4. DSC CHANGE IN

  12. Comparative Analysis of Fruit Metabolites and Pungency Candidate Genes Expression between Bhut Jolokia and Other Capsicum Species.

    Directory of Open Access Journals (Sweden)

    Sarpras M

    Full Text Available Bhut jolokia, commonly known as Ghost chili, a native Capsicum species found in North East India was recorded as the naturally occurring hottest chili in the world by the Guinness Book of World Records in 2006. Although few studies have reported variation in pungency content of this particular species, no study till date has reported detailed expression analysis of candidate genes involved in capsaicinoids (pungency biosynthesis pathway and other fruit metabolites. Therefore, the present study was designed to evaluate the diversity of fruit morphology, fruiting habit, capsaicinoids and other metabolite contents in 136 different genotypes mainly collected from North East India. Significant intra and inter-specific variations for fruit morphological traits, fruiting habits and 65 fruit metabolites were observed in the collected Capsicum germplasm belonging to three Capsicum species i.e., Capsicum chinense (Bhut jolokia, 63 accessions, C. frutescens (17 accessions and C. annuum (56 accessions. The pungency level, measured in Scoville Heat Unit (SHU and antioxidant activity measured by 2, 2-diphenyl-1-picrylhydrazyl (DPPH free radical scavenging assay showed maximum levels in C. chinense accessions followed by C. frutescens accessions, while C. annuum accessions showed the lowest value for both the traits. The number of different fruit metabolites detected did not vary significantly among the different species but the metabolite such as benzoic acid hydroxyl esters identified in large percentage in majority of C. annuum genotypes was totally absent in the C. chinense genotypes and sparingly present in few genotypes of C. frutescens. Significant correlations were observed between fruit metabolites capsaicin, dihydrocapsaicin, hexadecanoic acid, cyclopentane, α-tocopherol and antioxidant activity. Furthermore, comparative expression analysis (through qRT-PCR of candidate genes involved in capsaicinoid biosynthesis pathway revealed many fold higher

  13. Comparative Analysis of Fruit Metabolites and Pungency Candidate Genes Expression between Bhut Jolokia and Other Capsicum Species.

    Science.gov (United States)

    M, Sarpras; Gaur, Rashmi; Sharma, Vineet; Chhapekar, Sushil Satish; Das, Jharna; Kumar, Ajay; Yadava, Satish Kumar; Nitin, Mukesh; Brahma, Vijaya; Abraham, Suresh K; Ramchiary, Nirala

    2016-01-01

    Bhut jolokia, commonly known as Ghost chili, a native Capsicum species found in North East India was recorded as the naturally occurring hottest chili in the world by the Guinness Book of World Records in 2006. Although few studies have reported variation in pungency content of this particular species, no study till date has reported detailed expression analysis of candidate genes involved in capsaicinoids (pungency) biosynthesis pathway and other fruit metabolites. Therefore, the present study was designed to evaluate the diversity of fruit morphology, fruiting habit, capsaicinoids and other metabolite contents in 136 different genotypes mainly collected from North East India. Significant intra and inter-specific variations for fruit morphological traits, fruiting habits and 65 fruit metabolites were observed in the collected Capsicum germplasm belonging to three Capsicum species i.e., Capsicum chinense (Bhut jolokia, 63 accessions), C. frutescens (17 accessions) and C. annuum (56 accessions). The pungency level, measured in Scoville Heat Unit (SHU) and antioxidant activity measured by 2, 2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay showed maximum levels in C. chinense accessions followed by C. frutescens accessions, while C. annuum accessions showed the lowest value for both the traits. The number of different fruit metabolites detected did not vary significantly among the different species but the metabolite such as benzoic acid hydroxyl esters identified in large percentage in majority of C. annuum genotypes was totally absent in the C. chinense genotypes and sparingly present in few genotypes of C. frutescens. Significant correlations were observed between fruit metabolites capsaicin, dihydrocapsaicin, hexadecanoic acid, cyclopentane, α-tocopherol and antioxidant activity. Furthermore, comparative expression analysis (through qRT-PCR) of candidate genes involved in capsaicinoid biosynthesis pathway revealed many fold higher expression of

  14. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    International Nuclear Information System (INIS)

    Wang Xiaojuan; Song, Yu; Ma Yanhua; Zhuo Renying; Jin Liang

    2011-01-01

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: → Evaluate Cd tolerance in wide sources of alfalfa accessions. → Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. → Cloned differentially expressed metallothionein (MT) genes. → Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. → MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  15. Screening of Cd tolerant genotypes and isolation of metallothionein genes in alfalfa (Medicago sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Wang Xiaojuan, E-mail: xiaojuanwang@lzu.edu.cn [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Song, Yu [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China); Environment Management College of China, Qinhuangdao 066004 (China); Ma Yanhua [Hebei Normal University of Science and Technology, Qinhuangdao 066004 (China); Zhuo Renying [Key Lab of Tree Genomics, Research Institute of Subtropical of Forest, Chinese Academy of Forest, Fuyang 311400 (China); Jin Liang [School of Pastoral Agriculture Science and Technology, Lanzhou University, P.O. Box 61, Lanzhou 730020 (China)

    2011-12-15

    In order to evaluate Cd tolerance in wide-ranging sources of alfalfa (Medicago sativa) and to identify Cd tolerant genotypes which may potentially be useful for restoring Cd-contaminated environments, thirty-six accessions of alfalfa were screened under hydroponic culture. Our results showed that the relative root growth rate varied from 0.48 to 1.0, which indicated that different alfalfa accessions had various responses to Cd stress. The candidate fragments derived from differentially expressed metallothionein (MT) genes were cloned from leaves of two Cd tolerant genotypes, YE and LZ. DNA sequence and the deduced protein sequence showed that MsMT2a and MsMT2b had high similarity to those in leguminous plants. DDRT-PCR analysis showed that MsMT2a expressed in both YE and LZ plants under control and Cd stress treatment, but MsMT2b only expressed under Cd stress treatment. This suggested that MsMT2a was universally expressed in leaves of alfalfa but expression of MsMT2b was Cadmium (Cd) inducible. - Highlights: > Evaluate Cd tolerance in wide sources of alfalfa accessions. > Identify Cd-hyperaccumulators potentially useful for restoring Cd-contaminated environments. > Cloned differentially expressed metallothionein (MT) genes. > Characteristics and deduced protein sequence of MsMT2a and MsMT2b were analyzed. > MsMT2a might be a universally gene of alfalfa but MsMT2b might be an inductive gene. - Two Cd tolerant alfalfa genotypes were screened and their metallothionein genes were cloned which showed that MsMT2a was universally expressed but MsMT2b was Cd inducible expression.

  16. HBV genotypic variability in Cuba.

    Directory of Open Access Journals (Sweden)

    Carmen L Loureiro

    Full Text Available The genetic diversity of HBV in human population is often a reflection of its genetic admixture. The aim of this study was to explore the genotypic diversity of HBV in Cuba. The S genomic region of Cuban HBV isolates was sequenced and for selected isolates the complete genome or precore-core sequence was analyzed. The most frequent genotype was A (167/250, 67%, mainly A2 (149, 60% but also A1 and one A4. A total of 77 isolates were classified as genotype D (31%, with co-circulation of several subgenotypes (56 D4, 2 D1, 5 D2, 7 D3/6 and 7 D7. Three isolates belonged to genotype E, two to H and one to B3. Complete genome sequence analysis of selected isolates confirmed the phylogenetic analysis performed with the S region. Mutations or polymorphisms in precore region were more common among genotype D compared to genotype A isolates. The HBV genotypic distribution in this Caribbean island correlates with the Y lineage genetic background of the population, where a European and African origin prevails. HBV genotypes E, B3 and H isolates might represent more recent introductions.

  17. HBV Genotypic Variability in Cuba

    Science.gov (United States)

    Loureiro, Carmen L.; Aguilar, Julio C.; Aguiar, Jorge; Muzio, Verena; Pentón, Eduardo; Garcia, Daymir; Guillen, Gerardo; Pujol, Flor H.

    2015-01-01

    The genetic diversity of HBV in human population is often a reflection of its genetic admixture. The aim of this study was to explore the genotypic diversity of HBV in Cuba. The S genomic region of Cuban HBV isolates was sequenced and for selected isolates the complete genome or precore-core sequence was analyzed. The most frequent genotype was A (167/250, 67%), mainly A2 (149, 60%) but also A1 and one A4. A total of 77 isolates were classified as genotype D (31%), with co-circulation of several subgenotypes (56 D4, 2 D1, 5 D2, 7 D3/6 and 7 D7). Three isolates belonged to genotype E, two to H and one to B3. Complete genome sequence analysis of selected isolates confirmed the phylogenetic analysis performed with the S region. Mutations or polymorphisms in precore region were more common among genotype D compared to genotype A isolates. The HBV genotypic distribution in this Caribbean island correlates with the Y lineage genetic background of the population, where a European and African origin prevails. HBV genotypes E, B3 and H isolates might represent more recent introductions. PMID:25742179

  18. Reducing stigma and discrimination: Candidate interventions

    OpenAIRE

    Thornicroft, Graham; Brohan, Elaine; Kassam, Aliya; Lewis-Holmes, Elanor

    2008-01-01

    Abstract This paper proposes that stigma in relation to people with mental illness can be understood as a combination of problems of knowledge (ignorance), attitudes (prejudice) and behaviour (discrimination). From a literature review, a series of candidate interventions are identified which may be effective in reducing stigmatisation and discrimination at the following levels: individuals with mental illness and their family members; the workplace; and local, national and international. The ...

  19. Design, synthesis and identification of silicon-containing HCV NS5A inhibitors with pan-genotype activity.

    Science.gov (United States)

    Liu, Baomin; Gai, Kuo; Qin, Hui; Liu, Xushi; Cao, Yuan; Lu, Qin; Lu, Dandan; Chen, Deyang; Shen, Hengqiao; Song, Wei; Zhang, Yang; Wang, Xiaojin; Xu, Hongjiang; Zhang, Yinsheng

    2018-03-25

    Modification of a HCV NS5A inhibitor, ombitasvir, led to the identification of 10d with improved pan-genotype NS5A inhibition and better pharmacokinetic properties. The key structural changes to ombitasvir include bioisosteric replacement of carbon with silicon atom. Compared with ombitasvir, the activity of anti-HCV genotypes (GT 1 to 6) of 10d is increased to some extent, especially the inhibitory activity against genotype 3a and 6a is increased by more than seven times, and the dog's in vivo pharmacokinetics properties were also superior to ombitasvir. Further drug evaluation showed that 10d was similar to ombitasvir on plasma protein binding and liver distribution profiles, with no cytotoxicity and no inhibitory effect on both CYP 450 and hERG ligand binding. However, permeability assay results indicated that 10d was not the substrate of P-gp or BCRP transporter, which is different from that of ombitasvir. The results of a 14-day repeat-dose toxicity study identified no toxicity with 10d. Our findings in preclinical tests suggest that the silicon-containing compound 10d could be worthy of continued study as a potential drug candidate. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  20. Detection and genotyping of enteroviruses in cerebrospinal fluid in patients in Victoria, Australia, 2007-2013.

    Science.gov (United States)

    Papadakis, Georgina; Chibo, Doris; Druce, Julian; Catton, Michael; Birch, Chris

    2014-09-01

    Genotyping by VP1 fragment polymerase chain reaction (PCR) and nucleic acid sequencing to detect enterovirus (EV) genotypes was performed directly on 729 EV PCR positive cerebrospinal fluid (CSF) samples collected between 2007 and 2012 from Victorian hospital inpatients. The overall genotype identification rate from CSF-positive material was 43%. The four most common genotypes identified were Echovirus 6 (24%), Echovirus 30 (17%), Echovirus 25 (10%), and Coxsackievirus A9 (10%), together comprising 61% of all EVs typed. The seasonal distribution of all EVs identified followed the recognized pattern of mainly summer epidemics. Three of the four predominant genotypes were present in each of the 6 years in which the study was conducted, with 20 other EV genotypes also detected, often in only a single year. Genotyping of EVs directly in CSF is faster, simpler and more sensitive than traditional virus neutralization assays performed on EV positive samples. © 2014 Wiley Periodicals, Inc.

  1. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  2. Rotavirus genotype shifts among Swedish children and adults-Application of a real-time PCR genotyping.

    Science.gov (United States)

    Andersson, Maria; Lindh, Magnus

    2017-11-01

    It is well known that human rotavirus group A is the most important cause of severe diarrhoea in infants and young children. Less is known about rotavirus infections in other age groups, and about how rotavirus genotypes change over time in different age groups. Develop a real-time PCR to easily genotype rotavirus strains in order to monitor the pattern of circulating genotypes. In this study, rotavirus strains in clinical samples from children and adults in Western Sweden during 2010-2014 were retrospectively genotyped by using specific amplification of VP 4 and VP 7 genes with a new developed real-rime PCR. A genotype was identified in 97% of 775 rotavirus strains. G1P[8] was the most common genotype representing 34.9%, followed by G2P[4] (28.3%), G9P[8] (11.5%), G3P[8] (8.1%), and G4P[8] (7.9%) The genotype distribution changed over time, from predominance of G1P[8] in 2010-2012 to predominance of G2P[4] in 2013-2014. There were also age-related differences, with G1P[8] being the most common genotype in children under 2 years (47.6%), and G2P[4] the most common in those over 70 years of age (46.1%.). The shift to G2P[4] in 2013-2014 was associated with a change in the age distribution, with a greater number of rotavirus positive cases in elderly than in children. By using a new real-time PCR method for genotyping we found that genotype distribution was age related and changed over time with a decreasing proportion of G1P[8]. Copyright © 2017. Published by Elsevier B.V.

