WorldWideScience

Sample records for identify molecular events

  1. Identifying jet quantum numbers event by event

    International Nuclear Information System (INIS)

    Teper, M.J.

    1979-12-01

    A method is proposed to identify the parton that gives rise to any particular jet. The method improves with the number of particles in the jet, and should indicate which of the jets in a three jet event at PETRA is the gluon jet. (author)

  2. Identifying Adverse Drug Events by Relational Learning.

    Science.gov (United States)

    Page, David; Costa, Vítor Santos; Natarajan, Sriraam; Barnard, Aubrey; Peissig, Peggy; Caldwell, Michael

    2012-07-01

    The pharmaceutical industry, consumer protection groups, users of medications and government oversight agencies are all strongly interested in identifying adverse reactions to drugs. While a clinical trial of a drug may use only a thousand patients, once a drug is released on the market it may be taken by millions of patients. As a result, in many cases adverse drug events (ADEs) are observed in the broader population that were not identified during clinical trials. Therefore, there is a need for continued, post-marketing surveillance of drugs to identify previously-unanticipated ADEs. This paper casts this problem as a reverse machine learning task , related to relational subgroup discovery and provides an initial evaluation of this approach based on experiments with an actual EMR/EHR and known adverse drug events.

  3. Identifying Wind and Solar Ramping Events: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Florita, A.; Hodge, B. M.; Orwig, K.

    2013-01-01

    Wind and solar power are playing an increasing role in the electrical grid, but their inherent power variability can augment uncertainties in power system operations. One solution to help mitigate the impacts and provide more flexibility is enhanced wind and solar power forecasting; however, its relative utility is also uncertain. Within the variability of solar and wind power, repercussions from large ramping events are of primary concern. At the same time, there is no clear definition of what constitutes a ramping event, with various criteria used in different operational areas. Here the Swinging Door Algorithm, originally used for data compression in trend logging, is applied to identify variable generation ramping events from historic operational data. The identification of ramps in a simple and automated fashion is a critical task that feeds into a larger work of 1) defining novel metrics for wind and solar power forecasting that attempt to capture the true impact of forecast errors on system operations and economics, and 2) informing various power system models in a data-driven manner for superior exploratory simulation research. Both allow inference on sensitivities and meaningful correlations, as well as the ability to quantify the value of probabilistic approaches for future use in practice.

  4. Identifying Prominent Life Events on Twitter

    OpenAIRE

    Dickinson, Thomas; Fernández, Miriam; Thomas, Lisa A.; Mulholland, Paul; Briggs, Pam; Alani, Harith

    2015-01-01

    Social media is a common place for people to post and share digital reflections of their life events, including major events such as getting married, having children, graduating, etc. Although the creation of such posts is straightforward, the identification of events on online media remains a challenge. Much research in recent years focused on extracting major events from Twitter, such as earthquakes, storms, and floods. This paper however, targets the automatic detection of personal life ev...

  5. Text mining electronic health records to identify hospital adverse events

    DEFF Research Database (Denmark)

    Gerdes, Lars Ulrik; Hardahl, Christian

    2013-01-01

    Manual reviews of health records to identify possible adverse events are time consuming. We are developing a method based on natural language processing to quickly search electronic health records for common triggers and adverse events. Our results agree fairly well with those obtained using manu...

  6. Assessing quantitative EEG spectrograms to identify non-epileptic events.

    Science.gov (United States)

    Goenka, Ajay; Boro, Alexis; Yozawitz, Elissa

    2017-09-01

    To evaluate the sensitivity and specificity of quantitative EEG (QEEG) spectrograms in order to distinguish epileptic from non-epileptic events. Seventeen patients with paroxysmal non-epileptic events, captured during EEG monitoring, were retrospectively assessed using QEEG spectrograms. These patients were compared to a control group of 13 consecutive patients (ages 25-60 years) with epileptic seizures of similar semiology. Assessment of raw EEG was employed as the gold standard against which epileptic and non-epileptic events were validated. QEEG spectrograms, available using Persyst 12 EEG system integration software, were each assessed with respect to their usefulness to distinguish epileptic from non-epileptic seizures. The given spectrogram was interpreted as indicating a seizure if, at the time of the clinically identified event, it showed a visually significant change from baseline. Eighty-two clinically identified paroxysmal events were analysed (46 non-epileptic and 36 epileptic). The "seizure detector trend analysis" spectrogram correctly classified 33/46 (71%) non-epileptic events (no seizure indicated during a clinically identified event) vs. 29/36 (81%) epileptic seizures (seizure indicated during a clinically identified event) (p=0.013). Similarly, "rhythmicity spectrogram", FFT spectrogram, "asymmetry relative spectrogram", and integrated-amplitude EEG spectrogram detected 28/46 (61%), 30/46 (65%), 22/46 (48%) and 27/46 (59%) non-epileptic events vs. 27/36 (75%), 25/36 (69%), 25/36 (69%) and 27/36 (75%) epileptic events, respectively. High sensitivities and specificities for QEEG seizure detection analyses suggest that QEEG may have a role at the bedside to facilitate early differentiation between epileptic seizures and non-epileptic events in order to avoid unnecessary administration of antiepileptic drugs and possible iatrogenic consequences.

  7. Molecular events leading to HPV-induced high grade neoplasia

    Directory of Open Access Journals (Sweden)

    Saskia M. Wilting

    2016-12-01

    Full Text Available Cervical cancer is initiated by high-risk types of the human papillomavirus (hrHPV and develops via precursor stages, called cervical intraepithelial neoplasia (CIN. High-grade CIN lesions are considered true precancerous lesions when the viral oncogenes E6 and E7 are aberrantly expressed in the dividing cells. This results in abolishment of normal cell cycle control via p53 and pRb degradation. However, it has become clear that these viral oncogenes possess additional oncogenic properties, including interference with the DNA methylation machinery and mitotic checkpoints. Identification of the resulting molecular events leading to high-grade neoplasia will 1 increase our understanding of cervical carcinogenesis, 2 yield biomarkers for early diagnosis, and 3 identify therapeutic targets for HPV-induced (pre cancerous lesions.This review will briefly summarise current advances in our understanding of the molecular alterations in the host cell genome that occur during HPV-induced carcinogenesis.

  8. Identifying risk event in Indonesian fresh meat supply chain

    Science.gov (United States)

    Wahyuni, H. C.; Vanany, I.; Ciptomulyono, U.

    2018-04-01

    The aim of this paper is to identify risk issues in Indonesian fresh meat supply chain from the farm until to the “plate”. The critical points for food safety in physical fresh meat product flow are also identified. The paper employed one case study in the Indonesian fresh meat company by conducting observations and in-depth three stages of interviews. At the first interview, the players, process, and activities in the fresh meat industry were identified. In the second interview, critical points for food safety were recognized. The risk events in each player and process were identified in the last interview. The research will be conducted in three stages, but this article focuses on risk identification process (first stage) only. The second stage is measuring risk and the third stage focuses on determining the value of risk priority. The results showed that there were four players in the fresh meat supply chain: livestock (source), slaughter (make), distributor and retail (deliver). Each player has different activities and identified 16 risk events in the fresh meat supply chain. Some of the strategies that can be used to reduce the occurrence of such risks include improving the ability of laborers on food safety systems, improving cutting equipment and distribution processes

  9. Performance Analysis: Work Control Events Identified January - August 2010

    Energy Technology Data Exchange (ETDEWEB)

    De Grange, C E; Freeman, J W; Kerr, C E; Holman, G; Marsh, K; Beach, R

    2011-01-14

    This performance analysis evaluated 24 events that occurred at LLNL from January through August 2010. The analysis identified areas of potential work control process and/or implementation weaknesses and several common underlying causes. Human performance improvement and safety culture factors were part of the causal analysis of each event and were analyzed. The collective significance of all events in 2010, as measured by the occurrence reporting significance category and by the proportion of events that have been reported to the DOE ORPS under the ''management concerns'' reporting criteria, does not appear to have increased in 2010. The frequency of reporting in each of the significance categories has not changed in 2010 compared to the previous four years. There is no change indicating a trend in the significance category and there has been no increase in the proportion of occurrences reported in the higher significance category. Also, the frequency of events, 42 events reported through August 2010, is not greater than in previous years and is below the average of 63 occurrences per year at LLNL since 2006. Over the previous four years, an average of 43% of the LLNL's reported occurrences have been reported as either ''management concerns'' or ''near misses.'' In 2010, 29% of the occurrences have been reported as ''management concerns'' or ''near misses.'' This rate indicates that LLNL is now reporting fewer ''management concern'' and ''near miss'' occurrences compared to the previous four years. From 2008 to the present, LLNL senior management has undertaken a series of initiatives to strengthen the work planning and control system with the primary objective to improve worker safety. In 2008, the LLNL Deputy Director established the Work Control Integrated Project Team to develop the core requirements and graded

  10. Molecular events basic to cellular radiation response

    International Nuclear Information System (INIS)

    Kolodny, G.M.

    The initiation and control of the division process in normal cells is studied to gain insight into changes in these regards caused by x-irradiation and neoplasia. The Primer Hypothesis for eukaryotic gene regulation proposes that small molecular weight RNA acts as primer for new RNA synthesis by hybridizing with DNA and there initiating the transcription of a new RNA chain. The experiments reported here indicate that small molecular weight RNA will induce the production of new proteins. These results are consistent with the Primer Hypothesis, and demonstrate that RNA can be taken up from the media by cells in culture and can induce in vitro the production of differentiated cell products

  11. Identifying events that impact self-efficacy in physics learning

    Directory of Open Access Journals (Sweden)

    Vashti Sawtelle

    2012-09-01

    Full Text Available We present a method of analyzing the development of self-efficacy in real time using a framework of self-efficacy opportunities (SEOs. Considerable research has shown a connection between self-efficacy, or the confidence in one’s own ability to perform a task, and success in science fields. Traditional methods of investigating the development of self-efficacy have required participants to recollect past events. This reliance on participant memory makes it difficult to understand what impact particular events may have on developing self-efficacy in the moment. We use video recordings of three undergraduate Modeling Instruction students solving a physics problem to characterize SEOs in a moment-by-moment analysis. We then validate these characterizations of the development of self-efficacy by reviewing the problem-solving session with the participants and find evidence that the SEOs identified are taken up and impact self-efficacy. This characterization and validation of SEOs in the moment represents a first step towards establishing a methodology for analyzing the development of self-efficacy in real time.

  12. Early molecular events in the development of the diabetic cardiomyopathy.

    NARCIS (Netherlands)

    Monkemann, H.; Vriese, A.S. de; Blom, H.J.; Kluijtmans, L.A.J.; Heil, S.G.; Schild, H.H.; Golubnitschaja, O.

    2002-01-01

    Oxidative damage to DNA has been well documented in cardiac cells isolated from diabetic patients and rats with streptozotocin-induced diabetes mellitus (DM). This study evaluates possible molecular mechanisms for early events in the development of DM-induced cardiomyopathy. Methods: To analyze the

  13. Identifying Preserved Storm Events on Beaches from Trenches and Cores

    Science.gov (United States)

    Wadman, H. M.; Gallagher, E. L.; McNinch, J.; Reniers, A.; Koktas, M.

    2014-12-01

    Recent research suggests that even small scale variations in grain size in the shallow stratigraphy of sandy beaches can significantly influence large-scale morphology change. However, few quantitative studies of variations in shallow stratigraphic layers, as differentiated by variations in mean grain size, have been conducted, in no small part due to the difficulty of collecting undisturbed sediment cores in the energetic lower beach and swash zone. Due to this lack of quantitative stratigraphic grain size data, most coastal morphology models assume that uniform grain sizes dominate sandy beaches, allowing for little to no temporal or spatial variations in grain size heterogeneity. In a first-order attempt to quantify small-scale, temporal and spatial variations in beach stratigraphy, thirty-five vibracores were collected at the USACE Field Research Facility (FRF), Duck, NC, in March-April of 2014 using the FRF's Coastal Research and Amphibious Buggy (CRAB). Vibracores were collected at set locations along a cross-shore profile from the toe of the dune to a water depth of ~1m in the surf zone. Vibracores were repeatedly collected from the same locations throughout a tidal cycle, as well as pre- and post a nor'easter event. In addition, two ~1.5m deep trenches were dug in the cross-shore and along-shore directions (each ~14m in length) after coring was completed to allow better interpretation of the stratigraphic sequences observed in the vibracores. The elevations of coherent stratigraphic layers, as revealed in vibracore-based fence diagrams and trench data, are used to relate specific observed stratigraphic sequences to individual storm events observed at the FRF. These data provide a first-order, quantitative examination of the small-scale temporal and spatial variability of shallow grain size along an open, sandy coastline. The data will be used to refine morphological model predictions to include variations in grain size and associated shallow stratigraphy.

  14. Pathogenesis of pulmonary emphysema – cellular and molecular events

    Directory of Open Access Journals (Sweden)

    Antonio Di Petta

    2010-06-01

    Full Text Available Pulmonary emphysema is a chronic obstructive disease, resulting fromimportant alterations in the whole distal structure of terminal bronchioles, either by enlargement of air spaces or by destruction of the alveolar wall, leading to loss of respiratory surface, decreased elastic recoil and lung hyperinflation. For many years, the hypothesis of protease-antiprotease unbalance prevailed as the central theme in the pathogenesis of pulmonary emphysema. According to this hypothesis, the release of active proteolytic enzymes, produced mainly by neutrophils and macrophages, degrades the extracellular matrix, affecting the integrity of its components, especially collagen and elastic fibers. However, new concepts involving cellular and molecular events were proposed, including oxidative stress, cell apoptosis, cellular senescence and failed lung tissue repair. The aim of this review paper was to evaluate the cellular and molecular mechanisms seen in the pathogenesis of pulmonary emphysema.

  15. Molecular Events in Primary and Metastatic Colorectal Carcinoma: A Review

    Directory of Open Access Journals (Sweden)

    Rani Kanthan

    2012-01-01

    Full Text Available Colorectal cancer (CRC is a heterogeneous disease, developing through a multipathway sequence of events guided by clonal selections. Pathways included in the development of CRC may be broadly categorized into (a genomic instability, including chromosomal instability (CIN, microsatellite instability (MSI, and CpG island methylator phenotype (CIMP, (b genomic mutations including suppression of tumour suppressor genes and activation of tumour oncogenes, (c microRNA, and (d epigenetic changes. As cancer becomes more advanced, invasion and metastases are facilitated through the epithelial-mesenchymal transition (EMT, with additional genetic alterations. Despite ongoing identification of genetic and epigenetic markers and the understanding of alternative pathways involved in the development and progression of this disease, CRC remains the second highest cause of malignancy-related mortality in Canada. The molecular events that underlie the tumorigenesis of primary and metastatic colorectal carcinoma are detailed in this manuscript.

  16. Identifying and Synchronizing Health Information Technology (HIT) Events from FDA Medical Device Reports.

    Science.gov (United States)

    Kang, Hong; Wang, Frank; Zhou, Sicheng; Miao, Qi; Gong, Yang

    2017-01-01

    Health information technology (HIT) events, a subtype of patient safety events, pose a major threat and barrier toward a safer healthcare system. It is crucial to gain a better understanding of the nature of the errors and adverse events caused by current HIT systems. The scarcity of HIT event-exclusive databases and event reporting systems indicates the challenge of identifying the HIT events from existing resources. FDA Manufacturer and User Facility Device Experience (MAUDE) database is a potential resource for HIT events. However, the low proportion and the rapid evolvement of HIT-related events present challenges for distinguishing them from other equipment failures and hazards. We proposed a strategy to identify and synchronize HIT events from MAUDE by using a filter based on structured features and classifiers based on unstructured features. The strategy will help us develop and grow an HIT event-exclusive database, keeping pace with updates to MAUDE toward shared learning.

  17. Molecular Characterization of Transgenic Events Using Next Generation Sequencing Approach.

    Science.gov (United States)

    Guttikonda, Satish K; Marri, Pradeep; Mammadov, Jafar; Ye, Liang; Soe, Khaing; Richey, Kimberly; Cruse, James; Zhuang, Meibao; Gao, Zhifang; Evans, Clive; Rounsley, Steve; Kumpatla, Siva P

    2016-01-01

    Demand for the commercial use of genetically modified (GM) crops has been increasing in light of the projected growth of world population to nine billion by 2050. A prerequisite of paramount importance for regulatory submissions is the rigorous safety assessment of GM crops. One of the components of safety assessment is molecular characterization at DNA level which helps to determine the copy number, integrity and stability of a transgene; characterize the integration site within a host genome; and confirm the absence of vector DNA. Historically, molecular characterization has been carried out using Southern blot analysis coupled with Sanger sequencing. While this is a robust approach to characterize the transgenic crops, it is both time- and resource-consuming. The emergence of next-generation sequencing (NGS) technologies has provided highly sensitive and cost- and labor-effective alternative for molecular characterization compared to traditional Southern blot analysis. Herein, we have demonstrated the successful application of both whole genome sequencing and target capture sequencing approaches for the characterization of single and stacked transgenic events and compared the results and inferences with traditional method with respect to key criteria required for regulatory submissions.

  18. Molecular Characterization of Transgenic Events Using Next Generation Sequencing Approach.

    Directory of Open Access Journals (Sweden)

    Satish K Guttikonda

    Full Text Available Demand for the commercial use of genetically modified (GM crops has been increasing in light of the projected growth of world population to nine billion by 2050. A prerequisite of paramount importance for regulatory submissions is the rigorous safety assessment of GM crops. One of the components of safety assessment is molecular characterization at DNA level which helps to determine the copy number, integrity and stability of a transgene; characterize the integration site within a host genome; and confirm the absence of vector DNA. Historically, molecular characterization has been carried out using Southern blot analysis coupled with Sanger sequencing. While this is a robust approach to characterize the transgenic crops, it is both time- and resource-consuming. The emergence of next-generation sequencing (NGS technologies has provided highly sensitive and cost- and labor-effective alternative for molecular characterization compared to traditional Southern blot analysis. Herein, we have demonstrated the successful application of both whole genome sequencing and target capture sequencing approaches for the characterization of single and stacked transgenic events and compared the results and inferences with traditional method with respect to key criteria required for regulatory submissions.

  19. Molecular events in matrix protein metabolism in the aging kidney

    Science.gov (United States)

    Sataranatarajan, Kavithalakshmi; Feliers, Denis; Mariappan, Meenalakshmi M.; Lee, Hak Joo; Lee, Myung Ja; Day, Robert T.; Yalamanchili, Hima Bindu; Choudhury, Goutam G.; Barnes, Jeffrey L.; Van Remmen, Holly; Richardson, Arlan; Kasinath, Balakuntalam S.

    2018-01-01

    Summary We explored molecular events associated with aging-induced matrix changes in the kidney. C57BL6 mice were studied in youth, middle age, and old age. Albuminuria and serum cystatin C level (an index of glomerular filtration) increased with aging. Renal hypertrophy was evident in middle-aged and old mice and was associated with glomerulomegaly and increase in mesangial fraction occupied by extracellular matrix. Content of collagen types I and III and fibronectin was increased with aging; increment in their mRNA varied with the phase of aging. The content of ZEB1 and ZEB2, collagen type I transcription inhibitors, and their binding to the collagen type Iα2 promoter by ChIP assay also showed age-phase-specific changes. Lack of increase in mRNA and data from polysome assay suggested decreased degradation as a potential mechanism for kidney collagen type I accumulation in the middle-aged mice. These changes occurred with increment in TGFβ mRNA and protein and activation of its SMAD3 pathway; SMAD3 binding to the collagen type Iα2 promoter was also increased. TGFβ-regulated microRNAs (miRs) exhibited selective regulation. The renal cortical content of miR-21 and miR-200c, but not miR-192, miR-200a, or miR-200b, was increased with aging. Increased miR-21 and miR-200c contents were associated with reduced expression of their targets, Sprouty-1 and ZEB2, respectively. These data show that aging is associated with complex molecular events in the kidney that are already evident in the middle age and progress to old age. Agephase-specific regulation of matrix protein synthesis occurs and involves matrix protein-specific transcriptional and post-transcriptional mechanisms. PMID:23020145

  20. Genomic analyses identify molecular subtypes of pancreatic cancer.

    Science.gov (United States)

    Bailey, Peter; Chang, David K; Nones, Katia; Johns, Amber L; Patch, Ann-Marie; Gingras, Marie-Claude; Miller, David K; Christ, Angelika N; Bruxner, Tim J C; Quinn, Michael C; Nourse, Craig; Murtaugh, L Charles; Harliwong, Ivon; Idrisoglu, Senel; Manning, Suzanne; Nourbakhsh, Ehsan; Wani, Shivangi; Fink, Lynn; Holmes, Oliver; Chin, Venessa; Anderson, Matthew J; Kazakoff, Stephen; Leonard, Conrad; Newell, Felicity; Waddell, Nick; Wood, Scott; Xu, Qinying; Wilson, Peter J; Cloonan, Nicole; Kassahn, Karin S; Taylor, Darrin; Quek, Kelly; Robertson, Alan; Pantano, Lorena; Mincarelli, Laura; Sanchez, Luis N; Evers, Lisa; Wu, Jianmin; Pinese, Mark; Cowley, Mark J; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chantrill, Lorraine A; Mawson, Amanda; Humphris, Jeremy; Chou, Angela; Pajic, Marina; Scarlett, Christopher J; Pinho, Andreia V; Giry-Laterriere, Marc; Rooman, Ilse; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Merrett, Neil D; Toon, Christopher W; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Moran-Jones, Kim; Jamieson, Nigel B; Graham, Janet S; Duthie, Fraser; Oien, Karin; Hair, Jane; Grützmann, Robert; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Corbo, Vincenzo; Bassi, Claudio; Rusev, Borislav; Capelli, Paola; Salvia, Roberto; Tortora, Giampaolo; Mukhopadhyay, Debabrata; Petersen, Gloria M; Munzy, Donna M; Fisher, William E; Karim, Saadia A; Eshleman, James R; Hruban, Ralph H; Pilarsky, Christian; Morton, Jennifer P; Sansom, Owen J; Scarpa, Aldo; Musgrove, Elizabeth A; Bailey, Ulla-Maja Hagbo; Hofmann, Oliver; Sutherland, Robert L; Wheeler, David A; Gill, Anthony J; Gibbs, Richard A; Pearson, John V; Waddell, Nicola; Biankin, Andrew V; Grimmond, Sean M

    2016-03-03

    Integrated genomic analysis of 456 pancreatic ductal adenocarcinomas identified 32 recurrently mutated genes that aggregate into 10 pathways: KRAS, TGF-β, WNT, NOTCH, ROBO/SLIT signalling, G1/S transition, SWI-SNF, chromatin modification, DNA repair and RNA processing. Expression analysis defined 4 subtypes: (1) squamous; (2) pancreatic progenitor; (3) immunogenic; and (4) aberrantly differentiated endocrine exocrine (ADEX) that correlate with histopathological characteristics. Squamous tumours are enriched for TP53 and KDM6A mutations, upregulation of the TP63∆N transcriptional network, hypermethylation of pancreatic endodermal cell-fate determining genes and have a poor prognosis. Pancreatic progenitor tumours preferentially express genes involved in early pancreatic development (FOXA2/3, PDX1 and MNX1). ADEX tumours displayed upregulation of genes that regulate networks involved in KRAS activation, exocrine (NR5A2 and RBPJL), and endocrine differentiation (NEUROD1 and NKX2-2). Immunogenic tumours contained upregulated immune networks including pathways involved in acquired immune suppression. These data infer differences in the molecular evolution of pancreatic cancer subtypes and identify opportunities for therapeutic development.

  1. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    Science.gov (United States)

    2011-01-01

    Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples). Four distinct clusters were identified by Principal Components Analysis (PCA) in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples) using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p INSS stage 4 and/or dead of disease, p < 0.05, Fisher's exact test). Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group's specific characteristics. PMID:21492432

  2. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    Directory of Open Access Journals (Sweden)

    Kogner Per

    2011-04-01

    Full Text Available Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB; Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples. Four distinct clusters were identified by Principal Components Analysis (PCA in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p ALK, BIRC5, and PHOX2B, and was significantly associated with higher tumour stage, poor outcome and poor survival compared to the Type 1-corresponding favourable group (INSS stage 4 and/or dead of disease, p Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group's specific characteristics.

  3. Master Logic Diagram: An Approach to Identify Initiating Events of HTGRs

    Science.gov (United States)

    Purba, J. H.

    2018-02-01

    Initiating events of a nuclear power plant being evaluated need to be firstly identified prior to applying probabilistic safety assessment on that plant. Various types of master logic diagrams (MLDs) have been proposedforsearching initiating events of the next generation of nuclear power plants, which have limited data and operating experiences. Those MLDs are different in the number of steps or levels and different in the basis for developing them. This study proposed another type of MLD approach to find high temperature gas cooled reactor (HTGR) initiating events. It consists of five functional steps starting from the top event representing the final objective of the safety functions to the basic event representing the goal of the MLD development, which is an initiating event. The application of the proposed approach to search for two HTGR initiating events, i.e. power turbine generator trip and loss of offsite power, is provided. The results confirmed that the proposed MLD is feasiblefor finding HTGR initiating events.

  4. WANO Activities Related to Identifying and Reducing the Likelihood for Recurring Events

    International Nuclear Information System (INIS)

    Llewellyn, Michael

    2003-01-01

    Since its inception, WANO has encouraged members to share operating experience and events information through the WANO Operating Experience Programme. Preventing recurring events is a prime reason for sharing events information. Over 2500 events have been shared through WANO since 1989. However, a review of WANO activities in 1997 identified that this information was not being used very well by WANO members, and that WANO was not adding much 'value' to the events sharing process. At the time, WANO only provided the 'postal exchange' function for events sharing, and was not reviewing events across WANO to help members focus on the really important issues. Often, these very important issues involve recurring events. As a result of the 1997 review of the WANO operating experience process, WANO re-sourced and developed new analysis capabilities and began producing new types of reports for its members. The resource commitment includes four seconded engineers (one from each WANO Regional Centre) brought to Paris to staff a WANO Operating Experience Central Team. This team analyses events across WANO, writes WANO event reports, provides operating experience-related training, and provides technical support to members to improve their use of operating experience information. One focus area for events analysis by WANO is the identification and subsequent industry notification of recurring events. As a result of the 1997 review of WANO activities, in 1998 WANO began production of several new types of event-based reports to communicate significant industry events to our members. A key focus of analysis of these significant events is whether they are recurring events (that is, very similar to previous events either at that NPP or another NPP in the industry). The reports are called Significant Operating Experience Reports (SOERs) and Significant Event Reports (SERs). Significant Operating Experience Reports (SOERs) are written by WANO when several event reports indicate that

  5. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    LENUS (Irish Health Repository)

    Abel, Frida

    2011-04-14

    Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples). Four distinct clusters were identified by Principal Components Analysis (PCA) in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples) using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p < 0.05, one-way ANOVA test). PCA clusters p1, p2, and p3 were found to correspond well to the postulated subtypes 1, 2A, and 2B, respectively. Remarkably, a fourth novel cluster was detected in all three independent data sets. This cluster comprised mainly 11q-deleted MNA-negative tumours with low expression of ALK, BIRC5, and PHOX2B, and was significantly associated with higher tumour stage, poor outcome and poor survival compared to the Type 1-corresponding favourable group (INSS stage 4 and\\/or dead of disease, p < 0.05, Fisher\\'s exact test). Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group\\'s specific characteristics.

  6. Identifying molecular targets of lifestyle modifications in colon cancer prevention

    Directory of Open Access Journals (Sweden)

    Molly Marie Derry

    2013-05-01

    Full Text Available One in four deaths in the United States is cancer-related, and colorectal cancer (CRC is the second leading cause of cancer-associated deaths. Screening strategies are utilized but have not reduced disease incidence or mortality. In this regard, there is an interest in cancer preventive strategies focusing on lifestyle intervention, where specific etiologic factors involved in cancer initiation, promotion, and progression could be targeted. For example, exposure to dietary carcinogens, such as nitrosamines and polycyclic aromatic hydrocarbons influences colon carcinogenesis. Furthermore, dietary deficiencies could alter sensitivity to genetic damage and influence carcinogen metabolism contributing to CRC. High alcohol consumption increases the risk of mutations including the fact that acetaldehyde, an ethanol metabolite, is classified as a group 1 carcinogen. Tobacco smoke exposure is also a risk factor for cancer development; ~20% of CRCs are associated with smoking. Additionally, obese patients have a higher risk of cancer development, which is further supported by the fact that physical activity decreases CRC risk by 55%. Similarly, chronic inflammatory conditions also increase the risk of CRC development. Moreover, the circadian clock alters digestion and regulates other biochemical, physiological and behavioral processes that could positively influence CRC. Taken together, colon carcinogenesis involves a number of etiological factors, and therefore, to create effective preventive strategies, molecular targets need to be identified and beleaguered prior to disease progression. With this in mind, the following is a comprehensive review identifying downstream target proteins of the above lifestyle risk factors, which are modulated during colon carcinogenesis and could be targeted for CRC prevention by novel agents including phytochemicals.

  7. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Facilitating adverse drug event detection in pharmacovigilance databases using molecular structure similarity: application to rhabdomyolysis

    Science.gov (United States)

    Vilar, Santiago; Harpaz, Rave; Chase, Herbert S; Costanzi, Stefano; Rabadan, Raul

    2011-01-01

    Background Adverse drug events (ADE) cause considerable harm to patients, and consequently their detection is critical for patient safety. The US Food and Drug Administration maintains an adverse event reporting system (AERS) to facilitate the detection of ADE in drugs. Various data mining approaches have been developed that use AERS to detect signals identifying associations between drugs and ADE. The signals must then be monitored further by domain experts, which is a time-consuming task. Objective To develop a new methodology that combines existing data mining algorithms with chemical information by analysis of molecular fingerprints to enhance initial ADE signals generated from AERS, and to provide a decision support mechanism to facilitate the identification of novel adverse events. Results The method achieved a significant improvement in precision in identifying known ADE, and a more than twofold signal enhancement when applied to the ADE rhabdomyolysis. The simplicity of the method assists in highlighting the etiology of the ADE by identifying structurally similar drugs. A set of drugs with strong evidence from both AERS and molecular fingerprint-based modeling is constructed for further analysis. Conclusion The results demonstrate that the proposed methodology could be used as a pharmacovigilance decision support tool to facilitate ADE detection. PMID:21946238

  9. Using Active Learning to Identify Health Information Technology Related Patient Safety Events.

    Science.gov (United States)

    Fong, Allan; Howe, Jessica L; Adams, Katharine T; Ratwani, Raj M

    2017-01-18

    The widespread adoption of health information technology (HIT) has led to new patient safety hazards that are often difficult to identify. Patient safety event reports, which are self-reported descriptions of safety hazards, provide one view of potential HIT-related safety events. However, identifying HIT-related reports can be challenging as they are often categorized under other more predominate clinical categories. This challenge of identifying HIT-related reports is exacerbated by the increasing number and complexity of reports which pose challenges to human annotators that must manually review reports. In this paper, we apply active learning techniques to support classification of patient safety event reports as HIT-related. We evaluated different strategies and demonstrated a 30% increase in average precision of a confirmatory sampling strategy over a baseline no active learning approach after 10 learning iterations.

  10. A new index for identifying different types of El Niño Modoki events

    Science.gov (United States)

    Wang, Xin; Tan, Wei; Wang, Chunzai

    2018-04-01

    El Niño Modoki events can be further classified into El Niño Modoki I and II in terms of their opposite impacts on southern China rainfall (Wang and Wang, J Clim 26:1322-1338, 2013) and the Indian Ocean dipole mode (Wang and Wang, Clim Dyn 42:991-1005, 2014). The present paper develops an index to identify the types of El Niño events. The El Niño Modoki II (MII) index is defined as the leading principle component of multivariate empirical orthogonal function analysis of the normalized El Niño Modoki index, Niño4 index and 850 hPa relative vorticity anomalies averaged near the Philippine Sea during autumn. The MII index exhibits dominant variations on interannual (2-3 and 4-5 years) and decadal (10-20 years) timescales. El Niño Modoki II events can be well identified by using the MII index value being larger than 1 standard deviation. Further analyses and numerical model experiments confirm that the MII index can portray the major oceanic and atmospheric features of El Niño Modoki II events. The constructed MII index along with previous ENSO indices can be used for classifying and identifying all types of El Niño events. Because of distinct impacts induced by different types of El Niño events, the implication of the present study is that climate prediction and future climate projection under global warming can be improved by using the MII index and other indices to identify the types of El Niño events.

  11. Analyzing and Identifying Teens' Stressful Periods and Stressor Events From a Microblog.

    Science.gov (United States)

    Li, Qi; Xue, Yuanyuan; Zhao, Liang; Jia, Jia; Feng, Ling

    2017-09-01

    Increased health problems among adolescents caused by psychological stress have aroused worldwide attention. Long-standing stress without targeted assistance and guidance negatively impacts the healthy growth of adolescents, threatening the future development of our society. So far, research focused on detecting adolescent psychological stress revealed from each individual post on microblogs. However, beyond stressful moments, identifying teens' stressful periods and stressor events that trigger each stressful period is more desirable to understand the stress from appearance to essence. In this paper, we define the problem of identifying teens' stressful periods and stressor events from the open social media microblog. Starting from a case study of adolescents' posting behaviors during stressful school events, we build a Poisson-based probability model for the correlation between stressor events and stressful posting behaviors through a series of posts on Tencent Weibo (referred to as the microblog throughout the paper). With the model, we discover teens' maximal stressful periods and further extract details of possible stressor events that cause the stressful periods. We generalize and present the extracted stressor events in a hierarchy based on common stress dimensions and event types. Taking 122 scheduled stressful study-related events in a high school as the ground truth, we test the approach on 124 students' posts from January 1, 2012 to February 1, 2015 and obtain some promising experimental results: (stressful periods: recall 0.761, precision 0.737, and F 1 -measure 0.734) and (top-3 stressor events: recall 0.763, precision 0.756, and F 1 -measure 0.759). The most prominent stressor events extracted are in the self-cognition domain, followed by the school life domain. This conforms to the adolescent psychological investigation result that problems in school life usually accompanied with teens' inner cognition problems. Compared with the state-of-the-art top

  12. Utilization of Satellite Data to Identify and Monitor Changes in Frequency of Meteorological Events

    Science.gov (United States)

    Mast, J. C.; Dessler, A. E.

    2017-12-01

    Increases in temperature and climate variability due to human-induced climate change is increasing the frequency and magnitude of extreme heat events (i.e., heatwaves). This will have a detrimental impact on the health of human populations and habitability of certain land locations. Here we seek to utilize satellite data records to identify and monitor extreme heat events. We analyze satellite data sets (MODIS and AIRS land surface temperatures (LST) and water vapor profiles (WV)) due to their global coverage and stable calibration. Heat waves are identified based on the frequency of maximum daily temperatures above a threshold, determined as follows. Land surface temperatures are gridded into uniform latitude/longitude bins. Maximum daily temperatures per bin are determined and probability density functions (PDF) of these maxima are constructed monthly and seasonally. For each bin, a threshold is calculated at the 95th percentile of the PDF of maximum temperatures. Per each bin, an extreme heat event is defined based on the frequency of monthly and seasonal days exceeding the threshold. To account for the decreased ability of the human body to thermoregulate with increasing moisture, and to assess lethality of the heat events, we determine the wet-bulb temperature at the locations of extreme heat events. Preliminary results will be presented.

  13. Patient-identified events implicated in the development of body dysmorphic disorder.

    Science.gov (United States)

    Weingarden, Hilary; Curley, Erin E; Renshaw, Keith D; Wilhelm, Sabine

    2017-06-01

    Little is known about the causes of body dysmorphic disorder (BDD), but researchers have proposed a diathesis-stress model. This study uses a patient-centered approach to identify stressful events to which patients attribute the development of their BDD symptoms. An Internet-recruited sample of 165 adults with BDD participated. A large minority of participants attributed the development of their BDD to a triggering event. Bullying experiences were the most commonly described type of event. Additionally, most events were interpersonal and occurred during grade school or middle school. There were no differences in severity of psychosocial outcomes between participants who did or did not attribute their BDD to a specific triggering event. However, participants who specifically attributed their BDD development to a bullying experience had poorer psychosocial outcomes (i.e., perceived social support, depression severity, functional impairment, quality of life) compared to those who attributed their BDD development to another type of triggering event. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Molecular profiling identifies prognostic markers of stage IA lung adenocarcinoma.

    Science.gov (United States)

    Zhang, Jie; Shao, Jinchen; Zhu, Lei; Zhao, Ruiying; Xing, Jie; Wang, Jun; Guo, Xiaohui; Tu, Shichun; Han, Baohui; Yu, Keke

    2017-09-26

    We previously showed that different pathologic subtypes were associated with different prognostic values in patients with stage IA lung adenocarcinoma (AC). We hypothesize that differential gene expression profiles of different subtypes may be valuable factors for prognosis in stage IA lung adenocarcinoma. We performed microarray gene expression profiling on tumor tissues micro-dissected from patients with acinar and solid predominant subtypes of stage IA lung adenocarcinoma. These patients had undergone a lobectomy and mediastinal lymph node dissection at the Shanghai Chest Hospital, Shanghai, China in 2012. No patient had preoperative treatment. We performed the Gene Set Enrichment Analysis (GSEA) analysis to look for gene expression signatures associated with tumor subtypes. The histologic subtypes of all patients were classified according to the 2015 WHO lung Adenocarcinoma classification. We found that patients with the solid predominant subtype are enriched for genes involved in RNA polymerase activity as well as inactivation of the p53 pathway. Further, we identified a list of genes that may serve as prognostic markers for stage IA lung adenocarcinoma. Validation in the TCGA database shows that these genes are correlated with survival, suggesting that they are novel prognostic factors for stage IA lung adenocarcinoma. In conclusion, we have uncovered novel prognostic factors for stage IA lung adenocarcinoma using gene expression profiling in combination with histopathology subtyping.

  15. Why conventional detection methods fail in identifying the existence of contamination events.

    Science.gov (United States)

    Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

    2016-04-15

    Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Tuning and Test of Fragmentation Models Based on Identified Particles and Precision Event Shape Data

    CERN Document Server

    Abreu, P; Adye, T; Ajinenko, I; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andreazza, A; Andrieux, M L; Antilogus, P; Apel, W D; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barate, R; Barbi, M S; Bardin, Dimitri Yuri; Baroncelli, A; Bärring, O; Barrio, J A; Bartl, Walter; Bates, M J; Battaglia, Marco; Baubillier, M; Baudot, J; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Belous, K S; Benvenuti, Alberto C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bloch, D; Blume, M; Bolognese, T; Bonesini, M; Bonivento, W; Booth, P S L; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Bricman, C; Brown, R C A; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Buys, A; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Cankocak, K; Cao, F; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Chabaud, V; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Cindro, V; Collins, P; Contreras, J L; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; Dahl-Jensen, Erik; Dahm, J; D'Almagne, B; Dam, M; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Defoix, C; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; De Saint-Jean, C; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djama, F; Dolbeau, J; Dönszelmann, M; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fassouliotis, D; Feindt, Michael; Ferrer, A; Fichet, S; Filippas-Tassos, A; Firestone, A; Fischer, P A; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frenkiel, P; Fries, D E C; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gokieli, R; Golob, B; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Gumenyuk, S A; Gunnarsson, P; Günther, M; Guy, J; Hahn, F; Hahn, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Higón, E; Hilke, Hans Jürgen; Hill, T S; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kaiser, M; Kapusta, F; Karafasoulis, K; Karlsson, M; Karvelas, E; Katsanevas, S; Katsoufis, E C; Keränen, R; Khokhlov, Yu A; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Klovning, A; Kluit, P M; Köne, B; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Krupinski, W; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Laktineh, I; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Lapin, V; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Libby, J; Liko, D; Lindner, R; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; López, J M; Loukas, D; Lutz, P; Lyons, L; Naughton, J M; Maehlum, G; Mahon, J R; Maio, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Masik, J; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; Medbo, J; Merk, M; Meroni, C; Meyer, S; Meyer, W T; Myagkov, A; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Morettini, P; Müller, H; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Niss, P; Nomerotski, A; Normand, Ainsley; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Pagès, P; Pain, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Passeri, A; Pegoraro, M; Peralta, L; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Petrovykh, M; Phillips, H T; Piana, G; Pierre, F; Plaszczynski, S; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Rames, J; Ratoff, P N; Read, A L; Reale, M; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Renton, P B; Resvanis, L K; Richard, F; Richardson, J; Rídky, J; Rinaudo, G; Ripp, I; Romero, A; Roncagliolo, I; Ronchese, P; Roos, L; Rosenberg, E I; Rosso, E; Roudeau, Patrick; Rovelli, T; Rückstuhl, W; Ruhlmann-Kleider, V; Ruiz, A; Rybicki, K; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sahr, O; Sajot, G; Salt, J; Sánchez, J; Sannino, M; Schimmelpfennig, M; Schneider, H; Schwickerath, U; Schyns, M A E; Sciolla, G; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Seitz, A; Sekulin, R L; Serbelloni, L; Shellard, R C; Siegrist, P; Silvestre, R; Simonetti, S; Simonetto, F; Sissakian, A N; Sitár, B; Skaali, T B; Smadja, G; Smirnov, N; Smirnova, O G; Smith, G R; Sokolov, A; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stanescu, C; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stichelbaut, F; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Tavernet, J P; Chikilev, O G; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Trischuk, W; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; van Apeldoorn, G W; van Dam, P; Van Eldik, J; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Vilanova, D; Vincent, P; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Waldner, F; Weierstall, M; Weilhammer, Peter; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wielers, M; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Woschnagg, K; Yip, K; Yushchenko, O P; Zach, F; Zaitsev, A; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zito, M; Zontar, D; Zucchelli, G C; Zumerle, G

    1996-01-01

    Event shape and charged particle inclusive distributions are measured using 750000 decays of the $Z$ to hadrons from the DELPHI detector at LEP. These precise data allow a decisive confrontation with models of the hadronization process. Improved tunings of the JETSET ARIADNE and HERWIG parton shower models and the JETSET matrix element model are obtained by fitting the models to these DELPHI data as well as to identified particle distributions from all LEP experiments. The description of the data distributions by the models is critically reviewed with special importance attributed to identified particles.

  17. Metabolic and Molecular Events Occurring during Chromoplast Biogenesis

    Directory of Open Access Journals (Sweden)

    Wanping Bian

    2011-01-01

    Full Text Available Chromoplasts are nonphotosynthetic plastids that accumulate carotenoids. They derive from other plastid forms, mostly chloroplasts. The biochemical events responsible for the interconversion of one plastid form into another are poorly documented. However, thanks to transcriptomics and proteomics approaches, novel information is now available. Data of proteomic and biochemical analysis revealed the importance of lipid metabolism and carotenoids biosynthetic activities. The loss of photosynthetic activity was associated with the absence of the chlorophyll biosynthesis branch and the presence of proteins involved in chlorophyll degradation. Surprisingly, the entire set of Calvin cycle and of the oxidative pentose phosphate pathway persisted after the transition from chloroplast to chromoplast. The role of plastoglobules in the formation and organisation of carotenoid-containing structures and that of the Or gene in the control of chromoplastogenesis are reviewed. Finally, using transcriptomic data, an overview is given the expression pattern of a number of genes encoding plastid-located proteins during tomato fruit ripening.

  18. Identifying Typhoon Tracks based on Event Synchronization derived Spatially Embedded Climate Networks

    Science.gov (United States)

    Ozturk, Ugur; Marwan, Norbert; Kurths, Jürgen

    2017-04-01

    Complex networks are commonly used for investigating spatiotemporal dynamics of complex systems, e.g. extreme rainfall. Especially directed networks are very effective tools in identifying climatic patterns on spatially embedded networks. They can capture the network flux, so as the principal dynamics of spreading significant phenomena. Network measures, such as network divergence, bare the source-receptor relation of the directed networks. However, it is still a challenge how to catch fast evolving atmospheric events, i.e. typhoons. In this study, we propose a new technique, namely Radial Ranks, to detect the general pattern of typhoons forward direction based on the strength parameter of the event synchronization over Japan. We suggest to subset a circular zone of high correlation around the selected grid based on the strength parameter. Radial sums of the strength parameter along vectors within this zone, radial ranks are measured for potential directions, which allows us to trace the network flux over long distances. We employed also the delay parameter of event synchronization to identify and separate the frontal storms' and typhoons' individual behaviors.

  19. Performing drought indices to identify the relationship between agricultural losses and drought events in Spain.

    Science.gov (United States)

    Peña Gallardo, Marina; Serrano, Sergio Martín Vicente; Portugués Santiago, Beguería; Burguera Miquel, Tomás

    2017-04-01

    Drought leads to crop failures reducing the productivity. For this reason, the need of appropriate tool for recognize dry periods and evaluate the impact of drought on crop production is important. In this study, we provide an assessment of the relationship between drought episodes and crop failures in Spain as one of the direct consequences of drought is the diminishing of crop yields. First, different drought indices [the Standardized Precipitation and Evapotranspiration Index (SPEI); the Standardized Precipitation Index (SPI); the self-calibrated Palmer Moisture Anomaly Index (Z-Index), the self-calibrated Crop Moisture Index (CMI) and the Standardized Palmer Drought Index (SPDI)] have been calculated at different time scales in order to identify the dry events occurred in Spain and determine the duration and intensity of each event. Second, the drought episodes have been correlated with crop production estimated and final crop production data provided by the Spanish Crop Insurance System for the available period from 1995 to 2014 at the municipal spatial scale, with the purpose of knowing if the characteristics of the drought episodes are reflected on the agricultural losses. The analysis has been carried out in particular for two types of crop, wheat and barley. The results indicate the existence of an agreement between the most important drought events in Spain and the response of the crop productions and the proportion of hectare insurance. Nevertheless, this agreement vary depending on the drought index applied. Authors found a higher competence of the drought indices calculated at different time scales (SPEI, SPI and SPDI) identifying the begging and end of the drought events and the correspondence with the crop failures.

  20. Physiologically-based toxicokinetic models help identifying the key factors affecting contaminant uptake during flood events

    Energy Technology Data Exchange (ETDEWEB)

    Brinkmann, Markus; Eichbaum, Kathrin [Department of Ecosystem Analysis, Institute for Environmental Research,ABBt – Aachen Biology and Biotechnology, RWTH Aachen University, Worringerweg 1, 52074 Aachen (Germany); Kammann, Ulrike [Thünen-Institute of Fisheries Ecology, Palmaille 9, 22767 Hamburg (Germany); Hudjetz, Sebastian [Department of Ecosystem Analysis, Institute for Environmental Research,ABBt – Aachen Biology and Biotechnology, RWTH Aachen University, Worringerweg 1, 52074 Aachen (Germany); Institute of Hydraulic Engineering and Water Resources Management, RWTH Aachen University, Mies-van-der-Rohe-Straße 1, 52056 Aachen (Germany); Cofalla, Catrina [Institute of Hydraulic Engineering and Water Resources Management, RWTH Aachen University, Mies-van-der-Rohe-Straße 1, 52056 Aachen (Germany); Buchinger, Sebastian; Reifferscheid, Georg [Federal Institute of Hydrology (BFG), Department G3: Biochemistry, Ecotoxicology, Am Mainzer Tor 1, 56068 Koblenz (Germany); Schüttrumpf, Holger [Institute of Hydraulic Engineering and Water Resources Management, RWTH Aachen University, Mies-van-der-Rohe-Straße 1, 52056 Aachen (Germany); Preuss, Thomas [Department of Environmental Biology and Chemodynamics, Institute for Environmental Research,ABBt- Aachen Biology and Biotechnology, RWTH Aachen University, Worringerweg 1, 52074 Aachen (Germany); and others

    2014-07-01

    Highlights: • A PBTK model for trout was coupled with a sediment equilibrium partitioning model. • The influence of physical exercise on pollutant uptake was studies using the model. • Physical exercise during flood events can increase the level of biliary metabolites. • Cardiac output and effective respiratory volume were identified as relevant factors. • These confounding factors need to be considered also for bioconcentration studies. - Abstract: As a consequence of global climate change, we will be likely facing an increasing frequency and intensity of flood events. Thus, the ecotoxicological relevance of sediment re-suspension is of growing concern. It is vital to understand contaminant uptake from suspended sediments and relate it to effects in aquatic biota. Here we report on a computational study that utilizes a physiologically based toxicokinetic model to predict uptake, metabolism and excretion of sediment-borne pyrene in rainbow trout (Oncorhynchus mykiss). To this end, data from two experimental studies were compared with the model predictions: (a) batch re-suspension experiments with constant concentration of suspended particulate matter at two different temperatures (12 and 24 °C), and (b) simulated flood events in an annular flume. The model predicted both the final concentrations and the kinetics of 1-hydroxypyrene secretion into the gall bladder of exposed rainbow trout well. We were able to show that exhaustive exercise during exposure in simulated flood events can lead to increased levels of biliary metabolites and identified cardiac output and effective respiratory volume as the two most important factors for contaminant uptake. The results of our study clearly demonstrate the relevance and the necessity to investigate uptake of contaminants from suspended sediments under realistic exposure scenarios.

  1. Physiologically-based toxicokinetic models help identifying the key factors affecting contaminant uptake during flood events

    International Nuclear Information System (INIS)

    Brinkmann, Markus; Eichbaum, Kathrin; Kammann, Ulrike; Hudjetz, Sebastian; Cofalla, Catrina; Buchinger, Sebastian; Reifferscheid, Georg; Schüttrumpf, Holger; Preuss, Thomas

    2014-01-01

    Highlights: • A PBTK model for trout was coupled with a sediment equilibrium partitioning model. • The influence of physical exercise on pollutant uptake was studies using the model. • Physical exercise during flood events can increase the level of biliary metabolites. • Cardiac output and effective respiratory volume were identified as relevant factors. • These confounding factors need to be considered also for bioconcentration studies. - Abstract: As a consequence of global climate change, we will be likely facing an increasing frequency and intensity of flood events. Thus, the ecotoxicological relevance of sediment re-suspension is of growing concern. It is vital to understand contaminant uptake from suspended sediments and relate it to effects in aquatic biota. Here we report on a computational study that utilizes a physiologically based toxicokinetic model to predict uptake, metabolism and excretion of sediment-borne pyrene in rainbow trout (Oncorhynchus mykiss). To this end, data from two experimental studies were compared with the model predictions: (a) batch re-suspension experiments with constant concentration of suspended particulate matter at two different temperatures (12 and 24 °C), and (b) simulated flood events in an annular flume. The model predicted both the final concentrations and the kinetics of 1-hydroxypyrene secretion into the gall bladder of exposed rainbow trout well. We were able to show that exhaustive exercise during exposure in simulated flood events can lead to increased levels of biliary metabolites and identified cardiac output and effective respiratory volume as the two most important factors for contaminant uptake. The results of our study clearly demonstrate the relevance and the necessity to investigate uptake of contaminants from suspended sediments under realistic exposure scenarios

  2. Defining molecular initiating events in the adverse outcome pathway framework for risk assessment.

    Science.gov (United States)

    Allen, Timothy E H; Goodman, Jonathan M; Gutsell, Steve; Russell, Paul J

    2014-12-15

    Consumer and environmental safety decisions are based on exposure and hazard data, interpreted using risk assessment approaches. The adverse outcome pathway (AOP) conceptual framework has been presented as a logical sequence of events or processes within biological systems which can be used to understand adverse effects and refine current risk assessment practices in ecotoxicology. This framework can also be applied to human toxicology and is explored on the basis of investigating the molecular initiating events (MIEs) of compounds. The precise definition of the MIE has yet to reach general acceptance. In this work we present a unified MIE definition: an MIE is the initial interaction between a molecule and a biomolecule or biosystem that can be causally linked to an outcome via a pathway. Case studies are presented, and issues with current definitions are addressed. With the development of a unified MIE definition, the field can look toward defining, classifying, and characterizing more MIEs and using knowledge of the chemistry of these processes to aid AOP research and toxicity risk assessment. We also present the role of MIE research in the development of in vitro and in silico toxicology and suggest how, by using a combination of biological and chemical approaches, MIEs can be identified and characterized despite a lack of detailed reports, even for some of the most studied molecules in toxicology.

  3. Using Genetic Buffering Relationships Identified in Fission Yeast To Elucidate the Molecular Pathology of Tuberous Sclerosis

    Science.gov (United States)

    2016-07-01

    tsc1 and tsc2 loss of function mutations in Schizosaccharomyces pombe. Northeast Regional Yeast Meeting, June 16-17, University at Buffalo, The State...AWARD NUMBER: W81XWH-14-1-0169 TITLE: Using Genetic Buffering Relationships Identified in Fission Yeast To Elucidate the Molecular Pathology of...SUBTITLE Using Genetic Buffering Relationships Identified in Fission 5a. CONTRACT NUMBER W81XWH-14-1-0169 Yeast to Elucidate the Molecular Pathology

  4. Can surveillance systems identify and avert adverse drug events? A prospective evaluation of a commercial application.

    Science.gov (United States)

    Jha, Ashish K; Laguette, Julia; Seger, Andrew; Bates, David W

    2008-01-01

    Computerized monitors can effectively detect and potentially prevent adverse drug events (ADEs). Most monitors have been developed in large academic hospitals and are not readily usable in other settings. We assessed the ability of a commercial program to identify and prevent ADEs in a community hospital. and Measurement We prospectively evaluated the commercial application in a community-based hospital. We examined the frequency and types of alerts produced, how often they were associated with ADEs and potential ADEs, and the potential financial impact of monitoring for ADEs. Among 2,407 patients screened, the application generated 516 high priority alerts. We were able to review 266 alerts at the time they were generated and among these, 30 (11.3%) were considered substantially important to warrant contacting the physician caring for the patient. These 30 alerts were associated with 4 ADEs and 11 potential ADEs. In all 15 cases, the responsible physician was unaware of the event, leading to a change in clinical care in 14 cases. Overall, 23% of high priority alerts were associated with an ADE (95% confidence interval [CI] 12% to 34%) and another 15% were associated with a potential ADE (95% CI 6% to 24%). Active surveillance used approximately 1.5 hours of pharmacist time daily. A commercially available, computer-based ADE detection tool was effective at identifying ADEs. When used as part of an active surveillance program, it can have an impact on preventing or ameliorating ADEs.

  5. Identifying Changes in the Probability of High Temperature, High Humidity Heat Wave Events

    Science.gov (United States)

    Ballard, T.; Diffenbaugh, N. S.

    2016-12-01

    Understanding how heat waves will respond to climate change is critical for adequate planning and adaptation. While temperature is the primary determinant of heat wave severity, humidity has been shown to play a key role in heat wave intensity with direct links to human health and safety. Here we investigate the individual contributions of temperature and specific humidity to extreme heat wave conditions in recent decades. Using global NCEP-DOE Reanalysis II daily data, we identify regional variability in the joint probability distribution of humidity and temperature. We also identify a statistically significant positive trend in humidity over the eastern U.S. during heat wave events, leading to an increased probability of high humidity, high temperature events. The extent to which we can expect this trend to continue under climate change is complicated due to variability between CMIP5 models, in particular among projections of humidity. However, our results support the notion that heat wave dynamics are characterized by more than high temperatures alone, and understanding and quantifying the various components of the heat wave system is crucial for forecasting future impacts.

  6. Cartography of Pathway Signal Perturbations Identifies Distinct Molecular Pathomechanisms in Malignant and Chronic Lung Diseases

    Science.gov (United States)

    Arakelyan, Arsen; Nersisyan, Lilit; Petrek, Martin; Löffler-Wirth, Henry; Binder, Hans

    2016-01-01

    Lung diseases are described by a wide variety of developmental mechanisms and clinical manifestations. Accurate classification and diagnosis of lung diseases are the bases for development of effective treatments. While extensive studies are conducted toward characterization of various lung diseases at molecular level, no systematic approach has been developed so far. Here we have applied a methodology for pathway-centered mining of high throughput gene expression data to describe a wide range of lung diseases in the light of shared and specific pathway activity profiles. We have applied an algorithm combining a Pathway Signal Flow (PSF) algorithm for estimation of pathway activity deregulation states in lung diseases and malignancies, and a Self Organizing Maps algorithm for classification and clustering of the pathway activity profiles. The analysis results allowed clearly distinguish between cancer and non-cancer lung diseases. Lung cancers were characterized by pathways implicated in cell proliferation, metabolism, while non-malignant lung diseases were characterized by deregulations in pathways involved in immune/inflammatory response and fibrotic tissue remodeling. In contrast to lung malignancies, chronic lung diseases had relatively heterogeneous pathway deregulation profiles. We identified three groups of interstitial lung diseases and showed that the development of characteristic pathological processes, such as fibrosis, can be initiated by deregulations in different signaling pathways. In conclusion, this paper describes the pathobiology of lung diseases from systems viewpoint using pathway centered high-dimensional data mining approach. Our results contribute largely to current understanding of pathological events in lung cancers and non-malignant lung diseases. Moreover, this paper provides new insight into molecular mechanisms of a number of interstitial lung diseases that have been studied to a lesser extent. PMID:27200087

  7. Signal detection to identify serious adverse events (neuropsychiatric events in travelers taking mefloquine for chemoprophylaxis of malaria

    Directory of Open Access Journals (Sweden)

    Naing C

    2012-08-01

    Full Text Available Cho Naing,1,3 Kyan Aung,1 Syed Imran Ahmed,2 Joon Wah Mak31School of Medical Sciences, 2School of Pharmacy and Health Sciences, 3School of Postgraduate Studies and Research, International Medical University, Kuala Lumpur, MalaysiaBackground: For all medications, there is a trade-off between benefits and potential for harm. It is important for patient safety to detect drug-event combinations and analyze by appropriate statistical methods. Mefloquine is used as chemoprophylaxis for travelers going to regions with known chloroquine-resistant Plasmodium falciparum malaria. As such, there is a concern about serious adverse events associated with mefloquine chemoprophylaxis. The objective of the present study was to assess whether any signal would be detected for the serious adverse events of mefloquine, based on data in clinicoepidemiological studies.Materials and methods: We extracted data on adverse events related to mefloquine chemoprophylaxis from the two published datasets. Disproportionality reporting of adverse events such as neuropsychiatric events and other adverse events was presented in the 2 × 2 contingency table. Reporting odds ratio and corresponding 95% confidence interval [CI] data-mining algorithm was applied for the signal detection. The safety signals are considered significant when the ROR estimates and the lower limits of the corresponding 95% CI are ≥2.Results: Two datasets addressing adverse events of mefloquine chemoprophylaxis (one from a published article and one from a Cochrane systematic review were included for analyses. Reporting odds ratio 1.58, 95% CI: 1.49–1.68 based on published data in the selected article, and 1.195, 95% CI: 0.94–1.44 based on data in the selected Cochrane review. Overall, in both datasets, the reporting odds ratio values of lower 95% CI were less than 2.Conclusion: Based on available data, findings suggested that signals for serious adverse events pertinent to neuropsychiatric event were

  8. Identifying evidence of climate change impact on extreme events in permeable chalk catchments

    Science.gov (United States)

    Butler, A. P.; Nubert, S.

    2009-12-01

    The permeable chalk catchments of southern England are vital for the economy and well being of the UK. Not only important as a water resource, their freely draining soils support intensive agricultural production, and the rolling downs and chalk streams provide important habitants for many protected plant and animal species. Consequently, there are concerns about the potential impact of climate change on such catchments, particularly in relation to groundwater recharge. Of major concern are possible changes in extreme events, such as groundwater floods and droughts, as any increase in the frequency and/or severity of these has important consequences for water resources, ecological systems and local infrastructure. Studies of climate change impact on extreme events for such catchments have indicated that, under medium and high emissions scenarios, droughts are likely to become more severe whilst floods less so. However, given the uncertainties in such predictions and the inherent variability in historic data, producing definitive evidence of changes in flood/drought frequency/severity poses a significant challenge. Thus, there is a need for specific extreme event statistics that can be used as indicators of actual climate change in streamflow and groundwater level observations. Identifying such indicators that are sufficiently robust requires catchments with long historic time series data. One such catchment is the River Lavant, an intermittent chalk stream in West Sussex, UK. Located within this catchment is Chilgrove House, the site of the UK’s longest groundwater monitoring well (with a continuous record of water level observations of varying frequency dating back to 1836). Using a variety of meteorological datasets, the behaviour of the catchment has been modelled, from 1855 to present, using a 'leaky aquifer' conceptual model. Model calibration was based on observed daily streamflow, at a gauging station just outside the town of Chichester, from 1970. Long

  9. Domain-restricted mutation analysis to identify novel driver events in human cancer

    Directory of Open Access Journals (Sweden)

    Sanket Desai

    2017-10-01

    Full Text Available Analysis of mutational spectra across various cancer types has given valuable insights into tumorigenesis. Different approaches have been used to identify novel drivers from the set of somatic mutations, including the methods which use sequence conservation, geometric localization and pathway information. Recent computational methods suggest use of protein domain information for analysis and understanding of the functional consequence of non-synonymous mutations. Similarly, evidence suggests recurrence at specific position in proteins is robust indicators of its functional impact. Building on this, we performed a systematic analysis of TCGA exome derived somatic mutations across 6089 PFAM domains and significantly mutated domains were identified using randomization approach. Multiple alignment of individual domain allowed us to prioritize for conserved residues mutated at analogous positions across different proteins in a statistically disciplined manner. In addition to the known frequently mutated genes, this analysis independently identifies low frequency Meprin and TRAF-Homology (MATH domain in Speckle Type BTB/POZ (SPOP protein, in prostate adenocarcinoma. Results from this analysis will help generate hypotheses about the downstream molecular mechanism resulting in cancer phenotypes.

  10. Alternative splicing events identified in human embryonic stem cells and neural progenitors.

    Directory of Open Access Journals (Sweden)

    Gene W Yeo

    2007-10-01

    Full Text Available Human embryonic stem cells (hESCs and neural progenitor (NP cells are excellent models for recapitulating early neuronal development in vitro, and are key to establishing strategies for the treatment of degenerative disorders. While much effort had been undertaken to analyze transcriptional and epigenetic differences during the transition of hESC to NP, very little work has been performed to understand post-transcriptional changes during neuronal differentiation. Alternative RNA splicing (AS, a major form of post-transcriptional gene regulation, is important in mammalian development and neuronal function. Human ESC, hESC-derived NP, and human central nervous system stem cells were compared using Affymetrix exon arrays. We introduced an outlier detection approach, REAP (Regression-based Exon Array Protocol, to identify 1,737 internal exons that are predicted to undergo AS in NP compared to hESC. Experimental validation of REAP-predicted AS events indicated a threshold-dependent sensitivity ranging from 56% to 69%, at a specificity of 77% to 96%. REAP predictions significantly overlapped sets of alternative events identified using expressed sequence tags and evolutionarily conserved AS events. Our results also reveal that focusing on differentially expressed genes between hESC and NP will overlook 14% of potential AS genes. In addition, we found that REAP predictions are enriched in genes encoding serine/threonine kinase and helicase activities. An example is a REAP-predicted alternative exon in the SLK (serine/threonine kinase 2 gene that is differentially included in hESC, but skipped in NP as well as in other differentiated tissues. Lastly, comparative sequence analysis revealed conserved intronic cis-regulatory elements such as the FOX1/2 binding site GCAUG as being proximal to candidate AS exons, suggesting that FOX1/2 may participate in the regulation of AS in NP and hESC. In summary, a new methodology for exon array analysis was introduced

  11. Swarm-Aurora: A web-based tool for quickly identifying multi-instrument auroral events

    Science.gov (United States)

    Chaddock, D.; Donovan, E.; Spanswick, E.; Knudsen, D. J.; Frey, H. U.; Kauristie, K.; Partamies, N.; Jackel, B. J.; Gillies, M.; Holmdahl Olsen, P. E.

