WorldWideScience

Sample records for identify plant genes

  1. Transcriptomic Analysis Using Olive Varieties and Breeding Progenies Identifies Candidate Genes Involved in Plant Architecture.

    Science.gov (United States)

    González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R

    2016-01-01

    Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

  2. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  3. The compact Selaginella genome identifies changes in gene content associated with the evolution of vascular plants

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.; Banks, Jo Ann; Nishiyama, Tomoaki; Hasebe, Mitsuyasu; Bowman, John L.; Gribskov, Michael; dePamphilis, Claude; Albert, Victor A.; Aono, Naoki; Aoyama, Tsuyoshi; Ambrose, Barbara A.; Ashton, Neil W.; Axtell, Michael J.; Barker, Elizabeth; Barker, Michael S.; Bennetzen, Jeffrey L.; Bonawitz, Nicholas D.; Chapple, Clint; Cheng, Chaoyang; Correa, Luiz Gustavo Guedes; Dacre, Michael; DeBarry, Jeremy; Dreyer, Ingo; Elias, Marek; Engstrom, Eric M.; Estelle, Mark; Feng, Liang; Finet, Cedric; Floyd, Sandra K.; Frommer, Wolf B.; Fujita, Tomomichi; Gramzow, Lydia; Gutensohn, Michael; Harholt, Jesper; Hattori, Mitsuru; Heyl, Alexander; Hirai, Tadayoshi; Hiwatashi, Yuji; Ishikawa, Masaki; Iwata, Mineko; Karol, Kenneth G.; Koehler, Barbara; Kolukisaoglu, Uener; Kubo, Minoru; Kurata, Tetsuya; Lalonde, Sylvie; Li, Kejie; Li, Ying; Litt, Amy; Lyons, Eric; Manning, Gerard; Maruyama, Takeshi; Michael, Todd P.; Mikami, Koji; Miyazaki, Saori; Morinaga, Shin-ichi; Murata, Takashi; Mueller-Roeber, Bernd; Nelson, David R.; Obara, Mari; Oguri, Yasuko; Olmstead, Richard G.; Onodera, Naoko; Petersen, Bent Larsen; Pils, Birgit; Prigge, Michael; Rensing, Stefan A.; Riano-Pachon, Diego Mauricio; Roberts, Alison W.; Sato, Yoshikatsu; Scheller, Henrik Vibe; Schulz, Burkhard; Schulz, Christian; Shakirov, Eugene V.; Shibagaki, Nakako; Shinohara, Naoki; Shippen, Dorothy E.; Sorensen, Iben; Sotooka, Ryo; Sugimoto, Nagisa; Sugita, Mamoru; Sumikawa, Naomi; Tanurdzic, Milos; Theilsen, Gunter; Ulvskov, Peter; Wakazuki, Sachiko; Weng, Jing-Ke; Willats, William W.G.T.; Wipf, Daniel; Wolf, Paul G.; Yang, Lixing; Zimmer, Andreas D.; Zhu, Qihui; Mitros, Therese; Hellsten, Uffe; Loque, Dominique; Otillar, Robert; Salamov, Asaf; Schmutz, Jeremy; Shapiro, Harris; Lindquist, Erika; Lucas, Susan; Rokhsar, Daniel

    2011-04-28

    We report the genome sequence of the nonseed vascular plant, Selaginella moellendorffii, and by comparative genomics identify genes that likely played important roles in the early evolution of vascular plants and their subsequent evolution

  4. Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

    Science.gov (United States)

    Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

    2018-06-01

    Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation

  5. De novo assembly and characterization of the transcriptome of the parasitic weed dodder identifies genes associated with plant parasitism.

    Science.gov (United States)

    Ranjan, Aashish; Ichihashi, Yasunori; Farhi, Moran; Zumstein, Kristina; Townsley, Brad; David-Schwartz, Rakefet; Sinha, Neelima R

    2014-11-01

    Parasitic flowering plants are one of the most destructive agricultural pests and have major impact on crop yields throughout the world. Being dependent on finding a host plant for growth, parasitic plants penetrate their host using specialized organs called haustoria. Haustoria establish vascular connections with the host, which enable the parasite to steal nutrients and water. The underlying molecular and developmental basis of parasitism by plants is largely unknown. In order to investigate the process of parasitism, RNAs from different stages (i.e. seed, seedling, vegetative strand, prehaustoria, haustoria, and flower) were used to de novo assemble and annotate the transcriptome of the obligate plant stem parasite dodder (Cuscuta pentagona). The assembled transcriptome was used to dissect transcriptional dynamics during dodder development and parasitism and identified key gene categories involved in the process of plant parasitism. Host plant infection is accompanied by increased expression of parasite genes underlying transport and transporter categories, response to stress and stimuli, as well as genes encoding enzymes involved in cell wall modifications. By contrast, expression of photosynthetic genes is decreased in the dodder infective stages compared with normal stem. In addition, genes relating to biosynthesis, transport, and response of phytohormones, such as auxin, gibberellins, and strigolactone, were differentially expressed in the dodder infective stages compared with stems and seedlings. This analysis sheds light on the transcriptional changes that accompany plant parasitism and will aid in identifying potential gene targets for use in controlling the infestation of crops by parasitic weeds. © 2014 American Society of Plant Biologists. All Rights Reserved.

  6. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    Science.gov (United States)

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  7. A comparative genomics screen identifies a Sinorhizobium meliloti 1021 sodM-like gene strongly expressed within host plant nodules

    Directory of Open Access Journals (Sweden)

    Queiroux Clothilde

    2012-05-01

    Full Text Available Abstract Background We have used the genomic data in the Integrated Microbial Genomes system of the Department of Energy’s Joint Genome Institute to make predictions about rhizobial open reading frames that play a role in nodulation of host plants. The genomic data was screened by searching for ORFs conserved in α-proteobacterial rhizobia, but not conserved in closely-related non-nitrogen-fixing α-proteobacteria. Results Using this approach, we identified many genes known to be involved in nodulation or nitrogen fixation, as well as several new candidate genes. We knocked out selected new genes and assayed for the presence of nodulation phenotypes and/or nodule-specific expression. One of these genes, SMc00911, is strongly expressed by bacterial cells within host plant nodules, but is expressed minimally by free-living bacterial cells. A strain carrying an insertion mutation in SMc00911 is not defective in the symbiosis with host plants, but in contrast to expectations, this mutant strain is able to out-compete the S. meliloti 1021 wild type strain for nodule occupancy in co-inoculation experiments. The SMc00911 ORF is predicted to encode a “SodM-like” (superoxide dismutase-like protein containing a rhodanese sulfurtransferase domain at the N-terminus and a chromate-resistance superfamily domain at the C-terminus. Several other ORFs (SMb20360, SMc01562, SMc01266, SMc03964, and the SMc01424-22 operon identified in the screen are expressed at a moderate level by bacteria within nodules, but not by free-living bacteria. Conclusions Based on the analysis of ORFs identified in this study, we conclude that this comparative genomics approach can identify rhizobial genes involved in the nitrogen-fixing symbiosis with host plants, although none of the newly identified genes were found to be essential for this process.

  8. Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

    Science.gov (United States)

    Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

    2009-10-23

    We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

  9. De Novo Assembly and Characterization of the Transcriptome of the Parasitic Weed Dodder Identifies Genes Associated with Plant Parasitism1[C][W][OPEN

    Science.gov (United States)

    Ranjan, Aashish; Ichihashi, Yasunori; Farhi, Moran; Zumstein, Kristina; Townsley, Brad; David-Schwartz, Rakefet; Sinha, Neelima R.

    2014-01-01

    Parasitic flowering plants are one of the most destructive agricultural pests and have major impact on crop yields throughout the world. Being dependent on finding a host plant for growth, parasitic plants penetrate their host using specialized organs called haustoria. Haustoria establish vascular connections with the host, which enable the parasite to steal nutrients and water. The underlying molecular and developmental basis of parasitism by plants is largely unknown. In order to investigate the process of parasitism, RNAs from different stages (i.e. seed, seedling, vegetative strand, prehaustoria, haustoria, and flower) were used to de novo assemble and annotate the transcriptome of the obligate plant stem parasite dodder (Cuscuta pentagona). The assembled transcriptome was used to dissect transcriptional dynamics during dodder development and parasitism and identified key gene categories involved in the process of plant parasitism. Host plant infection is accompanied by increased expression of parasite genes underlying transport and transporter categories, response to stress and stimuli, as well as genes encoding enzymes involved in cell wall modifications. By contrast, expression of photosynthetic genes is decreased in the dodder infective stages compared with normal stem. In addition, genes relating to biosynthesis, transport, and response of phytohormones, such as auxin, gibberellins, and strigolactone, were differentially expressed in the dodder infective stages compared with stems and seedlings. This analysis sheds light on the transcriptional changes that accompany plant parasitism and will aid in identifying potential gene targets for use in controlling the infestation of crops by parasitic weeds. PMID:24399359

  10. A Complementary Bioinformatics Approach to Identify Potential Plant Cell Wall Glycosyltransferase-Encoding Genes

    DEFF Research Database (Denmark)

    Egelund, Jack; Skjøt, Michael; Geshi, Naomi

    2004-01-01

    Plant cell wall (CW) synthesizing enzymes can be divided into the glycan (i.e. cellulose and callose) synthases, which are multimembrane spanning proteins located at the plasma membrane, and the glycosyltransferases (GTs), which are Golgi localized single membrane spanning proteins, believed....... Although much is known with regard to composition and fine structures of the plant CW, only a handful of CW biosynthetic GT genes-all classified in the CAZy system-have been characterized. In an effort to identify CW GTs that have not yet been classified in the CAZy database, a simple bioinformatics...... approach was adopted. First, the entire Arabidopsis proteome was run through the Transmembrane Hidden Markov Model 2.0 server and proteins containing one or, more rarely, two transmembrane domains within the N-terminal 150 amino acids were collected. Second, these sequences were submitted...

  11. Use of DNA barcodes to identify flowering plants

    OpenAIRE

    Kress, W. John; Wurdack, Kenneth J.; Zimmer, Elizabeth A.; Weigt, Lee A.; Janzen, Daniel H.

    2005-01-01

    Methods for identifying species by using short orthologous DNA sequences, known as “DNA barcodes,” have been proposed and initiated to facilitate biodiversity studies, identify juveniles, associate sexes, and enhance forensic analyses. The cytochrome c oxidase 1 sequence, which has been found to be widely applicable in animal barcoding, is not appropriate for most species of plants because of a much slower rate of cytochrome c oxidase 1 gene evolution in higher plants than in animals. We ther...

  12. Application of Chemical Genomics to Plant-Bacteria Communication: A High-Throughput System to Identify Novel Molecules Modulating the Induction of Bacterial Virulence Genes by Plant Signals.

    Science.gov (United States)

    Vandelle, Elodie; Puttilli, Maria Rita; Chini, Andrea; Devescovi, Giulia; Venturi, Vittorio; Polverari, Annalisa

    2017-01-01

    The life cycle of bacterial phytopathogens consists of a benign epiphytic phase, during which the bacteria grow in the soil or on the plant surface, and a virulent endophytic phase involving the penetration of host defenses and the colonization of plant tissues. Innovative strategies are urgently required to integrate copper treatments that control the epiphytic phase with complementary tools that control the virulent endophytic phase, thus reducing the quantity of chemicals applied to economically and ecologically acceptable levels. Such strategies include targeted treatments that weaken bacterial pathogens, particularly those inhibiting early infection steps rather than tackling established infections. This chapter describes a reporter gene-based chemical genomic high-throughput screen for the induction of bacterial virulence by plant molecules. Specifically, we describe a chemical genomic screening method to identify agonist and antagonist molecules for the induction of targeted bacterial virulence genes by plant extracts, focusing on the experimental controls required to avoid false positives and thus ensuring the results are reliable and reproducible.

  13. Identifying Beneficial Qualities of Trichoderma parareesei for Plants

    Science.gov (United States)

    Rubio, M. Belén; Quijada, Narciso M.; Pérez, Esclaudys; Domínguez, Sara; Hermosa, Rosa

    2014-01-01

    Trichoderma parareesei and Trichoderma reesei (teleomorph Hypocrea jecorina) produce cellulases and xylanases of industrial interest. Here, the anamorphic strain T6 (formerly T. reesei) has been identified as T. parareesei, showing biocontrol potential against fungal and oomycete phytopathogens and enhanced hyphal growth in the presence of tomato exudates or plant cell wall polymers in in vitro assays. A Trichoderma microarray was used to examine the transcriptomic changes in T6 at 20 h of interaction with tomato plants. Out of a total 34,138 Trichoderma probe sets deposited on the microarray, 250 showed a significant change of at least 2-fold in expression in the presence of tomato plants, with most of them being downregulated. T. parareesei T6 exerted beneficial effects on tomato plants in terms of seedling lateral root development, and in adult plants it improved defense against Botrytis cinerea and growth promotion under salt stress. Time course expression patterns (0 to 6 days) observed for defense-related genes suggest that T6 was able to prime defense responses in the tomato plants against biotic and abiotic stresses. Such responses undulated, with a maximum upregulation of the jasmonic acid (JA)/ethylene (ET)-related LOX1 and EIN2 genes and the salt tolerance SOS1 gene at 24 h and that of the salicylic acid (SA)-related PR-1 gene at 48 h after T6 inoculation. Our study demonstrates that the T. parareesei T6-tomato interaction is beneficial to both partners. PMID:24413597

  14. Fungal and plant gene expression in arbuscular mycorrhizal symbiosis.

    Science.gov (United States)

    Balestrini, Raffaella; Lanfranco, Luisa

    2006-11-01

    Arbuscular mycorrhizas (AMs) are a unique example of symbiosis between two eukaryotes, soil fungi and plants. This association induces important physiological changes in each partner that lead to reciprocal benefits, mainly in nutrient supply. The symbiosis results from modifications in plant and fungal cell organization caused by specific changes in gene expression. Recently, much effort has gone into studying these gene expression patterns to identify a wider spectrum of genes involved. We aim in this review to describe AM symbiosis in terms of current knowledge on plant and fungal gene expression profiles.

  15. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  16. In silico identification and analysis of phytoene synthase genes in plants.

    Science.gov (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  17. Transcriptomic analysis of a tertiary relict plant, extreme xerophyte Reaumuria soongorica to identify genes related to drought adaptation.

    Directory of Open Access Journals (Sweden)

    Yong Shi

    Full Text Available BACKGROUND: Reaumuria soongorica is an extreme xerophyte shrub widely distributed in the desert regions including sand dune, Gobi and marginal loess of central Asia which plays a crucial role to sustain and restore fragile desert ecosystems. However, due to the lacking of the genomic sequences, studies on R. soongorica had mainly limited in physiological responses to drought stress. Here, a deep transcriptomic sequencing of R. soongorica will facilitate molecular functional studies and pave the path to understand drought adaptation for a desert plant. METHODOLOGY/PRINCIPAL FINDINGS: A total of 53,193,660 clean paired-end reads was generated from the Illumina HiSeq™ 2000 platform. By assembly with Trinity, we got 173,700 contigs and 77,647 unigenes with mean length of 677 bp and N50 of 1109 bp. Over 55% (43,054 unigenes were successfully annotated based on sequence similarity against public databases as well as Rfam and Pfam database. Local BLAST and Kyoto Encyclopedia of Genes and Genomes (KEGG maps were used to further exhausting seek for candidate genes related to drought adaptation and a set of 123 putative candidate genes were identified. Moreover, all the C4 photosynthesis genes existed and were active in R. soongorica, which has been regarded as a typical C3 plant. CONCLUSION/SIGNIFICANCE: The assembled unigenes in present work provide abundant genomic information for the functional assignments in an extreme xerophyte R. soongorica, and will help us exploit the genetic basis of how desert plants adapt to drought environment in the near future.

  18. Phylogenetics and evolution of Trx SET genes in fully sequenced land plants.

    Science.gov (United States)

    Zhu, Xinyu; Chen, Caoyi; Wang, Baohua

    2012-04-01

    Plant Trx SET proteins are involved in H3K4 methylation and play a key role in plant floral development. Genes encoding Trx SET proteins constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. To investigate the evolutionary history of the Trx SET gene family, we made a comprehensive evolutionary analysis on this gene family from 13 major representatives of green plants. A novel clustering (here named as cpTrx clade), which included the III-1, III-2, and III-4 orthologous groups, previously resolved was identified. Our analysis showed that plant Trx proteins possessed a variety of domain organizations and gene structures among paralogs. Additional domains such as PHD, PWWP, and FYR were early integrated into primordial SET-PostSET domain organization of cpTrx clade. We suggested that the PostSET domain was lost in some members of III-4 orthologous group during the evolution of land plants. At least four classes of gene structures had been formed at the early evolutionary stage of land plants. Three intronless orphan Trx SET genes from the Physcomitrella patens (moss) were identified, and supposedly, their parental genes have been eliminated from the genome. The structural differences among evolutionary groups of plant Trx SET genes with different functions were described, contributing to the design of further experimental studies.

  19. Use of the Plant Defense Protein Osmotin To Identify Fusarium oxysporum Genes That Control Cell Wall Properties

    KAUST Repository

    Lee, H.

    2010-02-26

    Fusarium oxysporum is the causative agent of fungal wilt disease in a variety of crops. The capacity of a fungal pathogen such as F. oxysporum f. sp. nicotianae to establish infection on its tobacco (Nicotiana tabacum) host depends in part on its capacity to evade the toxicity of tobacco defense proteins, such as osmotin. Fusarium genes that control resistance to osmotin would therefore reflect coevolutionary pressures and include genes that control mutual recognition, avoidance, and detoxification. We identified FOR (Fusarium Osmotin Resistance) genes on the basis of their ability to confer osmotin resistance to an osmotin-sensitive strain of Saccharomyces cerevisiae. FOR1 encodes a putative cell wall glycoprotein. FOR2 encodes the structural gene for glutamine:fructose-6-phosphate amidotransferase, the first and rate-limiting step in the biosynthesis of hexosamine and cell wall chitin. FOR3 encodes a homolog of SSD1, which controls cell wall composition, longevity, and virulence in S. cerevisiae. A for3 null mutation increased osmotin sensitivity of conidia and hyphae of F. oxysporum f. sp. nicotianae and also reduced cell wall β-1,3-glucan content. Together our findings show that conserved fungal genes that determine cell wall properties play a crucial role in regulating fungal susceptibility to the plant defense protein osmotin.

  20. Use of the Plant Defense Protein Osmotin To Identify Fusarium oxysporum Genes That Control Cell Wall Properties

    KAUST Repository

    Lee, H.; Damsz, B.; Woloshuk, C. P.; Bressan, R. A.; Narasimhan, Meena L.

    2010-01-01

    Fusarium oxysporum is the causative agent of fungal wilt disease in a variety of crops. The capacity of a fungal pathogen such as F. oxysporum f. sp. nicotianae to establish infection on its tobacco (Nicotiana tabacum) host depends in part on its capacity to evade the toxicity of tobacco defense proteins, such as osmotin. Fusarium genes that control resistance to osmotin would therefore reflect coevolutionary pressures and include genes that control mutual recognition, avoidance, and detoxification. We identified FOR (Fusarium Osmotin Resistance) genes on the basis of their ability to confer osmotin resistance to an osmotin-sensitive strain of Saccharomyces cerevisiae. FOR1 encodes a putative cell wall glycoprotein. FOR2 encodes the structural gene for glutamine:fructose-6-phosphate amidotransferase, the first and rate-limiting step in the biosynthesis of hexosamine and cell wall chitin. FOR3 encodes a homolog of SSD1, which controls cell wall composition, longevity, and virulence in S. cerevisiae. A for3 null mutation increased osmotin sensitivity of conidia and hyphae of F. oxysporum f. sp. nicotianae and also reduced cell wall β-1,3-glucan content. Together our findings show that conserved fungal genes that determine cell wall properties play a crucial role in regulating fungal susceptibility to the plant defense protein osmotin.

  1. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  2. Divergence and Conservative Evolution of XTNX Genes in Land Plants

    Directory of Open Access Journals (Sweden)

    Yan-Mei Zhang

    2017-10-01

    Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.

  3. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  4. Identifying new sex-linked genes through BAC sequencing in the dioecious plant Silene latifolia

    Czech Academy of Sciences Publication Activity Database

    Blavet, Nicolas; Blavet, Hana; Muyle, A.; Käfer, J.; Cegan, R.; Deschamps, C.; Zemp, N.; Mousset, S.; Aubourg, S.; Bergero, R.; Charlesworth, D.; Hobza, Roman; Widmer, A.; Marais, G.A.B.

    2015-01-01

    Roč. 16, JUL 25 (2015), s. 546 ISSN 1471-2164 R&D Projects: GA ČR GAP501/12/2220 Institutional support: RVO:61389030 Keywords : Sex chromosomes * Sex-linked genes * Plant Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.867, year: 2015

  5. In Silico Identification, Phylogenetic and Bioinformatic Analysis of Argonaute Genes in Plants

    Directory of Open Access Journals (Sweden)

    Khaled Mirzaei

    2014-01-01

    Full Text Available Argonaute protein family is the key players in pathways of gene silencing and small regulatory RNAs in different organisms. Argonaute proteins can bind small noncoding RNAs and control protein synthesis, affect messenger RNA stability, and even participate in the production of new forms of small RNAs. The aim of this study was to characterize and perform bioinformatic analysis of Argonaute proteins in 32 plant species that their genome was sequenced. A total of 437 Argonaute genes were identified and were analyzed based on lengths, gene structure, and protein structure. Results showed that Argonaute proteins were highly conserved across plant kingdom. Phylogenic analysis divided plant Argonautes into three classes. Argonaute proteins have three conserved domains PAZ, MID and PIWI. In addition to three conserved domains namely, PAZ, MID, and PIWI, we identified few more domains in AGO of some plant species. Expression profile analysis of Argonaute proteins showed that expression of these genes varies in most of tissues, which means that these proteins are involved in regulation of most pathways of the plant system. Numbers of alternative transcripts of Argonaute genes were highly variable among the plants. A thorough analysis of large number of putative Argonaute genes revealed several interesting aspects associated with this protein and brought novel information with promising usefulness for both basic and biotechnological applications.

  6. Selection on plant male function genes identifies candidates for reproductive isolation of yellow monkeyflowers.

    Directory of Open Access Journals (Sweden)

    Jan E Aagaard

    Full Text Available Understanding the genetic basis of reproductive isolation promises insight into speciation and the origins of biological diversity. While progress has been made in identifying genes underlying barriers to reproduction that function after fertilization (post-zygotic isolation, we know much less about earlier acting pre-zygotic barriers. Of particular interest are barriers involved in mating and fertilization that can evolve extremely rapidly under sexual selection, suggesting they may play a prominent role in the initial stages of reproductive isolation. A significant challenge to the field of speciation genetics is developing new approaches for identification of candidate genes underlying these barriers, particularly among non-traditional model systems. We employ powerful proteomic and genomic strategies to study the genetic basis of conspecific pollen precedence, an important component of pre-zygotic reproductive isolation among yellow monkeyflowers (Mimulus spp. resulting from male pollen competition. We use isotopic labeling in combination with shotgun proteomics to identify more than 2,000 male function (pollen tube proteins within maternal reproductive structures (styles of M. guttatus flowers where pollen competition occurs. We then sequence array-captured pollen tube exomes from a large outcrossing population of M. guttatus, and identify those genes with evidence of selective sweeps or balancing selection consistent with their role in pollen competition. We also test for evidence of positive selection on these genes more broadly across yellow monkeyflowers, because a signal of adaptive divergence is a common feature of genes causing reproductive isolation. Together the molecular evolution studies identify 159 pollen tube proteins that are candidate genes for conspecific pollen precedence. Our work demonstrates how powerful proteomic and genomic tools can be readily adapted to non-traditional model systems, allowing for genome-wide screens

  7. Flavonoid Biosynthesis Genes Putatively Identified in the Aromatic Plant Polygonum minus via Expressed Sequences Tag (EST Analysis

    Directory of Open Access Journals (Sweden)

    Zamri Zainal

    2012-02-01

    Full Text Available P. minus is an aromatic plant, the leaf of which is widely used as a food additive and in the perfume industry. The leaf also accumulates secondary metabolites that act as active ingredients such as flavonoid. Due to limited genomic and transcriptomic data, the biosynthetic pathway of flavonoids is currently unclear. Identification of candidate genes involved in the flavonoid biosynthetic pathway will significantly contribute to understanding the biosynthesis of active compounds. We have constructed a standard cDNA library from P. minus leaves, and two normalized full-length enriched cDNA libraries were constructed from stem and root organs in order to create a gene resource for the biosynthesis of secondary metabolites, especially flavonoid biosynthesis. Thus, large‑scale sequencing of P. minus cDNA libraries identified 4196 expressed sequences tags (ESTs which were deposited in dbEST in the National Center of Biotechnology Information (NCBI. From the three constructed cDNA libraries, 11 ESTs encoding seven genes were mapped to the flavonoid biosynthetic pathway. Finally, three flavonoid biosynthetic pathway-related ESTs chalcone synthase, CHS (JG745304, flavonol synthase, FLS (JG705819 and leucoanthocyanidin dioxygenase, LDOX (JG745247 were selected for further examination by quantitative RT-PCR (qRT-PCR in different P. minus organs. Expression was detected in leaf, stem and root. Gene expression studies have been initiated in order to better understand the underlying physiological processes.

  8. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  9. Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica

    International Nuclear Information System (INIS)

    Zulfiqar, Asma; Paulose, Bibin; Chhikara, Sudesh; Dhankher, Om Parkash

    2011-01-01

    Chromium pollution is a serious environmental problem with few cost-effective remediation strategies available. Crambe abyssinica (a member of Brassicaseae), a non-food, fast growing high biomass crop, is an ideal candidate for phytoremediation of heavy metals contaminated soils. The present study used a PCR-Select Suppression Subtraction Hybridization approach in C. abyssinica to isolate differentially expressed genes in response to Cr exposure. A total of 72 differentially expressed subtracted cDNAs were sequenced and found to represent 43 genes. The subtracted cDNAs suggest that Cr stress significantly affects pathways related to stress/defense, ion transporters, sulfur assimilation, cell signaling, protein degradation, photosynthesis and cell metabolism. The regulation of these genes in response to Cr exposure was further confirmed by semi-quantitative RT-PCR. Characterization of these differentially expressed genes may enable the engineering of non-food, high-biomass plants, including C. abyssinica, for phytoremediation of Cr-contaminated soils and sediments. - Highlights: → Molecular mechanism of Cr uptake and detoxification in plants is not well known. → We identified differentially regulated genes upon Cr exposure in Crambe abyssinica. → 72 Cr-induced subtracted cDNAs were sequenced and found to represent 43 genes. → Pathways linked to stress, ion transport, and sulfur assimilation were affected. → This is the first Cr transcriptome study in a crop with phytoremediation potential. - This study describes the identification and isolation of differentially expressed genes involved in chromium metabolism and detoxification in a non-food industrial oil crop Crambe abyssinica.

  10. Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica

    Energy Technology Data Exchange (ETDEWEB)

    Zulfiqar, Asma, E-mail: asmazulfiqar08@yahoo.com [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Paulose, Bibin, E-mail: bpaulose@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Chhikara, Sudesh, E-mail: sudesh@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Dhankher, Om Parkash, E-mail: parkash@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States)

    2011-10-15

    Chromium pollution is a serious environmental problem with few cost-effective remediation strategies available. Crambe abyssinica (a member of Brassicaseae), a non-food, fast growing high biomass crop, is an ideal candidate for phytoremediation of heavy metals contaminated soils. The present study used a PCR-Select Suppression Subtraction Hybridization approach in C. abyssinica to isolate differentially expressed genes in response to Cr exposure. A total of 72 differentially expressed subtracted cDNAs were sequenced and found to represent 43 genes. The subtracted cDNAs suggest that Cr stress significantly affects pathways related to stress/defense, ion transporters, sulfur assimilation, cell signaling, protein degradation, photosynthesis and cell metabolism. The regulation of these genes in response to Cr exposure was further confirmed by semi-quantitative RT-PCR. Characterization of these differentially expressed genes may enable the engineering of non-food, high-biomass plants, including C. abyssinica, for phytoremediation of Cr-contaminated soils and sediments. - Highlights: > Molecular mechanism of Cr uptake and detoxification in plants is not well known. > We identified differentially regulated genes upon Cr exposure in Crambe abyssinica. > 72 Cr-induced subtracted cDNAs were sequenced and found to represent 43 genes. > Pathways linked to stress, ion transport, and sulfur assimilation were affected. > This is the first Cr transcriptome study in a crop with phytoremediation potential. - This study describes the identification and isolation of differentially expressed genes involved in chromium metabolism and detoxification in a non-food industrial oil crop Crambe abyssinica.

  11. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  12. An elm EST database for identifying leaf beetle egg-induced defense genes.

    Science.gov (United States)

    Büchel, Kerstin; McDowell, Eric; Nelson, Will; Descour, Anne; Gershenzon, Jonathan; Hilker, Monika; Soderlund, Carol; Gang, David R; Fenning, Trevor; Meiners, Torsten

    2012-06-15

    Plants can defend themselves against herbivorous insects prior to the onset of larval feeding by responding to the eggs laid on their leaves. In the European field elm (Ulmus minor), egg laying by the elm leaf beetle ( Xanthogaleruca luteola) activates the emission of volatiles that attract specialised egg parasitoids, which in turn kill the eggs. Little is known about the transcriptional changes that insect eggs trigger in plants and how such indirect defense mechanisms are orchestrated in the context of other biological processes. Here we present the first large scale study of egg-induced changes in the transcriptional profile of a tree. Five cDNA libraries were generated from leaves of (i) untreated control elms, and elms treated with (ii) egg laying and feeding by elm leaf beetles, (iii) feeding, (iv) artificial transfer of egg clutches, and (v) methyl jasmonate. A total of 361,196 ESTs expressed sequence tags (ESTs) were identified which clustered into 52,823 unique transcripts (Unitrans) and were stored in a database with a public web interface. Among the analyzed Unitrans, 73% could be annotated by homology to known genes in the UniProt (Plant) database, particularly to those from Vitis, Ricinus, Populus and Arabidopsis. Comparative in silico analysis among the different treatments revealed differences in Gene Ontology term abundances. Defense- and stress-related gene transcripts were present in high abundance in leaves after herbivore egg laying, but transcripts involved in photosynthesis showed decreased abundance. Many pathogen-related genes and genes involved in phytohormone signaling were expressed, indicative of jasmonic acid biosynthesis and activation of jasmonic acid responsive genes. Cross-comparisons between different libraries based on expression profiles allowed the identification of genes with a potential relevance in egg-induced defenses, as well as other biological processes, including signal transduction, transport and primary metabolism

  13. Two novel antimicrobial defensins from rice identified by gene coexpression network analyses.

    Science.gov (United States)

    Tantong, Supaluk; Pringsulaka, Onanong; Weerawanich, Kamonwan; Meeprasert, Arthitaya; Rungrotmongkol, Thanyada; Sarnthima, Rakrudee; Roytrakul, Sittiruk; Sirikantaramas, Supaart

    2016-10-01

    Defensins form an antimicrobial peptides (AMP) family, and have been widely studied in various plants because of their considerable inhibitory functions. However, their roles in rice (Oryza sativa L.) have not been characterized, even though rice is one of the most important staple crops that is susceptible to damaging infections. Additionally, a previous study identified 598 rice genes encoding cysteine-rich peptides, suggesting there are several uncharacterized AMPs in rice. We performed in silico gene expression and coexpression network analyses of all genes encoding defensin and defensin-like peptides, and determined that OsDEF7 and OsDEF8 are coexpressed with pathogen-responsive genes. Recombinant OsDEF7 and OsDEF8 could form homodimers. They inhibited the growth of the bacteria Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, and Erwinia carotovora subsp. atroseptica with minimum inhibitory concentration (MIC) ranging from 0.6 to 63μg/mL. However, these OsDEFs are weakly active against the phytopathogenic fungi Helminthosporium oryzae and Fusarium oxysporum f.sp. cubense. This study describes a useful method for identifying potential plant AMPs with biological activities. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Signal Network Analysis of Plant Genes Responding to Ionizing Radiation

    International Nuclear Information System (INIS)

    Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon

    2012-12-01

    In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication

  15. Systems approach identifies an organic nitrogen-responsive gene network that is regulated by the master clock control gene CCA1.

    Science.gov (United States)

    Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M

    2008-03-25

    Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.

  16. Phylogenomic detection and functional prediction of genes potentially important for plant meiosis.

    Science.gov (United States)

    Zhang, Luoyan; Kong, Hongzhi; Ma, Hong; Yang, Ji

    2018-02-15

    Meiosis is a specialized type of cell division necessary for sexual reproduction in eukaryotes. A better understanding of the cytological procedures of meiosis has been achieved by comprehensive cytogenetic studies in plants, while the genetic mechanisms regulating meiotic progression remain incompletely understood. The increasing accumulation of complete genome sequences and large-scale gene expression datasets has provided a powerful resource for phylogenomic inference and unsupervised identification of genes involved in plant meiosis. By integrating sequence homology and expression data, 164, 131, 124 and 162 genes potentially important for meiosis were identified in the genomes of Arabidopsis thaliana, Oryza sativa, Selaginella moellendorffii and Pogonatum aloides, respectively. The predicted genes were assigned to 45 meiotic GO terms, and their functions were related to different processes occurring during meiosis in various organisms. Most of the predicted meiotic genes underwent lineage-specific duplication events during plant evolution, with about 30% of the predicted genes retaining only a single copy in higher plant genomes. The results of this study provided clues to design experiments for better functional characterization of meiotic genes in plants, promoting the phylogenomic approach to the evolutionary dynamics of the plant meiotic machineries. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  18. An elm EST database for identifying leaf beetle egg-induced defense genes

    Directory of Open Access Journals (Sweden)

    Büchel Kerstin

    2012-06-01

    Full Text Available Abstract Background Plants can defend themselves against herbivorous insects prior to the onset of larval feeding by responding to the eggs laid on their leaves. In the European field elm (Ulmus minor, egg laying by the elm leaf beetle ( Xanthogaleruca luteola activates the emission of volatiles that attract specialised egg parasitoids, which in turn kill the eggs. Little is known about the transcriptional changes that insect eggs trigger in plants and how such indirect defense mechanisms are orchestrated in the context of other biological processes. Results Here we present the first large scale study of egg-induced changes in the transcriptional profile of a tree. Five cDNA libraries were generated from leaves of (i untreated control elms, and elms treated with (ii egg laying and feeding by elm leaf beetles, (iii feeding, (iv artificial transfer of egg clutches, and (v methyl jasmonate. A total of 361,196 ESTs expressed sequence tags (ESTs were identified which clustered into 52,823 unique transcripts (Unitrans and were stored in a database with a public web interface. Among the analyzed Unitrans, 73% could be annotated by homology to known genes in the UniProt (Plant database, particularly to those from Vitis, Ricinus, Populus and Arabidopsis. Comparative in silico analysis among the different treatments revealed differences in Gene Ontology term abundances. Defense- and stress-related gene transcripts were present in high abundance in leaves after herbivore egg laying, but transcripts involved in photosynthesis showed decreased abundance. Many pathogen-related genes and genes involved in phytohormone signaling were expressed, indicative of jasmonic acid biosynthesis and activation of jasmonic acid responsive genes. Cross-comparisons between different libraries based on expression profiles allowed the identification of genes with a potential relevance in egg-induced defenses, as well as other biological processes, including signal transduction

  19. Methylobacterium-plant interaction genes regulated by plant exudate and quorum sensing molecules

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado

    2013-12-01

    Full Text Available Bacteria from the genus Methylobacterium interact symbiotically (endophytically and epiphytically with different plant species. These interactions can promote plant growth or induce systemic resistance, increasing plant fitness. The plant colonization is guided by molecular communication between bacteria-bacteria and bacteria-plants, where the bacteria recognize specific exuded compounds by other bacteria (e.g. homoserine molecules and/or by the plant roots (e.g. flavonoids, ethanol and methanol, respectively. In this context, the aim of this study was to evaluate the effect of quorum sensing molecules (N-acyl-homoserine lactones and plant exudates (including ethanol in the expression of a series of bacterial genes involved in Methylobacterium-plant interaction. The selected genes are related to bacterial metabolism (mxaF, adaptation to stressful environment (crtI, phoU and sss, to interactions with plant metabolism compounds (acdS and pathogenicity (patatin and phoU. Under in vitro conditions, our results showed the differential expression of some important genes related to metabolism, stress and pathogenesis, thereby AHL molecules up-regulate all tested genes, except phoU, while plant exudates induce only mxaF gene expression. In the presence of plant exudates there is a lower bacterial density (due the endophytic and epiphytic colonization, which produce less AHL, leading to down regulation of genes when compared to the control. Therefore, bacterial density, more than plant exudate, influences the expression of genes related to plant-bacteria interaction.

  20. Rice Transcriptome Analysis to Identify Possible Herbicide Quinclorac Detoxification Genes

    Directory of Open Access Journals (Sweden)

    Wenying eXu

    2015-09-01

    Full Text Available Quinclorac is a highly selective auxin-type herbicide, and is widely used in the effective control of barnyard grass in paddy rice fields, improving the world’s rice yield. The herbicide mode of action of quinclorac has been proposed and hormone interactions affect quinclorac signaling. Because of widespread use, quinclorac may be transported outside rice fields with the drainage waters, leading to soil and water pollution and environmental health problems.In this study, we used 57K Affymetrix rice whole-genome array to identify quinclorac signaling response genes to study the molecular mechanisms of action and detoxification of quinclorac in rice plants. Overall, 637 probe sets were identified with differential expression levels under either 6 or 24 h of quinclorac treatment. Auxin-related genes such as GH3 and OsIAAs responded to quinclorac treatment. Gene Ontology analysis showed that genes of detoxification-related family genes were significantly enriched, including cytochrome P450, GST, UGT, and ABC and drug transporter genes. Moreover, real-time RT-PCR analysis showed that top candidate P450 families such as CYP81, CYP709C and CYP72A genes were universally induced by different herbicides. Some Arabidopsis genes for the same P450 family were up-regulated under quinclorac treatment.We conduct rice whole-genome GeneChip analysis and the first global identification of quinclorac response genes. This work may provide potential markers for detoxification of quinclorac and biomonitors of environmental chemical pollution.

  1. Transcriptome Profiling to Identify Genes Involved in Mesosulfuron-Methyl Resistance in Alopecurus aequalis

    Directory of Open Access Journals (Sweden)

    Ning Zhao

    2017-08-01

    Full Text Available Non-target-site resistance (NTSR to herbicides is a worldwide concern for weed control. However, as the dominant NTSR mechanism in weeds, metabolic resistance is not yet well-characterized at the genetic level. For this study, we have identified a shortawn foxtail (Alopecurus aequalis Sobol. population displaying both TSR and NTSR to mesosulfuron-methyl and fenoxaprop-P-ethyl, yet the molecular basis for this NTSR remains unclear. To investigate the mechanisms of metabolic resistance, an RNA-Seq transcriptome analysis was used to find candidate genes that may confer metabolic resistance to the herbicide mesosulfuron-methyl in this plant population. The RNA-Seq libraries generated 831,846,736 clean reads. The de novo transcriptome assembly yielded 95,479 unigenes (averaging 944 bp in length that were assigned putative annotations. Among these, a total of 29,889 unigenes were assigned to 67 GO terms that contained three main categories, and 14,246 unigenes assigned to 32 predicted KEGG metabolic pathways. Global gene expression was measured using the reads generated from the untreated control (CK, water-only control (WCK, and mesosulfuron-methyl treatment (T of R and susceptible (S. Contigs that showed expression differences between mesosulfuron-methyl-treated R and S biotypes, and between mesosulfuron-methyl-treated, water-treated and untreated R plants were selected for further quantitative real-time PCR (qRT-PCR validation analyses. Seventeen contigs were consistently highly expressed in the resistant A. aequalis plants, including four cytochrome P450 monooxygenase (CytP450 genes, two glutathione S-transferase (GST genes, two glucosyltransferase (GT genes, two ATP-binding cassette (ABC transporter genes, and seven additional contigs with functional annotations related to oxidation, hydrolysis, and plant stress physiology. These 17 contigs could serve as major candidate genes for contributing to metabolic mesosulfuron-methyl resistance; hence

  2. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  3. Use of model plant hosts to identify Pseudomonas aeruginosa virulence factors

    Science.gov (United States)

    Rahme, Laurence G.; Tan, Man-Wah; Le, Long; Wong, Sandy M.; Tompkins, Ronald G.; Calderwood, Stephen B.; Ausubel, Frederick M.

    1997-01-01

    We used plants as an in vivo pathogenesis model for the identification of virulence factors of the human opportunistic pathogen Pseudomonas aeruginosa. Nine of nine TnphoA mutant derivatives of P. aeruginosa strain UCBPP-PA14 that were identified in a plant leaf assay for less pathogenic mutants also exhibited significantly reduced pathogenicity in a burned mouse pathogenicity model, suggesting that P. aeruginosa utilizes common strategies to infect both hosts. Seven of these nine mutants contain TnphoA insertions in previously unknown genes. These results demonstrate that an alternative nonvertebrate host of a human bacterial pathogen can be used in an in vivo high throughput screen to identify novel bacterial virulence factors involved in mammalian pathogenesis. PMID:9371831

  4. Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.

    Science.gov (United States)

    Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella

    2017-10-01

    Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Phylogenomic analysis demonstrates a pattern of rare and ancient horizontal gene transfer between plants and fungi.

    Science.gov (United States)

    Richards, Thomas A; Soanes, Darren M; Foster, Peter G; Leonard, Guy; Thornton, Christopher R; Talbot, Nicholas J

    2009-07-01

    Horizontal gene transfer (HGT) describes the transmission of genetic material across species boundaries and is an important evolutionary phenomenon in the ancestry of many microbes. The role of HGT in plant evolutionary history is, however, largely unexplored. Here, we compare the genomes of six plant species with those of 159 prokaryotic and eukaryotic species and identify 1689 genes that show the highest similarity to corresponding genes from fungi. We constructed a phylogeny for all 1689 genes identified and all homolog groups available from the rice (Oryza sativa) genome (3177 gene families) and used these to define 14 candidate plant-fungi HGT events. Comprehensive phylogenetic analyses of these 14 data sets, using methods that account for site rate heterogeneity, demonstrated support for nine HGT events, demonstrating an infrequent pattern of HGT between plants and fungi. Five HGTs were fungi-to-plant transfers and four were plant-to-fungi HGTs. None of the fungal-to-plant HGTs involved angiosperm recipients. These results alter the current view of organismal barriers to HGT, suggesting that phagotrophy, the consumption of a whole cell by another, is not necessarily a prerequisite for HGT between eukaryotes. Putative functional annotation of the HGT candidate genes suggests that two fungi-to-plant transfers have added phenotypes important for life in a soil environment. Our study suggests that genetic exchange between plants and fungi is exceedingly rare, particularly among the angiosperms, but has occurred during their evolutionary history and added important metabolic traits to plant lineages.

  6. JGI Plant Genomics Gene Annotation Pipeline

    Energy Technology Data Exchange (ETDEWEB)

    Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese

    2014-07-14

    Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.

  7. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Science.gov (United States)

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  8. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Directory of Open Access Journals (Sweden)

    Aaron E Walworth

    Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of

  9. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

    Science.gov (United States)

    Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

  10. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    Science.gov (United States)

    Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Sokolova (Guzeeva), Elena; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T.

    2017-01-01

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum. PMID:29065523

  11. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes.

    Science.gov (United States)

    Danchin, Etienne G J; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Guzeeva, Elena Sokolova; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T; den Akker, Sebastian Eves-van

    2017-10-23

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus , representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus , respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

  12. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    Directory of Open Access Journals (Sweden)

    Etienne G.J. Danchin

    2017-10-01

    Full Text Available Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

  13. Plants, genes and justice : an inquiry into fair and equitable benefit-sharing

    NARCIS (Netherlands)

    Jonge, de B.

    2009-01-01

    Since the advent of biotechnology, plant genetic resources have become more valuable as possible sources for new products and inventions. With knowledge about the genetic make-up and functioning of a plant, biotechnologists can identify and isolate genes with interesting traits which, after long

  14. NIH Researchers Identify OCD Risk Gene

    Science.gov (United States)

    ... News From NIH NIH Researchers Identify OCD Risk Gene Past Issues / Summer 2006 Table of Contents For ... and Alcoholism (NIAAA) have identified a previously unknown gene variant that doubles an individual's risk for obsessive- ...

  15. The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys

    Directory of Open Access Journals (Sweden)

    Anna V. Shchennikova

    2018-01-01

    Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.

  16. Lactococcus lactis Metabolism and Gene Expression during Growth on Plant Tissues

    Science.gov (United States)

    Golomb, Benjamin L.

    2014-01-01

    Lactic acid bacteria have been isolated from living, harvested, and fermented plant materials; however, the adaptations these bacteria possess for growth on plant tissues are largely unknown. In this study, we investigated plant habitat-specific traits of Lactococcus lactis during growth in an Arabidopsis thaliana leaf tissue lysate (ATL). L. lactis KF147, a strain originally isolated from plants, exhibited a higher growth rate and reached 7.9-fold-greater cell densities during growth in ATL than the dairy-associated strain L. lactis IL1403. Transcriptome profiling (RNA-seq) of KF147 identified 853 induced and 264 repressed genes during growth in ATL compared to that in GM17 laboratory culture medium. Genes induced in ATL included those involved in the arginine deiminase pathway and a total of 140 carbohydrate transport and metabolism genes, many of which are involved in xylose, arabinose, cellobiose, and hemicellulose metabolism. The induction of those genes corresponded with L. lactis KF147 nutrient consumption and production of metabolic end products in ATL as measured by gas chromatography-time of flight mass spectrometry (GC-TOF/MS) untargeted metabolomic profiling. To assess the importance of specific plant-inducible genes for L. lactis growth in ATL, xylose metabolism was targeted for gene knockout mutagenesis. Wild-type L. lactis strain KF147 but not an xylA deletion mutant was able to grow using xylose as the sole carbon source. However, both strains grew to similarly high levels in ATL, indicating redundancy in L. lactis carbohydrate metabolism on plant tissues. These findings show that certain strains of L. lactis are well adapted for growth on plants and possess specific traits relevant for plant-based food, fuel, and feed fermentations. PMID:25384484

  17. Major intrinsic proteins (MIPs) in plants: a complex gene family with major impacts on plant phenotype.

    Science.gov (United States)

    Forrest, Kerrie L; Bhave, Mrinal

    2007-10-01

    The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry.

  18. Domestication of transposable elements into MicroRNA genes in plants.

    Directory of Open Access Journals (Sweden)

    Yang Li

    Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.

  19. MADS goes genomic in conifers: towards determining the ancestral set of MADS-box genes in seed plants.

    Science.gov (United States)

    Gramzow, Lydia; Weilandt, Lisa; Theißen, Günter

    2014-11-01

    MADS-box genes comprise a gene family coding for transcription factors. This gene family expanded greatly during land plant evolution such that the number of MADS-box genes ranges from one or two in green algae to around 100 in angiosperms. Given the crucial functions of MADS-box genes for nearly all aspects of plant development, the expansion of this gene family probably contributed to the increasing complexity of plants. However, the expansion of MADS-box genes during one important step of land plant evolution, namely the origin of seed plants, remains poorly understood due to the previous lack of whole-genome data for gymnosperms. The newly available genome sequences of Picea abies, Picea glauca and Pinus taeda were used to identify the complete set of MADS-box genes in these conifers. In addition, MADS-box genes were identified in the growing number of transcriptomes available for gymnosperms. With these datasets, phylogenies were constructed to determine the ancestral set of MADS-box genes of seed plants and to infer the ancestral functions of these genes. Type I MADS-box genes are under-represented in gymnosperms and only a minimum of two Type I MADS-box genes have been present in the most recent common ancestor (MRCA) of seed plants. In contrast, a large number of Type II MADS-box genes were found in gymnosperms. The MRCA of extant seed plants probably possessed at least 11-14 Type II MADS-box genes. In gymnosperms two duplications of Type II MADS-box genes were found, such that the MRCA of extant gymnosperms had at least 14-16 Type II MADS-box genes. The implied ancestral set of MADS-box genes for seed plants shows simplicity for Type I MADS-box genes and remarkable complexity for Type II MADS-box genes in terms of phylogeny and putative functions. The analysis of transcriptome data reveals that gymnosperm MADS-box genes are expressed in a great variety of tissues, indicating diverse roles of MADS-box genes for the development of gymnosperms. This study is

  20. The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses

    Directory of Open Access Journals (Sweden)

    Yuling Bai

    2018-06-01

    Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.

  1. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  2. Plant gene technology: social considerations

    African Journals Online (AJOL)

    Administrator

    The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

  3. Identifying Virulence-Associated Genes Using Transcriptomic and Proteomic Association Analyses of the Plant Parasitic Nematode Bursaphelenchus mucronatus

    Directory of Open Access Journals (Sweden)

    Lifeng Zhou

    2016-09-01

    Full Text Available Bursaphelenchus mucronatus (B. mucronatus isolates that originate from different regions may vary in their virulence, but their virulence-associated genes and proteins are poorly understood. Thus, we conducted an integrated study coupling RNA-Seq and isobaric tags for relative and absolute quantitation (iTRAQ to analyse transcriptomic and proteomic data of highly and weakly virulent B. mucronatus isolates during the pathogenic processes. Approximately 40,000 annotated unigenes and 5000 proteins were gained from the isolates. When we matched all of the proteins with their detected transcripts, a low correlation coefficient of r = 0.138 was found, indicating probable post-transcriptional gene regulation involved in the pathogenic processes. A functional analysis showed that five differentially expressed proteins which were all highly expressed in the highly virulent isolate were involved in the pathogenic processes of nematodes. Peroxiredoxin, fatty acid- and retinol-binding protein, and glutathione peroxidase relate to resistance against plant defence responses, while β-1,4-endoglucanase and expansin are associated with the breakdown of plant cell walls. Thus, the pathogenesis of B. mucronatus depends on its successful survival in host plants. Our work adds to the understanding of B. mucronatus’ pathogenesis, and will aid in controlling B. mucronatus and other pinewood nematode species complexes in the future.

  4. Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants

    Science.gov (United States)

    Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.

    2005-04-01

    This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.

  5. Gene-based Association Approach Identify Genes Across Stress Traits in Fruit Flies

    DEFF Research Database (Denmark)

    Rohde, Palle Duun; Edwards, Stefan McKinnon; Sarup, Pernille Merete

    Identification of genes explaining variation in quantitative traits or genetic risk factors of human diseases requires both good phenotypic- and genotypic data, but also efficient statistical methods. Genome-wide association studies may reveal association between phenotypic variation and variation...... approach grouping variants accordingly to gene position, thus lowering the number of statistical tests performed and increasing the probability of identifying genes with small to moderate effects. Using this approach we identify numerous genes associated with different types of stresses in Drosophila...... melanogaster, but also identify common genes that affects the stress traits....

  6. Gene expression in mycorrhizal orchid protocorms suggests a friendly plant-fungus relationship.

    Science.gov (United States)

    Perotto, Silvia; Rodda, Marco; Benetti, Alex; Sillo, Fabiano; Ercole, Enrico; Rodda, Michele; Girlanda, Mariangela; Murat, Claude; Balestrini, Raffaella

    2014-06-01

    Orchids fully depend on symbiotic interactions with specific soil fungi for seed germination and early development. Germinated seeds give rise to a protocorm, a heterotrophic organ that acquires nutrients, including organic carbon, from the mycorrhizal partner. It has long been debated if this interaction is mutualistic or antagonistic. To investigate the molecular bases of the orchid response to mycorrhizal invasion, we developed a symbiotic in vitro system between Serapias vomeracea, a Mediterranean green meadow orchid, and the rhizoctonia-like fungus Tulasnella calospora. 454 pyrosequencing was used to generate an inventory of plant and fungal genes expressed in mycorrhizal protocorms, and plant genes could be reliably identified with a customized bioinformatic pipeline. A small panel of plant genes was selected and expression was assessed by real-time quantitative PCR in mycorrhizal and non-mycorrhizal protocorm tissues. Among these genes were some markers of mutualistic (e.g. nodulins) as well as antagonistic (e.g. pathogenesis-related and wound/stress-induced) genes. None of the pathogenesis or wound/stress-related genes were significantly up-regulated in mycorrhizal tissues, suggesting that fungal colonization does not trigger strong plant defence responses. In addition, the highest expression fold change in mycorrhizal tissues was found for a nodulin-like gene similar to the plastocyanin domain-containing ENOD55. Another nodulin-like gene significantly more expressed in the symbiotic tissues of mycorrhizal protocorms was similar to a sugar transporter of the SWEET family. Two genes coding for mannose-binding lectins were significantly up-regulated in the presence of the mycorrhizal fungus, but their role in the symbiosis is unclear.