  3. Associations among Race/Ethnicity, ApoC-III Genotypes, and Lipids in HIV-1-Infected Individuals on Antiretroviral Therapy.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available BACKGROUND: Protease inhibitors (PIs are associated with hypertriglyceridemia and atherogenic dyslipidemia. Identifying HIV-1-infected individuals who are at increased risk of PI-related dyslipidemia will facilitate therapeutic choices that maintain viral suppression while reducing risk of atherosclerotic diseases. Apolipoprotein C-III (apoC-III gene variants, which vary by race/ethnicity, have been associated with a lipid profile that resembles PI-induced dyslipidemia. However, the association of race/ethnicity, or candidate gene effects across race/ethnicity, with plasma lipid levels in HIV-1-infected individuals, has not been reported. METHODS AND FINDINGS: A cross-sectional analysis of race/ethnicity, apoC-III/apoA-I genotypes, and PI exposure on plasma lipids was performed in AIDS Clinical Trial Group studies (n = 626. Race/ethnicity was a highly significant predictor of plasma lipids in fully adjusted models. Furthermore, in stratified analyses, the effect of PI exposure appeared to differ across race/ethnicity. Black/non-Hispanic, compared with White/non-Hispanics and Hispanics, had lower plasma triglyceride (TG levels overall, but the greatest increase in TG levels when exposed to PIs. In Hispanics, current PI antiretroviral therapy (ART exposure was associated with a significantly smaller increase in TGs among patients with variant alleles at apoC-III-482, -455, and Intron 1, or at a composite apoC-III genotype, compared with patients with the wild-type genotypes. CONCLUSIONS: In the first pharmacogenetic study of its kind in HIV-1 disease, we found race/ethnic-specific differences in plasma lipid levels on ART, as well as differences in the influence of the apoC-III gene on the development of PI-related hypertriglyceridemia. Given the multi-ethnic distribution of HIV-1 infection, our findings underscore the need for future studies of metabolic and cardiovascular complications of ART that specifically account for racial

  4. Genotype-phenotype associations in obesity dependent on definition of the obesity phenotype.

    Science.gov (United States)

    Kring, Sofia Inez Iqbal; Larsen, Lesli Hingstrup; Holst, Claus; Toubro, Søren; Hansen, Torben; Astrup, Arne; Pedersen, Oluf; Sørensen, Thorkild I A

    2008-01-01

    In previous studies of associations of variants in the genes UCP2, UCP3, PPARG2, CART, GRL, MC4R, MKKS, SHP, GHRL, and MCHR1 with obesity, we have used a case-control approach with cases defined by a threshold for BMI. In the present study, we assess the association of seven abdominal, peripheral, and overall obesity phenotypes, which were analyzed quantitatively, and thirteen candidate gene polymorphisms in these ten genes in the same cohort. Obese Caucasian men (n = 234, BMI >or= 31.0 kg/m(2)) and a randomly sampled non-obese group (n = 323), originally identified at the draft board examinations, were re-examined at median ages of 47.0 or 49.0 years by anthropometry and DEXA scanning. Obesity phenotypes included BMI, fat body mass index, waist circumference, waist for given BMI, intra-abdominal adipose tissue, hip circumference and lower body fat mass (%). Using logistic regression models, we estimated the odds for defined genotypes (dominant or recessive genetic transmission) in relation to z-scores of the phenotypes. The minor (rare) allele for SHP 512G>C (rs6659176) was associated with increased hip circumference. The minor allele for UCP2 Ins45bp was associated with increased BMI, increased abdominal obesity, and increased hip circumference. The minor allele for UCP2 -866G>A (rs6593669) was associated with borderline increased fat body mass index. The minor allele for MCHR1 100213G>A (rs133072) was associated with reduced abdominal obesity. None of the other genotype-phenotype combinations showed appreciable associations. If replicated in independent studies with focus on the specific phenotypes, our explorative studies suggest significant associations between some candidate gene polymorphisms and distinct obesity phenotypes, predicting beneficial and detrimental effects, depending on compartments for body fat accumulation. Copyright 2008 S. Karger AG, Basel.

  5. Genome-wide association study and annotating candidate gene networks affecting age at first calving in Nellore cattle.

    Science.gov (United States)

    Mota, R R; Guimarães, S E F; Fortes, M R S; Hayes, B; Silva, F F; Verardo, L L; Kelly, M J; de Campos, C F; Guimarães, J D; Wenceslau, R R; Penitente-Filho, J M; Garcia, J F; Moore, S

    2017-12-01

    We performed a genome-wide mapping for the age at first calving (AFC) with the goal of annotating candidate genes that regulate fertility in Nellore cattle. Phenotypic data from 762 cows and 777k SNP genotypes from 2,992 bulls and cows were used. Single nucleotide polymorphism (SNP) effects based on the single-step GBLUP methodology were blocked into adjacent windows of 1 Megabase (Mb) to explain the genetic variance. SNP windows explaining more than 0.40% of the AFC genetic variance were identified on chromosomes 2, 8, 9, 14, 16 and 17. From these windows, we identified 123 coding protein genes that were used to build gene networks. From the association study and derived gene networks, putative candidate genes (e.g., PAPPA, PREP, FER1L6, TPR, NMNAT1, ACAD10, PCMTD1, CRH, OPKR1, NPBWR1 and NCOA2) and transcription factors (TF) (STAT1, STAT3, RELA, E2F1 and EGR1) were strongly associated with female fertility (e.g., negative regulation of luteinizing hormone secretion, folliculogenesis and establishment of uterine receptivity). Evidence suggests that AFC inheritance is complex and controlled by multiple loci across the genome. As several windows explaining higher proportion of the genetic variance were identified on chromosome 14, further studies investigating the interaction across haplotypes to better understand the molecular architecture behind AFC in Nellore cattle should be undertaken. © 2017 Blackwell Verlag GmbH.

  6. Echinococcus granulosus genotypes in Iran

    Science.gov (United States)

    Sharafi, Seyedeh Maryam; Rostami-Nejad, Mohammad; Moazeni, Mohammad; Yousefi, Morteza; Saneie, Behnam; Hosseini-Safa, Ahmad

    2014-01-01

    Hydatidosis, caused by Echinococcus granulosus is one of the most important zoonotic diseases, throughout most parts of the world. Hydatidosis is endemic in Iran and responsible for approximately 1% of admission to surgical wards. There are extensive genetic variations within E. granulosus and 10 different genotypes (G1–G10) within this parasite have been reported. Identification of strains is important for improvement of control and prevention of the disease. No new review article presented the situation of Echinococcus granulosus genotypes in Iran in the recent years; therefore in this paper we reviewed the different studies regarding Echinococcus granulosus genotypes in Iran. PMID:24834298

  7. Porphyromonas gingivalis Fim-A genotype distribution among Colombians

    Science.gov (United States)

    Jaramillo, Adriana; Parra, Beatriz; Botero, Javier Enrique; Contreras, Adolfo

    2015-01-01

    Introduction: Porphyromonas gingivalis is associated with periodontitis and exhibit a wide array of virulence factors, including fimbriae which is encoded by the FimA gene representing six known genotypes. Objetive: To identify FimA genotypes of P. gingivalis in subjects from Cali-Colombia, including the co-infection with Aggregatibacter actinomycetemcomitans, Treponema denticola, and Tannerella forsythia. Methods: Subgingival samples were collected from 151 people exhibiting diverse periodontal condition. The occurrence of P. gingivalis, FimA genotypes and other bacteria was determined by PCR. Results: P. gingivalis was positive in 85 patients. Genotype FimA II was more prevalent without reach significant differences among study groups (54.3%), FimA IV was also prevalent in gingivitis (13.0%). A high correlation (p= 0.000) was found among P. gingivalis, T. denticola, and T. forsythia co-infection. The FimA II genotype correlated with concomitant detection of T. denticola and T. forsythia. Conclusions: Porphyromonas gingivalis was high even in the healthy group at the study population. A trend toward a greater frequency of FimA II genotype in patients with moderate and severe periodontitis was determined. The FimA II genotype was also associated with increased pocket depth, greater loss of attachment level, and patients co-infected with T. denticola and T. forsythia. PMID:26600627

  8. Spectroscopic follow up of Kepler planet candidates

    DEFF Research Database (Denmark)

    Latham..[], D. W.; Cochran, W. D.; Marcy, G.W.

    2010-01-01

    Spectroscopic follow-up observations play a crucial role in the confirmation and characterization of transiting planet candidates identified by Kepler. The most challenging part of this work is the determination of radial velocities with a precision approaching 1 m/s in order to derive masses from...... spectroscopic orbits. The most precious resource for this work is HIRES on Keck I, to be joined by HARPS-North on the William Herschel Telescope when that new spectrometer comes on line in two years. Because a large fraction of the planet candidates are in fact stellar systems involving eclipsing stars...... and not planets, our strategy is to start with reconnaissance spectroscopy using smaller telescopes, to sort out and reject as many of the false positives as possible before going to Keck. During the first Kepler observing season in 2009, more than 100 nights of telescope time were allocated for this work, using...

  9. Discriminating dark matter candidates using direct detection

    International Nuclear Information System (INIS)

    Belanger, G.; Nezri, E.; Pukhov, A.

    2009-01-01

    We examine the predictions for both the spin-dependent and spin-independent direct detection rates in a variety of new particle physics models with dark matter candidates. We show that a determination of both spin-independent and spin-dependent amplitudes on protons and neutrons can in principle discriminate different candidates of dark matter up to a few ambiguities. We emphasize the importance of making measurements with different spin-dependent sensitive detector materials and the need for significant improvement of the detector sensitivities. Scenarios where exchange of new colored particles contributes significantly to the elastic scattering cross sections are often the most difficult to identify, the LHC should give an indication whether such scenarios are relevant for direct detection.

  10. Identification of KIF3A as a Novel Candidate Gene for Childhood Asthma Using RNA Expression and Population Allelic Frequencies Differences

    Science.gov (United States)

    Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M.; Wang, Ning; Martin, Lisa J.; Lindsey, Mark; Ericksen, Mark B.; He, Hua; Patterson, Tia L.; Baye, Tesfaye M.; Torgerson, Dara; Roth, Lindsey A.; Gupta, Jayanta; Sivaprasad, Umasundari; Gibson, Aaron M.; Tsoras, Anna M.; Hu, Donglei; Eng, Celeste; Chapela, Rocío; Rodríguez-Santana, José R.; Rodríguez-Cintrón, William; Avila, Pedro C.; Beckman, Kenneth; Seibold, Max A.; Gignoux, Chris; Musaad, Salma M.; Chen, Weiguo; Burchard, Esteban González; Khurana Hershey, Gurjit K.

    2011-01-01

    Background Asthma is a chronic inflammatory disease with a strong genetic predisposition. A major challenge for candidate gene association studies in asthma is the selection of biologically relevant genes. Methodology/Principal Findings Using epithelial RNA expression arrays, HapMap allele frequency variation, and the literature, we identified six possible candidate susceptibility genes for childhood asthma including ADCY2, DNAH5, KIF3A, PDE4B, PLAU, SPRR2B. To evaluate these genes, we compared the genotypes of 194 predominantly tagging SNPs in 790 asthmatic, allergic and non-allergic children. We found that SNPs in all six genes were nominally associated with asthma (pasthma (OR = 2.3, pasthma population attributable risk of 18.5%. The association between KIF3A rs7737031 and asthma was validated in 3 independent populations, further substantiating the validity of our gene selection approach. Conclusions/Significance Our study demonstrates that KIF3A, a member of the kinesin superfamily of microtubule associated motors that are important in the transport of protein complexes within cilia, is a novel candidate gene for childhood asthma. Polymorphisms in KIF3A may in part be responsible for poor mucus and/or allergen clearance from the airways. Furthermore, our study provides a promising framework for the identification and evaluation of novel candidate susceptibility genes. PMID:21912604

  11. Detection of two non-synonymous SNPs in SLC45A2 on BTA20 as candidate causal mutations for oculocutaneous albinism in Braunvieh cattle.

    Science.gov (United States)

    Rothammer, Sophie; Kunz, Elisabeth; Seichter, Doris; Krebs, Stefan; Wassertheurer, Martina; Fries, Ruedi; Brem, Gottfried; Medugorac, Ivica

    2017-10-05

    Cases of albinism have been reported in several species including cattle. So far, research has identified many genes that are involved in this eye-catching phenotype. Thus, when two paternal Braunvieh half-sibs with oculocutaneous albinism were detected on a private farm, we were interested in knowing whether their phenotype was caused by an already known gene/mutation. Analysis of genotyping data (50K) of the two albino individuals, their mothers and five other relatives identified a 47.61-Mb candidate haplotype on Bos taurus chromosome BTA20. Subsequent comparisons of the sequence of this haplotype with sequence data from four Braunvieh sires and the Aurochs genome identified two possible candidate causal mutations at positions 39,829,806 bp (G/A; R45Q) and 39,864,148 bp (C/T; T444I) that were absent in 1682 animals from various bovine breeds included in the 1000 bull genomes project. Both polymorphisms represent coding variants in the SLC45A2 gene, for which the human equivalent harbors numerous variants associated with oculocutaneous albinism type 4. We demonstrate an association of R45Q and T444I with the albino phenotype by targeted genotyping. Although the candidate gene SLC45A2 is known to be involved in albinism in different species, to date in cattle only mutations in the TYR and MITF genes were reported to be associated with albinism or albinism-like phenotypes. Thus, our study extends the list of genes that are associated with bovine albinism. However, further research and more samples from related animals are needed to elucidate if only one of these two single nucleotide polymorphisms or the combination of both is the actual causal variant.