    2016-12-01

    In recent years there has been a dramatic increase in ground-based auroral imaging systems. These include the continent-wide THEMIS-ASI network, and imagers operated by other programs including GO-Canada, MIRACLE, AGO, OMTI, and more. In the near future, a new Canadian program called TREx will see the deployment of new narrow-band ASIs that will provide multi-wavelength imaging across Western Canada. At the same time, there is an unprecedented fleet of international spacecraft probing geospace at low and high altitudes. We are now in the position to simultaneously observe the magnetospheric drivers of aurora, observe in situ the waves, currents, and particles associated with MI coupling, and the conjugate aurora. Whereas a decade ago, a single magnetic conjunction between one ASI and a low altitude satellite was a relatively rare event, we now have a plethora of triple conjunctions between imagers, low-altitude spacecraft, and near-equatorial magnetospheric probes. But with these riches comes a new level of complexity. It is often difficult to identify the many useful conjunctions for a specific line of inquiry from the multitude of conjunctions where the geospace conditions are often not relevant and/or the imaging is compromised by clouds, moon, or other factors. Swarm-Aurora was designed to facilitate and drive the use of Swarm in situ measurements in auroral science. The project seeks to build a bridge between the Swarm science community, Swarm data, and the complimentary auroral data and community. Swarm-Aurora (http://swarm-aurora.phys.ucalgary.ca) incorporates a web-based tool which provides access to quick-look summary data for a large array of instruments, with Swarm in situ and ground-based ASI data as the primary focus. This web interface allows researchers to quickly and efficiently browse Swarm and ASI data to identify auroral events of interest to them. This allows researchers to be able to easily and quickly identify Swarm overflights of ASIs that

  12. Identifying biologically meaningful hot-weather events using threshold temperatures that affect life-history.

    Directory of Open Access Journals (Sweden)

    Susan J Cunningham

    Full Text Available Increases in the frequency, duration and intensity of heat waves are frequently evoked in climate change predictions. However, there is no universal definition of a heat wave. Recent, intense hot weather events have caused mass mortalities of birds, bats and even humans, making the definition and prediction of heat wave events that have the potential to impact populations of different species an urgent priority. One possible technique for defining biologically meaningful heat waves is to use threshold temperatures (T(thresh above which known fitness costs are incurred by species of interest. We set out to test the utility of this technique using T(thresh values that, when exceeded, affect aspects of the fitness of two focal southern African bird species: the southern pied babbler Turdiodes bicolor (T(thresh = 35.5 °C and the common fiscal Lanius collaris (T(thresh = 33 °C. We used these T(thresh values to analyse trends in the frequency, duration and intensity of heat waves of magnitude relevant to the focal species, as well as the annual number of hot days (maximum air temperature > T(thresh, in north-western South Africa between 1961 and 2010. Using this technique, we were able to show that, while all heat wave indices increased during the study period, most rapid increases for both species were in the annual number of hot days and in the maximum intensity (and therefore intensity variance of biologically meaningful heat waves. Importantly, we also showed that warming trends were not uniform across the study area and that geographical patterns in warming allowed both areas of high risk and potential climate refugia to be identified. We discuss the implications of the trends we found for our focal species, and the utility of the T(thresh technique as a conservation tool.

  13. Identify alternative splicing events based on position-specific evolutionary conservation.

    Directory of Open Access Journals (Sweden)

    Liang Chen

    Full Text Available The evolution of eukaryotes is accompanied by the increased complexity of alternative splicing which greatly expands genome information. One of the greatest challenges in the post-genome era is a complete revelation of human transcriptome with consideration of alternative splicing. Here, we introduce a comparative genomics approach to systemically identify alternative splicing events based on the differential evolutionary conservation between exons and introns and the high-quality annotation of the ENCODE regions. Specifically, we focus on exons that are included in some transcripts but are completely spliced out for others and we call them conditional exons. First, we characterize distinguishing features among conditional exons, constitutive exons and introns. One of the most important features is the position-specific conservation score. There are dramatic differences in conservation scores between conditional exons and constitutive exons. More importantly, the differences are position-specific. For flanking intronic regions, the differences between conditional exons and constitutive exons are also position-specific. Using the Random Forests algorithm, we can classify conditional exons with high specificities (97% for the identification of conditional exons from intron regions and 95% for the classification of known exons and fair sensitivities (64% and 32% respectively. We applied the method to the human genome and identified 39,640 introns that actually contain conditional exons and classified 8,813 conditional exons from the current RefSeq exon list. Among those, 31,673 introns containing conditional exons and 5,294 conditional exons classified from known exons cannot be inferred from RefSeq, UCSC or Ensembl annotations. Some of these de novo predictions were experimentally verified.

  14. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles

    Directory of Open Access Journals (Sweden)

    Farshad Farshidfar

    2017-03-01

    Full Text Available Cholangiocarcinoma (CCA is an aggressive malignancy of the bile ducts, with poor prognosis and limited treatment options. Here, we describe the integrated analysis of somatic mutations, RNA expression, copy number, and DNA methylation by The Cancer Genome Atlas of a set of predominantly intrahepatic CCA cases and propose a molecular classification scheme. We identified an IDH mutant-enriched subtype with distinct molecular features including low expression of chromatin modifiers, elevated expression of mitochondrial genes, and increased mitochondrial DNA copy number. Leveraging the multi-platform data, we observed that ARID1A exhibited DNA hypermethylation and decreased expression in the IDH mutant subtype. More broadly, we found that IDH mutations are associated with an expanded histological spectrum of liver tumors with molecular features that stratify with CCA. Our studies reveal insights into the molecular pathogenesis and heterogeneity of cholangiocarcinoma and provide classification information of potential therapeutic significance.

  15. Reduced Clostridium difficile Tests and Laboratory-Identified Events With a Computerized Clinical Decision Support Tool and Financial Incentive.

    Science.gov (United States)

    Madden, Gregory R; German Mesner, Ian; Cox, Heather L; Mathers, Amy J; Lyman, Jason A; Sifri, Costi D; Enfield, Kyle B

    2018-06-01

    We hypothesized that a computerized clinical decision support tool for Clostridium difficile testing would reduce unnecessary inpatient tests, resulting in fewer laboratory-identified events. Census-adjusted interrupted time-series analyses demonstrated significant reductions of 41% fewer tests and 31% fewer hospital-onset C. difficile infection laboratory-identified events following this intervention.Infect Control Hosp Epidemiol 2018;39:737-740.

  16. Identifying molecular subtypes in human colon cancer using gene expression and DNA methylation microarray data

    OpenAIRE

    REN, ZHONGLU; WANG, WENHUI; LI, JINMING

    2015-01-01

    Identifying colon cancer subtypes based on molecular signatures may allow for a more rational, patient-specific approach to therapy in the future. Classifications using gene expression data have been attempted before with little concordance between the different studies carried out. In this study we aimed to uncover subtypes of colon cancer that have distinct biological characteristics and identify a set of novel biomarkers which could best reflect the clinical and/or biological characteristi...

  17. Identifying treatment effect heterogeneity in clinical trials using subpopulations of events: STEPP.

    Science.gov (United States)

    Lazar, Ann A; Bonetti, Marco; Cole, Bernard F; Yip, Wai-Ki; Gelber, Richard D

    2016-04-01

    Investigators conducting randomized clinical trials often explore treatment effect heterogeneity to assess whether treatment efficacy varies according to patient characteristics. Identifying heterogeneity is central to making informed personalized healthcare decisions. Treatment effect heterogeneity can be investigated using subpopulation treatment effect pattern plot (STEPP), a non-parametric graphical approach that constructs overlapping patient subpopulations with varying values of a characteristic. Procedures for statistical testing using subpopulation treatment effect pattern plot when the endpoint of interest is survival remain an area of active investigation. A STEPP analysis was used to explore patterns of absolute and relative treatment effects for varying levels of a breast cancer biomarker, Ki-67, in the phase III Breast International Group 1-98 randomized clinical trial, comparing letrozole to tamoxifen as adjuvant therapy for postmenopausal women with hormone receptor-positive breast cancer. Absolute treatment effects were measured by differences in 4-year cumulative incidence of breast cancer recurrence, while relative effects were measured by the subdistribution hazard ratio in the presence of competing risks using O-E (observed-minus-expected) methodology, an intuitive non-parametric method. While estimation of hazard ratio values based on O-E methodology has been shown, a similar development for the subdistribution hazard ratio has not. Furthermore, we observed that the subpopulation treatment effect pattern plot analysis may not produce results, even with 100 patients within each subpopulation. After further investigation through simulation studies, we observed inflation of the type I error rate of the traditional test statistic and sometimes singular variance-covariance matrix estimates that may lead to results not being produced. This is due to the lack of sufficient number of events within the subpopulations, which we refer to as instability of

  18. Quantification of pancreatic cancer proteome and phosphorylome: indicates molecular events likely contributing to cancer and activity of drug targets.

    Directory of Open Access Journals (Sweden)

    David Britton

    Full Text Available LC-MS/MS phospho-proteomics is an essential technology to help unravel the complex molecular events that lead to and propagate cancer. We have developed a global phospho-proteomic workflow to determine activity of signaling pathways and drug targets in pancreatic cancer tissue for clinical application.Peptides resulting from tryptic digestion of proteins extracted from frozen tissue of pancreatic ductal adenocarcinoma and background pancreas (n = 12, were labelled with tandem mass tags (TMT 8-plex, separated by strong cation exchange chromatography, then were analysed by LC-MS/MS directly or first enriched for phosphopeptides using IMAC and TiO2, prior to analysis. In-house, commercial and freeware bioinformatic platforms were used to identify relevant biological events from the complex dataset.Of 2,101 proteins identified, 152 demonstrated significant difference in abundance between tumor and non-tumor tissue. They included proteins that are known to be up-regulated in pancreatic cancer (e.g. Mucin-1, but the majority were new candidate markers such as HIPK1 & MLCK. Of the 6,543 unique phosphopeptides identified (6,284 unique phosphorylation sites, 635 showed significant regulation, particularly those from proteins involved in cell migration (Rho guanine nucleotide exchange factors & MRCKα and formation of focal adhesions. Activator phosphorylation sites on FYN, AKT1, ERK2, HDAC1 and other drug targets were found to be highly modulated (≥2 fold in different cases highlighting their predictive power.Here we provided critical information enabling us to identify the common and unique molecular events likely contributing to cancer in each case. Such information may be used to help predict more bespoke therapy suitable for an individual case.

  19. Quantification of pancreatic cancer proteome and phosphorylome: indicates molecular events likely contributing to cancer and activity of drug targets.

    Science.gov (United States)

    Britton, David; Zen, Yoh; Quaglia, Alberto; Selzer, Stefan; Mitra, Vikram; Löβner, Christopher; Jung, Stephan; Böhm, Gitte; Schmid, Peter; Prefot, Petra; Hoehle, Claudia; Koncarevic, Sasa; Gee, Julia; Nicholson, Robert; Ward, Malcolm; Castellano, Leandro; Stebbing, Justin; Zucht, Hans Dieter; Sarker, Debashis; Heaton, Nigel; Pike, Ian

    2014-01-01

    LC-MS/MS phospho-proteomics is an essential technology to help unravel the complex molecular events that lead to and propagate cancer. We have developed a global phospho-proteomic workflow to determine activity of signaling pathways and drug targets in pancreatic cancer tissue for clinical application. Peptides resulting from tryptic digestion of proteins extracted from frozen tissue of pancreatic ductal adenocarcinoma and background pancreas (n = 12), were labelled with tandem mass tags (TMT 8-plex), separated by strong cation exchange chromatography, then were analysed by LC-MS/MS directly or first enriched for phosphopeptides using IMAC and TiO2, prior to analysis. In-house, commercial and freeware bioinformatic platforms were used to identify relevant biological events from the complex dataset. Of 2,101 proteins identified, 152 demonstrated significant difference in abundance between tumor and non-tumor tissue. They included proteins that are known to be up-regulated in pancreatic cancer (e.g. Mucin-1), but the majority were new candidate markers such as HIPK1 & MLCK. Of the 6,543 unique phosphopeptides identified (6,284 unique phosphorylation sites), 635 showed significant regulation, particularly those from proteins involved in cell migration (Rho guanine nucleotide exchange factors & MRCKα) and formation of focal adhesions. Activator phosphorylation sites on FYN, AKT1, ERK2, HDAC1 and other drug targets were found to be highly modulated (≥2 fold) in different cases highlighting their predictive power. Here we provided critical information enabling us to identify the common and unique molecular events likely contributing to cancer in each case. Such information may be used to help predict more bespoke therapy suitable for an individual case.

  20. Using Lead Concentrations and Stable Lead Isotope Ratios to Identify Contamination Events in Alluvial Soils

    Directory of Open Access Journals (Sweden)

    Diane Saint-Laurent

    2010-01-01

    Full Text Available Soils contaminated with hydrocarbons (C10–C50, polycyclic aromatic hydrocarbons (PAHs, and other contaminants (e.g., As, Cd, Cu, Pb were recently discovered on the banks of the Saint-François and Massawippi rivers. Alluvial soils are contaminated over a distance of 100 kilometers, and the level of the contaminated-hydrocarbon layer in the soil profiles is among the highest at the Windsor and Richmond sites. Concentrations of lead and stable lead isotope ratios (204Pb/206Pb, 207Pb/206Pb, 208Pb/206Pb are also used to identify contamination events. The maximum and minimum values detected in soil profiles for arsenic, cadmium, and lead vary from 3.01 to 37.88 mg kg-1 (As, 0.11 to 0.81 mg kg-1 (Cd 12.32 to 149.13 mg kg-1 (Pb, respectively, while the 207Pb/206Pb isotopic ratio values are between 0.8545 and 0.8724 for all the profiles. The highest values of trace elements (As, Pb and Zn were detected in the hydrocarbon layer (C10–C50, most often located at the bottom of the profiles (160, 200, and 220 cm in depth. The various peaks recorded in the soils and the position of the profiles suggest that various contaminants were transported by the river on several occasions and infiltrated the soil matrix or deposited on floodplains during successive floods. Atmospheric particles which entered the river or deposited on riverbanks must also be considered as another source of pollution recorded in soils.

  1. Using Lead Concentrations and Stable Lead Isotope Ratios to Identify Contamination Events in Alluvial Soils

    International Nuclear Information System (INIS)

    Saint-Laurent, D.; St-Laurent, J.; Hahni, M.; Chapados, C.; Ghaleb, B.

    2010-01-01

    Soils contaminated with hydrocarbons (C10,C50), polycyclic aromatic hydrocarbons (PAHs), and other contaminants (e.g., As, Cd, Cu, Pb) were recently discovered on the banks of the Saint-Francois and Massawippi rivers. Alluvial soils are contaminated over a distance of 100 kilometers, and the level of the contaminated-hydrocarbon layer in the soil profiles is among the highest at the Windsor and Richmond sites. Concentrations of lead and stable lead isotope ratios ( 204 Pb/ 206 Pb, 206 Pb/ 207 Pb, 208 Pb/ 20 '6Pb) are also used to identify contamination events. The maximum and minimum values detected in soil profiles for arsenic, cadmium, and lead vary from 3.01 to 37.88?mg kg -1 (As), 0.11 to 0.81?mg kg-1 (Cd) 12.32 to 149.13?mg kg -1 (Pb), respectively, while the 207 Pb/ 206 Pb isotopic ratio values are between 0.8545 and 0.8724 for all the profiles. The highest values of trace elements (As, Pb and Zn) were detected in the hydrocarbon layer (C10,C50), most often located at the bottom of the profiles (160, 200, and 220 cm in depth). The various peaks recorded in the soils and the position of the profiles suggest that various contaminants were transported by the river on several occasions and infiltrated the soil matrix or deposited on flood plains during successive floods. Atmospheric particles which entered the river or deposited on riverbanks must also be considered as another source of pollution recorded in soils

  2. Positive predictive value of a register-based algorithm using the Danish National Registries to identify suicidal events.

    Science.gov (United States)

    Gasse, Christiane; Danielsen, Andreas Aalkjaer; Pedersen, Marianne Giørtz; Pedersen, Carsten Bøcker; Mors, Ole; Christensen, Jakob

    2018-04-17

    It is not possible to fully assess intention of self-harm and suicidal events using information from administrative databases. We conducted a validation study of intention of suicide attempts/self-harm contacts identified by a commonly applied Danish register-based algorithm (DK-algorithm) based on hospital discharge diagnosis and emergency room contacts. Of all 101 530 people identified with an incident suicide attempt/self-harm contact at Danish hospitals between 1995 and 2012 using the DK-algorithm, we selected a random sample of 475 people. We validated the DK-algorithm against medical records applying the definitions and terminology of the Columbia Classification Algorithm of Suicide Assessment of suicidal events, nonsuicidal events, and indeterminate or potentially suicidal events. We calculated positive predictive values (PPVs) of the DK-algorithm to identify suicidal events overall, by gender, age groups, and calendar time. We retrieved medical records for 357 (75%) people. The PPV of the DK-algorithm to identify suicidal events was 51.5% (95% CI: 46.4-56.7) overall, 42.7% (95% CI: 35.2-50.5) in males, and 58.5% (95% CI: 51.6-65.1) in females. The PPV varied further across age groups and calendar time. After excluding cases identified via the DK-algorithm by unspecific codes of intoxications and injury, the PPV improved slightly (56.8% [95% CI: 50.0-63.4]). The DK-algorithm can reliably identify self-harm with suicidal intention in 52% of the identified cases of suicide attempts/self-harm. The PPVs could be used for quantitative bias analysis and implemented as weights in future studies to estimate the proportion of suicidal events among cases identified via the DK-algorithm. Copyright © 2018 John Wiley & Sons, Ltd.

  3. A Systems Biology Framework Identifies Molecular Underpinnings of Coronary Heart Disease

    Science.gov (United States)

    Huan, Tianxiao; Zhang, Bin; Wang, Zhi; Joehanes, Roby; Zhu, Jun; Johnson, Andrew D.; Ying, Saixia; Munson, Peter J.; Raghavachari, Nalini; Wang, Richard; Liu, Poching; Courchesne, Paul; Hwang, Shih-Jen; Assimes, Themistocles L.; McPherson, Ruth; Samani, Nilesh J.; Schunkert, Heribert; Meng, Qingying; Suver, Christine; O'Donnell, Christopher J.; Derry, Jonathan; Yang, Xia; Levy, Daniel

    2013-01-01

    Objective Genetic approaches have identified numerous loci associated with coronary heart disease (CHD). The molecular mechanisms underlying CHD gene-disease associations, however, remain unclear. We hypothesized that genetic variants with both strong and subtle effects drive gene subnetworks that in turn affect CHD. Approach and Results We surveyed CHD-associated molecular interactions by constructing coexpression networks using whole blood gene expression profiles from 188 CHD cases and 188 age- and sex-matched controls. 24 coexpression modules were identified including one case-specific and one control-specific differential module (DM). The DMs were enriched for genes involved in B-cell activation, immune response, and ion transport. By integrating the DMs with altered gene expression associated SNPs (eSNPs) and with results of GWAS of CHD and its risk factors, the control-specific DM was implicated as CHD-causal based on its significant enrichment for both CHD and lipid eSNPs. This causal DM was further integrated with tissue-specific Bayesian networks and protein-protein interaction networks to identify regulatory key driver (KD) genes. Multi-tissue KDs (SPIB and TNFRSF13C) and tissue-specific KDs (e.g. EBF1) were identified. Conclusions Our network-driven integrative analysis not only identified CHD-related genes, but also defined network structure that sheds light on the molecular interactions of genes associated with CHD risk. PMID:23539213

  4. Action-Derived Molecular Dynamics in the Study of Rare Events

    Energy Technology Data Exchange (ETDEWEB)

    Passerone, Daniele; Parrinello, Michele

    2001-09-03

    We present a practical method to generate classical trajectories with fixed initial and final boundary conditions. Our method is based on the minimization of a suitably defined discretized action. The method finds its most natural application in the study of rare events. Its capabilities are illustrated by nontrivial examples. The algorithm lends itself to straightforward parallelization, and when combined with ab initio molecular dynamics it promises to offer a powerful tool for the study of chemical reactions.

  5. Action-Derived Molecular Dynamics in the Study of Rare Events

    International Nuclear Information System (INIS)

    Passerone, Daniele; Parrinello, Michele

    2001-01-01

    We present a practical method to generate classical trajectories with fixed initial and final boundary conditions. Our method is based on the minimization of a suitably defined discretized action. The method finds its most natural application in the study of rare events. Its capabilities are illustrated by nontrivial examples. The algorithm lends itself to straightforward parallelization, and when combined with ab initio molecular dynamics it promises to offer a powerful tool for the study of chemical reactions

  6. Identifying the molecular functions of electron transport proteins using radial basis function networks and biochemical properties.

    Science.gov (United States)

    Le, Nguyen-Quoc-Khanh; Nguyen, Trinh-Trung-Duong; Ou, Yu-Yen

    2017-05-01

    The electron transport proteins have an important role in storing and transferring electrons in cellular respiration, which is the most proficient process through which cells gather energy from consumed food. According to the molecular functions, the electron transport chain components could be formed with five complexes with several different electron carriers and functions. Therefore, identifying the molecular functions in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. This work includes two phases for discriminating electron transport proteins from transport proteins and classifying categories of five complexes in electron transport proteins. In the first phase, the performances from PSSM with AAIndex feature set were successful in identifying electron transport proteins in transport proteins with achieved sensitivity of 73.2%, specificity of 94.1%, and accuracy of 91.3%, with MCC of 0.64 for independent data set. With the second phase, our method can approach a precise model for identifying of five complexes with different molecular functions in electron transport proteins. The PSSM with AAIndex properties in five complexes achieved MCC of 0.51, 0.47, 0.42, 0.74, and 1.00 for independent data set, respectively. We suggest that our study could be a power model for determining new proteins that belongs into which molecular function of electron transport proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. NEWLY IDENTIFIED EXTENDED GREEN OBJECTS (EGOs) FROM THE SPITZER GLIMPSE II SURVEY. II. MOLECULAR CLOUD ENVIRONMENTS

    Energy Technology Data Exchange (ETDEWEB)

    Chen Xi; Gan Conggui; Shen Zhiqiang [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, Shanghai 200030 (China); Ellingsen, Simon P.; Titmarsh, Anita [School of Mathematics and Physics, University of Tasmania, Hobart, Tasmania (Australia); He Jinhua, E-mail: chenxi@shao.ac.cn [Key Laboratory for the Structure and Evolution of Celestial Objects, Yunnan Astronomical Observatory/National Astronomical Observatory, Chinese Academy of Sciences, P.O. Box 110, Kunming 650011, Yunnan Province (China)

    2013-06-01

    We have undertaken a survey of molecular lines in the 3 mm band toward 57 young stellar objects using the Australia Telescope National Facility Mopra 22 m radio telescope. The target sources were young stellar objects with active outflows (extended green objects (EGOs)) newly identified from the GLIMPSE II survey. We observe a high detection rate (50%) of broad line wing emission in the HNC and CS thermal lines, which combined with the high detection rate of class I methanol masers toward these sources (reported in Paper I) further demonstrates that the GLIMPSE II EGOs are associated with outflows. The physical and kinematic characteristics derived from the 3 mm molecular lines for these newly identified EGOs are consistent with these sources being massive young stellar objects with ongoing outflow activity and rapid accretion. These findings support our previous investigations of the mid-infrared properties of these sources and their association with other star formation tracers (e.g., infrared dark clouds, methanol masers and millimeter dust sources) presented in Paper I. The high detection rate (64%) of the hot core tracer CH{sub 3}CN reveals that the majority of these new EGOs have evolved to the hot molecular core stage. Comparison of the observed molecular column densities with predictions from hot core chemistry models reveals that the newly identified EGOs from the GLIMPSE II survey are members of the youngest hot core population, with an evolutionary time scale of the order of 10{sup 3} yr.

  8. Probing molecular mechanisms of the Hsp90 chaperone: biophysical modeling identifies key regulators of functional dynamics.

    Directory of Open Access Journals (Sweden)

    Anshuman Dixit

    Full Text Available Deciphering functional mechanisms of the Hsp90 chaperone machinery is an important objective in cancer biology aiming to facilitate discovery of targeted anti-cancer therapies. Despite significant advances in understanding structure and function of molecular chaperones, organizing molecular principles that control the relationship between conformational diversity and functional mechanisms of the Hsp90 activity lack a sufficient quantitative characterization. We combined molecular dynamics simulations, principal component analysis, the energy landscape model and structure-functional analysis of Hsp90 regulatory interactions to systematically investigate functional dynamics of the molecular chaperone. This approach has identified a network of conserved regions common to the Hsp90 chaperones that could play a universal role in coordinating functional dynamics, principal collective motions and allosteric signaling of Hsp90. We have found that these functional motifs may be utilized by the molecular chaperone machinery to act collectively as central regulators of Hsp90 dynamics and activity, including the inter-domain communications, control of ATP hydrolysis, and protein client binding. These findings have provided support to a long-standing assertion that allosteric regulation and catalysis may have emerged via common evolutionary routes. The interaction networks regulating functional motions of Hsp90 may be determined by the inherent structural architecture of the molecular chaperone. At the same time, the thermodynamics-based "conformational selection" of functional states is likely to be activated based on the nature of the binding partner. This mechanistic model of Hsp90 dynamics and function is consistent with the notion that allosteric networks orchestrating cooperative protein motions can be formed by evolutionary conserved and sparsely connected residue clusters. Hence, allosteric signaling through a small network of distantly connected

  9. Cortical GABA markers identify a molecular subtype of psychotic and bipolar disorders.

    Science.gov (United States)

    Volk, D W; Sampson, A R; Zhang, Y; Edelson, J R; Lewis, D A

    2016-09-01

    Deficits in gamma aminobutyric acid (GABA) neuron-related markers, including the GABA-synthesizing enzyme GAD67, the calcium-binding protein parvalbumin, the neuropeptide somatostatin, and the transcription factor Lhx6, are most pronounced in a subset of schizophrenia subjects identified as having a 'low GABA marker' (LGM) molecular phenotype. Furthermore, schizophrenia shares degrees of genetic liability, clinical features and cortical circuitry abnormalities with schizoaffective disorder and bipolar disorder. Therefore, we determined the extent to which a similar LGM molecular phenotype may also exist in subjects with these disorders. Transcript levels for GAD67, parvalbumin, somatostatin, and Lhx6 were quantified using quantitative PCR in prefrontal cortex area 9 of 184 subjects with a diagnosis of schizophrenia (n = 39), schizoaffective disorder (n = 23) or bipolar disorder (n = 35), or with a confirmed absence of any psychiatric diagnoses (n = 87). A blinded clustering approach was employed to determine the presence of a LGM molecular phenotype across all subjects. Approximately 49% of the subjects with schizophrenia, 48% of the subjects with schizoaffective disorder, and 29% of the subjects with bipolar disorder, but only 5% of unaffected subjects, clustered in the cortical LGM molecular phenotype. These findings support the characterization of psychotic and bipolar disorders by cortical molecular phenotype which may help elucidate more pathophysiologically informed and personalized medications.

  10. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers

    OpenAIRE

    Taïbi, Khaled; Campo, Antonio D. del; Vilagrosa Carmona, Alberto; Bellés, José M.; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J.; López-Nicolás, José M.; Mulet, José M.

    2017-01-01

    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of pre...

  11. MicroRNA Expression Profiling Identifies Molecular Diagnostic Signatures for Anaplastic Large Cell Lymphoma

    DEFF Research Database (Denmark)

    Liu, Cuiling; Iqbal, Javeed; Teruya-Feldstein, Julie

    2013-01-01

    distinct clustering of ALCL, PTCL-NOS, and the AITL subtype of PTCL. Cases of ALK(+) ALCL and ALK(-) ALCL were interspersed in unsupervised analysis, suggesting a close relationship at the molecular level. We identified an miRNA signature of 7 miRNAs (5 upregulated: miR-512-3p, miR-886-5p, miR-886-3p, mi...

  12. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers

    OpenAIRE

    Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E.M.

    2016-01-01

    Background The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequ...

  13. Molecular subtypes of osteosarcoma identified by reducing tumor heterogeneity through an interspecies comparative approach

    Science.gov (United States)

    Scott, Milcah C.; Sarver, Aaron L.; Gavin, Katherine J.; Thayanithy, Venugopal; Getzy, David M.; Newman, Robert A.; Cutter, Gary R.; Lindblad-Toh, Kerstin; Kisseberth, William C.; Hunter, Lawrence E.; Subramanian, Subbaya; Breen, Matthew; Modiano, Jaime F.

    2011-01-01

    The heterogeneous and chaotic nature of osteosarcoma has confounded accurate molecular classification, prognosis, and prediction for this tumor. The occurrence of spontaneous osteosarcoma is largely confined to humans and dogs. While the clinical features are remarkably similar in both species, the organization of dogs into defined breeds provides a more homogeneous genetic background that may increase the likelihood to uncover molecular subtypes for this complex disease. We thus hypothesized that molecular profiles derived from canine osteosarcoma would aid in molecular subclassification of this disease when applied to humans. To test the hypothesis, we performed genome wide gene expression profiling in a cohort of dogs with osteosarcoma, primarily from high-risk breeds. To further reduce inter-sample heterogeneity, we assessed tumor-intrinsic properties through use of an extensive panel of osteosarcoma-derived cell lines. We observed strong differential gene expression that segregated samples into two groups with differential survival probabilities. Groupings were characterized by the inversely correlated expression of genes associated with G2/M transition and DNA damage checkpoint and microenvironment-interaction categories. This signature was preserved in data from whole tumor samples of three independent dog osteosarcoma cohorts, with stratification into the two expected groups. Significantly, this restricted signature partially overlapped a previously defined, predictive signature for soft tissue sarcomas, and it unmasked orthologous molecular subtypes and their corresponding natural histories in five independent data sets from human patients with osteosarcoma. Our results indicate that the narrower genetic diversity of dogs can be utilized to group complex human osteosarcoma into biologically and clinically relevant molecular subtypes. This in turn may enhance prognosis and prediction, and identify relevant therapeutic targets. PMID:21621658

  14. Identifying Adverse Events Using International Classification of Diseases, Tenth Revision Y Codes in Korea: A Cross-sectional Study

    Directory of Open Access Journals (Sweden)

    Minsu Ock

    2018-01-01

    Full Text Available Objectives The use of administrative data is an affordable alternative to conducting a difficult large-scale medical-record review to estimate the scale of adverse events. We identified adverse events from 2002 to 2013 on the national level in Korea, using International Classification of Diseases, tenth revision (ICD-10 Y codes. Methods We used data from the National Health Insurance Service-National Sample Cohort (NHIS-NSC. We relied on medical treatment databases to extract information on ICD-10 Y codes from each participant in the NHIS-NSC. We classified adverse events in the ICD-10 Y codes into 6 types: those related to drugs, transfusions, and fluids; those related to vaccines and immunoglobulin; those related to surgery and procedures; those related to infections; those related to devices; and others. Results Over 12 years, a total of 20 817 adverse events were identified using ICD-10 Y codes, and the estimated total adverse event rate was 0.20%. Between 2002 and 2013, the total number of such events increased by 131.3%, from 1366 in 2002 to 3159 in 2013. The total rate increased by 103.9%, from 0.17% in 2002 to 0.35% in 2013. Events related to drugs, transfusions, and fluids were the most common (19 446, 93.4%, followed by those related to surgery and procedures (1209, 5.8% and those related to vaccines and immunoglobulin (72, 0.3%. Conclusions Based on a comparison with the results of other studies, the total adverse event rate in this study was significantly underestimated. Improving coding practices for ICD-10 Y codes is necessary to precisely monitor the scale of adverse events in Korea.

  15. Comparing hair-morphology and molecular methods to identify fecal samples from Neotropical felids.

    Directory of Open Access Journals (Sweden)

    Carlos C Alberts

    Full Text Available To avoid certain problems encountered with more-traditional and invasive methods in behavioral-ecology studies of mammalian predators, such as felids, molecular approaches have been employed to identify feces found in the field. However, this method requires a complete molecular biology laboratory, and usually also requires very fresh fecal samples to avoid DNA degradation. Both conditions are normally absent in the field. To address these difficulties, identification based on morphological characters (length, color, banding, scales and medullar patterns of hairs found in feces could be employed as an alternative. In this study we constructed a morphological identification key for guard hairs of eight Neotropical felids (jaguar, oncilla, Geoffroy's cat, margay, ocelot, Pampas cat, puma and jaguarundi and compared its efficiency to that of a molecular identification method, using the ATP6 region as a marker. For this molecular approach, we simulated some field conditions by postponing sample-conservation procedures. A blind test of the identification key obtained a nearly 70% overall success rate, which we considered equivalent to or better than the results of some molecular methods (probably due to DNA degradation found in other studies. The jaguar, puma and jaguarundi could be unequivocally discriminated from any other Neotropical felid. On a scale ranging from inadequate to excellent, the key proved poor only for the margay, with only 30% of its hairs successfully identified using this key; and have intermediate success rates for the remaining species, the oncilla, Geoffroy's cat, ocelot and Pampas cat, were intermediate. Complementary information about the known distributions of felid populations may be necessary to substantially improve the results obtained with the key. Our own molecular results were even better, since all blind-tested samples were correctly identified. Part of these identifications were made from samples kept in suboptimal

  16. Systematic procedures for identifying t quarks in p-barp collider events with a muon and jets

    International Nuclear Information System (INIS)

    Barger, V.; Baer, H.; Martin, A.D.; Phillips, R.J.N.

    1984-01-01

    Substantial rates are predicted for events containing a muon and jets resulting from W→tb-bar, Z→tt-bar, and tt-bar hadroproduction, with t→μνb decay. We investigate selective cuts to reject backgrounds from bb-bar, cc-bar, and cs-bar production and to identify the t-quark events. For example, from a data sample containing 50 W +- →e +- ν events, we expect that clean samples of approximately 4 tb-bar-(or t-barb-) and conservatively 4 tt-bar-initiated μ +- +jets events can be selected for a t-quark mass below 45 GeV. We suggest methods for distinguishing the contributions and for determining m/sub t/

  17. Iterative Calibration: A Novel Approach for Calibrating the Molecular Clock Using Complex Geological Events.

    Science.gov (United States)

    Loeza-Quintana, Tzitziki; Adamowicz, Sarah J

    2018-02-01

    During the past 50 years, the molecular clock has become one of the main tools for providing a time scale for the history of life. In the era of robust molecular evolutionary analysis, clock calibration is still one of the most basic steps needing attention. When fossil records are limited, well-dated geological events are the main resource for calibration. However, biogeographic calibrations have often been used in a simplistic manner, for example assuming simultaneous vicariant divergence of multiple sister lineages. Here, we propose a novel iterative calibration approach to define the most appropriate calibration date by seeking congruence between the dates assigned to multiple allopatric divergences and the geological history. Exploring patterns of molecular divergence in 16 trans-Bering sister clades of echinoderms, we demonstrate that the iterative calibration is predominantly advantageous when using complex geological or climatological events-such as the opening/reclosure of the Bering Strait-providing a powerful tool for clock dating that can be applied to other biogeographic calibration systems and further taxa. Using Bayesian analysis, we observed that evolutionary rate variability in the COI-5P gene is generally distributed in a clock-like fashion for Northern echinoderms. The results reveal a large range of genetic divergences, consistent with multiple pulses of trans-Bering migrations. A resulting rate of 2.8% pairwise Kimura-2-parameter sequence divergence per million years is suggested for the COI-5P gene in Northern echinoderms. Given that molecular rates may vary across latitudes and taxa, this study provides a new context for dating the evolutionary history of Arctic marine life.

  18. Novel molecular events associated with altered steroidogenesis induced by exposure to atrazine in the intact and castrate male rat

    Science.gov (United States)

    Toxicology is increasingly focused on molecular events comprising adverse outcome pathways. Atrazine activates the hypothalamic-pituitary adrenal axis, but relationships to gonadal alterations are unknown. We characterized hormone profiles and adrenal (intact and castrate) and te...

  19. Identifying Population Vulnerable to Extreme Heat Events in San Jose, California.

    Science.gov (United States)

    Rivera, A. L.

    2016-12-01

    The extreme heat days not only make cities less comfortable for living but also they are associated with increased morbidity and mortality. Mapping studies have demonstrated spatial variability in heat vulnerability. A study conducted between 2000 and 2011 in New York City shows that deaths during heat waves was more likely to occur in black individuals, at home in census tracts which received greater public assistance. This map project intends to portray areas in San Jose California that are vulnerable to extreme heat events. The variables considered to build a vulnerability index are: land surface temperature, vegetated areas (NDVI), and people exposed to these area (population density).

  20. Quantitative proteomics identify molecular targets that are crucial in larval settlement and metamorphosis of bugula neritina

    KAUST Repository

    Zhang, Huoming

    2011-01-07

    The marine invertebrate Bugula neritina has a biphasic life cycle that consists of a swimming larval stage and a sessile juvenile and adult stage. The attachment of larvae to the substratum and their subsequent metamorphosis have crucial ecological consequences. Despite many studies on this species, little is known about the molecular mechanism of these processes. Here, we report a comparative study of swimming larvae and metamorphosing individuals at 4 and 24 h postattachment using label-free quantitative proteomics. We identified more than 1100 proteins at each stage, 61 of which were differentially expressed. Specifically, proteins involved in energy metabolism and structural molecules were generally down-regulated, whereas proteins involved in transcription and translation, the extracellular matrix, and calcification were strongly up-regulated during metamorphosis. Many tightly regulated novel proteins were also identified. Subsequent analysis of the temporal and spatial expressions of some of the proteins and an assay of their functions indicated that they may have key roles in metamorphosis of B. neritina. These findings not only provide molecular evidence with which to elucidate the substantial changes in morphology and physiology that occur during larval attachment and metamorphosis but also identify potential targets for antifouling treatment. © 2011 American Chemical Society.

  1. Identifying molecular subtypes in human colon cancer using gene expression and DNA methylation microarray data.

    Science.gov (United States)

    Ren, Zhonglu; Wang, Wenhui; Li, Jinming

    2016-02-01

    Identifying colon cancer subtypes based on molecular signatures may allow for a more rational, patient-specific approach to therapy in the future. Classifications using gene expression data have been attempted before with little concordance between the different studies carried out. In this study we aimed to uncover subtypes of colon cancer that have distinct biological characteristics and identify a set of novel biomarkers which could best reflect the clinical and/or biological characteristics of each subtype. Clustering analysis and discriminant analysis were utilized to discover the subtypes in two different molecular levels on 153 colon cancer samples from The Cancer Genome Atlas (TCGA) Data Portal. At gene expression level, we identified two major subtypes, ECL1 (expression cluster 1) and ECL2 (expression cluster 2) and a list of signature genes. Due to the heterogeneity of colon cancer, the subtype ECL1 can be further subdivided into three nested subclasses, and HOTAIR were found upregulated in subclass 2. At DNA methylation level, we uncovered three major subtypes, MCL1 (methylation cluster 1), MCL2 (methylation cluster 2) and MCL3 (methylation cluster 3). We found only three subtypes of CpG island methylator phenotype (CIMP) in colon cancer instead of the four subtypes in the previous reports, and we found no sufficient evidence to subdivide MCL3 into two distinct subgroups.

  2. Energetic atomic and molecular ions of ionospheric origin observed in distant magnetotail flow-reversal events

    Science.gov (United States)

    Christon, S. P.; Gloeckler, G.; Williams, D. J.; Mukai, T.; Mcentire, R. W.; Jacquey, C.; Angelopoulos, V.; Lui, A. T. Y.; Kokubun, S.; Fairfield, D. H.

    1994-01-01

    Energetic atomic (O(+1) and N(+1)) and molecular (O2(+1), NO(+1), and N2(+1)) ions of ionospheric origin were observed in Earth's magnetotail at X approximately -146 R(sub E) during two plasma sheet sunward/tailward flow-reversal events measured by instruments on the GEOTAIL spacecraft. These events were associated with concurrent ground-measured geomagnetic disturbance intensification at auroral-and mid-latitudes (Kp = 7(-)). Energetic ions in the sunward-component and tailward flows were from both the solar wind and ionosphere. Plasma and energetic ions participated in the flows. During tailward flow, ionospheric origin ion abundance ratios at approximately 200-900 km/s in the rest frame were N(+1)/O(+1) = approximately 25-30% and ((O2(+1), NO(+1), and N2(+1))/O(+1) = approximately 1-2%. We argue that tailward flow most likely initiated approximately 80-100 R(sub E) tailward of Earth and molecular ions were in the plasma sheet prior to geomagnetic intensification onset.

  3. Insights into the Molecular Events That Regulate Heat-Induced Chilling Tolerance in Citrus Fruits.

    Science.gov (United States)

    Lafuente, María T; Establés-Ortíz, Beatriz; González-Candelas, Luis

    2017-01-01

    Low non-freezing temperature may cause chilling injury (CI), which is responsible for external quality deterioration in many chilling-sensitive horticultural crops. Exposure of chilling-sensitive citrus cultivars to non-lethal high-temperature conditioning may increase their chilling tolerance. Very little information is available about the molecular events involved in such tolerance. In this work, the molecular events associated with the low temperature tolerance induced by heating Fortune mandarin, which is very sensitive to chilling, for 3 days at 37°C prior to cold storage is presented. A transcriptomic analysis reveals that heat-conditioning has an important impact favoring the repression of genes in cold-stored fruit, and that long-term heat-induced chilling tolerance is an active process that requires activation of transcription factors involved in transcription initiation and of the WRKY family. The analysis also shows that chilling favors degradation processes, which affect lipids and proteins, and that the protective effect of the heat-conditioning treatment is more likely to be related to the repression of the genes involved in lipid degradation than to the modification of fatty acids unsaturation, which affects membrane permeability. Another major factor associated with the beneficial effect of the heat treatment on reducing CI is the regulation of stress-related proteins. Many of the genes that encoded such proteins are involved in secondary metabolism and in oxidative stress-related processes.

  4. Insights into the Molecular Events That Regulate Heat-Induced Chilling Tolerance in Citrus Fruits

    Directory of Open Access Journals (Sweden)

    María T. Lafuente

    2017-06-01

    Full Text Available Low non-freezing temperature may cause chilling injury (CI, which is responsible for external quality deterioration in many chilling-sensitive horticultural crops. Exposure of chilling-sensitive citrus cultivars to non-lethal high-temperature conditioning may increase their chilling tolerance. Very little information is available about the molecular events involved in such tolerance. In this work, the molecular events associated with the low temperature tolerance induced by heating Fortune mandarin, which is very sensitive to chilling, for 3 days at 37°C prior to cold storage is presented. A transcriptomic analysis reveals that heat-conditioning has an important impact favoring the repression of genes in cold-stored fruit, and that long-term heat-induced chilling tolerance is an active process that requires activation of transcription factors involved in transcription initiation and of the WRKY family. The analysis also shows that chilling favors degradation processes, which affect lipids and proteins, and that the protective effect of the heat-conditioning treatment is more likely to be related to the repression of the genes involved in lipid degradation than to the modification of fatty acids unsaturation, which affects membrane permeability. Another major factor associated with the beneficial effect of the heat treatment on reducing CI is the regulation of stress-related proteins. Many of the genes that encoded such proteins are involved in secondary metabolism and in oxidative stress-related processes.

  5. Using molecular tools to identify the geographical origin of a case of human brucellosis.

    Science.gov (United States)

    Muchowski, J K; Koylass, M S; Dainty, A C; Stack, J A; Perrett, L; Whatmore, A M; Perrier, C; Chircop, S; Demicoli, N; Gatt, A B; Caruana, P A; Gopaul, K K

    2015-10-01

    Although Malta is historically linked with the zoonosis brucellosis, there had not been a case of the disease in either the human or livestock population for several years. However, in July 2013 a case of human brucellosis was identified on the island. To determine whether this recent case originated in Malta, four isolates from this case were subjected to molecular analysis. Molecular profiles generated using multilocus sequence analysis and multilocus variable number tandem repeat for the recent human case isolates and 11 Brucella melitensis strains of known Maltese origin were compared with others held on in-house and global databases. While the 11 isolates of Maltese origin formed a distinct cluster, the recent human isolation was not associated with these strains but instead clustered with isolates originating from the Horn of Africa. These data was congruent with epidemiological trace-back showed that the individual had travelled to Malta from Eritrea. This work highlights the potential of using molecular typing data to aid in epidemiological trace-back of Brucella isolations and assist in monitoring of the effectiveness of brucellosis control schemes.

  6. Identifying Weak Ties from Publicly Available Social Media Data in an Event

    DEFF Research Database (Denmark)

    Prakash Gupta, Jayesh; Menon, Karan; Kärkkäinen, Hannu

    2016-01-01

    The concept of weak ties was introduced by Granovetter through the seminal paper titled "Strength of weak ties". Since then the role of weak ties in general and their specific role as occupying the structural hole has been explored in many different fields. In this study, we identify actual or po...

  7. Molecular defects identified by whole exome sequencing in a child with Fanconi anemia.

    Science.gov (United States)

    Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua

    2013-11-10

    Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.

  8. Positive predictive value of a register-based algorithm using the Danish National Registries to identify suicidal events

    DEFF Research Database (Denmark)

    Gasse, Christiane; Danielsen, Andreas Aalkjaer; Pedersen, Marianne Giørtz

    2018-01-01

    events overall, by gender, age groups, and calendar time. RESULTS: We retrieved medical records for 357 (75%) people. The PPV of the DK-algorithm to identify suicidal events was 51.5% (95% CI: 46.4-56.7) overall, 42.7% (95% CI: 35.2-50.5) in males, and 58.5% (95% CI: 51.6-65.1) in females. The PPV varied...... further across age groups and calendar time. After excluding cases identified via the DK-algorithm by unspecific codes of intoxications and injury, the PPV improved slightly (56.8% [95% CI: 50.0-63.4]). CONCLUSIONS: The DK-algorithm can reliably identify self-harm with suicidal intention in 52......PURPOSE: It is not possible to fully assess intention of self-harm and suicidal events using information from administrative databases. We conducted a validation study of intention of suicide attempts/self-harm contacts identified by a commonly applied Danish register-based algorithm (DK...

  9. Identifying the null subject: evidence from event-related brain potentials.

    Science.gov (United States)

    Demestre, J; Meltzer, S; García-Albea, J E; Vigil, A

    1999-05-01

    Event-related brain potentials (ERPs) were recorded during spoken language comprehension to study the on-line effects of gender agreement violations in controlled infinitival complements. Spanish sentences were constructed in which the complement clause contained a predicate adjective marked for syntactic gender. By manipulating the gender of the antecedent (i.e., the controller) of the implicit subject while holding constant the gender of the adjective, pairs of grammatical and ungrammatical sentences were created. The detection of such a gender agreement violation would indicate that the parser had established the coreference relation between the null subject and its antecedent. The results showed a complex biphasic ERP (i.e., an early negativity with prominence at anterior and central sites, followed by a centroparietal positivity) in the violating condition as compared to the non-violating conditions. The brain reacts to NP-adjective gender agreement violations within a few hundred milliseconds of their occurrence. The data imply that the parser has properly coindexed the null subject of an infinitive clause with its antecedent.

  10. Comprehensive expression profiling of tumor cell lines identifies molecular signatures of melanoma progression.

    Directory of Open Access Journals (Sweden)

    Byungwoo Ryu

    2007-07-01

    Full Text Available Gene expression profiling has revolutionized our ability to molecularly classify primary human tumors and significantly enhanced the development of novel tumor markers and therapies; however, progress in the diagnosis and treatment of melanoma over the past 3 decades has been limited, and there is currently no approved therapy that significantly extends lifespan in patients with advanced disease. Profiling studies of melanoma to date have been inconsistent due to the heterogeneous nature of this malignancy and the limited availability of informative tissue specimens from early stages of disease.In order to gain an improved understanding of the molecular basis of melanoma progression, we have compared gene expression profiles from a series of melanoma cell lines representing discrete stages of malignant progression that recapitulate critical characteristics of the primary lesions from which they were derived. Here we describe the unsupervised hierarchical clustering of profiling data from melanoma cell lines and melanocytes. This clustering identifies two distinctive molecular subclasses of melanoma segregating aggressive metastatic tumor cell lines from less-aggressive primary tumor cell lines. Further analysis of expression signatures associated with melanoma progression using functional annotations categorized these transcripts into three classes of genes: 1 Upregulation of activators of cell cycle progression, DNA replication and repair (CDCA2, NCAPH, NCAPG, NCAPG2, PBK, NUSAP1, BIRC5, ESCO2, HELLS, MELK, GINS1, GINS4, RAD54L, TYMS, and DHFR, 2 Loss of genes associated with cellular adhesion and melanocyte differentiation (CDH3, CDH1, c-KIT, PAX3, CITED1/MSG-1, TYR, MELANA, MC1R, and OCA2, 3 Upregulation of genes associated with resistance to apoptosis (BIRC5/survivin. While these broad classes of transcripts have previously been implicated in the progression of melanoma and other malignancies, the specific genes identified within each class

  11. Using event related potentials to identify a user's behavioural intention aroused by product form design.

    Science.gov (United States)

    Ding, Yi; Guo, Fu; Zhang, Xuefeng; Qu, Qingxing; Liu, Weilin

    2016-07-01

    The capacity of product form to arouse user's behavioural intention plays a decisive role in further user experience, even in purchase decision, while traditional methods rarely give a fully understanding of user experience evoked by product form, especially the feeling of anticipated use of product. Behavioural intention aroused by product form designs has not yet been investigated electrophysiologically. Hence event related potentials (ERPs) were applied to explore the process of behavioural intention when users browsed different smart phone form designs with brand and price not taken into account for mainly studying the brain activity evoked by variety of product forms. Smart phone pictures with different anticipated user experience were displayed with equiprobability randomly. Participants were asked to click the left mouse button when certain picture gave them a feeling of behavioural intention to interact with. The brain signal of each participant was recorded by Curry 7.0. The results show that pictures with an ability to arouse participants' behavioural intention for further experience can evoke enhanced N300 and LPPs (late positive potentials) in central-parietal, parietal and occipital regions. The scalp topography shows that central-parietal, parietal and occipital regions are more activated. The results indicate that the discrepancy of ERPs can reflect the neural activities of behavioural intention formed or not. Moreover, amplitude of ERPs occurred in corresponding brain areas can be used to measure user experience. The exploring of neural correlated with behavioural intention provide an accurate measurement method of user's perception and help marketers to know which product can arouse users' behavioural intention, maybe taken as an evaluating indicator of product design. Copyright © 2016 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  12. Clustering of transcriptional profiles identifies changes to insulin signaling as an early event in a mouse model of Alzheimer's disease.

    Science.gov (United States)

    Jackson, Harriet M; Soto, Ileana; Graham, Leah C; Carter, Gregory W; Howell, Gareth R

    2013-11-25

    Alzheimer's disease affects more than 35 million people worldwide but there is no known cure. Age is the strongest risk factor for Alzheimer's disease but it is not clear how age-related changes impact the disease. Here, we used a mouse model of Alzheimer's disease to identify age-specific changes that occur prior to and at the onset of traditional Alzheimer-related phenotypes including amyloid plaque formation. To identify these early events we used transcriptional profiling of mouse brains combined with computational approaches including singular value decomposition and hierarchical clustering. Our study identifies three key events in early stages of Alzheimer's disease. First, the most important drivers of Alzheimer's disease onset in these mice are age-specific changes. These include perturbations of the ribosome and oxidative phosphorylation pathways. Second, the earliest detectable disease-specific changes occur to genes commonly associated with the hypothalamic-adrenal-pituitary (HPA) axis. These include the down-regulation of genes relating to metabolism, depression and appetite. Finally, insulin signaling, in particular the down-regulation of the insulin receptor substrate 4 (Irs4) gene, may be an important event in the transition from age-related changes to Alzheimer's disease specific-changes. A combination of transcriptional profiling combined with computational analyses has uncovered novel features relevant to Alzheimer's disease in a widely used mouse model and offers avenues for further exploration into early stages of AD.

  13. A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Lisa Sanguinetti

    Full Text Available Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

  14. Dissecting molecular stress networks: identifying nodes of divergence between life-history phenotypes.

    Science.gov (United States)

    Schwartz, Tonia S; Bronikowski, Anne M

    2013-02-01

    The complex molecular network that underlies physiological stress response is comprised of nodes (proteins, metabolites, mRNAs, etc.) whose connections span cells, tissues and organs. Variable nodes are points in the network upon which natural selection may act. Thus, identifying variable nodes will reveal how this molecular stress network may evolve among populations in different habitats and how it might impact life-history evolution. Here, we use physiological and genetic assays to test whether laboratory-born juveniles from natural populations of garter snakes (Thamnophis elegans), which have diverged in their life-history phenotypes, vary concomitantly at candidate nodes of the stress response network, (i) under unstressed conditions and (ii) in response to an induced stress. We found that two common measures of stress (plasma corticosterone and liver gene expression of heat shock proteins) increased under stress in both life-history phenotypes. In contrast, the phenotypes diverged at four nodes both under unstressed conditions and in response to stress: circulating levels of reactive oxygen species (superoxide, H(2)O(2)); liver gene expression of GPX1 and erythrocyte DNA damage. Additionally, allele frequencies for SOD2 diverge from neutral markers, suggesting diversifying selection on SOD2 alleles. This study supports the hypothesis that these life-history phenotypes have diverged at the molecular level in how they respond to stress, particularly in nodes regulating oxidative stress. Furthermore, the differences between the life-history phenotypes were more pronounced in females. We discuss the responses to stress in the context of the associated life-history phenotype and the evolutionary pressures thought to be responsible for divergence between the phenotypes. © 2012 Blackwell Publishing Ltd.

  15. Gene expression analysis to identify molecular correlates of pre- and post-conditioning derived neuroprotection.

    Science.gov (United States)

    Prasad, Shiv S; Russell, Marsha; Nowakowska, Margeryta; Williams, Andrew; Yauk, Carole

    2012-06-01

    Mild ischaemic exposures before or after severe injurious ischaemia that elicit neuroprotective responses are referred to as preconditioning and post-conditioning. The corresponding molecular mechanisms of neuroprotection are not completely understood. Identification of the genes and associated pathways of corresponding neuroprotection would provide insight into neuronal survival, potential therapeutic approaches and assessments of therapies for stroke. The objectives of this study were to use global gene expression approach to infer the molecular mechanisms in pre- and post-conditioning-derived neuroprotection in cortical neurons following oxygen and glucose deprivation (OGD) in vitro and then to apply these findings to predict corresponding functional pathways. To this end, microarray analysis was applied to rat cortical neurons with or without the pre- and post-conditioning treatments at 3-h post-reperfusion, and differentially expressed transcripts were subjected to statistical, hierarchical clustering and pathway analyses. The expression patterns of 3,431 genes altered under all conditions of ischaemia (with and without pre- or post-conditioning). We identified 1,595 genes that were commonly regulated within both the pre- and post-conditioning treatments. Cluster analysis revealed that transcription profiles clustered tightly within controls, non-conditioned OGD and neuroprotected groups. Two clusters defining neuroprotective conditions associated with up- and downregulated genes were evident. The five most upregulated genes within the neuroprotective clusters were Tagln, Nes, Ptrf, Vim and Adamts9, and the five most downregulated genes were Slc7a3, Bex1, Brunol4, Nrxn3 and Cpne4. Pathway analysis revealed that the intracellular and second messenger signalling pathways in addition to cell death were predominantly associated with downregulated pre- and post-conditioning associated genes, suggesting that modulation of cell death and signal transduction pathways

  16. Events

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2016-02-01

    Full Text Available The 9th ARRCN Symposium 2015 was held during 21st–25th October 2015 at the Novotel Hotel, Chumphon, Thailand, one of the most favored travel destinations in Asia. The 10th ARRCN Symposium 2017 will be held during October 2017 in the Davao, Philippines. International Symposium on the Montagu's Harrier (Circus pygargus «The Montagu's Harrier in Europe. Status. Threats. Protection», organized by the environmental organization «Landesbund für Vogelschutz in Bayern e.V.» (LBV was held on November 20-22, 2015 in Germany. The location of this event was the city of Wurzburg in Bavaria.

  17. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    International Nuclear Information System (INIS)

    Bukkuru, S.; Bhardwaj, U.; Warrier, M.; Rao, A.D.P.; Valsakumar, M.C.

    2017-01-01

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values “r” to the lattice constant “a” lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods. - Highlights: • Max-Space Clustering (MSC) method is developed to identify interstitials in crystals. • MSC provides a structured way to identify the temperature dependent cut-off radius. • It is compared with widely used sphere methods and found to be better. • MSC coupled with graph tree optimization can be used to obtain diffusion trajectory. • Cascade simulations of Fe, W are carried out and results are compared with various methods.

  18. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Bukkuru, S., E-mail: srinivasaraobukkuru@gmail.com [Dept. of Nuclear Physics, Andhra University, Visakhapatnam 530003 (India); Bhardwaj, U., E-mail: haptork@gmail.com [Computational Analysis Division, BARC, Visakhapatnam 530012, Andhra Pradesh (India); Warrier, M., E-mail: manoj.warrier@gmail.com [Computational Analysis Division, BARC, Visakhapatnam 530012, Andhra Pradesh (India); Rao, A.D.P., E-mail: adp_rao_99@yahoo.com [Dept. of Nuclear Physics, Andhra University, Visakhapatnam 530003 (India); Valsakumar, M.C., E-mail: mc.valsakumar@gmail.com [IIT Palakkad, Kozhippara P.O., Palakkad 678557, Kerala (India)

    2017-02-15

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values “r” to the lattice constant “a” lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods. - Highlights: • Max-Space Clustering (MSC) method is developed to identify interstitials in crystals. • MSC provides a structured way to identify the temperature dependent cut-off radius. • It is compared with widely used sphere methods and found to be better. • MSC coupled with graph tree optimization can be used to obtain diffusion trajectory. • Cascade simulations of Fe, W are carried out and results are compared with various methods.

  19. Duodenoscope-Related Outbreak of a Carbapenem-Resistant Klebsiella pneumoniae Identified Using Advanced Molecular Diagnostics.

    Science.gov (United States)

    Humphries, Romney M; Yang, Shuan; Kim, Stephen; Muthusamy, Venkatara Raman; Russell, Dana; Trout, Alisa M; Zaroda, Teresa; Cheng, Quen J; Aldrovandi, Grace; Uslan, Daniel Zachary; Hemarajata, Peera; Rubin, Zachary Aaron

    2017-10-01

    Carbapenem-resistant Klebsiella pneumoniae infections are increasingly prevalent in North American hospitals. We describe an outbreak of carbapenem-resistant K. pneumoniae containing the blaOXA-232 gene transmitted by contaminated duodenoscopes during endoscopic retrograde cholangiopancreatography (ERCP) procedures. An outbreak investigation was performed when 9 patients with blaOXA-232 carbapenem-resistant K. pneumoniae infections were identified at a tertiary care hospital. The investigation included 2 case-control studies, review of duodenoscope reprocessing procedures, and culture of devices. Carbapenem-resistant Enterobacteriacieae (CRE) isolates were evaluated with polymerase chain reaction analysis for carbapenemase genes, and isolates with the blaOXA-232 gene were subjected to whole-genome sequencing and chromosome single-nucleotide polymorphism analysis. On recognition of ERCP as a key risk factor for infection, targeted patient notification and CRE screening cultures were performed. Molecular testing ultimately identified 17 patients with blaOxa-232 carbapenem-resistant K. pneumoniae isolates, including 9 with infections, 7 asymptomatic carriers who had undergone ERCP, and 1 additional patient who had been hospitalized in India and was probably the initial carrier. Two case-control studies established a point-source outbreak associated with 2 specific duodenoscopes. A field investigation of the use, reprocessing, and storage of deuodenoscopes did not identify deviations from US Food and Drug Administration or manufacturer recommendations for reprocessing. This outbreak demonstrated the previously underappreciated potential for duodenoscopes to transmit disease, even after undergoing high-level disinfection according to manufacturers' guidelines.

  20. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    Science.gov (United States)

    Bukkuru, S.; Bhardwaj, U.; Warrier, M.; Rao, A. D. P.; Valsakumar, M. C.

    2017-02-01

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values "r" to the lattice constant "a" lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods.

  1. A new index for identifying socioeconomic drought events under climate change over the East River basin in China

    Science.gov (United States)

    Shi, H.; Chen, J.; Wang, K.; Niu, J.

    2017-12-01

    Drought, which means severe water deficiencies, is a complex natural hazard that may have destructive damages on societal properties and lives. Generally, socioeconomic drought occurs when the water resources systems cannot meet the water demands due to a weather-related shortfall in water supply to societies. This paper aims to propose a new index (i.e., socioeconomic drought index (SEDI)) for identifying socioeconomic drought events on different levels (i.e., slight, moderate, severe and extreme) under climate change through considering the gap between water supply and demand. First, the minimum in-stream water requirement (MWR) is determined through comprehensively considering the requirements of water quality, ecology, navigation and water supply. Second, according to the monthly water deficit calculated as the monthly streamflow data minus the MWR, drought month can be identified. Third, according to the cumulative water deficit derived from the monthly water deficit, drought duration (i.e., the number of continuous drought months) can be detected. Fourth, the SEDI of each socioeconomic drought event can be calculated through integrating the impacts of the cumulative water deficit and drought duration. The study area is the East River basin in South China, and the impact of a multi-year reservoir (i.e., the Xinfengjiang Reservoir) on drought is also analyzed. For historical and future drought analysis, it is concluded that the proposed SEDI is feasible to identify socioeconomic drought events. The results show that a number of socioeconomic drought events (including some extreme ones) may occur during 2020-2099, and the appropriate reservoir operation can significantly ease such situation.