  7. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  8. New insights on the evolution of Leafy cotyledon1 (LEC1) type genes in vascular plants.

    Science.gov (United States)

    Cagliari, Alexandro; Turchetto-Zolet, Andreia Carina; Korbes, Ana Paula; Maraschin, Felipe Dos Santos; Margis, Rogerio; Margis-Pinheiro, Marcia

    2014-01-01

    NF-Y is a conserved oligomeric transcription factor found in all eukaryotes. In plants, this regulator evolved with a broad diversification of the genes coding for its three subunits (NF-YA, NF-YB and NF-YC). The NF-YB members can be divided into Leafy Cotyledon1 (LEC1) and non-LEC1 types. Here we presented a comparative genomic study using phylogenetic analyses to validate an evolutionary model for the origin of LEC-type genes in plants and their emergence from non-LEC1-type genes. We identified LEC1-type members in all vascular plant genomes, but not in amoebozoa, algae, fungi, metazoa and non-vascular plant representatives, which present exclusively non-LEC1-type genes as constituents of their NF-YB subunits. The non-synonymous to synonymous nucleotide substitution rates (Ka/Ks) between LEC1 and non-LEC1-type genes indicate the presence of positive selection acting on LEC1-type members to the fixation of LEC1-specific amino acid residues. The phylogenetic analyses demonstrated that plant LEC1-type genes are evolutionary divergent from the non-LEC1-type genes of plants, fungi, amoebozoa, algae and animals. Our results point to a scenario in which LEC1-type genes have originated in vascular plants after gene expansion in plants. We suggest that processes of neofunctionalization and/or subfunctionalization were responsible for the emergence of a versatile role for LEC1-type genes in vascular plants, especially in seed plants. LEC1-type genes besides being phylogenetic divergent also present different expression profile when compared with non-LEC1-type genes. Altogether, our data provide new insights about the LEC1 and non-LEC1 evolutionary relationship during the vascular plant evolution. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Phylogenomic analysis of UDP glycosyltransferase 1 multigene family in Linum usitatissimum identified genes with varied expression patterns

    Science.gov (United States)

    2012-01-01

    Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that

  10. Phylogenomic analysis of UDP glycosyltransferase 1 multigene family in Linum usitatissimum identified genes with varied expression patterns

    Directory of Open Access Journals (Sweden)

    Barvkar Vitthal T

    2012-05-01

    Full Text Available Abstract Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L. is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N. Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST, microarray data and reverse transcription quantitative real time PCR (RT-qPCR. Seventy-three per cent of these genes (100 out of 137 showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot

  11. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea.

    Science.gov (United States)

    Nakahara, Yoshiki; Sawabe, Shogo; Kainuma, Kenta; Katsuhara, Maki; Shibasaka, Mineo; Suzuki, Masanori; Yamamoto, Kosuke; Oguri, Suguru; Sakamoto, Hikaru

    2015-01-01

    Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1) a novel protein highly homologous to thaumatin-like proteins, (2) a novel coiled-coil protein of unknown function, and (3) a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  12. Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

    Directory of Open Access Journals (Sweden)

    Yoshiki eNakahara

    2015-10-01

    Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

  13. Use of NAP gene to manipulate leaf senescence in plants

    Science.gov (United States)

    Gan, Susheng; Guo, Yongfeng

    2013-04-16

    The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.

  14. Global transcriptome analysis reveals extensive gene remodeling, alternative splicing and differential transcription profiles in non-seed vascular plant Selaginella moellendorffii.

    Science.gov (United States)

    Zhu, Yan; Chen, Longxian; Zhang, Chengjun; Hao, Pei; Jing, Xinyun; Li, Xuan

    2017-01-25

    Selaginella moellendorffii, a lycophyte, is a model plant to study the early evolution and development of vascular plants. As the first and only sequenced lycophyte to date, the genome of S. moellendorffii revealed many conserved genes and pathways, as well as specialized genes different from flowering plants. Despite the progress made, little is known about long noncoding RNAs (lncRNA) and the alternative splicing (AS) of coding genes in S. moellendorffii. Its coding gene models have not been fully validated with transcriptome data. Furthermore, it remains important to understand whether the regulatory mechanisms similar to flowering plants are used, and how they operate in a non-seed primitive vascular plant. RNA-sequencing (RNA-seq) was performed for three S. moellendorffii tissues, root, stem, and leaf, by constructing strand-specific RNA-seq libraries from RNA purified using RiboMinus isolation protocol. A total of 176 million reads (44 Gbp) were obtained from three tissue types, and were mapped to S. moellendorffii genome. By comparing with 22,285 existing gene models of S. moellendorffii, we identified 7930 high-confidence novel coding genes (a 35.6% increase), and for the first time reported 4422 lncRNAs in a lycophyte. Further, we refined 2461 (11.0%) of existing gene models, and identified 11,030 AS events (for 5957 coding genes) revealed for the first time for lycophytes. Tissue-specific gene expression with functional implication was analyzed, and 1031, 554, and 269 coding genes, and 174, 39, and 17 lncRNAs were identified in root, stem, and leaf tissues, respectively. The expression of critical genes for vascular development stages, i.e. formation of provascular cells, xylem specification and differentiation, and phloem specification and differentiation, was compared in S. moellendorffii tissues, indicating a less complex regulatory mechanism in lycophytes than in flowering plants. The results were further strengthened by the evolutionary trend of

  15. Diversification of Root Hair Development Genes in Vascular Plants.

    Science.gov (United States)

    Huang, Ling; Shi, Xinhui; Wang, Wenjia; Ryu, Kook Hui; Schiefelbein, John

    2017-07-01

    The molecular genetic program for root hair development has been studied intensively in Arabidopsis ( Arabidopsis thaliana ). To understand the extent to which this program might operate in other plants, we conducted a large-scale comparative analysis of root hair development genes from diverse vascular plants, including eudicots, monocots, and a lycophyte. Combining phylogenetics and transcriptomics, we discovered conservation of a core set of root hair genes across all vascular plants, which may derive from an ancient program for unidirectional cell growth coopted for root hair development during vascular plant evolution. Interestingly, we also discovered preferential diversification in the structure and expression of root hair development genes, relative to other root hair- and root-expressed genes, among these species. These differences enabled the definition of sets of genes and gene functions that were acquired or lost in specific lineages during vascular plant evolution. In particular, we found substantial divergence in the structure and expression of genes used for root hair patterning, suggesting that the Arabidopsis transcriptional regulatory mechanism is not shared by other species. To our knowledge, this study provides the first comprehensive view of gene expression in a single plant cell type across multiple species. © 2017 American Society of Plant Biologists. All Rights Reserved.

  16. Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

    Science.gov (United States)

    Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

    2017-09-30

    Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

  17. Expression profiling identifies genes involved in emphysema severity

    Directory of Open Access Journals (Sweden)

    Bowman Rayleen V

    2009-09-01

    Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a major public health problem. The aim of this study was to identify genes involved in emphysema severity in COPD patients. Gene expression profiling was performed on total RNA extracted from non-tumor lung tissue from 30 smokers with emphysema. Class comparison analysis based on gas transfer measurement was performed to identify differentially expressed genes. Genes were then selected for technical validation by quantitative reverse transcriptase-PCR (qRT-PCR if also represented on microarray platforms used in previously published emphysema studies. Genes technically validated advanced to tests of biological replication by qRT-PCR using an independent test set of 62 lung samples. Class comparison identified 98 differentially expressed genes (p p Gene expression profiling of lung from emphysema patients identified seven candidate genes associated with emphysema severity including COL6A3, SERPINF1, ZNHIT6, NEDD4, CDKN2A, NRN1 and GSTM3.

  18. Expression profiling of Crambe abyssinica under arsenate stress identifies genes and gene networks involved in arsenic metabolism and detoxification

    Directory of Open Access Journals (Sweden)

    Kandasamy Suganthi

    2010-06-01

    Full Text Available Abstract Background Arsenic contamination is widespread throughout the world and this toxic metalloid is known to cause cancers of organs such as liver, kidney, skin, and lung in human. In spite of a recent surge in arsenic related studies, we are still far from a comprehensive understanding of arsenic uptake, detoxification, and sequestration in plants. Crambe abyssinica, commonly known as 'abyssinian mustard', is a non-food, high biomass oil seed crop that is naturally tolerant to heavy metals. Moreover, it accumulates significantly higher levels of arsenic as compared to other species of the Brassicaceae family. Thus, C. abyssinica has great potential to be utilized as an ideal inedible crop for phytoremediation of heavy metals and metalloids. However, the mechanism of arsenic metabolism in higher plants, including C. abyssinica, remains elusive. Results To identify the differentially expressed transcripts and the pathways involved in arsenic metabolism and detoxification, C. abyssinica plants were subjected to arsenate stress and a PCR-Select Suppression Subtraction Hybridization (SSH approach was employed. A total of 105 differentially expressed subtracted cDNAs were sequenced which were found to represent 38 genes. Those genes encode proteins functioning as antioxidants, metal transporters, reductases, enzymes involved in the protein degradation pathway, and several novel uncharacterized proteins. The transcripts corresponding to the subtracted cDNAs showed strong upregulation by arsenate stress as confirmed by the semi-quantitative RT-PCR. Conclusions Our study revealed novel insights into the plant defense mechanisms and the regulation of genes and gene networks in response to arsenate toxicity. The differential expression of transcripts encoding glutathione-S-transferases, antioxidants, sulfur metabolism, heat-shock proteins, metal transporters, and enzymes in the ubiquitination pathway of protein degradation as well as several unknown

  19. Expression profiling of Crambe abyssinica under arsenate stress identifies genes and gene networks involved in arsenic metabolism and detoxification

    Science.gov (United States)

    2010-01-01

    Background Arsenic contamination is widespread throughout the world and this toxic metalloid is known to cause cancers of organs such as liver, kidney, skin, and lung in human. In spite of a recent surge in arsenic related studies, we are still far from a comprehensive understanding of arsenic uptake, detoxification, and sequestration in plants. Crambe abyssinica, commonly known as 'abyssinian mustard', is a non-food, high biomass oil seed crop that is naturally tolerant to heavy metals. Moreover, it accumulates significantly higher levels of arsenic as compared to other species of the Brassicaceae family. Thus, C. abyssinica has great potential to be utilized as an ideal inedible crop for phytoremediation of heavy metals and metalloids. However, the mechanism of arsenic metabolism in higher plants, including C. abyssinica, remains elusive. Results To identify the differentially expressed transcripts and the pathways involved in arsenic metabolism and detoxification, C. abyssinica plants were subjected to arsenate stress and a PCR-Select Suppression Subtraction Hybridization (SSH) approach was employed. A total of 105 differentially expressed subtracted cDNAs were sequenced which were found to represent 38 genes. Those genes encode proteins functioning as antioxidants, metal transporters, reductases, enzymes involved in the protein degradation pathway, and several novel uncharacterized proteins. The transcripts corresponding to the subtracted cDNAs showed strong upregulation by arsenate stress as confirmed by the semi-quantitative RT-PCR. Conclusions Our study revealed novel insights into the plant defense mechanisms and the regulation of genes and gene networks in response to arsenate toxicity. The differential expression of transcripts encoding glutathione-S-transferases, antioxidants, sulfur metabolism, heat-shock proteins, metal transporters, and enzymes in the ubiquitination pathway of protein degradation as well as several unknown novel proteins serve as

  20. Elucidating gene function and function evolution through comparison of co-expression networks in plants

    Directory of Open Access Journals (Sweden)

    Marek eMutwil

    2014-08-01

    Full Text Available The analysis of gene expression data has shown that transcriptionally coordinated (co-expressed genes are often functionally related, enabling scientists to use expression data in gene function prediction. This Focused Review discusses our original paper (Large-scale co-expression approach to dissect secondary cell wall formation across plant species, Frontiers in Plant Science 2:23. In this paper we applied cross-species analysis to co-expression networks of genes involved in cellulose biosynthesis. We show that the co-expression networks from different species are highly similar, indicating that whole biological pathways are conserved across species. This finding has two important implications. First, the analysis can transfer gene function annotation from well-studied plants, such as Arabidopsis, to other, uncharacterized plant species. As the analysis finds genes that have similar sequence and similar expression pattern across different organisms, functionally equivalent genes can be identified. Second, since co-expression analyses are often noisy, a comparative analysis should have higher performance, as parts of co-expression networks that are conserved are more likely to be functionally relevant. In this Focused Review, we outline the comparative analysis done in the original paper and comment on the recent advances and approaches that allow comparative analyses of co-function networks. We hypothesize that, in comparison to simple co-expression analysis, comparative analysis would yield more accurate gene function predictions. Finally, by combining comparative analysis with genomic information of green plants, we propose a possible composition of cellulose biosynthesis machinery during earlier stages of plant evolution.

  1. Actin gene identification from selected medicinal plants for their use as internal controls for gene expression studies

    International Nuclear Information System (INIS)

    Mufti, F.U.D.; Banaras, S.

    2015-01-01

    Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)

  2. Coordinations between gene modules control the operation of plant amino acid metabolic networks

    Directory of Open Access Journals (Sweden)

    Galili Gad

    2009-01-01

    Full Text Available Abstract Background Being sessile organisms, plants should adjust their metabolism to dynamic changes in their environment. Such adjustments need particular coordination in branched metabolic networks in which a given metabolite can be converted into multiple other metabolites via different enzymatic chains. In the present report, we developed a novel "Gene Coordination" bioinformatics approach and use it to elucidate adjustable transcriptional interactions of two branched amino acid metabolic networks in plants in response to environmental stresses, using publicly available microarray results. Results Using our "Gene Coordination" approach, we have identified in Arabidopsis plants two oppositely regulated groups of "highly coordinated" genes within the branched Asp-family network of Arabidopsis plants, which metabolizes the amino acids Lys, Met, Thr, Ile and Gly, as well as a single group of "highly coordinated" genes within the branched aromatic amino acid metabolic network, which metabolizes the amino acids Trp, Phe and Tyr. These genes possess highly coordinated adjustable negative and positive expression responses to various stress cues, which apparently regulate adjustable metabolic shifts between competing branches of these networks. We also provide evidence implying that these highly coordinated genes are central to impose intra- and inter-network interactions between the Asp-family and aromatic amino acid metabolic networks as well as differential system interactions with other growth promoting and stress-associated genome-wide genes. Conclusion Our novel Gene Coordination elucidates that branched amino acid metabolic networks in plants are regulated by specific groups of highly coordinated genes that possess adjustable intra-network, inter-network and genome-wide transcriptional interactions. We also hypothesize that such transcriptional interactions enable regulatory metabolic adjustments needed for adaptation to the stresses.

  3. Genome Wide Association Mapping in Arabidopsis thaliana Identifies Novel Genes Involved in Linking Allyl Glucosinolate to Altered Biomass and Defense.

    Science.gov (United States)

    Francisco, Marta; Joseph, Bindu; Caligagan, Hart; Li, Baohua; Corwin, Jason A; Lin, Catherine; Kerwin, Rachel E; Burow, Meike; Kliebenstein, Daniel J

    2016-01-01

    A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS) have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL), may provide direct feedback regulation, linking defense metabolism outputs to the growth, and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s) that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 μM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  4. Genome wide association mapping in Arabidopsis thaliana identifies novel genes involved in linking allyl glucosinolate to altered biomass and defense

    Directory of Open Access Journals (Sweden)

    Marta Francisco

    2016-07-01

    Full Text Available A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL, may provide direct feedback regulation, linking defense metabolism outputs to the growth and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 µM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  5. Transfer of engineered genes from crop to wild plants

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.

    1996-01-01

    The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...

  6. Expression of streptavidin gene in bacteria and plants

    International Nuclear Information System (INIS)

    Guan, Xueni; Wurtele, E.S.; Nikolau, B.J.

    1990-01-01

    Six biotin-containing proteins are present in plants, representing at least four different biotin enzymes. The physiological function of these biotin enzymes is not understood. Streptavidin, a protein from Streptomyces avidinii, binds tightly and specifically to biotin causing inactivation of biotin enzymes. One approach to elucidating the physiological function of biotin enzymes in plant metabolism is to create transgenic plants expressing the streptavidin gene. A plasmid containing a fused streptavidin-beta-galactosidase gene has been expressed in E. coli. We also have constructed various fusion genes that include an altered CaMV 35S promoter, signal peptides to target the streptavidin protein to specific organelles, and the streptavidin coding gene. We are examining the expression of these genes in cells of carrot

  7. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  8. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  9. Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

    Directory of Open Access Journals (Sweden)

    Victor M. Bii

    2016-10-01

    Full Text Available Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types.

  10. Emerging use of gene expression microarrays in plant physiology.

    Science.gov (United States)

    Wullschleger, Stan D; Difazio, Stephen P

    2003-01-01

    Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.

  11. Testing the Efficacy of DNA Barcodes for Identifying the Vascular Plants of Canada.

    Science.gov (United States)

    Braukmann, Thomas W A; Kuzmina, Maria L; Sills, Jesse; Zakharov, Evgeny V; Hebert, Paul D N

    2017-01-01

    Their relatively slow rates of molecular evolution, as well as frequent exposure to hybridization and introgression, often make it difficult to discriminate species of vascular plants with the standard barcode markers (rbcL, matK, ITS2). Previous studies have examined these constraints in narrow geographic or taxonomic contexts, but the present investigation expands analysis to consider the performance of these gene regions in discriminating the species in local floras at sites across Canada. To test identification success, we employed a DNA barcode reference library with sequence records for 96% of the 5108 vascular plant species known from Canada, but coverage varied from 94% for rbcL to 60% for ITS2 and 39% for matK. Using plant lists from 27 national parks and one scientific reserve, we tested the efficacy of DNA barcodes in identifying the plants in simulated species assemblages from six biogeographic regions of Canada using BLAST and mothur. Mean pairwise distance (MPD) and mean nearest taxon distance (MNTD) were strong predictors of barcode performance for different plant families and genera, and both metrics supported ITS2 as possessing the highest genetic diversity. All three genes performed strongly in assigning the taxa present in local floras to the correct genus with values ranging from 91% for rbcL to 97% for ITS2 and 98% for matK. However, matK delivered the highest species discrimination (~81%) followed by ITS2 (~72%) and rbcL (~44%). Despite the low number of plant taxa in the Canadian Arctic, DNA barcodes had the least success in discriminating species from this biogeographic region with resolution ranging from 36% with rbcL to 69% with matK. Species resolution was higher in the other settings, peaking in the Woodland region at 52% for rbcL and 87% for matK. Our results indicate that DNA barcoding is very effective in identifying Canadian plants to a genus, and that it performs well in discriminating species in regions where floristic diversity is

  12. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  13. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  14. Identification and Evaluation of Reliable Reference Genes for Quantitative Real-Time PCR Analysis in Tea Plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Hao, Xinyuan; Horvath, David P.; Chao, Wun S.; Yang, Yajun; Wang, Xinchao; Xiao, Bin

    2014-01-01

    Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a crucial step in qRT-PCR normalization. To date, only a few housekeeping genes have been identified and used as reference genes in tea plant. The validity of those reference genes are not clear since their expression stabilities have not been rigorously examined. To identify more appropriate reference genes for qRT-PCR studies on tea plant, we examined the expression stability of 11 candidate reference genes from three different sources: the orthologs of Arabidopsis traditional reference genes and stably expressed genes identified from whole-genome GeneChip studies, together with three housekeeping gene commonly used in tea plant research. We evaluated the transcript levels of these genes in 94 experimental samples. The expression stabilities of these 11 genes were ranked using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ∆CT method. Results showed that the three commonly used housekeeping genes of CsTUBULIN1, CsACINT1 and Cs18S rRNA1 together with CsUBQ1 were the most unstable genes in all sample ranking order. However, CsPTB1, CsEF1, CsSAND1, CsCLATHRIN1 and CsUBC1 were the top five appropriate reference genes for qRT-PCR analysis in complex experimental conditions. PMID:25474086

  15. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life

    Directory of Open Access Journals (Sweden)

    Reusch Thorsten BH

    2011-01-01

    Full Text Available Abstract Background Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L. Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. Results In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. Conclusions These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  16. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life.

    Science.gov (United States)

    Wissler, Lothar; Codoñer, Francisco M; Gu, Jenny; Reusch, Thorsten B H; Olsen, Jeanine L; Procaccini, Gabriele; Bornberg-Bauer, Erich

    2011-01-12

    Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs) of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L.) Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica) and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  17. Emerging Use of Gene Expression Microarrays in Plant Physiology

    Directory of Open Access Journals (Sweden)

    Stephen P. Difazio

    2006-04-01

    Full Text Available Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.

  18. Evolution of endogenous non-retroviral genes integrated into plant genomes

    Directory of Open Access Journals (Sweden)

    Hyosub Chu

    2014-08-01

    Full Text Available Numerous comparative genome analyses have revealed the wide extent of horizontal gene transfer (HGT in living organisms, which contributes to their evolution and genetic diversity. Viruses play important roles in HGT. Endogenous viral elements (EVEs are defined as viral DNA sequences present within the genomes of non-viral organisms. In eukaryotic cells, the majority of EVEs are derived from RNA viruses using reverse transcription. In contrast, endogenous non-retroviral elements (ENREs are poorly studied. However, the increasing availability of genomic data and the rapid development of bioinformatics tools have enabled the identification of several ENREs in various eukaryotic organisms. To date, a small number of ENREs integrated into plant genomes have been identified. Of the known non-retroviruses, most identified ENREs are derived from double-strand (ds RNA viruses, followed by single-strand (ss DNA and ssRNA viruses. At least eight virus families have been identified. Of these, viruses in the family Partitiviridae are dominant, followed by viruses of the families Chrysoviridae and Geminiviridae. The identified ENREs have been primarily identified in eudicots, followed by monocots. In this review, we briefly discuss the current view on non-retroviral sequences integrated into plant genomes that are associated with plant-virus evolution and their possible roles in antiviral resistance.

  19. RNA-Seq analysis identifies key genes associated with haustorial development in the root hemiparasite Santalum album

    Directory of Open Access Journals (Sweden)

    Xinhua eZhang

    2015-09-01

    Full Text Available Santalum album (sandalwood is one of the economically important plant species in the Santalaceae for its production of highly valued perfume oils. Sandalwood is also a hemiparasitic tree that obtains some of its water and simple nutrients by tapping into other plants through haustoria which are highly specialized organs in parasitic angiosperms. However, an understanding of the molecular mechanisms involved in haustorium development is limited. In this study, RNA sequencing (RNA-seq analyses were performed to identify changes in gene expression and metabolic pathways associated with the development of the S. album haustorium. A total of 56,011 non-redundant contigs with a mean contig size of 618 bp were obtained by de novo assembly of the transcriptome of haustoria and non-haustorial seedling roots. A substantial number of the identified differentially expressed genes were involved in cell wall metabolism and protein metabolism, as well as mitochondrial electron transport functions. Phytohormone-mediated regulation might play an important role during haustorial development. Especially, auxin signaling is likely to be essential for haustorial initiation, and genes related to cytokinin and gibberellin biosynthesis and metabolism are involved in haustorial development. Our results suggest that genes encoding nodulin-like proteins may be important for haustorial morphogenesis in S. album. The obtained sequence data will become a rich resource for future research in this interesting species. This information improves our understanding of haustorium development in root hemiparasitic species and will allow further exploration of the detailed molecular mechanisms underlying plant parasitism.

  20. Functional genomics tools applied to plant metabolism: a survey on plant respiration, its connections and the annotation of complex gene functions

    Directory of Open Access Journals (Sweden)

    Wagner L. Araújo

    2012-09-01

    Full Text Available The application of post-genomic techniques in plant respiration studies has greatly improved our ability to assign functions to gene products. In addition it has also revealed previously unappreciated interactions between distal elements of metabolism. Such results have reinforced the need to consider plant respiratory metabolism as part of a complex network and making sense of such interactions will ultimately require the construction of predictive and mechanistic models. Transcriptomics, proteomics, metabolomics and the quantification of metabolic flux will be of great value in creating such models both by facilitating the annotation of complex gene function, determining their structure and by furnishing the quantitative data required to test them. In this review we highlight how these experimental approaches have contributed to our current understanding of plant respiratory metabolism and its interplay with associated process (e.g. photosynthesis, photorespiration and nitrogen metabolism. We also discuss how data from these techniques may be integrated, with the ultimate aim of identifying mechanisms that control and regulate plant respiration and discovering novel gene functions with potential biotechnological implications.

  1. Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

    Science.gov (United States)

    Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

    2015-09-01

    In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

  2. Transcriptomic variation among six Arabidopsis thaliana accessions identified several novel genes controlling aluminium tolerance.

    Science.gov (United States)

    Kusunoki, Kazutaka; Nakano, Yuki; Tanaka, Keisuke; Sakata, Yoichi; Koyama, Hiroyuki; Kobayashi, Yuriko

    2017-02-01

    Differences in the expression levels of aluminium (Al) tolerance genes are a known determinant of Al tolerance among plant varieties. We combined transcriptomic analysis of six Arabidopsis thaliana accessions with contrasting Al tolerance and a reverse genetic approach to identify Al-tolerance genes responsible for differences in Al tolerance between accession groups. Gene expression variation increased in the signal transduction process under Al stress and in growth-related processes in the absence of stress. Co-expression analysis and promoter single nucleotide polymorphism searching suggested that both trans-acting polymorphisms of Al signal transduction pathway and cis-acting polymorphisms in the promoter sequences caused the variations in gene expression associated with Al tolerance. Compared with the wild type, Al sensitivity increased in T-DNA knockout (KO) lines for five genes, including TARGET OF AVRB OPERATION1 (TAO1) and an unannotated gene (At5g22530). These were identified from 53 Al-inducible genes showing significantly higher expression in tolerant accessions than in sensitive accessions. These results indicate that the difference in transcriptional signalling is partly associated with the natural variation in Al tolerance in Arabidopsis. Our study also demonstrates the feasibility of comparative transcriptome analysis by using natural genetic variation for the identification of genes responsible for Al stress tolerance. © 2016 John Wiley & Sons Ltd.

  3. Bioinformatics analysis of the predicted polyprenol reductase genes in higher plants

    Science.gov (United States)

    Basyuni, M.; Wati, R.

    2018-03-01

    The present study evaluates the bioinformatics methods to analyze twenty-four predicted polyprenol reductase genes from higher plants on GenBank as well as predicted the structure, composition, similarity, subcellular localization, and phylogenetic. The physicochemical properties of plant polyprenol showed diversity among the observed genes. The percentage of the secondary structure of plant polyprenol genes followed the ratio order of α helix > random coil > extended chain structure. The values of chloroplast but not signal peptide were too low, indicated that few chloroplast transit peptide in plant polyprenol reductase genes. The possibility of the potential transit peptide showed variation among the plant polyprenol reductase, suggested the importance of understanding the variety of peptide components of plant polyprenol genes. To clarify this finding, a phylogenetic tree was drawn. The phylogenetic tree shows several branches in the tree, suggested that plant polyprenol reductase genes grouped into divergent clusters in the tree.

  4. Microarray analysis and scale-free gene networks identify candidate regulators in drought-stressed roots of loblolly pine (P. taeda L.

    Directory of Open Access Journals (Sweden)

    Bordeaux John M

    2011-05-01

    Full Text Available Abstract Background Global transcriptional analysis of loblolly pine (Pinus taeda L. is challenging due to limited molecular tools. PtGen2, a 26,496 feature cDNA microarray, was fabricated and used to assess drought-induced gene expression in loblolly pine propagule roots. Statistical analysis of differential expression and weighted gene correlation network analysis were used to identify drought-responsive genes and further characterize the molecular basis of drought tolerance in loblolly pine. Results Microarrays were used to interrogate root cDNA populations obtained from 12 genotype × treatment combinations (four genotypes, three watering regimes. Comparison of drought-stressed roots with roots from the control treatment identified 2445 genes displaying at least a 1.5-fold expression difference (false discovery rate = 0.01. Genes commonly associated with drought response in pine and other plant species, as well as a number of abiotic and biotic stress-related genes, were up-regulated in drought-stressed roots. Only 76 genes were identified as differentially expressed in drought-recovered roots, indicating that the transcript population can return to the pre-drought state within 48 hours. Gene correlation analysis predicts a scale-free network topology and identifies eleven co-expression modules that ranged in size from 34 to 938 members. Network topological parameters identified a number of central nodes (hubs including those with significant homology (E-values ≤ 2 × 10-30 to 9-cis-epoxycarotenoid dioxygenase, zeatin O-glucosyltransferase, and ABA-responsive protein. Identified hubs also include genes that have been associated previously with osmotic stress, phytohormones, enzymes that detoxify reactive oxygen species, and several genes of unknown function. Conclusion PtGen2 was used to evaluate transcriptome responses in loblolly pine and was leveraged to identify 2445 differentially expressed genes responding to severe drought stress in

  5. Microarray analysis and scale-free gene networks identify candidate regulators in drought-stressed roots of loblolly pine (P. taeda L.)

    Science.gov (United States)

    2011-01-01

    Background Global transcriptional analysis of loblolly pine (Pinus taeda L.) is challenging due to limited molecular tools. PtGen2, a 26,496 feature cDNA microarray, was fabricated and used to assess drought-induced gene expression in loblolly pine propagule roots. Statistical analysis of differential expression and weighted gene correlation network analysis were used to identify drought-responsive genes and further characterize the molecular basis of drought tolerance in loblolly pine. Results Microarrays were used to interrogate root cDNA populations obtained from 12 genotype × treatment combinations (four genotypes, three watering regimes). Comparison of drought-stressed roots with roots from the control treatment identified 2445 genes displaying at least a 1.5-fold expression difference (false discovery rate = 0.01). Genes commonly associated with drought response in pine and other plant species, as well as a number of abiotic and biotic stress-related genes, were up-regulated in drought-stressed roots. Only 76 genes were identified as differentially expressed in drought-recovered roots, indicating that the transcript population can return to the pre-drought state within 48 hours. Gene correlation analysis predicts a scale-free network topology and identifies eleven co-expression modules that ranged in size from 34 to 938 members. Network topological parameters identified a number of central nodes (hubs) including those with significant homology (E-values ≤ 2 × 10-30) to 9-cis-epoxycarotenoid dioxygenase, zeatin O-glucosyltransferase, and ABA-responsive protein. Identified hubs also include genes that have been associated previously with osmotic stress, phytohormones, enzymes that detoxify reactive oxygen species, and several genes of unknown function. Conclusion PtGen2 was used to evaluate transcriptome responses in loblolly pine and was leveraged to identify 2445 differentially expressed genes responding to severe drought stress in roots. Many of the

  6. Identifying novel fruit-related genes in Arabidopsis thaliana based on the random walk with restart algorithm.

    Science.gov (United States)

    Zhang, Yunhua; Dai, Li; Liu, Ying; Zhang, YuHang; Wang, ShaoPeng

    2017-01-01

    Fruit is essential for plant reproduction and is responsible for protection and dispersal of seeds. The development and maturation of fruit is tightly regulated by numerous genetic factors that respond to environmental and internal stimulation. In this study, we attempted to identify novel fruit-related genes in a model organism, Arabidopsis thaliana, using a computational method. Based on validated fruit-related genes, the random walk with restart (RWR) algorithm was applied on a protein-protein interaction (PPI) network using these genes as seeds. The identified genes with high probabilities were filtered by the permutation test and linkage tests. In the permutation test, the genes that were selected due to the structure of the PPI network were discarded. In the linkage tests, the importance of each candidate gene was measured from two aspects: (1) its functional associations with validated genes and (2) its similarity with validated genes on gene ontology (GO) terms and KEGG pathways. Finally, 255 inferred genes were obtained, subsequent extensive analysis of important genes revealed that they mainly contribute to ubiquitination (UBQ9, UBQ8, UBQ11, UBQ10), serine hydroxymethyl transfer (SHM7, SHM5, SHM6) or glycol-metabolism (HXKL2_ARATH, CSY5, GAPCP1), suggesting essential roles during the development and maturation of fruit in Arabidopsis thaliana.

  7. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  8. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  9. Digital Gene Expression Analysis Based on De Novo Transcriptome Assembly Reveals New Genes Associated with Floral Organ Differentiation of the Orchid Plant Cymbidium ensifolium.

    Directory of Open Access Journals (Sweden)

    Fengxi Yang

    Full Text Available Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms

  10. Identifying potential maternal genes of Bombyx mori using digital gene expression profiling

    Science.gov (United States)

    Xu, Pingzhen

    2018-01-01

    Maternal genes present in mature oocytes play a crucial role in the early development of silkworm. Although maternal genes have been widely studied in many other species, there has been limited research in Bombyx mori. High-throughput next generation sequencing provides a practical method for gene discovery on a genome-wide level. Herein, a transcriptome study was used to identify maternal-related genes from silkworm eggs. Unfertilized eggs from five different stages of early development were used to detect the changing situation of gene expression. The expressed genes showed different patterns over time. Seventy-six maternal genes were annotated according to homology analysis with Drosophila melanogaster. More than half of the differentially expressed maternal genes fell into four expression patterns, while the expression patterns showed a downward trend over time. The functional annotation of these material genes was mainly related to transcription factor activity, growth factor activity, nucleic acid binding, RNA binding, ATP binding, and ion binding. Additionally, twenty-two gene clusters including maternal genes were identified from 18 scaffolds. Altogether, we plotted a profile for the maternal genes of Bombyx mori using a digital gene expression profiling method. This will provide the basis for maternal-specific signature research and improve the understanding of the early development of silkworm. PMID:29462160

  11. Genes under positive selection in a model plant pathogenic fungus, Botrytis.

    Science.gov (United States)

    Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian

    2012-07-01

    The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Science.gov (United States)

    2010-01-01

    Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests

  13. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-12-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native

  14. The Identification of Genes Important in Pseudomonas syringae pv. phaseolicola Plant Colonisation Using In Vitro Screening of Transposon Libraries.

    Directory of Open Access Journals (Sweden)

    Bharani Manoharan

    Full Text Available The bacterial plant pathogen Pseudomonas syringae pv. phaseolicola (Pph colonises the surface of common bean plants before moving into the interior of plant tissue, via wounds and stomata. In the intercellular spaces the pathogen proliferates in the apoplastic fluid and forms microcolonies (biofilms around plant cells. If the pathogen can suppress the plant's natural resistance response, it will cause halo blight disease. The process of resistance suppression is fairly well understood, but the mechanisms used by the pathogen in colonisation are less clear. We hypothesised that we could apply in vitro genetic screens to look for changes in motility, colony formation, and adhesion, which are proxies for infection, microcolony formation and cell adhesion. We made transposon (Tn mutant libraries of Pph strains 1448A and 1302A and found 106/1920 mutants exhibited alterations in colony morphology, motility and biofilm formation. Identification of the insertion point of the Tn identified within the genome highlighted, as expected, a number of altered motility mutants bearing mutations in genes encoding various parts of the flagellum. Genes involved in nutrient biosynthesis, membrane associated proteins, and a number of conserved hypothetical protein (CHP genes were also identified. A mutation of one CHP gene caused a positive increase in in planta bacterial growth. This rapid and inexpensive screening method allows the discovery of genes important for in vitro traits that can be correlated to roles in the plant interaction.

  15. Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population

    Science.gov (United States)

    Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

    2016-01-01

    Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991

  16. Using a periclinal chimera to unravel layer-specific gene expression in plants.

    Science.gov (United States)

    Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J

    2013-09-01

    Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.

  17. Agrobacterium rhizogenes rolB gene affects photosynthesis and chlorophyll content in transgenic tomato (Solanum lycopersicum L.) plants.

    Science.gov (United States)

    Bettini, Priscilla P; Marvasi, Massimiliano; Fani, Fabiola; Lazzara, Luigi; Cosi, Elena; Melani, Lorenzo; Mauro, Maria Luisa

    2016-10-01

    Insertion of Agrobacterium rhizogenes rolB gene into plant genome affects plant development, hormone balance and defence. However, beside the current research, the overall transcriptional response and gene expression of rolB as a modulator in plant is unknown. Transformed rolB tomato plant (Solanum lycopersicum L.) cultivar Tondino has been used to investigate the differential expression profile. Tomato is a well-known model organism both at the genetic and molecular level, and one of the most important commercial food crops in the world. Through the construction and characterization of a cDNA subtracted library, we have investigated the differential gene expression between transgenic clones of rolB and control tomato and have evaluated genes specifically transcribed in transgenic rolB plants. Among the selected genes, five genes encoding for chlorophyll a/b binding protein, carbonic anhydrase, cytochrome b 6 /f complex Fe-S subunit, potassium efflux antiporter 3, and chloroplast small heat-shock protein, all involved in chloroplast function, were identified. Measurement of photosynthesis efficiency by the level of three different photosynthetic parameters (F v /F m , rETR, NPQ) showed rolB significant increase in non-photochemical quenching and a, b chlorophyll content. Our results point to highlight the role of rolB on plant fitness by improving photosynthesis. Copyright © 2016 Elsevier GmbH. All rights reserved.

  18. The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.

    Science.gov (United States)

    Masle, Josette; Gilmore, Scott R; Farquhar, Graham D

    2005-08-11

    Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.

  19. Planting increases the abundance and structure complexity of soil core functional genes relevant to carbon and nitrogen cycling.

    Science.gov (United States)

    Wang, Feng; Liang, Yuting; Jiang, Yuji; Yang, Yunfeng; Xue, Kai; Xiong, Jinbo; Zhou, Jizhong; Sun, Bo

    2015-09-23

    Plants have an important impact on soil microbial communities and their functions. However, how plants determine the microbial composition and network interactions is still poorly understood. During a four-year field experiment, we investigated the functional gene composition of three types of soils (Phaeozem, Cambisols and Acrisol) under maize planting and bare fallow regimes located in cold temperate, warm temperate and subtropical regions, respectively. The core genes were identified using high-throughput functional gene microarray (GeoChip 3.0), and functional molecular ecological networks (fMENs) were subsequently developed with the random matrix theory (RMT)-based conceptual framework. Our results demonstrated that planting significantly (P soils and 83.5% of microbial alpha-diversity can be explained by the plant factor. Moreover, planting had significant impacts on the microbial community structure and the network interactions of the microbial communities. The calculated network complexity was higher under maize planting than under bare fallow regimes. The increase of the functional genes led to an increase in both soil respiration and nitrification potential with maize planting, indicating that changes in the soil microbial communities and network interactions influenced ecological functioning.

  20. Identifying key genes in rheumatoid arthritis by weighted gene co-expression network analysis.

    Science.gov (United States)

    Ma, Chunhui; Lv, Qi; Teng, Songsong; Yu, Yinxian; Niu, Kerun; Yi, Chengqin

    2017-08-01

    This study aimed to identify rheumatoid arthritis (RA) related genes based on microarray data using the WGCNA (weighted gene co-expression network analysis) method. Two gene expression profile datasets GSE55235 (10 RA samples and 10 healthy controls) and GSE77298 (16 RA samples and seven healthy controls) were downloaded from Gene Expression Omnibus database. Characteristic genes were identified using metaDE package. WGCNA was used to find disease-related networks based on gene expression correlation coefficients, and module significance was defined as the average gene significance of all genes used to assess the correlation between the module and RA status. Genes in the disease-related gene co-expression network were subject to functional annotation and pathway enrichment analysis using Database for Annotation Visualization and Integrated Discovery. Characteristic genes were also mapped to the Connectivity Map to screen small molecules. A total of 599 characteristic genes were identified. For each dataset, characteristic genes in the green, red and turquoise modules were most closely associated with RA, with gene numbers of 54, 43 and 79, respectively. These genes were enriched in totally enriched in 17 Gene Ontology terms, mainly related to immune response (CD97, FYB, CXCL1, IKBKE, CCR1, etc.), inflammatory response (CD97, CXCL1, C3AR1, CCR1, LYZ, etc.) and homeostasis (C3AR1, CCR1, PLN, CCL19, PPT1, etc.). Two small-molecule drugs sanguinarine and papaverine were predicted to have a therapeutic effect against RA. Genes related to immune response, inflammatory response and homeostasis presumably have critical roles in RA pathogenesis. Sanguinarine and papaverine have a potential therapeutic effect against RA. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  1. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Science.gov (United States)

    Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K

    2014-01-01

    Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  2. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Directory of Open Access Journals (Sweden)

    Nidhi Thakur

    Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  3. Candidacy of a chitin-inducible gibberellin-responsive gene for a major locus affecting plant height in rice that is closely linked to Green Revolution gene sd1.

    Science.gov (United States)

    Kovi, Mallikarjuna Rao; Zhang, Yushan; Yu, Sibin; Yang, Gaiyu; Yan, Wenhao; Xing, Yongzhong

    2011-09-01

    Appropriate plant height is crucial for lodging resistance to improve the rice crop yield. The application of semi-dwarf 1 led to the green revolution in the 1960s, by predominantly increasing the rice yield. However, the frequent use of single sd1 gene sources may cause genetic vulnerability to pests and diseases. Identifying useful novel semi-dwarf genes is important for the genetic manipulation of plant architecture in practical rice breeding. In this study, introgression lines derived from two parents contrasting in plant height, Zhenshan 97 and Pokkali were employed to locate a gene with a large effect on plant height by the bulk segregant analysis method. A major gene, ph1, was mapped to a region closely linked to sd1 on chromosome 1; the additive effects of ph1 were more than 50 cm on the plant height and 2 days on the heading date in a BC(4)F(2) population and its progeny. ph1 was then fine mapped to BAC AP003227. Gene annotation indicated that LOC_OS01g65990 encoding a chitin-inducible gibberellin-responsive protein (CIGR), which belongs to the GRAS family, might be the right candidate gene of ph1. Co-segregation analysis of the candidate gene-derived marker finally confirmed its identity as the candidate gene. A higher expression level of the CIGR was detected in all the tested tissues in tall plants compared to those of short plants, especially in the young leaf sheath containing elongating tissues, which indicated its importance role in regulating plant height. ph1 showed a tremendous genetic effect on plant height, which is distinct from sd1 and could be a new resource for breeding semi-dwarf varieties.

  4. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou

    2014-08-01

    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  5. Expression of kenaf mitochondrial chimeric genes HM184 causes male sterility in transgenic tobacco plants.

    Science.gov (United States)

    Zhao, Yanhong; Liao, Xiaofang; Huang, Zhipeng; Chen, Peng; Zhou, Bujin; Liu, Dongmei; Kong, Xiangjun; Zhou, Ruiyang

    2015-08-01

    Chimeric genes resulting from the rearrangement of a mitochondrial genome were generally thought to be a causal factor in the occurrence of cytoplasmic male sterility (CMS). In the study, earlier we reported that identifying a 47 bp deletion at 3'- flanking of atp9 that was linked to male sterile cytoplasm in kenaf. The truncated fragment was fused with atp9, a mitochondrial transit signal (MTS) and/or GFP, comprised two chimeric genes MTS-HM184-GFP and MTS-HM184. The plant expression vector pBI121 containing chimeric genes were then introduced to tobacco plants by Agrobacterium-mediated T-DNA transformation. The result showed that certain transgenic plants were male sterility or semi-sterility, while some were not. The expression analysis further demonstrated that higher level of expression were showed in the sterility plants, while no expression or less expression in fertility plants, the levels of expression of semi-sterility were in between. And the sterile plant (containing MTS-HM184-GFP) had abnormal anther produced malformed/shriveled pollen grains stained negative that failed to germinate (0%), the corresponding fruits was shrunken, the semi-sterile plants having normal anther shape produced about 10-50% normal pollen grains, the corresponding fruits were not full, and the germination rate was 58%. Meanwhile these transgenic plants which altered on fertility were further analyzed in phenotype. As a result, the metamorphosis leaves were observed in the seedling stage, the plant height of transgenic plants was shorter than wild type. The growth duration of transgenic tobacco was delayed 30-45 days compared to the wild type. The copy numbers of target genes of transgenic tobacco were analyzed using the real-time quantitative method. The results showed that these transgenic plants targeting-expression in mitochondrial containing MTS-HM184-GFP had 1 copy and 2 copies, the other two plants containing MTS-HM184 both had 3 copies, but 0 copy in wild type. In

  6. Multi-omics approach identifies molecular mechanisms of plant-fungus mycorrhizal interaction

    Directory of Open Access Journals (Sweden)

    Peter E Larsen

    2016-01-01

    Full Text Available In mycorrhizal symbiosis, plant roots form close, mutually beneficial interactions with soil fungi. Before this mycorrhizal interaction can be established however, plant roots must be capable of detecting potential beneficial fungal partners and initiating the gene expression patterns necessary to begin symbiosis. To predict a plant root – mycorrhizal fungi sensor systems, we analyzed in vitro experiments of Populus tremuloides (aspen tree and Laccaria bicolor (mycorrhizal fungi interaction and leveraged over 200 previously published transcriptomic experimental data sets, 159 experimentally validated plant transcription factor binding motifs, and more than 120-thousand experimentally validated protein-protein interactions to generate models of pre-mycorrhizal sensor systems in aspen root. These sensor mechanisms link extracellular signaling molecules with gene regulation through a network comprised of membrane receptors, signal cascade proteins, transcription factors, and transcription factor biding DNA motifs. Modeling predicted four pre-mycorrhizal sensor complexes in aspen that interact with fifteen transcription factors to regulate the expression of 1184 genes in response to extracellular signals synthesized by Laccaria. Predicted extracellular signaling molecules include common signaling molecules such as phenylpropanoids, salicylate, and, jasmonic acid. This multi-omic computational modeling approach for predicting the complex sensory networks yielded specific, testable biological hypotheses for mycorrhizal interaction signaling compounds, sensor complexes, and mechanisms of gene regulation.

  7. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function.

    Science.gov (United States)

    Kourelis, Jiorgos; van der Hoorn, Renier A L

    2018-02-01

    Plants have many, highly variable resistance ( R ) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize ( Zea mays ) Hm1 , was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. © 2018 American Society of Plant Biologists. All rights reserved.

  8. Molecular Mapping of Reduced Plant Height Gene Rht24 in Bread Wheat.

    Science.gov (United States)

    Tian, Xiuling; Wen, Weie; Xie, Li; Fu, Luping; Xu, Dengan; Fu, Chao; Wang, Desen; Chen, Xinmin; Xia, Xianchun; Chen, Quanjia; He, Zhonghu; Cao, Shuanghe

    2017-01-01

    Height is an important trait related to plant architecture and yield potential in bread wheat ( Triticum aestivum L.). We previously identified a major quantitative trait locus QPH.caas-6A flanked by simple sequence repeat markers Xbarc103 and Xwmc256 that reduced height by 8.0-10.4%. Here QPH.caas-6A , designated as Rht24 , was confirmed using recombinant inbred lines (RILs) derived from a Jingdong 8/Aikang 58 cross. The target sequences of Xbarc103 and Xwmc256 were used as queries to BLAST against International Wheat Genome Sequence Consortium database and hit a super scaffold of approximately 208 Mb. Based on gene annotation of the scaffold, three gene-specific markers were developed to genotype the RILs, and Rht24 was narrowed to a 1.85 cM interval between TaAP2 and TaFAR . In addition, three single nucleotide polymorphism (SNP) markers linked to Rht24 were identified from SNP chip-based screening in combination with bulked segregant analysis. The allelic efficacy of Rht24 was validated in 242 elite wheat varieties using TaAP2 and TaFAR markers. These showed a significant association between genotypes and plant height. Rht24 reduced plant height by an average of 6.0-7.9 cm across environments and were significantly associated with an increased TGW of 2.0-3.4 g. The findings indicate that Rht24 is a common dwarfing gene in wheat breeding, and TaAP2 and TaFAR can be used for marker-assisted selection.

  9. Diametrical clustering for identifying anti-correlated gene clusters.

    Science.gov (United States)

    Dhillon, Inderjit S; Marcotte, Edward M; Roshan, Usman

    2003-09-01

    Clustering genes based upon their expression patterns allows us to predict gene function. Most existing clustering algorithms cluster genes together when their expression patterns show high positive correlation. However, it has been observed that genes whose expression patterns are strongly anti-correlated can also be functionally similar. Biologically, this is not unintuitive-genes responding to the same stimuli, regardless of the nature of the response, are more likely to operate in the same pathways. We present a new diametrical clustering algorithm that explicitly identifies anti-correlated clusters of genes. Our algorithm proceeds by iteratively (i). re-partitioning the genes and (ii). computing the dominant singular vector of each gene cluster; each singular vector serving as the prototype of a 'diametric' cluster. We empirically show the effectiveness of the algorithm in identifying diametrical or anti-correlated clusters. Testing the algorithm on yeast cell cycle data, fibroblast gene expression data, and DNA microarray data from yeast mutants reveals that opposed cellular pathways can be discovered with this method. We present systems whose mRNA expression patterns, and likely their functions, oppose the yeast ribosome and proteosome, along with evidence for the inverse transcriptional regulation of a number of cellular systems.

  10. Repressor-mediated tissue-specific gene expression in plants

    Science.gov (United States)

    Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

    2009-02-17

    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  11. Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population.

    Science.gov (United States)

    Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

    2016-06-02

    Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Plant domestication and gene banks

    International Nuclear Information System (INIS)

    Perrino, P.

    1989-01-01

    At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs

  13. ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

    Science.gov (United States)

    Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

    2012-01-01

    Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

  14. Functional conservation of coenzyme Q biosynthetic genes among yeasts, plants, and humans.

    Directory of Open Access Journals (Sweden)

    Kazuhiro Hayashi

    Full Text Available Coenzyme Q (CoQ is an essential factor for aerobic growth and oxidative phosphorylation in the electron transport system. The biosynthetic pathway for CoQ has been proposed mainly from biochemical and genetic analyses of Escherichia coli and Saccharomyces cerevisiae; however, the biosynthetic pathway in higher eukaryotes has been explored in only a limited number of studies. We previously reported the roles of several genes involved in CoQ synthesis in the fission yeast Schizosaccharomyces pombe. Here, we expand these findings by identifying ten genes (dps1, dlp1, ppt1, and coq3-9 that are required for CoQ synthesis. CoQ10-deficient S. pombe coq deletion strains were generated and characterized. All mutant fission yeast strains were sensitive to oxidative stress, produced a large amount of sulfide, required an antioxidant to grow on minimal medium, and did not survive at the stationary phase. To compare the biosynthetic pathway of CoQ in fission yeast with that in higher eukaryotes, the ability of CoQ biosynthetic genes from humans and plants (Arabidopsis thaliana to functionally complement the S. pombe coq deletion strains was determined. With the exception of COQ9, expression of all other human and plant COQ genes recovered CoQ10 production by the fission yeast coq deletion strains, although the addition of a mitochondrial targeting sequence was required for human COQ3 and COQ7, as well as A. thaliana COQ6. In summary, this study describes the functional conservation of CoQ biosynthetic genes between yeasts, humans, and plants.