  12. Identification of polymorphic inversions from genotypes

    Directory of Open Access Journals (Sweden)

    Cáceres Alejandro

    2012-02-01

    Full Text Available Abstract Background Polymorphic inversions are a source of genetic variability with a direct impact on recombination frequencies. Given the difficulty of their experimental study, computational methods have been developed to infer their existence in a large number of individuals using genome-wide data of nucleotide variation. Methods based on haplotype tagging of known inversions attempt to classify individuals as having a normal or inverted allele. Other methods that measure differences between linkage disequilibrium attempt to identify regions with inversions but unable to classify subjects accurately, an essential requirement for association studies. Results We present a novel method to both identify polymorphic inversions from genome-wide genotype data and classify individuals as containing a normal or inverted allele. Our method, a generalization of a published method for haplotype data 1, utilizes linkage between groups of SNPs to partition a set of individuals into normal and inverted subpopulations. We employ a sliding window scan to identify regions likely to have an inversion, and accumulation of evidence from neighboring SNPs is used to accurately determine the inversion status of each subject. Further, our approach detects inversions directly from genotype data, thus increasing its usability to current genome-wide association studies (GWAS. Conclusions We demonstrate the accuracy of our method to detect inversions and classify individuals on principled-simulated genotypes, produced by the evolution of an inversion event within a coalescent model 2. We applied our method to real genotype data from HapMap Phase III to characterize the inversion status of two known inversions within the regions 17q21 and 8p23 across 1184 individuals. Finally, we scan the full genomes of the European Origin (CEU and Yoruba (YRI HapMap samples. We find population-based evidence for 9 out of 15 well-established autosomic inversions, and for 52 regions

  13. Screening cotton genotypes for seedling drought tolerance

    Directory of Open Access Journals (Sweden)

    Penna Julio C. Viglioni

    1998-01-01

    Full Text Available The objectives of this study were to adapt a screening method previously used to assess seedling drought tolerance in cereals for use in cotton (Gossypium hirsutum L. and to identify tolerant accessions among a wide range of genotypes. Ninety genotypes were screened in seven growth chamber experiments. Fifteen-day-old seedlings were subjected to four 4-day drought cycles, and plant survival was evaluated after each cycle. Three cycles are probably the minimum required in cotton work. Significant differences (at the 0.05 level or lower among entries were obtained in four of the seven experiments. A "confirmation test" with entries previously evaluated as "tolerant" (high survival and "susceptible" (low survival was run. A number of entries duplicated their earlier performance, but others did not, which indicates the need to reevaluate selections. Germplasms considered tolerant included: `IAC-13-1', `IAC-RM4-SM5', `Minas Sertaneja', `Acala 1517E-1' and `4521'. In general, the technique is simple, though time-consuming, with practical value for screening a large number of genotypes. Results from the screening tests generally agreed with field information. The screening procedure is suitable to select tolerant accessions from among a large number of entries in germplasm collections as a preliminary step in breeding for drought tolerance. This research also demonstrated the need to characterize the internal lack of uniformity in growth chambers to allow for adequate designs of experiments.

  14. Evaluation of novel candidate variations and their interactions related to bipolar disorders: Analysis of GWAS data

    Directory of Open Access Journals (Sweden)

    Acikel C

    2016-11-01

    Full Text Available Cengizhan Acikel,1 Yesim Aydin Son,2 Cemil Celik,3 Husamettin Gul4 1Department of Biostatistics, Gulhane Military Medical Academy, 2Department of Health Informatics, Graduate School of Informatics, Middle East Technical University, 3Department of Medical Psychiatry, 4Department of Medical Informatics, Gulhane Military Medical Academy, Ankara, Turkey Background: Multifactor dimensionality reduction (MDR is a nonparametric approach that can be used to detect relevant interactions between single-nucleotide polymorphisms (SNPs. The aim of this study was to build the best genomic model based on SNP associations and to identify candidate polymorphisms that are the underlying molecular basis of the bipolar disorders. Methods: This study was performed on Whole-Genome Association Study of Bipolar Disorder (dbGaP [database of Genotypes and Phenotypes] study accession number: phs000017.v3.p1 data. After preprocessing of the genotyping data, three classification-based data mining methods (ie, random forest, naïve Bayes, and k-nearest neighbor were performed. Additionally, as a nonparametric, model-free approach, the MDR method was used to evaluate the SNP profiles. The validity of these methods was evaluated using true classification rate, recall (sensitivity, precision (positive predictive value, and F-measure. Results: Random forests, naïve Bayes, and k-nearest neighbors identified 16, 13, and ten candidate SNPs, respectively. Surprisingly, the top six SNPs were reported by all three methods. Random forests and k-nearest neighbors were more successful than naïve Bayes, with recall values >0.95. On the other hand, MDR generated a model with comparable predictive performance based on five SNPs. Although different SNP profiles were identified in MDR compared to the classification-based models, all models mapped SNPs to the DOCK10 gene. Conclusion: Three classification-based data mining approaches, random forests, naïve Bayes, and k-nearest neighbors

  15. Cytochrome P450 (CYP2D6) genotype is associated with elevated systolic blood pressure in preterm infants after discharge from the neonatal intensive care unit.

    Science.gov (United States)

    Dagle, John M; Fisher, Tyler J; Haynes, Susan E; Berends, Susan K; Brophy, Patrick D; Morriss, Frank H; Murray, Jeffrey C

    2011-07-01

    To determine genetic and clinical risk factors associated with elevated systolic blood pressure (ESBP) in preterm infants after discharge from the neonatal intensive care unit (NICU). A convenience cohort of infants born at 90th percentile for term infants). Genetic testing identified alleles associated with ESBP. Multivariate logistic regression analysis was performed for the outcome ESBP, with clinical characteristics and genotype as independent variables. Predictors of ESBP were cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6) (rs28360521) CC genotype (OR, 2.92; 95% CI, 1.48-5.79), adjusted for outpatient oxygen therapy (OR, 4.53; 95% CI, 2.23-8.81) and history of urinary tract infection (OR, 4.68; 95% CI, 1.47-14.86). Maximum SBP was modeled by multivariate linear regression analysis: maximum SBP=84.8 mm Hg + 6.8 mm Hg if cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6) CC genotype + 6.8 mm Hg if discharged on supplemental oxygen + 4.4 mm Hg if received inpatient glucocorticoids (P=.0002). ESBP is common in preterm infants with residual lung disease after discharge from the NICU. This study defines clinical factors associated with ESBP, identifies a candidate gene for further testing, and supports the recommendation to monitor blood pressure before age 3 years, as is suggested for term infants. Copyright © 2011 Mosby, Inc. All rights reserved.

  16. Transforming microbial genotyping: a robotic pipeline for genotyping bacterial strains.

    Directory of Open Access Journals (Sweden)

    Brian O'Farrell

    Full Text Available Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of 200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost.

  17. Analysis of behavioral and emotional problems in children highlights the role of genotype × environment interaction

    NARCIS (Netherlands)

    Molenaar, D.; Middeldorp, C.; van Beijsterveldt, T.; Boomsma, D.I.

    2015-01-01

    This study tested for Genotype × Environment (G × E) interaction on behavioral and emotional problems in children using new methods that do not require identification of candidate genes or environments, can distinguish between interaction with shared and unique environment, and are insensitive to

  18. Analysis of Behavioral and Emotional Problems in Children Highlights the Role of Genotype 9 Environment Interaction

    NARCIS (Netherlands)

    Molenaar, D.; Middeldorp, C.M.; van Beijsterveldt, C.E.M.; Boomsma, D.I.

    2015-01-01

    This study tested for Genotype × Environment (G × E) interaction on behavioral and emotional problems in children using new methods that do not require identification of candidate genes or environments, can distinguish between interaction with shared and unique environment, and are insensitive to

  19. Genotype and ancestry modulate brain's DAT availability in healthy humans

    International Nuclear Information System (INIS)

    Shumay, E.; Chen, J.; Fowler, J.S.; Volkow, N.D.

    2011-01-01

    The dopamine transporter (DAT) is a principal regulator of dopaminergic neurotransmission and its gene (the SLC6A3) is a strong biological candidate gene for various behavioral- and neurological disorders. Intense investigation of the link between the SLC6A3 polymorphisms and behavioral phenotypes yielded inconsistent and even contradictory results. Reliance on objective brain phenotype measures, for example, those afforded by brain imaging, might critically improve detection of DAT genotype-phenotype association. Here, we tested the relationship between the DAT brain availability and the SLC6A3 genotypes using an aggregate sample of 95 healthy participants of several imaging studies. These studies employed positron emission tomography (PET) with [ 11 C] cocaine wherein the DAT availability was estimated as Bmax/Kd; while the genotype values were obtained on two repeat polymorphisms - 3-UTR- and intron 8- VNTRs. The main findings are the following: (1) both polymorphisms analyzed as single genetic markers and in combination (haplotype) modulate DAT density in midbrain; (2) ethnic background and age influence the strength of these associations; and (3) age-related changes in DAT availability differ in the 3-UTR and intron8 - genotype groups.

  20. A CATALOG OF MOVING GROUP CANDIDATES IN THE SOLAR NEIGHBORHOOD

    International Nuclear Information System (INIS)

    Zhao Jingkun; Zhao Gang; Chen Yuqin

    2009-01-01

    Based on the kernel estimator and wavelet technique, we have identified 22 moving group candidates in the solar neighborhood from a sample which includes around 14,000 dwarfs and 6000 giants. Six of them were previously known as the Hercules stream, the Sirus-UMa stream, the Hyades stream, the Caster group, the Pleiades stream, and the IC 2391; five of them have also been reported by other authors. 11 moving group candidates, not previously reported in the literature, show prominent structures in dwarf or giant samples. A catalog of moving group candidates in the solar neighborhood is presented in this work.

  1. Accurate genotyping across variant classes and lengths using variant graphs

    DEFF Research Database (Denmark)

    Sibbesen, Jonas Andreas; Maretty, Lasse; Jensen, Jacob Malte

    2018-01-01

    of read k-mers to a graph representation of the reference and variants to efficiently perform unbiased, probabilistic genotyping across the variation spectrum. We demonstrate that BayesTyper generally provides superior variant sensitivity and genotyping accuracy relative to existing methods when used...... collecting a set of candidate variants across discovery methods, individuals and databases, and then realigning the reads to the variants and reference simultaneously. However, this realignment problem has proved computationally difficult. Here, we present a new method (BayesTyper) that uses exact alignment...... to integrate variants across discovery approaches and individuals. Finally, we demonstrate that including a ‘variation-prior’ database containing already known variants significantly improves sensitivity....

  2. Genetic and molecular functional characterization of variants within TNFSF13B, a positional candidate preeclampsia susceptibility gene on 13q.

    Directory of Open Access Journals (Sweden)

    Mona H Fenstad

    Full Text Available BACKGROUND: Preeclampsia is a serious pregnancy complication, demonstrating a complex pattern of inheritance. The elucidation of genetic liability to preeclampsia remains a major challenge in obstetric medicine. We have adopted a positional cloning approach to identify maternal genetic components, with linkages previously demonstrated to chromosomes 2q, 5q and 13q in an Australian/New Zealand familial cohort. The current study aimed to identify potential functional and structural variants in the positional candidate gene TNFSF13B under the 13q linkage peak and assess their association status with maternal preeclampsia genetic susceptibility. METHODOLOGY/PRINCIPAL FINDINGS: The proximal promoter and coding regions of the positional candidate gene TNFSF13B residing within the 13q linkage region was sequenced using 48 proband or founder individuals from Australian/New Zealand families. Ten sequence variants (nine SNPs and one single base insertion were identified and seven SNPs were successfully genotyped in the total Australian/New Zealand family cohort (74 families/480 individuals. Borderline association to preeclampsia (p = 0.0153 was observed for three rare SNPs (rs16972194, rs16972197 and rs56124946 in strong linkage disequilibrium with each other. Functional evaluation by electrophoretic mobility shift assays showed differential nuclear factor binding to the minor allele of the rs16972194 SNP, residing upstream of the translation start site, making this a putative functional variant. The observed genetic associations were not replicated in a Norwegian case/control cohort (The Nord-Trøndelag Health Study (HUNT2, 851 preeclamptic and 1,440 non-preeclamptic women. CONCLUSION/SIGNIFICANCE: TNFSF13B has previously been suggested to contribute to the normal immunological adaption crucial for a successful pregnancy. Our observations support TNFSF13B as a potential novel preeclampsia susceptibility gene. We discuss a possible role for TNFSF13B in

  3. Evaluation of the Abbott realtime HCV genotype II RUO (GT II) assay with reference to 5'UTR, core and NS5B sequencing.

    Science.gov (United States)

    Mallory, Melanie A; Lucic, Danijela X; Sears, Mitchell T; Cloherty, Gavin A; Hillyard, David R

    2014-05-01

    HCV genotyping is a critical tool for guiding initiation of therapy and selecting the most appropriate treatment regimen. To evaluate the concordance between the Abbott GT II assay and genotyping by sequencing subregions of the HCV 5'UTR, core and NS5B. The Abbott assay was used to genotype 127 routine patient specimens and 35 patient specimens with unusual subtypes and mixed infection. Abbott results were compared to genotyping by 5'UTR, core and NS5B sequencing. Sequences were genotyped using the NCBI non-redundant database and the online genotyping tool COMET. Among routine specimens, core/NS5B sequencing identified 93 genotype 1s, 13 genotype 2s, 15 genotype 3s, three genotype 4s, two genotype 6s and one recombinant specimen. Genotype calls by 5'UTR, core, NS5B sequencing and the Abbott assay were 97.6% concordant. Core/NS5B sequencing identified two discrepant samples as genotype 6 (subtypes 6l and 6u) while Abbott and 5'UTR sequencing identified these samples as genotype 1 with no subtype. The Abbott assay subtyped 91.4% of genotype 1 specimens. Among the 35 rare specimens, the Abbott assay inaccurately genotyped 3k, 6e, 6o, 6q and one genotype 4 variant; gave indeterminate results for 3g, 3h, 4r, 6m, 6n, and 6q specimens; and agreed with core/NS5B sequencing for mixed specimens. The Abbott assay is an automated HCV genotyping method with improved accuracy over 5'UTR sequencing. Samples identified by the Abbott assay as genotype 1 with no subtype may be rare subtypes of other genotypes and thus require confirmation by another method. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Caffeine Consumption Among Naval Aviation Candidates.