  2. A mouse model of alcoholic liver fibrosis-associated acute kidney injury identifies key molecular pathways

    International Nuclear Information System (INIS)

    Furuya, Shinji; Chappell, Grace A.; Iwata, Yasuhiro; Uehara, Takeki; Kato, Yuki; Kono, Hiroshi; Bataller, Ramon; Rusyn, Ivan

    2016-01-01

    Clinical data strongly indicate that acute kidney injury (AKI) is a critical complication in alcoholic hepatitis, an acute-on-chronic form of liver failure in patients with advanced alcoholic fibrosis. Development of targeted therapies for AKI in this setting is hampered by the lack of an animal model. To enable research into molecular drivers and novel therapies for fibrosis- and alcohol-associated AKI, we aimed to combine carbon tetrachloride (CCl 4 )-induced fibrosis with chronic intra-gastric alcohol feeding. Male C57BL/6J mice were administered a low dose of CCl 4 (0.2 ml/kg 2 × week/6 weeks) followed by alcohol intragastrically (up to 25 g/kg/day for 3 weeks) and with continued CCl 4 . We observed that combined treatment with CCl 4 and alcohol resulted in severe liver injury, more pronounced than using each treatment alone. Importantly, severe kidney injury was evident only in the combined treatment group. This mouse model reproduced distinct pathological features consistent with AKI in human alcoholic hepatitis. Transcriptomic analysis of kidneys revealed profound effects in the combined treatment group, with enrichment for damage-associated pathways, such as apoptosis, inflammation, immune-response and hypoxia. Interestingly, Havcr1 and Lcn2, biomarkers of AKI, were markedly up-regulated. Overall, this study established a novel mouse model of fibrosis- and alcohol-associated AKI and identified key mechanistic pathways. - Highlights: • Acute kidney injury (AKI) is a critical complication in alcoholic hepatitis • We developed a novel mouse model of fibrosis- and alcohol-associated AKI • This model reproduces key molecular and pathological features of human AKI • This animal model can help identify new targeted therapies for alcoholic hepatitis

  3. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers.

    Science.gov (United States)

    Taïbi, Khaled; Del Campo, Antonio D; Vilagrosa, Alberto; Bellés, José M; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J; López-Nicolás, José M; Mulet, José M

    2017-01-01

    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of predicting the ability of formerly uncharacterized seedlings to cope with drought stress. Gas-exchange, water potential, photosynthetic pigments, soluble sugars, free amino acids, glutathione and proteomic analyses were carried out on control and drought-stressed seedlings in greenhouse conditions. Gas-exchange determinations were also assessed in field-planted seedlings in order to validate the greenhouse experimental conditions. Drought-tolerant seed sources presented higher values of photosynthetic rates, water use efficiency, photosynthetic pigments and soluble carbohydrates concentrations. We observed the same pattern of variation of photosynthesis rate and maximal efficiency of PSII in field. Interestingly drought-tolerant seed sources exhibited increased levels of glutathione, methionine and cysteine. The proteomic profile of drought tolerant seedlings identified two heat shock proteins and an enzyme related to methionine biosynthesis that were not present in drought sensitive seedlings, pointing to the synthesis of sulfur amino acids as a limiting factor for drought tolerance in Pinus halepensis . Our results established physiological and molecular traits useful as distinctive markers to predict drought tolerance in Pinus halepensis provenances that could be reliably used in reforestation programs in drought prone areas.

  4. A mouse model of alcoholic liver fibrosis-associated acute kidney injury identifies key molecular pathways

    Energy Technology Data Exchange (ETDEWEB)

    Furuya, Shinji; Chappell, Grace A.; Iwata, Yasuhiro [Department of Veterinary Integrative Biosciences, Texas A& M University, College Station, TX (United States); Uehara, Takeki; Kato, Yuki [Laboratory of Veterinary Pathology, Osaka Prefecture University, Osaka (Japan); Kono, Hiroshi [First Department of Surgery, University of Yamanashi, Yamanashi (Japan); Bataller, Ramon [Division of Gastroenterology & Hepatology, Department of Medicine, University of North Carolina, Chapel Hill, NC (United States); Rusyn, Ivan, E-mail: irusyn@tamu.edu [Department of Veterinary Integrative Biosciences, Texas A& M University, College Station, TX (United States)

    2016-11-01

    Clinical data strongly indicate that acute kidney injury (AKI) is a critical complication in alcoholic hepatitis, an acute-on-chronic form of liver failure in patients with advanced alcoholic fibrosis. Development of targeted therapies for AKI in this setting is hampered by the lack of an animal model. To enable research into molecular drivers and novel therapies for fibrosis- and alcohol-associated AKI, we aimed to combine carbon tetrachloride (CCl{sub 4})-induced fibrosis with chronic intra-gastric alcohol feeding. Male C57BL/6J mice were administered a low dose of CCl{sub 4} (0.2 ml/kg 2 × week/6 weeks) followed by alcohol intragastrically (up to 25 g/kg/day for 3 weeks) and with continued CCl{sub 4}. We observed that combined treatment with CCl{sub 4} and alcohol resulted in severe liver injury, more pronounced than using each treatment alone. Importantly, severe kidney injury was evident only in the combined treatment group. This mouse model reproduced distinct pathological features consistent with AKI in human alcoholic hepatitis. Transcriptomic analysis of kidneys revealed profound effects in the combined treatment group, with enrichment for damage-associated pathways, such as apoptosis, inflammation, immune-response and hypoxia. Interestingly, Havcr1 and Lcn2, biomarkers of AKI, were markedly up-regulated. Overall, this study established a novel mouse model of fibrosis- and alcohol-associated AKI and identified key mechanistic pathways. - Highlights: • Acute kidney injury (AKI) is a critical complication in alcoholic hepatitis • We developed a novel mouse model of fibrosis- and alcohol-associated AKI • This model reproduces key molecular and pathological features of human AKI • This animal model can help identify new targeted therapies for alcoholic hepatitis.

  5. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers

    Directory of Open Access Journals (Sweden)

    Khaled Taïbi

    2017-07-01

    Full Text Available Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of predicting the ability of formerly uncharacterized seedlings to cope with drought stress. Gas-exchange, water potential, photosynthetic pigments, soluble sugars, free amino acids, glutathione and proteomic analyses were carried out on control and drought-stressed seedlings in greenhouse conditions. Gas-exchange determinations were also assessed in field-planted seedlings in order to validate the greenhouse experimental conditions. Drought-tolerant seed sources presented higher values of photosynthetic rates, water use efficiency, photosynthetic pigments and soluble carbohydrates concentrations. We observed the same pattern of variation of photosynthesis rate and maximal efficiency of PSII in field. Interestingly drought-tolerant seed sources exhibited increased levels of glutathione, methionine and cysteine. The proteomic profile of drought tolerant seedlings identified two heat shock proteins and an enzyme related to methionine biosynthesis that were not present in drought sensitive seedlings, pointing to the synthesis of sulfur amino acids as a limiting factor for drought tolerance in Pinus halepensis. Our results established physiological and molecular traits useful as distinctive markers to predict drought tolerance in Pinus halepensis provenances that could be reliably used in reforestation programs in drought prone areas.

  6. Ab initio molecular dynamics simulations of low energy recoil events in MgO

    International Nuclear Information System (INIS)

    Petersen, B. A.; Liu, B.; Weber, W. J.; Oak Ridge National Laboratory; Zhang, Y.; Oak Ridge National Laboratory

    2017-01-01

    In this paper, low-energy recoil events in MgO are studied using ab initio molecular dynamics simulations to reveal the dynamic displacement processes and final defect configurations. Threshold displacement energies, E_d, are obtained for Mg and O along three low-index crystallographic directions, [100], [110], and [111]. The minimum values for E_d are found along the [110] direction consisting of the same element, either Mg or O atoms. Minimum threshold values of 29.5 eV for Mg and 25.5 eV for O, respectively, are suggested from the calculations. For other directions, the threshold energies are considerably higher, 65.5 and 150.0 eV for O along [111] and [100], and 122.5 eV for Mg along both [111] and [100] directions, respectively. These results show that the recoil events in MgO are partial-charge transfer assisted processes where the charge transfer plays an important role. Finally, there is a similar trend found in other oxide materials, where the threshold displacement energy correlates linearly with the peak partial-charge transfer, suggesting this behavior might be universal in ceramic oxides.

  7. Cellular and molecular events leading to the development of skin cancer

    International Nuclear Information System (INIS)

    Melnikova, Vladislava O.; Ananthaswamy, Honnavara N.

    2005-01-01

    The transition from a normal cell to a neoplastic cell is a complex process and involves both genetic and epigenetic changes. The process of carcinogenesis begins when the DNA is damaged, which then leads to a cascade of events leading to the development of a tumor. Ultraviolet (UV) radiation causes DNA damage, inflammation, erythema, sunburn, immunosuppression, photoaging, gene mutations, and skin cancer. Upon DNA damage, the p53 tumor suppressor protein undergoes phosphorylation and translocation to the nucleus and aids in DNA repair or causes apoptosis. Excessive UV exposure overwhelms DNA repair mechanisms leading to induction of p53 mutations and loss of Fas-FasL interaction. Keratinocytes carrying p53 mutations acquire a growth advantage by virtue of their increased resistance to apoptosis. Thus, resistance to cell death is a key event in photocarcinogenesis and conversely, elimination of cells containing excessive UV-induced DNA damage is a key step in protecting against skin cancer development. Apoptosis-resistant keratinocytes undergo clonal expansion that eventually leads to formation of actinic keratoses and squamous cell carcinomas. In this article, we will review some of the cellular and molecular mechanisms involved in initiation and progression of UV-induced skin cancer

  8. Cellular and molecular events leading to the development of skin cancer

    Energy Technology Data Exchange (ETDEWEB)

    Melnikova, Vladislava O. [Department of Immunology, University of Texas M.D. Anderson Cancer Center, P.O. Box 301402, Unit 902, Houston, TX 77030 (United States); Ananthaswamy, Honnavara N. [Department of Immunology, University of Texas M.D. Anderson Cancer Center, P.O. Box 301402, Unit 902, Houston, TX 77030 (United States)]. E-mail: hanantha@mdanderson.org

    2005-04-01

    The transition from a normal cell to a neoplastic cell is a complex process and involves both genetic and epigenetic changes. The process of carcinogenesis begins when the DNA is damaged, which then leads to a cascade of events leading to the development of a tumor. Ultraviolet (UV) radiation causes DNA damage, inflammation, erythema, sunburn, immunosuppression, photoaging, gene mutations, and skin cancer. Upon DNA damage, the p53 tumor suppressor protein undergoes phosphorylation and translocation to the nucleus and aids in DNA repair or causes apoptosis. Excessive UV exposure overwhelms DNA repair mechanisms leading to induction of p53 mutations and loss of Fas-FasL interaction. Keratinocytes carrying p53 mutations acquire a growth advantage by virtue of their increased resistance to apoptosis. Thus, resistance to cell death is a key event in photocarcinogenesis and conversely, elimination of cells containing excessive UV-induced DNA damage is a key step in protecting against skin cancer development. Apoptosis-resistant keratinocytes undergo clonal expansion that eventually leads to formation of actinic keratoses and squamous cell carcinomas. In this article, we will review some of the cellular and molecular mechanisms involved in initiation and progression of UV-induced skin cancer.

  9. An Event-Driven Hybrid Molecular Dynamics and Direct Simulation Monte Carlo Algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Donev, A; Garcia, A L; Alder, B J

    2007-07-30

    A novel algorithm is developed for the simulation of polymer chains suspended in a solvent. The polymers are represented as chains of hard spheres tethered by square wells and interact with the solvent particles with hard core potentials. The algorithm uses event-driven molecular dynamics (MD) for the simulation of the polymer chain and the interactions between the chain beads and the surrounding solvent particles. The interactions between the solvent particles themselves are not treated deterministically as in event-driven algorithms, rather, the momentum and energy exchange in the solvent is determined stochastically using the Direct Simulation Monte Carlo (DSMC) method. The coupling between the solvent and the solute is consistently represented at the particle level, however, unlike full MD simulations of both the solvent and the solute, the spatial structure of the solvent is ignored. The algorithm is described in detail and applied to the study of the dynamics of a polymer chain tethered to a hard wall subjected to uniform shear. The algorithm closely reproduces full MD simulations with two orders of magnitude greater efficiency. Results do not confirm the existence of periodic (cycling) motion of the polymer chain.

  10. Automatically Identifying Fusion Events between GLUT4 Storage Vesicles and the Plasma Membrane in TIRF Microscopy Image Sequences

    Directory of Open Access Journals (Sweden)

    Jian Wu

    2015-01-01

    Full Text Available Quantitative analysis of the dynamic behavior about membrane-bound secretory vesicles has proven to be important in biological research. This paper proposes a novel approach to automatically identify the elusive fusion events between VAMP2-pHluorin labeled GLUT4 storage vesicles (GSVs and the plasma membrane. The differentiation is implemented to detect the initiation of fusion events by modified forward subtraction of consecutive frames in the TIRFM image sequence. Spatially connected pixels in difference images brighter than a specified adaptive threshold are grouped into a distinct fusion spot. The vesicles are located at the intensity-weighted centroid of their fusion spots. To reveal the true in vivo nature of a fusion event, 2D Gaussian fitting for the fusion spot is used to derive the intensity-weighted centroid and the spot size during the fusion process. The fusion event and its termination can be determined according to the change of spot size. The method is evaluated on real experiment data with ground truth annotated by expert cell biologists. The evaluation results show that it can achieve relatively high accuracy comparing favorably to the manual analysis, yet at a small fraction of time.

  11. Diagnostic and molecular evaluation of three iridovirus-associated salamander mortality events

    Science.gov (United States)

    Docherty, D.E.; Meteyer, C.U.; Wang, Jingyuan; Mao, J.; Case, S.T.; Chinchar, V.G.

    2003-01-01

    In 1998 viruses were isolated from tiger salamander larvae (Ambystoma tigrinum diaboli and A. tigrinum melanostictum) involved in North Dakota and Utah (USA) mortality events and spotted salamander (A. maculatum) larvae in a third event in Maine (USA). Although sympatric caudates and anurans were present at all three sites only ambystomid larvae appeared to be affected. Mortality at the North Dakota site was in the thousands while at the Utah and Maine sites mortality was in the hundreds. Sick larvae were lethargic and slow moving. They swam in circles with obvious buoyancy problems and were unable to remain upright. On the ventral surface, near the gills and hind limbs, red spots or swollen areas were noted. Necropsy findings included: hemorrhages and ulceration of the skin, subcutaneous and intramuscular edema, swollen and pale livers with multifocal hemorrhage, and distended fluid-filled intestines with areas of hemorrhage. Light microscopy revealed intracytoplasmic inclusions, suggestive of a viral infection, in a variety of organs. Electron microscopy of ultra thin sections of the same tissues revealed iridovirus-like particles within the inclusions. These viruses were isolated from a variety of organs, indicating a systemic infection. Representative viral isolates from the three mortality events were characterized using molecular assays. Characterization confirmed that the viral isolates were iridoviruses and that the two tiger salamander isolates were similar and could be distinguished from the spotted salamander isolate. The spotted salamander isolate was similar to frog virus 3, the type species of the genus Ranavirus, while the tiger salamander isolates were not. These data indicate that different species of salamanders can become infected and die in association with different iridoviruses. Challenge assays are required to determine the fish and amphibian host range of these isolates and to assess the susceptibility of tiger and spotted salamanders to

  12. PASBio: predicate-argument structures for event extraction in molecular biology

    Science.gov (United States)

    Wattarujeekrit, Tuangthong; Shah, Parantu K; Collier, Nigel

    2004-01-01

    Background The exploitation of information extraction (IE), a technology aiming to provide instances of structured representations from free-form text, has been rapidly growing within the molecular biology (MB) research community to keep track of the latest results reported in literature. IE systems have traditionally used shallow syntactic patterns for matching facts in sentences but such approaches appear inadequate to achieve high accuracy in MB event extraction due to complex sentence structure. A consensus in the IE community is emerging on the necessity for exploiting deeper knowledge structures such as through the relations between a verb and its arguments shown by predicate-argument structure (PAS). PAS is of interest as structures typically correspond to events of interest and their participating entities. For this to be realized within IE a key knowledge component is the definition of PAS frames. PAS frames for non-technical domains such as newswire are already being constructed in several projects such as PropBank, VerbNet, and FrameNet. Knowledge from PAS should enable more accurate applications in several areas where sentence understanding is required like machine translation and text summarization. In this article, we explore the need to adapt PAS for the MB domain and specify PAS frames to support IE, as well as outlining the major issues that require consideration in their construction. Results We introduce PASBio by extending a model based on PropBank to the MB domain. The hypothesis we explore is that PAS holds the key for understanding relationships describing the roles of genes and gene products in mediating their biological functions. We chose predicates describing gene expression, molecular interactions and signal transduction events with the aim of covering a number of research areas in MB. Analysis was performed on sentences containing a set of verbal predicates from MEDLINE and full text journals. Results confirm the necessity to analyze

  13. Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

    Science.gov (United States)

    Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

    2007-10-01

    AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

  14. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers.

    Science.gov (United States)

    Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E M

    2016-10-08

    The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequencing, different barcodes can be inserted at each fragment end to either increase the number of multiplexed samples in the library or to use one of the barcodes as UMI. Alternatively, UMIs can be combined with the sample barcodes into composite barcodes, or with standard Illumina® indexing. Subsequent analysis must take read duplicates and sample identity into account, by identifying UMIs. Existing tools do not support these complex barcoding configurations and custom code development is frequently required. Here, we present Je, a suite of tools that accommodates complex barcoding strategies, extracts UMIs and filters read duplicates taking UMIs into account. Using Je on publicly available scRNA-seq and iCLIP data containing UMIs, the number of unique reads increased by up to 36 %, compared to when UMIs are ignored. Je is implemented in JAVA and uses the Picard API. Code, executables and documentation are freely available at http://gbcs.embl.de/Je . Je can also be easily installed in Galaxy through the Galaxy toolshed.

  15. Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing.

    Science.gov (United States)

    Hong, Jungeui; Gresham, David

    2017-11-01

    Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

  16. Molecular markers for identifying a new selected variety of Pacific white shrimp Litopenaeus vannamei

    Science.gov (United States)

    Yu, Yang; Zhang, Xiaojun; Liu, Jingwen; Li, Fuhua; Huang, Hao; Li, Yijun; Liu, Xiaolin; Xiang, Jianhai

    2015-01-01

    Selective breeding of the Pacific white shrimp Litopenaeus vannamei during the last decade has produced new varieties exhibiting high growth rates and disease resistance. However, the identification of new varieties of shrimps from their phenotypic characters is difficult. This study introduces a new approach for identifying varieties of shrimps using molecular markers of microsatellites and mitochondrial control region sequences. The method was employed to identify a new selected variety, Kehai No. 1 (KH-1), from three representative stocks (control group): Zhengda; Tongwei; and a stock collected from Fujian Province, which is now cultured in mainland China. By pooled genotyping of KH-1 and the control group, five microsatellites showing differences between KH-1 and the control group were screened out. Individual genotyping data confirmed the results from pooled genotyping. The genotyping data for the five microsatellites were applied to the assignment analysis of the KH-1 group and the control group using the partial Bayesian assignment method in GENECLASS2. By sequencing the mitochondrial control regions of individuals from the KH-1 and control group, four haplotypes were observed in the KH-1 group, whereas 14 haplotypes were obtained in the control group. By combining the microsatellite assignment analysis with mitochondrial control region analysis, the average accuracy of identification of individuals in the KH-1 group and control group reached 89%. The five selected microsatellite loci and mitochondrial control region sequences were highly polymorphic and could be used to distinguish new selected varieties of L. vannamei from other populations cultured in China.

  17. Molecular genetic studies in Saudi population; identified variants from GWAS and meta-analysis in stroke.

    Science.gov (United States)

    Alharbi, Khalid Khalaf; Ali Khan, Imran; Alotaibi, Mohammad Abdullah; Saud Aloyaid, Abdullah; Al-Basheer, Haifa Abdulaziz; Alghamdi, Naelah Abdullah; Al-Baradie, Raid Saleem; Al-Sulaiman, A M

    2018-01-01

    Stroke is a multifactorial and heterogeneous disorder, correlates with heritability and considered as one of the major diseases. The prior reports performed the variable models such as genome-wide association studies (GWAS), replication, case-control, cross-sectional and meta-analysis studies and still, we lack diagnostic marker in the global world. There are limited studies were carried out in Saudi population, and we aim to investigate the molecular association of single nucleotide polymorphisms (SNPs) identified through GWAS and meta-analysis studies in stroke patients in the Saudi population. In this case-control study, we have opted gender equality of 207 cases and 207 controls from the capital city of Saudi Arabia in King Saud University Hospital. The peripheral blood (5 ml) sample will be collected in two different vacutainers, and three mL of the coagulated blood will be used for lipid analysis (biochemical tests) and two mL will be used for DNA analysis (molecular tests). Genomic DNA will be extracted with the collected blood samples, and specific primers will be designed for the opted SNPs ( SORT1 -rs646218 and OLR1 -rs11053646 polymorphisms) and PCR-RFLP will be performed and randomly DNA sequencing will be carried out to cross check the results. The rs646218 and rs11053646 polymorphisms were significantly associated with allele, genotype and dominant models with and without crude odds ratios (OR's) and Multiple logistic regression analysis (p Saudi population. The current results were in the association with the prior study results documented through GWAS and meta-analysis association. However, other ethnic population studies should be performed to rule out in the human hereditary diseases.

  18. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia.

    Science.gov (United States)

    van Uitert, Miranda; Moerland, Perry D; Enquobahrie, Daniel A; Laivuori, Hannele; van der Post, Joris A M; Ris-Stalpers, Carrie; Afink, Gijs B

    2015-01-01

    Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia gene expression signature, we performed a meta-analysis on the original data of 11 placenta RNA microarray experiments, representing 139 normotensive and 116 preeclamptic pregnancies. Microarray data were pre-processed and analyzed using standardized bioinformatics and statistical procedures and the effect sizes were combined using an inverse-variance random-effects model. Interactions between genes in the resulting gene expression signature were identified by pathway analysis (Ingenuity Pathway Analysis, Gene Set Enrichment Analysis, Graphite) and protein-protein associations (STRING). This approach has resulted in a comprehensive list of differentially expressed genes that led to a 388-gene meta-signature of preeclamptic placenta. Pathway analysis highlights the involvement of the previously identified hypoxia/HIF1A pathway in the establishment of the preeclamptic gene expression profile, while analysis of protein interaction networks indicates CREBBP/EP300 as a novel element central to the preeclamptic placental transcriptome. In addition, there is an apparent high incidence of preeclampsia in women carrying a child with a mutation in CREBBP/EP300 (Rubinstein-Taybi Syndrome). The 388-gene preeclampsia meta-signature offers a vital starting point for further studies into the relevance of these genes (in particular CREBBP/EP300) and their concomitant pathways as biomarkers or functional molecules in preeclampsia. This will result in a better understanding of the molecular basis of this disease and opens up the opportunity to develop rational therapies targeting the placental dysfunction causal to preeclampsia.

  19. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia.

    Directory of Open Access Journals (Sweden)

    Miranda van Uitert

    Full Text Available Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia gene expression signature, we performed a meta-analysis on the original data of 11 placenta RNA microarray experiments, representing 139 normotensive and 116 preeclamptic pregnancies. Microarray data were pre-processed and analyzed using standardized bioinformatics and statistical procedures and the effect sizes were combined using an inverse-variance random-effects model. Interactions between genes in the resulting gene expression signature were identified by pathway analysis (Ingenuity Pathway Analysis, Gene Set Enrichment Analysis, Graphite and protein-protein associations (STRING. This approach has resulted in a comprehensive list of differentially expressed genes that led to a 388-gene meta-signature of preeclamptic placenta. Pathway analysis highlights the involvement of the previously identified hypoxia/HIF1A pathway in the establishment of the preeclamptic gene expression profile, while analysis of protein interaction networks indicates CREBBP/EP300 as a novel element central to the preeclamptic placental transcriptome. In addition, there is an apparent high incidence of preeclampsia in women carrying a child with a mutation in CREBBP/EP300 (Rubinstein-Taybi Syndrome. The 388-gene preeclampsia meta-signature offers a vital starting point for further studies into the relevance of these genes (in particular CREBBP/EP300 and their concomitant pathways as biomarkers or functional molecules in preeclampsia. This will result in a better understanding of the molecular basis of this disease and opens up the opportunity to develop rational therapies targeting the placental dysfunction causal to preeclampsia.

  20. Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy-

    Science.gov (United States)

    Ishitani, Y.

    2017-12-01

    Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.

  1. Nonlinear Methodologies for Identifying Seismic Event and Nuclear Explosion Using Random Forest, Support Vector Machine, and Naive Bayes Classification

    Directory of Open Access Journals (Sweden)

    Longjun Dong

    2014-01-01

    Full Text Available The discrimination of seismic event and nuclear explosion is a complex and nonlinear system. The nonlinear methodologies including Random Forests (RF, Support Vector Machines (SVM, and Naïve Bayes Classifier (NBC were applied to discriminant seismic events. Twenty earthquakes and twenty-seven explosions with nine ratios of the energies contained within predetermined “velocity windows” and calculated distance are used in discriminators. Based on the one out cross-validation, ROC curve, calculated accuracy of training and test samples, and discriminating performances of RF, SVM, and NBC were discussed and compared. The result of RF method clearly shows the best predictive power with a maximum area of 0.975 under the ROC among RF, SVM, and NBC. The discriminant accuracies of RF, SVM, and NBC for test samples are 92.86%, 85.71%, and 92.86%, respectively. It has been demonstrated that the presented RF model can not only identify seismic event automatically with high accuracy, but also can sort the discriminant indicators according to calculated values of weights.

  2. Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations.

    Science.gov (United States)

    Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J

    2014-07-01

    Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts

  3. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life

    Directory of Open Access Journals (Sweden)

    Reusch Thorsten BH

    2011-01-01

    Full Text Available Abstract Background Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L. Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. Results In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. Conclusions These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  4. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life.

    Science.gov (United States)

    Wissler, Lothar; Codoñer, Francisco M; Gu, Jenny; Reusch, Thorsten B H; Olsen, Jeanine L; Procaccini, Gabriele; Bornberg-Bauer, Erich

    2011-01-12

    Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs) of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L.) Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica) and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  5. Collapse of proteostasis represents an early molecular event in Caenorhabditis elegans aging.

    Science.gov (United States)

    Ben-Zvi, Anat; Miller, Elizabeth A; Morimoto, Richard I

    2009-09-01

    Protein damage contributes prominently to cellular aging. To address whether this occurs at a specific period during aging or accumulates gradually, we monitored the biochemical, cellular, and physiological properties of folding sensors expressed in different tissues of C. elegans. We observed the age-dependent misfolding and loss of function of diverse proteins harboring temperature-sensitive missense mutations in all somatic tissues at the permissive condition. This widespread failure in proteostasis occurs rapidly at an early stage of adulthood, and coincides with a severely reduced activation of the cytoprotective heat shock response and the unfolded protein response. Enhancing stress responsive factors HSF-1 or DAF-16 suppresses misfolding of these metastable folding sensors and restores the ability of the cell to maintain a functional proteome. This suggests that a compromise in the regulation of proteostatic stress responses occurs early in adulthood and tips the balance between the load of damaged proteins and the proteostasis machinery. We propose that the collapse of proteostasis represents an early molecular event of aging that amplifies protein damage in age-associated diseases of protein conformation.

  6. Evidence for nucleosynthetic enrichment of the protosolar molecular cloud core by multiple supernova events

    DEFF Research Database (Denmark)

    Schiller, Martin; Paton, Chad; Bizzarro, Martin

    2015-01-01

    The presence of isotope heterogeneity of nucleosynthetic origin amongst meteorites and their components provides a record of the diverse stars that contributed matter to the protosolar molecular cloud core. Understanding how and when the solar system's nucleosynthetic heterogeneity was established...... and preserved within the solar protoplanetary disk is critical for unraveling the earliest formative stages of the solar system. Here, we report calcium and magnesium isotope measurements of primitive and differentiated meteorites as well as various types of refractory inclusions, including refractory...... and differentiated meteorites along with canonical and FUN-CAIs define correlated, mass-independent variations in 43Ca, 46Ca and 48Ca. Moreover, sequential dissolution experiments of the Ivuna carbonaceous chondrite aimed at identifying the nature and number of presolar carriers of isotope anomalies within primitive...

  7. LUMINOSITY FUNCTIONS OF SPITZER-IDENTIFIED PROTOSTARS IN NINE NEARBY MOLECULAR CLOUDS

    Energy Technology Data Exchange (ETDEWEB)

    Kryukova, E.; Megeath, S. T.; Allen, T. S. [Department of Physics and Astronomy, University of Toledo, Toledo, OH (United States); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA (United States); Pipher, J. [Department of Physics and Astronomy, University of Rochester, Rochester, NY (United States); Allen, L. E. [National Optical Astronomy Observatories, Tucson, AZ (United States); Myers, P. C. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States); Muzerolle, J. [Space Telescope Science Institute, Baltimore, MD (United States)

    2012-08-15

    We identify protostars in Spitzer surveys of nine star-forming (SF) molecular clouds within 1 kpc: Serpens, Perseus, Ophiuchus, Chamaeleon, Lupus, Taurus, Orion, Cep OB3, and Mon R2, which combined host over 700 protostar candidates. These clouds encompass a variety of SF environments, including both low-mass and high-mass SF regions, as well as dense clusters and regions of sparsely distributed star formation. Our diverse cloud sample allows us to compare protostar luminosity functions in these varied environments. We combine near- and mid-infrared photometry from the Two Micron All Sky Survey and Spitzer to create 1-24 {mu}m spectral energy distributions (SEDs). Using protostars from the c2d survey with well-determined bolometric luminosities, we derive a relationship between bolometric luminosity, mid-IR luminosity (integrated from 1-24 {mu}m), and SED slope. Estimations of the bolometric luminosities for protostar candidates are combined to create luminosity functions for each cloud. Contamination due to edge-on disks, reddened Class II sources, and galaxies is estimated and removed from the luminosity functions. We find that luminosity functions for high-mass SF clouds (Orion, Mon R2, and Cep OB3) peak near 1 L{sub Sun} and show a tail extending toward luminosities above 100 L{sub Sun }. The luminosity functions of the low-mass SF clouds (Serpens, Perseus, Ophiuchus, Taurus, Lupus, and Chamaeleon) do not exhibit a common peak, however the combined luminosity function of these regions peaks below 1 L{sub Sun }. Finally, we examine the luminosity functions as a function of the local surface density of young stellar objects. In the Orion molecular clouds, we find a significant difference between the luminosity functions of protostars in regions of high and low stellar density, the former of which is biased toward more luminous sources. This may be the result of primordial mass segregation, although this interpretation is not unique. We compare our luminosity

  8. LUMINOSITY FUNCTIONS OF SPITZER-IDENTIFIED PROTOSTARS IN NINE NEARBY MOLECULAR CLOUDS

    International Nuclear Information System (INIS)

    Kryukova, E.; Megeath, S. T.; Allen, T. S.; Gutermuth, R. A.; Pipher, J.; Allen, L. E.; Myers, P. C.; Muzerolle, J.

    2012-01-01

    We identify protostars in Spitzer surveys of nine star-forming (SF) molecular clouds within 1 kpc: Serpens, Perseus, Ophiuchus, Chamaeleon, Lupus, Taurus, Orion, Cep OB3, and Mon R2, which combined host over 700 protostar candidates. These clouds encompass a variety of SF environments, including both low-mass and high-mass SF regions, as well as dense clusters and regions of sparsely distributed star formation. Our diverse cloud sample allows us to compare protostar luminosity functions in these varied environments. We combine near- and mid-infrared photometry from the Two Micron All Sky Survey and Spitzer to create 1-24 μm spectral energy distributions (SEDs). Using protostars from the c2d survey with well-determined bolometric luminosities, we derive a relationship between bolometric luminosity, mid-IR luminosity (integrated from 1-24 μm), and SED slope. Estimations of the bolometric luminosities for protostar candidates are combined to create luminosity functions for each cloud. Contamination due to edge-on disks, reddened Class II sources, and galaxies is estimated and removed from the luminosity functions. We find that luminosity functions for high-mass SF clouds (Orion, Mon R2, and Cep OB3) peak near 1 L ☉ and show a tail extending toward luminosities above 100 L ☉ . The luminosity functions of the low-mass SF clouds (Serpens, Perseus, Ophiuchus, Taurus, Lupus, and Chamaeleon) do not exhibit a common peak, however the combined luminosity function of these regions peaks below 1 L ☉ . Finally, we examine the luminosity functions as a function of the local surface density of young stellar objects. In the Orion molecular clouds, we find a significant difference between the luminosity functions of protostars in regions of high and low stellar density, the former of which is biased toward more luminous sources. This may be the result of primordial mass segregation, although this interpretation is not unique. We compare our luminosity functions to those

  9. Molecular evolution of rbcL in three gymnosperm families: identifying adaptive and coevolutionary patterns

    LENUS (Irish Health Repository)

    Sen, Lin

    2011-06-03

    Abstract Background The chloroplast-localized ribulose-1, 5-biphosphate carboxylase\\/oxygenase (Rubisco), the primary enzyme responsible for autotrophy, is instrumental in the continual adaptation of plants to variations in the concentrations of CO2. The large subunit (LSU) of Rubisco is encoded by the chloroplast rbcL gene. Although adaptive processes have been previously identified at this gene, characterizing the relationships between the mutational dynamics at the protein level may yield clues on the biological meaning of such adaptive processes. The role of such coevolutionary dynamics in the continual fine-tuning of RbcL remains obscure. Results We used the timescale and phylogenetic analyses to investigate and search for processes of adaptive evolution in rbcL gene in three gymnosperm families, namely Podocarpaceae, Taxaceae and Cephalotaxaceae. To understand the relationships between regions identified as having evolved under adaptive evolution, we performed coevolutionary analyses using the software CAPS. Importantly, adaptive processes were identified at amino acid sites located on the contact regions among the Rubisco subunits and on the interface between Rubisco and its activase. Adaptive amino acid replacements at these regions may have optimized the holoenzyme activity. This hypothesis was pinpointed by evidence originated from our analysis of coevolution that supported the correlated evolution between Rubisco and its activase. Interestingly, the correlated adaptive processes between both these proteins have paralleled the geological variation history of the concentration of atmospheric CO2. Conclusions The gene rbcL has experienced bursts of adaptations in response to the changing concentration of CO2 in the atmosphere. These adaptations have emerged as a result of a continuous dynamic of mutations, many of which may have involved innovation of functional Rubisco features. Analysis of the protein structure and the functional implications of such

  10. Comparative metatranscriptomics identifies molecular bases for the physiological responses of phytoplankton to varying iron availability.

    Science.gov (United States)

    Marchetti, Adrian; Schruth, David M; Durkin, Colleen A; Parker, Micaela S; Kodner, Robin B; Berthiaume, Chris T; Morales, Rhonda; Allen, Andrew E; Armbrust, E Virginia

    2012-02-07

    In vast expanses of the oceans, growth of large phytoplankton such as diatoms is limited by iron availability. Diatoms respond almost immediately to the delivery of iron and rapidly compose the majority of phytoplankton biomass. The molecular bases underlying the subsistence of diatoms in iron-poor waters and the plankton community dynamics that follow iron resupply remain largely unknown. Here we use comparative metatranscriptomics to identify changes in gene expression associated with iron-stimulated growth of diatoms and other eukaryotic plankton. A microcosm iron-enrichment experiment using mixed-layer waters from the northeastern Pacific Ocean resulted in increased proportions of diatom transcripts and reduced proportions of transcripts from most other taxa within 98 h after iron addition. Hundreds of diatom genes were differentially expressed in the iron-enriched community compared with the iron-limited community; transcripts of diatom genes required for synthesis of photosynthesis and chlorophyll components, nitrate assimilation and the urea cycle, and synthesis of carbohydrate storage compounds were significantly overrepresented. Transcripts of genes encoding rhodopsins in eukaryotic phytoplankton were significantly underrepresented following iron enrichment, suggesting rhodopsins help cells cope with low-iron conditions. Oceanic diatoms appear to display a distinctive transcriptional response to iron enrichment that allows chemical reduction of available nitrogen and carbon sources along with a continued dependence on iron-free photosynthetic proteins rather than substituting for iron-containing functional equivalents present within their gene repertoire. This ability of diatoms to divert their newly acquired iron toward nitrate assimilation may underlie why diatoms consistently dominate iron enrichments in high-nitrate, low-chlorophyll regions.

  11. Global mapping of protein phosphorylation events identifies novel signalling hubs mediating fatty acid starvation responses in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Pultz, Dennis; Bennetzen, Martin; Rødkær, Steven Vestergaard

    2011-01-01

    Dietary restriction (DR) extends the life span of multiple species, ranging from single-celled organisms like yeast to mammals. This increase in longevity by dietary restriction is coupled to profound beneficial effects on age-related pathology. Despite the number of studies on DR...... and the physiological changes DR induces, only little is known about the genetics and signalling networks, which regulate the DR response. We have recently shown that inhibition of fatty acid synthesis in Saccharomyces cerevisiae induces autophagy mediated by TORC1 signalling and affects life span. In the present study...... in a temporal manner in response to inhibition of fatty acid synthesis by cerulenin. By in silico analysis of these phosphorylation events, we have identified the major downstream regulated processes and signalling networks mediating the cellular response to fatty acid starvation. The analysis further...

  12. Signal transduction by FcεRI: Analysis of the early molecular events

    Directory of Open Access Journals (Sweden)

    Henry Metzger

    1999-01-01

    Full Text Available We are analysing the initial molecular events stimulated by the high-affinity receptor for IgE, FcεRI. Earlier studies have shown that the first response when the receptor-bound IgE interacts with a multivalent antigen is a transphosphorylation of receptor tyrosines, induced by the approximation of two or more receptors by a constitutively associated src-family kinase (Lyn. The amount of weakly associated kinase regulates the intensity of the response. Several aspects are being analyzed: (i the sites on Lyn and the receptor that account for the constitutive interaction; (ii how the intrinsic affinity of a ligand for the receptor-bound IgE influences the responses; and (iii the mechanism(s by which low-affinity ligands can act as antagonists. In the latter studies, mast cell responses were followed by monitoring the phosphorylation of tyrosines on several proteins and secretion. At equivalent levels of receptor phosphorylation, a ligand with high affinity stimulated vigorous phosphorylation of downstream components, whereas a low-affinity ligand was unable to stimulate phosphorylation of the same components effectively. Cells stimulated with a mixture of high- and low-affinity ligands, under a protocol where simple displacement of one by the other was prevented, remarkably showed that excess low-affinity ligand inhibited the phosphorylation as well as degranulation by the high-affinity ligand. This antagonism results from a competition for the limiting amount of the constitutive initiating kinase. Related receptors that depend on recruitment of initiating kinases may be subject to similar regulatory mechanisms.

  13. Molecular confirmation of Bacillus Calmette Guerin vaccine related adverse events among Saudi Arabian children.

    Directory of Open Access Journals (Sweden)

    Sahal Al-Hajoj

    Full Text Available Bacillus Calmette Guerin (BCG is the only available vaccine for tuberculosis (TB. Low grade complications in healthy recipients and disseminated vaccine associated complications among immuno-suppressed individuals were noticed globally after administration. Recently a series of clinically suspected BCG associated suppurative and non-suppurative lymphadenitis cases were reported from different regions of Saudi Arabia. However a molecular confirmative analysis was lacking to prove these claims.During 2009-2010, 42 Mycobacterium bovis BCG suspected clinical isolates from children diagnosed with suppurative lymphadenitis from different provinces of the country were collected and subjected to 24 loci based MIRU-VNTR typing, spoligotyping and first line anti-TB drugs susceptibility testing.Of the total 42 cases, 41 (97.6% were Saudi nationals and particularly male (64.3%. Majority of the cases were aged below 6 months (83.3% with a median of age 4 months. All the enrolled subjects showed left axillary mass which suppurated in a median of 4 months after vaccination. Among the study subjects, 1 (2.4% case was reactive to HIV antigen and 2 (4.8% case had severe combined immunodeficiency. Genotyping results showed that, 41 (97.6% isolates were identical to the vaccine strain Danish 1331 and one to Tokyo 172-1. Phylogenetic analysis revealed all the Danish 1331 isolates in a single cluster.Elevated proportion of suppurative lymphadenitis caused by M. bovis BCG reported in the country recently is majorly related to the vaccine strain Danish 1331. However lack of nationwide data on real magnitude of BCG related adverse events warrants population centric, long term future studies.

  14. Development of an online morbidity, mortality, and near-miss reporting system to identify patterns of adverse events in surgical patients.

    Science.gov (United States)

    Bilimoria, Karl Y; Kmiecik, Thomas E; DaRosa, Debra A; Halverson, Amy; Eskandari, Mark K; Bell, Richard H; Soper, Nathaniel J; Wayne, Jeffrey D

    2009-04-01

    To design a Web-based system to track adverse and near-miss events, to establish an automated method to identify patterns of events, and to assess the adverse event reporting behavior of physicians. A Web-based system was designed to collect physician-reported adverse events including weekly Morbidity and Mortality (M&M) entries and anonymous adverse/near-miss events. An automated system was set up to help identify event patterns. Adverse event frequency was compared with hospital databases to assess reporting completeness. A metropolitan tertiary care center. Identification of adverse event patterns and completeness of reporting. From September 2005 to August 2007, 15,524 surgical patients were reported including 957 (6.2%) adverse events and 34 (0.2%) anonymous reports. The automated pattern recognition system helped identify 4 event patterns from M&M reports and 3 patterns from anonymous/near-miss reporting. After multidisciplinary meetings and expert reviews, the patterns were addressed with educational initiatives, correction of systems issues, and/or intensive quality monitoring. Only 25% of complications and 42% of inpatient deaths were reported. A total of 75.2% of adverse events resulting in permanent disability or death were attributed to the nature of the disease. Interventions to improve reporting were largely unsuccessful. We have developed a user-friendly Web-based system to track complications and identify patterns of adverse events. Underreporting of adverse events and attributing the complication to the nature of the disease represent a problem in reporting culture among surgeons at our institution. Similar systems should be used by surgery departments, particularly those affiliated with teaching hospitals, to identify quality improvement opportunities.

  15. Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity.

    Directory of Open Access Journals (Sweden)

    Guan-Feng Wang

    2015-02-01

    Full Text Available Plant disease resistance is often mediated by nucleotide binding-leucine rich repeat (NLR proteins which remain auto-inhibited until recognition of specific pathogen-derived molecules causes their activation, triggering a rapid, localized cell death called a hypersensitive response (HR. Three domains are recognized in one of the major classes of NLR proteins: a coiled-coil (CC, a nucleotide binding (NB-ARC and a leucine rich repeat (LRR domains. The maize NLR gene Rp1-D21 derives from an intergenic recombination event between two NLR genes, Rp1-D and Rp1-dp2 and confers an autoactive HR. We report systematic structural and functional analyses of Rp1 proteins in maize and N. benthamiana to characterize the molecular mechanism of NLR activation/auto-inhibition. We derive a model comprising the following three main features: Rp1 proteins appear to self-associate to become competent for activity. The CC domain is signaling-competent and is sufficient to induce HR. This can be suppressed by the NB-ARC domain through direct interaction. In autoactive proteins, the interaction of the LRR domain with the NB-ARC domain causes de-repression and thus disrupts the inhibition of HR. Further, we identify specific amino acids and combinations thereof that are important for the auto-inhibition/activity of Rp1 proteins. We also provide evidence for the function of MHD2, a previously uncharacterized, though widely conserved NLR motif. This work reports several novel insights into the precise structural requirement for NLR function and informs efforts towards utilizing these proteins for engineering disease resistance.

  16. Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity.

    Science.gov (United States)

    Wang, Guan-Feng; Ji, Jiabing; El-Kasmi, Farid; Dangl, Jeffery L; Johal, Guri; Balint-Kurti, Peter J

    2015-02-01

    Plant disease resistance is often mediated by nucleotide binding-leucine rich repeat (NLR) proteins which remain auto-inhibited until recognition of specific pathogen-derived molecules causes their activation, triggering a rapid, localized cell death called a hypersensitive response (HR). Three domains are recognized in one of the major classes of NLR proteins: a coiled-coil (CC), a nucleotide binding (NB-ARC) and a leucine rich repeat (LRR) domains. The maize NLR gene Rp1-D21 derives from an intergenic recombination event between two NLR genes, Rp1-D and Rp1-dp2 and confers an autoactive HR. We report systematic structural and functional analyses of Rp1 proteins in maize and N. benthamiana to characterize the molecular mechanism of NLR activation/auto-inhibition. We derive a model comprising the following three main features: Rp1 proteins appear to self-associate to become competent for activity. The CC domain is signaling-competent and is sufficient to induce HR. This can be suppressed by the NB-ARC domain through direct interaction. In autoactive proteins, the interaction of the LRR domain with the NB-ARC domain causes de-repression and thus disrupts the inhibition of HR. Further, we identify specific amino acids and combinations thereof that are important for the auto-inhibition/activity of Rp1 proteins. We also provide evidence for the function of MHD2, a previously uncharacterized, though widely conserved NLR motif. This work reports several novel insights into the precise structural requirement for NLR function and informs efforts towards utilizing these proteins for engineering disease resistance.

  17. Use of satellite imagery to identify vegetation cover changes following the Waldo Canyon Fire event, Colorado, 2012-2013

    Science.gov (United States)

    Cole, Christopher J.; Friesen, Beverly A.; Wilson, Earl M.

    2014-01-01

    The Waldo Canyon Fire of 2012 was one of the most destructive wildfire events in Colorado history. The fire burned a total of 18,247 acres, claimed 2 lives, and destroyed 347 homes. The Waldo Canyon Fire continues to pose challenges to nearby communities. In a preliminary emergency assessment conducted in 2012, the U.S. Geological Survey (USGS) concluded that drainage basins within and near the area affected by the Waldo Canyon Fire pose a risk for future debris flow events. Rainfall over burned, formerly vegetated surfaces resulted in multiple flood and debris flow events that affected the cities of Colorado Springs and Manitou Springs in 2013. One fatality resulted from a mudslide near Manitou Springs in August 2013. Federal, State, and local governments continue to monitor these hazards and other post-fire effects, along with the region’s ecological recovery. At the request of the Colorado Springs Office of Emergency Management, the USGS Special Applications Science Center developed a geospatial product to identify vegetation cover changes following the 2012 Waldo Canyon Fire event. Vegetation cover was derived from July 2012 WorldView-2 and September 2013 QuickBird multispectral imagery at a spatial resolution of two meters. The 2012 image was collected after the fire had reached its maximum extent. Per-pixel increases and decreases in vegetation cover were identified by measuring spectral changes that occurred between the 2012 and 2013 image dates. A Normalized Difference Vegetation Index (NDVI), and Green-Near Infrared Index (GRNIR) were computed from each image. These spectral indices are commonly used to characterize vegetation cover and health condition, due to their sensitivity to detect foliar chlorophyll content. Vector polygons identifying surface-cover feature boundaries were derived from the 2013 imagery using image segmentation software. This geographic software groups similar image pixels into vector objects based upon their spatial and spectral

  18. Identifying cognitive preferences for attractive female faces: an event-related potential experiment using a study-test paradigm.

    Science.gov (United States)

    Zhang, Yan; Kong, Fanchang; Chen, Hong; Jackson, Todd; Han, Li; Meng, Jing; Yang, Zhou; Gao, Jianguo; Najam ul Hasan, Abbasi

    2011-11-01

    In this experiment, sensitivity to female facial attractiveness was examined by comparing event-related potentials (ERPs) in response to attractive and unattractive female faces within a study-test paradigm. Fourteen heterosexual participants (age range 18-24 years, mean age 21.67 years) were required to judge 84 attractive and 84 unattractive face images as either "attractive" or "unattractive." They were then asked whether they had previously viewed each face in a recognition task in which 50% of the images were novel. Analyses indicated that attractive faces elicited more enhanced ERP amplitudes than did unattractive faces in judgment (N300 and P350-550 msec) and recognition (P160 and N250-400 msec and P400-700 msec) tasks on anterior locations. Moreover, longer reaction times and higher accuracy rate were observed in identifying attractive faces than unattractive faces. In sum, this research identified neural and behavioral bases related to cognitive preferences for judging and recognizing attractive female faces. Explanations for the results are that attractive female faces arouse more intense positive emotions in participants than do unattractive faces, and they also represent reproductive fitness and mating value from the evolutionary perspective. Copyright © 2011 Wiley-Liss, Inc.

  19. Retroviral insertional mutagenesis identifies Zeb2 activation as a novel leukemogenic collaborating event in CALM-AF10 transgenic mice.

    Science.gov (United States)

    Caudell, David; Harper, David P; Novak, Rachel L; Pierce, Rachel M; Slape, Christopher; Wolff, Linda; Aplan, Peter D

    2010-02-11

    The t(10;11) translocation results in a CALM-AF10 fusion gene in a subset of leukemia patients. Expression of a CALM-AF10 transgene results in leukemia, with prolonged latency and incomplete penetrance, suggesting that additional events are necessary for leukemic transformation. CALM-AF10 mice infected with the MOL4070LTR retrovirus developed acute leukemia, and ligation-mediated polymerase chain reaction was used to identify retroviral insertions at 19 common insertion sites, including Zeb2, Nf1, Mn1, Evi1, Ift57, Mpl, Plag1, Kras, Erg, Vav1, and Gata1. A total of 26% (11 of 42) of the mice had retroviral integrations near Zeb2, a transcriptional corepressor leading to overexpression of the Zeb2-transcript. A total of 91% (10 of 11) of mice with Zeb2 insertions developed B-lineage acute lymphoblastic leukemia, suggesting that Zeb2 activation promotes the transformation of CALM-AF10 hematopoietic precursors toward B-lineage leukemias. More than half of the mice with Zeb2 integrations also had Nf1 integrations, suggesting cooperativity among CALM-AF10, Zeb2, and Ras pathway mutations. We searched for Nras, Kras, and Ptpn11 point mutations in the CALM-AF10 leukemic mice. Three mutations were identified, all of which occurred in mice with Zeb2 integrations, consistent with the hypothesis that Zeb2 and Ras pathway activation promotes B-lineage leukemic transformation in concert with CALM-AF10.

  20. A systems biology strategy to identify molecular mechanisms of action and protein indicators of traumatic brain injury.

    Science.gov (United States)

    Yu, Chenggang; Boutté, Angela; Yu, Xueping; Dutta, Bhaskar; Feala, Jacob D; Schmid, Kara; Dave, Jitendra; Tawa, Gregory J; Wallqvist, Anders; Reifman, Jaques

    2015-02-01

    The multifactorial nature of traumatic brain injury (TBI), especially the complex secondary tissue injury involving intertwined networks of molecular pathways that mediate cellular behavior, has confounded attempts to elucidate the pathology underlying the progression of TBI. Here, systems biology strategies are exploited to identify novel molecular mechanisms and protein indicators of brain injury. To this end, we performed a meta-analysis of four distinct high-throughput gene expression studies involving different animal models of TBI. By using canonical pathways and a large human protein-interaction network as a scaffold, we separately overlaid the gene expression data from each study to identify molecular signatures that were conserved across the different studies. At 24 hr after injury, the significantly activated molecular signatures were nonspecific to TBI, whereas the significantly suppressed molecular signatures were specific to the nervous system. In particular, we identified a suppressed subnetwork consisting of 58 highly interacting, coregulated proteins associated with synaptic function. We selected three proteins from this subnetwork, postsynaptic density protein 95, nitric oxide synthase 1, and disrupted in schizophrenia 1, and hypothesized that their abundance would be significantly reduced after TBI. In a penetrating ballistic-like brain injury rat model of severe TBI, Western blot analysis confirmed our hypothesis. In addition, our analysis recovered 12 previously identified protein biomarkers of TBI. The results suggest that systems biology may provide an efficient, high-yield approach to generate testable hypotheses that can be experimentally validated to identify novel mechanisms of action and molecular indicators of TBI. © 2014 The Authors. Journal of Neuroscience Research Published by Wiley Periodicals, Inc.

  1. A suite of molecular markers for identifying species, detecting introgression and describing population structure in spadefoot toads (Spea spp.).

    Science.gov (United States)

    Pfennig, Karin S; Allenby, Ashley; Martin, Ryan A; Monroy, Anaïs; Jones, Corbin D

    2012-09-01

    Two congeneric species of spadefoot toad, Spea multiplicata and Spea bombifrons, have been the focus of hybridization studies since the 1970s. Because complex hybrids are not readily distinguished phenotypically, genetic markers are needed to identify introgressed individuals. We therefore developed a set of molecular markers (amplified fragment length polymorphism, polymerase chain reaction-restriction fragment length polymorphism and single nucleotide polymorphism) for identifying pure-species, F1 hybrids and more complex introgressed types. To do so, we tested a series of markers across both species and known hybrids using populations in both allopatry and sympatry. We retained those markers that differentiated the two pure-species and also consistently identified known species hybrids. These markers are well suited for identifying hybrids between these species. Moreover, those markers that show variation within each species can be used in conjunction with existing molecular markers in studies of population structure and gene flow. © 2012 Blackwell Publishing Ltd.

  2. Molecular events in the induction of murine tumors by ionizing radiation

    International Nuclear Information System (INIS)

    Andrews, K.L.

    1993-01-01

    A new method is presented to identify and clone novel transforming genes from radiation-induced tumors. It involves the creation of a cDNA expression library from radiation-induced tumors. The library is transfected into non-transformed cells, and the nude mouse tumorigenicity assay functionally defines the acquisition of a transformed phenotype. cDNA clones responsible for transformation are rescued by PCR amplification. This method is applicable to a variety of mammalian systems. The only requirement is a functional assay with which to measure the acquisition of an altered phenotype following transfection of a cDNA library. This method has identified a cDNA for the 16 kD subunit of v-H + -ATPase, which has been associated with cellular transformation. Two protocols were used to generate radiation-induced tumors. One experiment utilizing fractionated doses of ionizing radiation had a much greater tumor yield than the second protocol using a single dose of 11.25 Gy. To determine if the mechanism of gene activation is different in radiation- and chemically-induced tumors, the expression pattern of five tumor-associated genes was analyzed. The expression patterns of mals 1-4 were not significantly different. However, transin, a secreted protease, was overexpressed in radiation-induced papillomas and undetectable in chemically-induced papillomas. Transin degrades basement membrane proteins and may be involved in the progression of benign, encapsulated tumors to malignant, invasive squamous cell carcinomas. Isolation and characterization of genes with dominant transforming activity from radiation-induced tumors will provide information to bridge the gap between the initial ionizing radiation event and the subsequent development of malignant tumors. The function of these genes may also provide information about the development of human malignancies. An understanding the natural biology of cells will help elucidate the pathogenesis cancer and other diseases

  3. Galleria mellonella model identifies highly virulent strains among all major molecular types of Cryptococcus gattii.

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    Full Text Available Cryptococcosis is mainly caused by Cryptococcus neoformans. However, the number of cases due to C. gattii is increasing, affecting mainly immunocompetent hosts. C. gattii is divided into four major molecular types, VGI to VGIV, which differ in their host range, epidemiology, antifungal susceptibility and geographic distribution. Besides studies on the Vancouver Island outbreak strains, which showed that the subtype VGIIa is highly virulent compared to the subtype VGIIb, little is known about the virulence of the other major molecular types. To elucidate the virulence potential of the major molecular types of C. gattii, Galleria mellonella larvae were inoculated with ten globally selected strains per molecular type. Survival rates were recorded and known virulence factors were studied. One VGII, one VGIII and one VGIV strain were more virulent (p 0.05, 21 (five VGI, five VGII, four VGIII and seven VGIV were less virulent (p <0.05 while one strain of each molecular type were avirulent. Cell and capsule size of all strains increased markedly during larvae infection (p <0.001. No differences in growth rate at 37°C were observed. Melanin synthesis was directly related with the level of virulence: more virulent strains produced more melanin than less virulent strains (p <0.05. The results indicate that all C. gattii major molecular types exhibit a range of virulence, with some strains having the potential to be more virulent. The study highlights the necessity to further investigate the genetic background of more and less virulent strains in order to recognize critical features, other than the known virulence factors (capsule, melanin and growth at mammalian body temperature, that maybe crucial for the development and progression of cryptococcosis.

  4. Initial Chemical Events in CL-20 Under Extreme Conditions: An Ab Initio Molecular Dynamics Study

    National Research Council Canada - National Science Library

    Isaev, Olexandr; Kholod, Yana; Gorb, Leonid; Qasim, Mohammad; Fredrickson, Herb; Leszczynski, Jerzy

    2006-01-01

    .... In the present study molecular structure, electrostatic potential, vibrational spectrum and dynamics of thermal decomposition of CL-20 have been investigated by static and dynamic methods of ab...

  5. Whole-genome sequencing and comprehensive molecular profiling identify new driver mutations in gastric cancer

    NARCIS (Netherlands)

    Wang, Kai; Yuen, Siu Tsan; Xu, Jiangchun; Lee, Siu Po; Yan, Helen H N; Shi, Stephanie T; Siu, Hoi Cheong; Deng, Shibing; Chu, Kent Man; Law, Simon; Chan, Kok Hoe; Chan, Annie S Y; Tsui, Wai Yin; Ho, Siu Lun; Chan, Anthony K W; Man, Jonathan L K; Foglizzo, Valentina; Ng, Man Kin; Chan, April S; Ching, Yick Pang; Cheng, Grace H W; Xie, Tao; Fernandez, Julio; Li, Vivian S W; Clevers, Hans; Rejto, Paul A; Mao, Mao; Leung, Suet Yi

    Gastric cancer is a heterogeneous disease with diverse molecular and histological subtypes. We performed whole-genome sequencing in 100 tumor-normal pairs, along with DNA copy number, gene expression and methylation profiling, for integrative genomic analysis. We found subtype-specific genetic and

  6. Genome characterization of Turkey Rotavirus G strains from the United States identifies potential recombination events with human Rotavirus B strains.

    Science.gov (United States)

    Chen, Fangzhou; Knutson, Todd P; Porter, Robert E; Ciarlet, Max; Mor, Sunil Kumar; Marthaler, Douglas G

    2017-12-01

    Rotavirus G (RVG) strains have been detected in a variety of avian species, but RVG genomes have been published from only a single pigeon and two chicken strains. Two turkey RVG strains were identified and characterized, one in a hatchery with no reported health issues and the other in a hatchery with high embryo/poult mortality. The two turkey RVG strains shared only an 85.3 % nucleotide sequence identity in the VP7 gene while the other genes possessed high nucleotide identity among them (96.3-99.9 %). Low nucleotide percentage identities (31.6-87.3 %) occurred among the pigeon and chicken RVG strains. Interestingly, potential recombination events were detected between our RVG strains and a human RVB strain, in the VP6 and NSP3 segments. The epidemiology of RVG in avian flocks and the pathogenicity of the two different RVG strains should be further investigated to understand the ecology and impact of RVG in commercial poultry flocks.

  7. Predictive values of diagnostic codes for identifying serious hypocalcemia and dermatologic adverse events among women with postmenopausal osteoporosis in a commercial health plan database.

    Science.gov (United States)

    Wang, Florence T; Xue, Fei; Ding, Yan; Ng, Eva; Critchlow, Cathy W; Dore, David D

    2018-04-10

    Post-marketing safety studies of medicines often rely on administrative claims databases to identify adverse outcomes following drug exposure. Valid ascertainment of outcomes is essential for accurate results. We aim to quantify the validity of diagnostic codes for serious hypocalcemia and dermatologic adverse events from insurance claims data among women with postmenopausal osteoporosis (PMO). We identified potential cases of serious hypocalcemia and dermatologic events through ICD-9 diagnosis codes among women with PMO within claims from a large US healthcare insurer (June 2005-May 2010). A physician adjudicated potential hypocalcemic and dermatologic events identified from the primary position on emergency department (ED) or inpatient claims through medical record review. Positive predictive values (PPVs) and 95% confidence intervals (CIs) quantified the fraction of potential cases that were confirmed. Among 165,729 patients with PMO, medical charts were obtained for 40 of 55 (73%) potential hypocalcemia cases; 16 were confirmed (PPV 40%, 95% CI 25-57%). The PPV was higher for ED than inpatient claims (82 vs. 24%). Among 265 potential dermatologic events (primarily urticaria or rash), we obtained 184 (69%) charts and confirmed 128 (PPV 70%, 95% CI 62-76%). The PPV was higher for ED than inpatient claims (77 vs. 39%). Diagnostic codes for hypocalcemia and dermatologic events may be sufficient to identify events giving rise to emergency care, but are less accurate for identifying events within hospitalizations.

  8. New technique of identifying the hierarchy of dynamic domains in proteins using a method of molecular dynamics simulations

    Directory of Open Access Journals (Sweden)

    Yesylevskyy S. O.

    2010-04-01

    Full Text Available Aim. Despite a large number of existing domain identification techniques there is no universally accepted method, which identifies the hierarchy of dynamic domains using the data of molecular dynamics (MD simulations. The goal of this work is to develop such technique. Methods. The dynamic domains are identified by eliminating systematic motions from MD trajectories recursively in a model-free manner. Results. The technique called the Hierarchical Domain-Wise Alignment (HDWA to identify hierarchically organized dynamic domains in proteins using the MD trajectories has been developed. Conclusion. A new method of domain identification in proteins is proposed

  9. Molecular Imaging to Identify Tumor Recurrence following Chemoradiation in a Hostile Surgical Environment

    Directory of Open Access Journals (Sweden)

    Olugbenga T. Okusanya

    2015-01-01

    Full Text Available Surgical biopsy of potential tumor recurrence is a common challenge facing oncologists, surgeons, and cancer patients. Imaging modalities have limited ability to accurately detect recurrent cancer in fields affected by previous surgery, chemotherapy, or radiation. However, definitive tissue diagnosis is often needed to initiate treatment and to direct therapy. We sought to determine if a targeted fluorescent intraoperative molecular imaging technique could be applied in a clinical setting to assist a surgical biopsy in a “hostile” field. We describe the use of a folate-fluorescein conjugate to direct the biopsy of a suspected recurrent lung adenocarcinoma invading the mediastinum that had been previously treated with chemoradiation. We found that intraoperative imaging allowed the identification of small viable tumor deposits that were otherwise indistinguishable from scar and necrosis. Our operative observations were confirmed by histology, fluorescence microscopy, and immunohistochemistry. Our results demonstrate one possible application and clinical value of intraoperative molecular imaging.