  15. Candidate genes involved in the biosynthesis of triterpenoid saponins in Platycodon grandiflorum identified by transcriptome analysis

    Directory of Open Access Journals (Sweden)

    Chunhua eMa

    2016-05-01

    Full Text Available Background: Platycodon grandiflorum is the only species in the genus Platycodon of the family Campanulaceae, which has been traditionally used as a medicinal plant for its lung-heat-clearing, antitussive, and expectorant properties in China, Japanese and Korean. Oleanane-type triterpenoid saponins were the main chemical components of P. grandiflorum and platycodin D was the abundant and main bioactive component, but little is known about their biosynthesis in plants. Hence, P. grandiflorum is an ideal medicinal plant for studying the biosynthesis of Oleanane-type saponins. In addition, the genomic information of this important herbal plant is unavailable.Principal Findings:A total of 58,580,566 clean reads were obtained, which were assembled into 34,053 unigenes, with an average length of 936 bp and N50 of 1,661 bp by analyzing the transcriptome data of P. grandiflorum. Among these 34,053 unigenes, 22,409 unigenes (65.80% were annotated based on the information available from public databases, including Nr, NCBI, Swiss-Prot, KOG and KEGG. Furthermore, 21 candidate cytochrome P450 genes and 17 candidate UDP-glycosyltransferase genes most likely involved in triterpenoid saponins biosynthesis pathway were discovered from the transcriptome sequencing of P. grandiflorum. In addition, 10,626 SSRs were identified based on the transcriptome data, which would provide abundant candidates of molecular markers for genetic diversity and genetic map for this medicinal plant.Conclusion:The genomic data obtained from P. grandiflorum, especially the identification of putative genes involved in triterpenoid saponins biosynthesis pathway, will facilitate our understanding of the biosynthesis of triterpenoid saponins at molecular level.

  16. Gene stacking of multiple traits for high yield of fermentable sugars in plant biomass

    DEFF Research Database (Denmark)

    Aznar, Aude; Chalvin, Camille; Shih, Patrick M.

    2018-01-01

    the ratio of C6 to C5 sugars in the cell wall and decreasing the lignin content are two important targets in engineering of plants that are more suitable for downstream processing for second-generation biofuel production.Results: We have studied the basic mechanisms of cell wall biosynthesis and identified...... genes involved in biosynthesis of pectic galactan, including the GALS1 galactan synthase and the UDP-galactose/UDP-rhamnose transporter URGT1. We have engineered plants with a more suitable biomass composition by applying these findings, in conjunction with synthetic biology and gene stacking tools...... to vessels where this polysaccharide is essential. Finally, the high galactan and low xylan traits were stacked with the low lignin trait obtained by expressing the QsuB gene encoding dehydroshikimate dehydratase in lignifying cells.Conclusion: The results show that approaches to increasing C6 sugar content...

  17. Plant isoflavone and isoflavanone O-methyltransferase genes

    Science.gov (United States)

    Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

    2014-08-19

    The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

  18. Phylogenetic Analysis, Lineage-Specific Expansion and Functional Divergence of seed dormancy 4-Like Genes in Plants.

    Directory of Open Access Journals (Sweden)

    Saminathan Subburaj

    Full Text Available The rice gene seed dormancy 4 (OsSdr4 functions in seed dormancy and is a major factor associated with pre-harvest sprouting (PHS. Although previous studies of this protein family were reported for rice and other species, knowledge of the evolution of genes homologous to OsSdr4 in plants remains inadequate. Fifty four Sdr4-like (hereafter designated Sdr4L genes were identified in nine plant lineages including 36 species. Phylogenetic analysis placed these genes in eight subfamilies (I-VIII. Genes from the same lineage clustered together, supported by analysis of conserved motifs and exon-intron patterns. Segmental duplications were present in both dicot and monocot clusters, while tandemly duplicated genes occurred only in monocot clusters indicating that both tandem and segmental duplications contributed to expansion of the grass I and II subfamilies. Estimation of the approximate ages of the duplication events indicated that ancestral Sdr4 genes evolved from a common angiosperm ancestor, about 160 million years ago (MYA. Moreover, diversification of Sdr4L genes in mono and dicot plants was mainly associated with genome-wide duplication and speciation events. Functional divergence was observed in all subfamily pairs, except IV/VIIIa. Further analysis indicated that functional constraints between subfamily pairs I/II, I/VIIIb, II/VI, II/VIIIb, II/IV, and VI/VIIIb were statistically significant. Site and branch-site model analyses of positive selection suggested that these genes were under strong adaptive selection pressure. Critical amino acids detected for both functional divergence and positive selection were mostly located in the loops, pointing to functional importance of these regions in this protein family. In addition, differential expression studies by transcriptome atlas of 11 Sdr4L genes showed that the duplicated genes may have undergone divergence in expression between plant species. Our findings showed that Sdr4L genes are

  19. Expressed sequences tags of the anther smut fungus, Microbotryum violaceum, identify mating and pathogenicity genes

    Directory of Open Access Journals (Sweden)

    Devier Benjamin

    2007-08-01

    Full Text Available Abstract Background The basidiomycete fungus Microbotryum violaceum is responsible for the anther-smut disease in many plants of the Caryophyllaceae family and is a model in genetics and evolutionary biology. Infection is initiated by dikaryotic hyphae produced after the conjugation of two haploid sporidia of opposite mating type. This study describes M. violaceum ESTs corresponding to nuclear genes expressed during conjugation and early hyphal production. Results A normalized cDNA library generated 24,128 sequences, which were assembled into 7,765 unique genes; 25.2% of them displayed significant similarity to annotated proteins from other organisms, 74.3% a weak similarity to the same set of known proteins, and 0.5% were orphans. We identified putative pheromone receptors and genes that in other fungi are involved in the mating process. We also identified many sequences similar to genes known to be involved in pathogenicity in other fungi. The M. violaceum EST database, MICROBASE, is available on the Web and provides access to the sequences, assembled contigs, annotations and programs to compare similarities against MICROBASE. Conclusion This study provides a basis for cloning the mating type locus, for further investigation of pathogenicity genes in the anther smut fungi, and for comparative genomics.

  20. Ferritin gene organization: differences between plants and animals suggest possible kingdom-specific selective constraints.

    Science.gov (United States)

    Proudhon, D; Wei, J; Briat, J; Theil, E C

    1996-03-01

    Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may

  1. Hydrocarbon degradation, plant colonization and gene expression of alkane degradation genes by endophytic Enterobacter ludwigii strains

    International Nuclear Information System (INIS)

    Yousaf, Sohail; Afzal, Muhammad; Reichenauer, Thomas G.; Brady, Carrie L.; Sessitsch, Angela

    2011-01-01

    The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: → E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. → E. ludwigii strains efficiently expressed alkane degradation genes in plants. → E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. → E. ludwigii interacted more effectively with Italian ryegrass than with other plants. → Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.

  2. Hydrocarbon degradation, plant colonization and gene expression of alkane degradation genes by endophytic Enterobacter ludwigii strains

    Energy Technology Data Exchange (ETDEWEB)

    Yousaf, Sohail [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); Afzal, Muhammad [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad (Pakistan); Reichenauer, Thomas G. [AIT Austrian Institute of Technology GmbH, Environmental Resources and Technologies Unit, A-2444 Seibersdorf (Austria); Brady, Carrie L. [Forestry and Agricultural Biotechnology Institute, Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria (South Africa); Sessitsch, Angela, E-mail: angela.sessitsch@ait.ac.at [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria)

    2011-10-15

    The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: > E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. > E. ludwigii strains efficiently expressed alkane degradation genes in plants. > E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. > E. ludwigii interacted more effectively with Italian ryegrass than with other plants. > Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.

  3. Gastric Cancer Associated Genes Identified by an Integrative Analysis of Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Bing Jiang

    2017-01-01

    Full Text Available Gastric cancer is one of the most severe complex diseases with high morbidity and mortality in the world. The molecular mechanisms and risk factors for this disease are still not clear since the cancer heterogeneity caused by different genetic and environmental factors. With more and more expression data accumulated nowadays, we can perform integrative analysis for these data to understand the complexity of gastric cancer and to identify consensus players for the heterogeneous cancer. In the present work, we screened the published gene expression data and analyzed them with integrative tool, combined with pathway and gene ontology enrichment investigation. We identified several consensus differentially expressed genes and these genes were further confirmed with literature mining; at last, two genes, that is, immunoglobulin J chain and C-X-C motif chemokine ligand 17, were screened as novel gastric cancer associated genes. Experimental validation is proposed to further confirm this finding.

  4. Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.

    Science.gov (United States)

    Bandaranayake, Pradeepa C G; Yoder, John I

    2013-05-01

    Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene

  5. High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

    International Nuclear Information System (INIS)

    Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

    2013-05-01

    Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application

  6. High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

    2013-05-15

    Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application.

  7. Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.

    Science.gov (United States)

    Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan

    2016-09-26

    Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.

  8. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals

    Directory of Open Access Journals (Sweden)

    Wentao Wu

    2017-10-01

    Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  9. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals.

    Science.gov (United States)

    Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli

    2017-10-08

    The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  10. Horizontal transfer of a subtilisin gene from plants into an ancestor of the plant pathogenic fungal genus Colletotrichum.

    Science.gov (United States)

    Armijos Jaramillo, Vinicio Danilo; Vargas, Walter Alberto; Sukno, Serenella Ana; Thon, Michael R

    2013-01-01

    The genus Colletotrichum contains a large number of phytopathogenic fungi that produce enormous economic losses around the world. The effect of horizontal gene transfer (HGT) has not been studied yet in these organisms. Inter-Kingdom HGT into fungal genomes has been reported in the past but knowledge about the HGT between plants and fungi is particularly limited. We describe a gene in the genome of several species of the genus Colletotrichum with a strong resemblance to subtilisins typically found in plant genomes. Subtilisins are an important group of serine proteases, widely distributed in all of the kingdoms of life. Our hypothesis is that the gene was acquired by Colletotrichum spp. through (HGT) from plants to a Colletotrichum ancestor. We provide evidence to support this hypothesis in the form of phylogenetic analyses as well as a characterization of the similarity of the subtilisin at the primary, secondary and tertiary structural levels. The remarkable level of structural conservation of Colletotrichum plant-like subtilisin (CPLS) with plant subtilisins and the differences with the rest of Colletotrichum subtilisins suggests the possibility of molecular mimicry. Our phylogenetic analysis indicates that the HGT event would have occurred approximately 150-155 million years ago, after the divergence of the Colletotrichum lineage from other fungi. Gene expression analysis shows that the gene is modulated during the infection of maize by C. graminicola suggesting that it has a role in plant disease. Furthermore, the upregulation of the CPLS coincides with the downregulation of several plant genes encoding subtilisins. Based on the known roles of subtilisins in plant pathogenic fungi and the gene expression pattern that we observed, we postulate that the CPLSs have an important role in plant infection.

  11. Comparative Transcriptome Analysis Identifies Putative Genes Involved in the Biosynthesis of Xanthanolides in Xanthium strumarium L.

    OpenAIRE

    Li, Yuanjun; Gou, Junbo; Chen, Fangfang; Li, Changfu; Zhang, Yansheng

    2016-01-01

    Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones, which include the xanthanolides. To date, the biogenesis of xanthanolides, especiallytheir downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes...

  12. Molecular Evolution and Expression Divergence of HMT Gene Family in Plants

    Directory of Open Access Journals (Sweden)

    Man Zhao

    2018-04-01

    Full Text Available Homocysteine methyltransferase (HMT converts homocysteine to methionine using S-methylmethionine (SMM or S-adenosylmethionine (SAM as methyl donors in organisms, playing an important role in supplying methionine for the growth and the development of plants. To better understand the functions of the HMT genes in plants, we conducted a wide evolution and expression analysis of these genes. Reconstruction of the phylogenetic relationship showed that the HMT gene family was divided into Class 1 and Class 2. In Class 1, HMTs were only found in seed plants, while Class 2 presented in all land plants, which hinted that the HMT genes might have diverged in seed plants. The analysis of gene structures and selection pressures showed that they were relatively conserved during evolution. However, type I functional divergence had been detected in the HMTs. Furthermore, the expression profiles of HMTs showed their distinct expression patterns in different tissues, in which some HMTs were widely expressed in various organs, whereas the others were highly expressed in some specific organs, such as seeds or leaves. Therefore, according to our results in the evolution, functional divergence, and expression, the HMT genes might have diverged during evolution. Further analysis in the expression patterns of AthHMTs with their methyl donors suggested that the diverged HMTs might be related to supply methionine for the development of plant seeds.

  13. Effector gene birth in plant parasitic nematodes: Neofunctionalization of a housekeeping glutathione synthetase gene

    Science.gov (United States)

    Lilley, Catherine J.; Maqbool, Abbas; Wu, Duqing; Yusup, Hazijah B.; Jones, Laura M.; Birch, Paul R. J.; Urwin, Peter E.

    2018-01-01

    Plant pathogens and parasites are a major threat to global food security. Plant parasitism has arisen four times independently within the phylum Nematoda, resulting in at least one parasite of every major food crop in the world. Some species within the most economically important order (Tylenchida) secrete proteins termed effectors into their host during infection to re-programme host development and immunity. The precise detail of how nematodes evolve new effectors is not clear. Here we reconstruct the evolutionary history of a novel effector gene family. We show that during the evolution of plant parasitism in the Tylenchida, the housekeeping glutathione synthetase (GS) gene was extensively replicated. New GS paralogues acquired multiple dorsal gland promoter elements, altered spatial expression to the secretory dorsal gland, altered temporal expression to primarily parasitic stages, and gained a signal peptide for secretion. The gene products are delivered into the host plant cell during infection, giving rise to “GS-like effectors”. Remarkably, by solving the structure of GS-like effectors we show that during this process they have also diversified in biochemical activity, and likely represent the founding members of a novel class of GS-like enzyme. Our results demonstrate the re-purposing of an endogenous housekeeping gene to form a family of effectors with modified functions. We anticipate that our discovery will be a blueprint to understand the evolution of other plant-parasitic nematode effectors, and the foundation to uncover a novel enzymatic function. PMID:29641602

  14. Automatically identifying gene/protein terms in MEDLINE abstracts.

    Science.gov (United States)

    Yu, Hong; Hatzivassiloglou, Vasileios; Rzhetsky, Andrey; Wilbur, W John

    2002-01-01

    Natural language processing (NLP) techniques are used to extract information automatically from computer-readable literature. In biology, the identification of terms corresponding to biological substances (e.g., genes and proteins) is a necessary step that precedes the application of other NLP systems that extract biological information (e.g., protein-protein interactions, gene regulation events, and biochemical pathways). We have developed GPmarkup (for "gene/protein-full name mark up"), a software system that automatically identifies gene/protein terms (i.e., symbols or full names) in MEDLINE abstracts. As a part of marking up process, we also generated automatically a knowledge source of paired gene/protein symbols and full names (e.g., LARD for lymphocyte associated receptor of death) from MEDLINE. We found that many of the pairs in our knowledge source do not appear in the current GenBank database. Therefore our methods may also be used for automatic lexicon generation. GPmarkup has 73% recall and 93% precision in identifying and marking up gene/protein terms in MEDLINE abstracts. A random sample of gene/protein symbols and full names and a sample set of marked up abstracts can be viewed at http://www.cpmc.columbia.edu/homepages/yuh9001/GPmarkup/. Contact. hy52@columbia.edu. Voice: 212-939-7028; fax: 212-666-0140.

  15. Identifying key genes associated with acute myocardial infarction.

    Science.gov (United States)

    Cheng, Ming; An, Shoukuan; Li, Junquan

    2017-10-01

    This study aimed to identify key genes associated with acute myocardial infarction (AMI) by reanalyzing microarray data. Three gene expression profile datasets GSE66360, GSE34198, and GSE48060 were downloaded from GEO database. After data preprocessing, genes without heterogeneity across different platforms were subjected to differential expression analysis between the AMI group and the control group using metaDE package. P FI) network. Then, DEGs in each module were subjected to pathway enrichment analysis using DAVID. MiRNAs and transcription factors predicted to regulate target DEGs were identified. Quantitative real-time polymerase chain reaction (RT-PCR) was applied to verify the expression of genes. A total of 913 upregulated genes and 1060 downregulated genes were identified in the AMI group. A FI network consists of 21 modules and DEGs in 12 modules were significantly enriched in pathways. The transcription factor-miRNA-gene network contains 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p. RT-PCR validations showed that expression levels of FOXO3 and MYBL2 were significantly increased in AMI, and expression levels of hsa-miR-21-5p and hsa-miR-30c-5p were obviously decreased in AMI. A total of 41 DEGs, such as SOCS3, VAPA, and COL5A2, are speculated to have roles in the pathogenesis of AMI; 2 transcription factors FOXO3 and MYBL2, and 2 miRNAs hsa-miR-21-5p and hsa-miR-30c-5p may be involved in the regulation of the expression of these DEGs.

  16. Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

    Science.gov (United States)

    Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

    2015-09-29

    The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

  17. Identifying optimal reference genes for the normalization of microRNA expression in cucumber under viral stress

    Science.gov (United States)

    Liang, Chaoqiong; Hao, Jianjun; Meng, Yan; Luo, Laixin; Li, Jianqiang

    2018-01-01

    Cucumber green mottle mosaic virus (CGMMV) is an economically important pathogen and causes significant reduction of both yield and quality of cucumber (Cucumis sativus). Currently, there were no satisfied strategies for controlling the disease. A better understanding of microRNA (miRNA) expression related to the regulation of plant-virus interactions and virus resistance would be of great assistance when developing control strategies for CGMMV. However, accurate expression analysis is highly dependent on robust and reliable reference gene used as an internal control for normalization of miRNA expression. Most commonly used reference genes involved in CGMMV-infected cucumber are not universally expressed depending on tissue types and stages of plant development. It is therefore crucial to identify suitable reference genes in investigating the role of miRNA expression. In this study, seven reference genes, including Actin, Tubulin, EF-1α, 18S rRNA, Ubiquitin, GAPDH and Cyclophilin, were evaluated for the most accurate results in analyses using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Gene expression was assayed on cucumber leaves, stems and roots that were collected at different days post inoculation with CGMMV. The expression data were analyzed using algorithms including delta-Ct, geNorm, NormFinder, and BestKeeper as well as the comparative tool RefFinder. The reference genes were subsequently validated using miR159. The results showed that EF-1α and GAPDH were the most reliable reference genes for normalizing miRNA expression in leaf, root and stem samples, while Ubiquitin and EF-1α were the most suitable combination overall. PMID:29543906

  18. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants.

    Science.gov (United States)

    Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2010-10-08

    The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected

  19. Alteration of plant meristem function by manipulation of the Retinoblastoma-like plant RRB gene

    Science.gov (United States)

    Durfee, Tim [Madison, WI; Feiler, Heidi [Albany, CA; Gruissem, Wilhelm [Forch, CH; Jenkins, Susan [Martinez, CA; Roe, Judith [Manhattan, KS; Zambryski, Patricia [Berkeley, CA

    2007-01-16

    This invention provides methods and compositions for altering the growth, organization, and differentiation of plant tissues. The invention is based on the discovery that, in plants, genetically altering the levels of Retinoblastoma-related gene (RRB) activity produces dramatic effects on the growth, proliferation, organization, and differentiation of plant meristem.

  20. pGenN, a Gene Normalization Tool for Plant Genes and Proteins in Scientific Literature

    Science.gov (United States)

    Ding, Ruoyao; Arighi, Cecilia N.; Lee, Jung-Youn; Wu, Cathy H.; Vijay-Shanker, K.

    2015-01-01

    Background Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. Methods In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. Results We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/). PMID:26258475

  1. Spatial analyses of mono, di and trinucleotide trends in plant genes.

    Directory of Open Access Journals (Sweden)

    Andrea Porceddu

    Full Text Available Genomic DNA sequences display compositional heterogeneity on many scales. In this paper we analyzed tendencies and anomalies in the occurence of mono, di and trinucleotides in structural regions of plant genes. Representation of these trends as a function of position along genic sequences highlighted compositional features peculiar of either monocots or eudicots that were remarkably uniform within these two evolutionary clades. The most evident of these features appeared in the form of gradient of base content along the direction of transcription. The robustness of such a representation was validated in sequences sub-datasets generated considering structural and compositional features such as total length of cds, overall GC content and genic orientation in the genome. Piecewise regression analyses indicated that the gradients could be conveniently approximated to a two segmented model where a first region featuring a steep slope is followed by a second segment fitting a milder variation. In general, monocots species showed steeper segments than eudicots. The guanine gradient was the most distinctive feature between the two evolutionary clades, being moderately increasing in eudicots and firmly decreasing in monocots. Single gene investigation revealed that a high proportion of genes show compositional trends compatible with a segmented model suggesting that these features are essential attributes of gene organization. Dinucleotide and trinucleotide biases were referred to expectation based on a random union of the component elements. The average bias at dinucleotide level identified a significant undererpresentation of some dinucleotide and the overrepresention of others. The bias at trinucleotide level was on average low. Finally, the analysis of bryophyte coding sequences showed mononucleotide, dinucleotide and trinucleotide compositional trends resembling those of higher plants. This finding suggested that the emergenge of compositional bias

  2. Identification of differentially expressed genes in brown planthopper Nilaparvata lugens (Hemiptera: Delphacidae) responding to host plant resistance.

    Science.gov (United States)

    Yang, Zhifan; Zhang, Futie; Zhu, Lili; He, Guangcun

    2006-02-01

    The brown planthopper Nilaparvata lugens Stål is one of the major insect pests of rice Oryza sativa L. The host resistance exhibits profound effects on growth, development and propagation of N. lugens. To investigate the molecular response of N. lugens to host resistance, a cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique was employed to identify the differentially expressed genes in the nymphs feeding on three rice varieties. Of the 2,800 cDNA bands analysed, 54 were up-regulated and seven down-regulated qualitatively in N. lugens when the ingestion sources were changed from susceptible rice plants to resistant ones. Sequence analysis of the differential transcript-derived fragments showed that the genes involved in signalling, stress response, gene expression regulation, detoxification and metabolism were regulated by host resistance. Four of the transcript-derived fragments corresponding to genes encoding for a putative B subunit of phosphatase PP2A, a nemo kinase, a cytochrome P450 monooxygenase and a prolyl endopeptidase were further characterized in detail. Northern blot analysis confirmed that the expression of the four genes was enhanced in N. lugens feeding on resistant rice plants. The roles of these genes in the defensive response of N. lugens to host plant resistance were discussed.

  3. Gene expression analysis identifies global gene dosage sensitivity in cancer

    DEFF Research Database (Denmark)

    Fehrmann, Rudolf S. N.; Karjalainen, Juha M.; Krajewska, Malgorzata

    2015-01-01

    Many cancer-associated somatic copy number alterations (SCNAs) are known. Currently, one of the challenges is to identify the molecular downstream effects of these variants. Although several SCNAs are known to change gene expression levels, it is not clear whether each individual SCNA affects gen...

  4. A comparative gene analysis with rice identified orthologous group II HKT genes and their association with Na(+) concentration in bread wheat.

    Science.gov (United States)

    Ariyarathna, H A Chandima K; Oldach, Klaus H; Francki, Michael G

    2016-01-19

    Although the HKT transporter genes ascertain some of the key determinants of crop salt tolerance mechanisms, the diversity and functional role of group II HKT genes are not clearly understood in bread wheat. The advanced knowledge on rice HKT and whole genome sequence was, therefore, used in comparative gene analysis to identify orthologous wheat group II HKT genes and their role in trait variation under different saline environments. The four group II HKTs in rice identified two orthologous gene families from bread wheat, including the known TaHKT2;1 gene family and a new distinctly different gene family designated as TaHKT2;2. A single copy of TaHKT2;2 was found on each homeologous chromosome arm 7AL, 7BL and 7DL and each gene was expressed in leaf blade, sheath and root tissues under non-stressed and at 200 mM salt stressed conditions. The proteins encoded by genes of the TaHKT2;2 family revealed more than 93% amino acid sequence identity but ≤52% amino acid identity compared to the proteins encoded by TaHKT2;1 family. Specifically, variations in known critical domains predicted functional differences between the two protein families. Similar to orthologous rice genes on chromosome 6L, TaHKT2;1 and TaHKT2;2 genes were located approximately 3 kb apart on wheat chromosomes 7AL, 7BL and 7DL, forming a static syntenic block in the two species. The chromosomal region on 7AL containing TaHKT2;1 7AL-1 co-located with QTL for shoot Na(+) concentration and yield in some saline environments. The differences in copy number, genes sequences and encoded proteins between TaHKT2;2 homeologous genes and other group II HKT gene families within and across species likely reflect functional diversity for ion selectivity and transport in plants. Evidence indicated that neither TaHKT2;2 nor TaHKT2;1 were associated with primary root Na(+) uptake but TaHKT2;1 may be associated with trait variation for Na(+) exclusion and yield in some but not all saline environments.

  5. Epidermal growth factor gene is a newly identified candidate gene for gout

    OpenAIRE

    Lin Han; Chunwei Cao; Zhaotong Jia; Shiguo Liu; Zhen Liu; Ruosai Xin; Can Wang; Xinde Li; Wei Ren; Xuefeng Wang; Changgui Li

    2016-01-01

    Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 re...

  6. DNA barcoding of invasive plants in China: A resource for identifying invasive plants.

    Science.gov (United States)

    Xu, Song-Zhi; Li, Zhen-Yu; Jin, Xiao-Hua

    2018-01-01

    Invasive plants have aroused attention globally for causing ecological damage and having a negative impact on the economy and human health. However, it can be extremely challenging to rapidly and accurately identify invasive plants based on morphology because they are an assemblage of many different families and many plant materials lack sufficient diagnostic characteristics during border inspections. It is therefore urgent to evaluate candidate loci and build a reliable genetic library to prevent invasive plants from entering China. In this study, five common single markers (ITS, ITS2, matK, rbcL and trnH-psbA) were evaluated using 634 species (including 469 invasive plant species in China, 10 new records to China, 16 potentially invasive plant species around the world but not introduced into China yet and 139 plant species native to China) based on three different methods. Our results indicated that ITS2 displayed largest intra- and interspecific divergence (1.72% and 91.46%). Based on NJ tree method, ITS2, ITS, matK, rbcL and trnH-psbA provided 76.84%, 76.5%, 63.21%, 52.86% and 50.68% discrimination rates, respectively. The combination of ITS + matK performed best and provided 91.03% discriminatory power, followed by ITS2 + matK (85.78%). For identifying unknown individuals, ITS + matK had 100% correct identification rate based on our database, followed by ITS/ITS2 (both 93.33%) and ITS2 + matK (91.67%). Thus, we propose ITS/ITS2 + matK as the most suitable barcode for invasive plants in China. This study also demonstrated that DNA barcoding is an efficient tool for identifying invasive species. © 2017 John Wiley & Sons Ltd.

  7. High Rate of Chimeric Gene Origination by Retroposition in Plant Genomes

    DEFF Research Database (Denmark)

    Wang, Wen; Zheng, Hongkung; Fan, Chuanzhu

    2006-01-01

    Retroposition is widely found to play essential roles in origination of new mammalian and other animal genes. However, the scarcity of retrogenes in plants has led to the assumption that plant genomes rarely evolve new gene duplicates by retroposition, despite abundant retrotransposons in plants......, confirming a previously observed role of retroelements in generating plant retrogenes. Substitution analyses revealed that the vast majority are subject to negative selection, suggesting, along with expression data and evidence of age, that they are likely functional retrogenes. In addition, 42...

  8. Horizontal gene transfer of a plastid gene in the non-photosynthetic flowering plants Orobanche and Phelipanche (Orobanchaceae).

    Science.gov (United States)

    Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M

    2007-06-01

    Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.

  9. Localizing genes using linkage disequilibrium in plants: integrating ...

    African Journals Online (AJOL)

    GREGO

    2007-03-19

    Mar 19, 2007 ... Localizing genes using linkage disequilibrium in plants: integrating lessons ... reduce that association as a function of the marker distance from the QTL. ..... the gene locus enhanced the resolution power of asso- ciation tests .... agents, such as insects, birds, water and wind, so mating is determined by a ...

  10. Double-filter identification of vascular-expressed genes using Arabidopsis plants with vascular hypertrophy and hypotrophy.

    Science.gov (United States)

    Ckurshumova, Wenzislava; Scarpella, Enrico; Goldstein, Rochelle S; Berleth, Thomas

    2011-08-01

    Genes expressed in vascular tissues have been identified by several strategies, usually with a focus on mature vascular cells. In this study, we explored the possibility of using two opposite types of altered tissue compositions in combination with a double-filter selection to identify genes with a high probability of vascular expression in early organ primordia. Specifically, we generated full-transcriptome microarray profiles of plants with (a) genetically strongly reduced and (b) pharmacologically vastly increased vascular tissues and identified a reproducible cohort of 158 transcripts that fulfilled the dual requirement of being underrepresented in (a) and overrepresented in (b). In order to assess the predictive value of our identification scheme for vascular gene expression, we determined the expression patterns of genes in two unbiased subsamples. First, we assessed the expression patterns of all twenty annotated transcription factor genes from the cohort of 158 genes and found that seventeen of the twenty genes were preferentially expressed in leaf vascular cells. Remarkably, fifteen of these seventeen vascular genes were clearly expressed already very early in leaf vein development. Twelve genes with published leaf expression patterns served as a second subsample to monitor the representation of vascular genes in our cohort. Of those twelve genes, eleven were preferentially expressed in leaf vascular tissues. Based on these results we propose that our compendium of 158 genes represents a sample that is highly enriched for genes expressed in vascular tissues and that our approach is particularly suited to detect genes expressed in vascular cell lineages at early stages of their inception. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  11. A Strategy for Identifying Quantitative Trait Genes Using Gene Expression Analysis and Causal Analysis

    Directory of Open Access Journals (Sweden)

    Akira Ishikawa

    2017-11-01

    Full Text Available Large numbers of quantitative trait loci (QTL affecting complex diseases and other quantitative traits have been reported in humans and model animals. However, the genetic architecture of these traits remains elusive due to the difficulty in identifying causal quantitative trait genes (QTGs for common QTL with relatively small phenotypic effects. A traditional strategy based on techniques such as positional cloning does not always enable identification of a single candidate gene for a QTL of interest because it is difficult to narrow down a target genomic interval of the QTL to a very small interval harboring only one gene. A combination of gene expression analysis and statistical causal analysis can greatly reduce the number of candidate genes. This integrated approach provides causal evidence that one of the candidate genes is a putative QTG for the QTL. Using this approach, I have recently succeeded in identifying a single putative QTG for resistance to obesity in mice. Here, I outline the integration approach and discuss its usefulness using my studies as an example.

  12. A Strategy for Identifying Quantitative Trait Genes Using Gene Expression Analysis and Causal Analysis.

    Science.gov (United States)

    Ishikawa, Akira

    2017-11-27

    Large numbers of quantitative trait loci (QTL) affecting complex diseases and other quantitative traits have been reported in humans and model animals. However, the genetic architecture of these traits remains elusive due to the difficulty in identifying causal quantitative trait genes (QTGs) for common QTL with relatively small phenotypic effects. A traditional strategy based on techniques such as positional cloning does not always enable identification of a single candidate gene for a QTL of interest because it is difficult to narrow down a target genomic interval of the QTL to a very small interval harboring only one gene. A combination of gene expression analysis and statistical causal analysis can greatly reduce the number of candidate genes. This integrated approach provides causal evidence that one of the candidate genes is a putative QTG for the QTL. Using this approach, I have recently succeeded in identifying a single putative QTG for resistance to obesity in mice. Here, I outline the integration approach and discuss its usefulness using my studies as an example.

  13. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  14. Comparative Transcriptome Analysis Identifies Putative Genes Involved in the Biosynthesis of Xanthanolides in Xanthium strumarium L.

    Science.gov (United States)

    Li, Yuanjun; Gou, Junbo; Chen, Fangfang; Li, Changfu; Zhang, Yansheng

    2016-01-01

    Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones (STLs), which include the xanthanolides. To date, the biogenesis of xanthanolides, especially their downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes, which were derived from the young leaves of two different cultivars and the purified glandular trichomes from one of the cultivars, were constructed in this study. In total, 157 million clean reads were generated and assembled into 91,861 unigenes, of which 59,858 unigenes were successfully annotated. All the genes coding for known enzymes in the upstream pathway to the biosynthesis of xanthanolides were present in the X. strumarium transcriptomes. From a comparative analysis of the X. strumarium transcriptomes, this study identified a number of gene candidates that are putatively involved in the downstream pathway to the synthesis of xanthanolides, such as four unigenes encoding CYP71 P450s, 50 unigenes for dehydrogenases, and 27 genes for acetyltransferases. The possible functions of these four CYP71 candidates are extensively discussed. In addition, 116 transcription factors that are highly expressed in X. strumarium glandular trichomes were also identified. Their possible regulatory roles in the biosynthesis of STLs are discussed. The global transcriptomic data for X. strumarium should provide a valuable resource for further research into the biosynthesis of xanthanolides.

  15. Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

    Science.gov (United States)

    Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2015-01-01

    RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

  16. DNA barcoding as a means for identifying medicinal plants of Pakistan

    International Nuclear Information System (INIS)

    Schori, M.; Showalter, A.M.

    2011-01-01

    DNA barcoding involves the generation of DNA sequencing data from particular genetic regions in an organism and the use of these sequence data to identify or 'barcode' that organism and distinguish it from other species. Here, DNA barcoding is being used to identify several medicinal plants found in Pakistan and distinguished them from other similar species. Several challenges to the successful implementation of plant DNA barcoding are presented and discussed. Despite these challenges, DNA barcoding has the potential to uniquely identify medicinal plants and provide quality control and standardization of the plant material supplied to the pharmaceutical industry. (author)

  17. CEP genes regulate root and shoot development in response to environmental cues and are specific to seed plants.

    Science.gov (United States)

    Delay, Christina; Imin, Nijat; Djordjevic, Michael A

    2013-12-01

    The manifestation of repetitive developmental programmes during plant growth can be adjusted in response to various environmental cues. During root development, this means being able to precisely control root growth and lateral root development. Small signalling peptides have been found to play roles in many aspects of root development. One member of the CEP (C-TERMINALLY ENCODED PEPTIDE) gene family has been shown to arrest root growth. Here we report that CEP genes are widespread among seed plants but are not present in land plants that lack true branching roots or root vasculature. We have identified 10 additional CEP genes in Arabidopsis. Expression analysis revealed that CEP genes are regulated by environmental cues such as nitrogen limitation, increased salt levels, increased osmotic strength, and increased CO2 levels in both roots and shoots. Analysis of synthetic CEP variants showed that both peptide sequence and modifications of key amino acids affect CEP biological activity. Analysis of several CEP over-expression lines revealed distinct roles for CEP genes in root and shoot development. A cep3 knockout mutant showed increased root and shoot growth under a range of abiotic stress, nutrient, and light conditions. We demonstrate that CEPs are negative regulators of root development, slowing primary root growth and reducing lateral root formation. We propose that CEPs are negative regulators that mediate environmental influences on plant development.

  18. Transcriptome Analysis of Syringa oblata Lindl. Inflorescence Identifies Genes Associated with Pigment Biosynthesis and Scent Metabolism.

    Directory of Open Access Journals (Sweden)

    Jian Zheng

    Full Text Available Syringa oblata Lindl. is a woody ornamental plant with high economic value and characteristics that include early flowering, multiple flower colors, and strong fragrance. Despite a long history of cultivation, the genetics and molecular biology of S. oblata are poorly understood. Transcriptome and expression profiling data are needed to identify genes and to better understand the biological mechanisms of floral pigments and scents in this species. Nine cDNA libraries were obtained from three replicates of three developmental stages: inflorescence with enlarged flower buds not protruded, inflorescence with corolla lobes not displayed, and inflorescence with flowers fully opened and emitting strong fragrance. Using the Illumina RNA-Seq technique, 319,425,972 clean reads were obtained and were assembled into 104,691 final unigenes (average length of 853 bp, 41.75% of which were annotated in the NCBI non-redundant protein database. Among the annotated unigenes, 36,967 were assigned to gene ontology categories and 19,956 were assigned to eukaryoticorthologous groups. Using the Kyoto Encyclopedia of Genes and Genomes pathway database, 12,388 unigenes were sorted into 286 pathways. Based on these transcriptomic data, we obtained a large number of candidate genes that were differentially expressed at different flower stages and that were related to floral pigment biosynthesis and fragrance metabolism. This comprehensive transcriptomic analysis provides fundamental information on the genes and pathways involved in flower secondary metabolism and development in S. oblata, providing a useful database for further research on S. oblata and other plants of genus Syringa.

  19. A genetic screen for modifiers of UFO meristem activity identifies three novel FUSED FLORAL ORGANS genes required for early flower development in Arabidopsis.

    Science.gov (United States)

    Levin, J Z; Fletcher, J C; Chen, X; Meyerowitz, E M

    1998-06-01

    In a screen to identify novel genes required for early Arabidopsis flower development, we isolated four independent mutations that enhance the Ufo phenotype toward the production of filamentous structures in place of flowers. The mutants fall into three complementation groups, which we have termed FUSED FLORAL ORGANS (FFO) loci. ffo mutants have specific defects in floral organ separation and/or positioning; thus, the FFO genes identify components of a boundary formation mechanism(s) acting between developing floral organ primordia. FFO1 and FFO3 have specific functions in cauline leaf/stem separation and in first- and third-whorl floral organ separation, with FFO3 likely acting to establish and FFO1 to maintain floral organ boundaries. FFO2 acts at early floral stages to regulate floral organ number and positioning and to control organ separation within and between whorls. Plants doubly mutant for two ffo alleles display additive phenotypes, indicating that the FFO genes may act in separate pathways. Plants doubly mutant for an ffo gene and for ufo, lfy, or clv3 reveal that the FFO genes play roles related to those of UFO and LFY in floral meristem initiation and that FFO2 and FFO3 may act to control cell proliferation late in inflorescence development.

  20. Study of genes induced by ionizing radiations at Arabidopsis thaliana: identification and molecular characterization of the ATGR1 gene, a new gene encoding a protein involved in plant cell division

    International Nuclear Information System (INIS)

    Deveaux, Yves

    1999-01-01

    DNA damage, that can be experimentally introduced by ionizing radiation (IR), induces complex signal transduction pathways leading to cell recovery or, alternatively to programmed cell death if damages are too severe. To identify the inducible components of the response to genotoxic stress in plants, we have screened by Differential Display for mRNAs that rapidly and strongly accumulate after IR treatment in A. thaliana cells. We have characterized ATGR1, a new single copy Arabidopsis gene encoding a PEST-box protein of unknown function. In unstressed plant organs the ATGR1 mRNA is hardly detectable, whereas the protein is present in extracts prepared from roots, shoot meristems and inflorescences, that all contain large amounts of actively dividing cells. This pattern is confirmed by immuno localisation on tissue sections that shows constitutive ATGR1 protein expression covering the root elongation zone, the shoot meristem, leaf primordial and the ovules of developing flowers. Histochemical analysis of transgenic plants expressing the GUS reporter gene under the control of the ATGR1 promoter, demonstrate that the developmental and tissue-specific profile of ATGR1 protein expression is conferred by the gene promoter. The massive, transient and dose-dependent accumulation of ATGR1 transcripts after IR treatment observed in all plant organs does not lead to significant changes in ATGR1 protein pattern. Stable ATGR1 protein overexpression, as exemplified by transgenic A. thaliana plants that contain a 35S promoter-ATGR1 gene fusion, does not induce notable changes of the overall ATGR1 protein level, but leads to male and female sterility. The cause of sterility is a lack of correct chromosome assembly and distribution at the stage metaphase II of meiosis. Taken together our results show that i) ATGR1 gene expression is associated to cell division during plant development ii) the ATGR1 protein level is regulated at the transcriptional and post-transcriptional level iii

  1. Plant-bacteria partnership: phytoremediation of hydrocarbons contaminated soil and expression of catabolic genes

    Directory of Open Access Journals (Sweden)

    Hamna Saleem

    2016-01-01

    Full Text Available Petroleum hydrocarbons are harmful to living organisms when they are exposed in natural environment. Once they come in contact, it is not an easy to remove them because many of their constituents are persistent in nature. To achieve this target, different approaches have been exploited by using plants, bacteria, and plant-bacteria together. Among them, combined use of plants and bacteria has gained tremendous attention as bacteria possess set of catabolic genes which produce catabolic enzymes to decontaminate hydrocarbons. In return, plant ooze out root exudates containing nutrients and necessary metabolites which facilitate the microbial colonization in plant rhizosphere. This results into high gene abundance and gene expression in the rhizosphere and, thus, leads to enhanced degradation. Moreover, high proportions of beneficial bacteria helps plant to gain more biomass due to their plant growth promoting activities and production of phytohromones. This review focuses functioning and mechanisms of catabolic genes responsible for degradation of straight chain and aromatic hydrocarbons with their potential of degradation in bioremediation. With the understanding of expression mechanisms, rate of degradation can be enhanced by adjusting environmental factors and acclimatizing plant associated bacteria in plant rhizosphere.

  2. Gene expression from plants grown on the International Space Station

    Science.gov (United States)

    Stimpson, Alexander; Pereira, Rhea; Kiss, John Z.; Correll, Melanie

    Three experiments were performed on the International Space Station (ISS) in 2006 as part of the TROPI experiments. These experiments were performed to study graviTROPIsm and photoTROPIsm responses of Arabidopsis in microgravity (µg). Seedlings were grown with a variety of light and gravitational treatments for approximately five days. The frozen samples were returned to Earth during three space shuttle missions in 2007 and stored at -80° C. Due to the limited amount of plant biomass returned, new protocols were developed to minimize the amount of material needed for RNA extraction as a preparation for microarray analysis. Using these new protocols, RNA was extracted from several sets of seedlings grown in red light followed by blue light with one sample from 1.0g treatment and the other at µg. Using a 2-fold change criterion, microarray (Affymetrix, GeneChip) results showed that 613 genes were upregulated in the µg sample while 757 genes were downregulated. Upregulated genes in response to µg included transcription factors from the WRKY (15 genes), MYB (3) and ZF (8) families as well as those that are involved in auxin responses (10). Downregulated genes also included transcription factors such as MYB (5) and Zinc finger (10) but interestingly only two WRKY family genes were down-regulated during the µg treatment. Studies are underway to compare these results with other samples to identify the genes involved in the gravity and light signal transduction pathways (this project is Supported By: NASA NCC2-1200).

  3. Transcriptomic changes reveal gene networks responding to the overexpression of a blueberry DWARF AND DELAYED FLOWERING 1 gene in transgenic blueberry plants.

    Science.gov (United States)

    Song, Guo-Qing; Gao, Xuan

    2017-06-19

    Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.

  4. The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

    Science.gov (United States)

    Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

    1995-09-01

    The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

  5. Agrobacterium-mediated gene transfer in plants and biosafety considerations.

    Science.gov (United States)

    Mehrotra, Shweta; Goyal, Vinod

    2012-12-01

    Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.

  6. Protein functional links in Trypanosoma brucei, identified by gene fusion analysis

    Directory of Open Access Journals (Sweden)

    Trimpalis Philip

    2011-07-01

    Full Text Available Abstract Background Domain or gene fusion analysis is a bioinformatics method for detecting gene fusions in one organism by comparing its genome to that of other organisms. The occurrence of gene fusions suggests that the two original genes that participated in the fusion are functionally linked, i.e. their gene products interact either as part of a multi-subunit protein complex, or in a metabolic pathway. Gene fusion analysis has been used to identify protein functional links in prokaryotes as well as in eukaryotic model organisms, such as yeast and Drosophila. Results In this study we have extended this approach to include a number of recently sequenced protists, four of which are pathogenic, to identify fusion linked proteins in Trypanosoma brucei, the causative agent of African sleeping sickness. We have also examined the evolution of the gene fusion events identified, to determine whether they can be attributed to fusion or fission, by looking at the conservation of the fused genes and of the individual component genes across the major eukaryotic and prokaryotic lineages. We find relatively limited occurrence of gene fusions/fissions within the protist lineages examined. Our results point to two trypanosome-specific gene fissions, which have recently been experimentally confirmed, one fusion involving proteins involved in the same metabolic pathway, as well as two novel putative functional links between fusion-linked protein pairs. Conclusions This is the first study of protein functional links in T. brucei identified by gene fusion analysis. We have used strict thresholds and only discuss results which are highly likely to be genuine and which either have already been or can be experimentally verified. We discuss the possible impact of the identification of these novel putative protein-protein interactions, to the development of new trypanosome therapeutic drugs.

  7. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Xiangshu Dong

    Full Text Available Genome-wide dissection of the heat stress response (HSR is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT: 5.2% (2,142 genes in Chiifu and 3.7% (1,535 genes in Kenshin. The most enriched GO (Gene Ontology items included 'response to heat', 'response to reactive oxygen species (ROS', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps and heat shock factor (Hsf-like proteins such as HsfB2A (Bra029292, whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853, protein kinases, and phosphatases. Among heat stress (HS marker genes in Arabidopsis, only exportin 1A (XPO1A (Bra008580, Bra006382 can be applied to B. rapa for basal thermotolerance (BT and short-term acquired thermotolerance (SAT gene. CYP707A3 (Bra025083, Bra021965, which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF genes, including DREB2A (Bra005852, were involved in HS tolerance in both lines, Bra024224 (MYB41 and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1] were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a

  8. Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

    Science.gov (United States)

    Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

    2017-04-01

    Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

  9. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    Energy Technology Data Exchange (ETDEWEB)

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  10. Genome-wide mapping of virulence in brown planthopper identifies loci that break down host plant resistance.

    Science.gov (United States)

    Jing, Shengli; Zhang, Lei; Ma, Yinhua; Liu, Bingfang; Zhao, Yan; Yu, Hangjin; Zhou, Xi; Qin, Rui; Zhu, Lili; He, Guangcun

    2014-01-01

    Insects and plants have coexisted for over 350 million years and their interactions have affected ecosystems and agricultural practices worldwide. Variation in herbivorous insects' virulence to circumvent host resistance has been extensively documented. However, despite decades of investigation, the genetic foundations of virulence are currently unknown. The brown planthopper (Nilaparvata lugens) is the most destructive rice (Oryza sativa) pest in the world. The identification of the resistance gene Bph1 and its introduction in commercial rice varieties prompted the emergence of a new virulent brown planthopper biotype that was able to break the resistance conferred by Bph1. In this study, we aimed to construct a high density linkage map for the brown planthopper and identify the loci responsible for its virulence in order to determine their genetic architecture. Based on genotyping data for hundreds of molecular markers in three mapping populations, we constructed the most comprehensive linkage map available for this species, covering 96.6% of its genome. Fifteen chromosomes were anchored with 124 gene-specific markers. Using genome-wide scanning and interval mapping, the Qhp7 locus that governs preference for Bph1 plants was mapped to a 0.1 cM region of chromosome 7. In addition, two major QTLs that govern the rate of insect growth on resistant rice plants were identified on chromosomes 5 (Qgr5) and 14 (Qgr14). This is the first study to successfully locate virulence in the genome of this important agricultural insect by marker-based genetic mapping. Our results show that the virulence which overcomes the resistance conferred by Bph1 is controlled by a few major genes and that the components of virulence originate from independent genetic characters. The isolation of these loci will enable the elucidation of the molecular mechanisms underpinning the rice-brown planthopper interaction and facilitate the development of durable approaches for controlling this most

  11. Genome-wide mapping of virulence in brown planthopper identifies loci that break down host plant resistance.

    Directory of Open Access Journals (Sweden)

    Shengli Jing

    Full Text Available Insects and plants have coexisted for over 350 million years and their interactions have affected ecosystems and agricultural practices worldwide. Variation in herbivorous insects' virulence to circumvent host resistance has been extensively documented. However, despite decades of investigation, the genetic foundations of virulence are currently unknown. The brown planthopper (Nilaparvata lugens is the most destructive rice (Oryza sativa pest in the world. The identification of the resistance gene Bph1 and its introduction in commercial rice varieties prompted the emergence of a new virulent brown planthopper biotype that was able to break the resistance conferred by Bph1. In this study, we aimed to construct a high density linkage map for the brown planthopper and identify the loci responsible for its virulence in order to determine their genetic architecture. Based on genotyping data for hundreds of molecular markers in three mapping populations, we constructed the most comprehensive linkage map available for this species, covering 96.6% of its genome. Fifteen chromosomes were anchored with 124 gene-specific markers. Using genome-wide scanning and interval mapping, the Qhp7 locus that governs preference for Bph1 plants was mapped to a 0.1 cM region of chromosome 7. In addition, two major QTLs that govern the rate of insect growth on resistant rice plants were identified on chromosomes 5 (Qgr5 and 14 (Qgr14. This is the first study to successfully locate virulence in the genome of this important agricultural insect by marker-based genetic mapping. Our results show that the virulence which overcomes the resistance conferred by Bph1 is controlled by a few major genes and that the components of virulence originate from independent genetic characters. The isolation of these loci will enable the elucidation of the molecular mechanisms underpinning the rice-brown planthopper interaction and facilitate the development of durable approaches for

  12. Endophytic Herbaspirillum seropedicae expresses nif genes in gramineous plants.

    Science.gov (United States)

    Roncato-Maccari, Lauren D B; Ramos, Humberto J O; Pedrosa, Fabio O; Alquini, Yedo; Chubatsu, Leda S; Yates, Marshall G; Rigo, Liu U; Steffens, Maria Berenice R; Souza, Emanuel M

    2003-07-01

    Abstract The interactions between maize, sorghum, wheat and rice plants and Herbaspirillum seropedicae were examined microscopically following inoculation with the H. seropedicae LR15 strain, a Nif(+) (Pnif::gusA) mutant obtained by the insertion of a gusA-kanamycin cassette into the nifH gene of the H. seropedicae wild-type strain. The expression of the Pnif::gusA fusion was followed during the association of the diazotroph with the gramineous species. Histochemical analysis of seedlings of maize, sorghum, wheat and rice grown in vermiculite showed that strain LR15 colonized root surfaces and inner tissues. In early steps of the endophytic association, H. seropedicae colonized root exudation sites, such as axils of secondary roots and intercellular spaces of the root cortex; it then occupied the vascular tissue and there expressed nif genes. The expression of nif genes occurred in roots, stems and leaves as detected by the GUS reporter system. The expression of nif genes was also observed in bacterial colonies located in the external mucilaginous root material, 8 days after inoculation. Moreover, the colonization of plant tissue by H. seropedicae did not depend on the nitrogen-fixing ability, since similar numbers of cells were isolated from roots or shoots of the plants inoculated with Nif(+) or Nif(-) strains.

  13. Isolation and functional characterization of JcFT, a FLOWERING LOCUS T (FT) homologous gene from the biofuel plant Jatropha curcas.

    Science.gov (United States)

    Li, Chaoqiong; Luo, Li; Fu, Qiantang; Niu, Longjian; Xu, Zeng-Fu

    2014-05-08

    Physic nut (Jatropha curcas L.) is a potential feedstock for biofuel production because Jatropha oil is highly suitable for the production of the biodiesel and bio-jet fuels. However, Jatropha exhibits low seed yield as a result of unreliable and poor flowering. FLOWERING LOCUS T (FT) -like genes are important flowering regulators in higher plants. To date, the flowering genes in Jatropha have not yet been identified or characterized. To better understand the genetic control of flowering in Jatropha, an FT homolog was isolated from Jatropha and designated as JcFT. Sequence analysis and phylogenetic relationship of JcFT revealed a high sequence similarity with the FT genes of Litchi chinensis, Populus nigra and other perennial plants. JcFT was expressed in all tissues of adult plants except young leaves, with the highest expression level in female flowers. Overexpression of JcFT in Arabidopsis and Jatropha using the constitutive promoter cauliflower mosaic virus 35S or the phloem-specific promoter Arabidopsis SUCROSE TRANSPORTER 2 promoter resulted in an extremely early flowering phenotype. Furthermore, several flowering genes downstream of JcFT were up-regulated in the JcFT-overexpression transgenic plant lines. JcFT may encode a florigen that acts as a key regulator in flowering pathway. This study is the first to functionally characterize a flowering gene, namely, JcFT, in the biofuel plant Jatropha.