    Science.gov (United States)

    Sather, Thomas E; Williams, Ronald D; Delorey, Donald R; Woolsey, Conrad L

    2017-04-01

    Education frequently dictates students need to study for prolonged periods of time to adequately prepare for examinations. This is especially true with aviation preflight indoctrination (API) candidates who have to assimilate large volumes of information in a limited amount of time during API training. The purpose of this study was to assess caffeine consumption patterns (frequency, type, and volume) among naval aviation candidates attending API to determine the most frequently consumed caffeinated beverage and to examine if the consumption of a nonenergy drink caffeinated beverage was related to energy drink consumption. Data were collected by means of an anonymous 44-item survey administered and completed by 302 students enrolled in API at Naval Air Station Pensacola, FL. Results indicated the most frequently consumed caffeinated beverage consumed by API students was coffee (86.4%), with daily coffee consumption being approximately 28% and the most frequent pattern of consumption being 2 cups per day (85%). The least frequently consumed caffeinated beverages reported were energy drinks (52%) and energy shots (29.1%). The present study also found that the consumption patterns (weekly and daily) of caffeinated beverages (coffee and cola) were positively correlated to energy drink consumption patterns. Naval aviation candidates' consumption of caffeinated beverages is comparable to other college and high school cohorts. This study found that coffee and colas were the beverages of choice, with energy drinks and energy shots being the least frequently reported caffeinated beverages used. Additionally, a relationship between the consumption of caffeinated beverages and energy drinks was identified.Sather TE, Williams RD, Delorey DR, Woolsey CL. Caffeine consumption among naval aviation candidates. Aerosp Med Hum Perform. 2017; 88(4):399-405.

  5. Kernel Machine SNP-set Testing under Multiple Candidate Kernels

    Science.gov (United States)

    Wu, Michael C.; Maity, Arnab; Lee, Seunggeun; Simmons, Elizabeth M.; Harmon, Quaker E.; Lin, Xinyi; Engel, Stephanie M.; Molldrem, Jeffrey J.; Armistead, Paul M.

    2013-01-01

    Joint testing for the cumulative effect of multiple single nucleotide polymorphisms grouped on the basis of prior biological knowledge has become a popular and powerful strategy for the analysis of large scale genetic association studies. The kernel machine (KM) testing framework is a useful approach that has been proposed for testing associations between multiple genetic variants and many different types of complex traits by comparing pairwise similarity in phenotype between subjects to pairwise similarity in genotype, with similarity in genotype defined via a kernel function. An advantage of the KM framework is its flexibility: choosing different kernel functions allows for different assumptions concerning the underlying model and can allow for improved power. In practice, it is difficult to know which kernel to use a priori since this depends on the unknown underlying trait architecture and selecting the kernel which gives the lowest p-value can lead to inflated type I error. Therefore, we propose practical strategies for KM testing when multiple candidate kernels are present based on constructing composite kernels and based on efficient perturbation procedures. We demonstrate through simulations and real data applications that the procedures protect the type I error rate and can lead to substantially improved power over poor choices of kernels and only modest differences in power versus using the best candidate kernel. PMID:23471868

  6. Screening of whole genome sequences identified high-impact variants for stallion fertility.

    Science.gov (United States)

    Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar

    2016-04-14

    g.37455302G>A in NOTCH1 with the de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). For 9 high-impact variants within the genes CFTR, OVGP1, FBXO43, TSSK6, PKD1, FOXP1, TCP11, SPATA31E1 and NOTCH1 (g.37453246G>C) absence of the homozygous mutant genotype in the validation sample of all 337 fertile stallions was obvious. Therefore, these variants were considered as potentially deleterious factors for stallion fertility. In conclusion, this study revealed 17 genetic variants with a predicted high damaging effect on protein structure and missing homozygous mutant genotype. The g.37455302G>A NOTCH1 variant was identified as a significant stallion fertility locus in Hanoverian stallions and further 9 candidate fertility loci with missing homozygous mutant genotypes were validated in a panel including 19 horse breeds. To our knowledge this is the first study in horses using next generation sequencing data to uncover strong candidate factors for stallion fertility.

  7. Reducing stigma and discrimination: Candidate interventions

    Directory of Open Access Journals (Sweden)

    Kassam Aliya

    2008-04-01

    Full Text Available Abstract This paper proposes that stigma in relation to people with mental illness can be understood as a combination of problems of knowledge (ignorance, attitudes (prejudice and behaviour (discrimination. From a literature review, a series of candidate interventions are identified which may be effective in reducing stigmatisation and discrimination at the following levels: individuals with mental illness and their family members; the workplace; and local, national and international. The strongest evidence for effective interventions at present is for (i direct social contact with people with mental illness at the individual level, and (ii social marketing at the population level.

  8. Reducing stigma and discrimination: Candidate interventions.

    Science.gov (United States)

    Thornicroft, Graham; Brohan, Elaine; Kassam, Aliya; Lewis-Holmes, Elanor

    2008-04-13

    This paper proposes that stigma in relation to people with mental illness can be understood as a combination of problems of knowledge (ignorance), attitudes (prejudice) and behaviour (discrimination). From a literature review, a series of candidate interventions are identified which may be effective in reducing stigmatisation and discrimination at the following levels: individuals with mental illness and their family members; the workplace; and local, national and international. The strongest evidence for effective interventions at present is for (i) direct social contact with people with mental illness at the individual level, and (ii) social marketing at the population level.

  9. Teacher Candidate Selection and Evaluation.

    Science.gov (United States)

    Collins, Mary Lynn; And Others

    Summaries are presented of three papers presented at a summer workshop on Quality Assurance in Teacher Education conducted by the Association of Teacher Educators. The general topic covered by these presentations was teacher candidate selection and evaluation. Papers focused upon the following questions: (1) What entry level criteria should be…

  10. Candidate Prediction Models and Methods

    DEFF Research Database (Denmark)

    Nielsen, Henrik Aalborg; Nielsen, Torben Skov; Madsen, Henrik

    2005-01-01

    This document lists candidate prediction models for Work Package 3 (WP3) of the PSO-project called ``Intelligent wind power prediction systems'' (FU4101). The main focus is on the models transforming numerical weather predictions into predictions of power production. The document also outlines...... the possibilities w.r.t. different numerical weather predictions actually available to the project....

  11. EnviroAtlas - Candidate Areas for Ecological Restoration for the Conterminous United States

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas dataset shows the candidate areas for ecological restoration, identified as close but geographically disjunct vegetated regions. Ecological...

  12. The Distribution of Hepatitis C Virus Genotypes in Middle Eastern Countries: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Ghaderi-Zefrehi, Hossein; Gholami-Fesharaki, Mohammad; Sharafi, Heidar; Sadeghi, Farzin; Alavian, Seyed Moayed

    2016-09-01

    The hepatitis C virus (HCV) is classified into seven genotypes and more than 100 subtypes. The treatment regimen, duration and efficacy of HCV therapy may vary according to the HCV genotype. Therefore, the HCV genotype should be determined prior to antiviral therapy. The objective of the current study was to review systematically all studies reporting the distribution of HCV genotypes in the countries that make up the Middle East. Articles were identified by searching electronic databases, including Scopus, PubMed and Google scholar, with timeline limits (articles published between 1995 and 2016). We carried out a systematic search regarding the distribution of HCV genotypes in Middle Eastern countries. A total of 579 studies were identified by the electronic search. Of these, a total of 187 were identified as eligible papers including 60,319 patients who were meta-analyzed for pooled distribution of HCV genotypes. In Turkey, Israel, Cyprus, and Iran, genotype 1 was the most prevalent HCV genotype with rates of 82% (95% CI, 82%-83%), 68% (95% CI, 67%-69%), 68% (95% CI, 59%-77%), and 55% (95% CI, 54%-55%), respectively. In Egypt, Iraq, Saudi Arabia, and Syria, HCV genotype 4 was the most common genotype with rates of 86% (95% CI, 85%-88%), 60% (95% CI, 56%-64%), 56% (95% CI, 54%-55%), and 57% (95% CI, 54%-61%), respectively. On the basis of adjusted data, HCV genotype 4 was the most prevalent genotype in the Middle East region, with a rate of 74.7% (95% CI, 73.4%-76%), followed by genotype 1 at 15.1% (95% CI, 14.1%-16%). Our results showed that HCV genotype 4 is the most prevalent genotype in the Middle East region. However, HCV genotype 1 is the most prevalent among non-Arab countries in the region including Turkey, Iran, Cyprus, and Israel.

  13. Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

    2017-12-28

    Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the

  14. Genotypic variation in phytoremediation potential of Indian mustard exposed to nickel stress: a hydroponic study.

    Science.gov (United States)

    Ansari, Mohd Kafeel Ahmad; Ahmad, Altaf; Umar, Shahid; Zia, Munir Hussain; Iqbal, Muhammad; Owens, Gary

    2015-01-01

    Ten Indian mustard (Brassica juncea L.) genotypes were screened for their nickel (Ni) phytoremediation potential under controlled environmental conditions. All ten genotypes were grown hydroponically in aqueous solution containing Ni concentrations (as nickel chloride) ranging from 0 to 50 μM and changes in plant growth, biomass and total Ni uptake were evaluated. Of the ten genotypes (viz. Agrini, BTO, Kranti, Pusa Basant, Pusa Jai Kisan, Pusa Bahar, Pusa Bold, Vardhan, Varuna, and Vaibhav), Pusa Jai Kisan was the most Ni tolerant genotype accumulating up to 1.7 μg Ni g(-1) dry weight (DW) in its aerial parts. Thus Pusa Jai Kisan had the greatest potential to become a viable candidate in the development of practical phytoremediation technologies for Ni contaminated sites.

  15. Mining biological databases for candidate disease genes

    Science.gov (United States)

    Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

    2001-07-01

    The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

  16. In vitro screening of potato genotypes for osmotic stress tolerance

    Directory of Open Access Journals (Sweden)

    Gelmesa Dandena

    2017-02-01

    Full Text Available Potato (Solanum tuberosum L. is a cool season crop which is susceptible to both drought and heat stresses. Lack of suitable varieties of the crop adapted to drought-prone areas of the lowland tropics deprives farmers living in such areas the opportunity to produce and use the crop as a source of food and income. As a step towards developing such varieties, the present research was conducted to evaluate different potato genotypes for osmotic stress tolerance under in vitro conditions and identify drought tolerant genotypes for future field evaluation. The experiment was carried out at the Leibniz University of Hannover, Germany, by inducing osmotic stress using sorbitol at two concentrations (0.1 and 0.2 M in the culture medium. A total of 43 genotypes collected from different sources (27 advanced clones from CIP, nine improved varieties, and seven farmers’ cultivars were used in a completely randomized design with four replications in two rounds. Data were collected on root and shoot growth. The results revealed that the main effects of genotype, sorbitol treatment, and their interactions significantly (P < 0.01 influenced root and shoot growthrelated traits. Under osmotic stress, all the measured root and shoot growth traits were significantly correlated. The dendrogram obtained from the unweighted pair group method with arithmetic mean allowed grouping of the genotypes into tolerant, moderately tolerant, and susceptible ones to a sorbitol concentration of 0.2 M in the culture medium. Five advanced clones (CIP304350.100, CIP304405.47, CIP392745.7, CIP388676.1, and CIP388615.22 produced shoots and rooted earlier than all other genotypes, with higher root numbers, root length, shoot and root mass under osmotic stress conditions induced by sorbitol. Some of these genotypes had been previously identified as drought-tolerant under field conditions, suggesting the capacity of the in vitro evaluation method to predict drought stress tolerant

  17. Is incidence of multiple HPV genotypes rising in genital infections?

    Directory of Open Access Journals (Sweden)

    Amir Sohrabi

    2017-11-01

    Full Text Available Frequency of cervical cancer related to Human Papilloma Virus (HPV has increased remarkably in less-developed countries. Hence, applying capable diagnostic methods is urgently needed, as is having a therapeutic strategy as an effective step for cervical cancer prevention. The aim of this study was to investigate the prevalence of various multi-type HPV infection patterns and their possible rising incidence in women with genital infections.This descriptive study was conducted on women who attended referral clinical laboratories in Tehran for genital infections from January 2012 until December 2013. A total of 1387 archival cervical scraping and lesion specimens were collected from referred women. HPV genotyping was performed using approved HPV commercial diagnostic technologies with either INNO-LiPA HPV or Geno Array Test kits.HPV was positive in 563 cases (40.59% with mean age of 32.35 ± 9.96. Single, multiple HPV genotypes and untypable cases were detected in 398 (70.69%, 160 (28.42% and 5 (0.89% cases, respectively. Multiple HPV infections were detected in 92 (57.5%, 42 (26.2%, 17 (10.6% and 9 (5.7% cases as two, three, four and five or more genotypes, respectively. The prevalence of 32 HPV genotypes was determined one by one. Seventeen HPV genotypes were identified in 95.78% of all positive infections. Five dominant genotypes, HPV6, 16, 53, 11 and 31, were identified in a total of 52.35%of the HPV positive cases.In the present study, we were able to evaluate the rate of multiple HPV types in genital infections. Nevertheless, it is necessary to evaluate the role of the dominant HPV low-risk types and the new probably high-risk genotypes, such as HPV53, in the increasing incidences of genital infections. Keywords: Multiple HPV Types, Incidence, Genital infection, Cervical cancer, Iran

  18. A candidate gene-based association study of tocopherol content and composition in rapeseed (Brassica napus

    Directory of Open Access Journals (Sweden)

    Steffi eFritsche

    2012-06-01

    Full Text Available Rapeseed (Brassica napus L. is the most important oil crop of temperate climates. Rapeseed oil contains tocopherols, also known as vitamin E, which is an indispensable nutrient for humans and animals due to its antioxidant and radical scavenging abilities. Moreover, tocopherols are also important for the oxidative stability of vegetable oils. Therefore, seed oil with increased tocopherol content or altered tocopherol composition is a target for breeding. We investigated the role of nucleotide variations within candidate genes from the tocopherol biosynthesis pathway. Field trials were carried out with 229 accessions from a worldwide B. napus collection which was divided into two panels of 96 and 133 accessions. Seed tocopherol content and composition were measured by HPLC. High heritabilities were found for both traits, ranging from 0.62 to 0.94. We identified polymorphisms by sequencing selected regions of the tocopherol genes from the 96 accession panel. Subsequently, we determined the population structure (Q and relative kinship (K as detected by genotyping with genome-wide distributed SSR markers. Association studies were performed using two models, the structure-based GLM+Q and the PK mixed model. Between 26 and 12 polymorphisms within two genes (BnaX.VTE3.a, BnaA.PDS1.c were significantly associated with tocopherol traits. The SNPs explained up to 16.93 % of the genetic variance for tocopherol composition and up to 10.48 % for total tocopherol content. Based on the sequence information we designed CAPS markers for genotyping the 133 accessions from the 2nd panel. Significant associations with various tocopherol traits confirmed the results from the first experiment. We demonstrate that the polymorphisms within the tocopherol genes clearly impact tocopherol content and composition in B. napus seeds. We suggest that these nucleotide variations may be used as selectable markers for breeding rapeseed with enhanced tocopherol quality.