  10. Utilizing Endoscopic Ultrasound-Guided Fine Needle Aspiration in Identifying Molecular Targets for Pancreatic Cancer

    OpenAIRE

    Onyekachi Henry Ogbonna; Muhammad Wasif Saif

    2013-01-01

    Pancreatic cancer remains a devastating disease, with poor survival rates and high recurrence rates with current treatmentregimens. Over the years we have come to understand the complex biology of this cancer, involving cross-talking signalingpathways that proffers resistance to current therapy. Several molecularly targeted agents remain in development. At the2013 American Society of Clinical Oncology (ASCO) Annual Meeting, an abstract (#4051) was presented which exploredusing endoscopic ultr...

  11. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Hrabcová, M.; Pecková, Hana; Patra, Sneha; Kodádková, Alena; Jurajda, Pavel; Tyml, Tomáš; Holzer, Astrid S.

    2014-01-01

    Roč. 44, č. 8 (2014), s. 565-577 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GPP506/11/P724; GA ČR GBP505/12/G112; GA AV ČR(CZ) M200961205 Institutional support: RVO:60077344 ; RVO:68081766 Keywords : Buddenbrockia * Tetracapsuloides * diversity * phylogeny * Bryozoa * fish * cryptic * worm Subject RIV: EB - Genetics ; Molecular Biology; EG - Zoology (UBO-W) Impact factor: 3.872, year: 2014

  12. Direct and indirect costs for adverse drug events identified in medical records across care levels, and their distribution among payers.

    Science.gov (United States)

    Natanaelsson, Jennie; Hakkarainen, Katja M; Hägg, Staffan; Andersson Sundell, Karolina; Petzold, Max; Rehnberg, Clas; Jönsson, Anna K; Gyllensten, Hanna

    2017-11-01

    Adverse drug events (ADEs) cause considerable costs in hospitals. However, little is known about costs caused by ADEs outside hospitals, effects on productivity, and how the costs are distributed among payers. To describe the direct and indirect costs caused by ADEs, and their distribution among payers. Furthermore, to describe the distribution of patient out-of-pocket costs and lost productivity caused by ADEs according to socio-economic characteristics. In a random sample of 5025 adults in a Swedish county, prevalence-based costs for ADEs were calculated. Two different methods were used: 1) based on resource use judged to be caused by ADEs, and 2) as costs attributable to ADEs by comparing costs among individuals with ADEs to costs among matched controls. Payers of costs caused by ADEs were identified in medical records among those with ADEs (n = 596), and costs caused to individual patients were described by socio-economic characteristics. Costs for resource use caused by ADEs were €505 per patient with ADEs (95% confidence interval €345-665), of which 38% were indirect costs. Compared to matched controls, the costs attributable to ADEs were €1631, of which €410 were indirect costs. The local health authorities paid 58% of the costs caused by ADEs. Women had higher productivity loss than men (€426 vs. €109, p = 0.018). Out-of-pocket costs displaced a larger proportion of the disposable income among low-income earners than higher income earners (0.7% vs. 0.2%-0.3%). We used two methods to identify costs for ADEs, both identifying indirect costs as an important component of the overall costs for ADEs. Although the largest payers of costs caused by ADEs were the local health authorities responsible for direct costs, employers and patients costs for lost productivity contributed substantially. Our results indicate inequalities in costs caused by ADEs, by sex and income. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Identifying and quantifying proteolytic events and the natural N terminome by terminal amine isotopic labeling of substrates.

    Science.gov (United States)

    Kleifeld, Oded; Doucet, Alain; Prudova, Anna; auf dem Keller, Ulrich; Gioia, Magda; Kizhakkedathu, Jayachandran N; Overall, Christopher M

    2011-09-22

    Analysis of the sequence and nature of protein N termini has many applications. Defining the termini of proteins for proteome annotation in the Human Proteome Project is of increasing importance. Terminomics analysis of protease cleavage sites in degradomics for substrate discovery is a key new application. Here we describe the step-by-step procedures for performing terminal amine isotopic labeling of substrates (TAILS), a 2- to 3-d (depending on method of labeling) high-throughput method to identify and distinguish protease-generated neo-N termini from mature protein N termini with all natural modifications with high confidence. TAILS uses negative selection to enrich for all N-terminal peptides and uses primary amine labeling-based quantification as the discriminating factor. Labeling is versatile and suited to many applications, including biochemical and cell culture analyses in vitro; in vivo analyses using tissue samples from animal and human sources can also be readily performed. At the protein level, N-terminal and lysine amines are blocked by dimethylation (formaldehyde/sodium cyanoborohydride) and isotopically labeled by incorporating heavy and light dimethylation reagents or stable isotope labeling with amino acids in cell culture labels. Alternatively, easy multiplex sample analysis can be achieved using amine blocking and labeling with isobaric tags for relative and absolute quantification, also known as iTRAQ. After tryptic digestion, N-terminal peptide separation is achieved using a high-molecular-weight dendritic polyglycerol aldehyde polymer that binds internal tryptic and C-terminal peptides that now have N-terminal alpha amines. The unbound naturally blocked (acetylation, cyclization, methylation and so on) or labeled mature N-terminal and neo-N-terminal peptides are recovered by ultrafiltration and analyzed by tandem mass spectrometry (MS/MS). Hierarchical substrate winnowing discriminates substrates from the background proteolysis products and

  14. More on contamination: the use of asymmetric molecular behavior to identify authentic ancient human DNA

    DEFF Research Database (Denmark)

    Malmström, Helena; Svensson, Emma M; Gilbert, M Thomas P

    2007-01-01

    concerning the authenticity of such data. Although several methods have been developed to the purpose of authenticating ancient DNA (aDNA) results, while they are useful in faunal research, most of the methods have proven complicated to apply to ancient human DNA. Here, we investigate in detail...... the reliability of one of the proposed criteria, that of appropriate molecular behavior. Using real-time polymerase chain reaction (PCR) and pyrosequencing, we have quantified the relative levels of authentic aDNA and contaminant human DNA sequences recovered from archaeological dog and cattle remains. In doing...

  15. Cancer in silico drug discovery: a systems biology tool for identifying candidate drugs to target specific molecular tumor subtypes.

    Science.gov (United States)

    San Lucas, F Anthony; Fowler, Jerry; Chang, Kyle; Kopetz, Scott; Vilar, Eduardo; Scheet, Paul

    2014-12-01

    Large-scale cancer datasets such as The Cancer Genome Atlas (TCGA) allow researchers to profile tumors based on a wide range of clinical and molecular characteristics. Subsequently, TCGA-derived gene expression profiles can be analyzed with the Connectivity Map (CMap) to find candidate drugs to target tumors with specific clinical phenotypes or molecular characteristics. This represents a powerful computational approach for candidate drug identification, but due to the complexity of TCGA and technology differences between CMap and TCGA experiments, such analyses are challenging to conduct and reproduce. We present Cancer in silico Drug Discovery (CiDD; scheet.org/software), a computational drug discovery platform that addresses these challenges. CiDD integrates data from TCGA, CMap, and Cancer Cell Line Encyclopedia (CCLE) to perform computational drug discovery experiments, generating hypotheses for the following three general problems: (i) determining whether specific clinical phenotypes or molecular characteristics are associated with unique gene expression signatures; (ii) finding candidate drugs to repress these expression signatures; and (iii) identifying cell lines that resemble the tumors being studied for subsequent in vitro experiments. The primary input to CiDD is a clinical or molecular characteristic. The output is a biologically annotated list of candidate drugs and a list of cell lines for in vitro experimentation. We applied CiDD to identify candidate drugs to treat colorectal cancers harboring mutations in BRAF. CiDD identified EGFR and proteasome inhibitors, while proposing five cell lines for in vitro testing. CiDD facilitates phenotype-driven, systematic drug discovery based on clinical and molecular data from TCGA. ©2014 American Association for Cancer Research.

  16. Energy dependence of identified hadron spectra and event-by-event fluctuations in p+p interactions from NA61/SHINE at the CERN SPS

    CERN Document Server

    Rybczynski, Maciej; Aduszkiewicz, A.; Ali, Y.; Anticic, T.; Antoniou, N.; Argyriades, J.; Baatar, B.; Blondel, A.; Blumer, J.; Bogomilov, M.; Bravar, A.; Brooks, W.; Brzychczyk, J.; Bubak, A.; Bunyatov, S.A.; Busygina, O.; Christakoglou, P.; Czopowicz, T.; Davis, N.; Debieux, S.; Dembinski, H.; Diakonos, F.; Di Luise, S.; Dominik, W.; Drozhzhova, T.; Dumarchez, J.; Dynowski, K.; Engel, R.; Ereditato, A.; Esposito, L.S.; Feofilov, G.A.; Fodor, Z.; Ferrero, A.; Fulop, A.; Gazdzicki, M.; Golubeva, M.; Grabez, B.; Grebieszkow, K.; Grzeszczuk, A.; Guber, F.; Hakobyan, H.; Hasegawa, T.; Hierholzer, M.; Idczak, R.; Igolkin, S.; Ivanov, Y.; Ivashkin, A.; Jakovic, D.; Kadija, K.; Kapoyannis, A.; Katrynska, N.; Kaptur, E.; Kielczewska, D.; Kikola, D.; Kirejczyk, M.; Kisiel, J.; Kiss, T.; Kleinfelder, S.; Kobayashi, T.; Kolesnikov, V.I.; Kolev, D.; Kondratiev, V.P.; Korzenev, A.; Kowalski, S.; Krasnoperov, A.; Kuleshov, S.; Kurepin, A.; Larsen, D.; Laszlo, A.; Lyubushkin, V.V.; Mackowiak-Pawlowska, M.; Majka, Z.; Maksiak, B.; Malakhov, A.I.; Maletic, D.; Marchionni, A.; Marcinek, A.; Marin, V.; Marton, K.; Mathes, H.J.; Matulewicz, T.; Matveev, V.; Melkumov, G.L.; Mrowczynski, St.; Murphy, S.; Nakadaira, T.; Nirkko, M.; Nishikawa, K.; Palczewski, T.; Palla, G.; Panagiotou, A.D.; Paul, T.; Pistillo, C.; Redij, A.; Peryt, W.; Petukhov, O.; Planeta, R.; Pluta, J.; Popov, B.A.; Posiadala, M.; Pulawski, S.; Puzovic, J.; Rauch, W.; Ravonel, M.; Renfordt, R.; Robert, A.; Röhrich, D.; Rondio, E.; Roth, M.; Rubbia, A.; Rustamov, A.; Rybczynski, M.; Sadovsky, A.; Sakashita, K.; Savic, M.; Sekiguchi, T.; Seyboth, P.; Shibata, M.; Sipos, M.; Skrzypczak, E.; Slodkowski, M.; Staszel, P.; Stefanek, G.; Stepaniak, J.; Stroebele, H.; Susa, T.; Szuba, M.; Tada, M.; Tereshchenko, V.; Tolyhi, T.; Tsenov, R.; Turko, L.; Ulrich, R.; Unger, M.; Vassiliou, M.; Veberic, D.; Vechernin, V.V.; Vesztergombi, G.; Vinogradov, L.; Wilczek, A.; Wlodarczyk, Z.; Wojtaszek, A.; Wyszynski, O.; Zambelli, L.; Zipper, W.

    2013-01-01

    NA61/SHINE at the CERN SPS is a fixed-target experiment pursuing a rich physics program including measurements for heavy ion, neutrino and cosmic ray physics. The main goal of the ion program is to explore the most interesting $T, mu_{B}$ region of the phase diagram of strongly interacting matter. We plan to study the properties of the onset of deconfinement and to search for the signatures of the critical point. The search is performed by varying collision energy (13A-158A GeV/c) and system size (p+p, Be+Be, Ar+Ca, Xe+La). Thanks to its large acceptance and excellent particle identification capability NA61/SHINE is well suited for performing high-precision particle production measurements as well as for studying event-by-event fluctuations in p+p, p+nucleus and nucleus+nucleus collisions. Preliminary results on p+p interactions at 20, 31, 40, 80 and 158 GeV/c are presented. They include inclusive spectra of pi+, pi-, K- and protons as a function of transverse momentum/mass and rapidity as well as event-by-ev...

  17. Early and long-standing rheumatoid arthritis: distinct molecular signatures identified by gene-expression profiling in synovia

    Science.gov (United States)

    Lequerré, Thierry; Bansard, Carine; Vittecoq, Olivier; Derambure, Céline; Hiron, Martine; Daveau, Maryvonne; Tron, François; Ayral, Xavier; Biga, Norman; Auquit-Auckbur, Isabelle; Chiocchia, Gilles; Le Loët, Xavier; Salier, Jean-Philippe

    2009-01-01

    Introduction Rheumatoid arthritis (RA) is a heterogeneous disease and its underlying molecular mechanisms are still poorly understood. Because previous microarray studies have only focused on long-standing (LS) RA compared to osteoarthritis, we aimed to compare the molecular profiles of early and LS RA versus control synovia. Methods Synovial biopsies were obtained by arthroscopy from 15 patients (4 early untreated RA, 4 treated LS RA and 7 controls, who had traumatic or mechanical lesions). Extracted mRNAs were used for large-scale gene-expression profiling. The different gene-expression combinations identified by comparison of profiles of early, LS RA and healthy synovia were linked to the biological processes involved in each situation. Results Three combinations of 719, 116 and 52 transcripts discriminated, respectively, early from LS RA, and early or LS RA from healthy synovia. We identified several gene clusters and distinct molecular signatures specifically expressed during early or LS RA, thereby suggesting the involvement of different pathophysiological mechanisms during the course of RA. Conclusions Early and LS RA have distinct molecular signatures with different biological processes participating at different times during the course of the disease. These results suggest that better knowledge of the main biological processes involved at a given RA stage might help to choose the most appropriate treatment. PMID:19563633

  18. Slow Earthquake Hunters: A New Citizen Science Project to Identify and Catalog Slow Slip Events in Geodetic Data

    Science.gov (United States)

    Bartlow, N. M.

    2017-12-01

    Slow Earthquake Hunters is a new citizen science project to detect, catalog, and monitor slow slip events. Slow slip events, also called "slow earthquakes", occur when faults slip too slowly to generate significant seismic radiation. They typically take between a few days and over a year to occur, and are most often found on subduction zone plate interfaces. While not dangerous in and of themselves, recent evidence suggests that monitoring slow slip events is important for earthquake hazards, as slow slip events have been known to trigger damaging "regular" earthquakes. Slow slip events, because they do not radiate seismically, are detected with a variety of methods, most commonly continuous geodetic Global Positioning System (GPS) stations. There is now a wealth of GPS data in some regions that experience slow slip events, but a reliable automated method to detect them in GPS data remains elusive. This project aims to recruit human users to view GPS time series data, with some post-processing to highlight slow slip signals, and flag slow slip events for further analysis by the scientific team. Slow Earthquake Hunters will begin with data from the Cascadia subduction zone, where geodetically detectable slow slip events with a duration of at least a few days recur at regular intervals. The project will then expand to other areas with slow slip events or other transient geodetic signals, including other subduction zones, and areas with strike-slip faults. This project has not yet rolled out to the public, and is in a beta testing phase. This presentation will show results from an initial pilot group of student participants at the University of Missouri, and solicit feedback for the future of Slow Earthquake Hunters.

  19. Células madre: generalidades, eventos biológicos y moleculares Stem cells: general aspects, biological and molecular events

    Directory of Open Access Journals (Sweden)

    Mónica María Cortés Márquez

    2008-09-01

    Full Text Available Las autorrenovación y la diferenciación son características de las células madre que varían entre los diferentes tipos celulares según el tejido en el que se encuentren y el microambiente que las rodee. En ambos procesos intervienen inhibidores del ciclo celular, genes implicados en rearreglos cromosómicos, proteínas del desarrollo esencial y vías de señalización específicas. La autorrenovación está regulada por diversos mecanismos, entre los cuales se destacan las vías Wnt, Notch y Hedgehog, y los factores BMI-1, p16Ink4a, ARF, NANOG, OCT3/4, SOX2, HOXB4 y sus páralogos. Los adelantos en el conocimiento de la biología de las células madre y de los mecanismos moleculares que regulan la autorrenovación y la diferenciación han convertido a estas células en una importante promesa para la investigación básica y aplicada. Self-renewal capacity and differentiation are features of stem cells that vary among the different cellular types according to the tissue in which they reside and the surrounding microenvironment. Cellular cycle inhibitors, genes implied in chromosomal rearrangements, essential development proteins and specific signaling pathways intervene in these processes. Self-renewal is regulated by different mechanisms, the most important of which are the Wnt, Notch and Hedgehog pathways, and the factors BMI-1, p16Ink4a, ARF, NANOG, OCT3/4, SOX2, HOXB4 and their paralogs. Advances in the knowledge of stem cells biology and of the molecular mechanisms that influence their selfrenewal and differentiation have made these cells an important promise for both basic and appliedresearch.

  20. RNA sequencing of Populus x canadensis roots identifies key molecular mechanisms underlying physiological adaption to excess zinc.

    Directory of Open Access Journals (Sweden)

    Andrea Ariani

    Full Text Available Populus x canadensis clone I-214 exhibits a general indicator phenotype in response to excess Zn, and a higher metal uptake in roots than in shoots with a reduced translocation to aerial parts under hydroponic conditions. This physiological adaptation seems mainly regulated by roots, although the molecular mechanisms that underlie these processes are still poorly understood. Here, differential expression analysis using RNA-sequencing technology was used to identify the molecular mechanisms involved in the response to excess Zn in root. In order to maximize specificity of detection of differentially expressed (DE genes, we consider the intersection of genes identified by three distinct statistical approaches (61 up- and 19 down-regulated and validate them by RT-qPCR, yielding an agreement of 93% between the two experimental techniques. Gene Ontology (GO terms related to oxidation-reduction processes, transport and cellular iron ion homeostasis were enriched among DE genes, highlighting the importance of metal homeostasis in adaptation to excess Zn by P. x canadensis clone I-214. We identified the up-regulation of two Populus metal transporters (ZIP2 and NRAMP1 probably involved in metal uptake, and the down-regulation of a NAS4 gene involved in metal translocation. We identified also four Fe-homeostasis transcription factors (two bHLH38 genes, FIT and BTS that were differentially expressed, probably for reducing Zn-induced Fe-deficiency. In particular, we suggest that the down-regulation of FIT transcription factor could be a mechanism to cope with Zn-induced Fe-deficiency in Populus. These results provide insight into the molecular mechanisms involved in adaption to excess Zn in Populus spp., but could also constitute a starting point for the identification and characterization of molecular markers or biotechnological targets for possible improvement of phytoremediation performances of poplar trees.

  1. HLA DNA sequence variation among human populations: molecular signatures of demographic and selective events.

    Directory of Open Access Journals (Sweden)

    Stéphane Buhler

    2011-02-01

    Full Text Available Molecular differences between HLA alleles vary up to 57 nucleotides within the peptide binding coding region of human Major Histocompatibility Complex (MHC genes, but it is still unclear whether this variation results from a stochastic process or from selective constraints related to functional differences among HLA molecules. Although HLA alleles are generally treated as equidistant molecular units in population genetic studies, DNA sequence diversity among populations is also crucial to interpret the observed HLA polymorphism. In this study, we used a large dataset of 2,062 DNA sequences defined for the different HLA alleles to analyze nucleotide diversity of seven HLA genes in 23,500 individuals of about 200 populations spread worldwide. We first analyzed the HLA molecular structure and diversity of these populations in relation to geographic variation and we further investigated possible departures from selective neutrality through Tajima's tests and mismatch distributions. All results were compared to those obtained by classical approaches applied to HLA allele frequencies.Our study shows that the global patterns of HLA nucleotide diversity among populations are significantly correlated to geography, although in some specific cases the molecular information reveals unexpected genetic relationships. At all loci except HLA-DPB1, populations have accumulated a high proportion of very divergent alleles, suggesting an advantage of heterozygotes expressing molecularly distant HLA molecules (asymmetric overdominant selection model. However, both different intensities of selection and unequal levels of gene conversion may explain the heterogeneous mismatch distributions observed among the loci. Also, distinctive patterns of sequence divergence observed at the HLA-DPB1 locus suggest current neutrality but old selective pressures on this gene. We conclude that HLA DNA sequences advantageously complement HLA allele frequencies as a source of data used

  2. A Phylogenomic Census of Molecular Functions Identifies Modern Thermophilic Archaea as the Most Ancient Form of Cellular Life

    Directory of Open Access Journals (Sweden)

    Arshan Nasir

    2014-01-01

    Full Text Available The origins of diversified life remain mysterious despite considerable efforts devoted to untangling the roots of the universal tree of life. Here we reconstructed phylogenies that described the evolution of molecular functions and the evolution of species directly from a genomic census of gene ontology (GO definitions. We sampled 249 free-living genomes spanning organisms in the three superkingdoms of life, Archaea, Bacteria, and Eukarya, and used the abundance of GO terms as molecular characters to produce rooted phylogenetic trees. Results revealed an early thermophilic origin of Archaea that was followed by genome reduction events in microbial superkingdoms. Eukaryal genomes displayed extraordinary functional diversity and were enriched with hundreds of novel molecular activities not detected in the akaryotic microbial cells. Remarkably, the majority of these novel functions appeared quite late in evolution, synchronized with the diversification of the eukaryal superkingdom. The distribution of GO terms in superkingdoms confirms that Archaea appears to be the simplest and most ancient form of cellular life, while Eukarya is the most diverse and recent.

  3. A phylogenomic census of molecular functions identifies modern thermophilic archaea as the most ancient form of cellular life.

    Science.gov (United States)

    Nasir, Arshan; Kim, Kyung Mo; Caetano-Anollés, Gustavo

    2014-01-01

    The origins of diversified life remain mysterious despite considerable efforts devoted to untangling the roots of the universal tree of life. Here we reconstructed phylogenies that described the evolution of molecular functions and the evolution of species directly from a genomic census of gene ontology (GO) definitions. We sampled 249 free-living genomes spanning organisms in the three superkingdoms of life, Archaea, Bacteria, and Eukarya, and used the abundance of GO terms as molecular characters to produce rooted phylogenetic trees. Results revealed an early thermophilic origin of Archaea that was followed by genome reduction events in microbial superkingdoms. Eukaryal genomes displayed extraordinary functional diversity and were enriched with hundreds of novel molecular activities not detected in the akaryotic microbial cells. Remarkably, the majority of these novel functions appeared quite late in evolution, synchronized with the diversification of the eukaryal superkingdom. The distribution of GO terms in superkingdoms confirms that Archaea appears to be the simplest and most ancient form of cellular life, while Eukarya is the most diverse and recent.

  4. Molecular diagnostics to identify fungal plant pathogens – A review of current methods

    OpenAIRE

    Bernreiter, Andreas

    2017-01-01

    La siguiente revisión ofrece una visión amplia de los métodos actuales utilizados para la identificación de hongos fitopatógenos. Además, se presentan estudios previos centrados en patógenos relevantes para el Ecuador y una breve discusión sobre el futuro del diagnóstico en fitopatología. En la actualidad, las herramientas de diagnóstico que aplican biología molecular se basan en la tecnología de reacción en cadena de la polimerasa (PCR). Se presenta una selección de tecnologías basadas en PC...

  5. Using combined morphological, allometric and molecular approaches to identify species of the genus Raillietiella (Pentastomida.

    Directory of Open Access Journals (Sweden)

    Crystal Kelehear

    Full Text Available Taxonomic studies of parasites can be severely compromised if the host species affects parasite morphology; an uncritical analysis might recognize multiple taxa simply because of phenotypically plastic responses of parasite morphology to host physiology. Pentastomids of the genus Raillietiella are endoparasitic crustaceans primarily infecting the respiratory system of carnivorous reptiles, but also recorded from bufonid anurans. The delineation of pentastomids at the generic level is clear, but the taxonomic status of many species is not. We collected raillietiellids from lungs of the invasive cane toad (Rhinella marina, the invasive Asian house gecko (Hemidactylus frenatus, and a native tree frog (Litoria caerulea in tropical Australia, and employed a combination of genetic analyses, and traditional and novel morphological methods to clarify their identity. Conventional analyses of parasite morphology (which focus on raw values of morphological traits revealed two discrete clusters in terms of pentastome hook size, implying two different species of pentastomes: one from toads and a tree frog (Raillietiella indica and another from lizards (Raillietiella frenatus. However, these clusters disappeared in allometric analyses that took pentastome body size into account, suggesting that only a single pentastome taxon may be involved. Our molecular data revealed no genetic differences between parasites in toads versus lizards, confirming that there was only one species: R. frenatus. This pentastome (previously known only from lizards clearly is also capable of maturing in anurans. Our analyses show that the morphological features used in pentastomid taxonomy change as the parasite transitions through developmental stages in the definitive host. To facilitate valid descriptions of new species of pentastomes, future taxonomic work should include both morphological measurements (incorporating quantitative measures of body size and hook bluntness and

  6. ApoE4-specific Misfolded Intermediate Identified by Molecular Dynamics Simulations.

    Directory of Open Access Journals (Sweden)

    Benfeard Williams

    2015-10-01

    Full Text Available The increased risk of developing Alzheimer's disease (AD is associated with the APOE gene, which encodes for three variants of Apolipoprotein E, namely E2, E3, E4, differing only by two amino acids at positions 112 and 158. ApoE4 is known to be the strongest risk factor for AD onset, while ApoE3 and ApoE2 are considered to be the AD-neutral and AD-protective isoforms, respectively. It has been hypothesized that the ApoE isoforms may contribute to the development of AD by modifying the homeostasis of ApoE physiological partners and AD-related proteins in an isoform-specific fashion. Here we find that, despite the high sequence similarity among the three ApoE variants, only ApoE4 exhibits a misfolded intermediate state characterized by isoform-specific domain-domain interactions in molecular dynamics simulations. The existence of an ApoE4-specific intermediate state can contribute to the onset of AD by altering multiple cellular pathways involved in ApoE-dependent lipid transport efficiency or in AD-related protein aggregation and clearance. We present what we believe to be the first structural model of an ApoE4 misfolded intermediate state, which may serve to elucidate the molecular mechanism underlying the role of ApoE4 in AD pathogenesis. The knowledge of the structure for the ApoE4 folding intermediate provides a new platform for the rational design of alternative therapeutic strategies to fight AD.

  7. Molecular markers for tolerance of European ash (Fraxinus excelsior) to dieback disease identified using Associative Transcriptomics

    DEFF Research Database (Denmark)

    Harper, Andrea L.; McKinney, Lea Vig; Nielsen, Lene Rostgaard

    2016-01-01

    panel scored for disease symptoms and identified markers strongly associated with canopy damage in infected trees. Using these markers we predicted phenotypes in a test panel of unrelated trees, successfully identifying individuals with a low level of susceptibility to the disease. Co......Tree disease epidemics are a global problem, impacting food security, biodiversity and national economies. The potential for conservation and breeding in trees is hampered by complex genomes and long lifecycles, with most species lacking genomic resources. The European Ash tree Fraxinus excelsior...

  8. Fast transient current response to switching events in short chains of molecular islands

    Czech Academy of Sciences Publication Activity Database

    Kalvová, Anděla; Špička, Václav; Velický, B.

    2013-01-01

    Roč. 26, č. 4 (2013), s. 773-777 ISSN 1557-1939 R&D Projects: GA ČR GAP204/12/0897 Institutional support: RVO:68378271 Keywords : nonequilibrium * molecular islands * initial correlations * transient currents Subject RIV: BE - Theoretical Physics Impact factor: 0.930, year: 2013

  9. Molecular Epidemiology Identifies HIV Transmission Networks Associated With Younger Age and Heterosexual Exposure Among Korean Individuals

    OpenAIRE

    Chin, Bum Sik; Chaillon, Antoine; Mehta, Sanjay R.; Wertheim, Joel O.; Kim, Gayeon; Shin, Hyoung-Shik; Smith, Davey M.

    2016-01-01

    To evaluate if HIV transmission networks could be elucidated from data collected in a short time frame, 131 HIV-1 pol sequences were analyzed which were generated from treatment-naïve Korean individuals who were sequentially identified over 1 year. A transmission linkage was inferred when there was a genetic distance

  10. Molecular docking and NMR binding studies to identify novel inhibitors of human phosphomevalonate kinase

    Energy Technology Data Exchange (ETDEWEB)

    Boonsri, Pornthip [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States); Department of Chemistry, NANOTEC Center of Nanotechnology, National Nanotechnology Center, Faculty of Science, Kasetsart University, Bangkok 10900 (Thailand); Neumann, Terrence S.; Olson, Andrew L.; Cai, Sheng [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States); Herdendorf, Timothy J.; Miziorko, Henry M. [Division of Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Hannongbua, Supa [Department of Chemistry, NANOTEC Center of Nanotechnology, National Nanotechnology Center, Faculty of Science, Kasetsart University, Bangkok 10900 (Thailand); Sem, Daniel S., E-mail: daniel.sem@cuw.edu [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Natural and synthetic inhibitors of human phosphomevalonate kinase identified. Black-Right-Pointing-Pointer Virtual screening yielded a hit rate of 15%, with inhibitor K{sub d}'s of 10-60 {mu}M. Black-Right-Pointing-Pointer NMR studies indicate significant protein conformational changes upon binding. -- Abstract: Phosphomevalonate kinase (PMK) phosphorylates mevalonate-5-phosphate (M5P) in the mevalonate pathway, which is the sole source of isoprenoids and steroids in humans. We have identified new PMK inhibitors with virtual screening, using autodock. Promising hits were verified and their affinity measured using NMR-based {sup 1}H-{sup 15}N heteronuclear single quantum coherence (HSQC) chemical shift perturbation and fluorescence titrations. Chemical shift changes were monitored, plotted, and fitted to obtain dissociation constants (K{sub d}). Tight binding compounds with K{sub d}'s ranging from 6-60 {mu}M were identified. These compounds tended to have significant polarity and negative charge, similar to the natural substrates (M5P and ATP). HSQC cross peak changes suggest that binding induces a global conformational change, such as domain closure. Compounds identified in this study serve as chemical genetic probes of human PMK, to explore pharmacology of the mevalonate pathway, as well as starting points for further drug development.

  11. Discovery and molecular characterization of a new luteovirus identified by high-throughput sequencing from apple

    Science.gov (United States)

    ‘Rapid Apple Decline’ (RAD) is a newly emerging problem of young, dwarf apple trees in the northeastern USA. The affected trees show trunk necrosis, bark cracking and canker formation before collapsing in the summer. In this study, a new luteovirus and three common viruses were identified from apple...

  12. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia

    NARCIS (Netherlands)

    van Uitert, Miranda; Moerland, Perry D.; Enquobahrie, Daniel A.; Laivuori, Hannele; van der Post, Joris A. M.; Ris-Stalpers, Carrie; Afink, Gijs B.

    2015-01-01

    Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia

  13. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS IN WATER

    Science.gov (United States)

    Hepatitis E virus (HEV) causes an infectious form of hepatitis associated with contaminated water. By analyzing the sequence of several HEV isolates, a reverse transciption-polymerase chain reaction method was developed and optimized that should be able to identify all of the kn...

  14. Microscopic and Molecular Tracing of Cryptosporidium Oocysts: Identifying a Possible Reservoir of Infection in Red Grouse

    Directory of Open Access Journals (Sweden)

    David Baines

    2017-11-01

    Full Text Available Infection by Cryptosporidium baileyi causes respiratory cryptosporidiosis in red grouse Lagopus lagopus scotica. First diagnosed in 2010, it has since been detected across half of moors managed for grouse shooting in northern England. We hypothesised that contaminated grouse faeces within communal trays visited by grouse containing grit coated with flubendazole, provided to control Trichostrongylus tenuis parasites of grouse, is a reservoir of infection. To establish the basis to this hypothesis, contents of 23 trays from a grouse moor were examined for Cryptosporidium oocysts. Contents were subjected to Immuno Magnetic Separation oocyst concentration techniques prior to examination by Immuno Fluorescence Antibody Test microscopy and molecular analysis on the 18S rRNA gene. Seven of 13 (54% grit trays known to be used by infected grouse were positive for Cryptosporidium by IMS-IFAT, compared to two of 10 (20% random background trays. Ten of the 13 (77% trays used by infected birds amplified positive for Cryptosporidium by Polymerase Chain Reaction and three of the 10 (30% random trays. All PCR amplified products sequenced matched with C. baileyi, with C. parvum also present in one tray. These data suggest that trays used to “worm” grouse may act as reservoirs of Cryptosporidium infection and their future design may need to be reconsidered to minimise contamination.

  15. Antimycobacterial drug discovery using Mycobacteria-infected amoebae identifies anti-infectives and new molecular targets.

    Science.gov (United States)

    Trofimov, Valentin; Kicka, Sébastien; Mucaria, Sabrina; Hanna, Nabil; Ramon-Olayo, Fernando; Del Peral, Laura Vela-Gonzalez; Lelièvre, Joël; Ballell, Lluís; Scapozza, Leonardo; Besra, Gurdyal S; Cox, Jonathan A G; Soldati, Thierry

    2018-03-02

    Tuberculosis remains a serious threat to human health world-wide, and improved efficiency of medical treatment requires a better understanding of the pathogenesis and the discovery of new drugs. In the present study, we performed a whole-cell based screen in order to complete the characterization of 168 compounds from the GlaxoSmithKline TB-set. We have established and utilized novel previously unexplored host-model systems to characterize the GSK compounds, i.e. the amoeboid organisms D. discoideum and A. castellanii, as well as a microglial phagocytic cell line, BV2. We infected these host cells with Mycobacterium marinum to monitor and characterize the anti-infective activity of the compounds with quantitative fluorescence measurements and high-content microscopy. In summary, 88.1% of the compounds were confirmed as antibiotics against M. marinum, 11.3% and 4.8% displayed strong anti-infective activity in, respectively, the mammalian and protozoan infection models. Additionally, in the two systems, 13-14% of the compounds displayed pro-infective activity. Our studies underline the relevance of using evolutionarily distant pathogen and host models in order to reveal conserved mechanisms of virulence and defence, respectively, which are potential "universal" targets for intervention. Subsequent mechanism of action studies based on generation of over-expresser M. bovis BCG strains, generation of spontaneous resistant mutants and whole genome sequencing revealed four new molecular targets, including FbpA, MurC, MmpL3 and GlpK.

  16. Identifying and Overcoming Barriers to Effective Consideration of Human and Organisational Factors in Event Analysis and Root Cause Analysis. Workshop Proceedings, September 21-22, 2009, Paris, France

    International Nuclear Information System (INIS)

    2011-01-01

    Nuclear licensees must have effective processes for learning from operating experience in order to manage safety, secure continuous improvement and defend against the potential for repeat events. These processes include root cause analysis (RCA) to identify the underlying causes of events and mechanisms to learn from these analyses and to implement improvements. Correctly identifying and correcting the causes of events will allow lessons to be learned and shared with others in the industry. The treatment of Human and Organisational Factors (HOF) in RCA is of special interest to WGHOF. It is estimated that approximately 60-80% of events in the nuclear industry can be attributed to human and organisational factors. Although the importance of correctly identifying the HOF causes is understood, there is still a tendency for the analysis to focus solely on the technical issues of the event. The history of prominent events across the major hazards sector shows that HOF lessons often fail to be learned. A NEA/CSNI special experts meeting entitled 'Identification of Barriers to Analyzing and Identifying Human and Organisational Factors in Root Cause Analysis' was held at the NEA Headquarters in Paris, France on September 21-22, 2009. A total of 17 participants from 10 countries representing licensee organisations, regulators, international organisations and an independent consultant attended the meeting. The meeting was structured to allow for small group discussions during which a number of themes were explored, followed by plenary discussion. There were also four papers presented which complemented the discussion themes. As set out in the objectives of this work, the participants identified barriers to the effective treatment of HOF in RCA and recommendations to mitigate the effects of these barriers. Many of the barriers and recommendations identified relate to the RCA process in general, not specifically to the treatment of HOF in the RCA process. This is logical, for

  17. Galactosemia: A strategy to identify new biochemical phenotypes and molecular genotypes

    Energy Technology Data Exchange (ETDEWEB)

    Elsas, L.J.; Langley, S.; Steele, E.; Evinger, J.; Brown, A.; Singh, R.; Fernhoff, P.; Hjelm, L.N.; Dembure, P.P.; Fridovich-Keil, J.L. [Emory Univ. School of Medicine, Atlanta, GA (United States)

    1995-03-01

    We describe a stratagem for identifying new mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. GALT enzyme activity and isoforms were defined in erythrocytes from probands and their first-degree relatives. If the biochemical phenotypes segregated in an autosomal recesssive pattern, we screened for common mutations by using multiplex PCR and restriction endonuclease digestions. If common mutant alleles were not present, the 11 exons of the GALT gene were amplified by PCR, and variations from the normal nucleotide sequences were identified by SSCP. The suspected region(s) was then analyzed by direct DNA sequencing. We identified 86 mutant GALT alleles that reduced erythrocyte GALT activity. Seventy-five of these GALT genomes had abnormal SSCP patterns, of which 41 were sequenced, yielding 12 new and 21 previously reported, rare mutations. Among the novel group of 12 new mutations, an unusual biochemical phenotype was found in a family whose newborn proband has classical galactosemia. He had inherited two mutations in cis (N314D-E204K) from his father, whose GALT activity was near normal, and an additional GALT mutation in the splice-acceptor site of intron C (IVSC) from his mother. The substitution of a positively charged E204K mutation created a unique isoform-banding pattern. An asymptomatic sister`s GALT genes carries three mutations (E203K-N314D/N314D) with eight distinct isoform bands. Surprisingly, her erythrocytes have normal GALT activity. We conclude that the synergism of pedigree, biochemical, SSCP, and direct GALT gene analyses is an efficient protocol for identifying new mutations and speculate that E203K and N314D codon changes produce intra-allelic complementation when in cis. 40 refs., 4 figs., 3 tabs.

  18. Genetic plasticity of the Shigella virulence plasmid is mediated by intra- and inter-molecular events between insertion sequences.

    Science.gov (United States)

    Pilla, Giulia; McVicker, Gareth; Tang, Christoph M

    2017-09-01

    Acquisition of a single copy, large virulence plasmid, pINV, led to the emergence of Shigella spp. from Escherichia coli. The plasmid encodes a Type III secretion system (T3SS) on a 30 kb pathogenicity island (PAI), and is maintained in a bacterial population through a series of toxin:antitoxin (TA) systems which mediate post-segregational killing (PSK). The T3SS imposes a significant cost on the bacterium, and strains which have lost the plasmid and/or genes encoding the T3SS grow faster than wild-type strains in the laboratory, and fail to bind the indicator dye Congo Red (CR). Our aim was to define the molecular events in Shigella flexneri that cause loss of Type III secretion (T3S), and to examine whether TA systems exert positional effects on pINV. During growth at 37°C, we found that deletions of regions of the plasmid including the PAI lead to the emergence of CR-negative colonies; deletions occur through intra-molecular recombination events between insertion sequences (ISs) flanking the PAI. Furthermore, by repositioning MvpAT (which belongs to the VapBC family of TA systems) near the PAI, we demonstrate that the location of this TA system alters the rearrangements that lead to loss of T3S, indicating that MvpAT acts both globally (by reducing loss of pINV through PSK) as well as locally (by preventing loss of adjacent sequences). During growth at environmental temperatures, we show for the first time that pINV spontaneously integrates into different sites in the chromosome, and this is mediated by inter-molecular events involving IS1294. Integration leads to reduced PAI gene expression and impaired secretion through the T3SS, while excision of pINV from the chromosome restores T3SS function. Therefore, pINV integration provides a reversible mechanism for Shigella to circumvent the metabolic burden imposed by pINV. Intra- and inter-molecular events between ISs, which are abundant in Shigella spp., mediate plasticity of S. flexneri pINV.

  19. Morphological and molecular methods to identify butternut (Juglans cinerea) and butternut hybrids: relevance to butternut conservation.

    Science.gov (United States)

    Ross-Davis, Amy; Huang, Zhonglian; McKenna, James; Ostry, Michael; Woeste, Keith

    2008-07-01

    Butternut (Juglans cinerea L.) is a native, cold-tolerant, hard-mast species formerly valued for its nuts and wood, which is now endangered. The most immediate threat to butternut restoration is the spread of butternut canker disease, caused by the exotic fungus Sirococcus clavigignenti-juglandacearum Nair, Kostichka & Kuntz. Other threats include the hybridization of butternut with the exotic Japanese walnut (Juglans ailantifolia Carr.) and poor regeneration. The hybrids, known as buartnuts, are vegetatively vigorous, highly fecund, more resistant than butternut to butternut canker disease and difficult to identify. We review the vegetative and reproductive morphological traits that distinguish butternut from hybrids and identify those that can be used by field biologists to separate the taxa. No single trait was sufficient to separate butternut from hybrids, but pith color, lenticel size, shape and abundance, and the presence or absence of a notch in the upper margin of leaf scars, can be used in combination with other traits to identify butternuts and exclude most hybrids. In at least one butternut population, reduced symptoms of butternut canker disease were significantly associated with a dark barked phenotype. We also describe two randomly amplified polymorphic DNA (RAPD) markers that differentiate butternuts from hybrids based on DNA polymorphism. Together, these results should assist in the identification and testing of non-hybrid butternut for breeding and reintroduction of the species to its former habitats.

  20. A study on method to identify actual causes and conditions of safety rule deviations through analyzing events due to unsafe acts of workers

    International Nuclear Information System (INIS)

    Hirotsu, Yuko; Takeda, Daisuke

    2010-01-01

    The purpose of this study is to establish a method to understand actual causes and condition of intentional deviation from safety rules (including norm and written rules that has developed to anticipate, prevent, detect and recover human errors) in an organization by analyzing events due to unsafe acts of workers (human factor events) and to propose effective measures. Firstly, by reviewing literature regarding safety violations, the following two advantages of investigating actual condition of safety rule deviation through human factor event analysis were extracted, such as (a) being able to clarify relationships between deviations, human errors, and events, and (b) being able to identify specific causal factors that influenced the decision to deviate, including acts of people concerned, problems with rules, task demands, environment and management. Next, through the analysis of human factor event data in accordance with existing human error analysis method on the basis of advantages above, the following three requirements for analyzing event data were extracted, such as (a) gathering information such as rules concerning to the work activities related to the human factor events, and whether there are intentional deviations of the rules, (b) gathering information and identify interrelations among causal factors of the intentional deviations, and (c) gathering information on general condition of deviations and the causal factors. (author)

  1. A systems biology pipeline identifies new immune and disease related molecular signatures and networks in human cells during microgravity exposure.

    Science.gov (United States)

    Mukhopadhyay, Sayak; Saha, Rohini; Palanisamy, Anbarasi; Ghosh, Madhurima; Biswas, Anupriya; Roy, Saheli; Pal, Arijit; Sarkar, Kathakali; Bagh, Sangram

    2016-05-17

    Microgravity is a prominent health hazard for astronauts, yet we understand little about its effect at the molecular systems level. In this study, we have integrated a set of systems-biology tools and databases and have analysed more than 8000 molecular pathways on published global gene expression datasets of human cells in microgravity. Hundreds of new pathways have been identified with statistical confidence for each dataset and despite the difference in cell types and experiments, around 100 of the new pathways are appeared common across the datasets. They are related to reduced inflammation, autoimmunity, diabetes and asthma. We have identified downregulation of NfκB pathway via Notch1 signalling as new pathway for reduced immunity in microgravity. Induction of few cancer types including liver cancer and leukaemia and increased drug response to cancer in microgravity are also found. Increase in olfactory signal transduction is also identified. Genes, based on their expression pattern, are clustered and mathematically stable clusters are identified. The network mapping of genes within a cluster indicates the plausible functional connections in microgravity. This pipeline gives a new systems level picture of human cells under microgravity, generates testable hypothesis and may help estimating risk and developing medicine for space missions.

  2. A systems biology pipeline identifies new immune and disease related molecular signatures and networks in human cells during microgravity exposure

    Science.gov (United States)

    Mukhopadhyay, Sayak; Saha, Rohini; Palanisamy, Anbarasi; Ghosh, Madhurima; Biswas, Anupriya; Roy, Saheli; Pal, Arijit; Sarkar, Kathakali; Bagh, Sangram

    2016-05-01

    Microgravity is a prominent health hazard for astronauts, yet we understand little about its effect at the molecular systems level. In this study, we have integrated a set of systems-biology tools and databases and have analysed more than 8000 molecular pathways on published global gene expression datasets of human cells in microgravity. Hundreds of new pathways have been identified with statistical confidence for each dataset and despite the difference in cell types and experiments, around 100 of the new pathways are appeared common across the datasets. They are related to reduced inflammation, autoimmunity, diabetes and asthma. We have identified downregulation of NfκB pathway via Notch1 signalling as new pathway for reduced immunity in microgravity. Induction of few cancer types including liver cancer and leukaemia and increased drug response to cancer in microgravity are also found. Increase in olfactory signal transduction is also identified. Genes, based on their expression pattern, are clustered and mathematically stable clusters are identified. The network mapping of genes within a cluster indicates the plausible functional connections in microgravity. This pipeline gives a new systems level picture of human cells under microgravity, generates testable hypothesis and may help estimating risk and developing medicine for space missions.

  3. Microaerophilic conditions permit to mimic in vitro events occurring during in vivo Helicobacter pylori infection and to identify Rho/Ras-associated proteins in cellular signaling.

    Science.gov (United States)

    Cottet, Sandra; Corthésy-Theulaz, Irène; Spertini, François; Corthésy, Blaise

    2002-09-13

    Molecular dissection of the mechanisms underlying Helicobacter pylori infection suffers from the lack of in vitro systems mimicking in vivo observations. A system was developed whereby human epithelial cells (Caco-2) grown as polarized monolayers and bacteria can communicate with each other under culture conditions optimal for each partner. Caco-2 cells grown on filter supports were inserted in a vertical position into diffusion chambers equilibrated with air and 5% CO(2) at their basolateral surface (aerophilic conditions) and 5% CO(2), 5% O(2), 90% N(2) (microaerophilic conditions) in the apical compartment. Remarkably, the epithelial polarized layer was stable under these asymmetric culture conditions for at least 24 h, and the presence of Caco-2 cells was necessary to maintain H. pylori growth. In contrast to previous studies conducted with non-polarized Caco-2 cells and other cell lines kept under aerophilic conditions, we found H. pylori-dependent stimulation of cytokine secretion (MCP-1 (monocyte chemoattractant protein-1), GRO-alpha (growth-regulated oncogene-alpha), RANTES (regulated on activation normal T cell expressed and secreted)). This correlated with nuclear translocation of NF-kappaB p50 and p65 subunits. Tyrosine phosphorylation of nine cellular proteins was induced or enhanced; we identified p120(RasGAP), p190(RhoGAP), p62dok (downstream of tyrosine kinases), and cortactin as H. pylori-inducible targets. Moreover, reduction of H. pylori urease expression was observed in adherent bacteria as compared with bacteria in suspension. In addition to mimicking several observations seen in the inflamed gastric mucosa, the novel in vitro system was allowed to underscore complex cellular events not seen in classical in vitro analyses of microaerophilic bacteria-epithelial cell cross-talk.

  4. Quantum Mechanics/Molecular Mechanics Simulations Identify the Ring-Opening Mechanism of Creatininase.

    Science.gov (United States)

    Jitonnom, Jitrayut; Mujika, Jon I; van der Kamp, Marc W; Mulholland, Adrian J

    2017-12-05

    Creatininase catalyzes the conversion of creatinine (a biosensor for kidney function) to creatine via a two-step mechanism: water addition followed by ring opening. Water addition is common to other known cyclic amidohydrolases, but the precise mechanism for ring opening is still under debate. The proton donor in this step is either His178 or a water molecule bound to one of the metal ions, and the roles of His178 and Glu122 are unclear. Here, the two possible reaction pathways have been fully examined by means of combined quantum mechanics/molecular mechanics simulations at the SCC-DFTB/CHARMM22 level of theory. The results indicate that His178 is the main catalytic residue for the whole reaction and explain its role as proton shuttle during the ring-opening step. In the first step, His178 provides electrostatic stabilization to the gem-diolate tetrahedral intermediate. In the second step, His178 abstracts the hydroxyl proton of the intermediate and delivers it to the cyclic amide nitrogen, leading to ring opening. The latter is the rate-limiting step with a free energy barrier of 18.5 kcal/mol, in agreement with the experiment. We find that Glu122 must be protonated during the enzyme reaction, so that it can form a stable hydrogen bond with its neighboring water molecule. Simulations of the E122Q mutant showed that this replacement disrupts the H-bond network formed by three conserved residues (Glu34, Ser78, and Glu122) and water, increasing the energy barrier. Our computational studies provide a comprehensive explanation for previous structural and kinetic observations, including why the H178A mutation causes a complete loss of activity but the E122Q mutation does not.

  5. Molecular Method Development to Identify Foodborne Sarcocystishominis in Raw Beef Commercial Hamburger

    Directory of Open Access Journals (Sweden)

    Bahador Hajimohammadi

    2014-11-01

    Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.

  6. A Network of AOPs for reduced thyroid hormone synthesis derived from inhibition of Thyroperoxidase - A common Molecular Initiating Event Leading to Species-Specific Indices of Adversity.

    Science.gov (United States)

    This collection of 3 AOPs describe varying outcomes of adversity dependent upon species in response to inhibition of thyroperoxidase (TPO) during development. Chemical inhibition of TPO, the molecular-initiating event (MIE), results in decreased thyroid hormone (TH) synthesis, a...

  7. Identifying Genetic Hotspots by Mapping Molecular Diversity of Widespread Trees: When Commonness Matters.

    Science.gov (United States)

    Souto, Cintia P; Mathiasen, Paula; Acosta, María Cristina; Quiroga, María Paula; Vidal-Russell, Romina; Echeverría, Cristian; Premoli, Andrea C

    2015-01-01

    Conservation planning requires setting priorities at the same spatial scale at which decision-making processes are undertaken considering all levels of biodiversity, but current methods for identifying biodiversity hotspots ignore its genetic component. We developed a fine-scale approach based on the definition of genetic hotspots, which have high genetic diversity and unique variants that represent their evolutionary potential and evolutionary novelties. Our hypothesis is that wide-ranging taxa with similar ecological tolerances, yet of phylogenetically independent lineages, have been and currently are shaped by ecological and evolutionary forces that result in geographically concordant genetic patterns. We mapped previously published genetic diversity and unique variants of biparentally inherited markers and chloroplast sequences for 9 species from 188 and 275 populations, respectively, of the 4 woody dominant families of the austral temperate forest, an area considered a biodiversity hotspot. Spatial distribution patterns of genetic polymorphisms differed among taxa according to their ecological tolerances. Eight genetic hotspots were detected and we recommend conservation actions for some in the southern Coastal Range in Chile. Existing spatially explicit genetic data from multiple populations and species can help to identify biodiversity hotspots and guide conservation actions to establish science-based protected areas that will preserve the evolutionary potential of key habitats and species. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Identifying deliberate attempts to fake memory impairment through the combined use of reaction time and event-related potential measures

    NARCIS (Netherlands)

    van Hooff, Johanna C.; Sargeant, Elizabeth; Foster, Jonathan K.; Schmand, Ben A.

    2009-01-01

    The central aim of this study was to evaluate the value of reaction time (RT) measures and event-related potentials (ERPs) for the assessment of simulated memory impairment. In two identical experiments (N = 24), healthy volunteers carried out an adapted version of the Amsterdam Short-Term Memory

  9. Bagging grey swans : A supply network approach to identifying and managing low-probability high-impact supply chain events

    NARCIS (Netherlands)

    Rossetti, Christian; Akkermans, Henk; Bhakoo, Vikram; Carnovale, Steven

    Over the past decade practitioners and researchers have become increasingly focused on managing risks in extended supply chains. Whether these risks involve supply disruptions, financial liabilities for a supplier’s actions, or large market shifts; Grey Swan events, defined as unforeseen

  10. Integrated analysis of the molecular action of Vorinostat identifies epi-sensitised targets for combination therapy.

    Science.gov (United States)

    Hay, Jodie F; Lappin, Katrina; Liberante, Fabio; Kettyle, Laura M; Matchett, Kyle B; Thompson, Alexander; Mills, Ken I

    2017-09-15

    Several histone deacetylase inhibitors including Vorinostat have received FDA approval for the treatment of haematological malignancies. However, data from these trials indicate that Vorinostat has limited efficacy as a monotherapy, prompting the need for rational design of combination therapies. A number of epi-sensitised pathways, including sonic hedgehog (SHH), were identified in AML cells by integration of global patterns of histone H3 lysine 9 (H3K9) acetylation with transcriptomic analysis following Vorinostat-treatment. Direct targeting of the SHH pathway with SANT-1, following Vorinostat induced epi-sensitisation, resulted in synergistic cell death of AML cells. In addition, xenograft studies demonstrated that combination therapy induced a marked reduction in leukemic burden compared to control or single agents. Together, the data supports epi-sensitisation as a potential component of the strategy for the rational development of combination therapies in AML.

  11. Clinical and molecular characterization of a novel INS mutation identified in patients with MODY phenotype.

    Science.gov (United States)

    Piccini, Barbara; Artuso, Rosangela; Lenzi, Lorenzo; Guasti, Monica; Braccesi, Giulia; Barni, Federica; Casalini, Emilio; Giglio, Sabrina; Toni, Sonia

    2016-11-01

    Correct diagnosis of Maturity-Onset Diabetes of the Young (MODY) is based on genetic tests requiring an appropriate subject selection by clinicians. Mutations in the insulin (INS) gene rarely occur in patients with MODY. This study is aimed at determining the genetic background and clinical phenotype in patients with suspected MODY. 34 patients with suspected MODY, negative for mutations in the GCK, HNF1α, HNF4α, HNF1β and PDX1 genes, were screened by next generation sequencing (NGS). A heterozygous INS mutation was identified in 4 members of the same family. First genetic tests performed identified two heterozygous silent nucleotide substitutions in MODY3/HNF1α gene. An ineffective attempt to suspend insulin therapy, administering repaglinide and sulphonylureas, was made. DNA was re-sequenced by NGS investigating a set of 102 genes. Genes implicated in the pathway of pancreatic β-cells, candidate genes for type 2 diabetes mellitus and genes causative of diabetes in mice were selected. A novel heterozygous variant in human preproinsulin INS gene (c.125T > C) was found in the affected family members. The new INS mutation broadens the spectrum of possible INS phenotypes. Screening for INS mutations is warranted not only in neonatal diabetes but also in MODYx patients and in selected patients with type 1 diabetes mellitus negative for autoantibodies. Subjects with complex diseases without a specific phenotype should be studied by NGS because Sanger sequencing is ineffective and time consuming in detecting rare variants. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  12. A molecular systems approach to modelling human skin pigmentation: identifying underlying pathways and critical components.

    Science.gov (United States)

    Raghunath, Arathi; Sambarey, Awanti; Sharma, Neha; Mahadevan, Usha; Chandra, Nagasuma

    2015-04-29

    Ultraviolet radiations (UV) serve as an environmental stress for human skin, and result in melanogenesis, with the pigment melanin having protective effects against UV induced damage. This involves a dynamic and complex regulation of various biological processes that results in the expression of melanin in the outer most layers of the epidermis, where it can exert its protective effect. A comprehensive understanding of the underlying cross talk among different signalling molecules and cell types is only possible through a systems perspective. Increasing incidences of both melanoma and non-melanoma skin cancers necessitate the need to better comprehend UV mediated effects on skin pigmentation at a systems level, so as to ultimately evolve knowledge-based strategies for efficient protection and prevention of skin diseases. A network model for UV-mediated skin pigmentation in the epidermis was constructed and subjected to shortest path analysis. Virtual knock-outs were carried out to identify essential signalling components. We describe a network model for UV-mediated skin pigmentation in the epidermis. The model consists of 265 components (nodes) and 429 directed interactions among them, capturing the manner in which one component influences the other and channels information. Through shortest path analysis, we identify novel signalling pathways relevant to pigmentation. Virtual knock-outs or perturbations of specific nodes in the network have led to the identification of alternate modes of signalling as well as enabled determining essential nodes in the process. The model presented provides a comprehensive picture of UV mediated signalling manifesting in human skin pigmentation. A systems perspective helps provide a holistic purview of interconnections and complexity in the processes leading to pigmentation. The model described here is extensive yet amenable to expansion as new data is gathered. Through this study, we provide a list of important proteins essential

  13. Rational approach to identify newer caspase-1 inhibitors using pharmacophore based virtual screening, docking and molecular dynamic simulation studies.

    Science.gov (United States)

    Patel, Shivani; Modi, Palmi; Chhabria, Mahesh

    2018-05-01

    Caspase-1 is a key endoprotease responsible for the post-translational processing of pro-inflammatory cytokines IL-1β, 18 & 33. Excessive secretion of IL-1β leads to numerous inflammatory and autoimmune diseases. Thus caspase-1 inhibition would be considered as an important therapeutic strategy for development of newer anti-inflammatory agents. Here we have employed an integrated virtual screening by combining pharmacophore mapping and docking to identify small molecules as caspase-1 inhibitors. The ligand based 3D pharmacophore model was generated having the essential structural features of (HBA, HY & RA) using a data set of 27 compounds. A validated pharmacophore hypothesis (Hypo 1) was used to screen ZINC and Minimaybridge chemical databases. The retrieved virtual hits were filtered by ADMET properties and molecular docking analysis. Subsequently, the cross-docking study was also carried out using crystal structure of caspase-1, 3, 7 and 8 to identify the key residual interaction for specific caspase-1 inhibition. Finally, the best mapped and top scored (ZINC00885612, ZINC72003647, BTB04175 and BTB04410) molecules were subjected to molecular dynamics simulation for accessing the dynamic structure of protein after ligand binding. This study identifies the most promising hits, which can be leads for the development of novel caspase-1 inhibitors as anti-inflammatory agents. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. The role of stable α-synuclein oligomers in the molecular events underlying amyloid formation

    DEFF Research Database (Denmark)

    Lorenzen, Nikolai; Nielsen, Søren Bang; Buell, Alexander K.

    2014-01-01

    α-synuclein (αSN), whose aggregation is strongly implicated in the development of Parkinson’s disease (PD). The two types of oligomers are both formed under conditions where amyloid fibril formation is observed but differ in molecular weight by an order of magnitude. Both possess a degree of β......, either as precursors of fibrils or as species involved in the fibril elongation process or instead if they are associated with an aggregation process that is distinct from that generating mature fibrils. Here we describe and characterize in detail two well-defined oligomeric species formed by the protein...

  15. Integrative Bioinformatic Analysis of Transcriptomic Data Identifies Conserved Molecular Pathways Underlying Ionizing Radiation-Induced Bystander Effects (RIBE

    Directory of Open Access Journals (Sweden)

    Constantinos Yeles

    2017-11-01

    Full Text Available Ionizing radiation-induced bystander effects (RIBE encompass a number of effects with potential for a plethora of damages in adjacent non-irradiated tissue. The cascade of molecular events is initiated in response to the exposure to ionizing radiation (IR, something that may occur during diagnostic or therapeutic medical applications. In order to better investigate these complex response mechanisms, we employed a unified framework integrating statistical microarray analysis, signal normalization, and translational bioinformatics functional analysis techniques. This approach was applied to several microarray datasets from Gene Expression Omnibus (GEO related to RIBE. The analysis produced lists of differentially expressed genes, contrasting bystander and irradiated samples versus sham-irradiated controls. Furthermore, comparative molecular analysis through BioInfoMiner, which integrates advanced statistical enrichment and prioritization methodologies, revealed discrete biological processes, at the cellular level. For example, the negative regulation of growth, cellular response to Zn2+-Cd2+, and Wnt and NIK/NF-kappaB signaling, thus refining the description of the phenotypic landscape of RIBE. Our results provide a more solid understanding of RIBE cell-specific response patterns, especially in the case of high-LET radiations, like α-particles and carbon-ions.

  16. A molecular method to detect and identify the native species of southwestern Atlantic Crassostrea (Mollusca: Ostreidae

    Directory of Open Access Journals (Sweden)

    Sandra Ludwig

    2011-08-01

    Full Text Available Among oysters, species of Crassostrea (Sacco, 1897 are the most attractive to aquaculture. In Brazil, the genus is represented by C. rhizophorae (Guilding, 1828 and C. brasiliana (Lamarck, 1819. Because the maturation and breeding technology is not well developed for these species, aquaculturists need a reliable method to decide the correct time to place spat collectors in the field, and to identify both species, which are morphologically similar. In this study a specific Multiplex PCR protocol was developed, using one pair of universal primers from 18S rDNA as a positive control and a pair of specific primers for each target species. The sensitivity and specificity of the protocol was evaluated. It detected C. rhizophorae DNA in low concentrations, and C. brasiliana DNA in even lower concentrations. Further, the Multiplex PCR proved efficient in detecting DNA in concentrations equivalent to that of a single larva of each species, either separated or combined, when mixed with total DNA extract of a plankton sample representing 1000 L of filtered water. Field tests confirmed the applicability of the protocol, which holds the promise to become an important tool for aquaculture or conservation programs, allowing for the continuous monitoring of the life cycle of C. brasiliana and C. rhizophorae, by detecting the right periods of larval release and settlement.

  17. Distinct forms of the β subunit of GTP-binding regulatory proteins identified by molecular cloning

    International Nuclear Information System (INIS)

    Fong, H.K.W.; Amatruda, T.T. III; Birren, B.W.; Simon, M.I.

    1987-01-01

    Two distinct β subunits of guanine nucleotide-binding regulatory proteins have been identified by cDNA cloning and are referred to as β 1 and β 1 subunits. The bovine transducin β subunit (β 1 ) has been cloned previously. The author now isolated and analyzed cDNA clones that encode the β 2 subunit from bovine adrenal, bovine brain, and a human myeloid leukemia cell line, HL-60. The 340-residue M/sub r/ 37,329 Β 2 protein is 90% identical with β 1 in predicted amino acid sequence, and it is also organized as a series of repetitive homologous segments. The major mRNA that encodes the bovine β 2 subunit is 1.7 kilobases in length. It is expressed at lower levels than β 1 subunit mRNA in all tissues examined. The β 1 and β 2 messages are expressed in cloned human cell lines. Hybridization of cDNA probes to bovine DNA showed that β 1 and β 2 are encoded by separate genes. The amino acid sequences for the bovine and human β 2 subunit are identical, as are the amino acid sequences for the bovine and human β 1 subunit. This evolutionary conservation suggests that the two β subunits have different roles in the signal transduction process

  18. Molecular characterization of a new efficiently transducing bacteriophage identified in meticillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Varga, Marian; Pantůček, Roman; Růžičková, Vladislava; Doškař, Jirˇí

    2016-01-01

    In Staphylococcus aureus, generalized transduction mediated by temperate bacteriophages represents a highly efficient way of transferring antibiotic resistance genes between strains. In the present study, we identified and characterized in detail a new efficiently transducing bacteriophage of the family Siphoviridae, designated ϕJB, which resides as a prophage in the meticillin-resistant S. aureus (MRSA) strain Jevons B. Whole-genome sequencing followed by detailed in silico analysis uncovered a linear dsDNA genome consisting of 43 ,12 bp and comprising 70 ORFs, of which ∼40 encoded proteins with unknown function. A global genome alignment of ϕJB and other efficiently transducing phages ϕ11, ϕ53, ϕ80, ϕ80α and ϕNM4 showed a high degree of homology with ϕNM4 and substantial differences with regard to other phages. Using a model transduction system with a well-defined donor and recipient, ϕJB transferred the tetracycline resistance plasmid pT181 and a penicillinase plasmid with outstanding frequencies, beating most of the above-mentioned phages by an order of magnitude. Moreover, ϕJB demonstrated high frequencies of transferring antibiotic resistance plasmids even upon induction from a lysogenic donor strain. Considering such transducing potential, ϕJB and related bacteriophages may serve as a suitable tool for elucidating the nature of transduction and its contribution to the spread of antibiotic resistance genes in naturally occurring MRSA populations.