  14. Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum

    Directory of Open Access Journals (Sweden)

    Yuanman Tang

    2017-11-01

    Full Text Available Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA-responsive genes NtPR1a/c, NtPR2 and NtCHN50, JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26. Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum. Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

  15. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  16. Plant breeding by using radiation mutation - Development of radiation indicator plants by molecular breeding

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Jang Ryol; Kwak, Sang Soo; Kwon, Seok Yoon [Korea Research Institute of Bioscience and Biotechnology, Taejon (Korea)

    2000-04-01

    - tSOD1, cytosolic CuZnSOD cDNA was cloned from tobacco cDNA library by PCR. To develop the under-producing the transgenic plants, the vectors were constructed using by antisense and co-supressing technology. The transgenic tobacco plants were confirmed that over 60% of kanamycin-resistant plants were introduced the foreign gene by PCR and transformed one copy through Southern blot analysis. - In an attempt to identify marker genes for gamma irradiation of plants, expression patterns of diverse genes upon gamma irradiation of young tobacco plants were investigated. With the knowledge of distinctive expression patterns of diverse genes, irradiation-indicating marker plants could be developed by engineering and monitoring multiple radiation-responsive genes. Additionally, a gamma irradiation-responsive NtTMK1 receptor-like kinase gene was molecular biologically characterized. -Uranium reductase gene (Cytochrome C3) and radiation resistance gene (recA) have been cloned from Desulfovibrio and Deinococcus radiodurans. -Two plant transformation vectors (pCYC3 and pDrecA) have been constructed. - Tobacco transgenic plants of have been obtained. 52 refs., 5 figs. (Author)

  17. Genes associated with thermosensitive genic male sterility in rice identified by comparative expression profiling.

    Science.gov (United States)

    Pan, Yufang; Li, Qiaofeng; Wang, Zhizheng; Wang, Yang; Ma, Rui; Zhu, Lili; He, Guangcun; Chen, Rongzhi

    2014-12-16

    Thermosensitive genic male sterile (TGMS) lines and photoperiod-sensitive genic male sterile (PGMS) lines have been successfully used in hybridization to improve rice yields. However, the molecular mechanisms underlying male sterility transitions in most PGMS/TGMS rice lines are unclear. In the recently developed TGMS-Co27 line, the male sterility is based on co-suppression of a UDP-glucose pyrophosphorylase gene (Ugp1), but further study is needed to fully elucidate the molecular mechanisms involved. Microarray-based transcriptome profiling of TGMS-Co27 and wild-type Hejiang 19 (H1493) plants grown at high and low temperatures revealed that 15462 probe sets representing 8303 genes were differentially expressed in the two lines, under the two conditions, or both. Environmental factors strongly affected global gene expression. Some genes important for pollen development were strongly repressed in TGMS-Co27 at high temperature. More significantly, series-cluster analysis of differentially expressed genes (DEGs) between TGMS-Co27 plants grown under the two conditions showed that low temperature induced the expression of a gene cluster. This cluster was found to be essential for sterility transition. It includes many meiosis stage-related genes that are probably important for thermosensitive male sterility in TGMS-Co27, inter alia: Arg/Ser-rich domain (RS)-containing zinc finger proteins, polypyrimidine tract-binding proteins (PTBs), DEAD/DEAH box RNA helicases, ZOS (C2H2 zinc finger proteins of Oryza sativa), at least one polyadenylate-binding protein and some other RNA recognition motif (RRM) domain-containing proteins involved in post-transcriptional processes, eukaryotic initiation factor 5B (eIF5B), ribosomal proteins (L37, L1p/L10e, L27 and L24), aminoacyl-tRNA synthetases (ARSs), eukaryotic elongation factor Tu (eEF-Tu) and a peptide chain release factor protein involved in translation. The differential expression of 12 DEGs that are important for pollen

  18. Cartilage-selective genes identified in genome-scale analysis of non-cartilage and cartilage gene expression

    Directory of Open Access Journals (Sweden)

    Cohn Zachary A

    2007-06-01

    Full Text Available Abstract Background Cartilage plays a fundamental role in the development of the human skeleton. Early in embryogenesis, mesenchymal cells condense and differentiate into chondrocytes to shape the early skeleton. Subsequently, the cartilage anlagen differentiate to form the growth plates, which are responsible for linear bone growth, and the articular chondrocytes, which facilitate joint function. However, despite the multiplicity of roles of cartilage during human fetal life, surprisingly little is known about its transcriptome. To address this, a whole genome microarray expression profile was generated using RNA isolated from 18–22 week human distal femur fetal cartilage and compared with a database of control normal human tissues aggregated at UCLA, termed Celsius. Results 161 cartilage-selective genes were identified, defined as genes significantly expressed in cartilage with low expression and little variation across a panel of 34 non-cartilage tissues. Among these 161 genes were cartilage-specific genes such as cartilage collagen genes and 25 genes which have been associated with skeletal phenotypes in humans and/or mice. Many of the other cartilage-selective genes do not have established roles in cartilage or are novel, unannotated genes. Quantitative RT-PCR confirmed the unique pattern of gene expression observed by microarray analysis. Conclusion Defining the gene expression pattern for cartilage has identified new genes that may contribute to human skeletogenesis as well as provided further candidate genes for skeletal dysplasias. The data suggest that fetal cartilage is a complex and transcriptionally active tissue and demonstrate that the set of genes selectively expressed in the tissue has been greatly underestimated.

  19. Comparative Transcriptome Analysis Identifies Putative Genes Involved in the Biosynthesis of Xanthanolides in Xanthium strumarium L.

    Directory of Open Access Journals (Sweden)

    Yuanjun Li

    2016-08-01

    Full Text Available Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones, which include the xanthanolides. To date, the biogenesis of xanthanolides, especiallytheir downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes, which were derived from the young leaves of two different cultivars and the purified glandular trichomes from one of the cultivars, were constructed in this study. In total, 157 million clean reads were generated and assembled into 91,861 unigenes, of which 59,858 unigenes were successfully annotated. All the genes coding for known enzymes in the upstream pathway to the biosynthesis of xanthanolides were present in the X. strumarium transcriptomes. From a comparative analysis of the X. strumarium transcriptomes, this study identified a number of gene candidates that are putatively involved in the downstream pathway to the synthesis of xanthanolides, such as four unigenes encoding CYP71 P450s, 50 unigenes for dehydrogenases, and 27 genes for acetyltransferases. The possible functions of these four CYP71 candidates are extensively discussed. In addition, 116 transcription factors that were highly expressed in X. strumarium glandular trichomes were also identified. Their possible regulatory roles in the biosynthesis of sesquiterpene lactones are discussed. The global transcriptomic data for X. strumarium should provide a valuable resource for further research into the biosynthesis of xanthanolides.

  20. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

    Science.gov (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

    1996-04-01

    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  1. Identifying Differences in Abiotic Stress Gene Networks between Lowland and Upland Ecotypes of Switchgrass (DE-SC0008338)

    Energy Technology Data Exchange (ETDEWEB)

    Childs, Kevin [Michigan State Univ., East Lansing, MI (United States); Buell, Robin [Michigan State Univ., East Lansing, MI (United States); Zhao, Bingyu [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States); Zhang, Xunzhong [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States)

    2016-11-10

    Switchgrass (Panicum virgatum) is a warm-season C4 grass that is a target lignocellulosic biofuel species for use in the United States due to its local adaption capabilities and high biomass accumulation. Two ecotypes of switchgrass have been described. Members of the lowland ecotype are taller, have narrower leaf blades and generate more biomass compared to individuals from the upland ecotype. Additionally, lowland plants are generally found in the southern United States while upland switchgrass is more typically present in the northern United States. These differences are important as it is envisioned that switchgrass for biofuel production will typically be grown on marginal lands in the northern United States to supplement and diversify farmers' traditional crop incomes. While lowland switchgrass is more productive, it has poor winter survivability in northern latitudes where upland switchgrass is expected to be grown for biofuel use. Abiotic stresses likely to be encountered by switchgrass include drought and salinity. Despite initially being described as preferring wetter environments, members of the lowland ecotype have been characterized as being more drought tolerant than plants of the upland ecotype. Nonetheless, direct trials have indicated that variation for drought tolerance exists in both ecotypes, but prior to this project, only a relatively small number of switchgrass lines had been tested for drought responses. Similarly, switchgrass cultivars have not been widely tested for salt tolerance, but a few studies have shown that even mild salt stress can inhibit growth. The effects of drought and salt stress on plant growth are complex. Both drought and salinity affect the osmotic potential of plant cells and negatively affect plant growth due to reduced water potential and reduced photosynthesis that results from lower stomatal conductance of CO2. Plants respond to drought and salt stress by activating genes that directly attempt to

  2. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  3. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  4. Plant Genes Involved in Symbiotic Sinal Perception/Signal Transduction

    DEFF Research Database (Denmark)

    Binder, A; Soyano, T; Hayashi, H

    2014-01-01

    to nodule primordia formation, and the infection thread initiation in the root hairs guiding bacteria towards dividing cortical cells. This chapter focuses on the plant genes involved in the recognition of the symbiotic signal produced by rhizobia, and the downstream genes, which are part of a complex...... symbiotic signalling pathway that leads to the generation of calcium spiking in the nuclear regions and activation of transcription factors controlling symbiotic genes induction...

  5. A systems biology approach identifies a R2R3 MYB gene subfamily with distinct and overlapping functions in regulation of aliphatic glucosinolates.

    Directory of Open Access Journals (Sweden)

    Ida Elken Sønderby

    Full Text Available BACKGROUND: Glucosinolates are natural metabolites in the order Brassicales that defend plants against both herbivores and pathogens and can attract specialized insects. Knowledge about the genes controlling glucosinolate regulation is limited. Here, we identify three R2R3 MYB transcription factors regulating aliphatic glucosinolate biosynthesis in Arabidopsis by combining several systems biology tools. METHODOLOGY/PRINCIPAL FINDINGS: MYB28 was identified as a candidate regulator of aliphatic glucosinolates based on its co-localization within a genomic region controlling variation both in aliphatic glucosinolate content (metabolite QTL and in transcript level for genes involved in the biosynthesis of aliphatic glucosinolates (expression QTL, as well as its co-expression with genes in aliphatic glucosinolate biosynthesis. A phylogenetic analysis with the R2R3 motif of MYB28 showed that it and two homologues, MYB29 and MYB76, were members of an Arabidopsis-specific clade that included three characterized regulators of indole glucosinolates. Over-expression of the individual MYB genes showed that they all had the capacity to increase the production of aliphatic glucosinolates in leaves and seeds and induce gene expression of aliphatic biosynthetic genes within leaves. Analysis of leaves and seeds of single knockout mutants showed that mutants of MYB29 and MYB76 have reductions in only short-chained aliphatic glucosinolates whereas a mutant in MYB28 has reductions in both short- and long-chained aliphatic glucosinolates. Furthermore, analysis of a double knockout in MYB28 and MYB29 identified an emergent property of the system since the absence of aliphatic glucosinolates in these plants could not be predicted by the chemotype of the single knockouts. CONCLUSIONS/SIGNIFICANCE: It seems that these cruciferous-specific MYB regulatory genes have evolved both overlapping and specific regulatory capacities. This provides a unique system within which to

  6. [Viability of 7 kinds of medicinal plant seeds stored in medium-term gene bank of the National Medicinal Plant Gene Bank].

    Science.gov (United States)

    Jin, Yue; Yang, Cheng-Min; Wei, Jian-He

    2016-05-01

    In order to evaluate seed viability of Platycodon grandiflorum, Schizonepeta tenuifolia, Andrographis paniculat, Codonopsis pilosula, Scutellaria baicalensis, Leonurus japonicus, Rabdosia rubescens, stored in the medium-term gene bank of the National Medicinal Plant Gene Bank for 4 years, we tested seed germination rate of 7 species of medicinal plant and analyzed the change of significance of levels of the germination rate in pre and post store. Seed germination rates of 7 species of medicinal plants were all decreased after 4 years, and the decrease of S. tenuifolia and S. baicalensis germination rates were much smaller than other species. The higher initial germination rate of P. grandiflorum, C. pilosula, R. rubescens seed has the smaller decline of germination rate, but the data of A. paniculata showed the opposite trend. The rate decline of the germination of S. tenuifolia and S. baicalensis was roughly the same in different germination rate interval. The results showed that low temperature storage could effectively prolong the seed longevity, and maintain the seed vigor. Moreover, it is necessary to study on the storage characteristics of the main medicinal plant seeds, and establish the monitoring plan and regeneration standard. Copyright© by the Chinese Pharmaceutical Association.

  7. Gene Signature in Sessile Serrated Polyps Identifies Colon Cancer Subtype

    Science.gov (United States)

    Kanth, Priyanka; Bronner, Mary P.; Boucher, Kenneth M.; Burt, Randall W.; Neklason, Deborah W.; Hagedorn, Curt H.; Delker, Don A.

    2016-01-01

    Sessile serrated colon adenoma/polyps (SSA/Ps) are found during routine screening colonoscopy and may account for 20–30% of colon cancers. However, differentiating SSA/Ps from hyperplastic polyps (HP) with little risk of cancer is challenging and complementary molecular markers are needed. Additionally, the molecular mechanisms of colon cancer development from SSA/Ps are poorly understood. RNA sequencing was performed on 21 SSA/Ps, 10 HPs, 10 adenomas, 21 uninvolved colon and 20 control colon specimens. Differential expression and leave-one-out cross validation methods were used to define a unique gene signature of SSA/Ps. Our SSA/P gene signature was evaluated in colon cancer RNA-Seq data from The Cancer Genome Atlas (TCGA) to identify a subtype of colon cancers that may develop from SSA/Ps. A total of 1422 differentially expressed genes were found in SSA/Ps relative to controls. Serrated polyposis syndrome (n=12) and sporadic SSA/Ps (n=9) exhibited almost complete (96%) gene overlap. A 51-gene panel in SSA/P showed similar expression in a subset of TCGA colon cancers with high microsatellite instability (MSI-H). A smaller seven-gene panel showed high sensitivity and specificity in identifying BRAF mutant, CpG island methylator phenotype high (CIMP-H) and MLH1 silenced colon cancers. We describe a unique gene signature in SSA/Ps that identifies a subset of colon cancers likely to develop through the serrated pathway. These gene panels may be utilized for improved differentiation of SSA/Ps from HPs and provide insights into novel molecular pathways altered in colon cancer arising from the serrated pathway. PMID:27026680

  8. Arabidopsis female gametophyte gene expression map reveals similarities between plant and animal gametes.

    Science.gov (United States)

    Wuest, Samuel E; Vijverberg, Kitty; Schmidt, Anja; Weiss, Manuel; Gheyselinck, Jacqueline; Lohr, Miriam; Wellmer, Frank; Rahnenführer, Jörg; von Mering, Christian; Grossniklaus, Ueli

    2010-03-23

    The development of multicellular organisms is controlled by differential gene expression whereby cells adopt distinct fates. A spatially resolved view of gene expression allows the elucidation of transcriptional networks that are linked to cellular identity and function. The haploid female gametophyte of flowering plants is a highly reduced organism: at maturity, it often consists of as few as three cell types derived from a common precursor [1, 2]. However, because of its inaccessibility and small size, we know little about the molecular basis of cell specification and differentiation in the female gametophyte. Here we report expression profiles of all cell types in the mature Arabidopsis female gametophyte. Differentially expressed posttranscriptional regulatory modules and metabolic pathways characterize the distinct cell types. Several transcription factor families are overrepresented in the female gametophyte in comparison to other plant tissues, e.g., type I MADS domain, RWP-RK, and reproductive meristem transcription factors. PAZ/Piwi-domain encoding genes are upregulated in the egg, indicating a role of epigenetic regulation through small RNA pathways-a feature paralleled in the germline of animals [3]. A comparison of human and Arabidopsis egg cells for enrichment of functional groups identified several similarities that may represent a consequence of coevolution or ancestral gametic features. 2010 Elsevier Ltd. All rights reserved.

  9. De Novo Transcriptome Sequencing in Passiflora edulis Sims to Identify Genes and Signaling Pathways Involved in Cold Tolerance

    Directory of Open Access Journals (Sweden)

    Sian Liu

    2017-11-01

    Full Text Available The passion fruit (Passiflora edulis Sims, also known as the purple granadilla, is widely cultivated as the new darling of the fruit market throughout southern China. This exotic and perennial climber is adapted to warm and humid climates, and thus is generally intolerant of cold. There is limited information about gene regulation and signaling pathways related to the cold stress response in this species. In this study, two transcriptome libraries (KEDU_AP vs. GX_AP were constructed from the aerial parts of cold-tolerant and cold-susceptible varieties of P. edulis, respectively. Overall, 126,284,018 clean reads were obtained, and 86,880 unigenes with a mean size of 1449 bp were assembled. Of these, there were 64,067 (73.74% unigenes with significant similarity to publicly available plant protein sequences. Expression profiles were generated, and 3045 genes were found to be significantly differentially expressed between the KEDU_AP and GX_AP libraries, including 1075 (35.3% up-regulated and 1970 (64.7% down-regulated. These included 36 genes in enriched pathways of plant hormone signal transduction, and 56 genes encoding putative transcription factors. Six genes involved in the ICE1–CBF–COR pathway were induced in the cold-tolerant variety, and their expression levels were further verified using quantitative real-time PCR. This report is the first to identify genes and signaling pathways involved in cold tolerance using high-throughput transcriptome sequencing in P. edulis. These findings may provide useful insights into the molecular mechanisms regulating cold tolerance and genetic breeding in Passiflora spp.

  10. Connecting infrared spectra with plant traits to identify species

    Science.gov (United States)

    Buitrago, Maria F.; Skidmore, Andrew K.; Groen, Thomas A.; Hecker, Christoph A.

    2018-05-01

    Plant traits are used to define species, but also to evaluate the health status of forests, plantations and crops. Conventional methods of measuring plant traits (e.g. wet chemistry), although accurate, are inefficient and costly when applied over large areas or with intensive sampling. Spectroscopic methods, as used in the food industry and mineralogy, are nowadays applied to identify plant traits, however, most studies analysed visible to near infrared, while infrared spectra of longer wavelengths have been little used for identifying the spectral differences between plant species. This study measured the infrared spectra (1.4-16.0 μm) on individual, fresh leaves of 19 species (from herbaceous to woody species), as well as 14 leaf traits for each leaf. The results describe at which wavelengths in the infrared the leaves' spectra can differentiate most effectively between these plant species. A Quadratic Discrimination Analysis (QDA) shows that using five bands in the SWIR or the LWIR is enough to accurately differentiate these species (Kappa: 0.93, 0.94 respectively), while the MWIR has a lower classification accuracy (Kappa: 0.84). This study also shows that in the infrared spectra of fresh leaves, the identified species-specific features are correlated with leaf traits as well as changes in their values. Spectral features in the SWIR (1.66, 1.89 and 2.00 μm) are common to all species and match the main features of pure cellulose and lignin spectra. The depth of these features varies with changes of cellulose and leaf water content and can be used to differentiate species in this region. In the MWIR and LWIR, the absorption spectra of leaves are formed by key species-specific traits including lignin, cellulose, water, nitrogen and leaf thickness. The connection found in this study between leaf traits, features and spectral signatures are novel tools to assist when identifying plant species by spectroscopy and remote sensing.

  11. PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.

    Science.gov (United States)

    Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R

    2018-01-04

    The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. UV-C-Induced alleviation of transcriptional gene silencing through plant-plant communication: Key roles of jasmonic acid and salicylic acid pathways.

    Science.gov (United States)

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-08-01

    Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Identifying and Selecting Plants for the Landscape. Volume 23, Number 5.

    Science.gov (United States)

    Rodekohr, Sherie; Harris, Clark Richard

    This handbook on identifying and selecting landscape plants can be used as a reference in landscaping courses or on an individual basis. The first of two sections, Identifying Plants for the Landscape, contains the following tables: shade tree identification; flowering tree identification; evergreen tree identification; flowering shrub…

  14. Characterization of MORE AXILLARY GROWTH genes in Populus.

    Directory of Open Access Journals (Sweden)

    Olaf Czarnecki

    Full Text Available Strigolactones are a new class of plant hormones that play a key role in regulating shoot branching. Studies of branching mutants in Arabidopsis, pea, rice and petunia have identified several key genes involved in strigolactone biosynthesis or signaling pathway. In the model plant Arabidopsis, MORE AXILLARY GROWTH1 (MAX1, MAX2, MAX3 and MAX4 are four founding members of strigolactone pathway genes. However, little is known about the strigolactone pathway genes in the woody perennial plants.Here we report the identification of MAX homologues in the woody model plant Populus trichocarpa. We identified the sequence homologues for each MAX protein in P. trichocarpa. Gene expression analysis revealed that Populus MAX paralogous genes are differentially expressed across various tissues and organs. Furthermore, we showed that Populus MAX genes could complement or partially complement the shoot branching phenotypes of the corresponding Arabidopsis max mutants.This study provides genetic evidence that strigolactone pathway genes are likely conserved in the woody perennial plants and lays a foundation for further characterization of strigolactone pathway and its functions in the woody perennial plants.

  15. [Expression of plant antimicrobial peptide pro-SmAMP2 gene increases resistance of transgenic potato plants to Alternaria and Fusarium pathogens].

    Science.gov (United States)

    Vetchinkina, E M; Komakhina, V V; Vysotskii, D A; Zaitsev, D V; Smirnov, A N; Babakov, A V; Komakhin, R A

    2016-09-01

    The chickweed (Stellaria media L.) pro-SmAMP2 gene encodes the hevein-like peptides that have in vitro antimicrobial activity against certain harmful microorganisms. These peptides play an important role in protecting the chickweed plants from infection, and the pro-SmAMP2 gene was previously used to protect transgenic tobacco and Arabidopsis plants from phytopathogens. In this study, the pro-SmAMP2 gene under control of viral CaMV35S promoter or under control of its own pro-SmAMP2 promoter was transformed into cultivated potato plants of two cultivars, differing in the resistance to Alternaria: Yubiley Zhukova (resistant) and Skoroplodny (susceptible). With the help of quantitative real-time PCR, it was demonstrated that transgenic potato plants expressed the pro-SmAMP2 gene under control of both promoters at the level comparable to or exceeding the level of the potato actin gene. Assessment of the immune status of the transformants demonstrated that expression of antimicrobial peptide pro-SmAMP2 gene was able to increase the resistance to a complex of Alternaria sp. and Fusarium sp. phytopathogens only in potato plants of the Yubiley Zhukova cultivar. The possible role of the pro-SmAMP2 products in protecting potatoes from Alternaria sp. and Fusarium sp. is discussed.

  16. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  17. Cross-species multiple environmental stress responses: An integrated approach to identify candidate genes for multiple stress tolerance in sorghum (Sorghum bicolor (L. Moench and related model species.

    Directory of Open Access Journals (Sweden)

    Adugna Abdi Woldesemayat

    Full Text Available Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations.In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO, Trait Ontology (TO, Plant Ontology (PO, Growth Ontology (GRO and Environment Ontology (EO were used to semantically integrate drought related information.Target genes linked to Quantitative Trait Loci (QTLs controlling yield and stress tolerance in sorghum (Sorghum bicolor (L. Moench and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%, salt (32%, cold (20%, heat (8% and oxidative stress (25% were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs

  18. Implication of the changing concept of genes on plant breeder’s work

    Directory of Open Access Journals (Sweden)

    Marco Aurélio D. Dias

    2011-01-01

    Full Text Available The recent genome sequencing of some species has accumulated evidence that for a large number of traits, thecontrol and action of genes are far more complex than previously thought. This article discusses possible implications of newinsights into the gene concept on the work of plant breeders. Apparently, the successful application of biotechnological techniques is not as simple as once assumed. The evident changes in the available concept of genes confirmed what the past experience had shown,i.e, selection should focus on the phenotype, under the same conditions as the plant is to be cultivated in. Advanced vocationaltraining of plant breeders must be continuously maintained, focusing on phenotype-based selection in as accurate as possibleexperiments.

  19. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  20. An ant-plant mutualism through the lens of cGMP-dependent kinase genes.

    Science.gov (United States)

    Malé, Pierre-Jean G; Turner, Kyle M; Doha, Manjima; Anreiter, Ina; Allen, Aaron M; Sokolowski, Marla B; Frederickson, Megan E

    2017-09-13

    In plant-animal mutualisms, how an animal forages often determines how much benefit its plant partner receives. In many animals, foraging behaviour changes in response to foraging gene expression or activation of the cGMP-dependent protein kinase (PKG) that foraging encodes. Here, we show that this highly conserved molecular mechanism affects the outcome of a plant-animal mutualism. We studied the two PKG genes of Allomerus octoarticulatus, an Amazonian ant that defends the ant-plant Cordia nodosa against herbivores. Some ant colonies are better 'bodyguards' than others. Working in the field in Peru, we found that colonies fed with a PKG activator recruited more workers to attack herbivores than control colonies. This resulted in less herbivore damage. PKG gene expression in ant workers correlated with whether an ant colony discovered an herbivore and how much damage herbivores inflicted on leaves in a complex way; natural variation in expression levels of the two genes had significant interaction effects on ant behaviour and herbivory. Our results suggest a molecular basis for ant protection of plants in this mutualism. © 2017 The Author(s).

  1. QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD

    Science.gov (United States)

    Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...

  2. The Integrative Method Based on the Module-Network for Identifying Driver Genes in Cancer Subtypes

    Directory of Open Access Journals (Sweden)

    Xinguo Lu

    2018-01-01

    Full Text Available With advances in next-generation sequencing(NGS technologies, a large number of multiple types of high-throughput genomics data are available. A great challenge in exploring cancer progression is to identify the driver genes from the variant genes by analyzing and integrating multi-types genomics data. Breast cancer is known as a heterogeneous disease. The identification of subtype-specific driver genes is critical to guide the diagnosis, assessment of prognosis and treatment of breast cancer. We developed an integrated frame based on gene expression profiles and copy number variation (CNV data to identify breast cancer subtype-specific driver genes. In this frame, we employed statistical machine-learning method to select gene subsets and utilized an module-network analysis method to identify potential candidate driver genes. The final subtype-specific driver genes were acquired by paired-wise comparison in subtypes. To validate specificity of the driver genes, the gene expression data of these genes were applied to classify the patient samples with 10-fold cross validation and the enrichment analysis were also conducted on the identified driver genes. The experimental results show that the proposed integrative method can identify the potential driver genes and the classifier with these genes acquired better performance than with genes identified by other methods.

  3. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  4. Gene expression patterns combined with network analysis identify hub genes associated with bladder cancer.

    Science.gov (United States)

    Bi, Dongbin; Ning, Hao; Liu, Shuai; Que, Xinxiang; Ding, Kejia

    2015-06-01

    To explore molecular mechanisms of bladder cancer (BC), network strategy was used to find biomarkers for early detection and diagnosis. The differentially expressed genes (DEGs) between bladder carcinoma patients and normal subjects were screened using empirical Bayes method of the linear models for microarray data package. Co-expression networks were constructed by differentially co-expressed genes and links. Regulatory impact factors (RIF) metric was used to identify critical transcription factors (TFs). The protein-protein interaction (PPI) networks were constructed by the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) and clusters were obtained through molecular complex detection (MCODE) algorithm. Centralities analyses for complex networks were performed based on degree, stress and betweenness. Enrichment analyses were performed based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. Co-expression networks and TFs (based on expression data of global DEGs and DEGs in different stages and grades) were identified. Hub genes of complex networks, such as UBE2C, ACTA2, FABP4, CKS2, FN1 and TOP2A, were also obtained according to analysis of degree. In gene enrichment analyses of global DEGs, cell adhesion, proteinaceous extracellular matrix and extracellular matrix structural constituent were top three GO terms. ECM-receptor interaction, focal adhesion, and cell cycle were significant pathways. Our results provide some potential underlying biomarkers of BC. However, further validation is required and deep studies are needed to elucidate the pathogenesis of BC. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. A search engine to identify pathway genes from expression data on multiple organisms

    Directory of Open Access Journals (Sweden)

    Zambon Alexander C

    2007-05-01

    Full Text Available Abstract Background The completion of several genome projects showed that most genes have not yet been characterized, especially in multicellular organisms. Although most genes have unknown functions, a large collection of data is available describing their transcriptional activities under many different experimental conditions. In many cases, the coregulatation of a set of genes across a set of conditions can be used to infer roles for genes of unknown function. Results We developed a search engine, the Multiple-Species Gene Recommender (MSGR, which scans gene expression datasets from multiple organisms to identify genes that participate in a genetic pathway. The MSGR takes a query consisting of a list of genes that function together in a genetic pathway from one of six organisms: Homo sapiens, Drosophila melanogaster, Caenorhabditis elegans, Saccharomyces cerevisiae, Arabidopsis thaliana, and Helicobacter pylori. Using a probabilistic method to merge searches, the MSGR identifies genes that are significantly coregulated with the query genes in one or more of those organisms. The MSGR achieves its highest accuracy for many human pathways when searches are combined across species. We describe specific examples in which new genes were identified to be involved in a neuromuscular signaling pathway and a cell-adhesion pathway. Conclusion The search engine can scan large collections of gene expression data for new genes that are significantly coregulated with a pathway of interest. By integrating searches across organisms, the MSGR can identify pathway members whose coregulation is either ancient or newly evolved.

  6. ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

    Directory of Open Access Journals (Sweden)

    Dominika Ďurechová

    2013-02-01

    Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

  7. Gene expression profile identifies potential biomarkers for human intervertebral disc degeneration.

    Science.gov (United States)

    Guo, Wei; Zhang, Bin; Li, Yan; Duan, Hui-Quan; Sun, Chao; Xu, Yun-Qiang; Feng, Shi-Qing

    2017-12-01

    The present study aimed to reveal the potential genes associated with the pathogenesis of intervertebral disc degeneration (IDD) by analyzing microarray data using bioinformatics. Gene expression profiles of two regions of the intervertebral disc were compared between patients with IDD and controls. GSE70362 containing two groups of gene expression profiles, 16 nucleus pulposus (NP) samples from patients with IDD and 8 from controls, and 16 annulus fibrosus (AF) samples from patients with IDD and 8 from controls, was downloaded from the Gene Expression Omnibus database. A total of 93 and 114 differentially expressed genes (DEGs) were identified in NP and AF samples, respectively, using a limma software package for the R programming environment. Gene Ontology (GO) function enrichment analysis was performed to identify the associated biological functions of DEGs in IDD, which indicated that the DEGs may be involved in various processes, including cell adhesion, biological adhesion and extracellular matrix organization. Pathway enrichment analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG) demonstrated that the identified DEGs were potentially involved in focal adhesion and the p53 signaling pathway. Further analysis revealed that there were 35 common DEGs observed between the two regions (NP and AF), which may be further regulated by 6 clusters of microRNAs (miRNAs) retrieved with WebGestalt. The genes in the DEG‑miRNA regulatory network were annotated using GO function and KEGG pathway enrichment analysis, among which extracellular matrix organization was the most significant disrupted biological process and focal adhesion was the most significant dysregulated pathway. In addition, the result of protein‑protein interaction network modules demonstrated the involvement of inflammatory cytokine interferon signaling in IDD. These findings may not only advance the understanding of the pathogenesis of IDD, but also identify novel potential

  8. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function[OPEN

    Science.gov (United States)

    2018-01-01

    Plants have many, highly variable resistance (R) gene loci, which provide resistance to a variety of pathogens. The first R gene to be cloned, maize (Zea mays) Hm1, was published over 25 years ago, and since then, many different R genes have been identified and isolated. The encoded proteins have provided clues to the diverse molecular mechanisms underlying immunity. Here, we present a meta-analysis of 314 cloned R genes. The majority of R genes encode cell surface or intracellular receptors, and we distinguish nine molecular mechanisms by which R proteins can elevate or trigger disease resistance: direct (1) or indirect (2) perception of pathogen-derived molecules on the cell surface by receptor-like proteins and receptor-like kinases; direct (3) or indirect (4) intracellular detection of pathogen-derived molecules by nucleotide binding, leucine-rich repeat receptors, or detection through integrated domains (5); perception of transcription activator-like effectors through activation of executor genes (6); and active (7), passive (8), or host reprogramming-mediated (9) loss of susceptibility. Although the molecular mechanisms underlying the functions of R genes are only understood for a small proportion of known R genes, a clearer understanding of mechanisms is emerging and will be crucial for rational engineering and deployment of novel R genes. PMID:29382771

  9. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  10. Non-host Plant Resistance against Phytophthora capsici Is Mediated in Part by Members of the I2 R Gene Family in Nicotiana spp.

    Science.gov (United States)

    Vega-Arreguín, Julio C; Shimada-Beltrán, Harumi; Sevillano-Serrano, Jacobo; Moffett, Peter

    2017-01-01

    The identification of host genes associated with resistance to Phytophthora capsici is crucial to developing strategies of control against this oomycete pathogen. Since there are few sources of resistance to P. capsici in crop plants, non-host plants represent a promising source of resistance genes as well as excellent models to study P. capsici - plant interactions. We have previously shown that non-host resistance to P. capsici in Nicotiana spp. is mediated by the recognition of a specific P. capsici effector protein, PcAvr3a1 in a manner that suggests the involvement of a cognate disease resistance (R) genes. Here, we have used virus-induced gene silencing (VIGS) and transgenic tobacco plants expressing dsRNA in Nicotiana spp. to identify candidate R genes that mediate non-host resistance to P. capsici . Silencing of members of the I2 multigene family in the partially resistant plant N. edwardsonii and in the resistant N. tabacum resulted in compromised resistance to P. capsici . VIGS of two other components required for R gene-mediated resistance, EDS1 and SGT1 , also enhanced susceptibility to P. capsici in N. edwardsonii , as well as in the susceptible plants N. benthamiana and N. clevelandii . The silencing of I2 family members in N. tabacum also compromised the recognition of PcAvr3a1. These results indicate that in this case, non-host resistance is mediated by the same components normally associated with race-specific resistance.

  11. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  12. Application of biclustering of gene expression data and gene set enrichment analysis methods to identify potentially disease causing nanomaterials

    Directory of Open Access Journals (Sweden)

    Andrew Williams

    2015-12-01

    Full Text Available Background: The presence of diverse types of nanomaterials (NMs in commerce is growing at an exponential pace. As a result, human exposure to these materials in the environment is inevitable, necessitating the need for rapid and reliable toxicity testing methods to accurately assess the potential hazards associated with NMs. In this study, we applied biclustering and gene set enrichment analysis methods to derive essential features of altered lung transcriptome following exposure to NMs that are associated with lung-specific diseases. Several datasets from public microarray repositories describing pulmonary diseases in mouse models following exposure to a variety of substances were examined and functionally related biclusters of genes showing similar expression profiles were identified. The identified biclusters were then used to conduct a gene set enrichment analysis on pulmonary gene expression profiles derived from mice exposed to nano-titanium dioxide (nano-TiO2, carbon black (CB or carbon nanotubes (CNTs to determine the disease significance of these data-driven gene sets.Results: Biclusters representing inflammation (chemokine activity, DNA binding, cell cycle, apoptosis, reactive oxygen species (ROS and fibrosis processes were identified. All of the NM studies were significant with respect to the bicluster related to chemokine activity (DAVID; FDR p-value = 0.032. The bicluster related to pulmonary fibrosis was enriched in studies where toxicity induced by CNT and CB studies was investigated, suggesting the potential for these materials to induce lung fibrosis. The pro-fibrogenic potential of CNTs is well established. Although CB has not been shown to induce fibrosis, it induces stronger inflammatory, oxidative stress and DNA damage responses than nano-TiO2 particles.Conclusion: The results of the analysis correctly identified all NMs to be inflammogenic and only CB and CNTs as potentially fibrogenic. In addition to identifying several

  13. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    International Nuclear Information System (INIS)

    Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng

    2016-01-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  14. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhenyu, E-mail: wzy72609@163.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhao, Xiuyang, E-mail: xiuzh@psb.vib-ugent.be [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Wang, Bing, E-mail: wangbing@ibcas.ac.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Liu, Erlong, E-mail: liuel14@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Chen, Ni, E-mail: 63710156@qq.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhang, Wei, E-mail: wzhang1216@yahoo.com [Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444 (China); Liu, Heng, E-mail: hengliu@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China)

    2016-04-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  15. Integration of Genome-Wide TF Binding and Gene Expression Data to Characterize Gene Regulatory Networks in Plant Development.

    Science.gov (United States)

    Chen, Dijun; Kaufmann, Kerstin

    2017-01-01

    Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.

  16. Expression of TLP-3 gene without signal peptide in tobacco plants ...

    African Journals Online (AJOL)

    Expression of TLP-3 gene without signal peptide in tobacco plants using Agrobacterium mediated transformation. ... Plants are exploited as a source of food by a wide range of parasites, including viruses, bacteria, fungi, nematodes, insects and even other plants. So paying attention to their protection is very important.

  17. Wheat F-Box Protein Gene TaFBA1 Is Involved in Plant Tolerance to Heat Stress

    Directory of Open Access Journals (Sweden)

    Qinxue Li

    2018-04-01

    Full Text Available Adverse environmental conditions, including high temperature, often affect the growth and production of crops worldwide. F-box protein, a core component of the Skp1-Cullin-F-box (SCF E3 ligase complex, plays an important role in abiotic stress responses. A previously cloned gene from wheat, TaFBA1, encodes a homologous F-box protein. A Yeast two-Hybrid (Y2H assay showed that TaFBA1 interacted with other SCF proteins. We found that the expression of TaFBA1 could be induced by heat stress (45°C. Overexpression of TaFBA1 enhanced heat stress tolerance in transgenic tobacco, because growth inhibition was reduced and photosynthesis increased as compared with those in the wild type (WT plants. Furthermore, the accumulation of H2O2, O2-, and carbonyl protein decreased and cell damage was alleviated in transgenic plants under heat stress, which resulted in less oxidative damage. However, the transgenic plants contained more enzymatic antioxidants after heat stress, which might be related to the regulation of some antioxidant gene expressions. The qRT-PCR analysis showed that the overexpression of TaFBA1 upregulated the expression of genes involved in reactive oxygen species (ROS scavenging, proline biosynthesis, and abiotic stress responses. We identified the interaction of TaFBA1 with Triticum aestivum stress responsive protein 1 (TaASRP1 by Y2H assay and bimolecular fluorescence complementation (BiFC assay. The results suggested that TaFBA1 may improve enzymatic antioxidant levels and regulate gene expression by interacting with other proteins, such as TaASRP1, which leads to the enhanced heat stress tolerance seen in the transgenic plants.

  18. Large-scale gene expression reveals different adaptations of Hyalopterus persikonus to winter and summer host plants.

    Science.gov (United States)

    Cui, Na; Yang, Peng-Cheng; Guo, Kun; Kang, Le; Cui, Feng

    2017-06-01

    Host alternation, an obligatory seasonal shifting between host plants of distant genetic relationship, has had significant consequences for the diversification and success of the superfamily of aphids. However, the underlying molecular mechanism remains unclear. In this study, the molecular mechanism of host alternation was explored through a large-scale gene expression analysis of the mealy aphid Hyalopterus persikonus on winter and summer host plants. More than four times as many unigenes of the mealy aphid were significantly upregulated on summer host Phragmites australis than on winter host Rosaceae plants. In order to identify gene candidates related to host alternation, the differentially expressed unigenes of H. persikonus were compared to salivary gland expressed genes and secretome of Acyrthosiphon pisum. Genes involved in ribosome and oxidative phosphorylation and with molecular functions of heme-copper terminal oxidase activity, hydrolase activity and ribosome binding were potentially upregulated in salivary glands of H. persikonus on the summer host. Putative secretory proteins, such as detoxification enzymes (carboxylesterases and cytochrome P450s), antioxidant enzymes (peroxidase and superoxide dismutase), glutathione peroxidase, glucose dehydrogenase, angiotensin-converting enzyme, cadherin, and calreticulin, were highly expressed in H. persikonus on the summer host, while a SCP GAPR-1-like family protein and a salivary sheath protein were highly expressed in the aphids on winter hosts. These results shed light on phenotypic plasticity in host utilization and seasonal adaptation of aphids. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  19. Overexpression of the Wheat Expansin Gene TaEXPA2 Improved Seed Production and Drought Tolerance in Transgenic Tobacco Plants.

    Science.gov (United States)

    Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei

    2016-01-01

    Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants.

  20. ICan: an integrated co-alteration network to identify ovarian cancer-related genes.

    Science.gov (United States)

    Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan

    2015-01-01

    Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data.

  1. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    Energy Technology Data Exchange (ETDEWEB)

    Altabella, T.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (USA))

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  2. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  3. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  4. A graph-search framework for associating gene identifiers with documents

    Directory of Open Access Journals (Sweden)

    Cohen William W

    2006-10-01

    Full Text Available Abstract Background One step in the model organism database curation process is to find, for each article, the identifier of every gene discussed in the article. We consider a relaxation of this problem suitable for semi-automated systems, in which each article is associated with a ranked list of possible gene identifiers, and experimentally compare methods for solving this geneId ranking problem. In addition to baseline approaches based on combining named entity recognition (NER systems with a "soft dictionary" of gene synonyms, we evaluate a graph-based method which combines the outputs of multiple NER systems, as well as other sources of information, and a learning method for reranking the output of the graph-based method. Results We show that named entity recognition (NER systems with similar F-measure performance can have significantly different performance when used with a soft dictionary for geneId-ranking. The graph-based approach can outperform any of its component NER systems, even without learning, and learning can further improve the performance of the graph-based ranking approach. Conclusion The utility of a named entity recognition (NER system for geneId-finding may not be accurately predicted by its entity-level F1 performance, the most common performance measure. GeneId-ranking systems are best implemented by combining several NER systems. With appropriate combination methods, usefully accurate geneId-ranking systems can be constructed based on easily-available resources, without resorting to problem-specific, engineered components.

  5. Identifying essential genes in bacterial metabolic networks with machine learning methods

    Science.gov (United States)

    2010-01-01

    Background Identifying essential genes in bacteria supports to identify potential drug targets and an understanding of minimal requirements for a synthetic cell. However, experimentally assaying the essentiality of their coding genes is resource intensive and not feasible for all bacterial organisms, in particular if they are infective. Results We developed a machine learning technique to identify essential genes using the experimental data of genome-wide knock-out screens from one bacterial organism to infer essential genes of another related bacterial organism. We used a broad variety of topological features, sequence characteristics and co-expression properties potentially associated with essentiality, such as flux deviations, centrality, codon frequencies of the sequences, co-regulation and phyletic retention. An organism-wise cross-validation on bacterial species yielded reliable results with good accuracies (area under the receiver-operator-curve of 75% - 81%). Finally, it was applied to drug target predictions for Salmonella typhimurium. We compared our predictions to the viability of experimental knock-outs of S. typhimurium and identified 35 enzymes, which are highly relevant to be considered as potential drug targets. Specifically, we detected promising drug targets in the non-mevalonate pathway. Conclusions Using elaborated features characterizing network topology, sequence information and microarray data enables to predict essential genes from a bacterial reference organism to a related query organism without any knowledge about the essentiality of genes of the query organism. In general, such a method is beneficial for inferring drug targets when experimental data about genome-wide knockout screens is not available for the investigated organism. PMID:20438628

  6. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  7. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  8. The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.

    Science.gov (United States)

    Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J

    2017-05-01

    The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.

  9. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  10. A Comprehensive Classification and Evolutionary Analysis of Plant Homeobox Genes

    OpenAIRE

    Mukherjee, Krishanu; Brocchieri, Luciano; B?rglin, Thomas R.

    2009-01-01

    The full complement of homeobox transcription factor sequences, including genes and pseudogenes, was determined from the analysis of 10 complete genomes from flowering plants, moss, Selaginella, unicellular green algae, and red algae. Our exhaustive genome-wide searches resulted in the discovery in each class of a greater number of homeobox genes than previously reported. All homeobox genes can be unambiguously classified by sequence evolutionary analysis into 14 distinct classes also charact...

  11. Selection and Verification of Candidate Reference Genes for Mature MicroRNA Expression by Quantitative RT-PCR in the Tea Plant (Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Hui Song

    2016-05-01

    Full Text Available Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is a rapid and sensitive method for analyzing microRNA (miRNA expression. However, accurate qRT-PCR results depend on the selection of reliable reference genes as internal positive controls. To date, few studies have identified reliable reference genes for differential expression analysis of miRNAs among tissues, and among experimental conditions in plants. In this study, three miRNAs and four non-coding small RNAs (ncRNA were selected as reference candidates, and the stability of their expression was evaluated among different tissues and under different experimental conditions in the tea plant (Camellia sinensis using the geNorm and NormFinder programs. It was shown that miR159a was the best single reference gene in the bud to the fifth leaf, 5S rRNA was the most suitable gene in different organs, miR6149 was the most stable gene when the leaves were attacked by Ectropis oblique and U4, miR5368n and miR159a were the best genes when the leaves were treated by methyl jasmonate (MeJA, salicylic acid (SA and abscisic acid (ABA, respectively. Our results provide suitable reference genes for future investigations on miRNA functions in tea plants.

  12. Macro optical projection tomography for large scale 3D imaging of plant structures and gene activity.

    Science.gov (United States)

    Lee, Karen J I; Calder, Grant M; Hindle, Christopher R; Newman, Jacob L; Robinson, Simon N; Avondo, Jerome J H Y; Coen, Enrico S

    2017-01-01

    Optical projection tomography (OPT) is a well-established method for visualising gene activity in plants and animals. However, a limitation of conventional OPT is that the specimen upper size limit precludes its application to larger structures. To address this problem we constructed a macro version called Macro OPT (M-OPT). We apply M-OPT to 3D live imaging of gene activity in growing whole plants and to visualise structural morphology in large optically cleared plant and insect specimens up to 60 mm tall and 45 mm deep. We also show how M-OPT can be used to image gene expression domains in 3D within fixed tissue and to visualise gene activity in 3D in clones of growing young whole Arabidopsis plants. A further application of M-OPT is to visualise plant-insect interactions. Thus M-OPT provides an effective 3D imaging platform that allows the study of gene activity, internal plant structures and plant-insect interactions at a macroscopic scale. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  13. Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

    Directory of Open Access Journals (Sweden)

    O.I. Grabelnych

    2017-02-01

    Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

  14. Gene-Based Genome-Wide Association Analysis in European and Asian Populations Identified Novel Genes for Rheumatoid Arthritis.

    Directory of Open Access Journals (Sweden)

    Hong Zhu

    Full Text Available Rheumatoid arthritis (RA is a complex autoimmune disease. Using a gene-based association research strategy, the present study aims to detect unknown susceptibility to RA and to address the ethnic differences in genetic susceptibility to RA between European and Asian populations.Gene-based association analyses were performed with KGG 2.5 by using publicly available large RA datasets (14,361 RA cases and 43,923 controls of European subjects, 4,873 RA cases and 17,642 controls of Asian Subjects. For the newly identified RA-associated genes, gene set enrichment analyses and protein-protein interactions analyses were carried out with DAVID and STRING version 10.0, respectively. Differential expression verification was conducted using 4 GEO datasets. The expression levels of three selected 'highly verified' genes were measured by ELISA among our in-house RA cases and controls.A total of 221 RA-associated genes were newly identified by gene-based association study, including 71'overlapped', 76 'European-specific' and 74 'Asian-specific' genes. Among them, 105 genes had significant differential expressions between RA patients and health controls at least in one dataset, especially for 20 genes including 11 'overlapped' (ABCF1, FLOT1, HLA-F, IER3, TUBB, ZKSCAN4, BTN3A3, HSP90AB1, CUTA, BRD2, HLA-DMA, 5 'European-specific' (PHTF1, RPS18, BAK1, TNFRSF14, SUOX and 4 'Asian-specific' (RNASET2, HFE, BTN2A2, MAPK13 genes whose differential expressions were significant at least in three datasets. The protein expressions of two selected genes FLOT1 (P value = 1.70E-02 and HLA-DMA (P value = 4.70E-02 in plasma were significantly different in our in-house samples.Our study identified 221 novel RA-associated genes and especially highlighted the importance of 20 candidate genes on RA. The results addressed ethnic genetic background differences for RA susceptibility between European and Asian populations and detected a long list of overlapped or ethnic specific RA

  15. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  16. Developmental processes and responses to hormonal stimuli in tea plant (Camellia sinensis) leaves are controlled by GRF and GIF gene families.

    Science.gov (United States)

    Wu, Zhi-Jun; Wang, Wen-Li; Zhuang, Jing

    2017-09-01

    Tea plant (Camellia sinensis (L.) O. Kuntze) is an important leaf-type woody crop used for producing of non-alcoholic beverages worldwide. The GROWTH-REGULATING FACTOR (GRF) transcription factors cooperated with GRF-INTERACTING FACTOR (GIF) transcriptional coactivators positively regulate leaf development. In the present study, six GRF and two GIF genes were identified and characterized in the leaf transcriptome of C. sinensis, respectively. The alignment results showed that the feature structures of the predicted homologous GRF and GIF proteins of C. sinensis hold a high identity with Arabidopsis and rice. The presence of C. sinensis miR396 target sites suggested that these miR396 members are the potential post-transcriptional regulators of CsGRF genes. The expression profiles of CsGRF and CsGIF1 genes were higher in tender leaves and consistently downregulated during tea plant leaf development. Those results suggested that these genes may be actively involved in the early stage leaf tissue formation in tea plant. The divergence of CsGRF and CsGIF genes in response to different hormonal stimuli revealed the possible multiple functions of these genes in hormonal regulation. This study provided the potential molecular basis of the CsGRF and CsGIF family genes for future functional research on leaf development and hormonal stimuli in C. sinensis.

  17. Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

    2017-08-01

    Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

  18. Viral vectors for gene modification of plants as chem/bio sensors.

    Energy Technology Data Exchange (ETDEWEB)

    Manginell, Monica; Harper, Jason C.; Arango, Dulce C.; Brozik, Susan Marie; Dolan, Patricia L.

    2006-11-01

    Chemical or biological sensors that are specific, sensitive, and robust allowing intelligence gathering for verification of nuclear non-proliferation treaty compliance and detouring production of weapons of mass destruction are sorely needed. Although much progress has been made in the area of biosensors, improvements in sensor lifetime, robustness, and device packaging are required before these devices become widely used. Current chemical and biological detection and identification techniques require less-than-covert sample collection followed by transport to a laboratory for analysis. In addition to being expensive and time consuming, results can often be inconclusive due to compromised sample integrity during collection and transport. We report here a demonstration of a plant based sensor technology which utilizes mature and seedling plants as chemical sensors. One can envision genetically modifying native plants at a site of interest that can report the presence of specific toxins or chemicals. In this one year project we used a developed inducible expression system to show the feasibility of plant sensors. The vector was designed as a safe, non-infectious vector which could be used to invade, replicate, and introduce foreign genes into mature host plants that then allow the plant to sense chem/bio agents. The genes introduced through the vector included a reporter gene that encodes for green fluorescent protein (GFP) and a gene that encodes for a mammalian receptor that recognizes a chemical agent. Specifically, GFP was induced by the presence of 17-{beta}-Estradiol (estrogen). Detection of fluorescence indicated the presence of the target chemical agent. Since the sensor is a plant, costly device packaging development or manufacturing of the sensor were not required. Additionally, the biological recognition and reporting elements are maintained in a living, natural environment and therefore do not suffer from lifetime disadvantages typical of most biosensing

  19. A moso bamboo WRKY gene PeWRKY83 confers salinity tolerance in transgenic Arabidopsis plants.

    Science.gov (United States)

    Wu, Min; Liu, Huanlong; Han, Guomin; Cai, Ronghao; Pan, Feng; Xiang, Yan

    2017-09-15

    The WRKY family are transcription factors, involved in plant development, and response to biotic and abiotic stresses. Moso bamboo is an important bamboo that has high ecological, economic and cultural value and is widely distributed in the south of China. In this study, we performed a genome-wide identification of WRKY members in moso bamboo and identified 89 members. By comparative analysis in six grass genomes, we found the WRKY gene family may have experienced or be experiencing purifying selection. Based on relative expression levels among WRKY IIc members under three abiotic stresses, PeWRKY83 functioned as a transcription factor and was selected for detailed analysis. The transgenic Arabidopsis of PeWRKY83 showed superior physiological properties compared with the WT under salt stress. Overexpression plants were less sensitive to ABA at both germination and postgermination stages and accumulated more endogenous ABA under salt stress conditions. Further studies demonstrated that overexpression of PeWRKY83 could regulate the expression of some ABA biosynthesis genes (AtAAO3, AtNCED2, AtNCED3), signaling genes (AtABI1, AtPP2CA) and responsive genes (AtRD29A, AtRD29B, AtABF1) under salt stress. Together, these results suggested that PeWRKY83 functions as a novel WRKY-related TF which plays a positive role in salt tolerance by regulating stress-induced ABA synthesis.