  19. Haplotype-Based Genotyping in Polyploids

    Directory of Open Access Journals (Sweden)

    Josh P. Clevenger

    2018-04-01

    Full Text Available Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2 was developed for Arachis hypogaea (peanut, an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.

  20. Candidate genes in panic disorder

    DEFF Research Database (Denmark)

    Howe, A. S.; Buttenschön, Henriette N; Bani-Fatemi, A.

    2016-01-01

    The utilization of molecular genetics approaches in examination of panic disorder (PD) has implicated several variants as potential susceptibility factors for panicogenesis. However, the identification of robust PD susceptibility genes has been complicated by phenotypic diversity, underpowered...... association studies and ancestry-specific effects. In the present study, we performed a succinct review of case-control association studies published prior to April 2015. Meta-analyses were performed for candidate gene variants examined in at least three studies using the Cochrane Mantel-Haenszel fixed......-effect model. Secondary analyses were also performed to assess the influences of sex, agoraphobia co-morbidity and ancestry-specific effects on panicogenesis. Meta-analyses were performed on 23 variants in 20 PD candidate genes. Significant associations after correction for multiple testing were observed...

  1. Ensemble candidate classification for the LOTAAS pulsar survey

    Science.gov (United States)

    Tan, C. M.; Lyon, R. J.; Stappers, B. W.; Cooper, S.; Hessels, J. W. T.; Kondratiev, V. I.; Michilli, D.; Sanidas, S.

    2018-03-01

    One of the biggest challenges arising from modern large-scale pulsar surveys is the number of candidates generated. Here, we implemented several improvements to the machine learning (ML) classifier previously used by the LOFAR Tied-Array All-Sky Survey (LOTAAS) to look for new pulsars via filtering the candidates obtained during periodicity searches. To assist the ML algorithm, we have introduced new features which capture the frequency and time evolution of the signal and improved the signal-to-noise calculation accounting for broad profiles. We enhanced the ML classifier by including a third class characterizing RFI instances, allowing candidates arising from RFI to be isolated, reducing the false positive return rate. We also introduced a new training data set used by the ML algorithm that includes a large sample of pulsars misclassified by the previous classifier. Lastly, we developed an ensemble classifier comprised of five different Decision Trees. Taken together these updates improve the pulsar recall rate by 2.5 per cent, while also improving the ability to identify pulsars with wide pulse profiles, often misclassified by the previous classifier. The new ensemble classifier is also able to reduce the percentage of false positive candidates identified from each LOTAAS pointing from 2.5 per cent (˜500 candidates) to 1.1 per cent (˜220 candidates).

  2. On security arguments of the second round SHA-3 candidates

    DEFF Research Database (Denmark)

    Andreeva, Elena; Bogdanov, Andrey; Mennink, Bart

    2012-01-01

    of which got accepted to the first round. 14 candidates were left in the second round, out of which five candidates have been recently chosen for the final round. An important criterion in the selection process is the SHA-3 hash function security. We identify two important classes of security arguments...... for the new designs: (1) the possible reductions of the hash function security to the security of its underlying building blocks and (2) arguments against differential attack on building blocks. In this paper, we compare the state of the art provable security reductions for the second round candidates...... and review arguments and bounds against classes of differential attacks.We discuss all the SHA-3 candidates at a high functional level, analyze, and summarize the security reduction results and bounds against differential attacks. Additionally, we generalize the well-known proof of collision resistance...

  3. FTO genotype and weight loss

    DEFF Research Database (Denmark)

    Livingstone, Katherine M; Celis-Morales, Carlos; Papandonatos, George D

    2016-01-01

    : Ovid Medline, Scopus, Embase, and Cochrane from inception to November 2015. ELIGIBILITY CRITERIA FOR STUDY SELECTION: Randomised controlled trials in overweight or obese adults reporting reduction in body mass index, body weight, or waist circumference by FTO genotype (rs9939609 or a proxy) after...

  4. FTO genotype and weight loss

    DEFF Research Database (Denmark)

    Livingstone, Katherine M; Celis-Morales, Carlos; Papandonatos, George D

    2016-01-01

    OBJECTIVE: To assess the effect of the FTO genotype on weight loss after dietary, physical activity, or drug based interventions in randomised controlled trials. DESIGN: Systematic review and random effects meta-analysis of individual participant data from randomised controlled trials. DATA SOURC...

  5. Simultaneous Cocirculation of Both European Varicella-Zoster Virus Genotypes (E1 and E2) in Mexico City▿

    Science.gov (United States)

    Rodríguez-Castillo, Araceli; Vaughan, Gilberto; Ramírez-González, José Ernesto; Escobar-Gutiérrez, Alejandro

    2010-01-01

    Full-length genome analysis of varicella-zoster virus (VZV) has shown that viral strains can be classified into seven different genotypes: European (E), Mosaic (M), and Japanese (J), and the E and M genotypes can be further subclassified into E1, E2, and M1 through 4, respectively. The distribution of the main VZV genotypes in Mexico was described earlier, demonstrating the predominance of E genotype, although other genotypes (M1 and M4) were also identified. However, no information regarding the circulation of either E genotype in the country is available. In the present study, we confirm the presence of both E1 and E2 genotypes in the country and explore the possibility of coinfection as the triggering factor for increased virulence among severe cases. A total of 61 different European VZV isolates collected in the Mexico City metropolitan area from 2005 to 2006 were typed by using a PCR method based on genotype-specific primer amplification. Fifty isolates belonged to the E1 genotype, and the eleven remaining samples were classified as E2 genotypes. No coinfection with both E genotypes was identified among these specimens. We provide here new information on the distribution of VZV genotypes circulating in Mexico City. PMID:20220168

  6. 275 Candidates and 149 Validated Planets Orbiting Bright Stars in K2 Campaigns 0–10

    DEFF Research Database (Denmark)

    Mayo, Andrew W.; Vanderburg, Andrew; Latham, David W.

    2018-01-01

    Since 2014, NASA’s K2 mission has observed large portions of the ecliptic plane in search of transiting planets and has detected hundreds of planet candidates. With observations planned until at least early 2018, K2 will continue to identify more planet candidates. We present here 275 planet...... candidates observed during Campaigns 0–10 of the K2 mission that are orbiting stars brighter than 13 mag (in Kepler band) and for which we have obtained high-resolution spectra ( R = 44,000). These candidates are analyzed using the vespa package in order to calculate their false-positive probabilities (FPP......). We find that 149 candidates are validated with an FPP lower than 0.1%, 39 of which were previously only candidates and 56 of which were previously undetected. The processes of data reduction, candidate identification, and statistical validation are described, and the demographics of the candidates...

  7. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

    Directory of Open Access Journals (Sweden)

    Andrew J Burt

    Full Text Available Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris. Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08 where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  8. Evaluating potassium-use-efficiency of five cotton genotypes of pakistan

    International Nuclear Information System (INIS)

    Hassan, Z.U.; Kubar, K.A.

    2014-01-01

    Potassium (K) deficiency in Pakistani soils has been recently reported as the major limiting factor affecting sustainable cotton production. The present study was conducted to envisage how K nutrition affect the growth, biomass production, yield and K-use-efficiency of five cotton genotypes, NIBGE-3701, NIBGE-1524 (Bt-transgenic), Sadori, Sindh-1 and SAU-2 (non-Bt conventional), commonly grown in Pakistan. All five genotypes were raised at deficient and adequate K levels, i.e. 0 and 60 kg K/sub 2/O ha-1, respectively. The experiment was performed in plastic pots following a completely randomized factorial design with three repeats. Adequate K nutrition significantly increased various plant growth traits and yield of all cotton genotypes under study, viz. number of sympodia (21%), number of leaves (34%), leaf dry biomass (30%), shoot dry biomass (31%), number of bolls (50%) and yield of seed cotton (92%). Substantial variations were observed among cotton genotypes for their K-use-efficiency and K-response-efficiency. Sadori and SAU-2 were screened as most K-use-efficient cotton genotypes, while Sindh-1 and SAU-2 were ranked as the most K-responsive cotton genotypes. Interestingly, Sadori did not respond to K nutrition. Moreover, Bt cotton genotypes accumulated more K as compared to non-Bt genotypes. The cotton genotype SAU-2 was identified as efficient-response genotype for better adaptation for both low- and high-K-input sustainable cotton agriculture systems. (author)

  9. Candidal colonization, strain diversity, and antifungal susceptibility among adult diabetic patients.

    Science.gov (United States)

    Al-Attas, Safia A; Amro, Soliman O

    2010-01-01

    Candidal colonization in diabetics is a matter of debate. The aim of this study is to investigate oral candidal colonization, strain diversity, antifungal susceptibility, and the influence of local and systemic host factors on candidal colonization in adult diabetics. We conducted a case-control study that compared 150 diabetics (49 type 1, 101 type 2) with 50 healthy controls. Two salivary samples were collected, using the oral rinse sampling method: one for salivary flow rate and pH determination, and the other for candidal colonization assessment. The candidal isolates were identified and tested in vitro for antifungal susceptibility using the commercial kit, Candifast. The relationship between specific host factors and candidal colonization was also investigated. Diabetics had a higher candidal carriage rate compared to controls, but not density. Candida albicans was the most frequently isolated species, but diabetics had a variety of other candidal species present. None of the control samples were resistant to any tested antifungal, while the diabetic samples had differing resistances to azole antifungals. Although there was a significant positive correlation between glycemic control and candidal colonization in type 2 diabetics, there was a negative correlation between salivary pH and candidal carriage in the controls versus density in type 2 diabetics. Diabetic patients not only had a higher candidal carriage rate, but also a variety of candidal species that were resistant to azole antifungals. Oral candidal colonization was significantly associated with glycemic control, type of diabetes, and salivary pH.

  10. Identification of Chinese cabbage genotypes with low cadmium accumulation for food safety

    International Nuclear Information System (INIS)

    Liu Weitao; Zhou Qixing; Sun Yuebing; Liu Rui

    2009-01-01

    The pot-culture experiment and field studies were conducted to screen out and identify cadmium (Cd) excluders from 40 Chinese cabbage genotypes for food safety. The results of the pot-culture experiment indicated that the shoot Cd concentrations under three treatments (1.0, 2.5 and 5.0 mg Cd kg -1 Soil) varied significantly (p -1 , respectively. The Cd concentrations in 12 cabbage genotypes were lower than 0.50 mg kg -1 . The enrichment factors (EFs) and translocation factors (TFs) in 8 cabbage genotypes were lower than 1.0. The field studies further identified Lvxing 70 as a Cd-excluder genotype (CEG), which is suitable to be planted in low Cd-contaminated soils (Cd concentration should be lower than 1.25 mg kg -1 ) for food safety. - Lvxing 70 was identified as a Cd-excluder genotype (CEG) and suitable to be cultivated in low Cd-contaminated soils for food safety.

  11. Carotenoid content and root color of cultivated carrot: a candidate-gene association study using an original broad unstructured population.

    Directory of Open Access Journals (Sweden)

    Matthieu Jourdan

    Full Text Available Accumulated in large amounts in carrot, carotenoids are an important product quality attribute and therefore a major breeding trait. However, the knowledge of carotenoid accumulation genetic control in this root vegetable is still limited. In order to identify the genetic variants linked to this character, we performed an association mapping study with a candidate gene approach. We developed an original unstructured population with a broad genetic basis to avoid the pitfall of false positive detection due to population stratification. We genotyped 109 SNPs located in 17 candidate genes – mostly carotenoid biosynthesis genes – on 380 individuals, and tested the association with carotenoid contents and color components. Total carotenoids and β-carotene contents were significantly associated with genes zeaxanthin epoxydase (ZEP, phytoene desaturase (PDS and carotenoid isomerase (CRTISO while α-carotene was associated with CRTISO and plastid terminal oxidase (PTOX genes. Color components were associated most significantly with ZEP. Our results suggest the involvement of the couple PDS/PTOX and ZEP in carotenoid accumulation, as the result of the metabolic and catabolic activities respectively. This study brings new insights in the understanding of the carotenoid pathway in non-photosynthetic organs.

  12. Large SNP arrays for genotyping in crop plants

    Indian Academy of Sciences (India)

    Genotyping with large numbers of molecular markers is now an indispensable tool within plant genetics and breeding. Especially through the identification of large numbers of single nucleotide polymorphism (SNP) markers using the novel high-throughput sequencing technologies, it is now possible to reliably identify many ...