  19. Identifying the pattern of molecular evolution for Zaire ebolavirus in the 2014 outbreak in West Africa.

    Science.gov (United States)

    Liu, Si-Qing; Deng, Cheng-Lin; Yuan, Zhi-Ming; Rayner, Simon; Zhang, Bo

    2015-06-01

    The current Ebola virus disease (EVD) epidemic has killed more than all previous Ebola outbreaks combined and, even as efforts appear to be bringing the outbreak under control, the threat of reemergence remains. The availability of new whole-genome sequences from West Africa in 2014 outbreak, together with those from the earlier outbreaks, provide an opportunity to investigate the genetic characteristics, the epidemiological dynamics and the evolutionary history for Zaire ebolavirus (ZEBOV). To investigate the evolutionary properties of ZEBOV in this outbreak, we examined amino acid mutations, positive selection, and evolutionary rates on the basis of 123 ZEBOV genome sequences. The estimated phylogenetic relationships within ZEBOV revealed that viral sequences from the same period or location formed a distinct cluster. The West Africa viruses probably derived from Middle Africa, consistent with results from previous studies. Analysis of the seven protein regions of ZEBOV revealed evidence of positive selection acting on the GP and L genes. Interestingly, all putatively positive-selected sites identified in the GP are located within the mucin-like domain of the solved structure of the protein, suggesting a possible role in the immune evasion properties of ZEBOV. Compared with earlier outbreaks, the evolutionary rate of GP gene was estimated to significantly accelerate in the 2014 outbreak, suggesting that more ZEBOV variants are generated for human to human transmission during this sweeping epidemic. However, a more balanced sample set and next generation sequencing datasets would help achieve a clearer understanding at the genetic level of how the virus is evolving and adapting to new conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. A concerted kinase interplay identifies PPARgamma as a molecular target of ghrelin signaling in macrophages.

    Directory of Open Access Journals (Sweden)

    Annie Demers

    2009-11-01

    Full Text Available The peroxisome proliferator-activator receptor PPARgamma plays an essential role in vascular biology, modulating macrophage function and atherosclerosis progression. Recently, we have described the beneficial effect of combined activation of the ghrelin/GHS-R1a receptor and the scavenger receptor CD36 to induce macrophage cholesterol release through transcriptional activation of PPARgamma. Although the interplay between CD36 and PPARgamma in atherogenesis is well recognized, the contribution of the ghrelin receptor to regulate PPARgamma remains unknown. Here, we demonstrate that ghrelin triggers PPARgamma activation through a concerted signaling cascade involving Erk1/2 and Akt kinases, resulting in enhanced expression of downstream effectors LXRalpha and ABC sterol transporters in human macrophages. These effects were associated with enhanced PPARgamma phosphorylation independently of the inhibitory conserved serine-84. Src tyrosine kinase Fyn was identified as being recruited to GHS-R1a in response to ghrelin, but failure of activated Fyn to enhance PPARgamma Ser-84 specific phosphorylation relied on the concomitant recruitment of docking protein Dok-1, which prevented optimal activation of the Erk1/2 pathway. Also, substitution of Ser-84 preserved the ghrelin-induced PPARgamma activity and responsiveness to Src inhibition, supporting a mechanism independent of Ser-84 in PPARgamma response to ghrelin. Consistent with this, we found that ghrelin promoted the PI3-K/Akt pathway in a Galphaq-dependent manner, resulting in Akt recruitment to PPARgamma, enhanced PPARgamma phosphorylation and activation independently of Ser-84, and increased expression of LXRalpha and ABCA1/G1. Collectively, these results illustrate a complex interplay involving Fyn/Dok-1/Erk and Galphaq/PI3-K/Akt pathways to transduce in a concerted manner responsiveness of PPARgamma to ghrelin in macrophages.

  1. Phylogenetic and molecular epidemiological studies reveal evidence of multiple past recombination events between infectious laryngotracheitis viruses.

    Directory of Open Access Journals (Sweden)

    Sang-Won Lee

    Full Text Available In contrast to the RNA viruses, the genome of large DNA viruses such as herpesviruses have been considered to be relatively stable. Intra-specific recombination has been proposed as an important, but underestimated, driving force in herpesvirus evolution. Recently, two distinct field strains of infectious laryngotracheitis virus (ILTV have been shown to have arisen from independent recombination events between different commercial ILTV vaccines. In this study we sequenced the genomes of additional ILTV strains and also utilized other recently updated complete genome sequences of ILTV to confirm the existence of a number of ILTV recombinants in nature. Multiple recombination events were detected in the unique long and repeat regions of the genome, but not in the unique short region. Most recombinants contained a pair of crossover points between two distinct lineages of ILTV, corresponding to the European origin and the Australian origin vaccine strains of ILTV. These results suggest that there are two distinct genotypic lineages of ILTV and that these commonly recombine in the field.

  2. Molecular analysis of expansion, differentiation, and growth factor treatment of human chondrocytes identifies differentiation markers and growth-related genes.

    Science.gov (United States)

    Benz, Karin; Breit, Stephen; Lukoschek, Martin; Mau, Hans; Richter, Wiltrud

    2002-04-26

    This study is intended to optimise expansion and differentiation of cultured human chondrocytes by growth factor application and to identify molecular markers to monitor their differentiation state. We dissected the molecular consequences of matrix release, monolayer, and 3D-alginate culture, growth factor optimised expansion, and re-differentiation protocols by gene expression analysis. Among 19 common cartilage molecules assessed by cDNA array, six proved best to monitor differentiation. Instant down-regulation at release of cells from the matrix was strongest for COL 2A1, fibromodulin, and PRELP while LUM, CHI3L1, and CHI3L2 were expansion-related. Both gene sets reflected the physiologic effects of the most potent growth-inducing (PDGF-BB) and proteoglycan-inducing (BMP-4) factors. Only CRTAC1 expression correlated with 2D/3D switches while the molecular phenotype of native chondrocytes was not restored. The markers and optimised protocols we suggest can help to improve cell therapy of cartilage defects and chondrocyte differentiation from stem cell sources.

  3. A comprehensive molecular study on Coffin-Siris and Nicolaides-Baraitser syndromes identifies a broad molecular and clinical spectrum converging on altered chromatin remodeling.

    Science.gov (United States)

    Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Steiner-Haldenstätt, Sabine; Pohl, Esther; Li, Yun; Milz, Esther; Martin, Marcel; Thiele, Holger; Altmüller, Janine; Alanay, Yasemin; Kayserili, Hülya; Klein-Hitpass, Ludger; Böhringer, Stefan; Wollstein, Andreas; Albrecht, Beate; Boduroglu, Koray; Caliebe, Almuth; Chrzanowska, Krystyna; Cogulu, Ozgur; Cristofoli, Francesca; Czeschik, Johanna Christina; Devriendt, Koenraad; Dotti, Maria Teresa; Elcioglu, Nursel; Gener, Blanca; Goecke, Timm O; Krajewska-Walasek, Malgorzata; Guillén-Navarro, Encarnación; Hayek, Joussef; Houge, Gunnar; Kilic, Esra; Simsek-Kiper, Pelin Özlem; López-González, Vanesa; Kuechler, Alma; Lyonnet, Stanislas; Mari, Francesca; Marozza, Annabella; Mathieu Dramard, Michèle; Mikat, Barbara; Morin, Gilles; Morice-Picard, Fanny; Ozkinay, Ferda; Rauch, Anita; Renieri, Alessandra; Tinschert, Sigrid; Utine, G Eda; Vilain, Catheline; Vivarelli, Rossella; Zweier, Christiane; Nürnberg, Peter; Rahmann, Sven; Vermeesch, Joris; Lüdecke, Hermann-Josef; Zeschnigk, Michael; Wollnik, Bernd

    2013-12-20

    Chromatin remodeling complexes are known to modify chemical marks on histones or to induce conformational changes in the chromatin in order to regulate transcription. De novo dominant mutations in different members of the SWI/SNF chromatin remodeling complex have recently been described in individuals with Coffin-Siris (CSS) and Nicolaides-Baraitser (NCBRS) syndromes. Using a combination of whole-exome sequencing, NGS-based sequencing of 23 SWI/SNF complex genes, and molecular karyotyping in 46 previously undescribed individuals with CSS and NCBRS, we identified a de novo 1-bp deletion (c.677delG, p.Gly226Glufs*53) and a de novo missense mutation (c.914G>T, p.Cys305Phe) in PHF6 in two individuals diagnosed with CSS. PHF6 interacts with the nucleosome remodeling and deacetylation (NuRD) complex implicating dysfunction of a second chromatin remodeling complex in the pathogenesis of CSS-like phenotypes. Altogether, we identified mutations in 60% of the studied individuals (28/46), located in the genes ARID1A, ARID1B, SMARCB1, SMARCE1, SMARCA2, and PHF6. We show that mutations in ARID1B are the main cause of CSS, accounting for 76% of identified mutations. ARID1B and SMARCB1 mutations were also found in individuals with the initial diagnosis of NCBRS. These individuals apparently belong to a small subset who display an intermediate CSS/NCBRS phenotype. Our proposed genotype-phenotype correlations are important for molecular screening strategies.

  4. Molecular events by which dendritic cells promote Th2 immune protection in helmith infection.

    Science.gov (United States)

    Méndez-Samperio, Patricia

    2016-10-01

    Helminth parasites are a major cause of global infectious diseases, affecting nearly one quarter of the world's population. The common feature of helminth infections is to skew the immune system towards a T-helper 2 (Th2) response that helps to control disease. Dendritic cells (DCs), which are professional antigen-presenting cells, play a critical role for Th2 skewing against helminth parasites. However, the molecular mechanisms by which helminth antigens activate DCs for Th2 polarization have not yet been clearly defined. This review provides a focused update on the major role of DCs for inducing and/or enhancing Th2 immune responses in helminthic infection and will discuss the main signalling-dependent and independent mechanisms by which helminth antigens activate DCs for Th2 skewing.

  5. MelanomaDB: a Web Tool for Integrative Analysis of Melanoma Genomic Information to Identify Disease-Associated Molecular Pathways

    Directory of Open Access Journals (Sweden)

    Alexander Joseph Trevarton

    2013-07-01

    Full Text Available Despite on-going research, metastatic melanoma survival rates remain low and treatment options are limited. Researchers can now access a rapidly growing amount of molecular and clinical information about melanoma. This information is becoming difficult to assemble and interpret due to its dispersed nature, yet as it grows it becomes increasingly valuable for understanding melanoma. Integration of this information into a comprehensive resource to aid rational experimental design and patient stratification is needed. As an initial step in this direction, we have assembled a web-accessible melanoma database, MelanomaDB, which incorporates clinical and molecular data from publically available sources, which will be regularly updated as new information becomes available. This database allows complex links to be drawn between many different aspects of melanoma biology: genetic changes (e.g. mutations in individual melanomas revealed by DNA sequencing, associations between gene expression and patient survival, data concerning drug targets, biomarkers, druggability and clinical trials, as well as our own statistical analysis of relationships between molecular pathways and clinical parameters that have been produced using these data sets. The database is freely available at http://genesetdb.auckland.ac.nz/melanomadb/about.html . A subset of the information in the database can also be accessed through a freely available web application in the Illumina genomic cloud computing platform BaseSpace at http://www.biomatters.com/apps/melanoma-profiler-for-research . This illustrates dysregulation of specific signalling pathways, both across 310 exome-sequenced melanomas and in individual tumours and identifies novel features about the distribution of somatic variants in melanoma. We suggest that this database can provide a context in which to interpret the tumour molecular profiles of individual melanoma patients relative to biological information and available

  6. Analogies Between Digital Radio and Chemical Orthogonality as a Method for Enhanced Analysis of Molecular Recognition Events

    Directory of Open Access Journals (Sweden)

    Sang-Hun Lee

    2008-02-01

    Full Text Available Acoustic wave biosensors are a real-time, label-free biosensor technology, which have been exploited for the detection of proteins and cells. One of the conventional biosensor approaches involves the immobilization of a monolayer of antibodies onto the surface of the acoustic wave device for the detection of a specific analyte. The method described within includes at least two immobilizations of two different antibodies onto the surfaces of two separate acoustic wave devices for the detection of several analogous analytes. The chemical specificity of the molecular recognition event is achieved by virtue of the extremely high (nM to pM binding affinity between the antibody and its antigen. In a standard ELISA (Enzyme-Linked ImmunoSorbent Assay test, there are multiple steps and the end result is a measure of what is bound so tightly that it does not wash away easily. The fact that this “gold standard” is very much not real time, masks the dance that is the molecular recognition event. X-Ray Crystallographer, Ian Wilson, demonstrated more than a decade ago that antibodies undergo conformational change during a binding event[1, 2]. Further, it is known in the arena of immunochemistry that some antibodies exhibit significant cross-reactivity and this is widely termed antibody promiscuity. A third piece of the puzzle that we will exploit in our system of acoustic wave biosensors is the notion of chemical orthogonality. These three biochemical constructs, the dance, antibody promiscuity and chemical orthogonality will be combined in this paper with the notions of Int. J. Mol. Sci. 2008, 9 155 in-phase (I and quadrature (Q signals from digital radio to manifest an approach to molecular recognition that allows a level of discrimination and analysis unobtainable without the aggregate. As an example we present experimental data on the detection of TNT, RDX, C4, ammonium nitrate and musk oil from a system of antibody-coated acoustic

  7. Molecular events basic to cellular radiation response. Progress report, October 1, 1978-September 30, 1979

    International Nuclear Information System (INIS)

    Kolodny, G.M.

    1980-01-01

    Research during the past year has been directed at induction of specific protein synthesis in differentiated mammalian cells. The Primer Hypothesis for the regulation of eukaryotic gene expression suggests that RNA transcription is primed by small molecular weight RNA. It predicts that albumin mRNA transcription in a 3T3 fibroblast, which ordinarily does not produce albumin, can be initiated by RNA primer present in liver cells. In experiments this past year, mouse fibroblasts were incubated with mouse liver RNA. These cells did indeed produce albumin which was detected by counterimmunoelectrophoresis. Confluent 3T3 cell cultures were incubated with mouse liver RNA and polylysine in serum free media. Counterimmunoelectrophoresis (CIEP) of the dialyzed and lyophilized media against mouse albumin antisera gave a single precipitin line indicating albumin snthesis by the fibroblasts. The synthesis of this protein immunologicaly similar to albumin required new albumin mRNA transcription since it was not synthesized in the presence of actinomycin, could be found in media which had been incubated with RNA significantly smaller in size than albumin mRNA, and was synthesized in the absence of added poly A containing RNA. These results represent the first reported demonstration that RNA can be taken up from the media by cells in culture, and can induce in those cells the production of a differentiated cell product not ordinarily synthesized by those cells, i.e, a change in the normal transcription pattern in those cells

  8. ACUTE CEREBROVASCULAR EVENTS IN PATIENTS WITH ARTERIAL HYPERTENSION: MOLECULAR GENETIC ASPECTS

    Directory of Open Access Journals (Sweden)

    M. A. Karpenko

    2008-01-01

    Full Text Available Aim. To study association between stroke and gene polymorphism of angeotensin converting enzyme (ACE, angeotensin II type 1 receptor (ATR1, apolipoprotein СIII (APO CIII, apoproteine Е (APO E, methylentetrahydrofolate reductase (MTHFR, fibrinogen (Fb, endothelial NO-synthase (NOS3 in arterial hypertension (HT.Material and methods. Molecular genetic analysis by polymerase chain reaction was done in 41 patients with HT, who experienced first episode of acute disturbances of cerebral blood circulation (ADCBC.Results. Stroke rate in patients with HT is associated with A1166C of ATR1 gene polymorphism, G-455A of Fb gene polymorphism and C677T of MTHFR gene polymorphism. The high risk markers are C-allele of ATR1 gene, -455А allele and AA genotype of Fb gene, 677T allele of MTHFR. The A-allele and genotype AA of ATR1 gene, G-445 allele of Fb gene, С677-allele and CC genotype of MTHFR gene play protective role against ADCBC in HT.Conclusion. It is established an association between gene polymorphism of some molecules and ADCBC in HT.

  9. Origin of microbial life: Nano- and molecular events, thermodynamics/entropy, quantum mechanisms and genetic instructions.

    Science.gov (United States)

    Trevors, J T

    2011-03-01

    Currently, there are no agreed upon mechanisms and supporting evidence for the origin of the first microbial cells on the Earth. However, some hypotheses have been proposed with minimal supporting evidence and experimentation/observations. The approach taken in this article is that life originated at the nano- and molecular levels of biological organization, using quantum mechanic principles that became manifested as classical microbial cell(s), allowing the origin of microbial life on the Earth with a core or minimal, organic, genetic code containing the correct instructions for cell(s) for growth and division, in a micron dimension environment, with a local entropy range conducive to life (present about 4 billion years ago), and obeying the laws of thermodynamics. An integrated approach that explores all encompassing factors necessary for the origin of life, may bring forth plausible hypotheses (and mechanisms) with much needed supporting experimentation and observations for an origin of life theory. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Antibiotic discovery throughout the Small World Initiative: A molecular strategy to identify biosynthetic gene clusters involved in antagonistic activity.

    Science.gov (United States)

    Davis, Elizabeth; Sloan, Tyler; Aurelius, Krista; Barbour, Angela; Bodey, Elijah; Clark, Brigette; Dennis, Celeste; Drown, Rachel; Fleming, Megan; Humbert, Allison; Glasgo, Elizabeth; Kerns, Trent; Lingro, Kelly; McMillin, MacKenzie; Meyer, Aaron; Pope, Breanna; Stalevicz, April; Steffen, Brittney; Steindl, Austin; Williams, Carolyn; Wimberley, Carmen; Zenas, Robert; Butela, Kristen; Wildschutte, Hans

    2017-06-01

    The emergence of bacterial pathogens resistant to all known antibiotics is a global health crisis. Adding to this problem is that major pharmaceutical companies have shifted away from antibiotic discovery due to low profitability. As a result, the pipeline of new antibiotics is essentially dry and many bacteria now resist the effects of most commonly used drugs. To address this global health concern, citizen science through the Small World Initiative (SWI) was formed in 2012. As part of SWI, students isolate bacteria from their local environments, characterize the strains, and assay for antibiotic production. During the 2015 fall semester at Bowling Green State University, students isolated 77 soil-derived bacteria and genetically characterized strains using the 16S rRNA gene, identified strains exhibiting antagonistic activity, and performed an expanded SWI workflow using transposon mutagenesis to identify a biosynthetic gene cluster involved in toxigenic compound production. We identified one mutant with loss of antagonistic activity and through subsequent whole-genome sequencing and linker-mediated PCR identified a 24.9 kb biosynthetic gene locus likely involved in inhibitory activity in that mutant. Further assessment against human pathogens demonstrated the inhibition of Bacillus cereus, Listeria monocytogenes, and methicillin-resistant Staphylococcus aureus in the presence of this compound, thus supporting our molecular strategy as an effective research pipeline for SWI antibiotic discovery and genetic characterization. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  11. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  12. Visualization of early events in acetic acid denaturation of HIV-1 protease: a molecular dynamics study.

    Directory of Open Access Journals (Sweden)

    Aditi Narendra Borkar

    Full Text Available Protein denaturation plays a crucial role in cellular processes. In this study, denaturation of HIV-1 Protease (PR was investigated by all-atom MD simulations in explicit solvent. The PR dimer and monomer were simulated separately in 9 M acetic acid (9 M AcOH solution and water to study the denaturation process of PR in acetic acid environment. Direct visualization of the denaturation dynamics that is readily available from such simulations has been presented. Our simulations in 9 M AcOH reveal that the PR denaturation begins by separation of dimer into intact monomers and it is only after this separation that the monomer units start denaturing. The denaturation of the monomers is flagged off by the loss of crucial interactions between the α-helix at C-terminal and surrounding β-strands. This causes the structure to transit from the equilibrium dynamics to random non-equilibrating dynamics. Residence time calculations indicate that denaturation occurs via direct interaction of the acetic acid molecules with certain regions of the protein in 9 M AcOH. All these observations have helped to decipher a picture of the early events in acetic acid denaturation of PR and have illustrated that the α-helix and the β-sheet at the C-terminus of a native and functional PR dimer should maintain both the stability and the function of the enzyme and thus present newer targets for blocking PR function.

  13. Assessment of molecular events during in vitro re-epithelialization under honey-alginate matrix ambience

    International Nuclear Information System (INIS)

    Barui, Ananya; Mandal, Naresh; Majumder, Subhadipa; Das, Raunak Kumar; Sengupta, Sanghamitra; Banerjee, Provas; Ray, Ajoy Kumar; RoyChaudhuri, Chirosree; Chatterjee, Jyotirmoy

    2013-01-01

    Re-epithelialization is one of the most important stages of cutaneous regeneration and its success requires supportive micro-ambience which may be provided with suitable bio-matrix. Biocompatibility and efficacy of such bio-matrix in re-epithelialization could be explored by multimodal analysis of structural and functional attributes of in vitro wound healing model including evaluation of prime molecular expressions of the epithelial cells during repair. Present study examines the influence of honey-alginate and alginate matrices on re-epithelialization in keratinocyte (HaCaT) population in a 2-D wound model. Cellular viability, proliferation and cell–cell adhesion status were assessed during wound closure using live/dead cell assay and by evaluating expressions of Ki67, p63 and E-cadherin along-with % change in cellular electrical impedance. Efficacy of honey-alginate matrix in comparison to only alginate one was demonstrated by a quicker reduction in wound gap, improved cellular viability, enhanced expressions of Ki67, p63 and its isoforms (TAp63, ΔNp63) as well as E-cadherin. Faster restoration of electrical attribute (% of impedance change) after wounding also indicated better impact of honey-alginate matrix in re-epithelialization. - Highlights: • Role of honey based matrix is evaluated in wound re-epithelialization. • Healing impact of matrix studied in 2D in vitro keratinocyte (HaCaT) wound model. • Faster impedance restoration indicated rapid healing rate of HaCaT under honey. • PCR observations showed faster initiation of cell proliferation under honey. • ICC study indicated better up-regulation of healing markers under honey matrix

  14. Assessment of molecular events during in vitro re-epithelialization under honey-alginate matrix ambience

    Energy Technology Data Exchange (ETDEWEB)

    Barui, Ananya [Centre for Healthcare Science and Technology, BESU, Shibpur, Howrah 711103, West Bengal (India); Mandal, Naresh [Dept. of Electronics and Telecommunication Engg., BESU, Shibpur, Howrah 711103, West Bengal (India); Majumder, Subhadipa [Department of Biochemistry, University of Calcutta Ballygunge, Circular Road, Kolkata 700 019, West Bengal (India); Das, Raunak Kumar [School of Medical Science and Technology, IIT, Kharagpur 721 302, West Bengal (India); Sengupta, Sanghamitra [Department of Biochemistry, University of Calcutta Ballygunge, Circular Road, Kolkata 700 019, West Bengal (India); Banerjee, Provas [School of Medical Science and Technology, IIT, Kharagpur 721 302, West Bengal (India); Ray, Ajoy Kumar; RoyChaudhuri, Chirosree [Dept. of Electronics and Telecommunication Engg., BESU, Shibpur, Howrah 711103, West Bengal (India); Chatterjee, Jyotirmoy, E-mail: jchatterjee@smst.iitkgp.ernet.in [School of Medical Science and Technology, IIT, Kharagpur 721 302, West Bengal (India)

    2013-08-01

    Re-epithelialization is one of the most important stages of cutaneous regeneration and its success requires supportive micro-ambience which may be provided with suitable bio-matrix. Biocompatibility and efficacy of such bio-matrix in re-epithelialization could be explored by multimodal analysis of structural and functional attributes of in vitro wound healing model including evaluation of prime molecular expressions of the epithelial cells during repair. Present study examines the influence of honey-alginate and alginate matrices on re-epithelialization in keratinocyte (HaCaT) population in a 2-D wound model. Cellular viability, proliferation and cell–cell adhesion status were assessed during wound closure using live/dead cell assay and by evaluating expressions of Ki67, p63 and E-cadherin along-with % change in cellular electrical impedance. Efficacy of honey-alginate matrix in comparison to only alginate one was demonstrated by a quicker reduction in wound gap, improved cellular viability, enhanced expressions of Ki67, p63 and its isoforms (TAp63, ΔNp63) as well as E-cadherin. Faster restoration of electrical attribute (% of impedance change) after wounding also indicated better impact of honey-alginate matrix in re-epithelialization. - Highlights: • Role of honey based matrix is evaluated in wound re-epithelialization. • Healing impact of matrix studied in 2D in vitro keratinocyte (HaCaT) wound model. • Faster impedance restoration indicated rapid healing rate of HaCaT under honey. • PCR observations showed faster initiation of cell proliferation under honey. • ICC study indicated better up-regulation of healing markers under honey matrix.

  15. Molecular initiating events of the intersex phenotype: Low-dose exposure to 17α-ethinylestradiol rapidly regulates molecular networks associated with gonad differentiation in the adult fathead minnow testis

    International Nuclear Information System (INIS)

    Feswick, April; Loughery, Jennifer R.; Isaacs, Meghan A.; Munkittrick, Kelly R.; Martyniuk, Christopher J.

    2016-01-01

    Highlights: • Male fathead minnow were exposed to 17alpha ethinylestradiol (EE2). • Both 11-ketotestosterone and testosterone production was decreased relative to controls. • A gene network associated with doublesex and mab-3 related transcription factor 1 were suppressed. • Genes involved in granulosa cell development were increased and sensitive to EE2 exposure. • Molecular initiating events that may be related to the intersex condition were identified. - Abstract: Intersex, or the presence of oocytes in the testes, has been documented in fish following exposure to wastewater effluent and estrogenic compounds. However, the molecular networks underlying the intersex condition are not completely known. To address this, we exposed male fathead minnows to a low, environmentally-relevant concentration of 17alpha-ethinylestradiol (EE2) (15 ng/L) and measured the transcriptome response in the testis after 96 h to identify early molecular initiating events that may proceed the intersex condition. The short-term exposure to EE2 did not affect gonadosomatic index and proportion of gametes within the testes. However, the production of 11-ketotestosterone and testosterone from the testis in vitro was decreased relative to controls. Expression profiling using a 8 × 60 K fathead minnow microarray identified 10 transcripts that were differentially expressed in the testes, the most dramatic change being that of coagulation factor XIII A chain (20-fold increase). Transcripts that included guanine nucleotide binding protein (Beta Polypeptide 2), peroxisome proliferator-activated receptor delta, and WNK lysine deficient protein kinase 1a, were down-regulated by EE2. Subnetwork enrichment analysis revealed that EE2 suppressed transcriptional networks associated with steroid metabolism, hormone biosynthesis, and sperm mobility. Most interesting was that gene networks associated with doublesex and mab-3 related transcription factor 1 (dmrt1) were suppressed in the adult

  16. Molecular initiating events of the intersex phenotype: Low-dose exposure to 17α-ethinylestradiol rapidly regulates molecular networks associated with gonad differentiation in the adult fathead minnow testis

    Energy Technology Data Exchange (ETDEWEB)

    Feswick, April; Loughery, Jennifer R.; Isaacs, Meghan A.; Munkittrick, Kelly R.; Martyniuk, Christopher J., E-mail: cmartyni@yahoo.ca

    2016-12-15

    Highlights: • Male fathead minnow were exposed to 17alpha ethinylestradiol (EE2). • Both 11-ketotestosterone and testosterone production was decreased relative to controls. • A gene network associated with doublesex and mab-3 related transcription factor 1 were suppressed. • Genes involved in granulosa cell development were increased and sensitive to EE2 exposure. • Molecular initiating events that may be related to the intersex condition were identified. - Abstract: Intersex, or the presence of oocytes in the testes, has been documented in fish following exposure to wastewater effluent and estrogenic compounds. However, the molecular networks underlying the intersex condition are not completely known. To address this, we exposed male fathead minnows to a low, environmentally-relevant concentration of 17alpha-ethinylestradiol (EE2) (15 ng/L) and measured the transcriptome response in the testis after 96 h to identify early molecular initiating events that may proceed the intersex condition. The short-term exposure to EE2 did not affect gonadosomatic index and proportion of gametes within the testes. However, the production of 11-ketotestosterone and testosterone from the testis in vitro was decreased relative to controls. Expression profiling using a 8 × 60 K fathead minnow microarray identified 10 transcripts that were differentially expressed in the testes, the most dramatic change being that of coagulation factor XIII A chain (20-fold increase). Transcripts that included guanine nucleotide binding protein (Beta Polypeptide 2), peroxisome proliferator-activated receptor delta, and WNK lysine deficient protein kinase 1a, were down-regulated by EE2. Subnetwork enrichment analysis revealed that EE2 suppressed transcriptional networks associated with steroid metabolism, hormone biosynthesis, and sperm mobility. Most interesting was that gene networks associated with doublesex and mab-3 related transcription factor 1 (dmrt1) were suppressed in the adult

  17. Global transcriptomic profiling of aspen trees under elevated [CO2] to identify potential molecular mechanisms responsible for enhanced radial growth.

    Science.gov (United States)

    Wei, Hairong; Gou, Jiqing; Yordanov, Yordan; Zhang, Huaxin; Thakur, Ramesh; Jones, Wendy; Burton, Andrew

    2013-03-01

    Aspen (Populus tremuloides) trees growing under elevated [CO(2)] at a free-air CO(2) enrichment (FACE) site produced significantly more biomass than control trees. We investigated the molecular mechanisms underlying the observed increase in biomass by producing transcriptomic profiles of the vascular cambium zone (VCZ) and leaves, and then performed a comparative study to identify significantly changed genes and pathways after 12 years exposure to elevated [CO(2)]. In leaves, elevated [CO(2)] enhanced expression of genes related to Calvin cycle activity and linked pathways. In the VCZ, the pathways involved in cell growth, cell division, hormone metabolism, and secondary cell wall formation were altered while auxin conjugation, ABA synthesis, and cytokinin glucosylation and degradation were inhibited. Similarly, the genes involved in hemicellulose and pectin biosynthesis were enhanced, but some genes that catalyze important steps in lignin biosynthesis pathway were inhibited. Evidence from systemic analysis supported the functioning of multiple molecular mechanisms that underpin the enhanced radial growth in response to elevated [CO(2)].

  18. Distinct Molecular Signature of Murine Fetal Liver and Adult Hematopoietic Stem Cells Identify Novel Regulators of Hematopoietic Stem Cell Function.

    Science.gov (United States)

    Manesia, Javed K; Franch, Monica; Tabas-Madrid, Daniel; Nogales-Cadenas, Ruben; Vanwelden, Thomas; Van Den Bosch, Elisa; Xu, Zhuofei; Pascual-Montano, Alberto; Khurana, Satish; Verfaillie, Catherine M

    2017-04-15

    During ontogeny, fetal liver (FL) acts as a major site for hematopoietic stem cell (HSC) maturation and expansion, whereas HSCs in the adult bone marrow (ABM) are largely quiescent. HSCs in the FL possess faster repopulation capacity as compared with ABM HSCs. However, the molecular mechanism regulating the greater self-renewal potential of FL HSCs has not yet extensively been assessed. Recently, we published RNA sequencing-based gene expression analysis on FL HSCs from 14.5-day mouse embryo (E14.5) in comparison to the ABM HSCs. We reanalyzed these data to identify key transcriptional regulators that play important roles in the expansion of HSCs during development. The comparison of FL E14.5 with ABM HSCs identified more than 1,400 differentially expressed genes. More than 200 genes were shortlisted based on the gene ontology (GO) annotation term "transcription." By morpholino-based knockdown studies in zebrafish, we assessed the function of 18 of these regulators, previously not associated with HSC proliferation. Our studies identified a previously unknown role for tdg, uhrf1, uchl5, and ncoa1 in the emergence of definitive hematopoiesis in zebrafish. In conclusion, we demonstrate that identification of genes involved in transcriptional regulation differentially expressed between expanding FL HSCs and quiescent ABM HSCs, uncovers novel regulators of HSC function.

  19. Early molecular events involved in Pinus pinaster Ait. somatic embryo development under reduced water availability: transcriptomic and proteomic analyses.

    Science.gov (United States)

    Morel, Alexandre; Teyssier, Caroline; Trontin, Jean-François; Eliášová, Kateřina; Pešek, Bedřich; Beaufour, Martine; Morabito, Domenico; Boizot, Nathalie; Le Metté, Claire; Belal-Bessai, Leila; Reymond, Isabelle; Harvengt, Luc; Cadene, Martine; Corbineau, Françoise; Vágner, Martin; Label, Philippe; Lelu-Walter, Marie-Anne

    2014-09-01

    Maritime pine somatic embryos (SEs) require a reduction in water availability (high gellan gum concentration in the maturation medium) to reach the cotyledonary stage. This key switch, reported specifically for pine species, is not yet well understood. To facilitate the use of somatic embryogenesis for mass propagation of conifers, we need a better understanding of embryo development. Comparison of both transcriptome (Illumina RNA sequencing) and proteome [two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis with mass spectrometry (MS) identification] of immature SEs, cultured on either high (9G) or low (4G) gellan gum concentration, was performed, together with analysis of water content, fresh and dry mass, endogenous abscisic acid (ABA; gas chromatography-MS), soluble sugars (high-pressure liquid chromatography), starch and confocal laser microscope observations. This multiscale, integrated analysis was used to unravel early molecular and physiological events involved in SE development. Under unfavorable conditions (4G), the glycolytic pathway was enhanced, possibly in relation to cell proliferation that may be antagonistic to SE development. Under favorable conditions (9G), SEs adapted to culture constraint by activating specific protective pathways, and ABA-mediated molecular and physiological responses promoting embryo development. Our results suggest that on 9G, germin-like protein and ubiquitin-protein ligase could be used as predictive markers of SE development, whereas protein phosphatase 2C could be a biomarker for culture adaptive responses. This is the first characterization of early molecular mechanisms involved in the development of pine SEs following an increase in gellan gum concentration in the maturation medium, and it is also the first report on somatic embryogenesis in conifers combining transcriptomic and proteomic datasets. © 2014 Scandinavian Plant Physiology Society.

  20. Mechanisms to medicines: elucidating neural and molecular substrates of fear extinction to identify novel treatments for anxiety disorders

    Science.gov (United States)

    Bukalo, Olena; Pinard, Courtney R; Holmes, Andrew

    2014-01-01

    The burden of anxiety disorders is growing, but the efficacy of available anxiolytic treatments remains inadequate. Cognitive behavioural therapy for anxiety disorders focuses on identifying and modifying maladaptive patterns of thinking and behaving, and has a testable analogue in rodents in the form of fear extinction. A large preclinical literature has amassed in recent years describing the neural and molecular basis of fear extinction in rodents. In this review, we discuss how this work is being harnessed to foster translational research on anxiety disorders and facilitate the search for new anxiolytic treatments. We begin by summarizing the anatomical and functional connectivity of a medial prefrontal cortex (mPFC)–amygdala circuit that subserves fear extinction, including new insights from optogenetics. We then cover some of the approaches that have been taken to model impaired fear extinction and associated impairments with mPFC–amygdala dysfunction. The principal goal of the review is to evaluate evidence that various neurotransmitter and neuromodulator systems mediate fear extinction by modulating the mPFC–amygdala circuitry. To that end, we describe studies that have tested how fear extinction is impaired or facilitated by pharmacological manipulations of dopamine, noradrenaline, 5-HT, GABA, glutamate, neuropeptides, endocannabinoids and various other systems, which either directly target the mPFC–amygdala circuit, or produce behavioural effects that are coincident with functional changes in the circuit. We conclude that there are good grounds to be optimistic that the progress in defining the molecular substrates of mPFC–amygdala circuit function can be effectively leveraged to identify plausible candidates for extinction-promoting therapies for anxiety disorders. Linked Articles This article is part of a themed section on Animal Models in Psychiatry Research. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2014

  1. Mechanisms to medicines: elucidating neural and molecular substrates of fear extinction to identify novel treatments for anxiety disorders.

    Science.gov (United States)

    Bukalo, Olena; Pinard, Courtney R; Holmes, Andrew

    2014-10-01

    The burden of anxiety disorders is growing, but the efficacy of available anxiolytic treatments remains inadequate. Cognitive behavioural therapy for anxiety disorders focuses on identifying and modifying maladaptive patterns of thinking and behaving, and has a testable analogue in rodents in the form of fear extinction. A large preclinical literature has amassed in recent years describing the neural and molecular basis of fear extinction in rodents. In this review, we discuss how this work is being harnessed to foster translational research on anxiety disorders and facilitate the search for new anxiolytic treatments. We begin by summarizing the anatomical and functional connectivity of a medial prefrontal cortex (mPFC)-amygdala circuit that subserves fear extinction, including new insights from optogenetics. We then cover some of the approaches that have been taken to model impaired fear extinction and associated impairments with mPFC-amygdala dysfunction. The principal goal of the review is to evaluate evidence that various neurotransmitter and neuromodulator systems mediate fear extinction by modulating the mPFC-amygdala circuitry. To that end, we describe studies that have tested how fear extinction is impaired or facilitated by pharmacological manipulations of dopamine, noradrenaline, 5-HT, GABA, glutamate, neuropeptides, endocannabinoids and various other systems, which either directly target the mPFC-amygdala circuit, or produce behavioural effects that are coincident with functional changes in the circuit. We conclude that there are good grounds to be optimistic that the progress in defining the molecular substrates of mPFC-amygdala circuit function can be effectively leveraged to identify plausible candidates for extinction-promoting therapies for anxiety disorders. © 2014 The British Pharmacological Society.

  2. Molecular aspects in inflammatory events of temporomandibular joint: Microarray-based identification of mediators

    Directory of Open Access Journals (Sweden)

    Naomi Ogura

    2015-02-01

    Full Text Available Synovial inflammation (synovitis frequently accompanies intracapsular pathologic conditions of the temporomandibular joint (TMJ such as internal derangement (ID and/or osteoarthritis (OA, and is suggested to be associated with symptom severity. To identify the putative factors associated with synovitis, we investigated interleukin (IL-1β- and/or tumor necrosis factor (TNF-α-responsive genes of fibroblast-like synoviocytes (FLS from patients with ID and/or OA of TMJ using microarray analysis. In this review, we first summarize the FLS of TMJ and the signaling pathways of IL-1β and TNF-α. Next, we show the up-regulated genes in FLS after stimulation with IL-1β or TNF-α, and summarize the gene functions based on recent studies. Among the top 10 up-regulated factors, molecules such as IL-6 and cycrooxygense-2 have been well characterized and investigated in the inflammatory responses and tissue destruction associated with joint diseases such as RA and OA, but the roles of some molecules remain unclear. The FLS reaction can lead to the synthesis and release of a wide variety of inflammatory mediators. Some of these mediators are detected in joint tissues and synovial fluids under intracapsular pathologic conditions, and may represent potential targets for therapeutic interventions in ID and/or OA of TMJ.

  3. Molecular forensics in avian conservation: a DNA-based approach for identifying mammalian predators of ground-nesting birds and eggs.

    Science.gov (United States)

    Hopken, Matthew W; Orning, Elizabeth K; Young, Julie K; Piaggio, Antoinette J

    2016-01-07

    predation can have a high impact on recruitment, predation events are very difficult to observe, and predator species are difficult to identify visually from nest remains, molecular approaches that reduce the need to observe or handle animals offer an additional tool to better understand predator-prey dynamics at nesting sites.

  4. Advanced computational biology methods identify molecular switches for malignancy in an EGF mouse model of liver cancer.

    Directory of Open Access Journals (Sweden)

    Philip Stegmaier

    Full Text Available The molecular causes by which the epidermal growth factor receptor tyrosine kinase induces malignant transformation are largely unknown. To better understand EGFs' transforming capacity whole genome scans were applied to a transgenic mouse model of liver cancer and subjected to advanced methods of computational analysis to construct de novo gene regulatory networks based on a combination of sequence analysis and entrained graph-topological algorithms. Here we identified transcription factors, processes, key nodes and molecules to connect as yet unknown interacting partners at the level of protein-DNA interaction. Many of those could be confirmed by electromobility band shift assay at recognition sites of gene specific promoters and by western blotting of nuclear proteins. A novel cellular regulatory circuitry could therefore be proposed that connects cell cycle regulated genes with components of the EGF signaling pathway. Promoter analysis of differentially expressed genes suggested the majority of regulated transcription factors to display specificity to either the pre-tumor or the tumor state. Subsequent search for signal transduction key nodes upstream of the identified transcription factors and their targets suggested the insulin-like growth factor pathway to render the tumor cells independent of EGF receptor activity. Notably, expression of IGF2 in addition to many components of this pathway was highly upregulated in tumors. Together, we propose a switch in autocrine signaling to foster tumor growth that was initially triggered by EGF and demonstrate the knowledge gain form promoter analysis combined with upstream key node identification.

  5. Integrated Bioinformatics, Environmental Epidemiologic and Genomic Approaches to Identify Environmental and Molecular Links between Endometriosis and Breast Cancer

    Directory of Open Access Journals (Sweden)

    Deodutta Roy

    2015-10-01

    Full Text Available We present a combined environmental epidemiologic, genomic, and bioinformatics approach to identify: exposure of environmental chemicals with estrogenic activity; epidemiologic association between endocrine disrupting chemical (EDC and health effects, such as, breast cancer or endometriosis; and gene-EDC interactions and disease associations. Human exposure measurement and modeling confirmed estrogenic activity of three selected class of environmental chemicals, polychlorinated biphenyls (PCBs, bisphenols (BPs, and phthalates. Meta-analysis showed that PCBs exposure, not Bisphenol A (BPA and phthalates, increased the summary odds ratio for breast cancer and endometriosis. Bioinformatics analysis of gene-EDC interactions and disease associations identified several hundred genes that were altered by exposure to PCBs, phthalate or BPA. EDCs-modified genes in breast neoplasms and endometriosis are part of steroid hormone signaling and inflammation pathways. All three EDCs–PCB 153, phthalates, and BPA influenced five common genes—CYP19A1, EGFR, ESR2, FOS, and IGF1—in breast cancer as well as in endometriosis. These genes are environmentally and estrogen responsive, altered in human breast and uterine tumors and endometriosis lesions, and part of Mitogen Activated Protein Kinase (MAPK signaling pathways in cancer. Our findings suggest that breast cancer and endometriosis share some common environmental and molecular risk factors.

  6. Expression Profiling of Differentiating Emerin-Null Myogenic Progenitor Identifies Molecular Pathways Implicated in Their Impaired Differentiation

    Directory of Open Access Journals (Sweden)

    Ashvin Iyer

    2017-10-01

    Full Text Available Mutations in the gene encoding emerin cause Emery-Dreifuss muscular dystrophy (EDMD, a disorder causing progressive skeletal muscle wasting, irregular heart rhythms and contractures of major tendons. RNA sequencing was performed on differentiating wildtype and emerin-null myogenic progenitors to identify molecular pathways implicated in EDMD, 340 genes were uniquely differentially expressed during the transition from day 0 to day 1 in wildtype cells. 1605 genes were uniquely expressed in emerin-null cells; 1706 genes were shared among both wildtype and emerin-null cells. One thousand and forty-seven transcripts showed differential expression during the transition from day 1 to day 2. Four hundred and thirty-one transcripts showed altered expression in both wildtype and emerin-null cells. Two hundred and ninety-five transcripts were differentially expressed only in emerin-null cells and 321 transcripts were differentially expressed only in wildtype cells. DAVID, STRING and Ingenuity Pathway Analysis identified pathways implicated in impaired emerin-null differentiation, including cell signaling, cell cycle checkpoints, integrin signaling, YAP/TAZ signaling, stem cell differentiation, and multiple muscle development and myogenic differentiation pathways. Functional enrichment analysis showed biological functions associated with the growth of muscle tissue and myogenesis of skeletal muscle were inhibited. The large number of differentially expressed transcripts upon differentiation induction suggests emerin functions during transcriptional reprograming of progenitors to committed myoblasts.

  7. Molecular profiling of aged neural progenitors identifies Dbx2 as a candidate regulator of age-associated neurogenic decline.

    Science.gov (United States)

    Lupo, Giuseppe; Nisi, Paola S; Esteve, Pilar; Paul, Yu-Lee; Novo, Clara Lopes; Sidders, Ben; Khan, Muhammad A; Biagioni, Stefano; Liu, Hai-Kun; Bovolenta, Paola; Cacci, Emanuele; Rugg-Gunn, Peter J

    2018-06-01

    Adult neurogenesis declines with aging due to the depletion and functional impairment of neural stem/progenitor cells (NSPCs). An improved understanding of the underlying mechanisms that drive age-associated neurogenic deficiency could lead to the development of strategies to alleviate cognitive impairment and facilitate neuroregeneration. An essential step towards this aim is to investigate the molecular changes that occur in NSPC aging on a genomewide scale. In this study, we compare the transcriptional, histone methylation and DNA methylation signatures of NSPCs derived from the subventricular zone (SVZ) of young adult (3 months old) and aged (18 months old) mice. Surprisingly, the transcriptional and epigenomic profiles of SVZ-derived NSPCs are largely unchanged in aged cells. Despite the global similarities, we detect robust age-dependent changes at several hundred genes and regulatory elements, thereby identifying putative regulators of neurogenic decline. Within this list, the homeobox gene Dbx2 is upregulated in vitro and in vivo, and its promoter region has altered histone and DNA methylation levels, in aged NSPCs. Using functional in vitro assays, we show that elevated Dbx2 expression in young adult NSPCs promotes age-related phenotypes, including the reduced proliferation of NSPC cultures and the altered transcript levels of age-associated regulators of NSPC proliferation and differentiation. Depleting Dbx2 in aged NSPCs caused the reverse gene expression changes. Taken together, these results provide new insights into the molecular programmes that are affected during mouse NSPC aging, and uncover a new functional role for Dbx2 in promoting age-related neurogenic decline. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  8. Omics analysis of human bone to identify genes and molecular networks regulating skeletal remodeling in health and disease.

    Science.gov (United States)

    Reppe, Sjur; Datta, Harish K; Gautvik, Kaare M

    2017-08-01

    The skeleton is a metabolically active organ throughout life where specific bone cell activity and paracrine/endocrine factors regulate its morphogenesis and remodeling. In recent years, an increasing number of reports have used multi-omics technologies to characterize subsets of bone biological molecular networks. The skeleton is affected by primary and secondary disease, lifestyle and many drugs. Therefore, to obtain relevant and reliable data from well characterized patient and control cohorts are vital. Here we provide a brief overview of omics studies performed on human bone, of which our own studies performed on trans-iliacal bone biopsies from postmenopausal women with osteoporosis (OP) and healthy controls are among the first and largest. Most other studies have been performed on smaller groups of patients, undergoing hip replacement for osteoarthritis (OA) or fracture, and without healthy controls. The major findings emerging from the combined studies are: 1. Unstressed and stressed bone show profoundly different gene expression reflecting differences in bone turnover and remodeling and 2. Omics analyses comparing healthy/OP and control/OA cohorts reveal characteristic changes in transcriptomics, epigenomics (DNA methylation), proteomics and metabolomics. These studies, together with genome-wide association studies, in vitro observations and transgenic animal models have identified a number of genes and gene products that act via Wnt and other signaling systems and are highly associated to bone density and fracture. Future challenge is to understand the functional interactions between bone-related molecular networks and their significance in OP and OA pathogenesis, and also how the genomic architecture is affected in health and disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity

    Science.gov (United States)

    Xu, Ning; Cui, Jinrui; Mengesha, Emebet; Chen, Yii-Der I.; Taylor, Kent D.; Azziz, Ricardo; Goodarzi, Mark O.

    2015-01-01

    Genome wide association studies (GWAS) have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS), a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs) therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS. PMID:26305227

  10. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity.

    Directory of Open Access Journals (Sweden)

    Michelle R Jones

    2015-08-01

    Full Text Available Genome wide association studies (GWAS have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS, a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS.

  11. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity.

    Science.gov (United States)

    Jones, Michelle R; Brower, Meredith A; Xu, Ning; Cui, Jinrui; Mengesha, Emebet; Chen, Yii-Der I; Taylor, Kent D; Azziz, Ricardo; Goodarzi, Mark O

    2015-08-01

    Genome wide association studies (GWAS) have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS), a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs) therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS.

  12. Genetic relationships in an international collection of Puccinia horiana isolates based on newly identified molecular markers and demonstration of recombination.

    Science.gov (United States)

    De Backer, M; Bonants, P; Pedley, K F; Maes, M; Roldan-Ruiz, I; Van Bockstaele, E; Heungens, K; van der Lee, T

    2013-11-01

    The obligate biotrophic pathogen Puccinia horiana is the causal agent of chrysanthemum white rust. Although P. horiana is a quarantine organism, it has been able to spread to most chrysanthemum-producing regions in the world since the 1960s; however, the transfer routes are largely obscure. An extremely low level of allelic diversity was observed in a geographically diverse set of eight isolates using complexity reduction of polymorphic sequences (CRoPS) technology. Only 184 of the 16,196 contigs (1.1%) showed one or more single-nucleotide polymorphisms (SNPs). Thirty-two SNPs and one simple-sequence repeat were translated into molecular markers and used to genotype 45 isolates originating from North and South America, Asia, and Europe. In most cases, phylogenetic clustering was related to geographic origin, indicating local establishment. The European isolates mostly grouped in two major populations that may relate to the two historic introductions previously reported. However, evidence of recent geographic transfer was also observed, including transfer events between Europe and South America and between Southeast Asia and Europe. In contrast with the presumed clonal propagation of this microcyclic rust, strong indications of marker recombination were observed, presumably as a result of anastomosis, karyogamy, and somatic meiosis. Recombination and transfer also explain the geographic dispersal of specific markers. A near-to-significant correlation between the genotypic data and previously obtained pathotype data was observed and one marker was associated with the most virulent pathotype group. In combination with a fast SNP detection method, the markers presented here will be helpful tools to further elucidate the transfer pathways and local survival of this pathogen.

  13. Identifying cell and molecular stress after radiation in a three-dimensional (3-D) model of oral mucositis

    International Nuclear Information System (INIS)

    Lambros, Maria Polikandritou; Parsa, Cyrus; Mulamalla, HariChandana; Orlando, Robert; Lau, Bernard; Huang, Ying; Pon, Doreen; Chow, Moses

    2011-01-01

    Research highlights: → We irradiated a 3-D human oral cell culture of keratinocytes and fibroblasts with 12 and 2 Gy. → 6 h after irradiation the histopathology and apoptosis of the 3-D culture were evaluated. Microarrays were used to assess the gene expression in the irradiated 3-D tissue. → 12 Gy induced significant histopathologic changes and cellular apoptosis. → 12 Gy significantly affected genes of the NF-kB pathway, inflammatory cytokines and DAMPs. -- Abstract: Mucositis is a debilitating adverse effect of chemotherapy and radiation treatment. It is important to develop a simple and reliable in vitro model, which can routinely be used to screen new drugs for prevention and treatment of mucositis. Furthermore, identifying cell and molecular stresses especially in the initiation phase of mucositis in this model will help towards this end. We evaluated a three-dimensional (3-D) human oral cell culture that consisted of oral keratinocytes and fibroblasts as a model of oral mucositis. The 3-D cell culture model was irradiated with 12 or 2 Gy. Six hours after the irradiation we evaluated microscopic sections of the cell culture for evidence of morphologic changes including apoptosis. We used microarrays to compare the expression of several genes from the irradiated tissue with identical genes from tissue that was not irradiated. We found that irradiation with 12 Gy induced significant histopathologic effects including cellular apoptosis. Irradiation significantly affected the expression of several genes of the NF-kB pathway and several inflammatory cytokines, such as IL-1B, 1L-8, NF-kB1, and FOS compared to tissue that was not irradiated. We identified significant upregulation of several genes that belong to damage-associated molecular patterns (DAMPs) such as HMB1, S100A13, SA10014, and SA10016 in the 3-D tissues that received 12 Gy but not in tissues that received 2 Gy. In conclusion, this model quantifies radiation damage and this is an important first

  14. Evidence of molecular evolution driven by recombination events influencing tropism in a novel human adenovirus that causes epidemic keratoconjunctivitis.

    Directory of Open Access Journals (Sweden)

    Michael P Walsh

    2009-06-01

    the first genomic, bioinformatic, and biological descriptions of the molecular evolution events engendering an emerging pathogenic adenovirus.

  15. The AFFORD clinical decision aid to identify emergency department patients with atrial fibrillation at low risk for 30-day adverse events.

    Science.gov (United States)

    Barrett, Tyler W; Storrow, Alan B; Jenkins, Cathy A; Abraham, Robert L; Liu, Dandan; Miller, Karen F; Moser, Kelly M; Russ, Stephan; Roden, Dan M; Harrell, Frank E; Darbar, Dawood

    2015-03-15

    There is wide variation in the management of patients with atrial fibrillation (AF) in the emergency department (ED). We aimed to derive and internally validate the first prospective, ED-based clinical decision aid to identify patients with AF at low risk for 30-day adverse events. We performed a prospective cohort study at a university-affiliated tertiary-care ED. Patients were enrolled from June 9, 2010, to February 28, 2013, and followed for 30 days. We enrolled a convenience sample of patients in ED presenting with symptomatic AF. Candidate predictors were based on ED data available in the first 2 hours. The decision aid was derived using model approximation (preconditioning) followed by strong bootstrap internal validation. We used an ordinal outcome hierarchy defined as the incidence of the most severe adverse event within 30 days of the ED evaluation. Of 497 patients enrolled, stroke and AF-related death occurred in 13 (3%) and 4 (aid included the following: age, triage vitals (systolic blood pressure, temperature, respiratory rate, oxygen saturation, supplemental oxygen requirement), medical history (heart failure, home sotalol use, previous percutaneous coronary intervention, electrical cardioversion, cardiac ablation, frequency of AF symptoms), and ED data (2 hours heart rate, chest radiograph results, hemoglobin, creatinine, and brain natriuretic peptide). The decision aid's c-statistic in predicting any 30-day adverse event was 0.7 (95% confidence interval 0.65, 0.76). In conclusion, in patients with AF in the ED, Atrial Fibrillation and Flutter Outcome Risk Determination provides the first evidence-based decision aid for identifying patients who are at low risk for 30-day adverse events and candidates for safe discharge. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Molecular Characterization and Functional Analysis of PR-1-Like Proteins Identified from the Wheat Head Blight Fungus Fusarium graminearum.

    Science.gov (United States)

    Lu, Shunwen; Edwards, Michael C

    2018-04-01

    The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologs are also found in other eukaryotic kingdoms. Studies on nonplant PR-1-like (PR-1L) proteins have been pursued widely in humans and animals but rarely in filamentous ascomycetes. Here, we report the characterization of four PR-1L proteins identified from the ascomycete fungus Fusarium graminearum, the primary cause of Fusarium head blight of wheat and barley (designated FgPR-1L). Molecular cloning revealed that the four FgPR-1L proteins are all encoded by small open reading frames (612 to 909 bp) that are often interrupted by introns, in contrast to plant PR-1 genes that lack introns. Sequence analysis indicated that all FgPR-1L proteins contain the PR-1-specific three-dimensional structure, and one of them features a C-terminal transmembrane (TM) domain that has not been reported for any stand-alone PR-1 proteins. Transcriptional analysis revealed that the four FgPR-1L genes are expressed in axenic cultures and in planta with different spatial or temporal expression patterns. Phylogenetic analysis indicated that fungal PR-1L proteins fall into three major groups, one of which harbors FgPR-1L-2-related TM-containing proteins from both phytopathogenic and human-pathogenic ascomycetes. Low-temperature sodium dodecyl sulfate polyacrylamide gel electrophoresis and proteolytic assays indicated that the recombinant FgPR-1L-4 protein exists as a monomer and is resistant to subtilisin of the serine protease family. Functional analysis confirmed that deletion of the FgPR-1L-4 gene from the fungal genome results in significantly reduced virulence on susceptible wheat. This study provides the first example that the F. graminearum-wheat interaction involves a pathogen-derived PR-1L protein that affects fungal virulence on the host.

  17. An innovative strategy for the molecular diagnosis of Usher syndrome identifies causal biallelic mutations in 93% of European patients.

    Science.gov (United States)

    Bonnet, Crystel; Riahi, Zied; Chantot-Bastaraud, Sandra; Smagghe, Luce; Letexier, Mélanie; Marcaillou, Charles; Lefèvre, Gaëlle M; Hardelin, Jean-Pierre; El-Amraoui, Aziz; Singh-Estivalet, Amrit; Mohand-Saïd, Saddek; Kohl, Susanne; Kurtenbach, Anne; Sliesoraityte, Ieva; Zobor, Ditta; Gherbi, Souad; Testa, Francesco; Simonelli, Francesca; Banfi, Sandro; Fakin, Ana; Glavač, Damjan; Jarc-Vidmar, Martina; Zupan, Andrej; Battelino, Saba; Martorell Sampol, Loreto; Claveria, Maria Antonia; Catala Mora, Jaume; Dad, Shzeena; Møller, Lisbeth B; Rodriguez Jorge, Jesus; Hawlina, Marko; Auricchio, Alberto; Sahel, José-Alain; Marlin, Sandrine; Zrenner, Eberhart; Audo, Isabelle; Petit, Christine

    2016-12-01

    Usher syndrome (USH), the most prevalent cause of hereditary deafness-blindness, is an autosomal recessive and genetically heterogeneous disorder. Three clinical subtypes (USH1-3) are distinguishable based on the severity of the sensorineural hearing impairment, the presence or absence of vestibular dysfunction, and the age of onset of the retinitis pigmentosa. A total of 10 causal genes, 6 for USH1, 3 for USH2, and 1 for USH3, and an USH2 modifier gene, have been identified. A robust molecular diagnosis is required not only to improve genetic counseling, but also to advance gene therapy in USH patients. Here, we present an improved diagnostic strategy that is both cost- and time-effective. It relies on the sequential use of three different techniques to analyze selected genomic regions: targeted exome sequencing, comparative genome hybridization, and quantitative exon amplification. We screened a large cohort of 427 patients (139 USH1, 282 USH2, and six of undefined clinical subtype) from various European medical centers for mutations in all USH genes and the modifier gene. We identified a total of 421 different sequence variants predicted to be pathogenic, about half of which had not been previously reported. Remarkably, we detected large genomic rearrangements, most of which were novel and unique, in 9% of the patients. Thus, our strategy led to the identification of biallelic and monoallelic mutations in 92.7% and 5.8% of the USH patients, respectively. With an overall 98.5% mutation characterization rate, the diagnosis efficiency was substantially improved compared with previously reported methods.

  18. Molecular characterization of an unauthorized genetically modified Bacillus subtilis production strain identified in a vitamin B2 feed additive.

    Science.gov (United States)

    Paracchini, Valentina; Petrillo, Mauro; Reiting, Ralf; Angers-Loustau, Alexandre; Wahler, Daniela; Stolz, Andrea; Schönig, Birgit; Matthies, Anastasia; Bendiek, Joachim; Meinel, Dominik M; Pecoraro, Sven; Busch, Ulrich; Patak, Alex; Kreysa, Joachim; Grohmann, Lutz

    2017-09-01

    Many food and feed additives result from fermentation of genetically modified (GM) microorganisms. For vitamin B2 (riboflavin), GM Bacillus subtilis production strains have been developed and are often used. The presence of neither the GM strain nor its recombinant DNA is allowed for fermentation products placed on the EU market as food or feed additive. A vitamin B 2 product (80% feed grade) imported from China was analysed. Viable B. subtilis cells were identified and DNAs of two bacterial isolates (LHL and LGL) were subjected to three whole genome sequencing (WGS) runs with different devices (MiSeq, 454 or HiSeq system). WGS data revealed the integration of a chloramphenicol resistance gene, the deletion of the endogenous riboflavin (rib) operon and presence of four putative plasmids harbouring rib operons. Event- and construct-specific real-time PCR methods for detection of the GM strain and its putative plasmids in food and feed products have been developed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Madagascar sheds new light on the molecular systematics and biogeography of grammitid ferns: New unexpected lineages and numerous long-distance dispersal events.

    Science.gov (United States)

    Bauret, Lucie; Gaudeul, Myriam; Sundue, Michael A; Parris, Barbara S; Ranker, Tom A; Rakotondrainibe, France; Hennequin, Sabine; Ranaivo, Jaona; Selosse, Marc-André; Rouhan, Germinal

    2017-06-01

    Based on a worldwide phylogenetic framework filling the taxonomic gap of Madagascar and surrounding islands of the Western Indian Ocean (WIO), we revisited the systematics of grammitid fern species (Polypodiaceae). We also investigated the biogeographic origin of the extant diversity in Madagascar and estimated the relative influence of vicariance, long-distance dispersals (LDD) and in situ diversification. Phylogenetic inferences were based on five plastid DNA regions (atpB, rbcL, rps4-trnS, trnG-trnR, trnL-trnF) and the most comprehensive taxonomic sampling ever assembled (224 species belonging to 31 out of 33 recognized grammitids genera). 31 species from Madagascar were included representing 87% of the described diversity and 77% of the endemics. Our results confirmed a Paleotropical clade nested within an amphi-Atlantic grade. In addition, we identified three new major clades involving species currently belonging to Grammitis s.l., Ctenopterella and Enterosora. We resolved for the first time Grammitis s.s. as monophyletic, and Ctenopterella (newly tested here) and Enterosora as polyphyletic. The Neotropical genus Moranopteris was shown to also occur in Madagascar through a newly discovered species. Most importantly, we suggest a >30% inflation of the species number in the WIO due to the hidden diversity in >10 cryptic lineages, best explained by high morphological homoplasy. Molecular dating and ancestral areas reconstruction allowed identifying the Neotropics as the predominant source of LDD to the African-WIO region, with at least 12 colonization events within the last 20Ma. Repeated eastward migrations may be explained by transoceanic westerly winds transporting the dust-like spores. Tropical Asia s.l. would also have played a (minor) role through one dispersal event to Madagascar at the end of the Oligocene. Last, within the complex Malagasy region made of a mosaic of continental and oceanic islands located close to the African continent, we showed that

  20. An overview of techniques for linking high-dimensional molecular data to time-to-event endpoints by risk prediction models.