  20. Extracting gene expression patterns and identifying co-expressed genes from microarray data reveals biologically responsive processes

    Directory of Open Access Journals (Sweden)

    Paules Richard S

    2007-11-01

    Full Text Available Abstract Background A common observation in the analysis of gene expression data is that many genes display similarity in their expression patterns and therefore appear to be co-regulated. However, the variation associated with microarray data and the complexity of the experimental designs make the acquisition of co-expressed genes a challenge. We developed a novel method for Extracting microarray gene expression Patterns and Identifying co-expressed Genes, designated as EPIG. The approach utilizes the underlying structure of gene expression data to extract patterns and identify co-expressed genes that are responsive to experimental conditions. Results Through evaluation of the correlations among profiles, the magnitude of variation in gene expression profiles, and profile signal-to-noise ratio's, EPIG extracts a set of patterns representing co-expressed genes. The method is shown to work well with a simulated data set and microarray data obtained from time-series studies of dauer recovery and L1 starvation in C. elegans and after ultraviolet (UV or ionizing radiation (IR-induced DNA damage in diploid human fibroblasts. With the simulated data set, EPIG extracted the appropriate number of patterns which were more stable and homogeneous than the set of patterns that were determined using the CLICK or CAST clustering algorithms. However, CLICK performed better than EPIG and CAST with respect to the average correlation between clusters/patterns of the simulated data. With real biological data, EPIG extracted more dauer-specific patterns than CLICK. Furthermore, analysis of the IR/UV data revealed 18 unique patterns and 2661 genes out of approximately 17,000 that were identified as significantly expressed and categorized to the patterns by EPIG. The time-dependent patterns displayed similar and dissimilar responses between IR and UV treatments. Gene Ontology analysis applied to each pattern-related subset of co-expressed genes revealed underlying

  1. Exome sequencing identifies three novel candidate genes implicated in intellectual disability.

    Directory of Open Access Journals (Sweden)

    Zehra Agha

    Full Text Available Intellectual disability (ID is a major health problem mostly with an unknown etiology. Recently exome sequencing of individuals with ID identified novel genes implicated in the disease. Therefore the purpose of the present study was to identify the genetic cause of ID in one syndromic and two non-syndromic Pakistani families. Whole exome of three ID probands was sequenced. Missense variations in two plausible novel genes implicated in autosomal recessive ID were identified: lysine (K-specific methyltransferase 2B (KMT2B, zinc finger protein 589 (ZNF589, as well as hedgehog acyltransferase (HHAT with a de novo mutation with autosomal dominant mode of inheritance. The KMT2B recessive variant is the first report of recessive Kleefstra syndrome-like phenotype. Identification of plausible causative mutations for two recessive and a dominant type of ID, in genes not previously implicated in disease, underscores the large genetic heterogeneity of ID. These results also support the viewpoint that large number of ID genes converge on limited number of common networks i.e. ZNF589 belongs to KRAB-domain zinc-finger proteins previously implicated in ID, HHAT is predicted to affect sonic hedgehog, which is involved in several disorders with ID, KMT2B associated with syndromic ID fits the epigenetic module underlying the Kleefstra syndromic spectrum. The association of these novel genes in three different Pakistani ID families highlights the importance of screening these genes in more families with similar phenotypes from different populations to confirm the involvement of these genes in pathogenesis of ID.

  2. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  3. Integration of multiple networks and pathways identifies cancer driver genes in pan-cancer analysis.

    Science.gov (United States)

    Cava, Claudia; Bertoli, Gloria; Colaprico, Antonio; Olsen, Catharina; Bontempi, Gianluca; Castiglioni, Isabella

    2018-01-06

    Modern high-throughput genomic technologies represent a comprehensive hallmark of molecular changes in pan-cancer studies. Although different cancer gene signatures have been revealed, the mechanism of tumourigenesis has yet to be completely understood. Pathways and networks are important tools to explain the role of genes in functional genomic studies. However, few methods consider the functional non-equal roles of genes in pathways and the complex gene-gene interactions in a network. We present a novel method in pan-cancer analysis that identifies de-regulated genes with a functional role by integrating pathway and network data. A pan-cancer analysis of 7158 tumour/normal samples from 16 cancer types identified 895 genes with a central role in pathways and de-regulated in cancer. Comparing our approach with 15 current tools that identify cancer driver genes, we found that 35.6% of the 895 genes identified by our method have been found as cancer driver genes with at least 2/15 tools. Finally, we applied a machine learning algorithm on 16 independent GEO cancer datasets to validate the diagnostic role of cancer driver genes for each cancer. We obtained a list of the top-ten cancer driver genes for each cancer considered in this study. Our analysis 1) confirmed that there are several known cancer driver genes in common among different types of cancer, 2) highlighted that cancer driver genes are able to regulate crucial pathways.

  4. Identifying and Analyzing Novel Epilepsy-Related Genes Using Random Walk with Restart Algorithm

    Directory of Open Access Journals (Sweden)

    Wei Guo

    2017-01-01

    Full Text Available As a pathological condition, epilepsy is caused by abnormal neuronal discharge in brain which will temporarily disrupt the cerebral functions. Epilepsy is a chronic disease which occurs in all ages and would seriously affect patients’ personal lives. Thus, it is highly required to develop effective medicines or instruments to treat the disease. Identifying epilepsy-related genes is essential in order to understand and treat the disease because the corresponding proteins encoded by the epilepsy-related genes are candidates of the potential drug targets. In this study, a pioneering computational workflow was proposed to predict novel epilepsy-related genes using the random walk with restart (RWR algorithm. As reported in the literature RWR algorithm often produces a number of false positive genes, and in this study a permutation test and functional association tests were implemented to filter the genes identified by RWR algorithm, which greatly reduce the number of suspected genes and result in only thirty-three novel epilepsy genes. Finally, these novel genes were analyzed based upon some recently published literatures. Our findings implicate that all novel genes were closely related to epilepsy. It is believed that the proposed workflow can also be applied to identify genes related to other diseases and deepen our understanding of the mechanisms of these diseases.

  5. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    Science.gov (United States)

    2011-01-01

    Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples). Four distinct clusters were identified by Principal Components Analysis (PCA) in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples) using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p INSS stage 4 and/or dead of disease, p < 0.05, Fisher's exact test). Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group's specific characteristics. PMID:21492432

  6. [Key effect genes responding to nerve injury identified by gene ontology and computer pattern recognition].

    Science.gov (United States)

    Pan, Qian; Peng, Jin; Zhou, Xue; Yang, Hao; Zhang, Wei

    2012-07-01

    In order to screen out important genes from large gene data of gene microarray after nerve injury, we combine gene ontology (GO) method and computer pattern recognition technology to find key genes responding to nerve injury, and then verify one of these screened-out genes. Data mining and gene ontology analysis of gene chip data GSE26350 was carried out through MATLAB software. Cd44 was selected from screened-out key gene molecular spectrum by comparing genes' different GO terms and positions on score map of principal component. Function interferences were employed to influence the normal binding of Cd44 and one of its ligands, chondroitin sulfate C (CSC), to observe neurite extension. Gene ontology analysis showed that the first genes on score map (marked by red *) mainly distributed in molecular transducer activity, receptor activity, protein binding et al molecular function GO terms. Cd44 is one of six effector protein genes, and attracted us with its function diversity. After adding different reagents into the medium to interfere the normal binding of CSC and Cd44, varying-degree remissions of CSC's inhibition on neurite extension were observed. CSC can inhibit neurite extension through binding Cd44 on the neuron membrane. This verifies that important genes in given physiological processes can be identified by gene ontology analysis of gene chip data.

  7. Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development.

    Science.gov (United States)

    Takeda, Haruna; Rust, Alistair G; Ward, Jerrold M; Yew, Christopher Chin Kuan; Jenkins, Nancy A; Copeland, Neal G

    2016-04-05

    Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4(+/-) mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC.

  8. Novel Myopia Genes and Pathways Identified From Syndromic Forms of Myopia

    Science.gov (United States)

    Loughman, James; Wildsoet, Christine F.; Williams, Cathy; Guggenheim, Jeremy A.

    2018-01-01

    Purpose To test the hypothesis that genes known to cause clinical syndromes featuring myopia also harbor polymorphisms contributing to nonsyndromic refractive errors. Methods Clinical phenotypes and syndromes that have refractive errors as a recognized feature were identified using the Online Mendelian Inheritance in Man (OMIM) database. One hundred fifty-four unique causative genes were identified, of which 119 were specifically linked with myopia and 114 represented syndromic myopia (i.e., myopia and at least one other clinical feature). Myopia was the only refractive error listed for 98 genes and hyperopia and the only refractive error noted for 28 genes, with the remaining 28 genes linked to phenotypes with multiple forms of refractive error. Pathway analysis was carried out to find biological processes overrepresented within these sets of genes. Genetic variants located within 50 kb of the 119 myopia-related genes were evaluated for involvement in refractive error by analysis of summary statistics from genome-wide association studies (GWAS) conducted by the CREAM Consortium and 23andMe, using both single-marker and gene-based tests. Results Pathway analysis identified several biological processes already implicated in refractive error development through prior GWAS analyses and animal studies, including extracellular matrix remodeling, focal adhesion, and axon guidance, supporting the research hypothesis. Novel pathways also implicated in myopia development included mannosylation, glycosylation, lens development, gliogenesis, and Schwann cell differentiation. Hyperopia was found to be linked to a different pattern of biological processes, mostly related to organogenesis. Comparison with GWAS findings further confirmed that syndromic myopia genes were enriched for genetic variants that influence refractive errors in the general population. Gene-based analyses implicated 21 novel candidate myopia genes (ADAMTS18, ADAMTS2, ADAMTSL4, AGK, ALDH18A1, ASXL1, COL4A1

  9. A nucleotide metabolite controls stress-responsive gene expression and plant development.

    Directory of Open Access Journals (Sweden)

    Hao Chen

    Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt

  10. A nucleotide metabolite controls stress-responsive gene expression and plant development

    KAUST Repository

    Chen, Hao

    2011-10-19

    Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target

  11. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Whole genome-wide transcript profiling to identify differentially expressed genes associated with seed field emergence in two soybean low phytate mutants.

    Science.gov (United States)

    Yuan, Fengjie; Yu, Xiaomin; Dong, Dekun; Yang, Qinghua; Fu, Xujun; Zhu, Shenlong; Zhu, Danhua

    2017-01-18

    Seed germination is important to soybean (Glycine max) growth and development, ultimately affecting soybean yield. A lower seed field emergence has been the main hindrance for breeding soybeans low in phytate. Although this reduction could be overcome by additional breeding and selection, the mechanisms of seed germination in different low phytate mutants remain unknown. In this study, we performed a comparative transcript analysis of two low phytate soybean mutants (TW-1 and TW-1-M), which have the same mutation, a 2 bp deletion in GmMIPS1, but show a significant difference in seed field emergence, TW-1-M was higher than that of TW-1 . Numerous genes analyzed by RNA-Seq showed markedly different expression levels between TW-1-M and TW-1 mutants. Approximately 30,000-35,000 read-mapped genes and ~21000-25000 expressed genes were identified for each library. There were ~3900-9200 differentially expressed genes (DEGs) in each contrast library, the number of up-regulated genes was similar with down-regulated genes in the mutant TW-1and TW-1-M. Gene ontology functional categories of DEGs indicated that the ethylene-mediated signaling pathway, the abscisic acid-mediated signaling pathway, response to hormone, ethylene biosynthetic process, ethylene metabolic process, regulation of hormone levels, and oxidation-reduction process, regulation of flavonoid biosynthetic process and regulation of abscisic acid-activated signaling pathway had high correlations with seed germination. In total, 2457 DEGs involved in the above functional categories were identified. Twenty-two genes with 20 biological functions were the most highly up/down- regulated (absolute value Log2FC >5) in the high field emergence mutant TW-1-M and were related to metabolic or signaling pathways. Fifty-seven genes with 36 biological functions had the greatest expression abundance (FRPM >100) in germination-related pathways. Seed germination in the soybean low phytate mutants is a very complex process

  13. Evolutionary characterization and transcript profiling of β-tubulin genes in flax (Linum usitatissimum L.) during plant development.

    Science.gov (United States)

    Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura

    2017-12-08

    Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.

  14. TransDetect Identifies a New Regulatory Module Controlling Phosphate Accumulation.

    Science.gov (United States)

    Pal, Sikander; Kisko, Mushtak; Dubos, Christian; Lacombe, Benoit; Berthomieu, Pierre; Krouk, Gabriel; Rouached, Hatem

    2017-10-01

    Identifying transcription factor (TFs) cooperation controlling target gene expression is still an arduous challenge. The accuracy of current methods at genome scale significantly drops with the increase in number of genes, which limits their applicability to more complex genomes, like animals and plants. Here, we developed an algorithm, TransDetect, able to predict TF combinations controlling the expression level of a given gene. TransDetect was used to identify novel TF modules regulating the expression of Arabidopsis ( Arabidopsis thaliana ) phosphate transporter PHO1;H3 comprising MYB15, MYB84, bHLH35, and ICE1. These TFs were confirmed to interact between themselves and with the PHO1;H3 promoter. Phenotypic and genetic analyses of TF mutants enable the organization of these four TFs and PHO1;H3 in a new gene regulatory network controlling phosphate accumulation in zinc-dependent manner. This demonstrates the potential of TransDetect to extract directionality in nondynamic transcriptomes and to provide a blueprint to identify gene regulatory network involved in a given biological process. © 2017 American Society of Plant Biologists. All Rights Reserved.

  15. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Science.gov (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  16. A general method for identifying major hybrid male sterility genes in Drosophila.

    Science.gov (United States)

    Zeng, L W; Singh, R S

    1995-10-01

    The genes responsible for hybrid male sterility in species crosses are usually identified by introgressing chromosome segments, monitored by visible markers, between closely related species by continuous backcrosses. This commonly used method, however, suffers from two problems. First, it relies on the availability of markers to monitor the introgressed regions and so the portion of the genome examined is limited to the marked regions. Secondly, the introgressed regions are usually large and it is impossible to tell if the effects of the introgressed regions are the result of single (or few) major genes or many minor genes (polygenes). Here we introduce a simple and general method for identifying putative major hybrid male sterility genes which is free of these problems. In this method, the actual hybrid male sterility genes (rather than markers), or tightly linked gene complexes with large effects, are selectively introgressed from one species into the background of another species by repeated backcrosses. This is performed by selectively backcrossing heterozygous (for hybrid male sterility gene or genes) females producing fertile and sterile sons in roughly equal proportions to males of either parental species. As no marker gene is required for this procedure, this method can be used with any species pairs that produce unisexual sterility. With the application of this method, a small X chromosome region of Drosophila mauritiana which produces complete hybrid male sterility (aspermic testes) in the background of D. simulans was identified. Recombination analysis reveals that this region contains a second major hybrid male sterility gene linked to the forked locus located at either 62.7 +/- 0.66 map units or at the centromere region of the X chromosome of D. mauritiana.

  17. Epidermal growth factor gene is a newly identified candidate gene for gout.

    Science.gov (United States)

    Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui

    2016-08-10

    Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67-0.88, Padjusted = 6.42 × 10(-3)). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations.

  18. An affinity pull-down approach to identify the plant cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt

    2013-01-01

    Cyclic nucleotides (CNs) are intracellular second messengers that play an important role in mediating physiological responses to environmental and developmental signals, in species ranging from bacteria to humans. In response to these signals, CNs are synthesized by nucleotidyl cyclases and then act by binding to and altering the activity of downstream target proteins known as cyclic nucleotide-binding proteins (CNBPs). A number of CNBPs have been identified across kingdoms including transcription factors, protein kinases, phosphodiesterases, and channels, all of which harbor conserved CN-binding domains. In plants however, few CNBPs have been identified as homology searches fail to return plant sequences with significant matches to known CNBPs. Recently, affinity pull-down techniques have been successfully used to identify CNBPs in animals and have provided new insights into CN signaling. The application of these techniques to plants has not yet been extensively explored and offers an alternative approach toward the unbiased discovery of novel CNBP candidates in plants. Here, an affinity pull-down technique for the identification of the plant CN interactome is presented. In summary, the method involves an extraction of plant proteins which is incubated with a CN-bait, followed by a series of increasingly stringent elutions that eliminates proteins in a sequential manner according to their affinity to the bait. The eluted and bait-bound proteins are separated by one-dimensional gel electrophoresis, excised, and digested with trypsin after which the resultant peptides are identified by mass spectrometry - techniques that are commonplace in proteomics experiments. The discovery of plant CNBPs promises to provide valuable insight into the mechanism of CN signal transduction in plants. © Springer Science+Business Media New York 2013.

  19. An affinity pull-down approach to identify the plant cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2013-09-03

    Cyclic nucleotides (CNs) are intracellular second messengers that play an important role in mediating physiological responses to environmental and developmental signals, in species ranging from bacteria to humans. In response to these signals, CNs are synthesized by nucleotidyl cyclases and then act by binding to and altering the activity of downstream target proteins known as cyclic nucleotide-binding proteins (CNBPs). A number of CNBPs have been identified across kingdoms including transcription factors, protein kinases, phosphodiesterases, and channels, all of which harbor conserved CN-binding domains. In plants however, few CNBPs have been identified as homology searches fail to return plant sequences with significant matches to known CNBPs. Recently, affinity pull-down techniques have been successfully used to identify CNBPs in animals and have provided new insights into CN signaling. The application of these techniques to plants has not yet been extensively explored and offers an alternative approach toward the unbiased discovery of novel CNBP candidates in plants. Here, an affinity pull-down technique for the identification of the plant CN interactome is presented. In summary, the method involves an extraction of plant proteins which is incubated with a CN-bait, followed by a series of increasingly stringent elutions that eliminates proteins in a sequential manner according to their affinity to the bait. The eluted and bait-bound proteins are separated by one-dimensional gel electrophoresis, excised, and digested with trypsin after which the resultant peptides are identified by mass spectrometry - techniques that are commonplace in proteomics experiments. The discovery of plant CNBPs promises to provide valuable insight into the mechanism of CN signal transduction in plants. © Springer Science+Business Media New York 2013.

  20. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  1. Comparative transcriptome analysis of stylar canal cells identifies novel candidate genes implicated in the self-incompatibility response of Citrus clementina

    Directory of Open Access Journals (Sweden)

    Caruso Marco

    2012-02-01

    Full Text Available Abstract Background Reproductive biology in citrus is still poorly understood. Although in recent years several efforts have been made to study pollen-pistil interaction and self-incompatibility, little information is available about the molecular mechanisms regulating these processes. Here we report the identification of candidate genes involved in pollen-pistil interaction and self-incompatibility in clementine (Citrus clementina Hort. ex Tan.. These genes have been identified comparing the transcriptomes of laser-microdissected stylar canal cells (SCC isolated from two genotypes differing for self-incompatibility response ('Comune', a self-incompatible cultivar and 'Monreal', a self- compatible mutation of 'Comune'. Results The transcriptome profiling of SCC indicated that the differential regulation of few specific, mostly uncharacterized transcripts is associated with the breakdown of self-incompatibility in 'Monreal'. Among them, a novel F-box gene showed a drastic up-regulation both in laser microdissected stylar canal cells and in self-pollinated whole styles with stigmas of 'Comune' in concomitance with the arrest of pollen tube growth. Moreover, we identify a non-characterized gene family as closely associated to the self-incompatibility genetic program activated in 'Comune'. Three different aspartic-acid rich (Asp-rich protein genes, located in tandem in the clementine genome, were over-represented in the transcriptome of 'Comune'. These genes are tightly linked to a DELLA gene, previously found to be up-regulated in the self-incompatible genotype during pollen-pistil interaction. Conclusion The highly specific transcriptome survey of the stylar canal cells identified novel genes which have not been previously associated with self-pollen rejection in citrus and in other plant species. Bioinformatic and transcriptional analyses suggested that the mutation leading to self-compatibility in 'Monreal' affected the expression of non

  2. Controversy Associated With the Common Component of Most Transgenic Plants – Kanamycin Resistance Marker Gene

    Directory of Open Access Journals (Sweden)

    Srećko Jelenić

    2003-01-01

    Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.

  3. Clustering approaches to identifying gene expression patterns from DNA microarray data.

    Science.gov (United States)

    Do, Jin Hwan; Choi, Dong-Kug

    2008-04-30

    The analysis of microarray data is essential for large amounts of gene expression data. In this review we focus on clustering techniques. The biological rationale for this approach is the fact that many co-expressed genes are co-regulated, and identifying co-expressed genes could aid in functional annotation of novel genes, de novo identification of transcription factor binding sites and elucidation of complex biological pathways. Co-expressed genes are usually identified in microarray experiments by clustering techniques. There are many such methods, and the results obtained even for the same datasets may vary considerably depending on the algorithms and metrics for dissimilarity measures used, as well as on user-selectable parameters such as desired number of clusters and initial values. Therefore, biologists who want to interpret microarray data should be aware of the weakness and strengths of the clustering methods used. In this review, we survey the basic principles of clustering of DNA microarray data from crisp clustering algorithms such as hierarchical clustering, K-means and self-organizing maps, to complex clustering algorithms like fuzzy clustering.

  4. TAS3 miR390-dependent loci in non-vascular land plants: towards a comprehensive reconstruction of the gene evolutionary history

    Directory of Open Access Journals (Sweden)

    Sergey Y. Morozov

    2018-04-01

    Full Text Available Trans-acting small interfering RNAs (ta-siRNAs are transcribed from protein non-coding genomic TAS loci and belong to a plant-specific class of endogenous small RNAs. These siRNAs have been found to regulate gene expression in most taxa including seed plants, gymnosperms, ferns and mosses. In this study, bioinformatic and experimental PCR-based approaches were used as tools to analyze TAS3 and TAS6 loci in transcriptomes and genomic DNAs from representatives of evolutionary distant non-vascular plant taxa such as Bryophyta, Marchantiophyta and Anthocerotophyta. We revealed previously undiscovered TAS3 loci in plant classes Sphagnopsida and Anthocerotopsida, as well as TAS6 loci in Bryophyta classes Tetraphidiopsida, Polytrichopsida, Andreaeopsida and Takakiopsida. These data further unveil the evolutionary pathway of the miR390-dependent TAS3 loci in land plants. We also identified charophyte alga sequences coding for SUPPRESSOR OF GENE SILENCING 3 (SGS3, which is required for generation of ta-siRNAs in plants, and hypothesized that the appearance of TAS3-related sequences could take place at a very early step in evolutionary transition from charophyte algae to an earliest common ancestor of land plants.

  5. TAS3 miR390-dependent loci in non-vascular land plants: towards a comprehensive reconstruction of the gene evolutionary history.

    Science.gov (United States)

    Morozov, Sergey Y; Milyutina, Irina A; Erokhina, Tatiana N; Ozerova, Liudmila V; Troitsky, Alexey V; Solovyev, Andrey G

    2018-01-01

    Trans-acting small interfering RNAs (ta-siRNAs) are transcribed from protein non-coding genomic TAS loci and belong to a plant-specific class of endogenous small RNAs. These siRNAs have been found to regulate gene expression in most taxa including seed plants, gymnosperms, ferns and mosses. In this study, bioinformatic and experimental PCR-based approaches were used as tools to analyze TAS3 and TAS6 loci in transcriptomes and genomic DNAs from representatives of evolutionary distant non-vascular plant taxa such as Bryophyta, Marchantiophyta and Anthocerotophyta. We revealed previously undiscovered TAS3 loci in plant classes Sphagnopsida and Anthocerotopsida, as well as TAS6 loci in Bryophyta classes Tetraphidiopsida, Polytrichopsida, Andreaeopsida and Takakiopsida. These data further unveil the evolutionary pathway of the miR390-dependent TAS3 loci in land plants. We also identified charophyte alga sequences coding for SUPPRESSOR OF GENE SILENCING 3 (SGS3), which is required for generation of ta-siRNAs in plants, and hypothesized that the appearance of TAS3-related sequences could take place at a very early step in evolutionary transition from charophyte algae to an earliest common ancestor of land plants.

  6. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  7. Silencing of meiosis-critical genes for engineering male sterility in plants

    Science.gov (United States)

    Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...

  8. Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants

    OpenAIRE

    Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng

    2017-01-01

    Background Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution...

  9. Multi-omics analysis identifies genes mediating the extension of cell walls in the Arabidopsis thaliana root elongation zone

    DEFF Research Database (Denmark)

    Wilson, Michael H; Holman, Tara J; Sørensen, Iben

    2015-01-01

    Plant cell wall composition is important for regulating growth rates, especially in roots. However, neither analyses of cell wall composition nor transcriptomes on their own can comprehensively reveal which genes and processes are mediating growth and cell elongation rates. This study reveals...... the benefits of carrying out multiple analyses in combination. Sections of roots from five anatomically and functionally defined zones in Arabidopsis thaliana were prepared and divided into three biological replicates. We used glycan microarrays and antibodies to identify the major classes of glycans......)cellular localization of many epitopes. Extensins were localized in epidermal and cortex cell walls, while AGP glycans were specific to different tissues from root-hair cells to the stele. The transcriptome analysis found several gene families peaking in the REZ. These included a large family of peroxidases (which...

  10. Gene dosage, expression, and ontology analysis identifies driver genes in the carcinogenesis and chemoradioresistance of cervical cancer.

    Directory of Open Access Journals (Sweden)

    Malin Lando

    2009-11-01

    Full Text Available Integrative analysis of gene dosage, expression, and ontology (GO data was performed to discover driver genes in the carcinogenesis and chemoradioresistance of cervical cancers. Gene dosage and expression profiles of 102 locally advanced cervical cancers were generated by microarray techniques. Fifty-two of these patients were also analyzed with the Illumina expression method to confirm the gene expression results. An independent cohort of 41 patients was used for validation of gene expressions associated with clinical outcome. Statistical analysis identified 29 recurrent gains and losses and 3 losses (on 3p, 13q, 21q associated with poor outcome after chemoradiotherapy. The intratumor heterogeneity, assessed from the gene dosage profiles, was low for these alterations, showing that they had emerged prior to many other alterations and probably were early events in carcinogenesis. Integration of the alterations with gene expression and GO data identified genes that were regulated by the alterations and revealed five biological processes that were significantly overrepresented among the affected genes: apoptosis, metabolism, macromolecule localization, translation, and transcription. Four genes on 3p (RYBP, GBE1 and 13q (FAM48A, MED4 correlated with outcome at both the gene dosage and expression level and were satisfactorily validated in the independent cohort. These integrated analyses yielded 57 candidate drivers of 24 genetic events, including novel loci responsible for chemoradioresistance. Further mapping of the connections among genetic events, drivers, and biological processes suggested that each individual event stimulates specific processes in carcinogenesis through the coordinated control of multiple genes. The present results may provide novel therapeutic opportunities of both early and advanced stage cervical cancers.

  11. Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray.

    Science.gov (United States)

    Samolski, Ilanit; de Luis, Alberto; Vizcaíno, Juan Antonio; Monte, Enrique; Suárez, M Belén

    2009-10-13

    It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as

  12. Functional network analysis of genes differentially expressed during xylogenesis in soc1ful woody Arabidopsis plants.

    Science.gov (United States)

    Davin, Nicolas; Edger, Patrick P; Hefer, Charles A; Mizrachi, Eshchar; Schuetz, Mathias; Smets, Erik; Myburg, Alexander A; Douglas, Carl J; Schranz, Michael E; Lens, Frederic

    2016-06-01

    Many plant genes are known to be involved in the development of cambium and wood, but how the expression and functional interaction of these genes determine the unique biology of wood remains largely unknown. We used the soc1ful loss of function mutant - the woodiest genotype known in the otherwise herbaceous model plant Arabidopsis - to investigate the expression and interactions of genes involved in secondary growth (wood formation). Detailed anatomical observations of the stem in combination with mRNA sequencing were used to assess transcriptome remodeling during xylogenesis in wild-type and woody soc1ful plants. To interpret the transcriptome changes, we constructed functional gene association networks of differentially expressed genes using the STRING database. This analysis revealed functionally enriched gene association hubs that are differentially expressed in herbaceous and woody tissues. In particular, we observed the differential expression of genes related to mechanical stress and jasmonate biosynthesis/signaling during wood formation in soc1ful plants that may be an effect of greater tension within woody tissues. Our results suggest that habit shifts from herbaceous to woody life forms observed in many angiosperm lineages could have evolved convergently by genetic changes that modulate the gene expression and interaction network, and thereby redeploy the conserved wood developmental program. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

  13. Construction and comparison of gene co-expression networks shows complex plant immune responses

    Directory of Open Access Journals (Sweden)

    Luis Guillermo Leal

    2014-10-01

    Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.

  14. GESearch: An Interactive GUI Tool for Identifying Gene Expression Signature

    Directory of Open Access Journals (Sweden)

    Ning Ye

    2015-01-01

    Full Text Available The huge amount of gene expression data generated by microarray and next-generation sequencing technologies present challenges to exploit their biological meanings. When searching for the coexpression genes, the data mining process is largely affected by selection of algorithms. Thus, it is highly desirable to provide multiple options of algorithms in the user-friendly analytical toolkit to explore the gene expression signatures. For this purpose, we developed GESearch, an interactive graphical user interface (GUI toolkit, which is written in MATLAB and supports a variety of gene expression data files. This analytical toolkit provides four models, including the mean, the regression, the delegate, and the ensemble models, to identify the coexpression genes, and enables the users to filter data and to select gene expression patterns by browsing the display window or by importing knowledge-based genes. Subsequently, the utility of this analytical toolkit is demonstrated by analyzing two sets of real-life microarray datasets from cell-cycle experiments. Overall, we have developed an interactive GUI toolkit that allows for choosing multiple algorithms for analyzing the gene expression signatures.

  15. Identifying the candidate genes involved in the calyx abscission process of 'Kuerlexiangli' (Pyrus sinkiangensis Yu) by digital transcript abundance measurements.

    Science.gov (United States)

    Qi, Xiaoxiao; Wu, Jun; Wang, Lifen; Li, Leiting; Cao, Yufen; Tian, Luming; Dong, Xingguang; Zhang, Shaoling

    2013-10-23

    'Kuerlexiangli' (Pyrus sinkiangensis Yu), a native pear of Xinjiang, China, is an important agricultural fruit and primary export to the international market. However, fruit with persistent calyxes affect fruit shape and quality. Although several studies have looked into the physiological aspects of the calyx abscission process, the underlying molecular mechanisms remain unknown. In order to better understand the molecular basis of the process of calyx abscission, materials at three critical stages of regulation, with 6000 × Flusilazole plus 300 × PBO treatment (calyx abscising treatment) and 50 mg.L-1GA3 treatment (calyx persisting treatment), were collected and cDNA fragments were sequenced using digital transcript abundance measurements to identify candidate genes. Digital transcript abundance measurements was performed using high-throughput Illumina GAII sequencing on seven samples that were collected at three important stages of the calyx abscission process with chemical agent treatments promoting calyx abscission and persistence. Altogether more than 251,123,845 high quality reads were obtained with approximately 8.0 M raw data for each library. The values of 69.85%-71.90% of clean data in the digital transcript abundance measurements could be mapped to the pear genome database. There were 12,054 differentially expressed genes having Gene Ontology (GO) terms and associating with 251 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. The differentially expressed genes correlated with calyx abscission were mainly involved in photosynthesis, plant hormone signal transduction, cell wall modification, transcriptional regulation, and carbohydrate metabolism. Furthermore, candidate calyx abscission-specific genes, e.g. Inflorescence deficient in abscission gene, were identified. Quantitative real-time PCR was used to confirm the digital transcript abundance measurements results. We identified candidate genes that showed highly dynamic changes in

  16. Meta-analysis of Arabidopsis KANADI1 direct target genes identifies basic growth-promoting module acting upstream of hormonal signaling pathways

    DEFF Research Database (Denmark)

    Xie, Yakun; Straub, Daniel; Eguen, Teinai Ebimienere

    2015-01-01

    An intricate network of antagonistically acting transcription factors mediates formation of a flat leaf lamina of Arabidopsis thaliana plants. In this context, members of the class III homeodomain leucine zipper (HD-ZIPIII) transcription factor family specify the adaxial domain (future upper side......) of the leaf, while antagonistically acting KANADI transcription factors determine the abaxial domain (future lower side). Here we used an mRNA-seq approach to identify genes regulated by KANADI1 (KAN1) and subsequently performed a meta-analysis approach combining our datasets with published genome......-wide datasets. Our analysis revealed that KAN1 acts upstream of several genes encoding auxin biosynthetic enzymes. When exposed to shade, we find three YUCCA genes, YUC2, YUC5 and YUC8 to be transcriptionally upregulated, which correlates with an increase in the levels of free auxin. When ectopically expressed...

  17. Genome-Wide Identification of the Alba Gene Family in Plants and Stress-Responsive Expression of the Rice Alba Genes.

    Science.gov (United States)

    Verma, Jitendra Kumar; Wardhan, Vijay; Singh, Deepali; Chakraborty, Subhra; Chakraborty, Niranjan

    2018-03-28

    Architectural proteins play key roles in genome construction and regulate the expression of many genes, albeit the modulation of genome plasticity by these proteins is largely unknown. A critical screening of the architectural proteins in five crop species, viz., Oryza sativa , Zea mays , Sorghum bicolor , Cicer arietinum , and Vitis vinifera , and in the model plant Arabidopsis thaliana along with evolutionary relevant species such as Chlamydomonas reinhardtii , Physcomitrella patens , and Amborella trichopoda , revealed 9, 20, 10, 7, 7, 6, 1, 4, and 4 Alba (acetylation lowers binding affinity) genes, respectively. A phylogenetic analysis of the genes and of their counterparts in other plant species indicated evolutionary conservation and diversification. In each group, the structural components of the genes and motifs showed significant conservation. The chromosomal location of the Alba genes of rice ( OsAlba ), showed an unequal distribution on 8 of its 12 chromosomes. The expression profiles of the OsAlba genes indicated a distinct tissue-specific expression in the seedling, vegetative, and reproductive stages. The quantitative real-time PCR (qRT-PCR) analysis of the OsAlba genes confirmed their stress-inducible expression under multivariate environmental conditions and phytohormone treatments. The evaluation of the regulatory elements in 68 Alba genes from the 9 species studied led to the identification of conserved motifs and overlapping microRNA (miRNA) target sites, suggesting the conservation of their function in related proteins and a divergence in their biological roles across species. The 3D structure and the prediction of putative ligands and their binding sites for OsAlba proteins offered a key insight into the structure-function relationship. These results provide a comprehensive overview of the subtle genetic diversification of the OsAlba genes, which will help in elucidating their functional role in plants.

  18. Silicon Regulates Potential Genes Involved in Major Physiological Processes in Plants to Combat Stress

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2017-08-01

    Full Text Available Silicon (Si, the quasi-essential element occurs as the second most abundant element in the earth's crust. Biological importance of Si in plant kingdom has become inevitable particularly under stressed environment. In general, plants are classified as high, medium, and low silicon accumulators based on the ability of roots to absorb Si. The uptake of Si directly influence the positive effects attributed to the plant but Si supplementation proves to mitigate stress and recover plant growth even in low accumulating plants like tomato. The application of Si in soil as well as soil-less cultivation systems have resulted in the enhancement of quantitative and qualitative traits of plants even under stressed environment. Silicon possesses several mechanisms to regulate the physiological, biochemical, and antioxidant metabolism in plants to combat abiotic and biotic stresses. Nevertheless, very few reports are available on the aspect of Si-mediated molecular regulation of genes with potential role in stress tolerance. The recent advancements in the era of genomics and transcriptomics have opened an avenue for the determination of molecular rationale associated with the Si amendment to the stress alleviation in plants. Therefore, the present endeavor has attempted to describe the recent discoveries related to the regulation of vital genes involved in photosynthesis, transcription regulation, defense, water transport, polyamine synthesis, and housekeeping genes during abiotic and biotic stress alleviation by Si. Furthermore, an overview of Si-mediated modulation of multiple genes involved in stress response pathways such as phenylpropanoid pathway, jasmonic acid pathway, ABA-dependent or independent regulatory pathway have been discussed in this review.

  19. Genome Evolution of Plant-Parasitic Nematodes.

    Science.gov (United States)

    Kikuchi, Taisei; Eves-van den Akker, Sebastian; Jones, John T

    2017-08-04

    Plant parasitism has evolved independently on at least four separate occasions in the phylum Nematoda. The application of next-generation sequencing (NGS) to plant-parasitic nematodes has allowed a wide range of genome- or transcriptome-level comparisons, and these have identified genome adaptations that enable parasitism of plants. Current genome data suggest that horizontal gene transfer, gene family expansions, evolution of new genes that mediate interactions with the host, and parasitism-specific gene regulation are important adaptations that allow nematodes to parasitize plants. Sequencing of a larger number of nematode genomes, including plant parasites that show different modes of parasitism or that have evolved in currently unsampled clades, and using free-living taxa as comparators would allow more detailed analysis and a better understanding of the organization of key genes within the genomes. This would facilitate a more complete understanding of the way in which parasitism has shaped the genomes of plant-parasitic nematodes.

  20. Role of ethylene and related gene expression in the interaction between strawberry plants and the plant growth-promoting bacterium Azospirillum brasilense.

    Science.gov (United States)

    Elías, J M; Guerrero-Molina, M F; Martínez-Zamora, M G; Díaz-Ricci, J C; Pedraza, R O

    2018-05-01

    Induced systemic resistance (ISR) is one of the indirect mechanisms of growth promotion exerted by plant growth-promoting bacteria, and can be mediated by ethylene (ET). We assessed ET production and the expression of related genes in the Azospirillum-strawberry plant interaction. Ethylene production was evaluated by gas chromatography in plants inoculated or not with A. brasilense REC3. Also, plants were treated with AgNO 3 , an inhibitor of ET biosynthesis; with 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ET biosynthesis; and with indole acetic acid (IAA). Plant dry biomass and the growth index were determined to assess the growth-promoting effect of A. brasilense REC3 in strawberry plants. Quantitative real time PCR (qRT-PCR) was performed to analyse relative expression of the genes Faetr1, Faers1 and Faein4, which encode ET receptors; Factr1 and Faein2, involved in the ET signalling pathway; Faacs1 encoding ACC synthase; Faaco1 encoding ACC oxidase; and Faaux1 and Faami1 for IAA synthesis enzymes. Results showed that ET acts as a rapid and transient signal in the first 12 h post-treatment. A. brasilense REC3-inoculated plants had a significantly higher growth index compared to control plants. Modulation of the genes Faetr1, Faers1, Faein4, Factr1, Faein2 and Faaco1 indicated activation of ET synthesis and signalling pathways. The up-regulation of Faaux1 and Faami1 involved in IAA synthesis suggested that inoculation with A. brasilense REC3 induces production of this auxin, modulating ET signalling. Ethylene production and up-regulation of genes associated with ET signalling in strawberry plants inoculated with A. brasilense REC3 support the priming activation characteristic of ISR. This type of resistance and the activation of systemic acquired resistance previously observed in this interaction indicate that both are present in strawberry plants, could act synergistically and increase protection against pathogens. © 2018 German Society

  1. Epidermal growth factor gene is a newly identified candidate gene for gout

    Science.gov (United States)

    Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui

    2016-01-01

    Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67–0.88, Padjusted = 6.42 × 10−3). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations. PMID:27506295

  2. Cadmium resistance in tobacco plants expressing the MuSI gene

    OpenAIRE

    Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon

    2011-01-01

    MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI t...

  3. Identifying the genes of unconventional high temperature superconductors.

    Science.gov (United States)

    Hu, Jiangping

    We elucidate a recently emergent framework in unifying the two families of high temperature (high [Formula: see text]) superconductors, cuprates and iron-based superconductors. The unification suggests that the latter is simply the counterpart of the former to realize robust extended s-wave pairing symmetries in a square lattice. The unification identifies that the key ingredients (gene) of high [Formula: see text] superconductors is a quasi two dimensional electronic environment in which the d -orbitals of cations that participate in strong in-plane couplings to the p -orbitals of anions are isolated near Fermi energy. With this gene, the superexchange magnetic interactions mediated by anions could maximize their contributions to superconductivity. Creating the gene requires special arrangements between local electronic structures and crystal lattice structures. The speciality explains why high [Formula: see text] superconductors are so rare. An explicit prediction is made to realize high [Formula: see text] superconductivity in Co/Ni-based materials with a quasi two dimensional hexagonal lattice structure formed by trigonal bipyramidal complexes.

  4. Gene expression differences between Noccaea caerulescens ecotypes help to identify candidate genes for metal phytoremediation.

    Science.gov (United States)

    Halimaa, Pauliina; Lin, Ya-Fen; Ahonen, Viivi H; Blande, Daniel; Clemens, Stephan; Gyenesei, Attila; Häikiö, Elina; Kärenlampi, Sirpa O; Laiho, Asta; Aarts, Mark G M; Pursiheimo, Juha-Pekka; Schat, Henk; Schmidt, Holger; Tuomainen, Marjo H; Tervahauta, Arja I

    2014-03-18

    Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically well-characterized N. caerulescens accessions, i.e., Ganges, La Calamine, and Monte Prinzera. Genes with possible contribution to zinc, cadmium, and nickel hyperaccumulation and hypertolerance were predicted. The most significant differences between the accessions were related to metal ion (di-, trivalent inorganic cation) transmembrane transporter activity, iron and calcium ion binding, (inorganic) anion transmembrane transporter activity, and antioxidant activity. Analysis of correlation between the expression profile of each gene and the metal-related characteristics of the accessions disclosed both previously characterized (HMA4, HMA3) and new candidate genes (e.g., for nickel IRT1, ZIP10, and PDF2.3) as possible contributors to the hyperaccumulation/tolerance phenotype. A number of unknown Noccaea-specific transcripts also showed correlation with Zn(2+), Cd(2+), or Ni(2+) hyperaccumulation/tolerance. This study shows that N. caerulescens populations have evolved great diversity in the expression of metal-related genes, facilitating adaptation to various metalliferous soils. The information will be helpful in the development of improved plants for metal phytoremediation.

  5. Taxonomically Different Co-Microsymbionts of a Relict Legume, Oxytropis popoviana, Have Complementary Sets of Symbiotic Genes and Together Increase the Efficiency of Plant Nodulation.

    Science.gov (United States)

    Safronova, Vera I; Belimov, Andrey A; Sazanova, Anna L; Chirak, Elizaveta R; Verkhozina, Alla V; Kuznetsova, Irina G; Andronov, Evgeny E; Puhalsky, Jan V; Tikhonovich, Igor A

    2018-06-20

    Ten rhizobial strains were isolated from root nodules of a relict legume Oxytropis popoviana Peschkova. For identification of the isolates, sequencing of rrs, the internal transcribed spacer region, and housekeeping genes recA, glnII, and rpoB was used. Nine fast-growing isolates were Mesorhizobium-related; eight strains were identified as M. japonicum and one isolate belonged to M. kowhaii. The only slow-growing isolate was identified as a Bradyrhizobium sp. Two strains, M. japonicum Opo-242 and Bradyrhizobium sp. strain Opo-243, were isolated from the same nodule. Symbiotic genes of these isolates were searched throughout the whole-genome sequences. The common nodABC genes and other symbiotic genes required for plant nodulation and nitrogen fixation were present in the isolate Opo-242. Strain Opo-243 did not contain the principal nod, nif, and fix genes; however, five genes (nodP, nodQ, nifL, nolK, and noeL) affecting the specificity of plant-rhizobia interactions but absent in isolate Opo-242 were detected. Strain Opo-243 could not induce nodules but significantly accelerated the root nodule formation after coinoculation with isolate Opo-242. Thus, we demonstrated that taxonomically different strains of the archaic symbiotic system can be co-microsymbionts infecting the same nodule and promoting the nodulation process due to complementary sets of symbiotic genes.

  6. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    Directory of Open Access Journals (Sweden)

    Kogner Per

    2011-04-01

    Full Text Available Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB; Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples. Four distinct clusters were identified by Principal Components Analysis (PCA in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p ALK, BIRC5, and PHOX2B, and was significantly associated with higher tumour stage, poor outcome and poor survival compared to the Type 1-corresponding favourable group (INSS stage 4 and/or dead of disease, p Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group's specific characteristics.

  7. Gene Overexpression Resources in Cereals for Functional Genomics and Discovery of Useful Genes

    Directory of Open Access Journals (Sweden)

    Kiyomi Abe

    2016-09-01

    Full Text Available Identification and elucidation of functions of plant genes is valuable for both basic and applied research. In addition to natural variation in model plants, numerous loss-of-function resources have been produced by mutagenesis with chemicals, irradiation, or insertions of transposable elements or T-DNA. However, we may be unable to observe loss-of-function phenotypes for genes with functionally redundant homologs, and for those essential for growth and development. To offset such disadvantages, gain-of-function transgenic resources have been exploited. Activation-tagged lines have been generated using obligatory overexpression of endogenous genes by random insertion of an enhancer. Recent progress in DNA sequencing technology and bioinformatics has enabled the preparation of genomewide collections of full-length cDNAs (fl-cDNAs in some model species. Using the fl-cDNA clones, a novel gain-of-function strategy, Fl-cDNA OvereXpressor gene (FOX-hunting system, has been developed. A mutant phenotype in a FOX line can be directly attributed to the overexpressed fl-cDNA. Investigating a large population of FOX lines could reveal important genes conferring favorable phenotypes for crop breeding. Alternatively, a unique loss-of-function approach Chimeric REpressor gene Silencing Technology (CRES-T has been developed. In CRES-T, overexpression of a chimeric repressor, composed of the coding sequence of a transcription factor (TF and short peptide designated as the repression domain, could interfere with the action of endogenous TF in plants. Although plant TFs usually consist of gene families, CRES-T is effective, in principle, even for the TFs with functional redundancy. In this review, we focus on the current status of the gene-overexpression strategies and resources for identifying and elucidating novel functions of cereal genes. We discuss the potential of these research tools for identifying useful genes and phenotypes for application in crop

  8. Advances in plant gene-targeted and functional markers: a review

    Directory of Open Access Journals (Sweden)

    Poczai Péter

    2013-02-01

    Full Text Available Abstract Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information

  9. Advances in plant gene-targeted and functional markers: a review

    Science.gov (United States)

    2013-01-01

    Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the

  10. De Novo Transcriptome Sequencing of Olea europaea L. to Identify Genes Involved in the Development of the Pollen Tube.

    Science.gov (United States)

    Iaria, Domenico; Chiappetta, Adriana; Muzzalupo, Innocenzo

    2016-01-01

    In olive (Olea europaea L.), the processes controlling self-incompatibility are still unclear and the molecular basis underlying this process are still not fully characterized. In order to determine compatibility relationships, using next-generation sequencing techniques and a de novo transcriptome assembly strategy, we show that pollen tubes from different olive plants, grown in vitro in a medium containing its own pistil and in combination pollen/pistil from self-sterile and self-fertile cultivars, have a distinct gene expression profile and many of the differentially expressed sequences between the samples fall within gene families involved in the development of the pollen tube, such as lipase, carboxylesterase, pectinesterase, pectin methylesterase, and callose synthase. Moreover, different genes involved in signal transduction, transcription, and growth are overrepresented. The analysis also allowed us to identify members in actin and actin depolymerization factor and fibrin gene family and member of the Ca(2+) binding gene family related to the development and polarization of pollen apical tip. The whole transcriptomic analysis, through the identification of the differentially expressed transcripts set and an extended functional annotation analysis, will lead to a better understanding of the mechanisms of pollen germination and pollen tube growth in the olive.

  11. plantiSMASH: automated identification, annotation and expression analysis of plant biosynthetic gene clusters

    DEFF Research Database (Denmark)

    Kautsar, Satria A.; Suarez Duran, Hernando G.; Blin, Kai

    2017-01-01

    exploration of the nature and dynamics of gene clustering in plant metabolism. Moreover, spurred by the continuing decrease in costs of plant genome sequencing, they will allow genome mining technologies to be applied to plant natural product discovery. The plantiSMASH web server, precalculated results...

  12. Structural evolution of the 4/1 genes and proteins in non-vascular and lower vascular plants.

    Science.gov (United States)

    Morozov, Sergey Y; Milyutina, Irina A; Bobrova, Vera K; Ryazantsev, Dmitry Y; Erokhina, Tatiana N; Zavriev, Sergey K; Agranovsky, Alexey A; Solovyev, Andrey G; Troitsky, Alexey V

    2015-12-01

    The 4/1 protein of unknown function is encoded by a single-copy gene in most higher plants. The 4/1 protein of Nicotiana tabacum (Nt-4/1 protein) has been shown to be alpha-helical and predominantly expressed in conductive tissues. Here, we report the analysis of 4/1 genes and the encoded proteins of lower land plants. Sequences of a number of 4/1 genes from liverworts, lycophytes, ferns and gymnosperms were determined and analyzed together with sequences available in databases. Most of the vascular plants were found to encode Magnoliophyta-like 4/1 proteins exhibiting previously described gene structure and protein properties. Identification of the 4/1-like proteins in hornworts, liverworts and charophyte algae (sister lineage to all land plants) but not in mosses suggests that 4/1 proteins are likely important for plant development but not required for a primary metabolic function of plant cell. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  13. Less is more: strategies to remove marker genes from transgenic plants

    Science.gov (United States)

    2013-01-01

    Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification. PMID:23617583

  14. Less is more: strategies to remove marker genes from transgenic plants.

    Science.gov (United States)

    Yau, Yuan-Yeu; Stewart, C Neal

    2013-04-23

    Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification.

  15. Identifying human disease genes through cross-species gene mapping of evolutionary conserved processes.

    Directory of Open Access Journals (Sweden)

    Martin Poot

    2011-05-01

    Full Text Available Understanding complex networks that modulate development in humans is hampered by genetic and phenotypic heterogeneity within and between populations. Here we present a method that exploits natural variation in highly diverse mouse genetic reference panels in which genetic and environmental factors can be tightly controlled. The aim of our study is to test a cross-species genetic mapping strategy, which compares data of gene mapping in human patients with functional data obtained by QTL mapping in recombinant inbred mouse strains in order to prioritize human disease candidate genes.We exploit evolutionary conservation of developmental phenotypes to discover gene variants that influence brain development in humans. We studied corpus callosum volume in a recombinant inbred mouse panel (C57BL/6J×DBA/2J, BXD strains using high-field strength MRI technology. We aligned mouse mapping results for this neuro-anatomical phenotype with genetic data from patients with abnormal corpus callosum (ACC development.From the 61 syndromes which involve an ACC, 51 human candidate genes have been identified. Through interval mapping, we identified a single significant QTL on mouse chromosome 7 for corpus callosum volume with a QTL peak located between 25.5 and 26.7 Mb. Comparing the genes in this mouse QTL region with those associated with human syndromes (involving ACC and those covered by copy number variations (CNV yielded a single overlap, namely HNRPU in humans and Hnrpul1 in mice. Further analysis of corpus callosum volume in BXD strains revealed that the corpus callosum was significantly larger in BXD mice with a B genotype at the Hnrpul1 locus than in BXD mice with a D genotype at Hnrpul1 (F = 22.48, p<9.87*10(-5.This approach that exploits highly diverse mouse strains provides an efficient and effective translational bridge to study the etiology of human developmental disorders, such as autism and schizophrenia.

  16. A cheZ-Like Gene in Azorhizobium caulinodans Is a Key Gene in the Control of Chemotaxis and Colonization of the Host Plant.

    Science.gov (United States)

    Liu, Xiaolin; Liu, Wei; Sun, Yu; Xia, Chunlei; Elmerich, Claudine; Xie, Zhihong

    2018-02-01

    does not contain CheZ but which controls CheY∼P dephosphorylation through a phosphate sink mechanism. Azorhizobium caulinodans ORS571, a microsymbiont of Sesbania rostrata , has an orphan cheZ gene besides two cheY genes similar to those in S. meliloti In addition to controlling the chemotaxis response, the CheZ-like protein in strain ORS571 is playing a role by decreasing bacterial adhesion to the host plant, in contrast to the general situation where chemotaxis-associated proteins promote adhesion. In this study, we identified a CheZ-like protein among Alphaproteobacteria functioning in chemotaxis and the A. caulinodans - S. rostrata symbiosis. Copyright © 2018 American Society for Microbiology.