  13. Genotype-by-environment interaction and grain yield stability of ...

    African Journals Online (AJOL)

    The objective of this paper is to identify stable and high yielding varieties among 20 Ethiopian Bread wheat (Triticum aestivum L.) genotypes on the basis of experiments conducted during the 2007 and 2008 growing seasons. The additive main effects and multiplicative interaction (ammi) model has been used to estimate ...

  14. Field reaction of cassava genotypes to anthracnose, bacterial blight ...

    African Journals Online (AJOL)

    Field reaction of cassava genotypes to anthracnose, bacterial blight, cassava mosaic disease and their effects on yield. ... The BYDV-PAV and BYDV-RPV serotypes were identified from 9 and 10 of the 11 surveyed fields, respectively, with the two serotypes co-infecting some plants. Of the nine wheat cultivars surveyed, four ...

  15. Efficient cell culture system for hepatitis C virus genotype 7a

    DEFF Research Database (Denmark)

    2013-01-01

    Genotype 7a has been identified recently, thus not much is known about the biology of this new, major HCV genotype. The present inventors developed hepatitis C virus 7a/2a intergenotypic recombinants in which the JFH1 structural genes (Core, E1 and E2), p7 and the complete NS2 were replaced...

  16. Molecular characterization and genetic diversity of different genotypes of Oryza sativa and Oryza glaberrima

    Directory of Open Access Journals (Sweden)

    Caijin Chen

    2017-11-01

    Conclusions: Genetic diversity studies revealed that 50 rice types were clustered into different subpopulations whereas three genotypes were admixtures. Molecular fingerprinting and 10 specific markers were obtained to identify the 53 rice genotypes. These results can facilitate the potential utilization of sibling species in rice breeding and molecular classification of O. sativa and O. glaberrima germplasms.

  17. Fit genotypes and escape variants of subgroup III Neisseria meningitidis during three pandemics of epidemic meningitis

    NARCIS (Netherlands)

    Zhu, P.; van der Ende, A.; Falush, D.; Brieske, N.; Morelli, G.; Linz, B.; Popovic, T.; Schuurman, I. G.; Adegbola, R. A.; Zurth, K.; Gagneux, S.; Platonov, A. E.; Riou, J. Y.; Caugant, D. A.; Nicolas, P.; Achtman, M.

    2001-01-01

    The genetic variability at six polymorphic loci was examined within a global collection of 502 isolates of subgroup III, serogroup A Neisseria meningitidis. Nine "genoclouds" were identified, consisting of genotypes that were isolated repeatedly plus 48 descendent genotypes that were isolated

  18. Sequence analysis of sub-genotype D hepatitis B surface antigens isolated from Jeddah, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Sahar EL Hadad

    2018-05-01

    Full Text Available Little is known about the prevalence of HBV genotypes/sub-genotypes in Jeddah province, although the hepatitis B virus (HBV was identified as the most predominant type of hepatitis in Saudi Arabia. To characterize HBV genotypes/sub-genotypes, serum samples from 15 patients with chronic HBV were collected and subjected to HBsAg gene amplification and sequence analysis. Phylogenetic analysis of the HBsAg gene sequences revealed that 11 (48% isolates belonged to HBV/D while 4 (18% were associated with HBV/C. Notably, a HBV/D sub-genotype phylogenetic tree identified that eight current isolates (72% belonged to HBV/D1, whereas three isolates (28% appeared to be more closely related to HBV/D5, although they formed a novel cluster supported by a branch with 99% bootstrap value. Isolates belonging to D1 were grouped in one branch and seemed to be more closely related to various strains isolated from different countries. For further determination of whether the three current isolates belonged to HBV/D5 or represented a novel sub-genotype, HBV/DA, whole HBV genome sequences would be required. In the present study, we verified that HBV/D1 is the most prevalent HBV sub-genotype in Jeddah, and identified novel variant mutations suggesting that an additional sub-genotype designated HBV/DA should be proposed. Overall, the results of the present HBsAg sequence analyses provide us with insights regarding the nucleotide differences between the present HBsAg/D isolates identified in the populace of Jeddah, Saudi Arabia and those previously isolated worldwide. Additional studies with large numbers of subjects in other areas might lead to the discovery of the specific HBV strain genotypes or even additional new sub-genotypes that are circulating in Saudi Arabia. Keywords: Hepatitis B virus, HBV sub-genotypes, HBV/D, HBsAg, Viral isolates, Population studies

  19. Genotyping of Brucella species using clade specific SNPs

    Directory of Open Access Journals (Sweden)

    Foster Jeffrey T

    2012-06-01

    Full Text Available Abstract Background Brucellosis is a worldwide disease of mammals caused by Alphaproteobacteria in the genus Brucella. The genus is genetically monomorphic, requiring extensive genotyping to differentiate isolates. We utilized two different genotyping strategies to characterize isolates. First, we developed a microarray-based assay based on 1000 single nucleotide polymorphisms (SNPs that were identified from whole genome comparisons of two B. abortus isolates , one B. melitensis, and one B. suis. We then genotyped a diverse collection of 85 Brucella strains at these SNP loci and generated a phylogenetic tree of relationships. Second, we developed a selective primer-extension assay system using capillary electrophoresis that targeted 17 high value SNPs across 8 major branches of the phylogeny and determined their genotypes in a large collection ( n = 340 of diverse isolates. Results Our 1000 SNP microarray readily distinguished B. abortus, B. melitensis, and B. suis, differentiating B. melitensis and B. suis into two clades each. Brucella abortus was divided into four major clades. Our capillary-based SNP genotyping confirmed all major branches from the microarray assay and assigned all samples to defined lineages. Isolates from these lineages and closely related isolates, among the most commonly encountered lineages worldwide, can now be quickly and easily identified and genetically characterized. Conclusions We have identified clade-specific SNPs in Brucella that can be used for rapid assignment into major groups below the species level in the three main Brucella species. Our assays represent SNP genotyping approaches that can reliably determine the evolutionary relationships of bacterial isolates without the need for whole genome sequencing of all isolates.

  20. Identification of candidate regions for a novel Usher syndrome type II locus.

    Science.gov (United States)

    Ben Rebeh, Imen; Benzina, Zeineb; Dhouib, Houria; Hadjamor, Imen; Amyere, Mustapha; Ayadi, Leila; Turki, Khalil; Hammami, Bouthaina; Kmiha, Noureddine; Kammoun, Hassen; Hakim, Bochra; Charfedine, Ilhem; Vikkula, Miikka; Ghorbel, Abdelmonem; Ayadi, Hammadi; Masmoudi, Saber

    2008-09-19

    Chronic diseases affecting the inner ear and the retina cause severe impairments to our communication systems. In more than half of the cases, Usher syndrome (USH) is the origin of these double defects. Patients with USH type II (USH2) have retinitis pigmentosa (RP) that develops during puberty, moderate to severe hearing impairment with downsloping pure-tone audiogram, and normal vestibular function. Four loci and three genes are known for USH2. In this study, we proposed to localize the gene responsible for USH2 in a consanguineous family of Tunisian origin. Affected members underwent detailed ocular and audiologic characterization. One Tunisian family with USH2 and 45 healthy controls unrelated to the family were recruited. Two affected and six unaffected family members attended our study. DNA samples of eight family members were genotyped with polymorphic markers. Two-point and multipoint LOD scores were calculated using Genehunter software v2.1. Sequencing was used to investigate candidate genes. Haplotype analysis showed no significant linkage to any known USH gene or locus. A genome-wide screen, using microsatellite markers, was performed, allowing the identification of three homozygous regions in chromosomes 2, 4, and 15. We further confirmed and refined these three regions using microsatellite and single-nucleotide polymorphisms. With recessive mode of inheritance, the highest multipoint LOD score of 1.765 was identified for the candidate regions on chromosomes 4 and 15. The chromosome 15 locus is large (55 Mb), underscoring the limited number of meioses in the consanguineous pedigree. Moreover, the linked, homozygous chromosome 15q alleles, unlike those of the chromosome 2 and 4 loci, are infrequent in the local population. Thus, the data strongly suggest that the novel locus for USH2 is likely to reside on 15q. Our data provide a basis for the localization and the identification of a novel gene implicated in USH2, most likely localized on 15q.

  1. Screening of cotton (gossypium hirsutum l.) genotypes for heat tolerance

    International Nuclear Information System (INIS)

    Abro, S.; Khan, M.A.; Sial, M.A.

    2015-01-01

    Cotton yield is highly affected due to biotic (diseases and pests) and abiotic (heat, dought and salinity) Stresses. Among them, high temperature is the main environmental constraint which adversely reduces cotton yield and quality. High temperature above 36 degree C affects plant growth and development especially during reproductive phase. Present studies were carried out to assess the tolerance of fifty-eight newly evolved cotton genotypes to heat stresses, based on agronomic and physiological characteristics. The genotypes were screened in field conditions under two temperature regimes. The studies were conducted at experimental farm of Nuclear Institute of Agriculture, Tando Jam, Pakistan. The results showed that March sown crop experienced high temperature (i.e. > 44 degree C in May and June), which significantly affected crop growth and productivity. The genotypes were identified as heat-tolerant on the basis of relative cell injury percentage (RCI %), heat susceptibility index (HSI) values, boll retention and seed cotton yield (kg/ha). RCI level in cotton genotypes ranged from 39.0 to 86.0%. Out of 58, seventeen genotypes (viz.NIA-80, NIA-81, NIA-83, NIA-84, NIA-M-30, NIA-M31, NIA-HM-48, NIA-HM-327, NIA-H-32, NIA-HM-2-1, NIA-Bt1, NIA-Bt2, NIA-Perkh, CRIS-342, CRIS-134, NIAB-111 and check variety Sadori indicated high level of heat tolerance at both (heat-stressed and non-stressed) temperature regimes; as shown the lowest relative injury level and relatively heat resistant index (HSI<1) values. Such genotypes could be used as heattolerant genotypes under heat-stressed environments. (author)

  2. Simultaneous Cocirculation of Both European Varicella-Zoster Virus Genotypes (E1 and E2) in Mexico City▿

    OpenAIRE

    Rodríguez-Castillo, Araceli; Vaughan, Gilberto; Ramírez-González, José Ernesto; Escobar-Gutiérrez, Alejandro

    2010-01-01

    Full-length genome analysis of varicella-zoster virus (VZV) has shown that viral strains can be classified into seven different genotypes: European (E), Mosaic (M), and Japanese (J), and the E and M genotypes can be further subclassified into E1, E2, and M1 through 4, respectively. The distribution of the main VZV genotypes in Mexico was described earlier, demonstrating the predominance of E genotype, although other genotypes (M1 and M4) were also identified. However, no information regarding...

  3. Global Variation of Human Papillomavirus Genotypes and Selected Genes Involved in Cervical Malignancies.

    Science.gov (United States)

    Husain, R S Akram; Ramakrishnan, V

    2015-01-01

    Carcinoma of the cervix is ranked second among the top 5 cancers affecting women globally. Parallel to other cancers, it is also a complex disease involving numerous factors such as human papillomavirus (HPV) infection followed by the activity of oncogenes and environmental factors. The incidence rate of the disease remains high in developing countries due to lack of awareness, followed by mass screening programs, various socioeconomic issues, and low usage of preventive vaccines. Over the past 3 decades, extensive research has taken place in cervical malignancy to elucidate the role of host genes in the pathogenesis of the disease, yet it remains one of the most prevalent diseases. It is imperative that recent genome-wide techniques be used to determine whether carcinogenesis of oncogenes is associated with cervical cancer at the molecular level and to translate that knowledge into developing diagnostic and therapeutic tools. The aim of this study was to discuss HPV predominance with their genotype distribution worldwide, and in India, as well as to discuss the newly identified oncogenes related to cervical cancer in current scenario. Using data from various databases and robust technologies, oncogenes associated with cervical malignancies were identified and are explained in concise manner. Due to the advent of recent technologies, new candidate genes are explored and can be used as precise biomarkers for screening and developing drug targets. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Alternative dark matter candidates. Axions

    International Nuclear Information System (INIS)

    Ringwald, Andreas

    2017-01-01

    The axion is arguably one of the best motivated candidates for dark matter. For a decay constant >or similar 10 9 GeV, axions are dominantly produced non-thermally in the early universe and hence are ''cold'', their velocity dispersion being small enough to fit to large scale structure. Moreover, such a large decay constant ensures the stability at cosmological time scales and its behaviour as a collisionless fluid at cosmological length scales. Here, we review the state of the art of axion dark matter predictions and of experimental efforts to search for axion dark matter in laboratory experiments.

  5. Alternative dark matter candidates. Axions

    Energy Technology Data Exchange (ETDEWEB)

    Ringwald, Andreas

    2017-01-15

    The axion is arguably one of the best motivated candidates for dark matter. For a decay constant >or similar 10{sup 9} GeV, axions are dominantly produced non-thermally in the early universe and hence are ''cold'', their velocity dispersion being small enough to fit to large scale structure. Moreover, such a large decay constant ensures the stability at cosmological time scales and its behaviour as a collisionless fluid at cosmological length scales. Here, we review the state of the art of axion dark matter predictions and of experimental efforts to search for axion dark matter in laboratory experiments.