    Science.gov (United States)

    Binder, Harald; Porzelius, Christine; Schumacher, Martin

    2011-03-01

    Analysis of molecular data promises identification of biomarkers for improving prognostic models, thus potentially enabling better patient management. For identifying such biomarkers, risk prediction models can be employed that link high-dimensional molecular covariate data to a clinical endpoint. In low-dimensional settings, a multitude of statistical techniques already exists for building such models, e.g. allowing for variable selection or for quantifying the added value of a new biomarker. We provide an overview of techniques for regularized estimation that transfer this toward high-dimensional settings, with a focus on models for time-to-event endpoints. Techniques for incorporating specific covariate structure are discussed, as well as techniques for dealing with more complex endpoints. Employing gene expression data from patients with diffuse large B-cell lymphoma, some typical modeling issues from low-dimensional settings are illustrated in a high-dimensional application. First, the performance of classical stepwise regression is compared to stage-wise regression, as implemented by a component-wise likelihood-based boosting approach. A second issues arises, when artificially transforming the response into a binary variable. The effects of the resulting loss of efficiency and potential bias in a high-dimensional setting are illustrated, and a link to competing risks models is provided. Finally, we discuss conditions for adequately quantifying the added value of high-dimensional gene expression measurements, both at the stage of model fitting and when performing evaluation. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Whole genome analysis of selected human and animal rotaviruses identified in Uganda from 2012 to 2014 reveals complex genome reassortment events between human, bovine, caprine and porcine strains.

    Science.gov (United States)

    Bwogi, Josephine; Jere, Khuzwayo C; Karamagi, Charles; Byarugaba, Denis K; Namuwulya, Prossy; Baliraine, Frederick N; Desselberger, Ulrich; Iturriza-Gomara, Miren

    2017-01-01

    Rotaviruses of species A (RVA) are a common cause of diarrhoea in children and the young of various other mammals and birds worldwide. To investigate possible interspecies transmission of RVAs, whole genomes of 18 human and 6 domestic animal RVA strains identified in Uganda between 2012 and 2014 were sequenced using the Illumina HiSeq platform. The backbone of the human RVA strains had either a Wa- or a DS-1-like genetic constellation. One human strain was a Wa-like mono-reassortant containing a DS-1-like VP2 gene of possible animal origin. All eleven genes of one bovine RVA strain were closely related to those of human RVAs. One caprine strain had a mixed genotype backbone, suggesting that it emerged from multiple reassortment events involving different host species. The porcine RVA strains had mixed genotype backbones with possible multiple reassortant events with strains of human and bovine origin.Overall, whole genome characterisation of rotaviruses found in domestic animals in Uganda strongly suggested the presence of human-to animal RVA transmission, with concomitant circulation of multi-reassortant strains potentially derived from complex interspecies transmission events. However, whole genome data from the human RVA strains causing moderate and severe diarrhoea in under-fives in Uganda indicated that they were primarily transmitted from person-to-person.

  2. Molecular and Functional Characterization of GR2-R1 Event Based Backcross Derived Lines of Golden Rice in the Genetic Background of a Mega Rice Variety Swarna.

    Directory of Open Access Journals (Sweden)

    Haritha Bollinedi

    Full Text Available Homozygous Golden Rice lines developed in the background of Swarna through marker assisted backcross breeding (MABB using transgenic GR2-R1 event as a donor for the provitamin A trait have high levels of provitamin A (up to 20 ppm but are dwarf with pale green leaves and drastically reduced panicle size, grain number and yield as compared to the recurrent parent, Swarna. In this study, we carried out detailed morphological, biochemical and molecular characterization of these lines in a quest to identify the probable reasons for their abnormal phenotype. Nucleotide blast analysis with the primer sequences used to amplify the transgene revealed that the integration of transgene disrupted the native OsAux1 gene, which codes for an auxin transmembrane transporter protein. Real time expression analysis of the transgenes (ZmPsy and CrtI driven by endosperm-specific promoter revealed the leaky expression of the transgene in the vegetative tissues. We propose that the disruption of OsAux1 disturbed the fine balance of plant growth regulators viz., auxins, gibberellic acid and abscisic acid, leading to the abnormalities in the growth and development of the lines homozygous for the transgene. The study demonstrates the conserved roles of OsAux1 gene in rice and Arabidopsis.

  3. Using Remote Sensing and High-Resolution Digital Elevation Models to Identify Potential Erosional Hotspots Along River Channels During High Discharge Storm Events

    Science.gov (United States)

    Orland, E. D.; Amidon, W. H.

    2017-12-01

    As global warming intensifies, large precipitation events and associated floods are becoming increasingly common. Channel adjustments during floods can occur by both erosion and deposition of sediment, often damaging infrastructure in the process. There is thus a need for predictive models that can help managers identify river reaches that are most prone to adjustment during storms. Because rivers in post-glacial landscapes often flow over a mixture of bedrock and alluvial substrates, the identification of bedrock vs. alluvial channel reaches is an important first step in predicting vulnerability to channel adjustment during flood events, especially because bedrock channels are unlikely to adjust significantly, even during floods. This study develops a semi-automated approach to predicting channel substrate using a high-resolution LiDAR-derived digital elevation model (DEM). The study area is the Middlebury River in Middlebury, VT-a well-studied watershed with a wide variety of channel substrates, including reaches with documented channel adjustments during recent flooding events. Multiple metrics were considered for reference—such as channel width and drainage area—but the study utilized channel slope as a key parameter for identifying morphological variations within the Middlebury River. Using data extracted from the DEM, a power law was fit to selected slope and drainage area values for each branch in order to model idealized slope-drainage area relationships, which were then compared with measured slope-drainage area relationships. Differences in measured slope minus predicted slope (called delta-slope) are shown to help predict river channel substrate. Compared with field observations, higher delta-slope values correlate with more stable, boulder rich channels or bedrock gorges; conversely the lowest delta-slope values correlate with flat, sediment rich alluvial channels. The delta-slope metric thus serves as a reliable first-order predictor of channel

  4. A Network Biology Approach Identifies Molecular Cross-Talk between Normal Prostate Epithelial and Prostate Carcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Victor Trevino

    2016-04-01

    Full Text Available The advent of functional genomics has enabled the genome-wide characterization of the molecular state of cells and tissues, virtually at every level of biological organization. The difficulty in organizing and mining this unprecedented amount of information has stimulated the development of computational methods designed to infer the underlying structure of regulatory networks from observational data. These important developments had a profound impact in biological sciences since they triggered the development of a novel data-driven investigative approach. In cancer research, this strategy has been particularly successful. It has contributed to the identification of novel biomarkers, to a better characterization of disease heterogeneity and to a more in depth understanding of cancer pathophysiology. However, so far these approaches have not explicitly addressed the challenge of identifying networks representing the interaction of different cell types in a complex tissue. Since these interactions represent an essential part of the biology of both diseased and healthy tissues, it is of paramount importance that this challenge is addressed. Here we report the definition of a network reverse engineering strategy designed to infer directional signals linking adjacent cell types within a complex tissue. The application of this inference strategy to prostate cancer genome-wide expression profiling data validated the approach and revealed that normal epithelial cells exert an anti-tumour activity on prostate carcinoma cells. Moreover, by using a Bayesian hierarchical model integrating genetics and gene expression data and combining this with survival analysis, we show that the expression of putative cell communication genes related to focal adhesion and secretion is affected by epistatic gene copy number variation and it is predictive of patient survival. Ultimately, this study represents a generalizable approach to the challenge of deciphering cell

  5. A Network Biology Approach Identifies Molecular Cross-Talk between Normal Prostate Epithelial and Prostate Carcinoma Cells.

    Science.gov (United States)

    Trevino, Victor; Cassese, Alberto; Nagy, Zsuzsanna; Zhuang, Xiaodong; Herbert, John; Antczak, Philipp; Clarke, Kim; Davies, Nicholas; Rahman, Ayesha; Campbell, Moray J; Guindani, Michele; Bicknell, Roy; Vannucci, Marina; Falciani, Francesco

    2016-04-01

    The advent of functional genomics has enabled the genome-wide characterization of the molecular state of cells and tissues, virtually at every level of biological organization. The difficulty in organizing and mining this unprecedented amount of information has stimulated the development of computational methods designed to infer the underlying structure of regulatory networks from observational data. These important developments had a profound impact in biological sciences since they triggered the development of a novel data-driven investigative approach. In cancer research, this strategy has been particularly successful. It has contributed to the identification of novel biomarkers, to a better characterization of disease heterogeneity and to a more in depth understanding of cancer pathophysiology. However, so far these approaches have not explicitly addressed the challenge of identifying networks representing the interaction of different cell types in a complex tissue. Since these interactions represent an essential part of the biology of both diseased and healthy tissues, it is of paramount importance that this challenge is addressed. Here we report the definition of a network reverse engineering strategy designed to infer directional signals linking adjacent cell types within a complex tissue. The application of this inference strategy to prostate cancer genome-wide expression profiling data validated the approach and revealed that normal epithelial cells exert an anti-tumour activity on prostate carcinoma cells. Moreover, by using a Bayesian hierarchical model integrating genetics and gene expression data and combining this with survival analysis, we show that the expression of putative cell communication genes related to focal adhesion and secretion is affected by epistatic gene copy number variation and it is predictive of patient survival. Ultimately, this study represents a generalizable approach to the challenge of deciphering cell communication networks

  6. A molecular key for building hyphae aggregates: the role of the newly identified Streptomyces protein HyaS.

    Science.gov (United States)

    Koebsch, Ilona; Overbeck, Jens; Piepmeyer, Sophie; Meschke, Holger; Schrempf, Hildgund

    2009-05-01

    Streptomycetes produce many metabolites with medical and biotechnological applications. During fermentations, their hyphae build aggregates, a process in which the newly identified protein HyaS plays an important role. The corresponding hyaS gene is present within all investigated Streptomyces species. Reporter fusions indicate that transcription of hyaS occurs within substrate hyphae of the Streptomyces lividans wild type (WT). The HyaS protein is dominantly associated with the substrate hyphae. The WT strain forms cylindrically shaped clumps of densely packed substrate hyphae, often fusing to higher aggregates (pellets), which remain stably associated during shaking. Investigations by electron microscopy suggest that HyaS induces tight fusion-like contacts among substrate hyphae. In contrast, the pellets of the designed hyaS disruption mutant ΔH are irregular in shape, contain frequently outgrowing bunches of hyphae, and fuse less frequently. ΔH complemented with a plasmid carrying hyaS resembles the WT phenotype. Biochemical studies indicate that the C-terminal region of HyaS has amine oxidase activity. Investigations of ΔH transformants, each carrying a specifically mutated gene, lead to the conclusion that the in situ oxidase activity correlates with the pellet-inducing role of HyaS, and depends on the presence of certain histidine residues. Furthermore, the level of undecylprodigiosin, a red pigment with antibiotic activity, is influenced by the engineered hyaS subtype within a strain. These data present the first molecular basis for future manipulation of pellets, and concomitant production of secondary metabolites during biotechnological processes. © 2009 The Authors. Journal compilation © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.

  7. The molecular signature of impaired diabetic wound healing identifies serpinB3 as a healing biomarker.

    Science.gov (United States)

    Fadini, Gian Paolo; Albiero, Mattia; Millioni, Renato; Poncina, Nicol; Rigato, Mauro; Scotton, Rachele; Boscari, Federico; Brocco, Enrico; Arrigoni, Giorgio; Villano, Gianmarco; Turato, Cristian; Biasiolo, Alessandra; Pontisso, Patrizia; Avogaro, Angelo

    2014-09-01

    Chronic foot ulceration is a severe complication of diabetes, driving morbidity and mortality. The mechanisms underlying delaying wound healing in diabetes are incompletely understood and tools to identify such pathways are eagerly awaited. Wound biopsies were obtained from 75 patients with diabetic foot ulcers. Matched subgroups of rapidly healing (RH, n = 17) and non-healing (NH, n = 11) patients were selected. Proteomic analysis was performed by labelling with isobaric tag for relative and absolute quantification and mass spectrometry. Differentially expressed proteins were analysed in NH vs RH for identification of pathogenic pathways. Individual sample gene/protein validation and in vivo validation of candidate pathways in mouse models were carried out. Pathway analyses were conducted on 92/286 proteins that were differentially expressed in NH vs RH. The following pathways were enriched in NH vs RH patients: apoptosis, protease inhibitors, epithelial differentiation, serine endopeptidase activity, coagulation and regulation of defence response. SerpinB3 was strongly upregulated in RH vs NH wounds, validated as protein and mRNA in individual samples. To test the relevance of serpinB3 in vivo, we used a transgenic mouse model with α1-antitrypsin promoter-driven overexpression of human SERPINB3. In this model, wound healing was unaffected by SERPINB3 overexpression in non-diabetic or diabetic mice with or without hindlimb ischaemia. In an independent validation cohort of 47 patients, high serpinB3 protein content was confirmed as a biomarker of healing improvement. We provide a benchmark for the unbiased discovery of novel molecular targets and biomarkers of impaired diabetic wound healing. High serpinB3 protein content was found to be a biomarker of successful healing in diabetic patients.

  8. T cell differentiation stages identified by molecular and immunologic analysis of the T cell receptor complex in childhood lymphoblastic leukemia.

    Science.gov (United States)

    Mirro, J; Kitchingman, G; Behm, F G; Murphy, S B; Goorha, R M

    1987-03-01

    T cell differentiation was investigated by determining the relationship of T cell receptor (Ti) gene rearrangement and transcription to the expression of surface and cytoplasmic T3 antigen using blast cells from five children with acute lymphoblastic leukemia of thymic origin. Patterns of monoclonal antibody (MoAb) reactivity indicated that these cases were representative of the three recognized stages (I, II, III) of human thymocyte development. The T3 antigen, which becomes linked to the Ti to form a functional T cell receptor complex on mature thymocytes, was expressed on the cell surface in two cases (stage III). However, in the remaining three cases that were surface T3 negative (stages I and II), large amounts of T3 were identified in the cytoplasm by immunoperoxidase staining and flow cytometry. Leukemic blasts from all five patients showed rearranged genes encoding the beta-chain portion of the Ti heterodimer. RNA transcripts of Ti beta-chain genes were also evident in lymphoblasts from all five cases, but transcripts coding for the alpha-chain portion of Ti were found only in cases that expressed T3 on the cell surface. Thus the absence of surface T3 (and presumably Ti) coincides with the absence of Ti alpha-chain RNA, suggesting that transcription of alpha-chain genes is a critical regulatory event in the surface expression of the Ti-T3 complex. Leukemic T cells that rearrange and express Ti beta-chain genes but lack Ti alpha-chain messenger RNA (mRNA) may represent a stage of differentiation analogous to pre-B cells, where heavy-chain immunoglobulin (Ig) genes are rearranged and expressed but light-chain Ig genes are not expressed.

  9. Application of the RES methodology for identifying features, events and processes (FEPs) for near-field analysis of copper-steel canister

    International Nuclear Information System (INIS)

    Vieno, T.; Hautojaervi, A.; Raiko, H.; Ahonen, L.; Salo, J.P.

    1994-12-01

    Rock Engineering Systems (RES) is an approach to discover the important characteristics and interactions of a complex problem. Recently RES has been applied to identify features, events and processes (FEPs) for performance analysis of nuclear waste repositories. The RES methodology was applied to identify FEPs for the near-field analysis of the copper-steel canister for spent fuel disposal. The aims of the exercise were to learn and test the RES methodology and, secondly, to find out how much the results differ when RES is applied by two different groups on the same problem. A similar exercise was previously carried out by a SKB group. A total of 90 potentially significant FEPs were identified. The exercise showed that the RES methodology is a practicable tool to get a comprehensive and transparent picture of a complex problem. The approach is easy to learn and use. It reveals the important characteristics and interactions and organizes them in a format easy to understand. (9 refs., 5 figs., 3 tabs.)

  10. Intra-event correlations and the statistical moments of the identified particle multiplicity distributions in the RHIC beam energy scan data collected by STAR

    Science.gov (United States)

    Llope, W. J.; STAR Collaboration

    2013-10-01

    Specific products of the statistical moments of the multiplicity distributions of identified particles can be directly compared to susceptibility ratios obtained from lattice QCD calculations. They may also diverge for nuclear systems formed close to a possible QCD critical point due to the phenomenon of critical opalescence. Of particular interest are the moments products for net-protons, net-kaons, and net-charge, as these are considered proxies for conserved quantum numbers. The moments products have been measured by the STAR experiment for Au+Au collisions at seven beam energies ranging from 7.7 to 200 GeV. In this presentation, the experimental results are compared to data-based calculations in which the intra-event correlations of the numbers of positive and negative particles are broken by construction. The importance of intra-event correlations to the moments products values for net-protons, net-kaons, and net-charge can thus be evaluated. Work supported by the U.S. Dept of Energy under grant DE-PS02-09ER09.

  11. Integrative genome-wide expression profiling identifies three distinct molecular subgroups of renal cell carcinoma with different patient outcome

    Directory of Open Access Journals (Sweden)

    Beleut Manfred

    2012-07-01

    Full Text Available Abstract Background Renal cell carcinoma (RCC is characterized by a number of diverse molecular aberrations that differ among individuals. Recent approaches to molecularly classify RCC were based on clinical, pathological as well as on single molecular parameters. As a consequence, gene expression patterns reflecting the sum of genetic aberrations in individual tumors may not have been recognized. In an attempt to uncover such molecular features in RCC, we used a novel, unbiased and integrative approach. Methods We integrated gene expression data from 97 primary RCC of different pathologic parameters, 15 RCC metastases as well as 34 cancer cell lines for two-way nonsupervised hierarchical clustering using gene groups suggested by the PANTHER Classification System. We depicted the genomic landscape of the resulted tumor groups by means of Single Nuclear Polymorphism (SNP technology. Finally, the achieved results were immunohistochemically analyzed using a tissue microarray (TMA composed of 254 RCC. Results We found robust, genome wide expression signatures, which split RCC into three distinct molecular subgroups. These groups remained stable even if randomly selected gene sets were clustered. Notably, the pattern obtained from RCC cell lines was clearly distinguishable from that of primary tumors. SNP array analysis demonstrated differing frequencies of chromosomal copy number alterations among RCC subgroups. TMA analysis with group-specific markers showed a prognostic significance of the different groups. Conclusion We propose the existence of characteristic and histologically independent genome-wide expression outputs in RCC with potential biological and clinical relevance.

  12. Search for charged Higgs bosons and measurement of |V sub c sub s | in quark and lepton flavour identified events at LEP2

    CERN Document Server

    Kiiskinen, A P

    1999-01-01

    A search for pair produced charged Higgs bosons was performed on the high energy data collected by DELPHI at LEP2. All three major final states, tau nu tau nu, cs tau nu and cscs were searched for. The analyses used a combination of event shape variables, di-jet masses and jet flavour tagging. The jet flavours were identified by using life time tagging and particle identification based on the RICH detector complemented by ionisation energy loss measurements. A similar type of jet flavour tagging was also used in extracting the |V sub c sub s | element of the Cabibbo-Kobayashi-Maskawa (CKM) matrix in hadronic decays of the W sup+- boson.

  13. The past and the future of Alzheimer’s disease CSF biomarkers – a journey towards validated biochemical tests covering the whole spectra of molecular events

    Directory of Open Access Journals (Sweden)

    Kaj eBlennow

    2015-09-01

    Full Text Available This paper gives a short review on cerebrospinal fluid (CSF biomarkers for Alzheimer’s disease (AD, from early developments to high-precision validated assays on fully automated lab analyzers. We also discuss developments on novel biomarkers, such as synaptic proteins and Aβ oligomers. Our vision for the future is that assaying a set of biomarkers in a single CSF tube can monitor the whole spectra of AD molecular pathogenic events. CSF biomarkers will have a central position not only for clinical diagnosis, but also for the understanding of the sequence of molecular events in the pathogenic process underlying AD and as tools to monitor the effects of novel drug candidates targeting these different mechanisms.

  14. Molecular composition of rainwater and aerosol during rain events in León, Spain, using high resolution mass spectrometry.

    Science.gov (United States)

    Fee, Anna

    2017-04-01

    Anna Fee (1), Markus Kalberer (1), Roberto Fraile (2), Amaya Castro (2), Ana. I. Calvo (2), Carlos Blanco-Alegre (2), Fernanda Oduber (2) and Mário Cerqueira (3). 1 Department of Chemistry, University of Cambridge, UK. 2 Department of Applied Chemistry and Physics, IMARENAB, University of León, Spain. 3 Department of Environmental Planning, University of Aveiro, Portugal. A wide range of atmospheric compounds which are present in rainwater are often also present in aerosol. They can be taken up during cloud droplet formation (in-cloud scavenging) or washed out during precipitation (below-cloud scavenging). Such compounds including aromatic hydrocarbons and organic nitrogen containing compounds are hazardous to health. In this study, the organic chemical composition of rainwater and aerosol from rain events in León, Spain, is being analysed using high resolution mass spectrometry. Collected rainwater along with high volume and low volume filters from rain events which occurred during spring, summer and winter of 2016 have been selected for analysis. Rainwater samples were prepared using Polymeric Reversed Phase Solid Phase Extraction (SPE) and filters have been extracted in water with and without SPE. Three different SPE polymer based sorbents were tested; one for extracting neutral compounds and two which are more suitable for extracting organic compounds containing sulphate and other polar functional groups. The sorbent for extracting neutral compounds was found to yield a higher number of compounds from the sample extraction than the other two varieties. Kendrick masses, Van Krevelen plots and carbon oxidation states have been investigated to identify compounds and patterns. Preliminary results show a predominance in peaks with O/C ratios between 0.2 and 0.7 and H/C ratios between 1 and 2 in both rain and aerosol samples which indicates substituted aromatic compounds. Cellulose material and fatty acids may also be present. The rain samples also have a

  15. Demographic clusters identified within the northern Gulf of Mexico common bottlenose dolphin (Tursiops truncates unusual mortality event: January 2010-June 2013.

    Directory of Open Access Journals (Sweden)

    Stephanie Venn-Watson

    Full Text Available A multi-year unusual mortality event (UME involving primarily common bottlenose dolphins (Tursiops truncates was declared in the northern Gulf of Mexico (GoM with an initial start date of February 2010 and remains ongoing as of August 2014. To examine potential changing characteristics of the UME over time, we compared the number and demographics of dolphin strandings from January 2010 through June 2013 across the entire GoM as well as against baseline (1990-2009 GoM stranding patterns. Years 2010 and 2011 had the highest annual number of stranded dolphins since Louisiana's record began, and 2011 was one of the years with the highest strandings for both Mississippi and Alabama. Statewide, annual numbers of stranded dolphins were not elevated for GoM coasts of Florida or Texas during the UME period. Demographic, spatial, and temporal clusters identified within this UME included increased strandings in northern coastal Louisiana and Mississippi (March-May 2010; Barataria Bay, Louisiana (August 2010-December 2011; Mississippi and Alabama (2011, including a high prevalence and number of stranded perinates; and multiple GoM states during early 2013. While the causes of the GoM UME have not been determined, the location and magnitude of dolphin strandings during and the year following the 2010 Deepwater Horizon oil spill, including the Barataria Bay cluster from August 2010 to December 2011, overlap in time and space with locations that received heavy and prolonged oiling. There are, however, multiple known causes of previous GoM dolphin UMEs, including brevetoxicosis and dolphin morbillivirus. Additionally, increased dolphin strandings occurred in northern Louisiana and Mississippi before the Deepwater Horizon oil spill. Identification of spatial, temporal, and demographic clusters within the UME suggest that this mortality event may involve different contributing factors varying by location, time, and bottlenose dolphin populations that will be

  16. Molecular grading of tumors of the upper urothelial tract using FGFR3 mutation status identifies patients with favorable prognosis

    OpenAIRE

    Fernandez, Cecilia; Lyle,Stephen; Hsieh,; Shuber,Anthony

    2012-01-01

    Stephen R Lyle,1 Chung-Cheng Hsieh,1 Cecilia A Fernandez,2 Anthony P Shuber21University of Massachusetts, Worcester, MA, 2Predictive Biosciences Inc., Lexington, MA, USABackground: Mutations in FGFR3 have been shown to occur in tumors of the upper urothelial tract and may be indicative of a good prognosis. In bladder tumors, the combination of FGFR3 mutation status and Ki-67 level has been used to define a tumor's molecular grade and predict survival. Pathological evaluation of upper ...

  17. Molecular fingerprinting of the myxozoan community in common carp suffering Swim Bladder Inflammation (SBI) identifies multiple etiological agents

    Czech Academy of Sciences Publication Activity Database

    Holzer, Astrid S.; Hartigan, Ashlie; Patra, Sneha; Pecková, Hana; Eszterbauer, E.

    2014-01-01

    Roč. 7, AUG 28 2014 (2014), s. 398 ISSN 1756-3305 R&D Projects: GA AV ČR(CZ) M200961205; GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : Cyprinus carpio carpio * swim bladder inflammation * fish disease * Myxozoa * molecular diagnostic * rDNA * in situ hybridisation Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.430, year: 2014

  18. Evaluation of serological and molecular tests used to identify Toxoplasma gondii infection in pregnant women attended in a public health service in São Paulo state, Brazil.

    Science.gov (United States)

    Murata, Fernando Henrique Antunes; Ferreira, Marina Neves; Pereira-Chioccola, Vera Lucia; Spegiorin, Lígia Cosentino Junqueira Franco; Meira-Strejevitch, Cristina da Silva; Gava, Ricardo; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

    2017-09-01

    Toxoplasmosis during pregnancy can have severe consequences. The use of sensitive and specific serological and molecular methods is extremely important for the correct diagnosis of the disease. We compared the ELISA and ELFA serological methods, conventional PCR (cPCR), Nested PCR and quantitative PCR (qPCR) in the diagnosis of Toxoplasma gondii infection in pregnant women without clinical suspicion of toxoplasmosis (G1=94) and with clinical suspicion of toxoplasmosis (G2=53). The results were compared using the Kappa index, and the sensitivity, specificity, positive predictive value and negative predictive value were calculated. The results of the serological methods showed concordance between the ELISA and ELFA methods even though ELFA identified more positive cases than ELISA. Molecular methods were discrepant with cPCR using B22/23 primers having greater sensitivity and lower specificity compared to the other molecular methods. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  20. SRBreak: A read-depth and split-read framework to identify breakpoints of different events inside simple copy-number variable regions

    Directory of Open Access Journals (Sweden)

    HOANG T NGUYEN

    2016-09-01

    Full Text Available Copy-number variation (CNV has been associated with increased risk of complex diseases. High throughput sequencing (HTS technologies facilitate the detection of copy-number variable regions (CNVRs and their breakpoints. This helps in understanding genome structures of genomes as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximise information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM the pipeline obtained good concordance with results from the 1000 Genomes Project (92%, 100% and 82%, respectively.The package is available at https://github.com/hoangtn/SRBreak, and also as a docker-based application at https://registry.hub.docker.com/u/hoangtn/srbreak/.

  1. Deciphering the molecular events necessary for synergistic tumor cell apoptosis mediated by the histone deacetylase inhibitor vorinostat and the BH3 mimetic ABT-737

    NARCIS (Netherlands)

    Wiegmans, Adrian P.; Alsop, Amber E.; Bots, Michael; Cluse, Leonie A.; Williams, Steven P.; Banks, Kellie-Marie; Ralli, Rachael; Scott, Clare L.; Frenzel, Anna; Villunger, Andreas; Johnstone, Ricky W.

    2011-01-01

    The concept of personalized anticancer therapy is based on the use of targeted therapeutics through in-depth knowledge of the molecular mechanisms of action of these agents when used alone and in combination. We have identified the apoptotic proteins and pathways necessary for synergistic tumor cell

  2. Subtype-Specific Genes that Characterize Subpopulations of Callosal Projection Neurons in Mouse Identify Molecularly Homologous Populations in Macaque Cortex.

    Science.gov (United States)

    Fame, Ryann M; Dehay, Colette; Kennedy, Henry; Macklis, Jeffrey D

    2017-03-01

    Callosal projection neurons (CPN) interconnect the neocortical hemispheres via the corpus callosum and are implicated in associative integration of multimodal information. CPN have undergone differential evolutionary elaboration, leading to increased diversity of cortical neurons-and more extensive and varied connections in neocortical gray and white matter-in primates compared with rodents. In mouse, distinct sets of genes are enriched in discrete subpopulations of CPN, indicating the molecular diversity of rodent CPN. Elements of rodent CPN functional and organizational diversity might thus be present in the further elaborated primate cortex. We address the hypothesis that genes controlling mouse CPN subtype diversity might reflect molecular patterns shared among mammals that arose prior to the divergence of rodents and primates. We find that, while early expression of the examined CPN-enriched genes, and postmigratory expression of these CPN-enriched genes in deep layers are highly conserved (e.g., Ptn, Nnmt, Cited2, Dkk3), in contrast, the examined genes expressed by superficial layer CPN show more variable levels of conservation (e.g., EphA3, Chn2). These results suggest that there has been evolutionarily differential retraction and elaboration of superficial layer CPN subpopulations between mouse and macaque, with independent derivation of novel populations in primates. Together, these data inform future studies regarding CPN subpopulations that are unique to primates and rodents, and indicate putative evolutionary relationships. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Atom Tunneling in the Hydroxylation Process of Taurine/α-Ketoglutarate Dioxygenase Identified by Quantum Mechanics/Molecular Mechanics Simulations.

    Science.gov (United States)

    Álvarez-Barcia, Sonia; Kästner, Johannes

    2017-06-01

    Taurine/α-ketoglutarate dioxygenase is one of the most studied α-ketoglutarate-dependent dioxygenases (αKGDs), involved in several biotechnological applications. We investigated the key step in the catalytic cycle of the αKGDs, the hydrogen transfer process, by a quantum mechanics/molecular mechanics approach (B3LYP/CHARMM22). Analysis of the charge and spin densities during the reaction demonstrates that a concerted mechanism takes place, where the H atom transfer happens simultaneously with the electron transfer from taurine to the Fe═O cofactor. We found the quantum tunneling of the hydrogen atom to increase the rate constant by a factor of 40 at 5 °C. As a consequence, a quite high kinetic isotope effect close to 60 is obtained, which is consistent with the experimental value.

  4. Potential bacterial core species associated with digital dermatitis in cattle herds identified by molecular profiling of interdigital skin samples

    DEFF Research Database (Denmark)

    Weiss Nielsen, Martin; Strube, Mikael Lenz; Isbrand, Anastasia

    2016-01-01

    of different molecular methods. Deep sequencing of the 16S rRNA gene variable regions V1–V2 showed that Treponema, Mycoplasma, Fusobacterium and Porphyromonas were the genera best differentiating the DD samples from the controls. Additional deep sequencing analysis of the most abundant genus, Treponema...... in the epidermal lesions and were present in only a subset of samples. RT-qPCR analysis showed that treponemes were also actively expressing a panel of virulence factors at the site of infection. Our results further support the hypothesis that species belonging to the genus Treponema are major pathogens of DD...... and also provide sufficient clues to motivate additional research into the role of M. fermentans, F. necrophorum and P. levii in the etiology of DD....

  5. Molecular Events Accompanying Rous Sarcoma Virus Rescue from Rodent Cells and the Role of Viral Gene Complementation

    Czech Academy of Sciences Publication Activity Database

    Lounková, Anna; Dráberová, Eduarda; Šenigl, Filip; Trejbalová, Kateřina; Geryk, Josef; Hejnar, Jiří; Svoboda, Jan

    2014-01-01

    Roč. 88, č. 6 (2014), s. 3505-3515 ISSN 0022-538X R&D Projects: GA ČR GAP502/11/2207; GA ČR GAP302/12/1673 Institutional support: RVO:68378050 Keywords : Rous sarcoma virus * heterotransmission * cell non-permissiveness Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.439, year: 2014

  6. Molecular characterization and functional analysis of PR-1-like proteins identified from the wheat head blight fungus Fusarium graminearum

    Science.gov (United States)

    The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologues are also found in other eukaryotic kingdoms. Studies on non-plant PR-1-like (PR-1L) proteins have been pursued widely in humans/animals but rarely in filamentous ascomycetes. Here we report the ch...

  7. Molecular events associated with increased regenerative capacity of the goldfish retinal ganglion cells following X-irradiation: decreased level of axonal growth inhibitors

    International Nuclear Information System (INIS)

    Rachailovich, I.; Schwartz, M.

    1984-01-01

    In our previous work we established conditions to study the contribution of non-neuronal cells to the process of goldfish optic nerve regeneration. This issue has been studied successfully by adapting the use of X-irradiation to manipulate division of non-neuronal cells associated with the injured nerve. The regenerative capacity of the goldfish retinal ganglion cells was determined subsequent to the X-ray treatment. The authors present an analysis of the molecular events associated with regeneration and enhanced regenerative capacity which follows X-irradiation. (Auth.)

  8. Molecular events associated with increased regenerative capacity of the goldfish retinal ganglion cells following X-irradiation: decreased level of axonal growth inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Rachailovich, I.; Schwartz, M. (Weizmann Inst. of Science, Rehovot (Israel). Dept. of Neurobiology)

    1984-07-23

    In our previous work we established conditions to study the contribution of non-neuronal cells to the process of goldfish optic nerve regeneration. This issue has been studied successfully by adapting the use of X-irradiation to manipulate division of non-neuronal cells associated with the injured nerve. The regenerative capacity of the goldfish retinal ganglion cells was determined subsequent to the X-ray treatment. The authors present an analysis of the molecular events associated with regeneration and enhanced regenerative capacity which follows X-irradiation.

  9. sxtA-Based Quantitative Molecular Assay To Identify Saxitoxin-Producing Harmful Algal Blooms in Marine Waters ▿ †

    Science.gov (United States)

    Murray, Shauna A.; Wiese, Maria; Stüken, Anke; Brett, Steve; Kellmann, Ralf; Hallegraeff, Gustaaf; Neilan, Brett A.

    2011-01-01

    The recent identification of genes involved in the production of the potent neurotoxin and keystone metabolite saxitoxin (STX) in marine eukaryotic phytoplankton has allowed us for the first time to develop molecular genetic methods to investigate the chemical ecology of harmful algal blooms in situ. We present a novel method for detecting and quantifying the potential for STX production in marine environmental samples. Our assay detects a domain of the gene sxtA that encodes a unique enzyme putatively involved in the sxt pathway in marine dinoflagellates, sxtA4. A product of the correct size was recovered from nine strains of four species of STX-producing Alexandrium and Gymnodinium catenatum and was not detected in the non-STX-producing Alexandrium species, other dinoflagellate cultures, or an environmental sample that did not contain known STX-producing species. However, sxtA4 was also detected in the non-STX-producing strain of Alexandrium tamarense, Tasmanian ribotype. We investigated the copy number of sxtA4 in three strains of Alexandrium catenella and found it to be relatively constant among strains. Using our novel method, we detected and quantified sxtA4 in three environmental blooms of Alexandrium catenella that led to STX uptake in oysters. We conclude that this method shows promise as an accurate, fast, and cost-effective means of quantifying the potential for STX production in marine samples and will be useful for biological oceanographic research and harmful algal bloom monitoring. PMID:21841034

  10. sxtA-based quantitative molecular assay to identify saxitoxin-producing harmful algal blooms in marine waters.

    Science.gov (United States)

    Murray, Shauna A; Wiese, Maria; Stüken, Anke; Brett, Steve; Kellmann, Ralf; Hallegraeff, Gustaaf; Neilan, Brett A

    2011-10-01

    The recent identification of genes involved in the production of the potent neurotoxin and keystone metabolite saxitoxin (STX) in marine eukaryotic phytoplankton has allowed us for the first time to develop molecular genetic methods to investigate the chemical ecology of harmful algal blooms in situ. We present a novel method for detecting and quantifying the potential for STX production in marine environmental samples. Our assay detects a domain of the gene sxtA that encodes a unique enzyme putatively involved in the sxt pathway in marine dinoflagellates, sxtA4. A product of the correct size was recovered from nine strains of four species of STX-producing Alexandrium and Gymnodinium catenatum and was not detected in the non-STX-producing Alexandrium species, other dinoflagellate cultures, or an environmental sample that did not contain known STX-producing species. However, sxtA4 was also detected in the non-STX-producing strain of Alexandrium tamarense, Tasmanian ribotype. We investigated the copy number of sxtA4 in three strains of Alexandrium catenella and found it to be relatively constant among strains. Using our novel method, we detected and quantified sxtA4 in three environmental blooms of Alexandrium catenella that led to STX uptake in oysters. We conclude that this method shows promise as an accurate, fast, and cost-effective means of quantifying the potential for STX production in marine samples and will be useful for biological oceanographic research and harmful algal bloom monitoring.

  11. Molecular analysis of faecal samples from birds to identify potential crop pests and useful biocontrol agents in natural areas.

    Science.gov (United States)

    King, R A; Symondson, W O C; Thomas, R J

    2015-06-01

    Wild habitats adjoining farmland are potentially valuable sources of natural enemies, but also of pests. Here we tested the utility of birds as 'sampling devices', to identify the diversity of prey available to predators and particularly to screen for pests and natural enemies using natural ecosystems as refugia. Here we used PCR to amplify prey DNA from three sympatric songbirds foraging on small invertebrates in Phragmites reedbed ecosystems, namely the Reed Warbler (Acrocephalus scirpaceus), Sedge Warbler (Acrocephalus schoenobaenus) and Cetti's Warbler (Cettia cetti). A recently described general invertebrate primer pair was used for the first time to analyse diets. Amplicons were cloned and sequenced, then identified by reference to the Barcoding of Life Database and to our own sequences obtained from fresh invertebrates. Forty-five distinct prey DNA sequences were obtained from 11 faecal samples, of which 39 could be identified to species or genus. Targeting three warbler species ensured that species-specific differences in prey choice broadened the range of prey taken. Amongst the prey found in reedbeds were major pests (including the tomato moth Lacanobia oleracea) as well as many potentially valuable natural enemies including aphidophagous hoverflies and braconid wasps. Given the mobility of birds, this approach provides a practical way of sampling a whole habitat at once, providing growers with information on possible invasion by locally resident pests and the colonization potential of natural enemies from local natural habitats.

  12. Molecular typing and characterization of a new serotype of human enterovirus (EV-B111) identified in China.

    Science.gov (United States)

    Zhang, Yong; Hong, Mei; Sun, Qiang; Zhu, Shuangli; Tsewang; Li, Xiaolei; Yan, Dongmei; Wang, Dongyan; Xu, Wenbo

    2014-04-01

    Molecular methods, based on sequencing the region encoding the complete VP1 or P1 protein, have enabled the rapid identification of new enterovirus serotypes. In the present study, the complete genome of a newly discovered enterovirus serotype, strain Q0011/XZ/CHN/2000 (hereafter referred to as Q0011), was sequenced and analyzed. The virus, isolated from a stool sample from a patient with acute flaccid paralysis in the Tibet region of China in 2000, was characterized by amplicon sequencing and comparison to a GenBank database of enterovirus nucleotide sequences. The nucleotide sequence encoding the complete VP1 capsid protein is most closely related to the sequences of viruses within the species enterovirus B (EV-B), but is less than 72.1% identical to the homologous sequences of the recognized human enterovirus serotypes, with the greatest homology to EV-B101 and echovirus 32. Moreover, the deduced amino acid sequence of the complete VP1 region is less than 84.7% identical to those of the recognized serotypes, suggesting that the strain is a new serotype of enterovirus within EV-B. The virus was characterized as a new enterovirus type, named EV-B111, by the Picornaviridae Study Group of the International Committee on Taxonomy of Viruses. Low positive rate and titer of neutralizing antibody against EV-B111 were found in the Tibet region of China. Nearly 50% of children ≤5 years had no neutralizing antibody against EV-B111. So the extent of transmission and the exposure of the population to this new EV are very limited. This is the first identification of a new serotype of human enterovirus in China, and strain Q0011 was designated the prototype strain of EV-B111. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Development of a new marker system for identifying the complex members of the low-molecular-weight glutenin subunit gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Zhang, Xiaofei; Liu, Dongcheng; Yang, Wenlong; Liu, Kunfan; Sun, Jiazhu; Guo, Xiaoli; Li, Yiwen; Wang, Daowen; Ling, Hongqing; Zhang, Aimin

    2011-05-01

    Low-molecular-weight glutenin subunits (LMW-GSs) play an important role in determining the bread-making quality of bread wheat. However, LMW-GSs display high polymorphic protein complexes encoded by multiple genes, and elucidating the complex LMW-GS gene family in bread wheat remains challenging. In the present study, using conventional polymerase chain reaction (PCR) with conserved primers and high-resolution capillary electrophoresis, we developed a new molecular marker system for identifying LMW-GS gene family members. Based on sequence alignment of 13 LMW-GS genes previously identified in the Chinese bread wheat variety Xiaoyan 54 and other genes available in GenBank, PCR primers were developed and assigned to conserved sequences spanning the length polymorphism regions of LMW-GS genes. After PCR amplification, 17 DNA fragments in Xiaoyan 54 were detected using capillary electrophoresis. In total, 13 fragments were identical to previously identified LMW-GS genes, and the other 4 were derived from unique LMW-GS genes by sequencing. This marker system was also used to identify LMW-GS genes in Chinese Spring and its group 1 nulli-tetrasomic lines. Among the 17 detected DNA fragments, 4 were located on chromosome 1A, 5 on 1B, and 8 on 1D. The results suggest that this marker system is useful for large-scale identification of LMW-GS genes in bread wheat varieties, and for the selection of desirable LMW-GS genes to improve the bread-making quality in wheat molecular breeding programmes.

  14. Molecular profiling of short-term and long-term surviving patients identifies CD34 mRNA level as prognostic for glioblastoma survival

    DEFF Research Database (Denmark)

    Michaelsen, Signe Regner; Urup, Thomas; Olsen, Lars Rønn

    2018-01-01

    Despite extensive treatment, overall survival (OS) for glioblastoma (GBM) remains poor. A small proportion of patients present long survival over 3 years, but the underlying molecular background separating these long-term survivors (LTS) from short-term survivors (STS) are insufficiently understood....... Accordingly, study aim was to identify independent prognostic biomarkers for survival. Study cohort consisted of 93 primary GBM patients treated with radiation-, chemo- and bevacizumab therapy, among which 14 STS (OS ≤ 12 months) and 6 LTS (OS ≥ 36 months) were identified, all confirmed being IDH wild......-type. RNA expression levels in diagnostic tumor specimen for 792 genes were analyzed by NanoString technology. While no differences were found with regard to GBM subtype between LTS versus STS, comparative analysis of individual genes identified 14 significantly differently expressed candidate genes...

  15. Biochemical and molecular characteristics of patients with organic acidaemias and urea cycle disorders identified through newborn screening.

    Science.gov (United States)

    Barends, M; Pitt, J; Morrissy, S; Tzanakos, N; Boneh, A

    2014-01-01

    In recent years it has become clear that newborn screening (NBS) programmes using tandem mass spectrometry identify "patients" with "classical" inborn errors of metabolism who are asymptomatic. This observation raises issues regarding medicalization of "non-diseases," potentially unnecessary treatment and unnecessary anxiety to parents. This study aims to identify possible markers that may assist in predicting the need for treatment of infants with "classical" organic acidaemias (OA) and urea cycle disorders (UCD) diagnosed through NBS. Medical records of all patients with classical OA and UCD detected through the Victorian NBS programme from February 2002 to January 2014, or diagnosed clinically between 1990 and January 2002 were retrospectively reviewed. Neonatal presentation did not always predict the need for on-going strict treatment. Blood concentrations of amino acids and acyl-carnitines and the changes thereof in follow-up samples correlated with severity in citrullinaemia-I, possibly isovaleric acidaemia but not in argininosuccinic aciduria or propionic acidaemia. Some specific mutations correlate with "attenuated" citrullinaemia-I. Gender may affect clinical outcome in propionic acidaemia. Changes in blood concentration of certain metabolites (amino acids, acyl-carnitines) in the first weeks of life may be predictive of the need for treatment in some disorders but not in others. Mutation analysis may be predictive in some disorders but whether or not this should be considered as second-tier testing in NBS should be discussed separately. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  17. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, Rikke L. V.; Oettinger, Thomas; Rosenkrands, Ida

    2000-01-01

    . The molecules were characterized, mapped in a two-dimensional electrophoresis reference map of short-term culture filtrate, and compared with another recently identified low-mass protein, CFP10 (F. X. Berthet, P, B. Rasmussen, I. Rosenkrands, P. Andersen, and B. Gicquel. Microbiology 144:3195-3203, 1998......), and the well-described ESAT-6 antigen. Genetic analyses demonstrated that TB10.4 as well as CFP10 belongs to the ESAT-6 family of low-mass proteins, whereas TB7.3 is a low-molecular-mass protein outside this family. The proteins were expressed in Escherichia coli, and their immunogenicity was tested...

  18. Diet of pumas (Puma concolor) in Sonora, Mexico, as determined by GPS kill sites and molecular identified scat, with comments on jaguar (Panthera onca) diet

    Science.gov (United States)

    Cassaigne, Ivonne; Medellin, Rodrigo A.; Thompson, Ron W.; Culver, Melanie; Ochoa, Alexander; Vargas, Karla; Childs, Jack L.; Sanderson, Jim; List, Rurik; Torres-Gomez, Armando

    2016-01-01

    We documented puma (Puma concolor) and jaguar (Panthera onca) prey consumption in northeastern Sonora, Mexico, by investigating global positioning system cluster sites (n = 220), and conducting molecular analyses of scat (n = 116) collected between 2011 and 2013. We used camera trap data (n = 8,976 camera days) to estimate relative abundances of pumas and jaguars. Deer (Odocoileus virginianus) was the most frequent prey for puma found at kill sites (67%) and identified from scat (74%), although based on relative numbers of prey consumed, deer represented 45% and lagomorphs 20% of the proportion of all individuals eaten. A variety of small prey (weighing Sonora.

  19. Bringing molecules back into molecular evolution.

    Directory of Open Access Journals (Sweden)

    Claus O Wilke

    Full Text Available Much molecular-evolution research is concerned with sequence analysis. Yet these sequences represent real, three-dimensional molecules with complex structure and function. Here I highlight a growing trend in the field to incorporate molecular structure and function into computational molecular-evolution work. I consider three focus areas: reconstruction and analysis of past evolutionary events, such as phylogenetic inference or methods to infer selection pressures; development of toy models and simulations to identify fundamental principles of molecular evolution; and atom-level, highly realistic computational modeling of molecular structure and function aimed at making predictions about possible future evolutionary events.

  20. Virtual screening approach to identifying influenza virus neuraminidase inhibitors using molecular docking combined with machine-learning-based scoring function.

    Science.gov (United States)

    Zhang, Li; Ai, Hai-Xin; Li, Shi-Meng; Qi, Meng-Yuan; Zhao, Jian; Zhao, Qi; Liu, Hong-Sheng

    2017-10-10

    In recent years, an epidemic of the highly pathogenic avian influenza H7N9 virus has persisted in China, with a high mortality rate. To develop novel anti-influenza therapies, we have constructed a machine-learning-based scoring function (RF-NA-Score) for the effective virtual screening of lead compounds targeting the viral neuraminidase (NA) protein. RF-NA-Score is more accurate than RF-Score, with a root-mean-square error of 1.46, Pearson's correlation coefficient of 0.707, and Spearman's rank correlation coefficient of 0.707 in a 5-fold cross-validation study. The performance of RF-NA-Score in a docking-based virtual screening of NA inhibitors was evaluated with a dataset containing 281 NA inhibitors and 322 noninhibitors. Compared with other docking-rescoring virtual screening strategies, rescoring with RF-NA-Score significantly improved the efficiency of virtual screening, and a strategy that averaged the scores given by RF-NA-Score, based on the binding conformations predicted with AutoDock, AutoDock Vina, and LeDock, was shown to be the best strategy. This strategy was then applied to the virtual screening of NA inhibitors in the SPECS database. The 100 selected compounds were tested in an in vitro H7N9 NA inhibition assay, and two compounds with novel scaffolds showed moderate inhibitory activities. These results indicate that RF-NA-Score improves the efficiency of virtual screening for NA inhibitors, and can be used successfully to identify new NA inhibitor scaffolds. Scoring functions specific for other drug targets could also be established with the same method.

  1. Study on pivot-point vibration of molecular bond-rupture events by quartz crystal microbalance for biomedical diagnostics.

    Science.gov (United States)

    Yuan, Yong J; Jia, Renjie

    2012-01-01

    Bond-rupture scanning for biomedical diagnostics is examined using quartz crystal microbalance (QCM) experiments and microparticle mechanics modeling calculations. Specific and nonspecific interactions between a microparticle and its binding QCM surface can be distinguished by gradually increasing the amplitude of driving voltage applied to QCM and monitoring its frequency changes. This research proposes a mechanical model of interactions between biological molecules and a QCM substrate surface. The mechanical force required to break a biotin-streptavidin bond was calculated through a one-pivot-point bottom-up vibration model. The bond-rupture force increases with an increase of the microparticle radius, the QCM resonant frequency, and the amplitude of driving voltage applied to the QCM. The significance of the research on biological molecular bond rupture is extremely important in characterizing microbial (such as cells and virus) specificity, due to the force magnitude needed to break bonds using a transducer.

  2. Molecular detection of a putatively novel cyprinid herpesvirus in sichel (Pelecus cultratus) during a mass mortality event in Hungary.

    Science.gov (United States)

    Doszpoly, Andor; Papp, Melitta; Deákné, Petra P; Glávits, Róbert; Ursu, Krisztina; Dán, Ádám

    2015-05-01

    In the early summer of 2014, mass mortality of sichel (Pelecus cultratus) was observed in Lake Balaton, Hungary. Histological examination revealed degenerative changes within the tubular epithelium, mainly in the distal tubules and collecting ducts in the kidneys and multifocal vacuolisation in the brain stem and cerebellum. Routine molecular investigations showed the presence of the DNA of an unknown alloherpesvirus in some specimens. Subsequently, three genes of the putative herpesviral genome (DNA polymerase, terminase, and helicase) were amplified and partially sequenced. A phylogenetic tree reconstruction based on the concatenated sequence of these three conserved genes implied that the virus belongs to the genus Cyprinivirus within the family Alloherpesviridae. The sequences of the sichel herpesvirus differ markedly from those of the cypriniviruses CyHV-1, CyHV-2 and CyHV-3, putatively representing a fifth species in the genus.

  3. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, R L; Oettinger, T; Rosenkrands, I

    2000-01-01

    Culture filtrate from Mycobacterium tuberculosis contains protective antigens of relevance for the generation of a new antituberculosis vaccine. We have identified two previously uncharacterized M. tuberculosis proteins (TB7.3 and TB10.4) from the highly active low-mass fraction of culture filtrate....... The molecules were characterized, mapped in a two-dimensional electrophoresis reference map of short-term culture filtrate, and compared with another recently identified low-mass protein, CFP10 (F. X. Berthet, P. B. Rasmussen, I. Rosenkrands, P. Andersen, and B. Gicquel. Microbiology 144:3195-3203, 1998......), and the well-described ESAT-6 antigen. Genetic analyses demonstrated that TB10.4 as well as CFP10 belongs to the ESAT-6 family of low-mass proteins, whereas TB7.3 is a low-molecular-mass protein outside this family. The proteins were expressed in Escherichia coli, and their immunogenicity was tested...

  4. Evaluation of hygiene practices in catering premises at large-scale events in the UK: identifying risks for the Olympics 2012.

    Science.gov (United States)

    Willis, C; Elviss, N; Aird, H; Fenelon, D; McLauchlin, J

    2012-08-01

    To investigate hygiene practices of caterers at large events in order to: support the production of guidance on catering at such events; to compare hygiene standards at weekends with other times in the week; and to learn lessons in preparation for the London Olympics in 2012. UK-wide study of caterers at large events, including questionnaires on hygiene procedures and microbiological examination of food, water and environmental samples. In total, 1364 samples of food, water, surface swabs and cloths were collected at 139 events, by local authority sampling officers, and transported to laboratories for microbiological analysis. Eight percent of food samples were of an unsatisfactory quality, and a further 2% contained potentially hazardous levels of Bacillus spp. A significantly higher proportion of unsatisfactory food samples were taken from vendors without adequate food safety procedures in place. Fifty-two percent of water samples, 38% of swabs and 71% of cloths were also unsatisfactory. The majority of samples (57%) were collected on Saturdays, Sundays or bank holidays. Environmental swab results were significantly poorer at weekends compared with other days of the week. This study reinforces the fact that food hygiene is a continuing cause for concern in mobile vendors, and indicates a need for an ongoing programme of training and monitoring of caterers in preparation for the London Olympics. Copyright © 2012 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  5. Structure of proton-proton events at high center-of-mass energy with an identified particle of large transverse momentum

    International Nuclear Information System (INIS)

    Hanke, P.

    1977-01-01

    At the CERN-ISR events of pp-collisions, in which particles of large transverse momentum psub(T) are produced, were studied at √S = 52 GeV center-of-mass energy, using the 'Split-Field'-magnetspectrometer. The lorentz-invariant production cross-section of positive particles with high psub(T) was measured in the fragmentation region (average* approximately 20 0 ). In the same kinematical region the pion-fraction of produced particles for both charges was determined. In these events the effect of 'strangeness'-conservation on the dynamics of additionally produced particles was investigated. The comparison of events with negative pions and events with heavier particles - mainly kaons - at high psub(T) indicates, that the compensation of transverse momentum does not depend on the 'strangeness' of the particle at high psub(T). The quantum-number conservation rather influences the particle-content from the hadronic rest inside longitudinal phase-space. This was shown by reconstruction of decay-vertices of neutral kaons. The results obtained can be interpreted by 'constituent'-models of the proton-structure. (orig.) [de

  6. Transcriptomic profiling of diverse Aedes aegypti strains reveals increased basal-level immune activation in dengue virus-refractory populations and identifies novel virus-vector molecular interactions.

    Directory of Open Access Journals (Sweden)

    Shuzhen Sim

    Full Text Available Genetic variation among Aedes aegypti populations can greatly influence their vector competence for human pathogens such as the dengue virus (DENV. While intra-species transcriptome differences remain relatively unstudied when compared to coding sequence polymorphisms, they also affect numerous aspects of mosquito biology. Comparative molecular profiling of mosquito strain transcriptomes can therefore provide valuable insight into the regulation of vector competence. We established a panel of A. aegypti strains with varying levels of susceptibility to DENV, comprising both laboratory-maintained strains and field-derived colonies collected from geographically distinct dengue-endemic regions spanning South America, the Caribbean, and Southeast Asia. A comparative genome-wide gene expression microarray-based analysis revealed higher basal levels of numerous immunity-related gene transcripts in DENV-refractory mosquito strains than in susceptible strains, and RNA interference assays further showed different degrees of immune pathway contribution to refractoriness in different strains. By correlating transcript abundance patterns with DENV susceptibility across our panel, we also identified new candidate modulators of DENV infection in the mosquito, and we provide functional evidence for two potential DENV host factors and one potential restriction factor. Our comparative transcriptome dataset thus not only provides valuable information about immune gene regulation and usage in natural refractoriness of mosquito populations to dengue virus but also allows us to identify new molecular interactions between the virus and its mosquito vector.

  7. Genomic, Epigenomic, and Transcriptomic Profiling towards Identifying Omics Features and Specific Biomarkers That Distinguish Uterine Leiomyosarcoma and Leiomyoma at Molecular Levels

    Directory of Open Access Journals (Sweden)

    Tomoko Miyata

    2015-01-01

    Full Text Available Uterine leiomyosarcoma (LMS is the worst malignancy among the gynecologic cancers. Uterine leiomyoma (LM, a benign tumor of myometrial origin, is the most common among women of childbearing age. Because of their similar symptoms, it is difficult to preoperatively distinguish the two conditions only by ultrasound and pelvic MRI. While histopathological diagnosis is currently the main approach used to distinguish them postoperatively, unusual histologic variants of LM tend to be misdiagnosed as LMS. Therefore, development of molecular diagnosis as an alternative or confirmatory means will help to diagnose LMS more accurately. We adopted omics-based technologies to identify genome-wide features to distinguish LMS from LM and revealed that copy number, gene expression, and DNA methylation profiles successfully distinguished these tumors. LMS was found to possess features typically observed in malignant solid tumors, such as extensive chromosomal abnormalities, overexpression of cell cycle-related genes, hypomethylation spreading through large genomic regions, and frequent hypermethylation at the polycomb group target genes and protocadherin genes. We also identified candidate expression and DNA methylation markers, which will facilitate establishing postoperative molecular diagnostic tests based on conventional quantitative assays. Our results demonstrate the feasibility of establishing such tests and the possibility of developing preoperative and noninvasive methods.

  8. Study on pivot-point vibration of molecular bond-rupture events by quartz crystal microbalance for biomedical diagnostics

    Directory of Open Access Journals (Sweden)

    Yuan YJ

    2012-01-01

    Full Text Available Yong J Yuan, Renjie JiaLaboratory of Biosensing and MicroMechatronics, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan, People's Republic of ChinaAbstract: Bond-rupture scanning for biomedical diagnostics is examined using quartz crystal microbalance (QCM experiments and microparticle mechanics modeling calculations. Specific and nonspecific interactions between a microparticle and its binding QCM surface can be distinguished by gradually increasing the amplitude of driving voltage applied to QCM and monitoring its frequency changes. This research proposes a mechanical model of interactions between biological molecules and a QCM substrate surface. The mechanical force required to break a biotin–streptavidin bond was calculated through a one-pivot-point bottom-up vibration model. The bond-rupture force increases with an increase of the microparticle radius, the QCM resonant frequency, and the amplitude of driving voltage applied to the QCM. The significance of the research on biological molecular bond rupture is extremely important in characterizing microbial (such as cells and virus specificity, due to the force magnitude needed to break bonds using a transducer.Keywords: bond rupture, mechanical force, biomolecular binding energy spectra, quartz crystal microbalance (QCM

  9. Meta-analysis of cancer transcriptomes: A new approach to uncover molecular pathological events in different cancer tissues

    Directory of Open Access Journals (Sweden)

    Sundus Iqbal

    2014-03-01

    Full Text Available To explore secrets of metastatic cancers, individual expression of true sets of respective genes must spread across the tissue. In this study, meta-analysis for transcriptional profiles of oncogenes was carried out to hunt critical genes or networks helping in metastasizing cancers. For this, transcriptomic analysis of different cancerous tissues causing leukemia, lung, liver, spleen, colorectal, colon, breast, bladder, and kidney cancers was performed by extracting microarray expression data from online resource; Gene Expression Omnibus. A newly developed bioinformatics technique; Dynamic Impact Approach (DIA was applied for enrichment analysis of transcriptional profiles using Database for Annotation Visualization and Integrated Discovery (DAVID. Furthermore, oPOSSUM (v. 2.0 and Cytoscape (v. 2.8.2 were used for in-depth analysis of transcription factors and regulatory gene networks respectively. DAVID analysis uncovered the most significantly enriched pathways in molecular functions that were 'Ubiquitin thiolesterase activity' up regulated in blood, breast, bladder, colorectal, lung, spleen, prostrate cancer. 'Transforming growth factor beta receptor activity' was inhibited in all cancers except leukemia, colon and liver cancer. oPOSSUM further revealed highly over-represented Transcription Factors (TFs; Broad-complex_3, Broad-complex_4, and Foxd3 except for leukemia and bladder cancer. From these findings, it is possible to target genes and networks, play a crucial role in the development of cancer. In the future, these transcription factors can serve as potential candidates for the therapeutic drug targets which can impede the deadly spread.

  10. Exercise electrocardiogram in middle-aged and older leisure time sportsmen: 100 exercise tests would be enough to identify one silent myocardial ischemia at risk for cardiac event.

    Science.gov (United States)

    Hupin, David; Edouard, Pascal; Oriol, Mathieu; Laukkanen, Jari; Abraham, Pierre; Doutreleau, Stéphane; Guy, Jean-Michel; Carré, François; Barthélémy, Jean-Claude; Roche, Frédéric; Chatard, Jean-Claude

    2018-04-15

    The importance of exercise electrocardiogram (ECG) has been controversial in the prevention of cardiac events among sportsmen. The aim of this study was to determine the frequency of silent myocardial ischemia (SMI) from an exercise ECG and its relationship with induced coronary angiographic assessment and potentially preventable cardiac events. This prospective cohort study included leisure time asymptomatic sportsmen over 35years old, referred from 2011 to 2014 in the Sports Medicine Unit of the University Hospital of Saint-Etienne. Of the cohort of 1500 sportsmen (1205 men; mean age 50.7±9.4years; physical activity level 32.8±26.8MET-h/week), 951 (63%) had at least one cardiovascular disease (CVD) risk factor. Family history, medical examination and standard resting 12-lead were collected. A total of 163 exercise ECGs (10.9%) were defined as positive, most of them due to SMI (n=129, 8.6%). SMI was an indication for coronary angiography in 23 cases, leading to 17 documented SMIs (1.1%), including 11 significant stenoses requiring revascularization. In multivariate logistic regression analysis, a high risk of CVD (OR=2.65 [CI 95%: 1.33-5.27], p=0.005) and an age >50years (OR=2.71 [CI 95%: 1.65-4.44], p<0.0001) were independently associated with confirmed SMI. The association of positive exercise ECG with significant coronary stenosis was stronger among sportsmen with CVD risk factors and older than 50years. Screening by exercise ECG can lower the risk of cardiac events in middle-aged and older sportsmen. One hundred tests would be enough to detect one silent myocardial ischemia at risk for cardiac event. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Studies of identified hadrons in qq-bar events at LEPI, in W sup + W sup - and qq-bar events at LEPII and search for stable and long-lived heavy charged particles

    CERN Document Server

    Neufeld, N

    1999-01-01

    The use of RICH detectors allows the identification of charged pions, kaons and protons, covering the full momentum range 0.7qq-bar, Z sup 0->bb-bar and Z sup 0->uu-bar, dd-bar, ss-bar, selected from approx 1,400,000 Z sup 0 decays collected by DELPHI in 1994. This study has been extended to high-energy qq-bar events at LEPII. New heavy particles from 2 GeV/c sup 2 to the kinematic limit at LEPII have been searched using the RICH detectors.