  17. Hotspots of missense mutation identify novel neurodevelopmental disorder genes and functional domains

    Science.gov (United States)

    Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.

    2017-01-01

    Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100

  18. Identifying the rooted species tree from the distribution of unrooted gene trees under the coalescent.

    Science.gov (United States)

    Allman, Elizabeth S; Degnan, James H; Rhodes, John A

    2011-06-01

    Gene trees are evolutionary trees representing the ancestry of genes sampled from multiple populations. Species trees represent populations of individuals-each with many genes-splitting into new populations or species. The coalescent process, which models ancestry of gene copies within populations, is often used to model the probability distribution of gene trees given a fixed species tree. This multispecies coalescent model provides a framework for phylogeneticists to infer species trees from gene trees using maximum likelihood or Bayesian approaches. Because the coalescent models a branching process over time, all trees are typically assumed to be rooted in this setting. Often, however, gene trees inferred by traditional phylogenetic methods are unrooted. We investigate probabilities of unrooted gene trees under the multispecies coalescent model. We show that when there are four species with one gene sampled per species, the distribution of unrooted gene tree topologies identifies the unrooted species tree topology and some, but not all, information in the species tree edges (branch lengths). The location of the root on the species tree is not identifiable in this situation. However, for 5 or more species with one gene sampled per species, we show that the distribution of unrooted gene tree topologies identifies the rooted species tree topology and all its internal branch lengths. The length of any pendant branch leading to a leaf of the species tree is also identifiable for any species from which more than one gene is sampled.

  19. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    Science.gov (United States)

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  20. Comparative genomic analysis of the Lipase3 gene family in five plant species reveals distinct evolutionary origins.

    Science.gov (United States)

    Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan

    2018-04-01

    Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.

  1. A comprehensive strategy for identifying long-distance mobile peptides in xylem sap.

    Science.gov (United States)

    Okamoto, Satoru; Suzuki, Takamasa; Kawaguchi, Masayoshi; Higashiyama, Tetsuya; Matsubayashi, Yoshikatsu

    2015-11-01

    There is a growing awareness that secreted pemediate organ-to-organ communication in higher plants. Xylem sap peptidomics is an effective but challenging approach for identifying long-distance mobile peptides. In this study we developed a simple, gel-free purification system that combines o-chlorophenol extraction with HPLC separation. Using this system, we successfully identified seven oligopeptides from soybean xylem sap exudate that had one or more post-transcriptional modifications: glycosylation, sulfation and/or hydroxylation. RNA sequencing and quantitative PCR analyses showed that the peptide-encoding genes are expressed in multiple tissues. We further analyzed the long-distance translocation of four of the seven peptides using gene-encoding peptides with single amino acid substitutions, and identified these four peptides as potential root-to-shoot mobile oligopeptides. Promoter-GUS analysis showed that all four peptide-encoding genes were expressed in the inner tissues of the root endodermis. Moreover, we found that some of these peptide-encoding genes responded to biotic and/or abiotic factors. These results indicate that our purification system provides a comprehensive approach for effectively identifying endogenous small peptides and reinforce the concept that higher plants employ various peptides in root-to-shoot signaling. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  2. Analysis of tomato plasma membrane H(+)-ATPase gene family suggests a mycorrhiza-mediated regulatory mechanism conserved in diverse plant species.

    Science.gov (United States)

    Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua

    2016-10-01

    In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.

  3. The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool

    Directory of Open Access Journals (Sweden)

    Nan Zhao

    2018-02-01

    Full Text Available Intergenomic gene transfer (IGT is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies contribute to gene transfer by mediating recombination in the recipient genome.

  4. Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.

    Science.gov (United States)

    Kumar, Rahul

    2016-01-01

    Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.

  5. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gutiérrez Rodrigo A

    2008-09-01

    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  6. Genome-wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Directory of Open Access Journals (Sweden)

    Eunyoung Seo

    2016-08-01

    Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.

  7. Sparse canonical correlation analysis for identifying, connecting and completing gene-expression networks

    NARCIS (Netherlands)

    Waaijenborg, S.; Zwinderman, A.H.

    2009-01-01

    ABSTRACT: BACKGROUND: We generalized penalized canonical correlation analysis for analyzing microarray gene-expression measurements for checking completeness of known metabolic pathways and identifying candidate genes for incorporation in the pathway. We used Wold's method for calculation of the

  8. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L. Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

    Directory of Open Access Journals (Sweden)

    Renesh Bedre

    Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

  9. Identifying genes that mediate anthracyline toxicity in immune cells

    Directory of Open Access Journals (Sweden)

    Amber eFrick

    2015-04-01

    Full Text Available The role of the immune system in response to chemotherapeutic agents remains elusive. The interpatient variability observed in immune and chemotherapeutic cytotoxic responses is likely, at least in part, due to complex genetic differences. Through the use of a panel of genetically diverse mouse inbred strains, we developed a drug screening platform aimed at identifying genes underlying these chemotherapeutic cytotoxic effects on immune cells. Using genome-wide association studies (GWAS, we identified four genome-wide significant quantitative trait loci (QTL that contributed to the sensitivity of doxorubicin and idarubicin in immune cells. Of particular interest, a locus on chromosome 16 was significantly associated with cell viability following idarubicin administration (p = 5.01x10-8. Within this QTL lies App, which encodes amyloid beta precursor protein. Comparison of dose-response curves verified that T-cells in App knockout mice were more sensitive to idarubicin than those of C57BL/6J control mice (p < 0.05.In conclusion, the cellular screening approach coupled with GWAS led to the identification and subsequent validation of a gene involved in T-cell viability after idarubicin treatment. Previous studies have suggested a role for App in in vitro and in vivo cytotoxicity to anticancer agents; the overexpression of App enhances resistance, while the knockdown of this gene is deleterious to cell viability. Thus, further investigations should include performing mechanistic studies, validating additional genes from the GWAS, including Ppfia1 and Ppfibp1, and ultimately translating the findings to in vivo and human studies.

  10. Transcriptome characterization and sequencing-based identification of salt-responsive genes in Millettia pinnata, a semi-mangrove plant.

    Science.gov (United States)

    Huang, Jianzi; Lu, Xiang; Yan, Hao; Chen, Shouyi; Zhang, Wanke; Huang, Rongfeng; Zheng, Yizhi

    2012-04-01

    Semi-mangroves form a group of transitional species between glycophytes and halophytes, and hold unique potential for learning molecular mechanisms underlying plant salt tolerance. Millettia pinnata is a semi-mangrove plant that can survive a wide range of saline conditions in the absence of specialized morphological and physiological traits. By employing the Illumina sequencing platform, we generated ~192 million short reads from four cDNA libraries of M. pinnata and processed them into 108,598 unisequences with a high depth of coverage. The mean length and total length of these unisequences were 606 bp and 65.8 Mb, respectively. A total of 54,596 (50.3%) unisequences were assigned Nr annotations. Functional classification revealed the involvement of unisequences in various biological processes related to metabolism and environmental adaptation. We identified 23,815 candidate salt-responsive genes with significantly differential expression under seawater and freshwater treatments. Based on the reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR analyses, we verified the changes in expression levels for a number of candidate genes. The functional enrichment analyses for the candidate genes showed tissue-specific patterns of transcriptome remodelling upon salt stress in the roots and the leaves. The transcriptome of M. pinnata will provide valuable gene resources for future application in crop improvement. In addition, this study sets a good example for large-scale identification of salt-responsive genes in non-model organisms using the sequencing-based approach.

  11. RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

    Science.gov (United States)

    Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

    2015-01-01

    Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

  12. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  13. Genome-Wide Analysis in Three Fusarium Pathogens Identifies Rapidly Evolving Chromosomes and Genes Associated with Pathogenicity

    Science.gov (United States)

    Sperschneider, Jana; Gardiner, Donald M.; Thatcher, Louise F.; Lyons, Rebecca; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.

    2015-01-01

    Pathogens and hosts are in an ongoing arms race and genes involved in host–pathogen interactions are likely to undergo diversifying selection. Fusarium plant pathogens have evolved diverse infection strategies, but how they interact with their hosts in the biotrophic infection stage remains puzzling. To address this, we analyzed the genomes of three Fusarium plant pathogens for genes that are under diversifying selection. We found a two-speed genome structure both on the chromosome and gene group level. Diversifying selection acts strongly on the dispensable chromosomes in Fusarium oxysporum f. sp. lycopersici and on distinct core chromosome regions in Fusarium graminearum, all of which have associations with virulence. Members of two gene groups evolve rapidly, namely those that encode proteins with an N-terminal [SG]-P-C-[KR]-P sequence motif and proteins that are conserved predominantly in pathogens. Specifically, 29 F. graminearum genes are rapidly evolving, in planta induced and encode secreted proteins, strongly pointing toward effector function. In summary, diversifying selection in Fusarium is strongly reflected as genomic footprints and can be used to predict a small gene set likely to be involved in host–pathogen interactions for experimental verification. PMID:25994930

  14. Integrating genome-wide association study and expression quantitative trait loci data identifies multiple genes and gene set associated with neuroticism.

    Science.gov (United States)

    Fan, Qianrui; Wang, Wenyu; Hao, Jingcan; He, Awen; Wen, Yan; Guo, Xiong; Wu, Cuiyan; Ning, Yujie; Wang, Xi; Wang, Sen; Zhang, Feng

    2017-08-01

    Neuroticism is a fundamental personality trait with significant genetic determinant. To identify novel susceptibility genes for neuroticism, we conducted an integrative analysis of genomic and transcriptomic data of genome wide association study (GWAS) and expression quantitative trait locus (eQTL) study. GWAS summary data was driven from published studies of neuroticism, totally involving 170,906 subjects. eQTL dataset containing 927,753 eQTLs were obtained from an eQTL meta-analysis of 5311 samples. Integrative analysis of GWAS and eQTL data was conducted by summary data-based Mendelian randomization (SMR) analysis software. To identify neuroticism associated gene sets, the SMR analysis results were further subjected to gene set enrichment analysis (GSEA). The gene set annotation dataset (containing 13,311 annotated gene sets) of GSEA Molecular Signatures Database was used. SMR single gene analysis identified 6 significant genes for neuroticism, including MSRA (p value=2.27×10 -10 ), MGC57346 (p value=6.92×10 -7 ), BLK (p value=1.01×10 -6 ), XKR6 (p value=1.11×10 -6 ), C17ORF69 (p value=1.12×10 -6 ) and KIAA1267 (p value=4.00×10 -6 ). Gene set enrichment analysis observed significant association for Chr8p23 gene set (false discovery rate=0.033). Our results provide novel clues for the genetic mechanism studies of neuroticism. Copyright © 2017. Published by Elsevier Inc.

  15. A cross-study gene set enrichment analysis identifies critical pathways in endometriosis

    Directory of Open Access Journals (Sweden)

    Bai Chunyan

    2009-09-01

    Full Text Available Abstract Background Endometriosis is an enigmatic disease. Gene expression profiling of endometriosis has been used in several studies, but few studies went further to classify subtypes of endometriosis based on expression patterns and to identify possible pathways involved in endometriosis. Some of the observed pathways are more inconsistent between the studies, and these candidate pathways presumably only represent a fraction of the pathways involved in endometriosis. Methods We applied a standardised microarray preprocessing and gene set enrichment analysis to six independent studies, and demonstrated increased concordance between these gene datasets. Results We find 16 up-regulated and 19 down-regulated pathways common in ovarian endometriosis data sets, 22 up-regulated and one down-regulated pathway common in peritoneal endometriosis data sets. Among them, 12 up-regulated and 1 down-regulated were found consistent between ovarian and peritoneal endometriosis. The main canonical pathways identified are related to immunological and inflammatory disease. Early secretory phase has the most over-represented pathways in the three uterine cycle phases. There are no overlapping significant pathways between the dataset from human endometrial endothelial cells and the datasets from ovarian endometriosis which used whole tissues. Conclusion The study of complex diseases through pathway analysis is able to highlight genes weakly connected to the phenotype which may be difficult to detect by using classical univariate statistics. By standardised microarray preprocessing and GSEA, we have increased the concordance in identifying many biological mechanisms involved in endometriosis. The identified gene pathways will shed light on the understanding of endometriosis and promote the development of novel therapies.

  16. A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants.

    Directory of Open Access Journals (Sweden)

    Dong Wang

    2006-11-01

    Full Text Available Many biological processes are controlled by intricate networks of transcriptional regulators. With the development of microarray technology, transcriptional changes can be examined at the whole-genome level. However, such analysis often lacks information on the hierarchical relationship between components of a given system. Systemic acquired resistance (SAR is an inducible plant defense response involving a cascade of transcriptional events induced by salicylic acid through the transcription cofactor NPR1. To identify additional regulatory nodes in the SAR network, we performed microarray analysis on Arabidopsis plants expressing the NPR1-GR (glucocorticoid receptor fusion protein. Since nuclear translocation of NPR1-GR requires dexamethasone, we were able to control NPR1-dependent transcription and identify direct transcriptional targets of NPR1. We show that NPR1 directly upregulates the expression of eight WRKY transcription factor genes. This large family of 74 transcription factors has been implicated in various defense responses, but no specific WRKY factor has been placed in the SAR network. Identification of NPR1-regulated WRKY factors allowed us to perform in-depth genetic analysis on a small number of WRKY factors and test well-defined phenotypes of single and double mutants associated with NPR1. Among these WRKY factors we found both positive and negative regulators of SAR. This genomics-directed approach unambiguously positioned five WRKY factors in the complex transcriptional regulatory network of SAR. Our work not only discovered new transcription regulatory components in the signaling network of SAR but also demonstrated that functional studies of large gene families have to take into consideration sequence similarity as well as the expression patterns of the candidates.

  17. A Multiomics Approach to Identify Genes Associated with Childhood Asthma Risk and Morbidity.

    Science.gov (United States)

    Forno, Erick; Wang, Ting; Yan, Qi; Brehm, John; Acosta-Perez, Edna; Colon-Semidey, Angel; Alvarez, Maria; Boutaoui, Nadia; Cloutier, Michelle M; Alcorn, John F; Canino, Glorisa; Chen, Wei; Celedón, Juan C

    2017-10-01

    Childhood asthma is a complex disease. In this study, we aim to identify genes associated with childhood asthma through a multiomics "vertical" approach that integrates multiple analytical steps using linear and logistic regression models. In a case-control study of childhood asthma in Puerto Ricans (n = 1,127), we used adjusted linear or logistic regression models to evaluate associations between several analytical steps of omics data, including genome-wide (GW) genotype data, GW methylation, GW expression profiling, cytokine levels, asthma-intermediate phenotypes, and asthma status. At each point, only the top genes/single-nucleotide polymorphisms/probes/cytokines were carried forward for subsequent analysis. In step 1, asthma modified the gene expression-protein level association for 1,645 genes; pathway analysis showed an enrichment of these genes in the cytokine signaling system (n = 269 genes). In steps 2-3, expression levels of 40 genes were associated with intermediate phenotypes (asthma onset age, forced expiratory volume in 1 second, exacerbations, eosinophil counts, and skin test reactivity); of those, methylation of seven genes was also associated with asthma. Of these seven candidate genes, IL5RA was also significant in analytical steps 4-8. We then measured plasma IL-5 receptor α levels, which were associated with asthma age of onset and moderate-severe exacerbations. In addition, in silico database analysis showed that several of our identified IL5RA single-nucleotide polymorphisms are associated with transcription factors related to asthma and atopy. This approach integrates several analytical steps and is able to identify biologically relevant asthma-related genes, such as IL5RA. It differs from other methods that rely on complex statistical models with various assumptions.

  18. Using The Corngrass1 Gene To Enhance The Biofuel Properties Of Crop Plants

    Energy Technology Data Exchange (ETDEWEB)

    Hake, Sarah [USDA Agricultural Research Service, Washington DC (United States); Chuck, George [USDA Agricultural Research Service, Washington DC (United States)

    2015-10-29

    The development of novel plant germplasm is vital to addressing our increasing bioenergy demands. The major hurdle to digesting plant biomass is the complex structure of the cell walls, the substrate of fermentation. Plant cell walls are inaccessible matrices of macromolecules that are polymerized with lignin, making fermentation difficult. Overcoming this hurdle is a major goal toward developing usable bioenergy crop plants. Our project seeks to enhance the biofuel properties of perennial grass species using the Corngrass1 (Cg1) gene and its targets. Dominant maize Cg1 mutants produce increased biomass by continuously initiating extra axillary meristems and leaves. We cloned Cg1 and showed that its phenotype is caused by over expression of a unique miR156 microRNA gene that negatively regulates SPL transcription factors. We transferred the Cg1 phenotype to other plants by expressing the gene behind constitutive promoters in four different species, including the monocots, Brachypodium and switchgrass, and dicots, Arabidopsis and poplar. All transformants displayed a similar range of phenotypes, including increased biomass from extended leaf production, and increased vegetative branching. Field grown switchgrass transformants showed that overall lignin content was reduced, the ratio of glucans to xylans was increased, and surprisingly, that starch levels were greatly increased. The goals of this project are to control the tissue and temporal expression of Cg1 by using different promoters to drive its expression, elucidate the function of the SPL targets of Cg1 by generating gain and loss of function alleles, and isolate downstream targets of select SPL genes using deep sequencing and chromatin immunoprecipitation. We believe it is possible to control biomass accumulation, cell wall properties, and sugar levels through manipulation of either the Cg1 gene and/or its SPL targets.

  19. Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Kenneth W. Berendzen

    2013-04-01

    Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.

  20. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  1. MethylMix 2.0: an R package for identifying DNA methylation genes.

    Science.gov (United States)

    Cedoz, Pierre-Louis; Prunello, Marcos; Brennan, Kevin; Gevaert, Olivier

    2018-04-14

    DNA methylation is an important mechanism regulating gene transcription, and its role in carcinogenesis has been extensively studied. Hyper and hypomethylation of genes is a major mechanism of gene expression deregulation in a wide range of diseases. At the same time, high-throughput DNA methylation assays have been developed generating vast amounts of genome wide DNA methylation measurements. We developed MethylMix, an algorithm implemented in R to identify disease specific hyper and hypomethylated genes. Here we present a new version of MethylMix that automates the construction of DNA-methylation and gene expression datasets from The Cancer Genome Atlas (TCGA). More precisely, MethylMix 2.0 incorporates two major updates: the automated downloading of DNA methylation and gene expression datasets from TCGA and the automated preprocessing of such datasets: value imputation, batch correction and CpG sites clustering within each gene. The resulting datasets can subsequently be analyzed with MethylMix to identify transcriptionally predictive methylation states. We show that the Differential Methylation Values created by MethylMix can be used for cancer subtyping. olivier.gevaert@stanford.edu. https://bioconductor.org/packages/release/bioc/manuals/MethylMix/man/MethylMix.pdf. MethylMix 2.0 was implemented as an R package and is available in bioconductor.

  2. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    Science.gov (United States)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  3. Overexpression screens identify conserved dosage chromosome instability genes in yeast and human cancer

    Science.gov (United States)

    Duffy, Supipi; Fam, Hok Khim; Wang, Yi Kan; Styles, Erin B.; Kim, Jung-Hyun; Ang, J. Sidney; Singh, Tejomayee; Larionov, Vladimir; Shah, Sohrab P.; Andrews, Brenda; Boerkoel, Cornelius F.; Hieter, Philip

    2016-01-01

    Somatic copy number amplification and gene overexpression are common features of many cancers. To determine the role of gene overexpression on chromosome instability (CIN), we performed genome-wide screens in the budding yeast for yeast genes that cause CIN when overexpressed, a phenotype we refer to as dosage CIN (dCIN), and identified 245 dCIN genes. This catalog of genes reveals human orthologs known to be recurrently overexpressed and/or amplified in tumors. We show that two genes, TDP1, a tyrosyl-DNA-phosphdiesterase, and TAF12, an RNA polymerase II TATA-box binding factor, cause CIN when overexpressed in human cells. Rhabdomyosarcoma lines with elevated human Tdp1 levels also exhibit CIN that can be partially rescued by siRNA-mediated knockdown of TDP1. Overexpression of dCIN genes represents a genetic vulnerability that could be leveraged for selective killing of cancer cells through targeting of an unlinked synthetic dosage lethal (SDL) partner. Using SDL screens in yeast, we identified a set of genes that when deleted specifically kill cells with high levels of Tdp1. One gene was the histone deacetylase RPD3, for which there are known inhibitors. Both HT1080 cells overexpressing hTDP1 and rhabdomyosarcoma cells with elevated levels of hTdp1 were more sensitive to histone deacetylase inhibitors valproic acid (VPA) and trichostatin A (TSA), recapitulating the SDL interaction in human cells and suggesting VPA and TSA as potential therapeutic agents for tumors with elevated levels of hTdp1. The catalog of dCIN genes presented here provides a candidate list to identify genes that cause CIN when overexpressed in cancer, which can then be leveraged through SDL to selectively target tumors. PMID:27551064

  4. Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

    Science.gov (United States)

    Wang, Yaqiong; Ma, Hong

    2015-09-01

    Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  5. Seeing the forest for the trees: annotating small RNA producing genes in plants.

    Science.gov (United States)

    Coruh, Ceyda; Shahid, Saima; Axtell, Michael J

    2014-04-01

    A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

    Science.gov (United States)

    Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

    2014-01-01

    Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

  7. Major gene mutations and domestication of plants

    International Nuclear Information System (INIS)

    Ashri, A.

    1989-01-01

    From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

  8. Gene expression and activity of antioxidant enzymes in rice plants, cv. BRS AG, under saline stress.

    Science.gov (United States)

    Rossatto, Tatiana; do Amaral, Marcelo Nogueira; Benitez, Letícia Carvalho; Vighi, Isabel Lopes; Braga, Eugenia Jacira Bolacel; de Magalhães Júnior, Ariano Martins; Maia, Mara Andrade Colares; da Silva Pinto, Luciano

    2017-10-01

    The rice cultivar ( Oryza sativa L.) BRS AG, developed by Embrapa Clima Temperado, is the first cultivar designed for purposes other than human consumption. It may be used in ethanol production and animal feed. Different abiotic stresses negatively affect plant growth. Soil salinity is responsible for a serious reduction in productivity. Therefore, the objective of this study was to evaluate the gene expression and the activity of antioxidant enzymes (SOD, CAT, APX and GR) and identify their functions in controlling ROS levels in rice plants, cultivar BRS AG, after a saline stress period. The plants were grown in vitro with two NaCl concentrations (0 and 136 mM), collected at 10, 15 and 20 days of cultivation. The results indicated that the activity of the enzymes evaluated promotes protection against oxidative stress. Although, there was an increase of reactive oxygen species, there was no increase in MDA levels. Regarding genes encoding isoforms of antioxidant enzymes, it was observed that OsSOD3 - CU/Zn , OsSOD2 - Cu/Zn , OsSOD - Cu/Zn , OsSOD4 - Cu/Zn , OsSODCc1 - Cu/Zn , OsSOD - Fe , OsAPX1 , OsCATB and OsGR2 were the most responsive. The increase in the transcription of all genes among evaluated isoforms, except for OsAPX6 , which remained stable, contributed to the increase or the maintenance of enzyme activity. Thus, it is possible to infer that the cv. BRS AG has defense mechanisms against salt stress.

  9. Integrating mean and variance heterogeneities to identify differentially expressed genes.

    Science.gov (United States)

    Ouyang, Weiwei; An, Qiang; Zhao, Jinying; Qin, Huaizhen

    2016-12-06

    In functional genomics studies, tests on mean heterogeneity have been widely employed to identify differentially expressed genes with distinct mean expression levels under different experimental conditions. Variance heterogeneity (aka, the difference between condition-specific variances) of gene expression levels is simply neglected or calibrated for as an impediment. The mean heterogeneity in the expression level of a gene reflects one aspect of its distribution alteration; and variance heterogeneity induced by condition change may reflect another aspect. Change in condition may alter both mean and some higher-order characteristics of the distributions of expression levels of susceptible genes. In this report, we put forth a conception of mean-variance differentially expressed (MVDE) genes, whose expression means and variances are sensitive to the change in experimental condition. We mathematically proved the null independence of existent mean heterogeneity tests and variance heterogeneity tests. Based on the independence, we proposed an integrative mean-variance test (IMVT) to combine gene-wise mean heterogeneity and variance heterogeneity induced by condition change. The IMVT outperformed its competitors under comprehensive simulations of normality and Laplace settings. For moderate samples, the IMVT well controlled type I error rates, and so did existent mean heterogeneity test (i.e., the Welch t test (WT), the moderated Welch t test (MWT)) and the procedure of separate tests on mean and variance heterogeneities (SMVT), but the likelihood ratio test (LRT) severely inflated type I error rates. In presence of variance heterogeneity, the IMVT appeared noticeably more powerful than all the valid mean heterogeneity tests. Application to the gene profiles of peripheral circulating B raised solid evidence of informative variance heterogeneity. After adjusting for background data structure, the IMVT replicated previous discoveries and identified novel experiment

  10. Systems Genetics Analysis to Identify the Genetic Modulation of a Glaucoma-Associated Gene.

    Science.gov (United States)

    Chintalapudi, Sumana R; Jablonski, Monica M

    2017-01-01

    Loss of retinal ganglion cells (RGCs) is one of the hallmarks of retinal neurodegenerative diseases, glaucoma being one of the most common. Recently, γ-synuclein (SNCG) was shown to be highly expressed in the somas and axons of RGCs. In various mouse models of glaucoma, downregulation of Sncg gene expression correlates with RGC loss. To investigate the regulation of Sncg in RGCs, we used a systems genetics approach to identify a gene that modulates the expression of Sncg, followed by confirmatory studies in both healthy and diseased retinas. We found that chromosome 1 harbors an eQTL that modulates the expression of Sncg in the mouse retina and identified Pfdn2 as the candidate upstream modulator of Sncg expression. Downregulation of Pfdn2 in enriched RGCs causes a concomitant reduction in Sncg. In this chapter, we describe our strategy and methods for identifying and confirming a genetic modulation of a glaucoma-associated gene. A similar method can be applied to other genes expressed in other tissues.

  11. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Genome-Wide Identification of Genes Probably Relevant to the Uniqueness of Tea Plant (Camellia sinensis and Its Cultivars

    Directory of Open Access Journals (Sweden)

    Yan Wei

    2015-01-01

    Full Text Available Tea (Camellia sinensis is a popular beverage all over the world and a number of studies have focused on the genetic uniqueness of tea and its cultivars. However, molecular mechanisms underlying these phenomena are largely undefined. In this report, based on expression data available from public databases, we performed a series of analyses to identify genes probably relevant to the uniqueness of C. sinensis and two of its cultivars (LJ43 and ZH2. Evolutionary analyses showed that the evolutionary rates of genes involved in the pathways were not significantly different among C. sinensis, C. oleifera, and C. azalea. Interestingly, a number of gene families, including genes involved in the pathways synthesizing iconic secondary metabolites of tea plant, were significantly upregulated, expressed in C. sinensis (LJ43 when compared to C. azalea, and this may partially explain its higher content of flavonoid, theanine, and caffeine. Further investigation showed that nonsynonymous mutations may partially contribute to the differences between the two cultivars of C. sinensis, such as the chlorina and higher contents of amino acids in ZH2. Genes identified as candidates are probably relevant to the uniqueness of C. sinensis and its cultivars should be good candidates for subsequent functional analyses and marker-assisted breeding.

  13. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  14. A stochastic model for identifying differential gene pair co-expression patterns in prostate cancer progression

    Directory of Open Access Journals (Sweden)

    Mao Yu

    2009-07-01

    Full Text Available Abstract Background The identification of gene differential co-expression patterns between cancer stages is a newly developing method to reveal the underlying molecular mechanisms of carcinogenesis. Most researches of this subject lack an algorithm useful for performing a statistical significance assessment involving cancer progression. Lacking this specific algorithm is apparently absent in identifying precise gene pairs correlating to cancer progression. Results In this investigation we studied gene pair co-expression change by using a stochastic process model for approximating the underlying dynamic procedure of the co-expression change during cancer progression. Also, we presented a novel analytical method named 'Stochastic process model for Identifying differentially co-expressed Gene pair' (SIG method. This method has been applied to two well known prostate cancer data sets: hormone sensitive versus hormone resistant, and healthy versus cancerous. From these data sets, 428,582 gene pairs and 303,992 gene pairs were identified respectively. Afterwards, we used two different current statistical methods to the same data sets, which were developed to identify gene pair differential co-expression and did not consider cancer progression in algorithm. We then compared these results from three different perspectives: progression analysis, gene pair identification effectiveness analysis, and pathway enrichment analysis. Statistical methods were used to quantify the quality and performance of these different perspectives. They included: Re-identification Scale (RS and Progression Score (PS in progression analysis, True Positive Rate (TPR in gene pair analysis, and Pathway Enrichment Score (PES in pathway analysis. Our results show small values of RS and large values of PS, TPR, and PES; thus, suggesting that gene pairs identified by the SIG method are highly correlated with cancer progression, and highly enriched in disease-specific pathways. From

  15. Approaches to gene pool conservation of medicinal plant Oxytropis lanata (Pall. DC. (Fabaceae

    Directory of Open Access Journals (Sweden)

    A. B. Kholina

    2015-05-01

    Full Text Available In order to preserve the gene pool of medicinal plant Oxytropis lanata (Pall. DC. we analyzed allozyme polymorphism and identified reliable and informative marker enzyme systems of this species; also we studied the response of seeds to deep freezing in liquid nitrogen (–196 ºС. Population has an average level of polymorphism (P95 = 41,2 %, P99 = 52,9 %, A = 1,58, Ho = 0,158, He = 0,171 in general typical for herbaceous legumes, and can serve as a source of material for gene pool conservation of the species. Deep freezing has not led to the death of the seeds; it was marked stimulatory effect of ultralow temperatures, expressed as an acceleration of germination and sharp increase of germinability (98,6 ± 2,3 % compared to the control (12,0 ± 3,5 % that is associated with overcoming physical dormancy. There were no abnormalities in the development of seedlings from seeds passed cryopreservation.

  16. Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

    Science.gov (United States)

    Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

    2018-03-01

    A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

  17. Prequels to Synthetic Biology: From Candidate Gene Identification and Validation to Enzyme Subcellular Localization in Plant and Yeast Cells.

    Science.gov (United States)

    Foureau, E; Carqueijeiro, I; Dugé de Bernonville, T; Melin, C; Lafontaine, F; Besseau, S; Lanoue, A; Papon, N; Oudin, A; Glévarec, G; Clastre, M; St-Pierre, B; Giglioli-Guivarc'h, N; Courdavault, V

    2016-01-01

    Natural compounds extracted from microorganisms or plants constitute an inexhaustible source of valuable molecules whose supply can be potentially challenged by limitations in biological sourcing. The recent progress in synthetic biology combined to the increasing access to extensive transcriptomics and genomics data now provide new alternatives to produce these molecules by transferring their whole biosynthetic pathway in heterologous production platforms such as yeasts or bacteria. While the generation of high titer producing strains remains per se an arduous field of investigation, elucidation of the biosynthetic pathways as well as characterization of their complex subcellular organization are essential prequels to the efficient development of such bioengineering approaches. Using examples from plants and yeasts as a framework, we describe potent methods to rationalize the study of partially characterized pathways, including the basics of computational applications to identify candidate genes in transcriptomics data and the validation of their function by an improved procedure of virus-induced gene silencing mediated by direct DNA transfer to get around possible resistance to Agrobacterium-delivery of viral vectors. To identify potential alterations of biosynthetic fluxes resulting from enzyme mislocalizations in reconstituted pathways, we also detail protocols aiming at characterizing subcellular localizations of protein in plant cells by expression of fluorescent protein fusions through biolistic-mediated transient transformation, and localization of transferred enzymes in yeast using similar fluorescence procedures. Albeit initially developed for the Madagascar periwinkle, these methods may be applied to other plant species or organisms in order to establish synthetic biology platform. © 2016 Elsevier Inc. All rights reserved.

  18. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    LENUS (Irish Health Repository)

    Abel, Frida

    2011-04-14

    Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples). Four distinct clusters were identified by Principal Components Analysis (PCA) in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples) using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p < 0.05, one-way ANOVA test). PCA clusters p1, p2, and p3 were found to correspond well to the postulated subtypes 1, 2A, and 2B, respectively. Remarkably, a fourth novel cluster was detected in all three independent data sets. This cluster comprised mainly 11q-deleted MNA-negative tumours with low expression of ALK, BIRC5, and PHOX2B, and was significantly associated with higher tumour stage, poor outcome and poor survival compared to the Type 1-corresponding favourable group (INSS stage 4 and\\/or dead of disease, p < 0.05, Fisher\\'s exact test). Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group\\'s specific characteristics.

  19. Gene expression meta-analysis identifies metastatic pathways and transcription factors in breast cancer

    International Nuclear Information System (INIS)

    Thomassen, Mads; Tan, Qihua; Kruse, Torben A

    2008-01-01

    Metastasis is believed to progress in several steps including different pathways but the determination and understanding of these mechanisms is still fragmentary. Microarray analysis of gene expression patterns in breast tumors has been used to predict outcome in recent studies. Besides classification of outcome, these global expression patterns may reflect biological mechanisms involved in metastasis of breast cancer. Our purpose has been to investigate pathways and transcription factors involved in metastasis by use of gene expression data sets. We have analyzed 8 publicly available gene expression data sets. A global approach, 'gene set enrichment analysis' as well as an approach focusing on a subset of significantly differently regulated genes, GenMAPP, has been applied to rank pathway gene sets according to differential regulation in metastasizing tumors compared to non-metastasizing tumors. Meta-analysis has been used to determine overrepresentation of pathways and transcription factors targets, concordant deregulated in metastasizing breast tumors, in several data sets. The major findings are up-regulation of cell cycle pathways and a metabolic shift towards glucose metabolism reflected in several pathways in metastasizing tumors. Growth factor pathways seem to play dual roles; EGF and PDGF pathways are decreased, while VEGF and sex-hormone pathways are increased in tumors that metastasize. Furthermore, migration, proteasome, immune system, angiogenesis, DNA repair and several signal transduction pathways are associated to metastasis. Finally several transcription factors e.g. E2F, NFY, and YY1 are identified as being involved in metastasis. By pathway meta-analysis many biological mechanisms beyond major characteristics such as proliferation are identified. Transcription factor analysis identifies a number of key factors that support central pathways. Several previously proposed treatment targets are identified and several new pathways that may

  20. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

    Science.gov (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

    2018-03-01

    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.

    Science.gov (United States)

    Vozárová, Z; Žilová, M; Šubr, Z

    2015-12-01

    Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.

  2. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  3. Remote sensing of gene expression in Planta: transgenic plants as monitors of exogenous stress perception in extraterrestrial environments

    Science.gov (United States)

    Manak, Michael S.; Paul, Anna-Lisa; Sehnke, Paul C.; Ferl, Robert J.

    2002-01-01

    Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the green fluorescent protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and abcissic acid in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system for collecting gene expression data in real time from Transgenic Arabidopsis Gene Expression System (TAGES) biosensor plants during space exploration experiments.

  4. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  5. A cross-species genetic analysis identifies candidate genes for mouse anxiety and human bipolar disorder

    Directory of Open Access Journals (Sweden)

    David G Ashbrook

    2015-07-01

    Full Text Available Bipolar disorder (BD is a significant neuropsychiatric disorder with a lifetime prevalence of ~1%. To identify genetic variants underlying BD genome-wide association studies (GWAS have been carried out. While many variants of small effect associated with BD have been identified few have yet been confirmed, partly because of the low power of GWAS due to multiple comparisons being made. Complementary mapping studies using murine models have identified genetic variants for behavioral traits linked to BD, often with high power, but these identified regions often contain too many genes for clear identification of candidate genes. In the current study we have aligned human BD GWAS results and mouse linkage studies to help define and evaluate candidate genes linked to BD, seeking to use the power of the mouse mapping with the precision of GWAS. We use quantitative trait mapping for open field test and elevated zero maze data in the largest mammalian model system, the BXD recombinant inbred mouse population, to identify genomic regions associated with these BD-like phenotypes. We then investigate these regions in whole genome data from the Psychiatric Genomics Consortium’s bipolar disorder GWAS to identify candidate genes associated with BD. Finally we establish the biological relevance and pathways of these genes in a comprehensive systems genetics analysis.We identify four genes associated with both mouse anxiety and human BD. While TNR is a novel candidate for BD, we can confirm previously suggested associations with CMYA5, MCTP1 and RXRG. A cross-species, systems genetics analysis shows that MCTP1, RXRG and TNR coexpress with genes linked to psychiatric disorders and identify the striatum as a potential site of action. CMYA5, MCTP1, RXRG and TNR are associated with mouse anxiety and human BD. We hypothesize that MCTP1, RXRG and TNR influence intercellular signaling in the striatum.

  6. A systems genetics approach identifies genes and pathways for type 2 diabetes in human islets

    DEFF Research Database (Denmark)

    Taneera, Jalal; Lang, Stefan; Sharma, Amitabh

    2012-01-01

    Close to 50 genetic loci have been associated with type 2 diabetes (T2D), but they explain only 15% of the heritability. In an attempt to identify additional T2D genes, we analyzed global gene expression in human islets from 63 donors. Using 48 genes located near T2D risk variants, we identified ...

  7. Weighted gene co-expression network analysis of expression data of monozygotic twins identifies specific modules and hub genes related to BMI.

    Science.gov (United States)

    Wang, Weijing; Jiang, Wenjie; Hou, Lin; Duan, Haiping; Wu, Yili; Xu, Chunsheng; Tan, Qihua; Li, Shuxia; Zhang, Dongfeng

    2017-11-13

    The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis and weighted gene co-expression network analysis (WGCNA) to identify significant genes and specific modules related to BMI based on gene expression profile data of 7 discordant monozygotic twins. In the differential gene expression analysis, it appeared that 32 differentially expressed genes (DEGs) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database and NF-kappa B signaling pathway within KEGG database. DEGs of NAMPT, TLR9, PTGS2, HBD, and PCSK1N might be associated with obesity. In the WGCNA, among the total 20 distinct co-expression modules identified, coral1 module (68 genes) had the strongest positive correlation with BMI (r = 0.56, P = 0.04) and disease status (r = 0.56, P = 0.04). Categories of positive regulation of phospholipase activity, high-density lipoprotein particle clearance, chylomicron remnant clearance, reverse cholesterol transport, intermediate-density lipoprotein particle, chylomicron, low-density lipoprotein particle, very-low-density lipoprotein particle, voltage-gated potassium channel complex, cholesterol transporter activity, and neuropeptide hormone activity were significantly enriched within GO database for this module. And alcoholism and cell adhesion molecules pathways were significantly enriched within KEGG database. Several hub genes, such as GAL, ASB9, NPPB, TBX2, IL17C, APOE, ABCG4, and APOC2 were also identified. The module eigengene of saddlebrown module (212 genes) was also significantly

  8. Functional analysis of ABC transporter genes from Botrytis cinerea identifies BcatrB as a transporter of eugenol

    NARCIS (Netherlands)

    Schoonbeek, H.; Nistelrooy, van J.G.M.; Waard, de M.A.

    2003-01-01

    The role of multiple ATP-binding cassette (ABC) and major facilitator superfamily (MFS) transporter genes from the plant pathogenic fungus Botrytis cinerea in protection against natural fungitoxic compounds was studied by expression analysis and phenotyping of gene-replacement mutants. The

  9. Comprehensive Analysis of the COBRA-Like (COBL) Gene Family in Gossypium Identifies Two COBLs Potentially Associated with Fiber Quality

    Science.gov (United States)

    Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen

    2015-01-01

    COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066

  10. Evolutionary Inference across Eukaryotes Identifies Specific Pressures Favoring Mitochondrial Gene Retention.

    Science.gov (United States)

    Johnston, Iain G; Williams, Ben P

    2016-02-24

    Since their endosymbiotic origin, mitochondria have lost most of their genes. Although many selective mechanisms underlying the evolution of mitochondrial genomes have been proposed, a data-driven exploration of these hypotheses is lacking, and a quantitatively supported consensus remains absent. We developed HyperTraPS, a methodology coupling stochastic modeling with Bayesian inference, to identify the ordering of evolutionary events and suggest their causes. Using 2015 complete mitochondrial genomes, we inferred evolutionary trajectories of mtDNA gene loss across the eukaryotic tree of life. We find that proteins comprising the structural cores of the electron transport chain are preferentially encoded within mitochondrial genomes across eukaryotes. A combination of high GC content and high protein hydrophobicity is required to explain patterns of mtDNA gene retention; a model that accounts for these selective pressures can also predict the success of artificial gene transfer experiments in vivo. This work provides a general method for data-driven inference of the ordering of evolutionary and progressive events, here identifying the distinct features shaping mitochondrial genomes of present-day species. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Cadmium resistance in tobacco plants expressing the MuSI gene.

    Science.gov (United States)

    Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon

    2011-10-01

    MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI transgenic tobacco plants absorbed less Cd than wild-type plants. Cd translocation from roots to shoots was reduced in the transgenic plants, thereby avoiding Cd toxicity. The number of short trichomes in the leaves of wild-type tobacco plants was increased by Cd treatment, while this was unchanged in MuSI transgenic tobacco. These results suggest that MuSI transgenic tobacco plants have enhanced tolerance to Cd via reduced Cd uptake and/or increased Cd immobilization in the roots, resulting in less Cd translocation to the shoots.

  12. 'Omics' approaches in tomato aimed at identifying candidate genes ...

    African Journals Online (AJOL)

    adriana

    2013-12-04

    Dec 4, 2013 ... approaches could be combined in order to identify candidate genes for the genetic control of ascorbic ..... applied to other traits under the complex control of many ... Engineering increased vitamin C levels in ... Chem. Biol. 13:532–538. Giovannucci E, Rimm EB, Liu Y, Stampfer MJ, Willett WC (2002). A.

  13. Massive lateral transfer of genes encoding plant cell wall-degrading enzymes to the mycoparasitic fungus Trichoderma from its plant-associated hosts

    Science.gov (United States)

    Chenthamara, Komal; Zhang, Jian; Atanasova, Lea; Yang, Dongqing; Miao, Youzhi; Grujic, Marica; Pourmehdi, Shadi; Pretzer, Carina; Kopchinskiy, Alexey G.; Hundley, Hope; Wang, Mei; Aerts, Andrea; Salamov, Asaf; Lipzen, Anna; Barry, Kerrie; Grigoriev, Igor V.; Shen, Qirong; Kubicek, Christian P.

    2018-01-01

    Unlike most other fungi, molds of the genus Trichoderma (Hypocreales, Ascomycota) are aggressive parasites of other fungi and efficient decomposers of plant biomass. Although nutritional shifts are common among hypocrealean fungi, there are no examples of such broad substrate versatility as that observed in Trichoderma. A phylogenomic analysis of 23 hypocrealean fungi (including nine Trichoderma spp. and the related Escovopsis weberi) revealed that the genus Trichoderma has evolved from an ancestor with limited cellulolytic capability that fed on either fungi or arthropods. The evolutionary analysis of Trichoderma genes encoding plant cell wall-degrading carbohydrate-active enzymes and auxiliary proteins (pcwdCAZome, 122 gene families) based on a gene tree / species tree reconciliation demonstrated that the formation of the genus was accompanied by an unprecedented extent of lateral gene transfer (LGT). Nearly one-half of the genes in Trichoderma pcwdCAZome (41%) were obtained via LGT from plant-associated filamentous fungi belonging to different classes of Ascomycota, while no LGT was observed from other potential donors. In addition to the ability to feed on unrelated fungi (such as Basidiomycota), we also showed that Trichoderma is capable of endoparasitism on a broad range of Ascomycota, including extant LGT donors. This phenomenon was not observed in E. weberi and rarely in other mycoparasitic hypocrealean fungi. Thus, our study suggests that LGT is linked to the ability of Trichoderma to parasitize taxonomically related fungi (up to adelphoparasitism in strict sense). This may have allowed primarily mycotrophic Trichoderma fungi to evolve into decomposers of plant biomass. PMID:29630596

  14. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  15. Coalitional game theory as a promising approach to identify candidate autism genes.

    Science.gov (United States)

    Gupta, Anika; Sun, Min Woo; Paskov, Kelley Marie; Stockham, Nate Tyler; Jung, Jae-Yoon; Wall, Dennis Paul

    2018-01-01

    Despite mounting evidence for the strong role of genetics in the phenotypic manifestation of Autism Spectrum Disorder (ASD), the specific genes responsible for the variable forms of ASD remain undefined. ASD may be best explained by a combinatorial genetic model with varying epistatic interactions across many small effect mutations. Coalitional or cooperative game theory is a technique that studies the combined effects of groups of players, known as coalitions, seeking to identify players who tend to improve the performance--the relationship to a specific disease phenotype--of any coalition they join. This method has been previously shown to boost biologically informative signal in gene expression data but to-date has not been applied to the search for cooperative mutations among putative ASD genes. We describe our approach to highlight genes relevant to ASD using coalitional game theory on alteration data of 1,965 fully sequenced genomes from 756 multiplex families. Alterations were encoded into binary matrices for ASD (case) and unaffected (control) samples, indicating likely gene-disrupting, inherited mutations in altered genes. To determine individual gene contributions given an ASD phenotype, a "player" metric, referred to as the Shapley value, was calculated for each gene in the case and control cohorts. Sixty seven genes were found to have significantly elevated player scores and likely represent significant contributors to the genetic coordination underlying ASD. Using network and cross-study analysis, we found that these genes are involved in biological pathways known to be affected in the autism cases and that a subset directly interact with several genes known to have strong associations to autism. These findings suggest that coalitional game theory can be applied to large-scale genomic data to identify hidden yet influential players in complex polygenic disorders such as autism.

  16. Plant nodulation inducers enhance horizontal gene transfer of Azorhizobium caulinodans symbiosis island.

    Science.gov (United States)

    Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun

    2016-11-29

    Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.

  17. Reconstruction of Oomycete Genome Evolution Identifies Differences in Evolutionary Trajectories Leading to Present-Day Large Gene Families

    NARCIS (Netherlands)

    Seidl, M.F.; Ackerveken, van den G.; Govers, F.; Snel, B.

    2012-01-01

    The taxonomic class of oomycetes contains numerous pathogens of plants and animals but is related to nonpathogenic diatoms and brown algae. Oomycetes have flexible genomes comprising large gene families that play roles in pathogenicity. The evolutionary processes that shaped the gene content have

  18. A collection of cytochrome P450 monooxygenase genes involved in modification and detoxification of herbicide atrazine in rice (Oryza sativa) plants.

    Science.gov (United States)

    Rong Tan, Li; Chen Lu, Yi; Jing Zhang, Jing; Luo, Fang; Yang, Hong

    2015-09-01

    Plant cytochrome P450 monooxygenases constitute one of the largest families of protein genes involved in plant growth, development and acclimation to biotic and abiotic stresses. However, whether these genes respond to organic toxic compounds and their biological functions for detoxifying toxic compounds such as herbicides in rice are poorly understood. The present study identified 201 genes encoding cytochrome P450s from an atrazine-exposed rice transcriptome through high-throughput sequencing. Of these, 69 cytochrome P450 genes were validated by microarray and some of them were confirmed by real time PCR. Activities of NADPH-cytochrome P450 reductase (CPR) and p-nitroanisole O-demethylase (PNOD) related to toxicity were determined and significantly induced by atrazine exposure. To dissect the mechanism underlying atrazine modification and detoxification by P450, metabolites (or derivatives) of atrazine in plants were analyzed by ultra performance liquid chromatography mass spectrometry (UPLC/MS). Major metabolites comprised desmethylatrazine (DMA), desethylatrazine (DEA), desisopropylatrazine (DIA), hydroxyatrazine (HA), hydroxyethylatrazine (HEA) and hydroxyisopropylatrazine (HIA). All of them were chemically modified by P450s. Furthermore, two specific inhibitors of piperonyl butoxide (PBO) and malathion (MAL) were used to assess the correlation between the P450s activity and rice responses including accumulation of atrazine in tissues, shoot and root growth and detoxification. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Rosa Lozano-Durán

    2013-03-01

    Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the

  20. A DNA barcode for land plants.

    Science.gov (United States)

    2009-08-04

    DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK-psbI spacer, and trnH-psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants.

  1. Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

    2017-01-01

    Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms

  2. Transcriptional Profiling of Whole Blood Identifies a Unique 5-Gene Signature for Myelofibrosis and Imminent Myelofibrosis Transformation

    DEFF Research Database (Denmark)

    Hasselbalch, Hans Carl; Skov, Vibe; Stauffer Larsen, Thomas

    2014-01-01

    Identifying a distinct gene signature for myelofibrosis may yield novel information of the genes, which are responsible for progression of essential thrombocythemia and polycythemia vera towards myelofibrosis. We aimed at identifying a simple gene signature - composed of a few genes - which were...

  3. The FUN of identifying gene function in bacterial pathogens; insights from Salmonella functional genomics.

    Science.gov (United States)

    Hammarlöf, Disa L; Canals, Rocío; Hinton, Jay C D

    2013-10-01

    The availability of thousands of genome sequences of bacterial pathogens poses a particular challenge because each genome contains hundreds of genes of unknown function (FUN). How can we easily discover which FUN genes encode important virulence factors? One solution is to combine two different functional genomic approaches. First, transcriptomics identifies bacterial FUN genes that show differential expression during the process of mammalian infection. Second, global mutagenesis identifies individual FUN genes that the pathogen requires to cause disease. The intersection of these datasets can reveal a small set of candidate genes most likely to encode novel virulence attributes. We demonstrate this approach with the Salmonella infection model, and propose that a similar strategy could be used for other bacterial pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. A contribution to the study of plant development evolution based on gene co-expression networks

    Directory of Open Access Journals (Sweden)

    Francisco J. Romero-Campero

    2013-08-01

    Full Text Available Phototrophic eukaryotes are among the most successful organisms on Earth due to their unparalleled efficiency at capturing light energy and fixing carbon dioxide to produce organic molecules. A conserved and efficient network of light-dependent regulatory modules could be at the bases of this success. This regulatory system conferred early advantages to phototrophic eukaryotes that allowed for specialization, complex developmental processes and modern plant characteristics. We have studied light-dependent gene regulatory modules from algae to plants employing integrative-omics approaches based on gene co-expression networks. Our study reveals some remarkably conserved ways in which eukaryotic phototrophs deal with day length and light signaling. Here we describe how a family of Arabidopsis transcription factors involved in photoperiod response has evolved from a single algal gene according to the innovation, amplification and divergence theory of gene evolution by duplication. These modifications of the gene co-expression networks from the ancient unicellular green algae Chlamydomonas reinhardtii to the modern brassica Arabidopsis thaliana may hint on the evolution and specialization of plants and other organisms.

  5. Gravity-regulated gene expression in Arabidopsis thaliana

    Science.gov (United States)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  6. Gene expression signature analysis identifies vorinostat as a candidate therapy for gastric cancer.

    Directory of Open Access Journals (Sweden)

    Sofie Claerhout

    Full Text Available Gastric cancer continues to be one of the deadliest cancers in the world and therefore identification of new drugs targeting this type of cancer is thus of significant importance. The purpose of this study was to identify and validate a therapeutic agent which might improve the outcomes for gastric cancer patients in the future.Using microarray technology, we generated a gene expression profile of human gastric cancer-specific genes from human gastric cancer tissue samples. We used this profile in the Broad Institute's Connectivity Map analysis to identify candidate therapeutic compounds for gastric cancer. We found the histone deacetylase inhibitor vorinostat as the lead compound and thus a potential therapeutic drug for gastric cancer. Vorinostat induced both apoptosis and autophagy in gastric cancer cell lines. Pharmacological and genetic inhibition of autophagy however, increased the therapeutic efficacy of vorinostat, indicating that a combination of vorinostat with autophagy inhibitors may therapeutically be more beneficial. Moreover, gene expression analysis of gastric cancer identified a collection of genes (ITGB5, TYMS, MYB, APOC1, CBX5, PLA2G2A, and KIF20A whose expression was elevated in gastric tumor tissue and downregulated more than 2-fold by vorinostat treatment in gastric cancer cell lines. In contrast, SCGB2A1, TCN1, CFD, APLP1, and NQO1 manifested a reversed pattern.We showed that analysis of gene expression signature may represent an emerging approach to discover therapeutic agents for gastric cancer, such as vorinostat. The observation of altered gene expression after vorinostat treatment may provide the clue to identify the molecular mechanism of vorinostat and those patients likely to benefit from vorinostat treatment.