  6. QTL-seq for rapid identification of candidate genes for flowering time in broccoli × cabbage.

    Science.gov (United States)

    Shu, Jinshuai; Liu, Yumei; Zhang, Lili; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

    2018-04-01

    A major QTL controlling early flowering in broccoli × cabbage was identified by marker analysis and next-generation sequencing, corresponding to GRF6 gene conditioning flowering time in Arabidopsis. Flowering is an important agronomic trait for hybrid production in broccoli and cabbage, but the genetic mechanism underlying this process is unknown. In this study, segregation analysis with BC 1 P1, BC 1 P2, F 2 , and F 2:3 populations derived from a cross between two inbred lines "195" (late-flowering) and "93219" (early flowering) suggested that flowering time is a quantitative trait. Next, employing a next-generation sequencing-based whole-genome QTL-seq strategy, we identified a major genomic region harboring a robust flowering time QTL using an F 2 mapping population, designated Ef2.1 on cabbage chromosome 2 for early flowering. Ef2.1 was further validated by indel (insertion or deletion) marker-based classical QTL mapping, explaining 51.5% (LOD = 37.67) and 54.0% (LOD = 40.5) of the phenotypic variation in F 2 and F 2:3 populations, respectively. Combined QTL-seq and classical QTL analysis narrowed down Ef1.1 to a 228-kb genomic region containing 29 genes. A cabbage gene, Bol024659, was identified in this region, which is a homolog of GRF6, a major gene regulating flowering in Arabidopsis, and was designated BolGRF6. qRT-PCR study of the expression level of BolGRF6 revealed significantly higher expression in the early flowering genotypes. Taken together, our results provide support for BolGRF6 as a possible candidate gene for early flowering in the broccoli line 93219. The identified candidate genomic regions and genes may be useful for molecular breeding to improve broccoli and cabbage flowering times.

  7. Genome-wide scans for delineation of candidate genes regulating seed-protein content in chickpea

    Directory of Open Access Journals (Sweden)

    Hari Deo eUpadhyaya

    2016-03-01

    Full Text Available Identification of potential genes/alleles governing complex seed-protein content (SPC trait is essential in marker-assisted breeding for quality trait improvement of chickpea. Henceforth, the present study utilized an integrated genomics-assisted breeding strategy encompassing trait association analysis, selective genotyping in traditional bi-parental mapping population and differential expression profiling for the first-time to understand the complex genetic architecture of quantitative SPC trait in chickpea. For GWAS (genome-wide association study, high-throughput genotyping information of 16376 genome-based SNPs (single nucleotide polymorphism discovered from a structured population of 336 sequenced desi and kabuli accessions [with 150-200 kb LD (linkage disequilibrium decay] was utilized. This led to identification of seven most effective genomic loci (genes associated [10 to 20% with 41% combined PVE (phenotypic variation explained] with SPC trait in chickpea. Regardless of the diverse desi and kabuli genetic backgrounds, a comparable level of association potential of the identified seven genomic loci with SPC trait was observed. Five SPC-associated genes were validated successfully in parental accessions and homozygous individuals of an intra-specific desi RIL (recombinant inbred line mapping population (ICC 12299 x ICC 4958 by selective genotyping. The seed-specific expression, including differential up-regulation (> 4-fold of six SPC-associated genes particularly in accessions, parents and homozygous individuals of the aforementioned mapping population with high level of contrasting seed-protein content (21-22% was evident. Collectively, the integrated genomic approach delineated diverse naturally occurring novel functional SNP allelic variants in six potential candidate genes regulating SPC trait in chickpea. Of these, a non-synonymous SNP allele-carrying zinc finger transcription factor gene exhibiting strong association with SPC trait

  8. Genotype x environment interaction and optimum resource ...

    African Journals Online (AJOL)

    ... x E) interaction and to determine the optimum resource allocation for cassava yield trials. The effects of environment, genotype and G x E interaction were highly significant for all yield traits. Variations due to G x E interaction were greater than those due to genotypic differences for all yield traits. Genotype x location x year ...

  9. An inventory of continental U.S. terrestrial candidate ecological restoration areas based on landscape context

    Science.gov (United States)

    James Wickham; Kurt Riitters; Peter Vogt; Jennifer Costanza; Anne Neale

    2017-01-01

    Landscape context is an important factor in restoration ecology, but the use of landscape context for site prioritization has not been as fully developed.We used morphological image processing to identify candidate ecological restoration areas based on their proximity to existing natural vegetation. We identified 1,102,720 candidate ecological restoration areas across...

  10. Elemental abundances of solar sibling candidates

    International Nuclear Information System (INIS)

    Ramírez, I.; Lambert, D. L.; Endl, M.; Cochran, W. D.; MacQueen, P. J.; Bajkova, A. T.; Bobylev, V. V.; Roederer, I. U.; Wittenmyer, R. A.

    2014-01-01

    Dynamical information along with survey data on metallicity and in some cases age have been used recently by some authors to search for candidates of stars that were born in the cluster where the Sun formed. We have acquired high-resolution, high signal-to-noise ratio spectra for 30 of these objects to determine, using detailed elemental abundance analysis, if they could be true solar siblings. Only two of the candidates are found to have solar chemical composition. Updated modeling of the stars' past orbits in a realistic Galactic potential reveals that one of them, HD 162826, satisfies both chemical and dynamical conditions for being a sibling of the Sun. Measurements of rare-element abundances for this star further confirm its solar composition, with the only possible exception of Sm. Analysis of long-term high-precision radial velocity data rules out the presence of hot Jupiters and confirms that this star is not in a binary system. We find that chemical tagging does not necessarily benefit from studying as many elements as possible but instead from identifying and carefully measuring the abundances of those elements that show large star-to-star scatter at a given metallicity. Future searches employing data products from ongoing massive astrometric and spectroscopic surveys can be optimized by acknowledging this fact.

  11. Hearing impairment in genotyped Wolfram syndrome patients.

    Science.gov (United States)

    Plantinga, Rutger F; Pennings, Ronald J E; Huygen, Patrick L M; Bruno, Rocco; Eller, Philipp; Barrett, Timothy G; Vialettes, Bernard; Paquis-Fluklinger, Veronique; Lombardo, Fortunato; Cremers, Cor W R J

    2008-07-01

    Wolfram syndrome is a progressive neurodegenerative syndrome characterized by the features "DIDMOAD" (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). We sought to study the audiometric data of genotyped Wolfram syndrome patients with sensorineural hearing impairment. Pure tone threshold data of 23 Wolfram syndrome patients were used for cross-sectional analysis in subgroups (age less than 16 years or between 19 and 25 years, gender, and origin). All subgroups, with 1 exception, showed a fairly similar type of hearing impairment with, on average, thresholds of about 25 dB (range, 0 to 65 dB) at 0.25 to 1 kHz, gently sloping downward to about 60 dB (range, 25 to 95 dB) at 8 kHz. The subgroup of Dutch women, which was excluded from the calculations of the average hearing thresholds, showed a higher degree of hearing impairment. Only the latter subgroup showed progression; however, contrary to the previous longitudinal analysis, progression was not significant in the present cross-sectional analysis, presumably because of the high degree of cross-subject variability. This unique collection of audiometric data from genotyped Wolfram syndrome patients shows no substantial progression in sensorineural hearing impairment with advancing age, no relation to the types of WFS1 mutations identified, and, with exclusion of the subgroup of Dutch female patients, no significant sex-related differences.

  12. Agronomical and phytochemical evaluation of Stevia rebaudiana genotypes

    Directory of Open Access Journals (Sweden)

    Vouillamoz, José F.

    2016-07-01

    Full Text Available The agronomical potential and the phytochemical variability of 18 genotypes of the Paraguayan plant Stevia rebaudiana have been investigated in Switzerland in order identify the best genotype for local cultivation. Over a two years period, yields in dry leaves ranged from 10 to 170 g m-2, with a percentage of leaves ranging from 53 to 75 %. HPLC analyses showed a notable variability in phytochemical composition, with stevioside content ranging from 0.3 to 7.9 % w/w and rebaudioside A from 0.3 to 6.5 % w/w. Cultivation of S. rebaudiana in Switzerland is feasible. With a density of 10 plants per m2, the potential yields of dry matter are approximately 1-2 t ha-1. The most productive genotypes (Pharmasaat, Hem Zaden, Stepa and Mediplant 3 and 11 will be submitted to the industry for organoleptic evaluation.

  13. Resistance of citrus genotypes to Phyllocnitis citrella Stainton (Lepidoptera: Gracillariidae).

    Science.gov (United States)

    Santos, M S; Vendramim, J D; Lourenção, A L; Pitta, R M; Martins, E S

    2011-01-01

    The development and reproduction of the citrus leafminer (CLM), Phyllocnistis citrella Stainton, were evaluated in six citrus genotypes in order to identify genotypes with resistance traits that could be applied in a program for the development of citrus varieties resistant to the citrus leafminer. Tests were conducted under controlled laboratory conditions (25 ± 1ºC, 70 ± 10% RH, and 14h photophase). Seedlings of each genotype tested were infested with eggs obtained from a stock colony of CLM maintained on 'Cravo' lemon (Citrus limonia L. Osbeck), and the duration and survival of the eggs, larval and pupal stages, pupal size and weight, fecundity and longevity of adults, and sex ratio were evaluated. No influence was observed on the duration and survival of eggs, larvae and pupae of P. citrella. However, pupae obtained in the hybrid C x R(4) were significantly smaller and lighter than pupae from the remaining treatments. Adult females from the hybrids C x R(4) and C x R(315) were the least fecund. However, the lowest value for the corrected reproductive potential (CRP) was recorded in the hybrid C x R(315), suggesting that this genotype is the least favorable for the development and reproduction of CLM. On the other hand, the highest CRP value obtained in the 'Rugoso' lemon confirms the susceptibility of this genotype, indicating it as the most suitable for CLM.

  14. Methods for MHC genotyping in non-model vertebrates.

    Science.gov (United States)

    Babik, W

    2010-03-01

    Genes of the major histocompatibility complex (MHC) are considered a paradigm of adaptive evolution at the molecular level and as such are frequently investigated by evolutionary biologists and ecologists. Accurate genotyping is essential for understanding of the role that MHC variation plays in natural populations, but may be extremely challenging. Here, I discuss the DNA-based methods currently used for genotyping MHC in non-model vertebrates, as well as techniques likely to find widespread use in the future. I also highlight the aspects of MHC structure that are relevant for genotyping, and detail the challenges posed by the complex genomic organization and high sequence variation of MHC loci. Special emphasis is placed on designing appropriate PCR primers, accounting for artefacts and the problem of genotyping alleles from multiple, co-amplifying loci, a strategy which is frequently necessary due to the structure of the MHC. The suitability of typing techniques is compared in various research situations, strategies for efficient genotyping are discussed and areas of likely progress in future are identified. This review addresses the well established typing methods such as the Single Strand Conformation Polymorphism (SSCP), Denaturing Gradient Gel Electrophoresis (DGGE), Reference Strand Conformational Analysis (RSCA) and cloning of PCR products. In addition, it includes the intriguing possibility of direct amplicon sequencing followed by the computational inference of alleles and also next generation sequencing (NGS) technologies; the latter technique may, in the future, find widespread use in typing complex multilocus MHC systems. © 2009 Blackwell Publishing Ltd.

  15. Productivity of Upland Rice Genotypes under Different Nitrogen Doses

    Energy Technology Data Exchange (ETDEWEB)

    Traore, K.; Traore, O. [INERA /Station de Farakoba, Bobo-Dioulasso (Burkina Faso); Bado, V. B. [Africa Rice Center (AfricaRice), Saint Louis (Senegal)

    2013-11-15

    Nitrogen (N) deficiency is one of the most yield-limiting nutrients in upland rice growing area in Burkina Faso. A field experiment was carried out from 2008 to 2010 in Farakoba research center with the objective to evaluate 200 upland rice (Oryza sativa L.) genotypes from WAB, NERICA, CNA, CNAX, IRAT and IR lines for N use efficiency. The treatments consisted of three levels of N: low, medium and high at 20, 60 and 100 kg-N h{sup a-1}, respectively. Both grain and straw yield increased with N application. The yields were highest for NERICA and WAB lines compared to the other lines, and this was consistent over the N doses. A large variability was found among the genotypes. Three groups of genotypes were identified according to N use efficiency. The high N use efficiency genotypes were found in WAB and NERICA lines. The N concentration in the shoot at flowering significantly increased with N doses and this was similar for N taken up by genotypes. (author)

  16. Copy number variants in extended autism spectrum disorder families reveal candidates potentially involved in autism risk.

    Directory of Open Access Journals (Sweden)

    Daria Salyakina

    Full Text Available Copy number variations (CNVs are a major cause of genetic disruption in the human genome with far more nucleotides being altered by duplications and deletions than by single nucleotide polymorphisms (SNPs. In the multifaceted etiology of autism spectrum disorders (ASDs, CNVs appear to contribute significantly to our understanding of the pathogenesis of this complex disease. A unique resource of 42 extended ASD families was genotyped for over 1 million SNPs to detect CNVs that may contribute to ASD susceptibility. Each family has at least one avuncular or cousin pair with ASD. Families were then evaluated for co-segregation of CNVs in ASD patients. We identified a total of five deletions and seven duplications in eleven families that co-segregated with ASD. Two of the CNVs overlap with regions on 7p21.3 and 15q24.1 that have been previously reported in ASD individuals and two additional CNVs on 3p26.3 and 12q24.32 occur near regions associated with schizophrenia. These findings provide further evidence for the involvement of ICA1 and NXPH1 on 7p21.3 in ASD susceptibility and highlight novel ASD candidates, including CHL1, FGFBP3 and POUF41. These studies highlight the power of using extended families for gene discovery in traits with a complex etiology.