  12. Measurement of the Jet Vertex Charge algorithm performance for identified $b$-jets in $t\\bar{t}$ events in $pp$ collisions with the ATLAS detector

    CERN Document Server

    The ATLAS collaboration

    2018-01-01

    The Jet Vertex Charge algorithm, developed recently within the ATLAS collaboration, discriminates between jets resulting from the hadronisation of a bottom quark or bottom antiquark. This note describes a measurement of the performance of the algorithm and the extraction of data-to-simulation scale factors, made using $b$-tagged jets in candidate single lepton $t\\bar{t}$ events. The data sample was collected by the ATLAS detector at the LHC using $pp$ collisions at $\\sqrt{s}$ = 13 TeV in 2015 and 2016 and corresponds to a total integrated luminosity of 36.1 fb$^{-1}$ . Overall, good agreement is found between data and the simulation.

  13. Informing Antibiotic Treatment Decisions: Evaluating Rapid Molecular Diagnostics To Identify Susceptibility and Resistance to Carbapenems against Acinetobacter spp. in PRIMERS III.

    Science.gov (United States)

    Evans, Scott R; Hujer, Andrea M; Jiang, Hongyu; Hill, Carol B; Hujer, Kristine M; Mediavilla, Jose R; Manca, Claudia; Tran, Thuy Tien T; Domitrovic, T Nicholas; Higgins, Paul G; Seifert, Harald; Kreiswirth, Barry N; Patel, Robin; Jacobs, Michael R; Chen, Liang; Sampath, Rangarajan; Hall, Thomas; Marzan, Christine; Fowler, Vance G; Chambers, Henry F; Bonomo, Robert A

    2017-01-01

    The widespread dissemination of carbapenem-resistant Acinetobacter spp. has created significant therapeutic challenges. At present, rapid molecular diagnostics (RMDs) that can identify this phenotype are not commercially available. Two RMD platforms, PCR combined with electrospray ionization mass spectrometry (PCR/ESI-MS) and molecular beacons (MB), for detecting genes conferring resistance/susceptibility to carbapenems in Acinetobacter spp. were evaluated. An archived collection of 200 clinical Acinetobacter sp. isolates was tested. Predictive values for susceptibility and resistance were estimated as a function of susceptibility prevalence and were based on the absence or presence of beta-lactamase (bla) NDM, VIM, IMP, KPC, and OXA carbapenemase genes (e.g., bla OXA-23 , bla OXA-24/40 , and bla OXA-58 found in this study) against the reference standard of MIC determinations. According to the interpretation of MICs, 49% (n = 98) of the isolates were carbapenem resistant (as defined by either resistance or intermediate resistance to imipenem). The susceptibility sensitivities (95% confidence interval [CI]) for imipenem were 82% (74%, 89%) and 92% (85%, 97%) for PCR/ESI-MS and MB, respectively. Resistance sensitivities (95% CI) for imipenem were 95% (88%, 98%) and 88% (80%, 94%) for PCR/ESI-MS and MB, respectively. PRIMERS III establishes that RMDs can discriminate between carbapenem resistance and susceptibility in Acinetobacter spp. In the context of a known prevalence of resistance, SPVs and RPVs can inform clinicians regarding the best choice for empiric antimicrobial therapy against this multidrug-resistant pathogen. Copyright © 2016 American Society for Microbiology.

  14. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  15. Therapeutic molecules for multiple human diseases identified from pigeon pea (Cajanus cajan L. Millsp. through GC–MS and molecular docking

    Directory of Open Access Journals (Sweden)

    Deepu Mathew

    2017-12-01

    Full Text Available Molecular mechanism behind the therapeutic potential of pigeon pea over the human diseases such as rheumatoid arthritis, breast cancer, type II diabetes, malaria, measles and sickle cell disease were revealed through docking of GC–MS identified phyto-compound ligands with candidate disease proteins. Of the 242 ligands, three dimensional structures of 47 compounds had to be drawn using ChemSketch and the remaining structures were retrieved from PubChem and docked with the active sites of candidate proteins. The molecules identified through docking were further subjected to ADMET analysis and promising drug candidates were identified for each disease. This paper presents a precise account of the chemoprofile of pigeon pea leaves, stems and seeds, interaction of these molecules with target proteins and suggests 26 highly potential molecules which are drug candidates for multiple human diseases. Pigeon pea seeds are especially proven as invaluable source for therapeutic molecules. Keywords: Breast cancer, Drug discovery, Herbal medicine, In silico, Malaria, Measles, Phyto-compounds, Rheumatoid arthritis, Sickle cell disease, Type II diabetes

  16. Dissecting molecular events in thyroid neoplasia provides evidence for distinct evolution of follicular thyroid adenoma and carcinoma.

    Science.gov (United States)

    Krause, Kerstin; Prawitt, Susanne; Eszlinger, Markus; Ihling, Christian; Sinz, Andrea; Schierle, Katrin; Gimm, Oliver; Dralle, Henning; Steinert, Frank; Sheu, Sien-Yi; Schmid, Kurt W; Fuhrer, Dagmar

    2011-12-01

    Benign hypofunctional cold thyroid nodules (CTNs) are a frequent scintiscan finding and need to be distinguished from thyroid carcinomas. The origin of CTNs with follicular morphologic features is unresolved. The DNA damage response might act as a physiologic barrier, inhibiting the progression of preneoplastic lesions to neoplasia. We investigated the following in hypofunctional follicular adenoma (FA) and follicular thyroid cancer (FTC): i) the mutation rate of frequently activated oncogenes, ii) the activation of DNA damage response checkpoints, and iii) the differential proteomic pattern between FA and FTC. Both FTC and FA, which did not harbor RAS, phosphoinositide-3-kinase, or PAX/peroxisome proliferator activated receptor-γ mutations, express various proteins in common and others that are more distinctly expressed in FTC rather than in FA or normal thyroid tissue. This finding is in line with the finding of constitutive DNA damage checkpoint activation (p-Chk2, γ-H2AX) and evidence for replicative stress causing genomic instability (increased cyclin E, retinoblastoma, or E2F1 mRNA expression) in FTC but not FA. We discuss the findings of the increased expression of translationally controlled tumor protein, phosphatase 2A inhibitor, and DJ-1 in FTC compared with FA identified by proteomics and their potential implication in follicular thyroid carcinogenesis. Our present findings argue for the definition of FA as a truly benign entity and against progressive development of FA to FTC. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  17. Erroneous cardiac ECG-gated PET list-mode trigger events can be retrospectively identified and replaced by an offline reprocessing approach: first results in rodents

    International Nuclear Information System (INIS)

    Böning, Guido; Todica, Andrei; Vai, Alessandro; Lehner, Sebastian; Xiong, Guoming; Mille, Erik; Ilhan, Harun; Fougère, Christian la; Bartenstein, Peter; Hacker, Marcus

    2013-01-01

    The assessment of left ventricular function, wall motion and myocardial viability using electrocardiogram (ECG)-gated [ 18 F]-FDG positron emission tomography (PET) is widely accepted in human and in preclinical small animal studies. The nonterminal and noninvasive approach permits repeated in vivo evaluations of the same animal, facilitating the assessment of temporal changes in disease or therapy response. Although well established, gated small animal PET studies can contain erroneous gating information, which may yield to blurred images and false estimation of functional parameters. In this work, we present quantitative and visual quality control (QC) methods to evaluate the accuracy of trigger events in PET list-mode and physiological data. Left ventricular functional analysis is performed to quantify the effect of gating errors on the end-systolic and end-diastolic volumes, and on the ejection fraction (EF). We aim to recover the cardiac functional parameters by the application of the commonly established heart rate filter approach using fixed ranges based on a standardized population. In addition, we propose a fully reprocessing approach which retrospectively replaces the gating information of the PET list-mode file with appropriate list-mode decoding and encoding software. The signal of a simultaneously acquired ECG is processed using standard MATLAB vector functions, which can be individually adapted to reliably detect the R-peaks. Finally, the new trigger events are inserted into the PET list-mode file. A population of 30 mice with various health statuses was analyzed and standard cardiac parameters such as mean heart rate (119 ms ± 11.8 ms) and mean heart rate variability (1.7 ms ± 3.4 ms) derived. These standard parameter ranges were taken into account in the QC methods to select a group of nine optimal gated and a group of eight sub-optimal gated [ 18 F]-FDG PET scans of mice from our archive. From the list-mode files of the optimal gated group

  18. Targeting N-Glycan Cryptic Sugar Moieties for Broad-Spectrum Virus Neutralization: Progress in Identifying Conserved Molecular Targets in Viruses of Distinct Phylogenetic Origins

    Directory of Open Access Journals (Sweden)

    Denong Wang

    2015-03-01

    Full Text Available Identifying molecular targets for eliciting broadly virus-neutralizing antibodies is one of the key steps toward development of vaccines against emerging viral pathogens. Owing to genomic and somatic diversities among viral species, identifying protein targets for broad-spectrum virus neutralization is highly challenging even for the same virus, such as HIV-1. However, viruses rely on host glycosylation machineries to synthesize and express glycans and, thereby, may display common carbohydrate moieties. Thus, exploring glycan-binding profiles of broad-spectrum virus-neutralizing agents may provide key information to uncover the carbohydrate-based virus-neutralizing epitopes. In this study, we characterized two broadly HIV-neutralizing agents, human monoclonal antibody 2G12 and Galanthus nivalis lectin (GNA, for their viral targeting activities. Although these agents were known to be specific for oligomannosyl antigens, they differ strikingly in virus-binding activities. The former is HIV-1 specific; the latter is broadly reactive and is able to neutralize viruses of distinct phylogenetic origins, such as HIV-1, severe acute respiratory syndrome coronavirus (SARS-CoV, and human cytomegalovirus (HCMV. In carbohydrate microarray analyses, we explored the molecular basis underlying the striking differences in the spectrum of anti-virus activities of the two probes. Unlike 2G12, which is strictly specific for the high-density Man9GlcNAc2Asn (Man9-clusters, GNA recognizes a number of N-glycan cryptic sugar moieties. These include not only the known oligomannosyl antigens but also previously unrecognized tri-antennary or multi-valent GlcNAc-terminating N-glycan epitopes (Tri/m-Gn. These findings highlight the potential of N-glycan cryptic sugar moieties as conserved targets for broad-spectrum virus neutralization and suggest the GNA-model of glycan-binding warrants focused investigation.

  19. The preventing recurrent vascular events and neurological worsening through intensive organized case-management (PREVENTION trial protocol [clinicaltrials.gov identifier: NCT00931788

    Directory of Open Access Journals (Sweden)

    Tsuyuki Ross

    2010-04-01

    Full Text Available Abstract Background Survivors of transient ischemic attack (TIA or stroke are at high risk for recurrent vascular events and aggressive treatment of vascular risk factors can reduce this risk. However, vascular risk factors, especially hypertension and high cholesterol, are not managed optimally even in those patients seen in specialized clinics. This gap between the evidence for secondary prevention of stroke and the clinical reality leads to suboptimal patient outcomes. In this study, we will be testing a pharmacist case manager for delivery of stroke prevention services. We hypothesize this new structure will improve processes of care which in turn should lead to improved outcomes. Methods We will conduct a prospective, randomized, controlled open-label with blinded ascertainment of outcomes (PROBE trial. Treatment allocation will be concealed from the study personnel, and all outcomes will be collected in an independent and blinded manner by observers who have not been involved in the patient's clinical care or trial participation and who are masked to baseline measurements. Patients will be randomized to control or a pharmacist case manager treating vascular risk factors to guideline-recommended target levels. Eligible patients will include all adult patients seen at stroke prevention clinics in Edmonton, Alberta after an ischemic stroke or TIA who have uncontrolled hypertension (defined as systolic blood pressure (BP > 140 mm Hg or dyslipidemia (fasting LDL-cholesterol > 2.00 mmol/L and who are not cognitively impaired or institutionalized. The primary outcome will be the proportion of subjects who attain 'optimal BP and lipid control'(defined as systolic BP Conclusions Nearly one-quarter of those who survive a TIA or minor stroke suffer another vascular event within a year. If our intervention improves the provision of secondary prevention therapies in these patients, the clinical (and financial implications will be enormous.

  20. Identifying Relationships between High-Risk Sexual Behaviors and Screening Positive for Chlamydia and Gonorrhea in School-Wide Screening Events

    Science.gov (United States)

    Salerno, Jennifer; Darling-Fisher, Cindy; Hawkins, Nicole M.; Fraker, Elizabeth

    2013-01-01

    Background: This article describes a school-wide sexually transmitted infection (STI) screening to identify adolescent high-risk sexual behaviors, STI history/incidence, and presence of chlamydia and gonorrhea, and examines relationships between high-risk behaviors and screening positive for chlamydia and gonorrhea in an alternative high school…

  1. Comparative mRNA and microRNA expression profiling of three genitourinary cancers reveals common hallmarks and cancer-specific molecular events.

    Directory of Open Access Journals (Sweden)

    Xianxin Li

    Full Text Available Genome-wide gene expression profile using deep sequencing technologies can drive the discovery of cancer biomarkers and therapeutic targets. Such efforts are often limited to profiling the expression signature of either mRNA or microRNA (miRNA in a single type of cancer.Here we provided an integrated analysis of the genome-wide mRNA and miRNA expression profiles of three different genitourinary cancers: carcinomas of the bladder, kidney and testis.Our results highlight the general or cancer-specific roles of several genes and miRNAs that may serve as candidate oncogenes or suppressors of tumor development. Further comparative analyses at the systems level revealed that significant aberrations of the cell adhesion process, p53 signaling, calcium signaling, the ECM-receptor and cell cycle pathways, the DNA repair and replication processes and the immune and inflammatory response processes were the common hallmarks of human cancers. Gene sets showing testicular cancer-specific deregulation patterns were mainly implicated in processes related to male reproductive function, and general disruptions of multiple metabolic pathways and processes related to cell migration were the characteristic molecular events for renal and bladder cancer, respectively. Furthermore, we also demonstrated that tumors with the same histological origins and genes with similar functions tended to group together in a clustering analysis. By assessing the correlation between the expression of each miRNA and its targets, we determined that deregulation of 'key' miRNAs may result in the global aberration of one or more pathways or processes as a whole.This systematic analysis deciphered the molecular phenotypes of three genitourinary cancers and investigated their variations at the miRNA level simultaneously. Our results provided a valuable source for future studies and highlighted some promising genes, miRNAs, pathways and processes that may be useful for diagnostic or

  2. Array-based molecular karyotyping in 115 VATER/VACTERL and VATER/VACTERL-like patients identifies disease-causing copy number variations.

    Science.gov (United States)

    Zhang, Rong; Marsch, Florian; Kause, Franziska; Degenhardt, Franziska; Schmiedeke, Eeberhard; Märzheuser, Stefanie; Hoppe, Bernd; Bachour, Haitham; Boemers, Thomas M; Schäfer, Matthias; Spychalski, Nicole; Neser, Jörg; Leonhardt, Johannes; Kosch, Ferdinand; Ure, Benno; Gómez, Barbara; Lacher, Martin; Deffaa, Oliver J; Palta, Markus; Wittekindt, Boris; Kleine, Katharina; Schmedding, Andrea; Grasshoff-Derr, Sabine; Ven, Amelie van der; Heilmann-Heimbach, Stefanie; Zwink, Nadine; Jenetzky, Ekkehart; Ludwig, Michael; Reutter, Heiko

    2017-07-17

    The acronym VATER/VACTERL refers to the rare nonrandom association of the following component features (CF): vertebral defects (V), anorectal malformations (A), cardiac defects (C), tracheoesophageal fistula with or without esophageal atresia, renal malformations (R), and limb defects (L). Patients presenting with at least three CFs are diagnosed as having VATER/VACTERL association while patients presenting with only two CFs are diagnosed as having VATER/VACTERL-like phenotypes. Recently, rare causative copy number variations (CNVs) have been identified in patients with VATER/VACTERL association and VATER/VACTERL-like phenotypes. To detect further causative CNVs we performed array based molecular karyotyping in 75 VATER/VACTERL and 40 VATER/VACTERL-like patients. Following the application of stringent filter criteria, we identified 13 microdeletions and seven microduplications in 20 unrelated patients all of which were absent in 1,307 healthy inhouse controls (n microdeletion at 17q12 was confirmed to be de novo. Three microdeletions at 5q23.1, 16q23.3, 22q11.21, and one microduplication at 10q11.21 were all absent in the available parent. Microdeletion of chromosomal region 22q11.21 was previously found in VATER/VACTERL patients rendering it to be causative in our patient. The remaining 15 CNVs were inherited from a healthy parent. In two of 115 patients' causative CNVs were found (2%). The remaining identified rare CNVs represent candidates for further evaluation. Rare inherited CNVs may constitute modifiers of, or contributors to, multifactorial VATER/VACTERL or VATER/VACTERL-like phenotypes. Birth Defects Research 109:1063-1069, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  3. Identifying the Climatic Conditions in Iraq by Tracking Down Cooling Events in the North Atlantic Ocean in the Period 3000–0 BC

    Directory of Open Access Journals (Sweden)

    Muslih Khamis D.

    2014-09-01

    Full Text Available North Atlantic Oscillation (NAO, monthly averages of precipitation in the Baghdad station, and petrologic tracer proxy data for ocean properties in the North Atlantic (NA have been used in an attempt to identify climatic conditions in Iraq during the study period. The study showed that contemporary changes in precipitation in Iraq are associated with NAO, as a negative relationship is found between them. Moreover, the study found that there is a strong negative correlation between NAOI and SST in NA, where drift ice indices explain between 33–36% of the NAOI variability.

  4. Mobile phone sensors and supervised machine learning to identify alcohol use events in young adults: Implications for just-in-time adaptive interventions.

    Science.gov (United States)

    Bae, Sangwon; Chung, Tammy; Ferreira, Denzil; Dey, Anind K; Suffoletto, Brian

    2017-11-27

    Real-time detection of drinking could improve timely delivery of interventions aimed at reducing alcohol consumption and alcohol-related injury, but existing detection methods are burdensome or impractical. To evaluate whether phone sensor data and machine learning models are useful to detect alcohol use events, and to discuss implications of these results for just-in-time mobile interventions. 38 non-treatment seeking young adult heavy drinkers downloaded AWARE app (which continuously collected mobile phone sensor data), and reported alcohol consumption (number of drinks, start/end time of prior day's drinking) for 28days. We tested various machine learning models using the 20 most informative sensor features to classify time periods as non-drinking, low-risk (1 to 3/4 drinks per occasion for women/men), and high-risk drinking (>4/5 drinks per occasion for women/men). Among 30 participants in the analyses, 207 non-drinking, 41 low-risk, and 45 high-risk drinking episodes were reported. A Random Forest model using 30-min windows with 1day of historical data performed best for detecting high-risk drinking, correctly classifying high-risk drinking windows 90.9% of the time. The most informative sensor features were related to time (i.e., day of week, time of day), movement (e.g., change in activities), device usage (e.g., screen duration), and communication (e.g., call duration, typing speed). Preliminary evidence suggests that sensor data captured from mobile phones of young adults is useful in building accurate models to detect periods of high-risk drinking. Interventions using mobile phone sensor features could trigger delivery of a range of interventions to potentially improve effectiveness. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Basal gene expression by lung CD4+ T cells in chronic obstructive pulmonary disease identifies independent molecular correlates of airflow obstruction and emphysema extent.

    Directory of Open Access Journals (Sweden)

    Christine M Freeman

    Full Text Available Lung CD4+ T cells accumulate as chronic obstructive pulmonary disease (COPD progresses, but their role in pathogenesis remains controversial. To address this controversy, we studied lung tissue from 53 subjects undergoing clinically-indicated resections, lung volume reduction, or transplant. Viable single-cell suspensions were analyzed by flow cytometry or underwent CD4+ T cell isolation, followed either by stimulation with anti-CD3 and cytokine/chemokine measurement, or by real-time PCR analysis. In lung CD4+ T cells of most COPD subjects, relative to lung CD4+ T cells in smokers with normal spirometry: (a stimulation induced minimal IFN-γ or other inflammatory mediators, but many subjects produced more CCL2; (b the T effector memory subset was less uniformly predominant, without correlation with decreased IFN-γ production. Analysis of unstimulated lung CD4+ T cells of all subjects identified a molecular phenotype, mainly in COPD, characterized by markedly reduced mRNA transcripts for the transcription factors controlling TH1, TH2, TH17 and FOXP3+ T regulatory subsets and their signature cytokines. This mRNA-defined CD4+ T cell phenotype did not result from global inability to elaborate mRNA; increased transcripts for inhibitory CD28 family members or markers of anergy; or reduced telomerase length. As a group, these subjects had significantly worse spirometry, but not DLCO, relative to subjects whose lung CD4+ T cells expressed a variety of transcripts. Analysis of mRNA transcripts of unstimulated lung CD4+ T cell among all subjects identified two distinct molecular correlates of classical COPD clinical phenotypes: basal IL-10 transcripts correlated independently and inversely with emphysema extent (but not spirometry; by contrast, unstimulated IFN-γ transcripts correlated independently and inversely with reduced spirometry (but not reduced DLCO or emphysema extent. Aberrant lung CD4+ T cells polarization appears to be common in advanced

  6. Molecular and Conventional Analysis of Acute Diarrheal Isolates Identifies Epidemiological Trends, Antibiotic Resistance and Virulence Profiles of Common Enteropathogens in Shanghai

    Directory of Open Access Journals (Sweden)

    Feng Yang

    2018-02-01

    Full Text Available Objective: To investigate prevalence of acute diarrhea in Shanghai and analyze virulence associated-genes and antibiotic resistance of major enteropathogens using combination of conventional and molecular epidemiology methods.Method: The 412 stool specimens were obtained by systematic sampling from diarrhea patients throughout entire year 2016. Bacterial and viral pathogens were identified and bacterial isolates were cultured and screened for antibiotic resistance profiles. Two most prevalent bacteria, Vibrio parahaemolyticus and Salmonella were further typed by multi-locus sequence typing (MLST and analyzed for presence of virulence-associated genes. The association between virulence genes, resistance phenotypes and genetic diversities was analyzed.Results: Among stool specimens testing positive for pathogens (23.1%, 59 bacterial and 36 viral pathogens were identified. V. parahaemolyticus (27/412, 6.6%, Salmonella (23/412, 5.6% and norovirus GII (21/412, 5.1% were three most-commonly found. Most bacterial isolates exhibited high levels of antibiotic resistance with high percentage of MDR. The drug resistance rates of V. parahaemolyticus and Salmonella isolates to cephalosporins were high, such as 100.0 and 34.8% to CFX, 55.6 and 43.4% to CTX, 92.6 and 95.7% to CXM, respectively. The most common resistance combination of V. parahaemolyticus and Salmonella was cephalosporins and quinolone. The dominant sequence types (STs of V. parahaemolyticus and Salmonella were ST3 (70.4% and ST11 (43.5%, respectively. The detection rates of virulence genes in V. parahaemolyticus were tlh (100% and tdh (92.6%, without trh and ureR. Most of the Salmonella isolates were positive for the Salmonella pathogenicity islands (SPIs genes (87–100%, and some for Salmonella plasmid virulence (SPV genes (34.8% for spvA and spvB, 43.5% for spvC. In addition, just like the drug resistance, virulence genes exhibited wide-spread distribution among the different STs albeit

  7. Applying Unique Molecular Identifiers in Next Generation Sequencing Reveals a Constrained Viral Quasispecies Evolution under Cross-Reactive Antibody Pressure Targeting Long Alpha Helix of Hemagglutinin

    Science.gov (United States)

    Hauck, Nastasja C.; Kirpach, Josiane; Kiefer, Christina; Farinelle, Sophie; Morris, Stephen A.; Muller, Claude P.; Lu, I-Na

    2018-01-01

    To overcome yearly efforts and costs for the production of seasonal influenza vaccines, new approaches for the induction of broadly protective and long-lasting immune responses have been developed in the past decade. To warrant safety and efficacy of the emerging crossreactive vaccine candidates, it is critical to understand the evolution of influenza viruses in response to these new immune pressures. Here we applied unique molecular identifiers in next generation sequencing to analyze the evolution of influenza quasispecies under in vivo antibody pressure targeting the hemagglutinin (HA) long alpha helix (LAH). Our vaccine targeting LAH of hemagglutinin elicited significant seroconversion and protection against homologous and heterologous influenza virus strains in mice. The vaccine not only significantly reduced lung viral titers, but also induced a well-known bottleneck effect by decreasing virus diversity. In contrast to the classical bottleneck effect, here we showed a significant increase in the frequency of viruses with amino acid sequences identical to that of vaccine targeting LAH domain. No escape mutant emerged after vaccination. These results not only support the potential of a universal influenza vaccine targeting the conserved LAH domains, but also clearly demonstrate that the well-established bottleneck effect on viral quasispecies evolution does not necessarily generate escape mutants. PMID:29587397

  8. Proteomics Analysis to Identify and Characterize the Molecular Signatures of Hepatic Steatosis in Ovariectomized Rats as a Model of Postmenopausal Status

    Directory of Open Access Journals (Sweden)

    Chen-Chung Liao

    2015-10-01

    Full Text Available Postmenopausal women are particularly at increased risk of developing non-alcoholic fatty liver disease (NAFLD. Here we aimed to determine the impact of postmenopausal-induced NAFLD (PM-NAFLD in an ovariectomized rat model. Sixteen six-week-old Sprague-Dawley female rats were randomly divided into two groups (eight per group, for sham-operation (Sham or bilateral ovariectomy (Ovx. Four months after surgery, indices of liver damage and liver histomorphometry were measured. Both serum aspartate aminotransferase (AST and alanine aminotranferease (ALT levels were significantly higher in the Ovx than Sham group. We performed quantitative LC-MS/MS-based proteomic profiling of livers from rats with PM-NAFLD to provide baseline knowledge of the PM-NAFLD proteome and to investigate proteins involved in PM-NAFLD by ingenuity pathways analysis (IPA to provide corroborative evidence for differential regulation of molecular and cellular functions affecting metabolic processes. Of the 586 identified proteins, the levels of 59 (10.0% and 48 (8.2% were significantly higher and lower, respectively, in the Ovx group compared to the Sham group. In conclusion, the changes in regulation of proteins implicated in PM-NAFLD may affect other vital biological processes in the body apart from causing postmenopause-mediated liver dysfunction. Our quantitative proteomics analysis may also suggest potential biomarkers and further clinical applications for PM-NAFLD.

  9. Integrated molecular analysis of Tamoxifen-resistant invasive lobular breast cancer cells identifies MAPK and GRM/mGluR signaling as therapeutic vulnerabilities.

    Science.gov (United States)

    Stires, Hillary; Heckler, Mary M; Fu, Xiaoyong; Li, Zhao; Grasso, Catherine S; Quist, Michael J; Lewis, Joseph A; Klimach, Uwe; Zwart, Alan; Mahajan, Akanksha; Győrffy, Balázs; Cavalli, Luciane R; Riggins, Rebecca B

    2018-08-15

    Invasive lobular breast cancer (ILC) is an understudied malignancy with distinct clinical, pathological, and molecular features that distinguish it from the more common invasive ductal carcinoma (IDC). Mounting evidence suggests that estrogen receptor-alpha positive (ER+) ILC has a poor response to Tamoxifen (TAM), but the mechanistic drivers of this are undefined. In the current work, we comprehensively characterize the SUM44/LCCTam ILC cell model system through integrated analysis of gene expression, copy number, and mutation, with the goal of identifying actionable alterations relevant to clinical ILC that can be co-targeted along with ER to improve treatment outcomes. We show that TAM has several distinct effects on the transcriptome of LCCTam cells, that this resistant cell model has acquired copy number alterations and mutations that impinge on MAPK and metabotropic glutamate receptor (GRM/mGluR) signaling networks, and that pharmacological inhibition of either improves or restores the growth-inhibitory actions of endocrine therapy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  10. Applying Unique Molecular Identifiers in Next Generation Sequencing Reveals a Constrained Viral Quasispecies Evolution under Cross-Reactive Antibody Pressure Targeting Long Alpha Helix of Hemagglutinin

    Directory of Open Access Journals (Sweden)

    Nastasja C. Hauck

    2018-03-01

    Full Text Available To overcome yearly efforts and costs for the production of seasonal influenza vaccines, new approaches for the induction of broadly protective and long-lasting immune responses have been developed in the past decade. To warrant safety and efficacy of the emerging crossreactive vaccine candidates, it is critical to understand the evolution of influenza viruses in response to these new immune pressures. Here we applied unique molecular identifiers in next generation sequencing to analyze the evolution of influenza quasispecies under in vivo antibody pressure targeting the hemagglutinin (HA long alpha helix (LAH. Our vaccine targeting LAH of hemagglutinin elicited significant seroconversion and protection against homologous and heterologous influenza virus strains in mice. The vaccine not only significantly reduced lung viral titers, but also induced a well-known bottleneck effect by decreasing virus diversity. In contrast to the classical bottleneck effect, here we showed a significant increase in the frequency of viruses with amino acid sequences identical to that of vaccine targeting LAH domain. No escape mutant emerged after vaccination. These results not only support the potential of a universal influenza vaccine targeting the conserved LAH domains, but also clearly demonstrate that the well-established bottleneck effect on viral quasispecies evolution does not necessarily generate escape mutants.

  11. Molecular Cytogenetic Characterization Identified the Murine B-Cell Lymphoma Cell Line A-20 as a Model for Sporadic Burkitt's Lymphoma.

    Science.gov (United States)

    Guja, Karolina; Liehr, Thomas; Rincic, Martina; Kosyakova, Nadezda; Hussein Azawi, Shaymaa S

    2017-11-01

    Here, we report the first molecular cytogenetic characterization of the BALB/cAnN mouse derived B-cell non-Hodgkin lymphoma (B-cell NHL) cell lines A-20. Even though previously used as a model for testing of, for example, dexametason, up to present, no data in the genetic properties of A-20 were available. The present study closed this gap and provides evidence that A-20 is a model for B-cell NHL subgroup sporadic Burkitt's lymphoma. C-myc oncogene is involved in a translocation and copy number alterations as gain of murine 14q material could be observed. Interestingly, the cell line showed the karyotype 39,X,-X or -Y,t(2;15)(qE5;qD2),del(6)(qB3qC3),del(9)(qA3qA4),dup(14)(qE1qE4) in ~95% of the cells, being exceptionally stable for cell lines being established 38 years ago. Still, ~5% of the cells showed polyploidization followed by chromothripsis. It remains to be determined if this can be observed also in other cell lines, just has not been reported yet, and/or if it is a unique feature of A-20. Overall, finally here, the necessary genetic data to identify A-20 as a model for human sporadic Burkitt's lymphoma are provided.

  12. The Role of Difficulty in Identifying and Describing Feelings in Non-Suicidal Self-Injury Behavior (NSSI): Associations With Perceived Attachment Quality, Stressful Life Events, and Suicidal Ideation.

    Science.gov (United States)

    Cerutti, Rita; Zuffianò, Antonio; Spensieri, Valentina

    2018-01-01

    Objective: Core alexithymic features, such as the difficulty in identifying and describing feelings, are associated with poor attachment styles and emotional trauma, which influence the capacity to regulate affect. Additionally, emotional regulation has been found to be the most commonly identified function associated with non-suicidal self-injury behavior (NSSI) in adolescents as they attempt to modulate strong emotions. However, few studies have examined the link between difficulty in identifying and describing feelings (core components of alexithymia), NSSI behaviors, quality of attachment, life stressors and suicidal ideation in healthy early adolescents. Consequently, this study aims to investigate these constructs and the relationship among them in a large non-clinical sample of adolescents. Methods: Seven hundred and nine middle school students (50.4% males), aged 10-15 years ( M = 12.6; SD = 1.06) were involved in this study. In order to investigate the variables considered in the study, the following measures were administered: the Deliberate Self-Harm Inventory exploring non-suicidal self-injurious behaviors; the Alexithymia Questionnaire for Children examining difficulty in identifying and describing feelings; the Inventory of Parent and Peer Attachment assessing the quality of parental and peer attachment; the Life Stressor Checklist-Revised outlining stressful/traumatic events and the Children's Depression Inventory evaluating suicidal ideation. Results: We found significantly positive relationships among difficulty in identifying and describing feelings, NSSI behaviors, stressful events, and suicidal ideation. Data indicated a significant negative association of difficulty in identifying and describing feelings with quality of attachment to parents and peers. Further findings highlighted that difficulty in identifying and describing feelings significantly mediated the effect of quality of attachment (parent and peer) on NSSI and suicidal ideation

  13. Experimentally-derived fibroblast gene signatures identify molecular pathways associated with distinct subsets of systemic sclerosis patients in three independent cohorts.

    Directory of Open Access Journals (Sweden)

    Michael E Johnson

    Full Text Available Genome-wide expression profiling in systemic sclerosis (SSc has identified four 'intrinsic' subsets of disease (fibroproliferative, inflammatory, limited, and normal-like, each of which shows deregulation of distinct signaling pathways; however, the full set of pathways contributing to this differential gene expression has not been fully elucidated. Here we examine experimentally derived gene expression signatures in dermal fibroblasts for thirteen different signaling pathways implicated in SSc pathogenesis. These data show distinct and overlapping sets of genes induced by each pathway, allowing for a better understanding of the molecular relationship between profibrotic and immune signaling networks. Pathway-specific gene signatures were analyzed across a compendium of microarray datasets consisting of skin biopsies from three independent cohorts representing 80 SSc patients, 4 morphea, and 26 controls. IFNα signaling showed a strong association with early disease, while TGFβ signaling spanned the fibroproliferative and inflammatory subsets, was associated with worse MRSS, and was higher in lesional than non-lesional skin. The fibroproliferative subset was most strongly associated with PDGF signaling, while the inflammatory subset demonstrated strong activation of innate immune pathways including TLR signaling upstream of NF-κB. The limited and normal-like subsets did not show associations with fibrotic and inflammatory mediators such as TGFβ and TNFα. The normal-like subset showed high expression of genes associated with lipid signaling, which was absent in the inflammatory and limited subsets. Together, these data suggest a model by which IFNα is involved in early disease pathology, and disease severity is associated with active TGFβ signaling.

  14. Differential Adverse Event Profiles Associated with BCG as a Preventive Tuberculosis Vaccine or Therapeutic Bladder Cancer Vaccine Identified by Comparative Ontology-Based VAERS and Literature Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Jiangan Xie

    Full Text Available M. bovis strain Bacillus Calmette-Guérin (BCG has been the only licensed live attenuated vaccine against tuberculosis (TB for nearly one century and has also been approved as a therapeutic vaccine for bladder cancer treatment since 1990. During its long time usage, different adverse events (AEs have been reported. However, the AEs associated with the BCG preventive TB vaccine and therapeutic cancer vaccine have not been systematically compared. In this study, we systematically collected various BCG AE data mined from the US VAERS database and PubMed literature reports, identified statistically significant BCG-associated AEs, and ontologically classified and compared these AEs related to these two types of BCG vaccine. From 397 VAERS BCG AE case reports, we identified 64 AEs statistically significantly associated with the BCG TB vaccine and 14 AEs with the BCG cancer vaccine. Our meta-analysis of 41 peer-reviewed journal reports identified 48 AEs associated with the BCG TB vaccine and 43 AEs associated with the BCG cancer vaccine. Among all identified AEs from VAERS and literature reports, 25 AEs belong to serious AEs. The Ontology of Adverse Events (OAE-based ontological hierarchical analysis indicated that the AEs associated with the BCG TB vaccine were enriched in immune system (e.g., lymphadenopathy and lymphadenitis, skin (e.g., skin ulceration and cyanosis, and respiratory system (e.g., cough and pneumonia; in contrast, the AEs associated with the BCG cancer vaccine mainly occurred in the urinary system (e.g., dysuria, pollakiuria, and hematuria. With these distinct AE profiles detected, this study also discovered three AEs (i.e., chills, pneumonia, and C-reactive protein increased shared by the BCG TB vaccine and bladder cancer vaccine. Furthermore, our deep investigation of 24 BCG-associated death cases from VAERS identified the important effects of age, vaccine co-administration, and immunosuppressive status on the final BCG

  15. Integrated RNA-Seq and sRNA-Seq Analysis Identifies Chilling and Freezing Responsive Key Molecular Players and Pathways in Tea Plant (Camellia sinensis)

    Science.gov (United States)

    Zheng, Chao; Zhao, Lei; Wang, Yu; Shen, Jiazhi; Zhang, Yinfei; Jia, Sisi; Li, Yusheng; Ding, Zhaotang

    2015-01-01

    Tea [Camellia sinensis (L) O. Kuntze, Theaceae] is one of the most popular non-alcoholic beverages worldwide. Cold stress is one of the most severe abiotic stresses that limit tea plants’ growth, survival and geographical distribution. However, the genetic regulatory network and signaling pathways involved in cold stress responses in tea plants remain unearthed. Using RNA-Seq, DGE and sRNA-Seq technologies, we performed an integrative analysis of miRNA and mRNA expression profiling and their regulatory network of tea plants under chilling (4℃) and freezing (-5℃) stress. Differentially expressed (DE) miRNA and mRNA profiles were obtained based on fold change analysis, miRNAs and target mRNAs were found to show both coherent and incoherent relationships in the regulatory network. Furthermore, we compared several key pathways (e.g., ‘Photosynthesis’), GO terms (e.g., ‘response to karrikin’) and transcriptional factors (TFs, e.g., DREB1b/CBF1) which were identified as involved in the early chilling and/or freezing response of tea plants. Intriguingly, we found that karrikins, a new group of plant growth regulators, and β-primeverosidase (BPR), a key enzyme functionally relevant with the formation of tea aroma might play an important role in both early chilling and freezing response of tea plants. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-Seq and sRNA-Seq analysis. This is the first study to simultaneously profile the expression patterns of both miRNAs and mRNAs on a genome-wide scale to elucidate the molecular mechanisms of early responses of tea plants to cold stress. In addition to gaining a deeper insight into the cold resistant characteristics of tea plants, we provide a good case study to analyse mRNA/miRNA expression and profiling of non-model plant species using next-generation sequencing technology. PMID:25901577

  16. Special Experts Meeting: Identifying and Overcoming Barriers to the Effective Consideration of Human and Organizational Factors in Event Analysis and Root Cause Analysis. Nuclear Energy Agency / Working Group on Human and Organizational Factors

    International Nuclear Information System (INIS)

    2011-01-01

    The main mission of the Nuclear Energy Agency (NEA) Working Group on Human and Organisational Factors (WGHOF) is to improve the understanding and treatment of human and organisational factors (HOF) within the nuclear industry in order to support the continued safety performance of nuclear installations and improve the effectiveness of regulatory practices in member countries. WGHOF developed a CSNI (Committee on the Safety of Nuclear Installations) Activity Proposal Sheet (CAPS) outlining the work and milestones necessary towards achieving the following objectives: - Identify barriers to analyzing and correctly identifying the Human and Organisational Factors (HOF) causes of events; - Identify barriers to implementing lessons learned from these analyses; and - Develop recommendations for overcoming these barriers to: improve the identification of HOF causes of events and support the successful implementation of appropriate corrective actions The CAPS can be found in Appendix A. The first activity under the plan was the development of a questionnaire. This was distributed to WGHOF members and their counterparts from the Working Group on Operating Experience (WGOE). The questionnaire was comprised of 20 questions based on the objectives of the CSNI Activity Proposed Sheet. The intended survey participants were licensees with previous experience conducting root cause analyses. Responses were received from 26 respondents from 11 different countries. The results of the questionnaire were analyzed to identify themes for further discussion during a specialist meeting planned for September 2009. The following themes were presented during the WGHOF meeting in March of 2009 and endorsed for further work: - Roles and Influence of Senior Management, - Skills and Knowledge of the Investigators, - Qualitative Nature of HOF, - Influence of the Regulator, - Systematic Approach to Investigation. A summary of the questionnaire responses is provided in Appendix B

  17. Identifying the Interaction of Vancomycin With Novel pH-Responsive Lipids as Antibacterial Biomaterials Via Accelerated Molecular Dynamics and Binding Free Energy Calculations.

    Science.gov (United States)

    Ahmed, Shaimaa; Vepuri, Suresh B; Jadhav, Mahantesh; Kalhapure, Rahul S; Govender, Thirumala

    2018-06-01

    Nano-drug delivery systems have proven to be an efficient formulation tool to overcome the challenges with current antibiotics therapy and resistance. A series of pH-responsive lipid molecules were designed and synthesized for future liposomal formulation as a nano-drug delivery system for vancomycin at the infection site. The structures of these lipids differ from each other in respect of hydrocarbon tails: Lipid1, 2, 3 and 4 have stearic, oleic, linoleic, and linolenic acid hydrocarbon chains, respectively. The impact of variation in the hydrocarbon chain in the lipid structure on drug encapsulation and release profile, as well as mode of drug interaction, was investigated using molecular modeling analyses. A wide range of computational tools, including accelerated molecular dynamics, normal molecular dynamics, binding free energy calculations and principle component analysis, were applied to provide comprehensive insight into the interaction landscape between vancomycin and the designed lipid molecules. Interestingly, both MM-GBSA and MM-PBSA binding affinity calculations using normal molecular dynamics and accelerated molecular dynamics trajectories showed a very consistent trend, where the order of binding affinity towards vancomycin was lipid4 > lipid1 > lipid2 > lipid3. From both normal molecular dynamics and accelerated molecular dynamics, the interaction of lipid3 with vancomycin is demonstrated to be the weakest (∆G binding  = -2.17 and -11.57, for normal molecular dynamics and accelerated molecular dynamics, respectively) when compared to other complexes. We believe that the degree of unsaturation of the hydrocarbon chain in the lipid molecules may impact on the overall conformational behavior, interaction mode and encapsulation (wrapping) of the lipid molecules around the vancomycin molecule. This thorough computational analysis prior to the experimental investigation is a valuable approach to guide for predicting the encapsulation

  18. Identified Hadron Production as a Function of Event Multiplicity and Transverse Spherocity in pp Collisions at $\\sqrt{s}$ = 7 and 13 TeV with the ALICE Detector

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00510339; Oskarsson, Anders; Silvermyr, David

    This study reports on identified hadron production as a function of event multiplicity ($\\langle\\textrm{d}N_{\\textrm{ch}}/\\textrm{d}η\\rangle$) and transverse spherocity ($S_\\textrm{O}$ ) in proton-proton collisions at $\\sqrt{s}$ = 7 and 13 TeV measured with the ALICE detector at the LHC. The particle spectra and their ratios measured in high-multiplicity events show signatures of an expanding medium. Integrated particle yields as a function of multiplicity measured in pp collisions at $\\sqrt{s}$ = 7 and 13 TeV are compared to those measured in p-Pb and Pb-Pb collisions. Hadrochemical composition of particles are found to be similar in different colliding systems under different $\\sqrt{s}$, provided similar multiplicities are compared. This suggests that hadron yields are dominantly driven by $\\langle\\textrm{d}N_{\\textrm{ch}}/\\textrm{d}η\\rangle$, and not the colliding system or center-of-mass energy. On the other hand, particle spectra measured in pp collisions at $\\sqrt{s}$ = 13 TeV is harder than that at 7...

  19. Energetics of the rearrangement of neutral and ionized perfluorocyclopropane to perfluoropropylene. Use of infrared multiphoton dissociation spectra to identify structural isomers of molecular ions

    International Nuclear Information System (INIS)

    Bomse, D.S.; Berman, D.W.; Beauchamp, J.L.

    1981-01-01

    Infrared photodissociation spectroscopy is used to compare the structure of gas-phase C 3 F 6 + ions obtained by electron-impact ionization of two isomeric precursors: perfluoropropylene and perfluorocyclopropane. Photodissociation spectra are obtained by observing the extent of multiphoton dissociation as the CO 2 laser is tuned across the 925 to 1080 cm -1 wavelength range. Ions are formed, stored, and detected with the use of techniques of ion cyclotron resonance spectroscopy. Infrared multiphoton excitation is effected by using low-power, continuous-wave laser radiation. The fingerprint spectrum of the molecular ion of perfluorocyclopropane is identical with that obtained from perfluoropropylene, indicating rearrangement of the former to the latter. Photodissociation kinetics indicate that the entire perfluorocyclopropane molecular ion population isomerizes to the more stable perfluoropropylene structure. Thermochemistry of C 3 F 6 and C 3 F 6 + isomers is discussed. Comparisons are made with the analogous C 3 H 6 system. Photoionization mass spectroscopy results yield ΔH/sub f/(c-C 3 F 6 ) = -233.8 kcal/mol. 4 figures

  20. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots.

    Science.gov (United States)

    Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang

    2017-02-06

    Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. 'MAPK cascade'), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway'), reactive oxygen species (ROS) metabolic process (e.g. 'hydrogen peroxide catabolic process') and transcription factors (e.g., 'MYB, ZFP and bZIP') were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment.

  1. A centennial record of anthropogenic impacts and extreme weather events in southwestern Taiwan: Evidence from sedimentary molecular markers in coastal margin

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Li-Jung; Lee, Chon-Lin; Louchouarn, Patrick; Huh, Chih-An; Liu, James T.; Chen, Jian-Cheng; Lee, Kun-Je

    2014-09-15

    A 100-year history of human and natural disturbances in southwestern Taiwan was reconstructed using a suite of molecular markers in four dated sediment cores from the upper slope region off the Gaoping River mouth. Trends in polycyclic aromatic hydrocarbons (PAHs) tracked Taiwan's industrialization/urbanization starting in the 1970s, and the enactment of environmental regulatory policies thereafter.

  2. Transient downregulation of Sema3A mRNA in a rat model for temporal lobe epilepsy. A novel molecular event potentially contributing to mossy fiber sprouting

    NARCIS (Netherlands)

    Holtmaat, Anthony J D G; Gorter, Jan A; de Wit, Joris; Tolner, Else A; Spijker, Sabine; Giger, Roman J; Lopes da Silva, Fernando H; Verhaagen, J.

    Mossy fiber sprouting (MFS) in the hippocampal dentate gyrus is thought to play a critical role in the hyperexcitability of the hippocampus in temporal lobe epilepsy patients. The composition of molecular signals that is needed to direct this sprouting response has not yet been elucidated to a great

  3. Neuronal Functions Associated with Endo- and Exocytotic Events-cum-Molecular Trafficking May Be Cell Maturation-Dependent: Lessons Learned from Studies on Botulism

    Science.gov (United States)

    2011-01-01

    Clostridium botulinum type A progenitor toxins . Infect Immun 64:1589–1594 Li L, Singh BR (1999) Structure -function relationship of clostridial...experimental design and demonstration of the validity of the targeted neurologic therapeutic delivery approach based on recombinant botulinum toxin ...Endocytosis Exocytosis Molecular trafficking Cell maturation Botulism Targeted therapeutic Background Botulinum neurotoxins (BoNTs) are produced by

  4. Structure of Human B12 Trafficking Protein CblD Reveals Molecular Mimicry and Identifies a New Subfamily of Nitro-FMN Reductases.

    Science.gov (United States)

    Yamada, Kazuhiro; Gherasim, Carmen; Banerjee, Ruma; Koutmos, Markos

    2015-12-04

    In mammals, B12 (or cobalamin) is an essential cofactor required by methionine synthase and methylmalonyl-CoA mutase. A complex intracellular pathway supports the assimilation of cobalamin into its active cofactor forms and delivery to its target enzymes. MMADHC (the methylmalonic aciduria and homocystinuria type D protein), commonly referred to as CblD, is a key chaperone involved in intracellular cobalamin trafficking, and mutations in CblD cause methylmalonic aciduria and/or homocystinuria. Herein, we report the first crystal structure of the globular C-terminal domain of human CblD, which is sufficient for its interaction with MMADHC (the methylmalonic aciduria and homocystinuria type C protein), or CblC, and for supporting the cytoplasmic cobalamin trafficking pathway. CblD contains an α+β fold that is structurally reminiscent of the nitro-FMN reductase superfamily. Two of the closest structural relatives of CblD are CblC, a multifunctional enzyme important for cobalamin trafficking, and the activation domain of methionine synthase. CblD, CblC, and the activation domain of methionine synthase share several distinguishing features and, together with two recently described corrinoid-dependent reductive dehalogenases, constitute a new subclass within the nitro-FMN reductase superfamily. We demonstrate that CblD enhances oxidation of cob(II)alamin bound to CblC and that disease-causing mutations in CblD impair the kinetics of this reaction. The striking structural similarity of CblD to CblC, believed to be contiguous in the cobalamin trafficking pathway, suggests the co-option of molecular mimicry as a strategy for achieving its function. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Molecular dynamics simulations of site point mutations in the TPR domain of cyclophilin 40 identify conformational states with distinct dynamic and enzymatic properties

    Science.gov (United States)

    Gur, Mert; Blackburn, Elizabeth A.; Ning, Jia; Narayan, Vikram; Ball, Kathryn L.; Walkinshaw, Malcolm D.; Erman, Burak

    2018-04-01

    Cyclophilin 40 (Cyp40) is a member of the immunophilin family that acts as a peptidyl-prolyl-isomerase enzyme and binds to the heat shock protein 90 (Hsp90). Its structure comprises an N-terminal cyclophilin domain and a C-terminal tetratricopeptide (TPR) domain. Cyp40 is overexpressed in prostate cancer and certain T-cell lymphomas. The groove for Hsp90 binding on the TPR domain includes residues Lys227 and Lys308, referred to as the carboxylate clamp, and is essential for Cyp40-Hsp90 binding. In this study, the effect of two mutations, K227A and K308A, and their combinative mutant was investigated by performing a total of 5.76 μs of all-atom molecular dynamics (MD) simulations in explicit solvent. All simulations, except the K308A mutant, were found to adopt two distinct (extended or compact) conformers defined by different cyclophilin-TPR interdomain distances. The K308A mutant was only observed in the extended form which is observed in the Cyp40 X-ray structure. The wild-type, K227A, and combined mutant also showed bimodal distributions. The experimental melting temperature, Tm, values of the mutants correlate with the degree of compactness with the K308A extended mutant having a marginally lower melting temperature. Another novel measure of compactness determined from the MD data, the "coordination shell volume," also shows a direct correlation with Tm. In addition, the MD simulations show an allosteric effect with the mutations in the remote TPR domain having a pronounced effect on the molecular motions of the enzymatic cyclophilin domain which helps rationalise the experimentally observed increase in enzyme activity measured for all three mutations.

  6. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, R L; Oettinger, T; Rosenkrands, I

    2000-01-01

    Culture filtrate from Mycobacterium tuberculosis contains protective antigens of relevance for the generation of a new antituberculosis vaccine. We have identified two previously uncharacterized M. tuberculosis proteins (TB7.3 and TB10.4) from the highly active low-mass fraction of culture filtra...

  7. Visions of a Semantic Molecular Future

    OpenAIRE

    Murray-Rust, Peter; Brooks, Brian; Bolton, Charlotte

    2011-01-01

    Booklet handout distributed at the VSMF Symposium held at the Unilever Centre on 2011-01-17 The event looks forward. Scholarship (universities, research, teaching, publishing) has been slow to take up the opportunities of this digital century. This is an opportunity to identify and build the future. EPSRC (Pathways to Impact Award). Unilever plc (Unilever Centre for Molecular Science Informatics)

  8. Visions of a Semantic Molecular Future

    OpenAIRE

    Murray-Rust, Peter

    2011-01-01

    Additional booklet insert distributed at the VSMF Symposium held at the Unilever Centre on 2011-01-17 The event looks forward. Scholarship (universities, research, teaching, publishing) has been slow to take up the opportunities of this digital century. This is an opportunity to identify and build the future. EPSRC (Pathways to Impact award). Unilever plc (Unilever Centre for Molecular Science Informatics)

  9. Comparative Study between Sequential Automatic and Manual Home Respiratory Polygraphy Scoring Using a Three-Channel Device: Impact of the Manual Editing of Events to Identify Severe Obstructive Sleep Apnea

    Directory of Open Access Journals (Sweden)

    Glenda Ernst

    2015-01-01

    Full Text Available Objective. According to current guidelines, autoscoring of respiratory events in respiratory polygraphy requires manual scoring. The aim of this study was to evaluate the agreement between automatic analysis and manual scoring to identify patients with suspected OSA. Methods. This retrospective study analyzed 791 records from respiratory polygraphy (RP performed at home. The association grade between automatic scoring and manual scoring was evaluated using Kappa coefficient and the agreement using Bland and Altman test and intraclass correlation coefficient (CCI. To determine the accuracy in the identification of AHI≥30 eV/h, the ROC curve analysis was used. Results. The population analyzed consisted of 493 male (62.3% and 298 female patients, with an average age of 54.7±14.20 years and BMI of 32.7±8.21 kg/m2. There was no significant difference between automatic and manual apnea/hypopnea indexes (aAHI, mAHI: aAHI 17.25 (SD: 17.42 versus mAHI 21.20±7.96 (p; NS. The agreement between mAHI and aAHI to AHI≥30 was 94%, with a Kappa coefficient of 0.83 (p<0.001 and a CCI of 0.83. The AUC-ROC, sensitivity, and specificity were 0.99 (CI 95%: 0.98-0.99, p<0.001, 86% (CI 95%: 78.7–91.4, and 97% (CI 95%: 96–98.3, respectively. Conclusions. We observed good agreement between automatic scoring and sequential manual scoring to identify subjects with AHI≥30 eV/h.

  10. Use of quantitative molecular diagnostic methods to identify causes of diarrhoea in children: a reanalysis of the GEMS case-control study.

    Science.gov (United States)

    Liu, Jie; Platts-Mills, James A; Juma, Jane; Kabir, Furqan; Nkeze, Joseph; Okoi, Catherine; Operario, Darwin J; Uddin, Jashim; Ahmed, Shahnawaz; Alonso, Pedro L; Antonio, Martin; Becker, Stephen M; Blackwelder, William C; Breiman, Robert F; Faruque, Abu S G; Fields, Barry; Gratz, Jean; Haque, Rashidul; Hossain, Anowar; Hossain, M Jahangir; Jarju, Sheikh; Qamar, Farah; Iqbal, Najeeha Talat; Kwambana, Brenda; Mandomando, Inacio; McMurry, Timothy L; Ochieng, Caroline; Ochieng, John B; Ochieng, Melvin; Onyango, Clayton; Panchalingam, Sandra; Kalam, Adil; Aziz, Fatima; Qureshi, Shahida; Ramamurthy, Thandavarayan; Roberts, James H; Saha, Debasish; Sow, Samba O; Stroup, Suzanne E; Sur, Dipika; Tamboura, Boubou; Taniuchi, Mami; Tennant, Sharon M; Toema, Deanna; Wu, Yukun; Zaidi, Anita; Nataro, James P; Kotloff, Karen L; Levine, Myron M; Houpt, Eric R

    2016-09-24

    Diarrhoea is the second leading cause of mortality in children worldwide, but establishing the cause can be complicated by diverse diagnostic approaches and varying test characteristics. We used quantitative molecular diagnostic methods to reassess causes of diarrhoea in the Global Enteric Multicenter Study (GEMS). GEMS was a study of moderate to severe diarrhoea in children younger than 5 years in Africa and Asia. We used quantitative real-time PCR (qPCR) to test for 32 enteropathogens in stool samples from cases and matched asymptomatic controls from GEMS, and compared pathogen-specific attributable incidences with those found with the original GEMS microbiological methods, including culture, EIA, and reverse-transcriptase PCR. We calculated revised pathogen-specific burdens of disease and assessed causes in individual children. We analysed 5304 sample pairs. For most pathogens, incidence was greater with qPCR than with the original methods, particularly for adenovirus 40/41 (around five times), Shigella spp or enteroinvasive Escherichia coli (EIEC) and Campylobactor jejuni o C coli (around two times), and heat-stable enterotoxin-producing E coli ([ST-ETEC] around 1·5 times). The six most attributable pathogens became, in descending order, Shigella spp, rotavirus, adenovirus 40/41, ST-ETEC, Cryptosporidium spp, and Campylobacter spp. Pathogen-attributable diarrhoeal burden was 89·3% (95% CI 83·2-96·0) at the population level, compared with 51·5% (48·0-55·0) in the original GEMS analysis. The top six pathogens accounted for 77·8% (74·6-80·9) of all attributable diarrhoea. With use of model-derived quantitative cutoffs to assess individual diarrhoeal cases, 2254 (42·5%) of 5304 cases had one diarrhoea-associated pathogen detected and 2063 (38·9%) had two or more, with Shigella spp and rotavirus being the pathogens most strongly associated with diarrhoea in children with mixed infections. A quantitative molecular diagnostic approach improved population

  11. Molecular characterization of the VP4, VP6, VP7, and NSP4 genes of lapine rotaviruses identified in italy: emergence of a novel VP4 genotype

    International Nuclear Information System (INIS)

    Martella, Vito; Ciarlet, Max; Camarda, Antonio; Pratelli, Annamaria; Tempesta, Maria; Greco, Grazia; Cavalli, Alessandra; Elia, Gabriella; Decaro, Nicola; Terio, Valentina; Bozzo, Giancarlo; Camero, Michele; Buonavoglia, Canio

    2003-01-01

    The genes encoding the glycoprotein VP7, the VP8* trypsin-cleavage product of the protein VP4, a fragment of the protein VP6 associated with subgroup (SG) specificity, and the enterotoxin NSP4 of rotavirus strains identified in diarrheic fecal samples of rabbits in Italy were sequenced. The Italian lapine rotavirus (LRV) strains possessed a G3 VP7, SG I VP6, and KUN-like NSP4, a gene constellation typical of LRVs. One LRV strain (30/96), isolated in 1996, shared the closest amino acid (aa) identity (87-96%) with the P[14] genotype, composed of human and LRV strains. Conversely, three LRV strains (160/01, 229/01, and 308/01), identified in 2001, were highly identical (90-95%) among each other, but showed low aa identity (34-77%) to the VP8* genotype-specific sequences of representative rotavirus strains of all remaining P genotypes. This report confirms the worldwide genetic constellations of LRVs and identifies a novel VP4 genotype in rabbits, tentatively proposed as genotype P[22

  12. Giant Galápagos tortoises; molecular genetic analyses identify a trans-island hybrid in a repatriation program of an endangered taxon

    Directory of Open Access Journals (Sweden)

    Caccone Adalgisa

    2007-02-01

    Full Text Available Abstract Background Giant Galápagos tortoises on the island of Española have been the focus of an intensive captive breeding-repatriation programme for over 35 years that saved the taxon from extinction. However, analysis of 118 samples from released individuals indicated that the bias sex ratio and large variance in reproductive success among the 15 breeders has severely reduced the effective population size (Ne. Results We report here that an analysis of an additional 473 captive-bred tortoises released back to the island reveals an individual (E1465 that exhibits nuclear microsatellite alleles not found in any of the 15 breeders. Statistical analyses incorporating genotypes of 304 field-sampled individuals from all populations on the major islands indicate that E1465 is most probably a hybrid between an Española female tortoise and a male from the island of Pinzón, likely present on Española due to human transport. Conclusion Removal of E1465 as well as its father and possible (half-siblings is warranted to prevent further contamination within this taxon of particular conservation significance. Despite this detected single contamination, it is highly noteworthy to emphasize the success of this repatriation program conducted over nearly 40 years and involving release of over 2000 captive-bred tortoises that now reproduce in situ. The incorporation of molecular genetic analysis of the program is providing guidance that will aid in monitoring the genetic integrity of this ambitious effort to restore a unique linage of a spectacular animal.

  13. What does it take to resolve relationships and to identify species with molecular markers? An example from the epiphytic Rhipsalideae (Cactaceae).

    Science.gov (United States)

    Korotkova, Nadja; Borsch, Thomas; Quandt, Dietmar; Taylor, Nigel P; Müller, Kai F; Barthlott, Wilhelm

    2011-09-01

    The Cactaceae are a major New World plant family and popular in horticulture. Still, taxonomic units and species limits have been difficult to define, and molecular phylogenetic studies so far have yielded largely unresolved trees, so relationships within Cactaceae remain insufficiently understood. This study focuses on the predominantly epiphytic tribe Rhipsalideae and evaluates the utility of a spectrum of plastid genomic regions. • We present a phylogenetic study including 52 of the 53 Rhipsalideae species and all the infraspecific taxa. Seven regions (trnK intron, matK, rbcL, rps3-rpl16, rpl16 intron, psbA-trnH, trnQ-rps16), ca. 5600 nucleotides (nt) were sequenced per sample. The regions used were evaluated for their phylogenetic performance and performance in DNA-based species recognition based on operational taxonomic units (OTUs) defined beforehand. • The Rhipsalideae are monophyletic and contain five clades that correspond to the genera Rhipsalis, Lepismium, Schlumbergera, Hatiora, and Rhipsalidopsis. The species-level tree was well resolved and supported; the rpl16 and trnK introns yielded the best phylogenetic signal. Although the psbA-trnH and trnQ-rps16 spacers were the most successful individual regions for OTU identification, their success rate did not significantly exceed 70%. The highest OTU identification rate of 97% was found using the combination of psbA-trnH, rps3-rpl16, trnK intron, and trnQ-rps16 as a minimum possible marker length (ca. 1660 nt). • The phylogenetic performance of a marker is not determined by the level of sequence variability, and species discrimination power does not necessarily correlate with phylogenetic utility.

  14. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  15. Event generators

    International Nuclear Information System (INIS)

    Durand, D.; Gulminelli, F.; Lopez, O.; Vient, E.

    1998-01-01

    The results concerning the heavy ion collision simulations at Fermi energies by means of phenomenological models obtained in the last two years ar presented. The event generators are essentially following the phase of elaboration of analysis methods of data obtained by INDRA or NAUTILUS 4 π multidetectors. To identify and correctly quantify a phenomenon or a physical quantity it is necessary to verify by simulation the feasibility and validity of the analysis and also to estimate the bias introduced by the experimental filter. Many studies have shown this, for instance: the determination of the collision reaction plan for flow studies, determination of kinematical characteristics of the quasi-projectiles, and the excitation energy measurement stored in the hot nuclei. To Eugene, the currently utilised generator, several improvements were added: introduction of space-time correlations between the different products emitted in the decay of excited nuclei by calculating the trajectories of the particles in the final phase of the reaction; taking into account in the decay cascade of the discrete levels of the lighter fragments; the possibility of the schematically description of the explosion of the nucleus by simultaneous emission of multi-fragments. Thus, by comparing the calculations with the data relative to heavy systems studied with the NAUTILUS assembly it was possible to extract the time scales in the nuclear fragmentation. The utilisation of these event generators was extended to the analysis of INDRA data concerning the determination of the vaporization threshold in the collisions Ar + Ni and also the research of the expansion effects in the collisions Xe + Sn at 50 MeV/u

  16. Urinary Metabolomics Identifies a Molecular Correlate of Interstitial Cystitis/Bladder Pain Syndrome in a Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP Research Network Cohort

    Directory of Open Access Journals (Sweden)

    Kaveri S. Parker

    2016-05-01

    Full Text Available Interstitial cystitis/bladder pain syndrome (IC/BPS is a poorly understood syndrome affecting up to 6.5% of adult women in the U.S. The lack of broadly accepted objective laboratory markers for this condition hampers efforts to diagnose and treat this condition. To identify biochemical markers for IC/BPS, we applied mass spectrometry-based global metabolite profiling to urine specimens from a cohort of female IC/BPS subjects from the Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP Research Network. These analyses identified multiple metabolites capable of discriminating IC/BPS and control subjects. Of these candidate markers, etiocholan-3α-ol-17-one sulfate (Etio-S, a sulfoconjugated 5-β reduced isomer of testosterone, distinguished female IC/BPS and control subjects with a sensitivity and specificity >90%. Among IC/BPS subjects, urinary Etio-S levels are correlated with elevated symptom scores (symptoms, pelvic pain, and number of painful body sites and could resolve high- from low-symptom IC/BPS subgroups. Etio-S-associated biochemical changes persisted through 3–6 months of longitudinal follow up. These results raise the possibility that an underlying biochemical abnormality contributes to symptoms in patients with severe IC/BPS.