  7. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Science.gov (United States)

    Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

    2013-01-01

    As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  8. Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

    Science.gov (United States)

    Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

    2014-12-01

    We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

  9. Identifying novel genes and biological processes relevant to the development of cancer therapy-induced mucositis: An informative gene network analysis.

    Directory of Open Access Journals (Sweden)

    Cielito C Reyes-Gibby

    Full Text Available Mucositis is a complex, dose-limiting toxicity of chemotherapy or radiotherapy that leads to painful mouth ulcers, difficulty eating or swallowing, gastrointestinal distress, and reduced quality of life for patients with cancer. Mucositis is most common for those undergoing high-dose chemotherapy and hematopoietic stem cell transplantation and for those being treated for malignancies of the head and neck. Treatment and management of mucositis remain challenging. It is expected that multiple genes are involved in the formation, severity, and persistence of mucositis. We used Ingenuity Pathway Analysis (IPA, a novel network-based approach that integrates complex intracellular and intercellular interactions involved in diseases, to systematically explore the molecular complexity of mucositis. As a first step, we searched the literature to identify genes that harbor or are close to the genetic variants significantly associated with mucositis. Our literature review identified 27 candidate genes, of which ERCC1, XRCC1, and MTHFR were the most frequently studied for mucositis. On the basis of this 27-gene list, we used IPA to generate gene networks for mucositis. The most biologically significant novel molecules identified through IPA analyses included TP53, CTNNB1, MYC, RB1, P38 MAPK, and EP300. Additionally, uracil degradation II (reductive and thymine degradation pathways (p = 1.06-08 were most significant. Finally, utilizing 66 SNPs within the 8 most connected IPA-derived candidate molecules, we conducted a genetic association study for oral mucositis in the head and neck cancer patients who were treated using chemotherapy and/or radiation therapy (186 head and neck cancer patients with oral mucositis vs. 699 head and neck cancer patients without oral mucositis. The top ranked gene identified through this association analysis was RB1 (rs2227311, p-value = 0.034, odds ratio = 0.67. In conclusion, gene network analysis identified novel molecules and

  10. Identifying novel genes and biological processes relevant to the development of cancer therapy-induced mucositis: An informative gene network analysis.

    Science.gov (United States)

    Reyes-Gibby, Cielito C; Melkonian, Stephanie C; Wang, Jian; Yu, Robert K; Shelburne, Samuel A; Lu, Charles; Gunn, Gary Brandon; Chambers, Mark S; Hanna, Ehab Y; Yeung, Sai-Ching J; Shete, Sanjay

    2017-01-01

    Mucositis is a complex, dose-limiting toxicity of chemotherapy or radiotherapy that leads to painful mouth ulcers, difficulty eating or swallowing, gastrointestinal distress, and reduced quality of life for patients with cancer. Mucositis is most common for those undergoing high-dose chemotherapy and hematopoietic stem cell transplantation and for those being treated for malignancies of the head and neck. Treatment and management of mucositis remain challenging. It is expected that multiple genes are involved in the formation, severity, and persistence of mucositis. We used Ingenuity Pathway Analysis (IPA), a novel network-based approach that integrates complex intracellular and intercellular interactions involved in diseases, to systematically explore the molecular complexity of mucositis. As a first step, we searched the literature to identify genes that harbor or are close to the genetic variants significantly associated with mucositis. Our literature review identified 27 candidate genes, of which ERCC1, XRCC1, and MTHFR were the most frequently studied for mucositis. On the basis of this 27-gene list, we used IPA to generate gene networks for mucositis. The most biologically significant novel molecules identified through IPA analyses included TP53, CTNNB1, MYC, RB1, P38 MAPK, and EP300. Additionally, uracil degradation II (reductive) and thymine degradation pathways (p = 1.06-08) were most significant. Finally, utilizing 66 SNPs within the 8 most connected IPA-derived candidate molecules, we conducted a genetic association study for oral mucositis in the head and neck cancer patients who were treated using chemotherapy and/or radiation therapy (186 head and neck cancer patients with oral mucositis vs. 699 head and neck cancer patients without oral mucositis). The top ranked gene identified through this association analysis was RB1 (rs2227311, p-value = 0.034, odds ratio = 0.67). In conclusion, gene network analysis identified novel molecules and biological

  11. Genetically modified soybean plants and their ecosystem

    Directory of Open Access Journals (Sweden)

    Milošević Mirjana B.

    2004-01-01

    Full Text Available Transgenic plants are developed by introgressing new genes using methods of molecular genetics and genetic engineering. The presence of these genes in plant genome is identified on the basis of specific oligonucleotides primers, and the use of PCR (Polymerase Chain Reaction and DNA fragments multiplication. Genetically modified plants such as soybean constitute a newly created bioenergetic potential whose gene expression can cause disturbance of the biological balance ecosystem, soil structure and soil microbiological activity. Genetically modified plants may acquire monogenic or polygenic traits causing genetic and physiological changes in these plants, which may elicit a certain reaction of the environment including changes of microbiological composition of soil rhizosphere. The aim of introgressing genes for certain traits into a cultivated plant is to enhance its yield and intensify food production. There are more and more genetically modified plant species such as soybean, corn, potato, rice and others and there is a pressure to use them as human food and animal feed. Genetically modified soybean plants with introgressed gene for resistance to total herbicides, such as Round-up, are more productive than non-modified herbicide-sensitive soybeans.

  12. Single-base resolution maps of cultivated and wild rice methylomes and regulatory roles of DNA methylation in plant gene expression

    Directory of Open Access Journals (Sweden)

    Li Xin

    2012-07-01

    Full Text Available Abstract Background DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild relatives, Oryza rufipogon and Oryza nivara. Results The overall methylation level of rice genomes is four times higher than that of Arabidopsis. Consistent with the results reported for Arabidopsis, methylation in promoters represses gene expression while gene-body methylation generally appears to be positively associated with gene expression. Interestingly, we discovered that methylation in gene transcriptional termination regions (TTRs can significantly repress gene expression, and the effect is even stronger than that of promoter methylation. Through integrated analysis of genomic, DNA methylomic and transcriptomic differences between cultivated and wild rice, we found that primary DNA sequence divergence is the major determinant of methylational differences at the whole genome level, but DNA methylational difference alone can only account for limited gene expression variation between the cultivated and wild rice. Furthermore, we identified a number of genes with significant difference in methylation level between the wild and cultivated rice. Conclusions The single-base resolution methylomes of rice obtained in this study have not only broadened our understanding of the mechanism and function of DNA methylation in plant genomes, but also provided valuable data for future studies of rice epigenetics and the epigenetic differentiation between wild and cultivated rice.

  13. Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.

    Science.gov (United States)

    Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav

    2007-08-01

    Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.

  14. Genome-wide association study identifies candidate genes for starch content regulation in maize kernels

    Directory of Open Access Journals (Sweden)

    Na Liu

    2016-07-01

    Full Text Available Kernel starch content is an important trait in maize (Zea mays L. as it accounts for 65% to 75% of the dry kernel weight and positively correlates with seed yield. A number of starch synthesis-related genes have been identified in maize in recent years. However, many loci underlying variation in starch content among maize inbred lines still remain to be identified. The current study is a genome-wide association study that used a set of 263 maize inbred lines. In this panel, the average kernel starch content was 66.99%, ranging from 60.60% to 71.58% over the three study years. These inbred lines were genotyped with the SNP50 BeadChip maize array, which is comprised of 56,110 evenly spaced, random SNPs. Population structure was controlled by a mixed linear model (MLM as implemented in the software package TASSEL. After the statistical analyses, four SNPs were identified as significantly associated with starch content (P ≤ 0.0001, among which one each are located on chromosomes 1 and 5 and two are on chromosome 2. Furthermore, 77 candidate genes associated with starch synthesis were found within the 100-kb intervals containing these four QTLs, and four highly associated genes were within 20-kb intervals of the associated SNPs. Among the four genes, Glucose-1-phosphate adenylyltransferase (APS1; Gene ID GRMZM2G163437 is known as an important regulator of kernel starch content. The identified SNPs, QTLs, and candidate genes may not only be readily used for germplasm improvement by marker-assisted selection in breeding, but can also elucidate the genetic basis of starch content. Further studies on these identified candidate genes may help determine the molecular mechanisms regulating kernel starch content in maize and other important cereal crops.

  15. The WRKY Transcription Factor Genes in Lotus japonicus

    OpenAIRE

    Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun

    2014-01-01

    WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (...

  16. Light represses transcription of asparagine synthetase genes in photosynthetic and nonphotosynthetic organs of plants

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))

    1991-10-01

    Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.

  17. Arabidopsis Vacuolar Pyrophosphatase gene (AVP1) induces drought and salt tolerance in Nicotiana tabacum plants (abstract)

    International Nuclear Information System (INIS)

    Arif, A.; Mohsin, A.M.; Shafiq, S.; Zafar, Y.; Hameed, S.M.; Arif, M.; Javed, M.; Gaxiola, R.A.

    2005-01-01

    Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na

  18. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  19. Plant gene bank and vegetable varieties biodiversity in Smederevska Palanka

    Directory of Open Access Journals (Sweden)

    Pavlović Nenad

    2011-01-01

    Full Text Available Biodiversity protection and preservation of genetic variability is based on the fact that plant varieties are irreplaceable in production process and that they are more and more jeopardized by urban and industrial development. The most common way of preserving and at the same time the safest way is a storage in a gene bank. Prior to storage comes collecting, studying and replanting for Institute Gene Bank, Central State Gene Bank and for Regional Gene Banks. Institute for Vegetable Crops in Smederevska Palanka preserves a wide variety of vegetable germplasm. This is, so called, work collection, used as a gene resource for breeding purposes. Seed samples are stored at 4±2°C and 50% relative humidity. At the moment, the collection has 2265 samples. Almost all samples have the passport data, but only 10% of samples have been further characterized and evaluated.

  20. Gene Discovery and Functional Analyses in the Model Plant Arabidopsis

    DEFF Research Database (Denmark)

    Feng, Cai-ping; Mundy, J.

    2006-01-01

    The present mini-review describes newer methods and strategies, including transposon and T-DNA insertions, TILLING, Deleteagene, and RNA interference, to functionally analyze genes of interest in the model plant Arabidopsis. The relative advantages and disadvantages of the systems are also discus...

  1. Data mining and influential analysis of gene expression data for plant resistance gene identification in tomato (Solanum lycopersicum

    Directory of Open Access Journals (Sweden)

    Francisco Torres-Avilés

    2014-03-01

    Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.

  2. Gene Delivery into Plant Cells for Recombinant Protein Production

    Directory of Open Access Journals (Sweden)

    Qiang Chen

    2015-01-01

    Full Text Available Recombinant proteins are primarily produced from cultures of mammalian, insect, and bacteria cells. In recent years, the development of deconstructed virus-based vectors has allowed plants to become a viable platform for recombinant protein production, with advantages in versatility, speed, cost, scalability, and safety over the current production paradigms. In this paper, we review the recent progress in the methodology of agroinfiltration, a solution to overcome the challenge of transgene delivery into plant cells for large-scale manufacturing of recombinant proteins. General gene delivery methodologies in plants are first summarized, followed by extensive discussion on the application and scalability of each agroinfiltration method. New development of a spray-based agroinfiltration and its application on field-grown plants is highlighted. The discussion of agroinfiltration vectors focuses on their applications for producing complex and heteromultimeric proteins and is updated with the development of bridge vectors. Progress on agroinfiltration in Nicotiana and non-Nicotiana plant hosts is subsequently showcased in context of their applications for producing high-value human biologics and low-cost and high-volume industrial enzymes. These new advancements in agroinfiltration greatly enhance the robustness and scalability of transgene delivery in plants, facilitating the adoption of plant transient expression systems for manufacturing recombinant proteins with a broad range of applications.

  3. CAsubtype: An R Package to Identify Gene Sets Predictive of Cancer Subtypes and Clinical Outcomes.

    Science.gov (United States)

    Kong, Hualei; Tong, Pan; Zhao, Xiaodong; Sun, Jielin; Li, Hua

    2018-03-01

    In the past decade, molecular classification of cancer has gained high popularity owing to its high predictive power on clinical outcomes as compared with traditional methods commonly used in clinical practice. In particular, using gene expression profiles, recent studies have successfully identified a number of gene sets for the delineation of cancer subtypes that are associated with distinct prognosis. However, identification of such gene sets remains a laborious task due to the lack of tools with flexibility, integration and ease of use. To reduce the burden, we have developed an R package, CAsubtype, to efficiently identify gene sets predictive of cancer subtypes and clinical outcomes. By integrating more than 13,000 annotated gene sets, CAsubtype provides a comprehensive repertoire of candidates for new cancer subtype identification. For easy data access, CAsubtype further includes the gene expression and clinical data of more than 2000 cancer patients from TCGA. CAsubtype first employs principal component analysis to identify gene sets (from user-provided or package-integrated ones) with robust principal components representing significantly large variation between cancer samples. Based on these principal components, CAsubtype visualizes the sample distribution in low-dimensional space for better understanding of the distinction between samples and classifies samples into subgroups with prevalent clustering algorithms. Finally, CAsubtype performs survival analysis to compare the clinical outcomes between the identified subgroups, assessing their clinical value as potentially novel cancer subtypes. In conclusion, CAsubtype is a flexible and well-integrated tool in the R environment to identify gene sets for cancer subtype identification and clinical outcome prediction. Its simple R commands and comprehensive data sets enable efficient examination of the clinical value of any given gene set, thus facilitating hypothesis generating and testing in biological and

  4. The SWEET gene family in Hevea brasiliensis - its evolution and expression compared with four other plant species.

    Science.gov (United States)

    Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong

    2017-12-01

    SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.

  5. GTI: a novel algorithm for identifying outlier gene expression profiles from integrated microarray datasets.

    Directory of Open Access Journals (Sweden)

    John Patrick Mpindi

    Full Text Available BACKGROUND: Meta-analysis of gene expression microarray datasets presents significant challenges for statistical analysis. We developed and validated a new bioinformatic method for the identification of genes upregulated in subsets of samples of a given tumour type ('outlier genes', a hallmark of potential oncogenes. METHODOLOGY: A new statistical method (the gene tissue index, GTI was developed by modifying and adapting algorithms originally developed for statistical problems in economics. We compared the potential of the GTI to detect outlier genes in meta-datasets with four previously defined statistical methods, COPA, the OS statistic, the t-test and ORT, using simulated data. We demonstrated that the GTI performed equally well to existing methods in a single study simulation. Next, we evaluated the performance of the GTI in the analysis of combined Affymetrix gene expression data from several published studies covering 392 normal samples of tissue from the central nervous system, 74 astrocytomas, and 353 glioblastomas. According to the results, the GTI was better able than most of the previous methods to identify known oncogenic outlier genes. In addition, the GTI identified 29 novel outlier genes in glioblastomas, including TYMS and CDKN2A. The over-expression of these genes was validated in vivo by immunohistochemical staining data from clinical glioblastoma samples. Immunohistochemical data were available for 65% (19 of 29 of these genes, and 17 of these 19 genes (90% showed a typical outlier staining pattern. Furthermore, raltitrexed, a specific inhibitor of TYMS used in the therapy of tumour types other than glioblastoma, also effectively blocked cell proliferation in glioblastoma cell lines, thus highlighting this outlier gene candidate as a potential therapeutic target. CONCLUSIONS/SIGNIFICANCE: Taken together, these results support the GTI as a novel approach to identify potential oncogene outliers and drug targets. The algorithm is

  6. Gene-Transformation-Induced Changes in Chemical Functional Group Features and Molecular Structure Conformation in Alfalfa Plants Co-Expressing Lc-bHLH and C1-MYB Transcriptive Flavanoid Regulatory Genes: Effects of Single-Gene and Two-Gene Insertion.

    Science.gov (United States)

    Heendeniya, Ravindra G; Yu, Peiqiang

    2017-03-20

    Alfalfa ( Medicago sativa L.) genotypes transformed with Lc-bHLH and Lc transcription genes were developed with the intention of stimulating proanthocyanidin synthesis in the aerial parts of the plant. To our knowledge, there are no studies on the effect of single-gene and two-gene transformation on chemical functional groups and molecular structure changes in these plants. The objective of this study was to use advanced molecular spectroscopy with multivariate chemometrics to determine chemical functional group intensity and molecular structure changes in alfalfa plants when co-expressing Lc-bHLH and C1-MYB transcriptive flavanoid regulatory genes in comparison with non-transgenic (NT) and AC Grazeland (ACGL) genotypes. The results showed that compared to NT genotype, the presence of double genes ( Lc and C1 ) increased ratios of both the area and peak height of protein structural Amide I/II and the height ratio of α-helix to β-sheet. In carbohydrate-related spectral analysis, the double gene-transformed alfalfa genotypes exhibited lower peak heights at 1370, 1240, 1153, and 1020 cm -1 compared to the NT genotype. Furthermore, the effect of double gene transformation on carbohydrate molecular structure was clearly revealed in the principal component analysis of the spectra. In conclusion, single or double transformation of Lc and C1 genes resulted in changing functional groups and molecular structure related to proteins and carbohydrates compared to the NT alfalfa genotype. The current study provided molecular structural information on the transgenic alfalfa plants and provided an insight into the impact of transgenes on protein and carbohydrate properties and their molecular structure's changes.

  7. Cross-species global and subset gene expression profiling identifies genes involved in prostate cancer response to selenium

    Directory of Open Access Journals (Sweden)

    Dhir Rajiv

    2004-08-01

    Full Text Available Abstract Background Gene expression technologies have the ability to generate vast amounts of data, yet there often resides only limited resources for subsequent validation studies. This necessitates the ability to perform sorting and prioritization of the output data. Previously described methodologies have used functional pathways or transcriptional regulatory grouping to sort genes for further study. In this paper we demonstrate a comparative genomics based method to leverage data from animal models to prioritize genes for validation. This approach allows one to develop a disease-based focus for the prioritization of gene data, a process that is essential for systems that lack significant functional pathway data yet have defined animal models. This method is made possible through the use of highly controlled spotted cDNA slide production and the use of comparative bioinformatics databases without the use of cross-species slide hybridizations. Results Using gene expression profiling we have demonstrated a similar whole transcriptome gene expression patterns in prostate cancer cells from human and rat prostate cancer cell lines both at baseline expression levels and after treatment with physiologic concentrations of the proposed chemopreventive agent Selenium. Using both the human PC3 and rat PAII prostate cancer cell lines have gone on to identify a subset of one hundred and fifty-four genes that demonstrate a similar level of differential expression to Selenium treatment in both species. Further analysis and data mining for two genes, the Insulin like Growth Factor Binding protein 3, and Retinoic X Receptor alpha, demonstrates an association with prostate cancer, functional pathway links, and protein-protein interactions that make these genes prime candidates for explaining the mechanism of Selenium's chemopreventive effect in prostate cancer. These genes are subsequently validated by western blots showing Selenium based induction and using

  8. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages

    DEFF Research Database (Denmark)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man

    2018-01-01

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed...... with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes...... have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays...

  9. Temporal expression of genes involved in the biosynthesis of ...

    African Journals Online (AJOL)

    Gibberellins (GAs) are a large family of endogenous plant growth regulators. Bioactive GAs influence nearly all processes during plant growth and development. In the present study, we cloned and identified 10 unique genes that are potentially involved in the biosynthesis of GAs, including one BpGGDP gene, two BpCPS ...

  10. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  11. Suppression subtractive hybridization library construction and identification of epidermal bladder cell related genes in the common ice plant, Mesembryanthemum crystallinum L.

    Directory of Open Access Journals (Sweden)

    Siranet Roeurn

    2016-10-01

    Full Text Available Mesembryanthemum crystallinum L., a halophytic species, displays modified trichomes, epidermal bladder cells (EBC, on the surfaces of its aerial organs. EBCs serve to sequester excessive salt from underlying metabolically active tissues. To elucidate the molecular determinants governing EBC development in the common ice plant, we constructed a cDNA-based suppression subtractive hybridization library and identified genes differentially expressed between the wild-type and the EBC-less mutant. After hybridization, 38 clones were obtained. Among them, 24 clones had homology with plant genes of known functions, whose roles might not be directly related to EBC-morphology, while 14 clones were homologous to genes of unknown functions. After confirmation by northern blot analysis, 12 out of 14 clones of unknown functions were chosen for semi-quantitative RT-PCR analysis, and the results revealed that three clones designated as MW3, MW21, and MW31 preferentially expressed in the EBC-less mutant, whereas the other two designated as WM10 and WM28 preferentially expressed in the wild type. Among these genes, the expression of a putative jasmonate-induced gene, designated as WM28 was completely suppressed in the EBC-mutant. In addition, the deletion of C-box cis-acting element was found in the promoter region of WM28 in the EBC-less mutant. Overexpression of WM28 in Arabidopsis resulted in increased trichome number due to the upregulation of key trichome-related genes GLABRA1 (GL1, and GLABRA3 (GL3. These results demonstrate that WM28 can be an important factor responsible for EBC formation, and also suggest the similarity of developmental mechanism between trichome in Arabidopsis and EBC in common ice plant.

  12. Gene Expression Signature Analysis Identifies Vorinostat as a Candidate Therapy for Gastric Cancer

    Science.gov (United States)

    Choi, Woonyoung; Park, Yun-Yong; Kim, KyoungHyun; Kim, Sang-Bae; Lee, Ju-Seog; Mills, Gordon B.; Cho, Jae Yong

    2011-01-01

    Background Gastric cancer continues to be one of the deadliest cancers in the world and therefore identification of new drugs targeting this type of cancer is thus of significant importance. The purpose of this study was to identify and validate a therapeutic agent which might improve the outcomes for gastric cancer patients in the future. Methodology/Principal Findings Using microarray technology, we generated a gene expression profile of human gastric cancer–specific genes from human gastric cancer tissue samples. We used this profile in the Broad Institute's Connectivity Map analysis to identify candidate therapeutic compounds for gastric cancer. We found the histone deacetylase inhibitor vorinostat as the lead compound and thus a potential therapeutic drug for gastric cancer. Vorinostat induced both apoptosis and autophagy in gastric cancer cell lines. Pharmacological and genetic inhibition of autophagy however, increased the therapeutic efficacy of vorinostat, indicating that a combination of vorinostat with autophagy inhibitors may therapeutically be more beneficial. Moreover, gene expression analysis of gastric cancer identified a collection of genes (ITGB5, TYMS, MYB, APOC1, CBX5, PLA2G2A, and KIF20A) whose expression was elevated in gastric tumor tissue and downregulated more than 2-fold by vorinostat treatment in gastric cancer cell lines. In contrast, SCGB2A1, TCN1, CFD, APLP1, and NQO1 manifested a reversed pattern. Conclusions/Significance We showed that analysis of gene expression signature may represent an emerging approach to discover therapeutic agents for gastric cancer, such as vorinostat. The observation of altered gene expression after vorinostat treatment may provide the clue to identify the molecular mechanism of vorinostat and those patients likely to benefit from vorinostat treatment. PMID:21931799

  13. Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses

    Directory of Open Access Journals (Sweden)

    Magdalena eMazur

    2012-09-01

    Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.

  14. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  15. A DNA barcode for land plants

    Science.gov (United States)

    Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.

    2009-01-01

    DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622

  16. Nitrate-induced genes in tomato roots. Array analysis reveals novel genes that may play a role in nitrogen nutrition.

    Science.gov (United States)

    Wang, Y H; Garvin, D F; Kochian, L V

    2001-09-01

    A subtractive tomato (Lycopersicon esculentum) root cDNA library enriched in genes up-regulated by changes in plant mineral status was screened with labeled mRNA from roots of both nitrate-induced and mineral nutrient-deficient (-nitrogen [N], -phosphorus, -potassium [K], -sulfur, -magnesium, -calcium, -iron, -zinc, and -copper) tomato plants. A subset of cDNAs was selected from this library based on mineral nutrient-related changes in expression. Additional cDNAs were selected from a second mineral-deficient tomato root library based on sequence homology to known genes. These selection processes yielded a set of 1,280 mineral nutrition-related cDNAs that were arrayed on nylon membranes for further analysis. These high-density arrays were hybridized with mRNA from tomato plants exposed to nitrate at different time points after N was withheld for 48 h, for plants that were grown on nitrate/ammonium for 5 weeks prior to the withholding of N. One hundred-fifteen genes were found to be up-regulated by nitrate resupply. Among these genes were several previously identified as nitrate responsive, including nitrate transporters, nitrate and nitrite reductase, and metabolic enzymes such as transaldolase, transketolase, malate dehydrogenase, asparagine synthetase, and histidine decarboxylase. We also identified 14 novel nitrate-inducible genes, including: (a) water channels, (b) root phosphate and K(+) transporters, (c) genes potentially involved in transcriptional regulation, (d) stress response genes, and (e) ribosomal protein genes. In addition, both families of nitrate transporters were also found to be inducible by phosphate, K, and iron deficiencies. The identification of these novel nitrate-inducible genes is providing avenues of research that will yield new insights into the molecular basis of plant N nutrition, as well as possible networking between the regulation of N, phosphorus, and K nutrition.

  17. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Directory of Open Access Journals (Sweden)

    Joachim W Bargsten

    Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  18. Identifying candidate driver genes by integrative ovarian cancer genomics data

    Science.gov (United States)

    Lu, Xinguo; Lu, Jibo

    2017-08-01

    Integrative analysis of molecular mechanics underlying cancer can distinguish interactions that cannot be revealed based on one kind of data for the appropriate diagnosis and treatment of cancer patients. Tumor samples exhibit heterogeneity in omics data, such as somatic mutations, Copy Number Variations CNVs), gene expression profiles and so on. In this paper we combined gene co-expression modules and mutation modulators separately in tumor patients to obtain the candidate driver genes for resistant and sensitive tumor from the heterogeneous data. The final list of modulators identified are well known in biological processes associated with ovarian cancer, such as CCL17, CACTIN, CCL16, CCL22, APOB, KDF1, CCL11, HNF1B, LRG1, MED1 and so on, which can help to facilitate the discovery of biomarkers, molecular diagnostics, and drug discovery.

  19. Environmental control of plant nuclear gene expression by chloroplast redox signals

    Directory of Open Access Journals (Sweden)

    Jeannette ePfalz

    2012-11-01

    Full Text Available Plant photosynthesis takes place in specialised cell organelles, the chloroplasts, which perform all essential steps of this process. The proteins involved in photosynthesis are encoded by genes located on the plastid and nuclear genomes. Proper function and regulation of light harvesting and energy fixation thus requires a tight coordination of the gene expression machineries in the two genetic compartments. This is achieved by a bi-directional exchange of information between nucleus and plastids. Signals emerging from plastids report the functional and developmental state of the organelle to the nucleus and initiate distinct nuclear gene expression profiles, which trigger responses that support or improve plastid functions. Recent research indicated that this signalling is absolutely essential for plant growth and development. Reduction/oxidation (redox signals from photosynthesis are key players in this information network since they do report functional disturbances in photosynthesis, the primary energy source of plants. Such disturbances are caused by environmental fluctuations for instance in illumination, temperature or water availability. These environmental changes affect the linear electron flow of photosynthesis and result in changes of the redox state of the components involved (e.g. the plastoquinone pool or coupled to it (e.g. the thioredoxin pool. Thus, the changes in redox state directly reflect the environmental impact and serve as immediate plastidial signals to the nucleus. The triggered responses range from counterbalancing reactions within the physiological range up to severe stress responses including cell death. This review focuses on physiological redox signals from photosynthetic electron transport, their relation to the environment, potential transduction pathways to the nucleus and their impact on nuclear gene expression.

  20. Microarray analysis of Arabidopsis under gold exposure to identify putative genes involved in the synthesis of gold nanoparticles (AuNPs).

    Science.gov (United States)

    Shukla, Devesh; Krishnamurthy, Sneha; Sahi, Shivendra V

    2015-03-01

    Very little is known about the genes responsible for Au uptake, reduction and detoxification in plants, which indeed essential to understand the complex trait of AuNP biosynthesis. We designed a targeted experiment to elucidate the response of plant at transcriptional level under Au exposure, and a microarray was performed on root tissue treated with AuCl4 (-) in the absence of nutrient media to record specific gene expression signature. Here, we describe the experimental procedures and data analysis in detail to reproduce the results (available at GEO database under GSE55436) published by Shukla et al. (2014) [1] in the Frontiers in Plant Sciences. The data produced from this study provide significant information of genes which may be used to enhance the AuNP biosynthesis.

  1. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  2. Gene-environment interaction involving recently identified colorectal cancer susceptibility loci

    Science.gov (United States)

    Kantor, Elizabeth D.; Hutter, Carolyn M.; Minnier, Jessica; Berndt, Sonja I.; Brenner, Hermann; Caan, Bette J.; Campbell, Peter T.; Carlson, Christopher S.; Casey, Graham; Chan, Andrew T.; Chang-Claude, Jenny; Chanock, Stephen J.; Cotterchio, Michelle; Du, Mengmeng; Duggan, David; Fuchs, Charles S.; Giovannucci, Edward L.; Gong, Jian; Harrison, Tabitha A.; Hayes, Richard B.; Henderson, Brian E.; Hoffmeister, Michael; Hopper, John L.; Jenkins, Mark A.; Jiao, Shuo; Kolonel, Laurence N.; Le Marchand, Loic; Lemire, Mathieu; Ma, Jing; Newcomb, Polly A.; Ochs-Balcom, Heather M.; Pflugeisen, Bethann M.; Potter, John D.; Rudolph, Anja; Schoen, Robert E.; Seminara, Daniela; Slattery, Martha L.; Stelling, Deanna L.; Thomas, Fridtjof; Thornquist, Mark; Ulrich, Cornelia M.; Warnick, Greg S.; Zanke, Brent W.; Peters, Ulrike; Hsu, Li; White, Emily

    2014-01-01

    BACKGROUND Genome-wide association studies have identified several single nucleotide polymorphisms (SNPs) that are associated with risk of colorectal cancer (CRC). Prior research has evaluated the presence of gene-environment interaction involving the first 10 identified susceptibility loci, but little work has been conducted on interaction involving SNPs at recently identified susceptibility loci, including: rs10911251, rs6691170, rs6687758, rs11903757, rs10936599, rs647161, rs1321311, rs719725, rs1665650, rs3824999, rs7136702, rs11169552, rs59336, rs3217810, rs4925386, and rs2423279. METHODS Data on 9160 cases and 9280 controls from the Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO) and Colon Cancer Family Registry (CCFR) were used to evaluate the presence of interaction involving the above-listed SNPs and sex, body mass index (BMI), alcohol consumption, smoking, aspirin use, post-menopausal hormone (PMH) use, as well as intake of dietary calcium, dietary fiber, dietary folate, red meat, processed meat, fruit, and vegetables. Interaction was evaluated using a fixed-effects meta-analysis of an efficient Empirical Bayes estimator, and permutation was used to account for multiple comparisons. RESULTS None of the permutation-adjusted p-values reached statistical significance. CONCLUSIONS The associations between recently identified genetic susceptibility loci and CRC are not strongly modified by sex, BMI, alcohol, smoking, aspirin, PMH use, and various dietary factors. IMPACT Results suggest no evidence of strong gene-environment interactions involving the recently identified 16 susceptibility loci for CRC taken one at a time. PMID:24994789

  3. The Composition and Spatial Patterns of Bacterial Virulence Factors and Antibiotic Resistance Genes in 19 Wastewater Treatment Plants.

    Directory of Open Access Journals (Sweden)

    Bing Zhang

    Full Text Available Bacterial pathogenicity and antibiotic resistance are of concern for environmental safety and public health. Accumulating evidence suggests that wastewater treatment plants (WWTPs are as an important sink and source of pathogens and antibiotic resistance genes (ARGs. Virulence genes (encoding virulence factors are good indicators for bacterial pathogenic potentials. To achieve a comprehensive understanding of bacterial pathogenic potentials and antibiotic resistance in WWTPs, bacterial virulence genes and ARGs in 19 WWTPs covering a majority of latitudinal zones of China were surveyed by using GeoChip 4.2. A total of 1610 genes covering 13 virulence factors and 1903 genes belonging to 11 ARG families were detected respectively. The bacterial virulence genes exhibited significant spatial distribution patterns of a latitudinal biodiversity gradient and a distance-decay relationship across China. Moreover, virulence genes tended to coexist with ARGs as shown by their strongly positive associations. In addition, key environmental factors shaping the overall virulence gene structure were identified. This study profiles the occurrence, composition and distribution of virulence genes and ARGs in current WWTPs in China, and uncovers spatial patterns and important environmental variables shaping their structure, which may provide the basis for further studies of bacterial virulence factors and antibiotic resistance in WWTPs.

  4. LGscore: A method to identify disease-related genes using biological literature and Google data.

    Science.gov (United States)

    Kim, Jeongwoo; Kim, Hyunjin; Yoon, Youngmi; Park, Sanghyun

    2015-04-01

    Since the genome project in 1990s, a number of studies associated with genes have been conducted and researchers have confirmed that genes are involved in disease. For this reason, the identification of the relationships between diseases and genes is important in biology. We propose a method called LGscore, which identifies disease-related genes using Google data and literature data. To implement this method, first, we construct a disease-related gene network using text-mining results. We then extract gene-gene interactions based on co-occurrences in abstract data obtained from PubMed, and calculate the weights of edges in the gene network by means of Z-scoring. The weights contain two values: the frequency and the Google search results. The frequency value is extracted from literature data, and the Google search result is obtained using Google. We assign a score to each gene through a network analysis. We assume that genes with a large number of links and numerous Google search results and frequency values are more likely to be involved in disease. For validation, we investigated the top 20 inferred genes for five different diseases using answer sets. The answer sets comprised six databases that contain information on disease-gene relationships. We identified a significant number of disease-related genes as well as candidate genes for Alzheimer's disease, diabetes, colon cancer, lung cancer, and prostate cancer. Our method was up to 40% more accurate than existing methods. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Metagenomic profiling of antibiotic resistance genes and mobile genetic elements in a tannery wastewater treatment plant.

    Directory of Open Access Journals (Sweden)

    Zhu Wang

    Full Text Available Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs and mobile genetic elements (MGEs in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP. Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns.

  6. Development of salt tolerant plants through genetic engineering (abstract)

    International Nuclear Information System (INIS)

    Mukhtar, Z.; Khan, S.A.; Zafar, Y.

    2005-01-01

    Salinity stress is one of the most serious factors limiting the productivity of agricultural crops. Genetic engineering provides a useful tool for tailoring plants with enhanced salt tolerance characteristics. Many organisms have evolved mechanisms to survive and grow under such extreme environments. These organisms provide us with a useful source of genes which can be used to improve salt tolerance in plants. The present study aims at identification and cloning of useful halo tolerance conferring genes from fungi and plants and to develop salt tolerant transgenic plants. Here we describe the cloning and use of HSR1 gene (a yeast transcription factor known to confer salt tolerance) and Na/sup +//H/sup +/ antiporter gene AtNHX1 (3016 bp) from Arabidopsis thaliana, and transformation of tobacco with HSR1 and AtNHX1 genes through Agrobacterium method. A number of transgenic tobacco plants were regenerated from leaf explants transformed with Agrobacterium tumefaciens (LBA4404) having HSR1 and AtNHX1 genes by leaf disc method. The putative transgenic plants were analyzed by PCR and dot blot analysis. Screening of these transgenic plants at different salinity levels is in progress which will help identify the suitable plant lines and thus the promising genes which can be further exploited to engineer salt tolerant crop plants. (author)

  7. Insights into the evolution and diversification of the AT-hook Motif Nuclear Localized gene family in land plants.

    Science.gov (United States)

    Zhao, Jianfei; Favero, David S; Qiu, Jiwen; Roalson, Eric H; Neff, Michael M

    2014-10-14

    Members of the ancient land-plant-specific transcription factor AT-Hook Motif Nuclear Localized (AHL) gene family regulate various biological processes. However, the relationships among the AHL genes, as well as their evolutionary history, still remain unexplored. We analyzed over 500 AHL genes from 19 land plant species, ranging from the early diverging Physcomitrella patens and Selaginella to a variety of monocot and dicot flowering plants. We classified the AHL proteins into three types (Type-I/-II/-III) based on the number and composition of their functional domains, the AT-hook motif(s) and PPC domain. We further inferred their phylogenies via Bayesian inference analysis and predicted gene gain/loss events throughout their diversification. Our analyses suggested that the AHL gene family emerged in embryophytes and further evolved into two distinct clades, with Type-I AHLs forming one clade (Clade-A), and the other two types together diversifying in another (Clade-B). The two AHL clades likely diverged before the separation of Physcomitrella patens from the vascular plant lineage. In angiosperms, Clade-A AHLs expanded into 5 subfamilies; while, the ones in Clade-B expanded into 4 subfamilies. Examination of their expression patterns suggests that the AHLs within each clade share similar expression patterns with each other; however, AHLs in one monophyletic clade exhibit distinct expression patterns from the ones in the other clade. Over-expression of a Glycine max AHL PPC domain in Arabidopsis thaliana recapitulates the phenotype observed when over-expressing its Arabidopsis thaliana counterpart. This result suggests that the AHL genes from different land plant species may share conserved functions in regulating plant growth and development. Our study further suggests that such functional conservation may be due to conserved physical interactions among the PPC domains of AHL proteins. Our analyses reveal a possible evolutionary scenario for the AHL gene family

  8. A unique virulence factor for proliferation and dwarfism in plants identified from a phytopathogenic bacterium

    Science.gov (United States)

    Hoshi, Ayaka; Oshima, Kenro; Kakizawa, Shigeyuki; Ishii, Yoshiko; Ozeki, Johji; Hashimoto, Masayoshi; Komatsu, Ken; Kagiwada, Satoshi; Yamaji, Yasuyuki; Namba, Shigetou

    2009-01-01

    One of the most important themes in agricultural science is the identification of virulence factors involved in plant disease. Here, we show that a single virulence factor, tengu-su inducer (TENGU), induces witches' broom and dwarfism and is a small secreted protein of the plant-pathogenic bacterium, phytoplasma. When tengu was expressed in Nicotiana benthamiana plants, these plants showed symptoms of witches' broom and dwarfism, which are typical of phytoplasma infection. Transgenic Arabidopsis thaliana lines expressing tengu exhibited similar symptoms, confirming the effects of tengu expression on plants. Although the localization of phytoplasma was restricted to the phloem, TENGU protein was detected in apical buds by immunohistochemical analysis, suggesting that TENGU was transported from the phloem to other cells. Microarray analyses showed that auxin-responsive genes were significantly down-regulated in the tengu-transgenic plants compared with GUS-transgenic control plants. These results suggest that TENGU inhibits auxin-related pathways, thereby affecting plant development. PMID:19329488

  9. Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa

    Science.gov (United States)

    Basyuni, M.; Sumardi

    2017-01-01

    This study descibes bioinformatics approach on the analyze of the salt tolerance genes in mangrove plant, Rhizophora stylosa on DDBJ/EMBL/GenBank as well as similarity, phylogenetic, potential peptide, and subcellular localization. The DNA sequence between salt tolerance gene from R. stylosa exhibited 42-11% between themselves The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the salt-tolerant genes in R. stylosa, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, first branch of Cu/Zn SOD and reverse transcriptase genes, the second branch consists of the majority genes and the last group was MAP3K alpha protein kinase only. The present study, therefore, suggested that salt tolerance genes form distinct clusters in the tree.

  10. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    Science.gov (United States)

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

  11. Expression of TLP-3 gene without signal peptide in tobacco plants ...

    African Journals Online (AJOL)

    Administrator

    2011-06-06

    Jun 6, 2011 ... African Journal of Biotechnology Vol. ... group of plant proteins which accumulate as a result of different types ... across the plasma membranes, the rapid production of ..... transformation and RT-PCR analysis confirm the gene.

  12. Harnessing Biomedical Natural Language Processing Tools to Identify Medicinal Plant Knowledge from Historical Texts.

    Science.gov (United States)

    Sharma, Vivekanand; Law, Wayne; Balick, Michael J; Sarkar, Indra Neil

    2017-01-01

    The growing amount of data describing historical medicinal uses of plants from digitization efforts provides the opportunity to develop systematic approaches for identifying potential plant-based therapies. However, the task of cataloguing plant use information from natural language text is a challenging task for ethnobotanists. To date, there have been only limited adoption of informatics approaches used for supporting the identification of ethnobotanical information associated with medicinal uses. This study explored the feasibility of using biomedical terminologies and natural language processing approaches for extracting relevant plant-associated therapeutic use information from historical biodiversity literature collection available from the Biodiversity Heritage Library. The results from this preliminary study suggest that there is potential utility of informatics methods to identify medicinal plant knowledge from digitized resources as well as highlight opportunities for improvement.

  13. Transcriptional profiling of whole blood identifies a unique 5-gene signature for myelofibrosis and imminent myelofibrosis transformation.

    Directory of Open Access Journals (Sweden)

    Hans Carl Hasselbalch

    Full Text Available Identifying a distinct gene signature for myelofibrosis may yield novel information of the genes, which are responsible for progression of essential thrombocythemia and polycythemia vera towards myelofibrosis. We aimed at identifying a simple gene signature - composed of a few genes - which were selectively and highly deregulated in myelofibrosis patients. Gene expression microarray studies have been performed on whole blood from 69 patients with myeloproliferative neoplasms. Amongst the top-20 of the most upregulated genes in PMF compared to controls, we identified 5 genes (DEFA4, ELA2, OLFM4, CTSG, and AZU1, which were highly significantly deregulated in PMF only. None of these genes were significantly regulated in ET and PV patients. However, hierarchical cluster analysis showed that these genes were also highly expressed in a subset of patients with ET (n = 1 and PV (n = 4 transforming towards myelofibrosis and/or being featured by an aggressive phenotype. We have identified a simple 5-gene signature, which is uniquely and highly significantly deregulated in patients in transitional stages of ET and PV towards myelofibrosis and in patients with PMF only. Some of these genes are considered to be responsible for the derangement of bone marrow stroma in myelofibrosis. Accordingly, this gene-signature may reflect key processes in the pathogenesis and pathophysiology of myelofibrosis development.

  14. New Mutation Identified in the SRY Gene High Mobility Group (HMG

    Directory of Open Access Journals (Sweden)

    Feride İffet Şahin

    2013-06-01

    Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.

  15. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta.

    Science.gov (United States)

    McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; de Pamphilis, Claude W

    2007-10-24

    Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  16. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta

    Directory of Open Access Journals (Sweden)

    Kuehl Jennifer V

    2007-10-01

    Full Text Available Abstract Background Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Results Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Conclusion Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  17. Consistent Differential Expression Pattern (CDEP) on microarray to identify genes related to metastatic behavior.

    Science.gov (United States)

    Tsoi, Lam C; Qin, Tingting; Slate, Elizabeth H; Zheng, W Jim

    2011-11-11

    To utilize the large volume of gene expression information generated from different microarray experiments, several meta-analysis techniques have been developed. Despite these efforts, there remain significant challenges to effectively increasing the statistical power and decreasing the Type I error rate while pooling the heterogeneous datasets from public resources. The objective of this study is to develop a novel meta-analysis approach, Consistent Differential Expression Pattern (CDEP), to identify genes with common differential expression patterns across different datasets. We combined False Discovery Rate (FDR) estimation and the non-parametric RankProd approach to estimate the Type I error rate in each microarray dataset of the meta-analysis. These Type I error rates from all datasets were then used to identify genes with common differential expression patterns. Our simulation study showed that CDEP achieved higher statistical power and maintained low Type I error rate when compared with two recently proposed meta-analysis approaches. We applied CDEP to analyze microarray data from different laboratories that compared transcription profiles between metastatic and primary cancer of different types. Many genes identified as differentially expressed consistently across different cancer types are in pathways related to metastatic behavior, such as ECM-receptor interaction, focal adhesion, and blood vessel development. We also identified novel genes such as AMIGO2, Gem, and CXCL11 that have not been shown to associate with, but may play roles in, metastasis. CDEP is a flexible approach that borrows information from each dataset in a meta-analysis in order to identify genes being differentially expressed consistently. We have shown that CDEP can gain higher statistical power than other existing approaches under a variety of settings considered in the simulation study, suggesting its robustness and insensitivity to data variation commonly associated with microarray

  18. Comparative transcriptional profiling of the axolotl limb identifies a tripartite regeneration-specific gene program.

    Directory of Open Access Journals (Sweden)

    Dunja Knapp

    Full Text Available Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression - early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation.

  19. Preferential Allele Expression Analysis Identifies Shared Germline and Somatic Driver Genes in Advanced Ovarian Cancer

    Science.gov (United States)

    Halabi, Najeeb M.; Martinez, Alejandra; Al-Farsi, Halema; Mery, Eliane; Puydenus, Laurence; Pujol, Pascal; Khalak, Hanif G.; McLurcan, Cameron; Ferron, Gwenael; Querleu, Denis; Al-Azwani, Iman; Al-Dous, Eman; Mohamoud, Yasmin A.; Malek, Joel A.; Rafii, Arash

    2016-01-01

    Identifying genes where a variant allele is preferentially expressed in tumors could lead to a better understanding of cancer biology and optimization of targeted therapy. However, tumor sample heterogeneity complicates standard approaches for detecting preferential allele expression. We therefore developed a novel approach combining genome and transcriptome sequencing data from the same sample that corrects for sample heterogeneity and identifies significant preferentially expressed alleles. We applied this analysis to epithelial ovarian cancer samples consisting of matched primary ovary and peritoneum and lymph node metastasis. We find that preferentially expressed variant alleles include germline and somatic variants, are shared at a relatively high frequency between patients, and are in gene networks known to be involved in cancer processes. Analysis at a patient level identifies patient-specific preferentially expressed alleles in genes that are targets for known drugs. Analysis at a site level identifies patterns of site specific preferential allele expression with similar pathways being impacted in the primary and metastasis sites. We conclude that genes with preferentially expressed variant alleles can act as cancer drivers and that targeting those genes could lead to new therapeutic strategies. PMID:26735499

  20. Complete genome analysis of Serratia marcescens RSC-14: A plant growth-promoting bacterium that alleviates cadmium stress in host plants

    Science.gov (United States)

    Khan, Abdur Rahim; Park, Gun-Seok; Asaf, Sajjad; Hong, Sung-Jun; Jung, Byung Kwon

    2017-01-01

    Serratia marcescens RSC-14 is a Gram-negative bacterium that was previously isolated from the surface-sterilized roots of the Cd-hyperaccumulator Solanum nigrum. The strain stimulates plant growth and alleviates Cd stress in host plants. To investigate the genetic basis for these traits, the complete genome of RSC-14 was obtained by single-molecule real-time sequencing. The genome of S. marcescens RSC-14 comprised a 5.12-Mbp-long circular chromosome containing 4,593 predicted protein-coding genes, 22 rRNA genes, 88 tRNA genes, and 41 pseudogenes. It contained genes with potential functions in plant growth promotion, including genes involved in indole-3-acetic acid (IAA) biosynthesis, acetoin synthesis, and phosphate solubilization. Moreover, annotation using NCBI and Rapid Annotation using Subsystem Technology identified several genes that encode antioxidant enzymes as well as genes involved in antioxidant production, supporting the observed resistance towards heavy metals, such as Cd. The presence of IAA pathway-related genes and oxidative stress-responsive enzyme genes may explain the plant growth-promoting potential and Cd tolerance, respectively. This is the first report of a complete genome sequence of Cd-tolerant S. marcescens and its plant growth promotion pathway. The whole-genome analysis of this strain clarified the genetic basis underlying its phenotypic and biochemical characteristics, underpinning the beneficial interactions between RSC-14 and plants. PMID:28187139

  1. Identification of Appropriate Reference Genes for Normalization of miRNA Expression in Grafted Watermelon Plants under Different Nutrient Stresses.

    Science.gov (United States)

    Wu, Weifang; Deng, Qin; Shi, Pibiao; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2016-01-01

    Watermelon (Citrullus lanatus) is a globally important crop belonging to the family Cucurbitaceae. The grafting technique is commonly used to improve its tolerance to stress, as well as to enhance its nutrient uptake and utilization. It is believed that miRNA is most likely involved in its nutrient-starvation response as a graft-transportable signal. The quantitative real-time reverse transcriptase polymerase chain reaction is the preferred method for miRNA functional analysis, in which reliable reference genes for normalization are crucial to ensure the accuracy. The purpose of this study was to select appropriate reference genes in scion (watermelon) and rootstocks (squash and bottle gourd) of grafted watermelon plants under normal growth conditions and nutrient stresses (nitrogen and phosphorus starvation). Under nutrient starvation, geNorm identified miR167c and miR167f as two most stable genes in both watermelon leaves and squash roots. miR166b was recommended by both geNorm and NormFinder as the best reference in bottle gourd roots under nutrient limitation. Expression of a new Cucurbitaceae miRNA, miR85, was used to validate the reliability of candidate reference genes under nutrient starvation. Moreover, by comparing several target genes expression in qRT-PCR analysis with those in RNA-seq data, miR166b and miR167c were proved to be the most suitable reference genes to normalize miRNA expression under normal growth condition in scion and rootstock tissues, respectively. This study represents the first comprehensive survey of the stability of miRNA reference genes in Cucurbitaceae and provides valuable information for investigating more accurate miRNA expression involving grafted watermelon plants.

  2. Amygdala-enriched genes identified by microarray technology are restricted to specific amygdaloid subnuclei

    OpenAIRE

    Zirlinger, M.; Kreiman, Gabriel; Anderson, D. J.

    2001-01-01

    Microarray technology represents a potentially powerful method for identifying cell type- and regionally restricted genes expressed in the brain. Here we have combined a microarray analysis of differential gene expression among five selected brain regions, including the amygdala, cerebellum, hippocampus, olfactory bulb, and periaqueductal gray, with in situ hybridization. On average, 0.3% of the 34,000 genes interrogated were highly enriched in each of the five regions...

  3. [The obtainment and characteristics of Kalanchoe pinnata L. plants expressing the artificial gene of the cecropin P1 antimicrobial peptide].

    Science.gov (United States)

    Zakharchenko, N S; Rukavtsova, E B; Shevchuk, T V; Furs, O V; Pigoleva, S V; Lebedeva, A A; Chulina, I A; Baidakova, L K; Bur'yanov, Ya I

    2016-01-01

    Kalanchoe pinnata L. plants bearing an artificial CP1 gene encoding the cecropin P1 antimicrobial peptide have been obtained. The presence of the CP1 gene in the plant genome has been confirmed by PCR. Cecropin P1 synthesis in transgenic plants has been shown by MALDI mass spectrometry and Western blotting. The obtained plants have been highly resistant to bacterial and fungal phytopathogens, and their extracts have demonstrated antimicrobial activity towards human and animal pathogens. It has been shown that transgenic plants bearing the CP1 gene can be colonized by the beneficial associative microorganisms Methylovorus mays.

  4. Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

    Science.gov (United States)

    Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

    2016-01-01

    Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

  5. The ALDH21 gene found in lower plants and some vascular plants codes for a NADP+ -dependent succinic semialdehyde dehydrogenase.