  17. Transcriptome Analysis Reveals Candidate Genes involved in Blister Blight defense in Tea (Camellia sinensis (L) Kuntze)

    Science.gov (United States)

    Jayaswall, Kuldip; Mahajan, Pallavi; Singh, Gagandeep; Parmar, Rajni; Seth, Romit; Raina, Aparnashree; Swarnkar, Mohit Kumar; Singh, Anil Kumar; Shankar, Ravi; Sharma, Ram Kumar

    2016-07-01

    To unravel the molecular mechanism of defense against blister blight (BB) disease caused by an obligate biotrophic fungus, Exobasidium vexans, transcriptome of BB interaction with resistance and susceptible tea genotypes was analysed through RNA-seq using Illumina GAIIx at four different stages during ~20-day disease cycle. Approximately 69 million high quality reads were assembled de novo, yielding 37,790 unique transcripts with more than 55% being functionally annotated. Differentially expressed, 149 defense related transcripts/genes, namely defense related enzymes, resistance genes, multidrug resistant transporters, transcription factors, retrotransposons, metacaspases and chaperons were observed in RG, suggesting their role in defending against BB. Being present in the major hub, putative master regulators among these candidates were identified from predetermined protein-protein interaction network of Arabidopsis thaliana. Further, confirmation of abundant expression of well-known RPM1, RPS2 and RPP13 in quantitative Real Time PCR indicates salicylic acid and jasmonic acid, possibly induce synthesis of antimicrobial compounds, required to overcome the virulence of E. vexans. Compendiously, the current study provides a comprehensive gene expression and insights into the molecular mechanism of tea defense against BB to serve as a resource for unravelling the possible regulatory mechanism of immunity against various biotic stresses in tea and other crops.

  18. Prototheca zopfii genotypes isolated from cow barns and bovine mastitis in Japan.

    Science.gov (United States)

    Osumi, Takafumi; Kishimoto, Yuji; Kano, Rui; Maruyama, Haruhiko; Onozaki, Masanobu; Makimura, Koichi; Ito, Takaaki; Matsubara, Kiyoshi; Hasegawa, Atsuhiko

    2008-10-15

    This study is the first investigation on Japanese isolates of Prototheca zopfii from bovine mastitis and the cow-barn surroundings by molecular characterization to clarify routes of infection for bovine protothecal mastitis. We performed isolation of Prototheca from cow-barn surroundings (drinking water, sewage and feces) and milk samples from cases of bovine mastitis. Genotypes of the 32 isolates of P. zopfii from cow-barn surroundings and 67 isolates from mastitis were analyzed by genotype-specific PCR assays and restriction fragment length polymorphism (RFLP) assays. All mastitis isolates were identified as P. zopfii genotype 2. Conversely, 29 isolates from cow-barn surroundings were identified as P. zopfii genotypes 1 and 3 isolates as genotype 2, respectively. Given these results, both genotypes of P. zopfii could exist in cow-barn surroundings, but no sites were identified as frequent sources of P. zopfii genotype 2. P. zopfii isolates should thus be further explored with regard to genotype to clarify the reservoir of etiological agents in bovine Prototheca mastitis.

  19. Genetic Divergence in Sugarcane Genotypes

    OpenAIRE

    Tahir, Mohammad; Rahman, Hidayatur; Gul, Rahmani; Ali, Amjad; Khalid, Muhammad

    2012-01-01

    To assess genetic divergence of sugarcane germplasm, an experiment comprising 25 sugarcane genotypes was conducted at Sugar Crops Research Institute (SCRI), Mardan, Khyber Pakhtunkhwa, Pakistan, in quadruple lattice design during 2008-09. Among the 14 parameters evaluated, majority exhibited significant differences while some showed nonsignificant mean squares. The initial correlation matrix revealed medium to high correlations. Principal Component Analysis (PCA) showed that there were two pr...

  20. Transcriptome Analysis of Cotton (Gossypium hirsutum L. Genotypes That Are Susceptible, Resistant, and Hypersensitive to Reniform Nematode (Rotylenchulus reniformis.

    Directory of Open Access Journals (Sweden)

    Ruijuan Li

    Full Text Available Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.. An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747, resistant (BARBREN-713, and hypersensitive (LONREN-1 genotypes of cotton (Gossypium hirsutum L. with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.

  1. Rotavirus genotypes associated with acute diarrhea in Egyptian infants.

    Science.gov (United States)

    Ahmed, Salwa F; Mansour, Adel M; Klena, John D; Husain, Tupur S; Hassan, Khaled A; Mohamed, Farag; Steele, Duncan

    2014-01-01

    Before the introduction of rotavirus vaccine in Egypt, information on the burden of disease and the circulating rotavirus genotypes is critical to monitor vaccine effectiveness. A cohort of 348 Egyptian children was followed from birth to 2 years of age with twice-weekly home visits to detect diarrheal illness. VP7 and VP4 genes were genotyped by reverse-transcription polymerase chain reaction and DNA sequencing. Forty percentage of children had rotavirus-associated diarrhea at least once by their second birthday. One hundred and twelve children experienced a single rotavirus diarrheal episodes (RDE) at a median age of 9 months; while 27 infants had their second RDE at a median age of 15 months and 1 infant had 3 RDE at the age of 2, 16 and 22 months. Of the 169 RDE, 82% could be assigned a G-type, while 58% had been identified a P-type. The most prevalent genotype was G2 (32%), followed by G1 (24%) and G9 (19%). G2P[4] rotavirus episodes were significantly associated with fever (P = 0.03) and vomiting (P = 0.06) when compared with other genotypes. G2 strains were the predominant genotype causing 50% of the second RDE while G9 represented 25% of the second RDE. Genotypes identified are similar to those detected globally except for absence of G4. Our finding that 75% of the second RDE were due to G2 and G9 indicates a possible reduction in natural protection afforded by these types compared with G1, where 90% of G1 cases did not experience a second xposure, indicating greater protection against recurrent symptomatic infection.

  2. Historical zoonoses and other changes in host tropism of Staphylococcus aureus, identified by phylogenetic analysis of a population dataset.

    Directory of Open Access Journals (Sweden)

    Marcus A Shepheard

    Full Text Available Staphylococcus aureus exhibits tropisms to many distinct animal hosts. While spillover events can occur wherever there is an interface between host species, changes in host tropism only occur with the establishment of sustained transmission in the new host species, leading to clonal expansion. Although the genomic variation underpinning adaptation in S. aureus genotypes infecting bovids and poultry has been well characterized the frequency of switches from one host to another remains obscure. We sought to identify sustained switches in host tropism in the S. aureus population, both anthroponotic and zoonotic, and their distribution over the species phylogeny. METHODOLOGIES/RESULTS: We have used a sample of 3042 isolates, representing 696 distinct MLST genotypes, from a well-established database (www.mlst.net. Using an empirical parsimony approach (AdaptML we have investigated the distribution of switches in host association between both human and non-human (henceforth referred to as animal hosts. We reconstructed a credible description of past events in the form of a phylogenetic tree; the nodes and leaves of which are statistically associated with either human or animal habitats, estimated from extant host-association and the degree of sequence divergence between genotypes. We identified 15 likely historical switching events; 13 anthroponoses and two zoonoses. Importantly, we identified two human-associated clade candidates (CC25 and CC59 that have arisen from animal-associated ancestors; this demonstrates that a human-specific lineage can emerge from an animal host. We also highlight novel rabbit-associated genotypes arising from a human ancestor.S. aureus is an organism with the capacity to switch into and adapt to novel hosts, even after long periods of isolation in a single host species. Based on this evidence, animal-adapted S. aureus lineages exhibiting resistance to antibiotics must be considered a major threat to public health, as they

  3. ANGIOTENSIN-CONVERTING ENZYME GENOTYPE AFFECTS SKELETAL MUSCLE STRENGTH IN ELITE ATHLETES

    Directory of Open Access Journals (Sweden)

    Aldo Matos Costa

    2009-09-01

    Full Text Available Previous studies have associated angiotensin-converting enzyme (ACE D allele with variability in the skeletal muscle baseline strength, though conclusions have been inconsistent across investigations. The purpose of this study was to examine the possible association between ACE genotype and skeletal muscle baseline strength in elite male and female athletes involved in different event expertise. A group of 58 elite athletes, designated as Olympic candidates, were studied: 35 swimmers (19 males and 16 females, 18.8 ± 3.2 years and 23 triathletes (15 males and 8 females, 18.7 ± 3.0 years. The athletes were classified as: short (< 200m and middle (400m to 1500m distance athletes, respectively. For each subject the grip strength in both hands was measure using an adjustable mechanical hand dynamometer. The maximum height in both squat jump (SJ and counter movement jump (CMJ were also assessed, using a trigonometric carpet (Ergojump Digitime 1000; Digitest, Jyvaskyla, Finland. DNA extraction was obtained with Chelex 100® and genotype determination by PCR-RFLP methods. Both males and females showed significantly higher right grip strength in D allele carriers compared to II homozygote's. We found that allelic frequency differs significantly by event distance specialization in both genders (p < 0.05. In fact, sprinter D allele carriers showed the superior scores in nearly all strength measurements (p < 0.05, in both genders. Among endurance athletes, the results also demonstrated that female D allele carriers exhibited the higher performance right grip and CMJ scores (p < 0.05. In conclusion, the ACE D allele seems associated with skeletal muscle baseline strength in elite athletes, being easily identified in females

  4. Effects of ghrelin gene genotypes on the growth traits in Chinese cattle.

    Science.gov (United States)

    Zhang, Ai-ling; Zhang, Li; Zhang, Liang-zhi; Zhang, Cun-fang; Lan, Xian-yong; Zhang, Chun-lei; Chen, Hong

    2012-06-01

    Ghrelin is an important peptide that stimulates food intake and regulates energy balance of animals. Single nucleotide polymorphisms of ghrelin gene in three Chinese cattle populations were investigated through PCR-SSCP and DNA sequencing. Five over-lapped DNA fragments were analyzed and a total of three ones exhibited different genotypes. Three genotypes and four SNPs (-415 A > G, -414 T > C, -321 C > A, and -172 A > G) were found on the -544 to +35 bp region (G-1) of ghrelin gene. On the locus of -1037 to -509 bp (G-2), two genotypes and one SNP (-726 A > T) were discovered. And in the exon1, exon2, and intron1 (G-4 locus, (+4 to +427)), two genotypes and one SNP were detected (+205 C > T, located in intron1). Positions of the five SNPs in the 5′ regulatory region might be the transcription factor binding sites. The SNPs at -415 and -414 in the core binding sequence were found to cause the change of the site. Though the SNP at -172 did not change the binding site, it generated one new site at the same time. The frequencies of the genotypes varied differently in the three breeds. Results of ANOVA showed that G-1 was correlative to the ischium width (IW) of Nanyang cattle aged 18 months (p = 0.043). The least square analysis between genotypes at G-1 locus and growth traits in Nanyang cattle showed that the individuals (aged 18 months) with C genotype had greater IW than that of the other two genotypes. The C genotype might serve as one potential candidate genetic marker for cattle growth and development.

  5. 11 CFR 100.154 - Candidate debates.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate debates. 100.154 Section 100.154 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.154 Candidate debates. Funds used to defray costs incurred in staging candidate debates in...

  6. 11 CFR 100.92 - Candidate debates.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate debates. 100.92 Section 100.92 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Contributions § 100.92 Candidate debates. Funds provided to defray costs incurred in staging candidate debates...

  7. A new trend of genotype distribution of hepatitis B virus infection in southeast China (Fujian), 2006-2013.

    Science.gov (United States)

    Wei, D H; Liu, H Z; Huang, A M; Liu, X L; Liu, J F

    2015-10-01

    HBV genotypes have specific geographical distributions and can serve as epidemiological markers. Accumulated data have shown that the major HBV genotypes in China are B and C. Here, the HBV genotypes were examined from 6817 blood samples, which were collected from patients with chronic HBV infection in Fujian Province during 2006-2013; genotype B was identified in 3384 patients (49·6%), while genotype C was identified in 3430 patients (50·3%). The percentage of patients infected with genotype C gradually increased with age from 39·5% (patients aged 50 years), reaching a peak of 67·3% in the 45-50 years age group. These results clearly demonstrate that the genotype distribution of HBV in Fujian Province has significantly changed in recent years with almost equal numbers of genotype B and genotype C infections existing in the entire patient population, while higher incidence of genotype C infection exists in older patients, but genotype B is no longer dominant in the Fujian area as previously reported.

  8. Echinococcus granulosus sensu lato genotypes infecting humans--review of current knowledge.

    Science.gov (United States)

    Alvarez Rojas, Cristian A; Romig, Thomas; Lightowlers, Marshall W

    2014-01-01

    Genetic variability in the species group Echinococcus granulosus sensu lato is well recognised as affecting intermediate host susceptibility and other biological features of the parasites. Molecular methods have allowed discrimination of different genotypes (G1-10 and the 'lion strain'), some of which are now considered separate species. An accumulation of genotypic analyses undertaken on parasite isolates from human cases of cystic echinococcosis provides the basis upon which an assessment is made here of the relative contribution of the different genotypes to human disease. The allocation of samples to G-numbers becomes increasingly difficult, because much more variability than previously recognised exists in the genotypic clusters G1-3 (=E. granulosus sensu stricto) and G6-10 (Echinococcus canadensis). To accommodate the heterogeneous criteria used for genotyping in the literature, we restrict ourselves to differentiate between E. granulosus sensu stricto (G1-3), Echinococcus equinus (G4), Echinococcus ortleppi (G5) and E. canadensis (G6-7, G8, G10). The genotype G1 is responsible for the great majority of human cystic echinococcosis worldwide (88.44%), has the most cosmopolitan distribution and is often associated with transmission via sheep as intermediate hosts. The closely related genotypes G6 and G7 cause a significant number of human infections (11.07%). The genotype G6 was found to be responsible for 7.34% of infections worldwide. This strain is known from Africa and Asia, where it is transmitted mainly by camels (and goats), and South America, where it appears to be mainly transmitted by goats. The G7 genotype has been responsible for 3.73% of human cases of cystic echinococcosis in eastern European countries, where the parasite is transmitted by pigs. Some of the samples (11) could not be identified with a single specific genotype belonging to E. canadensis (G6/10). Rare cases of human cystic echinococcosis have been identified as having been caused by