    Science.gov (United States)

    Kopečná, Martina; Vigouroux, Armelle; Vilím, Jan; Končitíková, Radka; Briozzo, Pierre; Hájková, Eva; Jašková, Lenka; von Schwartzenberg, Klaus; Šebela, Marek; Moréra, Solange; Kopečný, David

    2017-10-01

    Lower plant species including some green algae, non-vascular plants (bryophytes) as well as the oldest vascular plants (lycopods) and ferns (monilophytes) possess a unique aldehyde dehydrogenase (ALDH) gene named ALDH21, which is upregulated during dehydration. However, the gene is absent in flowering plants. Here, we show that ALDH21 from the moss Physcomitrella patens codes for a tetrameric NADP + -dependent succinic semialdehyde dehydrogenase (SSALDH), which converts succinic semialdehyde, an intermediate of the γ-aminobutyric acid (GABA) shunt pathway, into succinate in the cytosol. NAD + is a very poor coenzyme for ALDH21 unlike for mitochondrial SSALDHs (ALDH5), which are the closest related ALDH members. Structural comparison between the apoform and the coenzyme complex reveal that NADP + binding induces a conformational change of the loop carrying Arg-228, which seals the NADP + in the coenzyme cavity via its 2'-phosphate and α-phosphate groups. The crystal structure with the bound product succinate shows that its carboxylate group establishes salt bridges with both Arg-121 and Arg-457, and a hydrogen bond with Tyr-296. While both arginine residues are pre-formed for substrate/product binding, Tyr-296 moves by more than 1 Å. Both R121A and R457A variants are almost inactive, demonstrating a key role of each arginine in catalysis. Our study implies that bryophytes but presumably also some green algae, lycopods and ferns, which carry both ALDH21 and ALDH5 genes, can oxidize SSAL to succinate in both cytosol and mitochondria, indicating a more diverse GABA shunt pathway compared with higher plants carrying only the mitochondrial ALDH5. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  6. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  7. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  8. Occurrence and Variety of β-Lactamase Genes among Aeromonas spp. Isolated from Urban Wastewater Treatment Plant

    Directory of Open Access Journals (Sweden)

    Marta Piotrowska

    2017-05-01

    Full Text Available Members of the genus Aeromonas that commonly occur in various aquatic ecosystems are taken into account as vectors spreading antibiotic resistance genes (ARGs in the environment. In our study strains of Aeromonas spp. (n = 104 not susceptible to ampicillin were isolated from municipal sewage of different levels of purification – raw sewage, activated sludge and treated wastewater. The crucial step of the study was the identification of β-lactamase resistance genes. The identified genes encode β-lactamases from 14 families – blaTEM, blaOXA, blaSHV, blaCTX-M, blaMOX, blaACC, blaFOX, blaGES, blaPER, blaV EB, blaKPC, cphA, imiH, and cepH. There were no significant differences in number of identified ARGs between isolation points. BlaOXA, blaFOX variants and, characteristic for Aeromonas genus, metallo-β-lactamase cphA-related genes were the most commonly identified types of β-lactam resistance determinants. Moreover, we found four extended-spectrum β-lactamases (blaSHV -11, blaCTX-M-27, blaCTX-M-98, and blaPER-4 – and seven AmpC (blaACC, blaFOX-2-like, blaFOX-3, blaFOX-4-like, blaFOX-9, blaFOX-10-like, and blaFOX-13-like types and variants of genes that had never been found among Aeromonas spp. before. Five of the β-lactamases families (blaTEM, blaOXA, blaFOX, blaV EB, and cphA were identified in all three isolation sites, which supports the hypothesis that wastewater treatment plants (WWTPs are hot spots of ARGs dissemination. The obtained ARGs sequences share high identity with previously described β-lactamases, but new variants of those genes have to be considered as well. Characterization of antibiotic susceptibility was performed using disk the diffusion method with 12 different antibiotics according to CLSI guidelines. Over 60% of the strains are unsusceptible to cefepime and chloramphenicol and the majority of the strains have a multidrug resistance phenotype (68%. Finally, analysis of plasmid profiles among the resistant strains

  9. Plants with useful traits and related methods

    Science.gov (United States)

    Mackenzie, Sally Ann; De la Rosa Santamaria, Roberto

    2016-10-25

    The present invention provides methods for obtaining plants that exhibit useful traits by transient suppression of the MSH1 gene of the plants. Methods for identifying genetic loci that provide for useful traits in plants and plants produced with those loci are also provided. In addition, plants that exhibit the useful traits, parts of the plants including seeds, and products of the plants are provided as well as methods of using the plants.

  10. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    Science.gov (United States)

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

    2016-02-01

    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  11. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  12. NDH expression marks major transitions in plant evolution and reveals coordinate intracellular gene loss.

    Science.gov (United States)

    Ruhlman, Tracey A; Chang, Wan-Jung; Chen, Jeremy J W; Huang, Yao-Ting; Chan, Ming-Tsair; Zhang, Jin; Liao, De-Chih; Blazier, John C; Jin, Xiaohua; Shih, Ming-Che; Jansen, Robert K; Lin, Choun-Sea

    2015-04-11

    Key innovations have facilitated novel niche utilization, such as the movement of the algal predecessors of land plants into terrestrial habitats where drastic fluctuations in light intensity, ultraviolet radiation and water limitation required a number of adaptations. The NDH (NADH dehydrogenase-like) complex of Viridiplantae plastids participates in adapting the photosynthetic response to environmental stress, suggesting its involvement in the transition to terrestrial habitats. Although relatively rare, the loss or pseudogenization of plastid NDH genes is widely distributed across diverse lineages of photoautotrophic seed plants and mutants/transgenics lacking NDH function demonstrate little difference from wild type under non-stressed conditions. This study analyzes large transcriptomic and genomic datasets to evaluate the persistence and loss of NDH expression across plants. Nuclear expression profiles showed accretion of the NDH gene complement at key transitions in land plant evolution, such as the transition to land and at the base of the angiosperm lineage. While detection of transcripts for a selection of non-NDH, photosynthesis related proteins was independent of the state of NDH, coordinate, lineage-specific loss of plastid NDH genes and expression of nuclear-encoded NDH subunits was documented in Pinaceae, gnetophytes, Orchidaceae and Geraniales confirming the independent and complete loss of NDH in these diverse seed plant taxa. The broad phylogenetic distribution of NDH loss and the subtle phenotypes of mutants suggest that the NDH complex is of limited biological significance in contemporary plants. While NDH activity appears dispensable under favorable conditions, there were likely sufficiently frequent episodes of abiotic stress affecting terrestrial habitats to allow the retention of NDH activity. These findings reveal genetic factors influencing plant/environment interactions in a changing climate through 450 million years of land plant

  13. Overexpression of the AtSHI gene in poinsettia, Euphorbia pulcherrima, results in compact plants.

    Directory of Open Access Journals (Sweden)

    M Ashraful Islam

    Full Text Available Euphorbia pulcherrima, poinsettia, is a non-food and non-feed vegetatively propagated ornamental plant. Appropriate plant height is one of the most important traits in poinsettia production and is commonly achieved by application of chemical growth retardants. To produce compact poinsettia plants with desirable height and reduce the utilization of growth retardants, the Arabidopsis SHORT INTERNODE (AtSHI gene controlled by the cauliflower mosaic virus 35S promoter was introduced into poinsettia by Agrobacterium-mediated transformation. Three independent transgenic lines were produced and stable integration of transgene was verified by PCR and Southern blot analysis. Reduced plant height (21-52% and internode lengths (31-49% were obtained in the transgenic lines compared to control plants. This correlates positively with the AtSHI transcript levels, with the highest levels in the most dwarfed transgenic line (TL1. The indole-3-acetic acid (IAA content appeared lower (11-31% reduction in the transgenic lines compared to the wild type (WT controls, with the lowest level (31% reduction in TL1. Total internode numbers, bract numbers and bract area were significantly reduced in all transgenic lines in comparison with the WT controls. Only TL1 showed significantly lower plant diameter, total leaf area and total dry weight, whereas none of the AtSHI expressing lines showed altered timing of flower initiation, cyathia abscission or bract necrosis. This study demonstrated that introduction of the AtSHI gene into poinsettia by genetic engineering can be an effective approach in controlling plant height without negatively affecting flowering time. This can help to reduce or avoid the use of toxic growth retardants of environmental and human health concern. This is the first report that AtSHI gene was overexpressed in poinsettia and transgenic poinsettia plants with compact growth were produced.

  14. Identification of plant defence regulators through transcriptional ...

    Indian Academy of Sciences (India)

    2015-02-04

    Feb 4, 2015 ... defence-related genes also supports constitutive activation of defence in cdd1. We screened T-DNA ..... identified through this work as novel plant defence regu- ... to drought stress than untransformed plants (Lee et al. 2012).

  15. Plant and fungal gene expression in mycorrhizal protocorms of the orchid Serapias vomeracea colonized by Tulasnella calospora.

    Science.gov (United States)

    Balestrini, Raffaella; Nerva, Luca; Sillo, Fabiano; Girlanda, Mariangela; Perotto, Silvia

    2014-01-01

    Little is known on the molecular bases of plant-fungal interactions in orchid mycorrhiza. We developed a model system to investigate gene expression in mycorrhizal protocorms of Serapias vomeracea colonised by Tulasnella calospora. Our recent results with a small panel of genes as indicators of plant response to mycorrhizal colonization indicate that genes related with plant defense were not significantly up-regulated in mycorrhizal tissues. Here, we used laser microdissection to investigate whether expression of some orchid genes was restricted to specific cell types. Results showed that SvNod1, a S. vomeracea nodulin-like protein containing a plastocyanin-like domain, is expressed only in protocorm cells containing intracellular fungal hyphae. In addition, we investigated a family of fungal zinc metallopeptidases (M36). This gene family has expanded in the T. calospora genome and RNA-Seq experiments indicate that some members of the M36 metallopeptidases family are differentially regulated in orchid mycorrhizal protocorms.

  16. Human Management of a Wild Plant Modulates the Evolutionary Dynamics of a Gene Determining Recessive Resistance to Virus Infection.

    Science.gov (United States)

    Poulicard, Nils; Pacios, Luis Fernández; Gallois, Jean-Luc; Piñero, Daniel; García-Arenal, Fernando

    2016-08-01

    This work analyses the genetic variation and evolutionary patterns of recessive resistance loci involved in matching-allele (MA) host-pathogen interactions, focusing on the pvr2 resistance gene to potyviruses of the wild pepper Capsicum annuum glabriusculum (chiltepin). Chiltepin grows in a variety of wild habitats in Mexico, and its cultivation in home gardens started about 25 years ago. Potyvirus infection of Capsicum plants requires the physical interaction of the viral VPg with the pvr2 product, the translation initiation factor eIF4E1. Mutations impairing this interaction result in resistance, according to the MA model. The diversity of pvr2/eIF4E1 in wild and cultivated chiltepin populations from six biogeographical provinces in Mexico was analysed in 109 full-length coding sequences from 97 plants. Eleven alleles were found, and their interaction with potyvirus VPg in yeast-two-hybrid assays, plus infection assays of plants, identified six resistance alleles. Mapping resistance mutations on a pvr2/eIF4E1 model structure showed that most were around the cap-binding pocket and strongly altered its surface electrostatic potential, suggesting resistance-associated costs due to functional constraints. The pvr2/eIF4E1 phylogeny established that susceptibility was ancestral and resistance was derived. The spatial structure of pvr2/eIF4E1 diversity differed from that of neutral markers, but no evidence of selection for resistance was found in wild populations. In contrast, the resistance alleles were much more frequent, and positive selection stronger, in cultivated chiltepin populations, where diversification of pvr2/eIF4E1 was higher. This analysis of the genetic variation of a recessive resistance gene involved in MA host-pathogen interactions in populations of a wild plant show that evolutionary patterns differ according to the plant habitat, wild or cultivated. It also demonstrates that human management of the plant population has profound effects on the

  17. Human Management of a Wild Plant Modulates the Evolutionary Dynamics of a Gene Determining Recessive Resistance to Virus Infection.

    Directory of Open Access Journals (Sweden)

    Nils Poulicard

    2016-08-01

    Full Text Available This work analyses the genetic variation and evolutionary patterns of recessive resistance loci involved in matching-allele (MA host-pathogen interactions, focusing on the pvr2 resistance gene to potyviruses of the wild pepper Capsicum annuum glabriusculum (chiltepin. Chiltepin grows in a variety of wild habitats in Mexico, and its cultivation in home gardens started about 25 years ago. Potyvirus infection of Capsicum plants requires the physical interaction of the viral VPg with the pvr2 product, the translation initiation factor eIF4E1. Mutations impairing this interaction result in resistance, according to the MA model. The diversity of pvr2/eIF4E1 in wild and cultivated chiltepin populations from six biogeographical provinces in Mexico was analysed in 109 full-length coding sequences from 97 plants. Eleven alleles were found, and their interaction with potyvirus VPg in yeast-two-hybrid assays, plus infection assays of plants, identified six resistance alleles. Mapping resistance mutations on a pvr2/eIF4E1 model structure showed that most were around the cap-binding pocket and strongly altered its surface electrostatic potential, suggesting resistance-associated costs due to functional constraints. The pvr2/eIF4E1 phylogeny established that susceptibility was ancestral and resistance was derived. The spatial structure of pvr2/eIF4E1 diversity differed from that of neutral markers, but no evidence of selection for resistance was found in wild populations. In contrast, the resistance alleles were much more frequent, and positive selection stronger, in cultivated chiltepin populations, where diversification of pvr2/eIF4E1 was higher. This analysis of the genetic variation of a recessive resistance gene involved in MA host-pathogen interactions in populations of a wild plant show that evolutionary patterns differ according to the plant habitat, wild or cultivated. It also demonstrates that human management of the plant population has profound

  18. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Directory of Open Access Journals (Sweden)

    Preeti Arya

    Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  19. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Science.gov (United States)

    Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

    2014-01-01

    Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  20. Integrated mRNA and microRNA analysis identifies genes and small miRNA molecules associated with transcriptional and post-transcriptional-level responses to both drought stress and re-watering treatment in tobacco.

    Science.gov (United States)

    Chen, Qiansi; Li, Meng; Zhang, Zhongchun; Tie, Weiwei; Chen, Xia; Jin, Lifeng; Zhai, Niu; Zheng, Qingxia; Zhang, Jianfeng; Wang, Ran; Xu, Guoyun; Zhang, Hui; Liu, Pingping; Zhou, Huina

    2017-01-10

    Drought stress is one of the most severe problem limited agricultural productivity worldwide. It has been reported that plants response to drought-stress by sophisticated mechanisms at both transcriptional and post-transcriptional levels. However, the precise molecular mechanisms governing the responses of tobacco leaves to drought stress and water status are not well understood. To identify genes and miRNAs involved in drought-stress responses in tobacco, we performed both mRNA and small RNA sequencing on tobacco leaf samples from the following three treatments: untreated-control (CL), drought stress (DL), and re-watering (WL). In total, we identified 798 differentially expressed genes (DEGs) between the DL and CL (DL vs. CL) treatments and identified 571 DEGs between the WL and DL (WL vs. DL) treatments. Further analysis revealed 443 overlapping DEGs between the DL vs. CL and WL vs. DL comparisons, and, strikingly, all of these genes exhibited opposing expression trends between these two comparisons, strongly suggesting that these overlapping DEGs are somehow involved in the responses of tobacco leaves to drought stress. Functional annotation analysis showed significant up-regulation of genes annotated to be involved in responses to stimulus and stress, (e.g., late embryogenesis abundant proteins and heat-shock proteins) antioxidant defense (e.g., peroxidases and glutathione S-transferases), down regulation of genes related to the cell cycle pathway, and photosynthesis processes. We also found 69 and 56 transcription factors (TFs) among the DEGs in, respectively, the DL vs. CL and the WL vs. DL comparisons. In addition, small RNA sequencing revealed 63 known microRNAs (miRNA) from 32 families and 368 novel miRNA candidates in tobacco. We also found that five known miRNA families (miR398, miR390, miR162, miR166, and miR168) showed differential regulation under drought conditions. Analysis to identify negative correlations between the differentially expressed mi

  1. The complexity of nitrogen metabolism and nitrogen-regulated gene expression in plant pathogenic fungi

    NARCIS (Netherlands)

    Bolton, M.D.; Thomma, B.P.H.J.

    2008-01-01

    Plant pathogens secrete effector molecules that contribute to the establishment of disease in their plant hosts. The identification of cellular cues that regulate effector gene expression is an important aspect of understanding the infection process. Nutritional status in the cell has been

  2. Exome Sequencing and Linkage Analysis Identified Novel Candidate Genes in Recessive Intellectual Disability Associated with Ataxia.

    Science.gov (United States)

    Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia

    2015-10-01

    Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).

  3. High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kassir, Yona

    2017-01-01

    Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

  4. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  5. Comparative Mitogenomics of Plant Bugs (Hemiptera: Miridae): Identifying the AGG Codon Reassignments between Serine and Lysine

    Science.gov (United States)

    Wang, Pei; Song, Fan; Cai, Wanzhi

    2014-01-01

    Insect mitochondrial genomes are very important to understand the molecular evolution as well as for phylogenetic and phylogeographic studies of the insects. The Miridae are the largest family of Heteroptera encompassing more than 11,000 described species and of great economic importance. For better understanding the diversity and the evolution of plant bugs, we sequence five new mitochondrial genomes and present the first comparative analysis of nine mitochondrial genomes of mirids available to date. Our result showed that gene content, gene arrangement, base composition and sequences of mitochondrial transcription termination factor were conserved in plant bugs. Intra-genus species shared more conserved genomic characteristics, such as nucleotide and amino acid composition of protein-coding genes, secondary structure and anticodon mutations of tRNAs, and non-coding sequences. Control region possessed several distinct characteristics, including: variable size, abundant tandem repetitions, and intra-genus conservation; and was useful in evolutionary and population genetic studies. The AGG codon reassignments were investigated between serine and lysine in the genera Adelphocoris and other cimicomorphans. Our analysis revealed correlated evolution between reassignments of the AGG codon and specific point mutations at the antidocons of tRNALys and tRNASer(AGN). Phylogenetic analysis indicated that mitochondrial genome sequences were useful in resolving family level relationship of Cimicomorpha. Comparative evolutionary analysis of plant bug mitochondrial genomes allowed the identification of previously neglected coding genes or non-coding regions as potential molecular markers. The finding of the AGG codon reassignments between serine and lysine indicated the parallel evolution of the genetic code in Hemiptera mitochondrial genomes. PMID:24988409

  6. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  7. Next-generation sequencing identifies transportin 3 as the causative gene for LGMD1F.

    Directory of Open Access Journals (Sweden)

    Annalaura Torella

    Full Text Available Limb-girdle muscular dystrophies (LGMD are genetically and clinically heterogeneous conditions. We investigated a large family with autosomal dominant transmission pattern, previously classified as LGMD1F and mapped to chromosome 7q32. Affected members are characterized by muscle weakness affecting earlier the pelvic girdle and the ileopsoas muscles. We sequenced the whole exome of four family members and identified a shared heterozygous frame-shift variant in the Transportin 3 (TNPO3 gene, encoding a member of the importin-β super-family. The TNPO3 gene is mapped within the LGMD1F critical interval and its 923-amino acid human gene product is also expressed in skeletal muscle. In addition, we identified an isolated case of LGMD with a new missense mutation in the same gene. We localized the mutant TNPO3 around the nucleus, but not inside. The involvement of gene related to the nuclear transport suggests a novel disease mechanism leading to muscular dystrophy.

  8. Identifying noncoding risk variants using disease-relevant gene regulatory networks.

    Science.gov (United States)

    Gao, Long; Uzun, Yasin; Gao, Peng; He, Bing; Ma, Xiaoke; Wang, Jiahui; Han, Shizhong; Tan, Kai

    2018-02-16

    Identifying noncoding risk variants remains a challenging task. Because noncoding variants exert their effects in the context of a gene regulatory network (GRN), we hypothesize that explicit use of disease-relevant GRNs can significantly improve the inference accuracy of noncoding risk variants. We describe Annotation of Regulatory Variants using Integrated Networks (ARVIN), a general computational framework for predicting causal noncoding variants. It employs a set of novel regulatory network-based features, combined with sequence-based features to infer noncoding risk variants. Using known causal variants in gene promoters and enhancers in a number of diseases, we show ARVIN outperforms state-of-the-art methods that use sequence-based features alone. Additional experimental validation using reporter assay further demonstrates the accuracy of ARVIN. Application of ARVIN to seven autoimmune diseases provides a holistic view of the gene subnetwork perturbed by the combinatorial action of the entire set of risk noncoding mutations.

  9. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  10. Identification and Analysis of Jasmonate Pathway Genes in Coffea canephora (Robusta Coffee) by In Silico Approach.

    Science.gov (United States)

    Bharathi, Kosaraju; Sreenath, H L

    2017-07-01

    Coffea canephora is the commonly cultivated coffee species in the world along with Coffea arabica . Different pests and pathogens affect the production and quality of the coffee. Jasmonic acid (JA) is a plant hormone which plays an important role in plants growth, development, and defense mechanisms, particularly against insect pests. The key enzymes involved in the production of JA are lipoxygenase, allene oxide synthase, allene oxide cyclase, and 12-oxo-phytodienoic reductase. There is no report on the genes involved in JA pathway in coffee plants. We made an attempt to identify and analyze the genes coding for these enzymes in C. canephora . First, protein sequences of jasmonate pathway genes from model plant Arabidopsis thaliana were identified in the National Center for Biotechnology Information (NCBI) database. These protein sequences were used to search the web-based database Coffee Genome Hub to identify homologous protein sequences in C. canephora genome using Basic Local Alignment Search Tool (BLAST). Homologous protein sequences for key genes were identified in the C. canephora genome database. Protein sequences of the top matches were in turn used to search in NCBI database using BLAST tool to confirm the identity of the selected proteins and to identify closely related genes in species. The protein sequences from C. canephora database and the top matches in NCBI were aligned, and phylogenetic trees were constructed using MEGA6 software and identified the genetic distance of the respective genes. The study identified the four key genes of JA pathway in C. canephora , confirming the conserved nature of the pathway in coffee. The study expected to be useful to further explore the defense mechanisms of coffee plants. JA is a plant hormone that plays an important role in plant defense against insect pests. Genes coding for the 4 key enzymes involved in the production of JA viz., LOX, AOS, AOC, and OPR are identified in C. canephora (robusta coffee) by

  11. A method to identify differential expression profiles of time-course gene data with Fourier transformation.

    Science.gov (United States)

    Kim, Jaehee; Ogden, Robert Todd; Kim, Haseong

    2013-10-18

    Time course gene expression experiments are an increasingly popular method for exploring biological processes. Temporal gene expression profiles provide an important characterization of gene function, as biological systems are both developmental and dynamic. With such data it is possible to study gene expression changes over time and thereby to detect differential genes. Much of the early work on analyzing time series expression data relied on methods developed originally for static data and thus there is a need for improved methodology. Since time series expression is a temporal process, its unique features such as autocorrelation between successive points should be incorporated into the analysis. This work aims to identify genes that show different gene expression profiles across time. We propose a statistical procedure to discover gene groups with similar profiles using a nonparametric representation that accounts for the autocorrelation in the data. In particular, we first represent each profile in terms of a Fourier basis, and then we screen out genes that are not differentially expressed based on the Fourier coefficients. Finally, we cluster the remaining gene profiles using a model-based approach in the Fourier domain. We evaluate the screening results in terms of sensitivity, specificity, FDR and FNR, compare with the Gaussian process regression screening in a simulation study and illustrate the results by application to yeast cell-cycle microarray expression data with alpha-factor synchronization.The key elements of the proposed methodology: (i) representation of gene profiles in the Fourier domain; (ii) automatic screening of genes based on the Fourier coefficients and taking into account autocorrelation in the data, while controlling the false discovery rate (FDR); (iii) model-based clustering of the remaining gene profiles. Using this method, we identified a set of cell-cycle-regulated time-course yeast genes. The proposed method is general and can be

  12. Gene-set analysis based on the pharmacological profiles of drugs to identify repurposing opportunities in schizophrenia.

    Science.gov (United States)

    de Jong, Simone; Vidler, Lewis R; Mokrab, Younes; Collier, David A; Breen, Gerome

    2016-08-01

    Genome-wide association studies (GWAS) have identified thousands of novel genetic associations for complex genetic disorders, leading to the identification of potential pharmacological targets for novel drug development. In schizophrenia, 108 conservatively defined loci that meet genome-wide significance have been identified and hundreds of additional sub-threshold associations harbour information on the genetic aetiology of the disorder. In the present study, we used gene-set analysis based on the known binding targets of chemical compounds to identify the 'drug pathways' most strongly associated with schizophrenia-associated genes, with the aim of identifying potential drug repositioning opportunities and clues for novel treatment paradigms, especially in multi-target drug development. We compiled 9389 gene sets (2496 with unique gene content) and interrogated gene-based p-values from the PGC2-SCZ analysis. Although no single drug exceeded experiment wide significance (corrected pneratinib. This is a proof of principle analysis showing the potential utility of GWAS data of schizophrenia for the direct identification of candidate drugs and molecules that show polypharmacy. © The Author(s) 2016.

  13. Identifying Genes Controlling Ferulate Cross-Linking Formation in Grass Cell Walls

    Energy Technology Data Exchange (ETDEWEB)

    de O. Buanafina, Marcia Maria [Pennsylvania State Univ., University Park, PA (United States)

    2013-10-16

    This proposal focuses on cell wall feruloylation and our long term goal is to identify and isolate novel genes controlling feruloylation and to characterize the phenotype of mutants in this pathway, with a spotlight on cell wall properties.

  14. A Generally Applicable Translational Strategy Identifies S100A4 as a Candidate Gene in Allergy

    DEFF Research Database (Denmark)

    Bruhn, Sören; Fang, Yu; Barrenäs, Fredrik

    2014-01-01

    The identification of diagnostic markers and therapeutic candidate genes in common diseases is complicated by the involvement of thousands of genes. We hypothesized that genes co-regulated with a key gene in allergy, IL13, would form a module that could help to identify candidate genes. We identi...

  15. Utility and Limitations of Using Gene Expression Data to Identify Functional Associations.

    Directory of Open Access Journals (Sweden)

    Sahra Uygun

    2016-12-01

    Full Text Available Gene co-expression has been widely used to hypothesize gene function through guilt-by association. However, it is not clear to what degree co-expression is informative, whether it can be applied to genes involved in different biological processes, and how the type of dataset impacts inferences about gene functions. Here our goal is to assess the utility and limitations of using co-expression as a criterion to recover functional associations between genes. By determining the percentage of gene pairs in a metabolic pathway with significant expression correlation, we found that many genes in the same pathway do not have similar transcript profiles and the choice of dataset, annotation quality, gene function, expression similarity measure, and clustering approach significantly impacts the ability to recover functional associations between genes using Arabidopsis thaliana as an example. Some datasets are more informative in capturing coordinated expression profiles and larger data sets are not always better. In addition, to recover the maximum number of known pathways and identify candidate genes with similar functions, it is important to explore rather exhaustively multiple dataset combinations, similarity measures, clustering algorithms and parameters. Finally, we validated the biological relevance of co-expression cluster memberships with an independent phenomics dataset and found that genes that consistently cluster with leucine degradation genes tend to have similar leucine levels in mutants. This study provides a framework for obtaining gene functional associations by maximizing the information that can be obtained from gene expression datasets.

  16. Gene Network for Identifying the Entropy Changes of Different Modules in Pediatric Sepsis

    Directory of Open Access Journals (Sweden)

    Jing Yang

    2016-12-01

    Full Text Available Background/Aims: Pediatric sepsis is a disease that threatens life of children. The incidence of pediatric sepsis is higher in developing countries due to various reasons, such as insufficient immunization and nutrition, water and air pollution, etc. Exploring the potential genes via different methods is of significance for the prevention and treatment of pediatric sepsis. This study aimed to identify potential genes associated with pediatric sepsis utilizing analysis of gene network and entropy. Methods: The mRNA expression in the blood samples collected from 20 septic children and 30 healthy controls was quantified by using Affymetrix HG-U133A microarray. Two condition-specific protein-protein interaction networks (PINs, one for the healthy control and the other one for the children with sepsis, were deduced by combining the fundamental human PINs with gene expression profiles in the two phenotypes. Subsequently, distinct modules from the two conditional networks were extracted by adopting a maximal clique-merging approach. Delta entropy (ΔS was calculated between sepsis and control modules. Results: Then, key genes displaying changes in gene composition were identified by matching the control and sepsis modules. Two objective modules were obtained, in which ribosomal protein RPL4 and RPL9 as well as TOP2A were probably considered as the key genes differentiating sepsis from healthy controls. Conclusion: According to previous reports and this work, TOP2A is the potential gene therapy target for pediatric sepsis. The relationship between pediatric sepsis and RPL4 and RPL9 needs further investigation.

  17. Enhanced water stress tolerance of transgenic maize plants over-expressing LEA Rab28 gene.

    Science.gov (United States)

    Amara, Imen; Capellades, Montserrat; Ludevid, M Dolors; Pagès, Montserrat; Goday, Adela

    2013-06-15

    Late Embryogenesis Abundant (LEA) proteins participate in plant stress responses and contribute to the acquisition of desiccation tolerance. In this report Rab28 LEA gene has been over-expressed in maize plants under a constitutive maize promoter. The expression of Rab28 transcripts led to the accumulation and stability of Rab28 protein in the transgenic plants. Native Rab28 protein is localized to nucleoli in wild type maize embryo cells; here we find by whole-mount immunocytochemistry that in root cells of Rab28 transgenic and wild-type plants the protein is also associated to nucleolar structures. Transgenic plants were tested for stress tolerance and resulted in sustained growth under polyethyleneglycol (PEG)-mediated dehydration compared to wild-type controls. Under osmotic stress transgenic seedlings showed increased leaf and root areas, higher relative water content (RWC), reduced chlorophyll loss and lower Malondialdehyde (MDA) production in relation to wild-type plants. Moreover, transgenic seeds exhibited higher germination rates than wild-type seeds under water deficit. Overall, our results highlight the presence of transgenic Rab28 protein in nucleolar structures and point to the potential of group 5 LEA Rab28 gene as candidate to enhance stress tolerance in maize plants. Copyright © 2013 Elsevier GmbH. All rights reserved.

  18. Bioaerosols from a Food Waste Composting Plant Affect Human Airway Epithelial Cell Remodeling Genes

    Science.gov (United States)

    Chang, Ming-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu

    2013-01-01

    The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 102 conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5–10 μm) having higher endotoxin levels than did fine particles (0.5–2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers. PMID:24368426

  19. Bioaerosols from a food waste composting plant affect human airway epithelial cell remodeling genes.

    Science.gov (United States)

    Chang, Min-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu

    2013-12-24

    The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 10(2) conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5-10 μm) having higher endotoxin levels than did fine particles (0.5-2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21 WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers.

  20. Gene expression meta-analysis identifies chromosomal regions involved in ovarian cancer survival

    DEFF Research Database (Denmark)

    Thomassen, Mads; Jochumsen, Kirsten M; Mogensen, Ole

    2009-01-01

    the relation of gene expression and chromosomal position to identify chromosomal regions of importance for early recurrence of ovarian cancer. By use of *Gene Set Enrichment Analysis*, we have ranked chromosomal regions according to their association to survival. Over-representation analysis including 1...... using death (P = 0.015) and recurrence (P = 0.002) as outcome. The combined mutation score is strongly associated to upregulation of several growth factor pathways....

  1. The genome of the endophytic bacterium H. frisingense GSF30T identifies diverse strategies in the Herbaspirillum genus to interact with plants

    Directory of Open Access Journals (Sweden)

    Daniel eStraub

    2013-06-01

    Full Text Available The diazotrophic, bacterial endophyte Herbaspirillum frisingense GSF30T has been identified in biomass grasses grown in temperate climate, including the highly nitrogen-efficient grass Miscanthus. Its genome was annotated and compared with related Herbaspirillum species from diverse habitats, including H. seropedicae, and further well-characterized endophytes. The analysis revealed that Herbaspirillum frisingense lacks a type III secretion system that is present in some related Herbaspirillum grass endophytes. Together with the lack of components of the type II secretion system, the genomic inventory indicates distinct interaction scenarios of endophytic Herbaspirillum strains with plants. Differences in respiration, carbon, nitrogen and cell wall metabolism among Herbaspirillum isolates partially correlate with their different habitats. Herbaspirillum frisingense is closely related to strains isolated from the rhizosphere of phragmites and from well water, but these lack nitrogen fixation and metabolism genes. Within grass endophytes, the high diversity in their genomic inventory suggests that even individual plant species provide distinct, highly diverse metabolic niches for successful endophyte-plant associations.

  2. The genome of the endophytic bacterium H. frisingense GSF30(T) identifies diverse strategies in the Herbaspirillum genus to interact with plants.

    Science.gov (United States)

    Straub, Daniel; Rothballer, Michael; Hartmann, Anton; Ludewig, Uwe

    2013-01-01

    The diazotrophic, bacterial endophyte Herbaspirillum frisingense GSF30(T) has been identified in biomass grasses grown in temperate climate, including the highly nitrogen-efficient grass Miscanthus. Its genome was annotated and compared with related Herbaspirillum species from diverse habitats, including H. seropedicae, and further well-characterized endophytes. The analysis revealed that Herbaspirillum frisingense lacks a type III secretion system that is present in some related Herbaspirillum grass endophytes. Together with the lack of components of the type II secretion system, the genomic inventory indicates distinct interaction scenarios of endophytic Herbaspirillum strains with plants. Differences in respiration, carbon, nitrogen and cell wall metabolism among Herbaspirillum isolates partially correlate with their different habitats. Herbaspirillum frisingense is closely related to strains isolated from the rhizosphere of phragmites and from well water, but these lack nitrogen fixation and metabolism genes. Within grass endophytes, the high diversity in their genomic inventory suggests that even individual plant species provide distinct, highly diverse metabolic niches for successful endophyte-plant associations.

  3. The genome of the endophytic bacterium H. frisingense GSF30T identifies diverse strategies in the Herbaspirillum genus to interact with plants

    Science.gov (United States)

    Straub, Daniel; Rothballer, Michael; Hartmann, Anton; Ludewig, Uwe

    2013-01-01

    The diazotrophic, bacterial endophyte Herbaspirillum frisingense GSF30T has been identified in biomass grasses grown in temperate climate, including the highly nitrogen-efficient grass Miscanthus. Its genome was annotated and compared with related Herbaspirillum species from diverse habitats, including H. seropedicae, and further well-characterized endophytes. The analysis revealed that Herbaspirillum frisingense lacks a type III secretion system that is present in some related Herbaspirillum grass endophytes. Together with the lack of components of the type II secretion system, the genomic inventory indicates distinct interaction scenarios of endophytic Herbaspirillum strains with plants. Differences in respiration, carbon, nitrogen and cell wall metabolism among Herbaspirillum isolates partially correlate with their different habitats. Herbaspirillum frisingense is closely related to strains isolated from the rhizosphere of phragmites and from well water, but these lack nitrogen fixation and metabolism genes. Within grass endophytes, the high diversity in their genomic inventory suggests that even individual plant species provide distinct, highly diverse metabolic niches for successful endophyte-plant associations. PMID:23825472

  4. A novel plant ferredoxin-like protein and the regulator Hor are quorum-sensing targets in the plant pathogen Erwinia carotovora.

    Science.gov (United States)

    Sjöblom, Solveig; Harjunpää, Heidi; Brader, Günter; Palva, E Tapio

    2008-07-01

    Quorum sensing (QS), a population-density-sensing mechanism, controls the production of the main virulence determinants, the plant cell-wall-degrading enzymes (PCWDEs) of the soft-rot phytopathogen Erwinia carotovora subsp. carotovora. In this study, we used random transposon mutagenesis with a gusA reporter construct to identify two new QS-controlled genes encoding the regulator Hor and a plant ferredoxin-like protein, FerE. The QS control of the identified genes was executed by the QS regulators ExpR1 and ExpR2 and mediated by the global repressor RsmA. Hor was shown to contribute to bacterial virulence at least partly through its control of PCWDE production. Our results showed that FerE contributes to oxidative stress tolerance and in planta fitness of the bacteria and suggest that QS could be central to control of oxidative stress tolerance. The presence of the FerE protein appears to be rather unique in heterotrophic bacteria and suggests an acquisition of the corresponding gene from plant host by horizontal gene transfer.

  5. Evolution of the bHLH genes involved in stomatal development: implications for the expansion of developmental complexity of stomata in land plants.

    Directory of Open Access Journals (Sweden)

    Jin-Hua Ran

    Full Text Available Stomata play significant roles in plant evolution. A trio of closely related basic Helix-Loop-Helix (bHLH subgroup Ia genes, SPCH, MUTE and FAMA, mediate sequential steps of stomatal development, and their functions may be conserved in land plants. However, the evolutionary history of the putative SPCH/MUTE/FAMA genes is still greatly controversial, especially the phylogenetic positions of the bHLH Ia members from basal land plants. To better understand the evolutionary pattern and functional diversity of the bHLH genes involved in stomatal development, we made a comprehensive evolutionary analysis of the homologous genes from 54 species representing the major lineages of green plants. The phylogenetic analysis indicated: (1 All bHLH Ia genes from the two basal land plants Physcomitrella and Selaginella were closely related to the FAMA genes of seed plants; and (2 the gymnosperm 'SPCH' genes were sister to a clade comprising the angiosperm SPCH and MUTE genes, while the FAMA genes of gymnosperms and angiosperms had a sister relationship. The revealed phylogenetic relationships are also supported by the distribution of gene structures and previous functional studies. Therefore, we deduce that the function of FAMA might be ancestral in the bHLH Ia subgroup. In addition, the gymnosperm "SPCH" genes may represent an ancestral state and have a dual function of SPCH and MUTE, two genes that could have originated from a duplication event in the common ancestor of angiosperms. Moreover, in angiosperms, SPCHs have experienced more duplications and harbor more copies than MUTEs and FAMAs, which, together with variation of the stomatal development in the entry division, implies that SPCH might have contributed greatly to the diversity of stomatal development. Based on the above, we proposed a model for the correlation between the evolution of stomatal development and the genes involved in this developmental process in land plants.

  6. Genome-Wide Association Study Identifies NBS-LRR-Encoding Genes Related with Anthracnose and Common Bacterial Blight in the Common Bean.

    Science.gov (United States)

    Wu, Jing; Zhu, Jifeng; Wang, Lanfen; Wang, Shumin

    2017-01-01

    Nucleotide-binding site and leucine-rich repeat (NBS-LRR) genes represent the largest and most important disease resistance genes in plants. The genome sequence of the common bean ( Phaseolus vulgaris L.) provides valuable data for determining the genomic organization of NBS-LRR genes. However, data on the NBS-LRR genes in the common bean are limited. In total, 178 NBS-LRR-type genes and 145 partial genes (with or without a NBS) located on 11 common bean chromosomes were identified from genome sequences database. Furthermore, 30 NBS-LRR genes were classified into Toll/interleukin-1 receptor (TIR)-NBS-LRR (TNL) types, and 148 NBS-LRR genes were classified into coiled-coil (CC)-NBS-LRR (CNL) types. Moreover, the phylogenetic tree supported the division of these PvNBS genes into two obvious groups, TNL types and CNL types. We also built expression profiles of NBS genes in response to anthracnose and common bacterial blight using qRT-PCR. Finally, we detected nine disease resistance loci for anthracnose (ANT) and seven for common bacterial blight (CBB) using the developed NBS-SSR markers. Among these loci, NSSR24, NSSR73, and NSSR265 may be located at new regions for ANT resistance, while NSSR65 and NSSR260 may be located at new regions for CBB resistance. Furthermore, we validated NSSR24, NSSR65, NSSR73, NSSR260, and NSSR265 using a new natural population. Our results provide useful information regarding the function of the NBS-LRR proteins and will accelerate the functional genomics and evolutionary studies of NBS-LRR genes in food legumes. NBS-SSR markers represent a wide-reaching resource for molecular breeding in the common bean and other food legumes. Collectively, our results should be of broad interest to bean scientists and breeders.

  7. Systematic enrichment analysis of gene expression profiling studies identifies consensus pathways implicated in colorectal cancer development

    Directory of Open Access Journals (Sweden)

    Jesús Lascorz

    2011-01-01

    Full Text Available Background: A large number of gene expression profiling (GEP studies on colorectal carcinogenesis have been performed but no reliable gene signature has been identified so far due to the lack of reproducibility in the reported genes. There is growing evidence that functionally related genes, rather than individual genes, contribute to the etiology of complex traits. We used, as a novel approach, pathway enrichment tools to define functionally related genes that are consistently up- or down-regulated in colorectal carcinogenesis. Materials and Methods: We started the analysis with 242 unique annotated genes that had been reported by any of three recent meta-analyses covering GEP studies on genes differentially expressed in carcinoma vs normal mucosa. Most of these genes (218, 91.9% had been reported in at least three GEP studies. These 242 genes were submitted to bioinformatic analysis using a total of nine tools to detect enrichment of Gene Ontology (GO categories or Kyoto Encyclopedia of Genes and Genomes (KEGG pathways. As a final consistency criterion the pathway categories had to be enriched by several tools to be taken into consideration. Results: Our pathway-based enrichment analysis identified the categories of ribosomal protein constituents, extracellular matrix receptor interaction, carbonic anhydrase isozymes, and a general category related to inflammation and cellular response as significantly and consistently overrepresented entities. Conclusions: We triaged the genes covered by the published GEP literature on colorectal carcinogenesis and subjected them to multiple enrichment tools in order to identify the consistently enriched gene categories. These turned out to have known functional relationships to cancer development and thus deserve further investigation.

  8. Reference Gene Selection in the Desert Plant Eremosparton songoricum

    Directory of Open Access Journals (Sweden)

    Dao-Yuan Zhang

    2012-06-01

    Full Text Available Eremosparton songoricum (Litv. Vass. (E. songoricum is a rare and extremely drought-tolerant desert plant that holds promise as a model organism for the identification of genes associated with water deficit stress. Here, we cloned and evaluated the expression of eight candidate reference genes using quantitative real-time reverse transcriptase polymerase chain reactions. The expression of these candidate reference genes was analyzed in a diverse set of 20 samples including various E. songoricum plant tissues exposed to multiple environmental stresses. GeNorm analysis indicated that expression stability varied between the reference genes in the different experimental conditions, but the two most stable reference genes were sufficient for normalization in most conditions. EsEF and Esα-TUB were sufficient for various stress conditions, EsEF and EsACT were suitable for samples of differing germination stages, and EsGAPDHand EsUBQ were most stable across multiple adult tissue samples. The Es18S gene was unsuitable as a reference gene in our analysis. In addition, the expression level of the drought-stress related transcription factor EsDREB2 verified the utility of E. songoricum reference genes and indicated that no single gene was adequate for normalization on its own. This is the first systematic report on the selection of reference genes in E. songoricum, and these data will facilitate future work on gene expression in this species.

  9. vProtein: identifying optimal amino acid complements from plant-based foods.

    Directory of Open Access Journals (Sweden)

    Peter J Woolf

    Full Text Available BACKGROUND: Indispensible amino acids (IAAs are used by the body in different proportions. Most animal-based foods provide these IAAs in roughly the needed proportions, but many plant-based foods provide different proportions of IAAs. To explore how these plant-based foods can be better used in human nutrition, we have created the computational tool vProtein to identify optimal food complements to satisfy human protein needs. METHODS: vProtein uses 1251 plant-based foods listed in the United States Department of Agriculture standard release 22 database to determine the quantity of each food or pair of foods required to satisfy human IAA needs as determined by the 2005 daily recommended intake. The quantity of food in a pair is found using a linear programming approach that minimizes total calories, total excess IAAs, or the total weight of the combination. RESULTS: For single foods, vProtein identifies foods with particularly balanced IAA patterns such as wheat germ, quinoa, and cauliflower. vProtein also identifies foods with particularly unbalanced IAA patterns such as macadamia nuts, degermed corn products, and wakame seaweed. Although less useful alone, some unbalanced foods provide unusually good complements, such as Brazil nuts to legumes. Interestingly, vProtein finds no statistically significant bias toward grain/legume pairings for protein complementation. These analyses suggest that pairings of plant-based foods should be based on the individual foods themselves instead of based on broader food group-food group pairings. Overall, the most efficient pairings include sweet corn/tomatoes, apple/coconut, and sweet corn/cherry. The top pairings also highlight the utility of less common protein sources such as the seaweeds laver and spirulina, pumpkin leaves, and lambsquarters. From a public health perspective, many of the food pairings represent novel, low cost food sources to combat malnutrition. Full analysis results are available online

  10. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  11. Identifying time-delayed gene regulatory networks via an evolvable hierarchical recurrent neural network.

    Science.gov (United States)

    Kordmahalleh, Mina Moradi; Sefidmazgi, Mohammad Gorji; Harrison, Scott H; Homaifar, Abdollah

    2017-01-01

    The modeling of genetic interactions within a cell is crucial for a basic understanding of physiology and for applied areas such as drug design. Interactions in gene regulatory networks (GRNs) include effects of transcription factors, repressors, small metabolites, and microRNA species. In addition, the effects of regulatory interactions are not always simultaneous, but can occur after a finite time delay, or as a combined outcome of simultaneous and time delayed interactions. Powerful biotechnologies have been rapidly and successfully measuring levels of genetic expression to illuminate different states of biological systems. This has led to an ensuing challenge to improve the identification of specific regulatory mechanisms through regulatory network reconstructions. Solutions to this challenge will ultimately help to spur forward efforts based on the usage of regulatory network reconstructions in systems biology applications. We have developed a hierarchical recurrent neural network (HRNN) that identifies time-delayed gene interactions using time-course data. A customized genetic algorithm (GA) was used to optimize hierarchical connectivity of regulatory genes and a target gene. The proposed design provides a non-fully connected network with the flexibility of using recurrent connections inside the network. These features and the non-linearity of the HRNN facilitate the process of identifying temporal patterns of a GRN. Our HRNN method was implemented with the Python language. It was first evaluated on simulated data representing linear and nonlinear time-delayed gene-gene interaction models across a range of network sizes and variances of noise. We then further demonstrated the capability of our method in reconstructing GRNs of the Saccharomyces cerevisiae synthetic network for in vivo benchmarking of reverse-engineering and modeling approaches (IRMA). We compared the performance of our method to TD-ARACNE, HCC-CLINDE, TSNI and ebdbNet across different network

  12. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    NARCIS (Netherlands)

    Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Rocha, Da Martine; Bajew, Simon; Neilson, Roy; Sokolova, Elena; Silva, Da Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Hans; Jones, John T.; Eves-van den Akker, Sebastian

    2017-01-01

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been

  13. Shoot to root communication is necessary to control the expression of iron-acquisition genes in Strategy I plants.

    Science.gov (United States)

    García, María J; Romera, Francisco J; Stacey, Minviluz G; Stacey, Gary; Villar, Eduardo; Alcántara, Esteban; Pérez-Vicente, Rafael

    2013-01-01

    Previous research showed that auxin, ethylene, and nitric oxide (NO) can activate the expression of iron (Fe)-acquisition genes in the roots of Strategy I plants grown with low levels of Fe, but not in plants grown with high levels of Fe. However, it is still an open question as to how Fe acts as an inhibitor and which pool of Fe (e.g., root, phloem, etc.) in the plant acts as the key regulator for gene expression control. To further clarify this, we studied the effect of the foliar application of Fe on the expression of Fe-acquisition genes in several Strategy I plants, including wild-type cultivars of Arabidopsis [Arabidopsis thaliana (L.) Heynh], pea [Pisum sativum L.], tomato [Solanum lycopersicon Mill.], and cucumber [Cucumis sativus L.], as well as mutants showing constitutive expression of Fe-acquisition genes when grown under Fe-sufficient conditions [Arabidopsis opt3-2 and frd3-3, pea dgl and brz, and tomato chln (chloronerva)]. The results showed that the foliar application of Fe blocked the expression of Fe-acquisition genes in the wild-type cultivars and in the frd3-3, brz, and chln mutants, but not in the opt3-2 and dgl mutants, probably affected in the transport of a Fe-related repressive signal in the phloem. Moreover, the addition of either ACC (ethylene precursor) or GSNO (NO donor) to Fe-deficient plants up-regulated the expression of Fe-acquisition genes, but this effect did not occur in Fe-deficient plants sprayed with foliar Fe, again suggesting the existence of a Fe-related repressive signal moving from leaves to roots.

  14. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin

    2016-08-22

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  15. Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS

    KAUST Repository

    Wong, Yee-Chin; Abd El Ghany, Moataz; Naeem, Raeece; Lee, Kok-Wei; Tan, Yung-Chie; Pain, Arnab; Nathan, Sheila

    2016-01-01

    Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing) as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  16. Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS

    Directory of Open Access Journals (Sweden)

    Yee-Chin Wong

    2016-08-01

    Full Text Available Burkholderia cenocepacia infection often leads to fatal cepacia syndrome in cystic fibrosis patients. However, antibiotic therapy rarely results in complete eradication of the pathogen due to its intrinsic resistance to many clinically available antibiotics. Recent attention has turned to the identification of essential genes as the proteins encoded by these genes may serve as potential targets for development of novel antimicrobials. In this study, we utilized TraDIS (Transposon Directed Insertion-site Sequencing as a genome-wide screening tool to facilitate the identification of B. cenocepacia genes essential for its growth and viability. A transposon mutant pool consisting of approximately 500,000 mutants was successfully constructed, with more than 400,000 unique transposon insertion sites identified by computational analysis of TraDIS datasets. The saturated library allowed for the identification of 383 genes that were predicted to be essential in B. cenocepacia. We extended the application of TraDIS to identify conditionally essential genes required for in vitro growth and revealed an additional repertoire of 439 genes to be crucial for B. cenocepacia growth under nutrient-depleted conditions. The library of B. cenocepacia mutants can subsequently be subjected to various biologically related conditions to facilitate the discovery of genes involved in niche adaptation as well as pathogenicity and virulence.

  17. Biotechnological uses of RNAi in plants: risk assessment considerations.

    Science.gov (United States)

    Casacuberta, Josep M; Devos, Yann; du Jardin, Patrick; Ramon, Matthew; Vaucheret, Hervé; Nogué, Fabien

    2015-03-01

    RNAi offers opportunities to generate new traits in genetically modified (GM) plants. Instead of expressing novel proteins, RNAi-based GM plants reduce target gene expression. Silencing of off-target genes may trigger unintended effects, and identifying these genes would facilitate risk assessment. However, using bioinformatics alone is not reliable, due to the lack of genomic data and insufficient knowledge of mechanisms governing mRNA-small (s)RNA interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Gene response in rice plants treated with continuous fog influenced by pH, was similar to that treated with biotic stress.

    Science.gov (United States)

    Satoh, Kouji; Saji, Shoko; Ito, Shoko; Shimizu, Hideyuki; Saji, Hikaru; Kikuchi, Shoshi

    2014-01-01

    Throughout Asia, including Japan, rice plants are cultivated in a wide range of areas from lowlands to highlands and are frequently exposed to fog, including acid fog. Some physiological studies have shown that acid fog can be a stress factor for plants. We analyzed the gene expression profiles of rice plants treated with artificially prepared simulated acid fog (SiAF) or simulated neutral fog (SiNF) for 1 or 7 days. Microarray analysis results suggested that both the SiAF and the SiNF treatments induced the expression of genes involved in the defense and stress responses in rice plants. Induction of such genes was detected in plants treated with SiAF for 1 day, and the number of induced genes increased in plants treated with SiAF for 7 days. The genes for defense and stress responses were also induced by SiNF for 7 days, although they were not induced by SiNF for 1 day. The gene expression profiles of the SiAF-treated and the SiNF-treated plants were compared to those of plants treated with other stress factors. The comparison revealed that both SiAF and SiNF treatments have similar effects to biotic stresses and ozone stress. The genes encoding NADPH oxidase and germin, which function in apoplasts, were also induced by SiAF, SiNF and biotic stresses. These findings suggest that both the SiAF and the SiNF treatments may result in oxidative stress through the apoplastic production of reactive oxygen species.

  19. Characterization of the serine acetyltransferase gene family of Vitis vinifera uncovers differences in regulation of OAS synthesis in woody plants

    OpenAIRE

    Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara

    2015-01-01

    In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family...

  20. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.