  17. Event Investigation

    International Nuclear Information System (INIS)

    Korosec, D.

    2000-01-01

    The events in the nuclear industry are investigated from the license point of view and from the regulatory side too. It is well known the importance of the event investigation. One of the main goals of such investigation is to prevent the circumstances leading to the event and the consequences of the event. The protection of the nuclear workers against nuclear hazard, and the protection of general public against dangerous effects of an event could be achieved by systematic approach to the event investigation. Both, the nuclear safety regulatory body and the licensee shall ensure that operational significant events are investigated in a systematic and technically sound manner to gather information pertaining to the probable causes of the event. One of the results should be appropriate feedback regarding the lessons of the experience to the regulatory body, nuclear industry and general public. In the present paper a general description of systematic approach to the event investigation is presented. The systematic approach to the event investigation works best where cooperation is present among the different divisions of the nuclear facility or regulatory body. By involving management and supervisors the safety office can usually improve their efforts in the whole process. The end result shall be a program which serves to prevent events and reduce the time and efforts solving the root cause which initiated each event. Selection of the proper method for the investigation and an adequate review of the findings and conclusions lead to the higher level of the overall nuclear safety. (author)

  18. A multiple translocation event in a patient with hexadactyly, facial dysmorphism, mental retardation and behaviour disorder characterised comprehensively by molecular cytogenetics. Case report and review of the literature.

    Science.gov (United States)

    Seidel, Jörg; Heller, Anita; Senger, Gabriele; Starke, Heike; Chudoba, Ilse; Kelbova, Christina; Tönnies, Holger; Neitzel, Heidemarie; Haase, Claudia; Beensen, Volkmar; Zintl, Felix; Claussen, Uwe; Liehr, Thomas

    2003-09-01

    We report a 13-year-old female patient with multiple congenital abnormalities (microcephaly, facial dysmorphism, anteverted dysplastic ears and postaxial hexadactyly), mental retardation, and adipose-gigantism. Ultrasonography revealed no signs of a heart defect or renal abnormalities. She showed no speech development and suffered from a behavioural disorder. CNS abnormalities were excluded by cerebral MRI. Initial cytogenetic studies by Giemsa banding revealed an aberrant karyotype involving three chromosomes, t(2;4;11). By high resolution banding and multicolour fluoresence in-situ hybridisation (M-FISH, MCB), chromosome 1 was also found to be involved in the complex chromosomal aberrations, confirming the karyotype 46,XX,t(2;11;4).ish t(1;4;2;11)(q43;q21.1;p12-p13.1;p14.1). To the best of our knowledge no patient has been previously described with such a complex translocation involving 4 chromosomes. This case demonstrates that conventional chromosome banding techniques such as Giemsa banding are not always sufficient to characterise complex chromosomal abnormalities. Only by the additional utilisation of molecular cytogenetic techniques could the complexity of the present chromosomal rearrangements and the origin of the involved chromosomal material be detected. Further molecular genetic studies will be performed to clarify the chromosomal breakpoints potentially responsible for the observed clinical symptoms. This report demonstrates that multicolour-fluorescence in-situ hybridisation studies should be performed in patients with congenital abnormalities and suspected aberrant karyotypes in addition to conventional Giemsa banding.

  19. Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

    Science.gov (United States)

    Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

    2012-07-01

    Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and

  20. Epidemiological links between tuberculosis cases identified twice as efficiently by whole genome sequencing than conventional molecular typing: A population-based study.

    Science.gov (United States)

    Jajou, Rana; de Neeling, Albert; van Hunen, Rianne; de Vries, Gerard; Schimmel, Henrieke; Mulder, Arnout; Anthony, Richard; van der Hoek, Wim; van Soolingen, Dick

    2018-01-01

    Patients with Mycobacterium tuberculosis isolates sharing identical DNA fingerprint patterns can be epidemiologically linked. However, municipal health services in the Netherlands are able to confirm an epidemiological link in only around 23% of the patients with isolates clustered by the conventional variable number of tandem repeat (VNTR) genotyping. This research aims to investigate whether whole genome sequencing (WGS) is a more reliable predictor of epidemiological links between tuberculosis patients than VNTR genotyping. VNTR genotyping and WGS were performed in parallel on all Mycobacterium tuberculosis complex isolates received at the Netherlands National Institute for Public Health and the Environment in 2016. Isolates were clustered by VNTR when they shared identical 24-loci VNTR patterns; isolates were assigned to a WGS cluster when the pair-wise genetic distance was ≤ 12 single nucleotide polymorphisms (SNPs). Cluster investigation was performed by municipal health services on all isolates clustered by VNTR in 2016. The proportion of epidemiological links identified among patients clustered by either method was calculated. In total, 535 isolates were genotyped, of which 25% (134/535) were clustered by VNTR and 14% (76/535) by WGS; the concordance between both typing methods was 86%. The proportion of epidemiological links among WGS clustered cases (57%) was twice as common than among VNTR clustered cases (31%). When WGS was applied, the number of clustered isolates was halved, while all epidemiologically linked cases remained clustered. WGS is therefore a more reliable tool to predict epidemiological links between tuberculosis cases than VNTR genotyping and will allow more efficient transmission tracing, as epidemiological investigations based on false clustering can be avoided.

  1. Exploring the influence of EGCG on the β-sheet-rich oligomers of human islet amyloid polypeptide (hIAPP1-37 and identifying its possible binding sites from molecular dynamics simulation.

    Directory of Open Access Journals (Sweden)

    Qianqian Wang

    Full Text Available EGCG possesses the ability of disaggregating the existing amyloid fibrils which were associated with many age-related degenerative diseases. However, the molecular mechanism of EGCG to disaggregate these fibrils is poorly known. In this work, to study the influence of EGCG on the full-length human islet amyloid polypeptide 1-37 (hIAPP1-37 oligomers, molecular dynamics simulations of hIAPP1-37 pentamer and decamer with EGCG were performed, respectively. The obtained results indicate that EGCG indeed destabilized the hIAPP1-37 oligomers. The nematic order parameter and secondary structure calculations coupled with the free-energy landscape indicate that EGCG broke the initial ordered pattern of two polymers, greatly reduced their β-sheet content and enlarged their conformational space. On this basis, three possible target sites were identified with the binding capacity order of S1>S2>S3. After a deeper analysis of each site, we found that S1 was the most possible site on which residues B-Ile26/Ala25, A-Phe23, B/C-Leu27 and E-Tyr37 played an important role for their binding. The proposal of this molecular mechanism can not only provide a prospective interaction figure between EGCG and β-sheet-rich fibrils of hIAPP1-37, but also is useful for further discovering other potential inhibitors.

  2. SENTINEL EVENTS

    Directory of Open Access Journals (Sweden)

    Andrej Robida

    2004-09-01

    Full Text Available Background. The Objective of the article is a two year statistics on sentinel events in hospitals. Results of a survey on sentinel events and the attitude of hospital leaders and staff are also included. Some recommendations regarding patient safety and the handling of sentinel events are given.Methods. In March 2002 the Ministry of Health introduce a voluntary reporting system on sentinel events in Slovenian hospitals. Sentinel events were analyzed according to the place the event, its content, and root causes. To show results of the first year, a conference for hospital directors and medical directors was organized. A survey was conducted among the participants with the purpose of gathering information about their view on sentinel events. One hundred questionnaires were distributed.Results. Sentinel events. There were 14 reports of sentinel events in the first year and 7 in the second. In 4 cases reports were received only after written reminders were sent to the responsible persons, in one case no reports were obtained. There were 14 deaths, 5 of these were in-hospital suicides, 6 were due to an adverse event, 3 were unexplained. Events not leading to death were a suicide attempt, a wrong side surgery, a paraplegia after spinal anaesthesia, a fall with a femoral neck fracture, a damage of the spleen in the event of pleural space drainage, inadvertent embolization with absolute alcohol into a femoral artery and a physical attack on a physician by a patient. Analysis of root causes of sentinel events showed that in most cases processes were inadequate.Survey. One quarter of those surveyed did not know about the sentinel events reporting system. 16% were having actual problems when reporting events and 47% beleived that there was an attempt to blame individuals. Obstacles in reporting events openly were fear of consequences, moral shame, fear of public disclosure of names of participants in the event and exposure in mass media. The majority of

  3. A centennial record of anthropogenic impacts and extreme weather events in southwestern Taiwan: Evidence from sedimentary molecular markers in coastal margin

    International Nuclear Information System (INIS)

    Kuo, Li-Jung; Lee, Chon-Lin; Louchouarn, Patrick; Huh, Chih-An; Liu, James T.; Chen, Jian-Cheng; Lee, Kun-Je

    2014-01-01

    Highlights: • Historical reconstruction of human and natural disturbances in SW Taiwan. • Comparative analysis of PAHs and lignin to evaluate sources/processes. • Distinct timing of PAH maxima between western Pacific, Europe and North America. • Consistently low (Ad/Al) v suggests quick transport of TOM by mountainous rivers. • Both PAHs and lignin point to turbidite flows driven by typhoon floods. - Abstract: A 100-year history of human and natural disturbances in southwestern Taiwan was reconstructed using a suite of molecular markers in four dated sediment cores from the upper slope region off the Gaoping River mouth. Trends in polycyclic aromatic hydrocarbons (PAHs) tracked Taiwan’s industrialization/urbanization starting in the 1970s, and the enactment of environmental regulatory policies thereafter. The predominant pyrogenic sources include vehicular, smelter, and coal combustion but spatial differences are observed among sub-regions of the shelf. Profiles of lignin oxidation products (LOPs) point to a significant increase in terrestrial organic matter inputs driven by land development after the 1970s. Low lignin diagenetic signature ratios [(Ad/Al) v ] in all sediments suggest quick transport of fresh plant material from land to sea via mountainous rivers. Shifts in PAHs, LOPs, and radionuclides in recent sediments reveal the deposition of turbidites resulting from typhoon-induced floods. Multiproxy analysis illustrates the interplay between anthropogenic activities and natural processes

  4. A centennial record of anthropogenic impacts and extreme weather events in southwestern Taiwan: evidence from sedimentary molecular markers in coastal margin.

    Science.gov (United States)

    Kuo, Li-Jung; Lee, Chon-Lin; Louchouarn, Patrick; Huh, Chih-An; Liu, James T; Chen, Jian-Cheng; Lee, Kun-Je

    2014-09-15

    A 100-year history of human and natural disturbances in southwestern Taiwan was reconstructed using a suite of molecular markers in four dated sediment cores from the upper slope region off the Gaoping River mouth. Trends in polycyclic aromatic hydrocarbons (PAHs) tracked Taiwan's industrialization/urbanization starting in the 1970s, and the enactment of environmental regulatory policies thereafter. The predominant pyrogenic sources include vehicular, smelter, and coal combustion but spatial differences are observed among sub-regions of the shelf. Profiles of lignin oxidation products (LOPs) point to a significant increase in terrestrial organic matter inputs driven by land development after the 1970s. Low lignin diagenetic signature ratios [(Ad/Al)v] in all sediments suggest quick transport of fresh plant material from land to sea via mountainous rivers. Shifts in PAHs, LOPs, and radionuclides in recent sediments reveal the deposition of turbidites resulting from typhoon-induced floods. Multiproxy analysis illustrates the interplay between anthropogenic activities and natural processes. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Acquired copy-neutral loss of heterozygosity of chromosome 1p as a molecular event associated with marrow fibrosis in MPL-mutated myeloproliferative neoplasms.

    Science.gov (United States)

    Rumi, Elisa; Pietra, Daniela; Guglielmelli, Paola; Bordoni, Roberta; Casetti, Ilaria; Milanesi, Chiara; Sant'Antonio, Emanuela; Ferretti, Virginia; Pancrazzi, Alessandro; Rotunno, Giada; Severgnini, Marco; Pietrelli, Alessandro; Astori, Cesare; Fugazza, Elena; Pascutto, Cristiana; Boveri, Emanuela; Passamonti, Francesco; De Bellis, Gianluca; Vannucchi, Alessandro; Cazzola, Mario

    2013-05-23

    We studied mutations of MPL exon 10 in patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF), first investigating a cohort of 892 consecutive patients. MPL mutation scanning was performed on granulocyte genomic DNA by using a high-resolution melt assay, and the mutant allele burden was evaluated by using deep sequencing. Somatic mutations of MPL, all but one involving codon W515, were detected in 26/661 (4%) patients with ET, 10/187 (5%) with PMF, and 7/44 (16%) patients with post-ET myelofibrosis. Comparison of JAK2 (V617F)-mutated and MPL-mutated patients showed only minor phenotypic differences. In an extended group of 62 MPL-mutated patients, the granulocyte mutant allele burden ranged from 1% to 95% and was significantly higher in patients with PMF or post-ET myelofibrosis compared with those with ET. Patients with higher mutation burdens had evidence of acquired copy-neutral loss of heterozygosity (CN-LOH) of chromosome 1p in granulocytes, consistent with a transition from heterozygosity to homozygosity for the MPL mutation in clonal cells. A significant association was found between MPL-mutant allele burden greater than 50% and marrow fibrosis. These observations suggest that acquired CN-LOH of chromosome 1p involving the MPL location may represent a molecular mechanism of fibrotic transformation in MPL-mutated myeloproliferative neoplasms.

  6. Event Modeling

    DEFF Research Database (Denmark)

    Bækgaard, Lars

    2001-01-01

    The purpose of this chapter is to discuss conceptual event modeling within a context of information modeling. Traditionally, information modeling has been concerned with the modeling of a universe of discourse in terms of information structures. However, most interesting universes of discourse...... are dynamic and we present a modeling approach that can be used to model such dynamics.We characterize events as both information objects and change agents (Bækgaard 1997). When viewed as information objects events are phenomena that can be observed and described. For example, borrow events in a library can...

  7. Molecular dynamics simulations of Hsp40 J-domain mutants identifies disruption of the critical HPD-motif as the key factor for impaired curing in vivo of the yeast prion [URE3].

    Science.gov (United States)

    Xue, You-Lin; Wang, Hao; Riedy, Michael; Roberts, Brittany-Lee; Sun, Yuna; Song, Yong-Bo; Jones, Gary W; Masison, Daniel C; Song, Youtao

    2018-05-01

    Genetic screens using Saccharomyces cerevisiae have identified an array of Hsp40 (Ydj1p) J-domain mutants that are impaired in the ability to cure the yeast [URE3] prion through disrupting functional interactions with Hsp70. However, biochemical analysis of some of these Hsp40 J-domain mutants has so far failed to provide major insight into the specific functional changes in Hsp40-Hsp70 interactions. To explore the detailed structural and dynamic properties of the Hsp40 J-domain, 20 ns molecular dynamic simulations of 4 mutants (D9A, D36A, A30T, and F45S) and wild-type J-domain were performed, followed by Hsp70 docking simulations. Results demonstrated that although the Hsp70 interaction mechanism of the mutants may vary, the major structural change was targeted to the critical HPD motif of the J-domain. Our computational analysis fits well with previous yeast genetics studies regarding highlighting the importance of J-domain function in prion propagation. During the molecular dynamics simulations several important residues were identified and predicted to play an essential role in J-domain structure. Among these residues, Y26 and F45 were confirmed, using both in silico and in vivo methods, as being critical for Ydj1p function.

  8. Early energy metabolism-related molecular events in skeletal muscle of diabetic rats: The effects of l-arginine and SOD mimic.

    Science.gov (United States)

    Stancic, Ana; Filipovic, Milos; Ivanovic-Burmazovic, Ivana; Masovic, Sava; Jankovic, Aleksandra; Otasevic, Vesna; Korac, Aleksandra; Buzadzic, Biljana; Korac, Bato

    2017-06-25

    Considering the vital role of skeletal muscle in control of whole-body metabolism and the severity of long-term diabetic complications, we aimed to reveal the molecular pattern of early diabetes-related skeletal muscle phenotype in terms of energy metabolism, focusing on regulatory mechanisms, and the possibility to improve it using two redox modulators, l-arginine and superoxide dismutase (SOD) mimic. Alloxan-induced diabetic rats (120 mg/kg) were treated with l-arginine or the highly specific SOD mimic, M40403, for 7 days. As appropriate controls, non-diabetic rats received the same treatments. We found that l-arginine and M40403 restored diabetes-induced impairment of phospho-5'-AMP-activated protein kinase α (AMPKα) signaling by upregulating AMPKα protein itself and its downstream effectors, peroxisome proliferator-activated receptor-γ coactivator-1α and nuclear respiratory factor 1. Also, there was a restitution of the protein levels of oxidative phosphorylation components (complex I, complex II and complex IV) and mitofusin 2. Furthermore, l-arginine and M40403 induced translocation of glucose transporter 4 to the membrane and upregulation of protein of phosphofructokinase and acyl coenzyme A dehydrogenase, diminishing negative diabetic effects on limiting factors of glucose and lipid metabolism. Both treatments abolished diabetes-induced downregulation of sarcoplasmic reticulum calcium-ATPase proteins (SERCA 1 and 2). Similar effects of l-arginine and SOD mimic treatments suggest that disturbances in the superoxide/nitric oxide ratio may be responsible for skeletal muscle mitochondrial and metabolic impairment in early diabetes. Our results provide evidence that l-arginine and SOD mimics have potential in preventing and treating metabolic disturbances accompanying this widespread metabolic disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Identifying the Molecular Origin of Global Warming

    Science.gov (United States)

    Bera, Partha P.; Francisco, Joseph S.; Lee, Timothy J.

    2009-01-01

    We have investigated the physical characteristics of greenhouse gases (GHGs) to assess which properties are most important in determining the efficiency of a GHG. Chlorofluorcarbons (CFCs), hydrofluorocarbons (HFCs), perfluorocarbons (PFCs), nitrogen fluorides, and various other known atmospheric trace molecules have been included in this study. Compounds containing the halogens F or Cl have in common very polar X-F or X-Cl bonds, particularly the X-F bonds. It is shown that as more F atoms bond to the same central atom, the bond dipoles become larger as a result of the central atom becoming more positive. This leads to a linear increase in the total or integrated XF bond dipole derivatives for the molecule, which leads to a non-linear (quadratic) increase in infrared (IR) intensity. Moreover, virtually all of the X-F bond stretches occur in the atmospheric IR window as opposed to X-H stretches, which do not occur in the atmospheric window. It is concluded that molecules possessing several F atoms will always have a large radiative forcing parameter in the calculation of their global warming potential. Some of the implications for global warming and climate change are discussed.

  10. Investigation of naphthofuran moiety as potential dual inhibitor against BACE-1 and GSK-3β: molecular dynamics simulations, binding energy, and network analysis to identify first-in-class dual inhibitors against Alzheimer's disease.

    Science.gov (United States)

    Kumar, Akhil; Srivastava, Gaurava; Srivastava, Swati; Verma, Seema; Negi, Arvind S; Sharma, Ashok

    2017-08-01

    BACE-1 and GSK-3β are potential therapeutic drug targets for Alzheimer's disease. Recently, both the targets received attention for designing dual inhibitors for Alzheimer's disease. Until now, only two-scaffold triazinone and curcumin have been reported as BACE-1 and GSK-3β dual inhibitors. Docking, molecular dynamics, clustering, binding energy, and network analysis of triazinone derivatives with BACE-1 and GSK-3β was performed to get molecular insight into the first reported dual inhibitor. Further, we designed and evaluated a naphthofuran series for its ability to inhibit BACE-1 and GSK-3β with the computational approaches. Docking study of naphthofuran series showed a good binding affinity towards both the targets. Molecular dynamics, binding energy, and network analysis were performed to compare their binding with the targets and amino acids responsible for binding. Naphthofuran series derivatives showed good interaction within the active site residues of both of the targets. Hydrogen bond occupancy and binding energy suggested strong binding with the targets. Dual-inhibitor binding was mostly governed by the hydrophobic interactions for both of the targets. Per residue energy decomposition and network analysis identified the key residues involved in the binding and inhibiting BACE-1 and GSK-3β. The results indicated that naphthofuran series derivative 11 may be a promising first-in-class dual inhibitor against BACE-1 and GSK-3β. This naphthofuran series may be further explored to design better dual inhibitors. Graphical abstract Naphthofuran derivative as a dual inhibitor for BACE-1 and GSK-3β.

  11. Local elastic expansion model for viscous-flow activation energies of glass-forming molecular liquids

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Olsen, Niels Boye; Christensen, Tage Emil

    1996-01-01

    A model for the viscosity of glass-forming molecular liquids is proposed in which a "flow event" requires a local volume increase. The activation energy for a flow event is identified with the work done in shoving aside the surrounding liquid; this work is proportional to the high-frequency shear...

  12. Purchase decision involvement: Event management segments and related event behavior

    Science.gov (United States)

    Rodney B. Warnick; David C. Bojanic

    2012-01-01

    The goal of this research was to examine the relationships between different levels of event purchase decision involvement (PDI) segments and their respective event behaviors (e.g., expenditures, travel behavior, event consumption and satisfaction). The specific purpose was to answer two major research questions: 1) Can PDI identify different levels or segments of...

  13. Event-Based Conceptual Modeling

    DEFF Research Database (Denmark)

    Bækgaard, Lars

    2009-01-01

    The purpose of the paper is to obtain insight into and provide practical advice for event-based conceptual modeling. We analyze a set of event concepts and use the results to formulate a conceptual event model that is used to identify guidelines for creation of dynamic process models and static...... information models. We characterize events as short-duration processes that have participants, consequences, and properties, and that may be modeled in terms of information structures. The conceptual event model is used to characterize a variety of event concepts and it is used to illustrate how events can...... be used to integrate dynamic modeling of processes and static modeling of information structures. The results are unique in the sense that no other general event concept has been used to unify a similar broad variety of seemingly incompatible event concepts. The general event concept can be used...

  14. What causes disability after transient ischemic attack and minor stroke?: Results from the CT and MRI in the Triage of TIA and minor Cerebrovascular Events to Identify High Risk Patients (CATCH) Study.

    Science.gov (United States)

    Coutts, Shelagh B; Modi, Jayesh; Patel, Shiel K; Aram, Heidi; Demchuk, Andrew M; Goyal, Mayank; Hill, Michael D

    2012-11-01

    Minor stroke and transient ischemic attack portend a significant risk of disability. Three possible mechanisms for this include disability not captured by the National Institutes of Health Stroke Scale, symptom progression, or recurrent stroke. We sought to assess the relative impact of these mechanisms on disability in a population of patients with transient ischemic attack and minor stroke. Five hundred ten consecutive minor stroke (National Institutes of Health Stroke Scalefour of 499 (15%; 95% CI, 12%-18%) patients had a disabled outcome. Baseline factors predicting disability were: age≥60 years, diabetes mellitus, premorbid modified Rankin Scale 1, ongoing symptoms, baseline National Institutes of Health Stroke Scale, CT/CT angiography-positive metric, and diffusion-weighted imaging positivity. In the multivariable analysis ongoing symptoms (OR, 2.4; 95% CI, 1.3-4.4; P=0.004), diabetes mellitus (OR, 2.3; 95% CI, 1.2-4.3; P=0.009), female sex (OR, 1.8; 95% CI, 1.1-3; P=0.025), and CT/CT angiography-positive metric (OR, 2.4; 95% CI, 1.4-4; P=0.001) predicted disability. Of the 463 patients who did not have a recurrent event, 55 were disabled (12%). By contrast 19 of 36 (53%) patients were disabled after a recurrent event (risk ratio, 4.4; 95% CI, 3-6.6; Pstroke become disabled. In terms of absolute numbers, most patients have disability as a result of their presenting event; however, recurrent events have the largest relative impact on outcome.

  15. The 1.1 Å resolution structure of a periplasmic phosphate-binding protein from Stenotrophomonas maltophilia: a crystallization contaminant identified by molecular replacement using the entire Protein Data Bank.

    Science.gov (United States)

    Keegan, Ronan; Waterman, David G; Hopper, David J; Coates, Leighton; Taylor, Graham; Guo, Jingxu; Coker, Alun R; Erskine, Peter T; Wood, Steve P; Cooper, Jonathan B

    2016-08-01

    During efforts to crystallize the enzyme 2,4-dihydroxyacetophenone dioxygenase (DAD) from Alcaligenes sp. 4HAP, a small number of strongly diffracting protein crystals were obtained after two years of crystal growth in one condition. The crystals diffracted synchrotron radiation to almost 1.0 Å resolution and were, until recently, assumed to be formed by the DAD protein. However, when another crystal form of this enzyme was eventually solved at lower resolution, molecular replacement using this new structure as the search model did not give a convincing solution with the original atomic resolution data set. Hence, it was considered that these crystals might have arisen from a protein impurity, although molecular replacement using the structures of common crystallization contaminants as search models again failed. A script to perform molecular replacement using MOLREP in which the first chain of every structure in the PDB was used as a search model was run on a multi-core cluster. This identified a number of prokaryotic phosphate-binding proteins as scoring highly in the MOLREP peak lists. Calculation of an electron-density map at 1.1 Å resolution based on the solution obtained with PDB entry 2q9t allowed most of the amino acids to be identified visually and built into the model. A BLAST search then indicated that the molecule was most probably a phosphate-binding protein from Stenotrophomonas maltophilia (UniProt ID B4SL31; gene ID Smal_2208), and fitting of the corresponding sequence to the atomic resolution map fully corroborated this. Proteins in this family have been linked to the virulence of antibiotic-resistant strains of pathogenic bacteria and with biofilm formation. The structure of the S. maltophilia protein has been refined to an R factor of 10.15% and an Rfree of 12.46% at 1.1 Å resolution. The molecule adopts the type II periplasmic binding protein (PBP) fold with a number of extensively elaborated loop regions. A fully dehydrated phosphate

  16. Fusion events

    International Nuclear Information System (INIS)

    Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.

    1998-01-01

    The fusion reactions between low energy heavy ions have a very high cross section. First measurements at energies around 30-40 MeV/nucleon indicated no residue of either complete or incomplete fusion, thus demonstrating the disappearance of this process. This is explained as being due to the high amount o energies transferred to the nucleus, what leads to its total dislocation in light fragments and particles. Exclusive analyses have permitted to mark clearly the presence of fusion processes in heavy systems at energies above 30-40 MeV/nucleon. Among the complete events of the Kr + Au reaction at 60 MeV/nucleon the majority correspond to binary collisions. Nevertheless, for the most considerable energy losses, a class of events do occur for which the detected fragments appears to be emitted from a unique source. These events correspond to an incomplete projectile-target fusion followed by a multifragmentation. Such events were singled out also in the reaction Xe + Sn at 50 MeV/nucleon. For the events in which the energy dissipation was maximal it was possible to isolate an isotropic group of events showing all the characteristics of fusion nuclei. The fusion is said to be incomplete as pre-equilibrium Z = 1 and Z = 2 particles are emitted. The cross section is of the order of 25 mb. Similar conclusions were drown for the systems 36 Ar + 27 Al and 64 Zn + nat Ti. A cross section value of ∼ 20 mb was determined at 55 MeV/nucleon in the first case, while the measurement of evaporation light residues in the last system gave an upper limit of 20-30 mb for the cross section at 50 MeV/nucleon

  17. Molecular Foundry

    Science.gov (United States)

    . New Study Indicates Greater Capacity for Carbon Storage in the Earth's Subsurface A team of Foundry minerals which make up the dominant clays in the Earth's deep subsurface. Doubling Down on Energy Storage identify molecular components within small volumes of biological samples, such as blood or urine. Industry

  18. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    2Staff Development Institute of CNTC, Zhengzhou, Henan 450008, People's Republic of China .... more strict selective constraint than others and none of high ω value ... (2007) description, M1a versus M2a is less power than M7 ... We failed to.

  19. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    Some large insertion fragments of NbeGGPS1 and NbeGGPS3 were deleted for more visibility. Three conserved motifs were located in the middle region of proteins and were conservative in all 25 sequences. Four positive selection sites were detected in N-terminal region of proteins that are labelled as red arrows.

  20. U-Pb baddeleyite ages and geochemistry of dolerite dykes in the Bas Drâa Inlier of the Anti-Atlas of Morocco: Newly identified 1380 Ma event in the West African Craton

    Science.gov (United States)

    El Bahat, Abdelhakim; Ikenne, Moha; Söderlund, Ulf; Cousens, Brian; Youbi, Nasrrddine; Ernst, Richard; Soulaimani, Abderrahmane; El Janati, M'hamed; Hafid, Ahmid

    2013-08-01

    In the Bas-Drâa Inlier (Anti-Atlas, Morocco), the Paleoproterozoic basement which is cut by the Ediacaran Taourgha granite is also crosscut by numerous dykes of a variety of trends, mostly of uncertain age. Two doleritic dykes are dated by the ID-TIMS U-Pb method on baddeleyite and yield emplacement ages of 1381 ± 8 Ma (MSWD = 0.84) and 1384 ± 6 Ma (MSWD = 1.4) determined for a N135°E and a N40°E trending dyke, respectively. These dates represent the first geochronological evidence of a Mesoproterozoic magmatic event in the Anti-Atlas. This magmatic event falls in the previously considered ca 1.7-1.0 Ga (Mesoproterozoic) gap in geological activity in the Anti-Atlas. The poorly dated Taghdout and Taarotihate sequences could represent remnants of the ca. 1380 Ma magmatism and rift-related sedimentation. The Mesoproterozoic sedimentary succession of the Atar Group in the Taoudeni basin (Mauritania) could also represent a good candidate for rift-related sedimentation but it postdates the 1380 Ma magmatic event by 270 Ma. The dated 1380 Ma dykes are transitional to mildly alkaline basalts, not unlike some Hawaiian lavas. However, these dykes have a distinct negative Nb anomaly (a common features in many Large Igneous Provinces, LIPs), and this requires interaction with the lithosphere. This interaction may have occurred at the level of the lithospheric mantle or the crust. These newly dated 1380 Ma dykes may converge to the north, speculatively suggesting a magmatic center (associated with a 1380 Ma mantle plume?) along the northern margin, and possibly linked to rifting and possible breakup on that margin, and also to a regional uplift that largely removed the evidence of a 1380 Ma cover sequence. Contemporaneous 1380-1390 Ma magmatism is reported elsewhere on other crustal blocks, and that in northeastern Laurentia (northern Greenland), northern Siberia (Anabar shield), and Baltica (southern Urals) can be reconstructed with that of the Bas Drâa Inlier (Anti

  1. Molecular genetics of craniosynostosis

    Science.gov (United States)

    Caterine; Auerkari, Elza Ibrahim

    2018-03-01

    Tight regulation process and complex interplay occur along the osteogenic interfaces of the cranial sutures in normal growth and development of the skull. Cranial sutures serve as sites of bone growth while maintaining a state of patency to accommodate the developing brain. Cranial sutures are fibro-cellular structures that separate the rigid plates of the skull bones. Premature fusion of one or more cranial sutures leads to a condition known as craniosynostosis. Craniosynostosis is one of the most common craniofacial anomalies with a prevalence of 1 in 2,500 newborns. Several genes have been identified in the pathogenesis of craniosynostosis. Molecular signaling events and the intracellular signal transduction pathways implicated in the suture pathobiology will provide a useful approach for therapeutic targeting.

  2. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    Directory of Open Access Journals (Sweden)

    Abadie Jerome

    2011-05-01

    Full Text Available Abstract Background Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Methods Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Results Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. Conclusions The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model

  4. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    International Nuclear Information System (INIS)

    Hedan, Benoit; Thomas, Rachael; Motsinger-Reif, Alison; Abadie, Jerome; Andre, Catherine; Cullen, John; Breen, Matthew

    2011-01-01

    Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS) is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs) that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model for the human counterpart, providing additional evidence towards

  5. Event Index - a LHCb Event Search System

    CERN Document Server

    INSPIRE-00392208; Kazeev, Nikita; Redkin, Artem

    2015-12-23

    LHC experiments generate up to $10^{12}$ events per year. This paper describes Event Index - an event search system. Event Index's primary function is quickly selecting subsets of events from a combination of conditions, such as the estimated decay channel or stripping lines output. Event Index is essentially Apache Lucene optimized for read-only indexes distributed over independent shards on independent nodes.

  6. An open-label randomized controlled trial of low molecular weight heparin compared to heparin and coumadin for the treatment of venous thromboembolic events in children: the REVIVE trial.

    Science.gov (United States)

    Massicotte, Patricia; Julian, Jim A; Gent, Michael; Shields, Karen; Marzinotto, Velma; Szechtman, Barbara; Andrew, Maureen

    2003-01-25

    Venous thromboembolic events (VTE) are serious complications in children and for which the standard of care, unfractionated heparin followed by oral anticoagulation (UFH/OA), is problematic. The objective of REVIVE was to compare the efficacy and safety of a low molecular weight heparin (reviparin-sodium) to UFH/OA for the treatment of VTE in children. This multicenter, open-label study, with blinded central outcome adjudication, randomized patients with objectively confirmed VTE to receive either reviparin-sodium or UFH/OA. Dose adjustments were made using nomograms. The efficacy outcome was based on recurrent VTE and death due to VTE during the 3-month treatment period. The safety outcomes were major bleeding, minor bleeding and death. Due to slow patient accrual, REVIVE was closed prematurely. At 3 months, with reviparin-sodium, 2/36 patients (5.6%) had recurrent VTE or death compared to 4/40 patients (10.0%) receiving UFH/OA (odds ratio=0.53; 95% CI=(0.05, 4.00); Fisher's exact test: 2P=0.677). There were 7 major bleeds, 2/36 (5.6%) in the reviparin-sodium group and 5/40 (12.5%) in UFH/OA group (odds ratio=0.41; 95% confidence interval 0.04, 2.76); Fisher's exact test: P=0.435). There were 5 deaths during the study period, 1 (2.8%) in the reviparin-sodium group and 4 (10.0%) in the UFH/OA group. All five deaths were unrelated to VTE but one was due to an intracranial hemorrhage in the UFH/OA group. Although limited by small sample size, REVIVE provides valuable information on the incidence of recurrent VTE, major bleeding and problematic issues associated with therapy of VTE in children.

  7. Simulating events

    Energy Technology Data Exchange (ETDEWEB)

    Ferretti, C; Bruzzone, L [Techint Italimpianti, Milan (Italy)

    2000-06-01

    The Petacalco Marine terminal on the Pacific coast in the harbour of Lazaro Carclenas (Michoacan) in Mexico, provides coal to the thermoelectric power plant at Pdte Plutarco Elias Calles in the port area. The plant is being converted from oil to burn coal to generate 2100 MW of power. The article describes the layout of the terminal and equipment employed in the unloading, coal stacking, coal handling areas and the receiving area at the power plant. The contractor Techint Italimpianti has developed a software system, MHATIS, for marine terminal management which is nearly complete. The discrete event simulator with its graphic interface provides a real-type decision support system for simulating changes to the terminal operations and evaluating impacts. The article describes how MHATIS is used. 7 figs.

  8. Genetic and molecular risk factors within the newly identified primate-specific exon of the SAP97/DLG1 gene in the 3q29 schizophrenia-associated locus.

    Science.gov (United States)

    Uezato, Akihito; Yamamoto, Naoki; Jitoku, Daisuke; Haramo, Emiko; Hiraaki, Eri; Iwayama, Yoshimi; Toyota, Tomoko; Umino, Masakazu; Umino, Asami; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Hashimoto, Tasuku; Kanahara, Nobuhisa; Kurumaji, Akeo; Yoshikawa, Takeo; Nishikawa, Toru

    2017-12-01

    The synapse-associated protein 97/discs, large homolog 1 of Drosophila (DLG1) gene encodes synaptic scaffold PDZ proteins interacting with ionotropic glutamate receptors including the N-methyl-D-aspartate type glutamate receptor (NMDAR) that is presumed to be hypoactive in brains of patients with schizophrenia. The DLG1 gene resides in the chromosomal position 3q29, the microdeletion of which confers a 40-fold increase in the risk for schizophrenia. In the present study, we performed genetic association analyses for DLG1 gene using a Japanese cohort with 1808 schizophrenia patients and 2170 controls. We detected an association which remained significant after multiple comparison testing between schizophrenia and the single nucleotide polymorphism (SNP) rs3915512 that is located within the newly identified primate-specific exon (exon 3b) of the DLG1 gene and constitutes the exonic splicing enhancer sequence. When stratified by onset age, although it did not survive multiple comparisons, the association was observed in non-early onset schizophrenia, whose onset-age selectivity is consistent with our recent postmortem study demonstrating a decrease in the expression of the DLG1 variant in early-onset schizophrenia. Although the present study did not demonstrate the previously reported association of the SNP rs9843659 by itself, a meta-analysis revealed a significant association between DLG1 gene and schizophrenia. These findings provide a valuable clue for molecular mechanisms on how genetic variations in the primate-specific exon of the gene in the schizophrenia-associated 3q29 locus affect its regulation in the glutamate system and lead to the disease onset around a specific stage of brain development. © 2017 Wiley Periodicals, Inc.

  9. Transcriptional profiling reveals molecular signatures associated with HIV permissiveness in Th1Th17 cells and identifies Peroxisome Proliferator-Activated Receptor Gamma as an intrinsic negative regulator of viral replication

    Science.gov (United States)

    2013-01-01

    Background We previously demonstrated that primary Th1Th17 cells are highly permissive to HIV-1, whereas Th1 cells are relatively resistant. Molecular mechanisms underlying these differences remain unknown. Results Exposure to replication competent and single-round VSV-G pseudotyped HIV strains provide evidence that superior HIV replication in Th1Th17 vs. Th1 cells was regulated by mechanisms located at entry and post-entry levels. Genome-wide transcriptional profiling identified transcripts upregulated (n = 264) and downregulated (n = 235) in Th1Th17 vs. Th1 cells (p-value Th17 (nuclear receptors, trafficking, p38/MAPK, NF-κB, p53/Ras, IL-23) vs. Th1 cells (proteasome, interferon α/β). Differentially expressed genes were classified into biological categories using Gene Ontology. Th1Th17 cells expressed typical Th17 markers (IL-17A/F, IL-22, CCL20, RORC, IL-26, IL-23R, CCR6) and transcripts functionally linked to regulating cell trafficking (CEACAM1, MCAM), activation (CD28, CD40LG, TNFSF13B, TNFSF25, PTPN13, MAP3K4, LTB, CTSH), transcription (PPARγ, RUNX1, ATF5, ARNTL), apoptosis (FASLG), and HIV infection (CXCR6, FURIN). Differential expression of CXCR6, PPARγ, ARNTL, PTPN13, MAP3K4, CTSH, SERPINB6, PTK2, and ISG20 was validated by RT-PCR, flow cytometry and/or confocal microscopy. The nuclear receptor PPARγ was preferentially expressed by Th1Th17 cells. PPARγ RNA interference significantly increased HIV replication at levels post-entry and prior HIV-DNA integration. Finally, the activation of PPARγ pathway via the agonist Rosiglitazone induced the nuclear translocation of PPARγ and a robust inhibition of viral replication. Conclusions Thus, transcriptional profiling in Th1Th17 vs. Th1 cells demonstrated that HIV permissiveness is associated with a superior state of cellular activation and limited antiviral properties and identified PPARγ as an intrinsic negative regulator of viral replication. Therefore, triggering PPARγ pathway via non

  10. Detection of anomalous events

    Science.gov (United States)

    Ferragut, Erik M.; Laska, Jason A.; Bridges, Robert A.

    2016-06-07

    A system is described for receiving a stream of events and scoring the events based on anomalousness and maliciousness (or other classification). The system can include a plurality of anomaly detectors that together implement an algorithm to identify low-probability events and detect atypical traffic patterns. The anomaly detector provides for comparability of disparate sources of data (e.g., network flow data and firewall logs.) Additionally, the anomaly detector allows for regulatability, meaning that the algorithm can be user configurable to adjust a number of false alerts. The anomaly detector can be used for a variety of probability density functions, including normal Gaussian distributions, irregular distributions, as well as functions associated with continuous or discrete variables.

  11. Events diary

    Science.gov (United States)

    2000-01-01

    as Imperial College, the Royal Albert Hall, the Royal College of Art, the Natural History and Science Museums and the Royal Geographical Society. Under the heading `Shaping the future together' BA2000 will explore science, engineering and technology in their wider cultural context. Further information about this event on 6 - 12 September may be obtained from Sandra Koura, BA2000 Festival Manager, British Association for the Advancement of Science, 23 Savile Row, London W1X 2NB (tel: 0171 973 3075, e-mail: sandra.koura@britassoc.org.uk ). Details of the creating SPARKS events may be obtained from creating.sparks@britassoc.org.uk or from the website www.britassoc.org.uk . Other events 3 - 7 July, Porto Alegre, Brazil VII Interamerican conference on physics education: The preparation of physicists and physics teachers in contemporary society. Info: IACPE7@if.ufrgs.br or cabbat1.cnea.gov.ar/iacpe/iacpei.htm 27 August - 1 September, Barcelona, Spain GIREP conference: Physics teacher education beyond 2000. Info: www.blues.uab.es/phyteb/index.html

  12. Geophysical events

    Science.gov (United States)

    This is a summary of SEAN Bulletin, 13(3), March 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-002 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid.

  13. MadEvent: automatic event generation with MadGraph

    International Nuclear Information System (INIS)

    Maltoni, Fabio; Stelzer, Tim

    2003-01-01

    We present a new multi-channel integration method and its implementation in the multi-purpose event generator MadEvent, which is based on MadGraph. Given a process, MadGraph automatically identifies all the relevant subprocesses, generates both the amplitudes and the mappings needed for an efficient integration over the phase space, and passes them to MadEvent. As a result, a process-specific, stand-alone code is produced that allows the user to calculate cross sections and produce unweighted events in a standard output format. Several examples are given for processes that are relevant for physics studies at present and forthcoming colliders. (author)

  14. Molecular diagnostics of myeloproliferative neoplasms.

    Science.gov (United States)

    Langabeer, Stephen E; Andrikovics, Hajnalka; Asp, Julia; Bellosillo, Beatriz; Carillo, Serge; Haslam, Karl; Kjaer, Lasse; Lippert, Eric; Mansier, Olivier; Oppliger Leibundgut, Elisabeth; Percy, Melanie J; Porret, Naomi; Palmqvist, Lars; Schwarz, Jiri; McMullin, Mary F; Schnittger, Susanne; Pallisgaard, Niels; Hermouet, Sylvie

    2015-10-01

    Since the discovery of the JAK2 V617F mutation in the majority of the myeloproliferative neoplasms (MPN) of polycythemia vera, essential thrombocythemia and primary myelofibrosis ten years ago, further MPN-specific mutational events, notably in JAK2 exon 12, MPL exon 10 and CALR exon 9 have been identified. These discoveries have been rapidly incorporated into evolving molecular diagnostic algorithms. Whilst many of these mutations appear to have prognostic implications, establishing MPN diagnosis is of immediate clinical importance with selection, implementation and the continual evaluation of the appropriate laboratory methodology to achieve this diagnosis similarly vital. The advantages and limitations of these approaches in identifying and quantitating the common MPN-associated mutations are considered herein with particular regard to their clinical utility. The evolution of molecular diagnostic applications and platforms has occurred in parallel with the discovery of MPN-associated mutations, and it therefore appears likely that emerging technologies such as next-generation sequencing and digital PCR will in the future play an increasing role in the molecular diagnosis of MPN. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Characterization of GM events by insert knowledge adapted re-sequencing approaches.

    Science.gov (United States)

    Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing

    2013-10-03

    Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events.

  16. Recurring events - Volume 2

    International Nuclear Information System (INIS)

    2003-04-01

    known, thus the actions taken were not effective in preventing recurrence of an event, - The contributing factors or causes of the event were not taken into account in defining the actions to be taken. Several good practices were identified to prevent recurring events. These practices are part of related guides provided by national and international bodies. Some of these are: - NPPs should analyse recurring events in-depth, in order to identify root causes and contributing factors to prevent further recurrence. The specific factors that failed to prevent recurrence should be investigated and identified (that is, why prior operating experience was not effectively applied). - For minor events, trend analyses should be performed to monitor the frequency of component failures (which may be unavoidable) or the frequency of minor human performance problems (which may indicate weaknesses in error prevention processes and programs). - Analysis of external operating experiences from other NPPs should be strengthened to broaden the basis for preventive measures; - Actions taken after events should be assessed regarding their effectiveness in preventing recurrence of similar events. Subsequent to the workshop, a more detailed search of reports of operating experience, including IRS and other reports from national sources, resulted in the determination of a number of recurring categories: - Loss of RHR at mid-loop (in the 1999 report also); - BWR instability (in the 1999 report also); - PWR vessel corrosion due to boric acid effects; - Hydrogen detonation in BWR piping; - Steam Generator Tube Rupture; - Multiple valve failures in ECCS; - Service Water Failure due to Marine Biofouling (in the 1999 report also); - System Level Failures with Human Factors Considerations; - Strainer Clogging (sources of emergency injection or recirculation). Five conclusions were established on the basis of the workshop and the recurring event analysis: Conclusion 1: Recurring events continue to be

  17. Data Mining FAERS to Analyze Molecular Targets of Drugs Highly Associated with Stevens-Johnson Syndrome.

    Science.gov (United States)

    Burkhart, Keith K; Abernethy, Darrell; Jackson, David

    2015-06-01

    Drug features that are associated with Stevens-Johnson syndrome (SJS) have not been fully characterized. A molecular target analysis of the drugs associated with SJS in the FDA Adverse Event Reporting System (FAERS) may contribute to mechanistic insights into SJS pathophysiology. The publicly available version of FAERS was analyzed to identify disproportionality among the molecular targets, metabolizing enzymes, and transporters for drugs associated with SJS. The FAERS in-house version was also analyzed for an internal comparison of the drugs most highly associated with SJS. Cyclooxygenases 1 and 2, carbonic anhydrase 2, and sodium channel 2 alpha were identified as disproportionately associated with SJS. Cytochrome P450 (CYPs) 3A4 and 2C9 are disproportionately represented as metabolizing enzymes of the drugs associated with SJS adverse event reports. Multidrug resistance protein 1 (MRP-1), organic anion transporter 1 (OAT1), and PEPT2 were also identified and are highly associated with the transport of these drugs. A detailed review of the molecular targets identifies important roles for these targets in immune response. The association with CYP metabolizing enzymes suggests that reactive metabolites and oxidative stress may have a contributory role. Drug transporters may enhance intracellular tissue concentrations and also have vital physiologic roles that impact keratinocyte proliferation and survival. Data mining FAERS may be used to hypothesize mechanisms for adverse drug events by identifying molecular targets that are highly associated with drug-induced adverse events. The information gained may contribute to systems biology disease models.

  18. Data Mining FAERS to Analyze Molecular Targets of Drugs Highly Associated with Stevens-Johnson Syndrome

    OpenAIRE

    Burkhart, Keith K.; Abernethy, Darrell; Jackson, David

    2015-01-01

    Drug features that are associated with Stevens-Johnson syndrome (SJS) have not been fully characterized. A molecular target analysis of the drugs associated with SJS in the FDA Adverse Event Reporting System (FAERS) may contribute to mechanistic insights into SJS pathophysiology. The publicly available version of FAERS was analyzed to identify disproportionality among the molecular targets, metabolizing enzymes, and transporters for drugs associated with SJS. The FAERS in-house version was al...

  19. Global Microbial Identifier

    DEFF Research Database (Denmark)

    Wielinga, Peter; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2017-01-01

    ) will likely also enable a much better understanding of the pathogenesis of the infection and the molecular basis of the host response to infection. But the full potential of these advances will only transpire if the data in this area become transferable and thereby comparable, preferably in open-source...... of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect outbreaks and emerging pathogens. To harness the full potential of WGS, a shared global database of genomes linked to relevant metadata and the necessary software tools needs to be generated, hence the global...... microbial identifier (GMI) initiative. This tool will ideally be used in amongst others in the diagnosis of infectious diseases in humans and animals, in the identification of microorganisms in food and environment, and to track and trace microbial agents in all arenas globally. This will require...

  20. Vaccine Adverse Events

    Science.gov (United States)

    ... for Biologics Evaluation & Research Vaccine Adverse Events Vaccine Adverse Events Share Tweet Linkedin Pin it More sharing ... in the primary immunization series in infants Report Adverse Event Report a Vaccine Adverse Event Contact FDA ( ...

  1. Identifying high-risk medication

    DEFF Research Database (Denmark)

    Sædder, Eva; Brock, Birgitte; Nielsen, Lars Peter

    2014-01-01

    salicylic acid, and beta-blockers; 30 drugs or drug classes caused 82 % of all serious MEs. The top ten drugs involved in fatal events accounted for 73 % of all drugs identified. CONCLUSION: Increasing focus on seven drugs/drug classes can potentially reduce hospitalizations, extended hospitalizations...

  2. An evaluation of a diagnostic test to identify the sex of farmed rainbow trout, using sex-specific molecular markers Evaluación de un test diagnóstico para identificar el sexo en truchas arcoíris por medio de marcadores moleculares específicos

    Directory of Open Access Journals (Sweden)

    María E López

    2012-11-01

    Full Text Available In trout farming males exhibits lower growth rate and precocious sexual maturation in contrast to females. Since these traits are detrimental for intensive production, all females populations are most appreciated by fish farmers. Molecular markers sex-specific have been developed for rainbow trout that can be useful to diagnose the phenotypic sex of individuals. We evaluated the use of two SCAR markers (OmyP9 & Omy163, which show polymorphisms between males and females in rainbow trout as a diagnostic test for sexing farmed trout. Adult trout (n = 131 were genotyped to assess the association of the SCAR markers with phenotypic sex. To evaluate the correct performance of the SCAR marker in sex diagnosis, each marker and both were analyzed to estimate its specificity (the proportion of males that are correctly identified, sensitivity (the proportion of females that are correctly identified and predictive value (the probability of the correct positive or negative female identification. Significant associations with phenotypic sex of both SCAR markers with sex were found. The sensitivity and predictive (positive and negative indexes show higher values when both SCAR markers were considered (95.7, 77.4 and 94.4%, respectively. For joined SCAR markers a likelihood ratio (LR+ of 3.43 was obtained indicating its utility to establish a diagnostic test for sexing trout by use of marker-based analysis.En el cultivo de truchas los individuos del sexo masculino presentan menor tasa de crecimiento y maduración sexual precoz, características que no presentan las hembras. Debido a estos rasgos indeseables para el cultivo intensivo, el uso de poblaciones todo hembra es una práctica habitual en el cultivo de truchas. Para trucha arcoíris se han desarrollado marcadores moleculares sexo específico que pueden utilizarse en el diagnóstico temprano del sexo, en condiciones de cultivo. Se evaluó la aplicación de dos marcadores SCAR (OmyP9 y Omy163, que muestran

  3. Genome wide identification of aberrant alternative splicing events in myotonic dystrophy type 2.

    Science.gov (United States)

    Perfetti, Alessandra; Greco, Simona; Fasanaro, Pasquale; Bugiardini, Enrico; Cardani, Rosanna; Garcia-Manteiga, Jose M; Manteiga, Jose M Garcia; Riba, Michela; Cittaro, Davide; Stupka, Elia; Meola, Giovanni; Martelli, Fabio

    2014-01-01

    Myotonic dystrophy type 2 (DM2) is a genetic, autosomal dominant disease due to expansion of tetraplet (CCTG) repetitions in the first intron of the ZNF9/CNBP gene. DM2 is a multisystemic disorder affecting the skeletal muscle, the heart, the eye and the endocrine system. According to the proposed pathological mechanism, the expanded tetraplets have an RNA toxic effect, disrupting the splicing of many mRNAs. Thus, the identification of aberrantly spliced transcripts is instrumental for our understanding of the molecular mechanisms underpinning the disease. The aim of this study was the identification of new aberrant alternative splicing events in DM2 patients. By genome wide analysis of 10 DM2 patients and 10 controls (CTR), we identified 273 alternative spliced exons in 218 genes. While many aberrant splicing events were already identified in the past, most were new. A subset of these events was validated by qPCR assays in 19 DM2 and 15 CTR subjects. To gain insight into the molecular pathways involving the identified aberrantly spliced genes, we performed a bioinformatics analysis with Ingenuity system. This analysis indicated a deregulation of development, cell survival, metabolism, calcium signaling and contractility. In conclusion, our genome wide analysis provided a database of aberrant splicing events in the skeletal muscle of DM2 patients. The affected genes are involved in numerous pathways and networks important for muscle physio-pathology, suggesting that the identified variants may contribute to DM2 pathogenesis.

  4. Topology of Event Horizon

    OpenAIRE

    Siino, Masaru

    1997-01-01

    The topologies of event horizons are investigated. Considering the existence of the endpoint of the event horizon, it cannot be differentiable. Then there are the new possibilities of the topology of the event horizon though they are excluded in smooth event horizons. The relation between the topology of the event horizon and the endpoint of it is revealed. A torus event horizon is caused by two-dimensional endpoints. One-dimensional endpoints provide the coalescence of spherical event horizo...

  5. Trending analysis of precursor events

    International Nuclear Information System (INIS)

    Watanabe, Norio

    1998-01-01

    The Accident Sequence Precursor (ASP) Program of United States Nuclear Regulatory Commission (U.S.NRC) identifies and categorizes operational events at nuclear power plants in terms of the potential for core damage. The ASP analysis has been performed on yearly basis and the results have been published in the annual reports. This paper describes the trends in initiating events and dominant sequences for 459 precursors identified in the ASP Program during the 1969-94 period and also discusses a comparison with dominant sequences predicted in the past Probabilistic Risk Assessment (PRA) studies. These trends were examined for three time periods, 1969-81, 1984-87 and 1988-94. Although the different models had been used in the ASP analyses for these three periods, the distribution of precursors by dominant sequences show similar trends to each other. For example, the sequences involving loss of both main and auxiliary feedwater were identified in many PWR events and those involving loss of both high and low coolant injection were found in many BWR events. Also, it was found that these dominant sequences were comparable to those determined to be dominant in the predictions by the past PRAs. As well, a list of the 459 precursors identified are provided in Appendix, indicating initiating event types, unavailable systems, dominant sequences, conditional core damage probabilities, and so on. (author)

  6. Event segmentation ability uniquely predicts event memory.

    Science.gov (United States)

    Sargent, Jesse Q; Zacks, Jeffrey M; Hambrick, David Z; Zacks, Rose T; Kurby, Christopher A; Bailey, Heather R; Eisenberg, Michelle L; Beck, Taylor M

    2013-11-01

    Memory for everyday events plays a central role in tasks of daily living, autobiographical memory, and planning. Event memory depends in part on segmenting ongoing activity into meaningful units. This study examined the relationship between event segmentation and memory in a lifespan sample to answer the following question: Is the ability to segment activity into meaningful events a unique predictor of subsequent memory, or is the relationship between event perception and memory accounted for by general cognitive abilities? Two hundred and eight adults ranging from 20 to 79years old segmented movies of everyday events and attempted to remember the events afterwards. They also completed psychometric ability tests and tests measuring script knowledge for everyday events. Event segmentation and script knowledge both explained unique variance in event memory above and beyond the psychometric measures, and did so as strongly in older as in younger adults. These results suggest that event segmentation is a basic cognitive mechanism, important for memory across the lifespan. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Event-by-Event Identified Particle Ratio Fluctuations in Pb–Pb Collisions with ALICE

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00245664

    ALICE is the dedicated heavy-ion experiment among the experiments at the LHC at CERN. It is, in particular, designed to exploit the physics of strongly interacting matter. The theory of strong interactions, Quantum Chromodynamics (QCD), predicts that at sufficiently high energy densities nuclear matter transforms into a deconfined state of quarks and gluons. One of the possible signatures of a transition between hadronic and partonic phases is the enhancement of fluctuations of the number of particles in the hadronic final state of relativistic heavy-ion collisions. \\\\ \\\\ The observable $\

  8. Molecular ion photofragment spectroscopy

    International Nuclear Information System (INIS)

    Bustamente, S.W.

    1983-11-01

    A new molecular ion photofragment spectrometer is described which features a supersonic molecular beam ion source and a radio frequency octapole ion trap interaction region. This unique combination allows several techniques to be applied to the problem of detecting a photon absorption event of a molecular ion. In particular, it may be possible to obtain low resolution survey spectra of exotic molecular ions by using a direct vibrational predissociation process, or by using other more indirect detection methods. The use of the spectrometer is demonstrated by measuring the lifetime of the O 2 + ( 4 π/sub u/) metastable state which is found to consist of two main components: the 4 π/sub 5/2/ and 4 π/sub -1/2/ spin components having a long lifetime (approx. 129 ms) and the 4 π/sub 3/2/ and 4 π/sub 1/2/ spin components having a short lifetime (approx. 6 ms)

  9. MGR External Events Hazards Analysis

    International Nuclear Information System (INIS)

    Booth, L.

    1999-01-01

    The purpose and objective of this analysis is to apply an external events Hazards Analysis (HA) to the License Application Design Selection Enhanced Design Alternative 11 [(LADS EDA II design (Reference 8.32))]. The output of the HA is called a Hazards List (HL). This analysis supersedes the external hazards portion of Rev. 00 of the PHA (Reference 8.1). The PHA for internal events will also be updated to the LADS EDA II design but under a separate analysis. Like the PHA methodology, the HA methodology provides a systematic method to identify potential hazards during the 100-year Monitored Geologic Repository (MGR) operating period updated to reflect the EDA II design. The resulting events on the HL are candidates that may have potential radiological consequences as determined during Design Basis Events (DBEs) analyses. Therefore, the HL that results from this analysis will undergo further screening and analysis based on the criteria that apply during the performance of DBE analyses

  10. Magnetismo Molecular (Molecular Magentism)

    Energy Technology Data Exchange (ETDEWEB)

    Reis, Mario S [Universidade Federal Fluminense, Brasil; Moreira Dos Santos, Antonio F [ORNL

    2010-07-01

    The new synthesis processes in chemistry open a new world of research, new and surprising materials never before found in nature can now be synthesized and, as a wonderful result, observed a series of physical phenomena never before imagined. Among these are many new materials the molecular magnets, the subject of this book and magnetic properties that are often reflections of the quantum behavior of these materials. Aside from the wonderful experience of exploring something new, the theoretical models that describe the behavior these magnetic materials are, in most cases, soluble analytically, which allows us to know in detail the physical mechanisms governing these materials. Still, the academic interest in parallel this subject, these materials have a number of properties that are promising to be used in technological devices, such as in computers quantum magnetic recording, magnetocaloric effect, spintronics and many other devices. This volume will journey through the world of molecular magnets, from the structural description of these materials to state of the art research.

  11. Event dependent sampling of recurrent events

    DEFF Research Database (Denmark)

    Kvist, Tine Kajsa; Andersen, Per Kragh; Angst, Jules

    2010-01-01

    The effect of event-dependent sampling of processes consisting of recurrent events is investigated when analyzing whether the risk of recurrence increases with event count. We study the situation where processes are selected for study if an event occurs in a certain selection interval. Motivation...... retrospective and prospective disease course histories are used. We examine two methods to correct for the selection depending on which data are used in the analysis. In the first case, the conditional distribution of the process given the pre-selection history is determined. In the second case, an inverse...

  12. Parameter trajectory analysis to identify treatment effects of pharmacological interventions.

    Directory of Open Access Journals (Sweden)

    Christian A Tiemann

    Full Text Available The field of medical systems biology aims to advance understanding of molecular mechanisms that drive disease progression and to translate this knowledge into therapies to effectively treat diseases. A challenging task is the investigation of long-term effects of a (pharmacological treatment, to establish its applicability and to identify potential side effects. We present a new modeling approach, called Analysis of Dynamic Adaptations in Parameter Trajectories (ADAPT, to analyze the long-term effects of a pharmacological intervention. A concept of time-dependent evolution of model parameters is introduced to study the dynamics of molecular adaptations. The progression of these adaptations is predicted by identifying necessary dynamic changes in the model parameters to describe the transition between experimental data obtained during different stages of the treatment. The trajectories provide insight in the affected underlying biological systems and identify the molecular events that should be studied in more detail to unravel the mechanistic basis of treatment outcome. Modulating effects caused by interactions with the proteome and transcriptome levels, which are often less well understood, can be captured by the time-dependent descriptions of the parameters. ADAPT was employed to identify metabolic adaptations induced upon pharmacological activation of the liver X receptor (LXR, a potential drug target to treat or prevent atherosclerosis. The trajectories were investigated to study the cascade of adaptations. This provided a counter-intuitive insight concerning the function of scavenger receptor class B1 (SR-B1, a receptor that facilitates the hepatic uptake of cholesterol. Although activation of LXR promotes cholesterol efflux and -excretion, our computational analysis showed that the hepatic capacity to clear cholesterol was reduced upon prolonged treatment. This prediction was confirmed experimentally by immunoblotting measurements of SR-B1

  13. Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

    Directory of Open Access Journals (Sweden)

    Victor M. Bii

    2016-10-01

    Full Text Available Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types.

  14. Event generators for address event representation transmitters

    Science.gov (United States)

    Serrano-Gotarredona, Rafael; Serrano-Gotarredona, Teresa; Linares Barranco, Bernabe

    2005-06-01

    Address Event Representation (AER) is an emergent neuromorphic interchip communication protocol that allows for real-time virtual massive connectivity between huge number neurons located on different chips. By exploiting high speed digital communication circuits (with nano-seconds timings), synaptic neural connections can be time multiplexed, while neural activity signals (with mili-seconds timings) are sampled at low frequencies. Also, neurons generate 'events' according to their activity levels. More active neurons generate more events per unit time, and access the interchip communication channel more frequently, while neurons with low activity consume less communication bandwidth. In a typical AER transmitter chip, there is an array of neurons that generate events. They send events to a peripheral circuitry (let's call it "AER Generator") that transforms those events to neurons coordinates (addresses) which are put sequentially on an interchip high speed digital bus. This bus includes a parallel multi-bit address word plus a Rqst (request) and Ack (acknowledge) handshaking signals for asynchronous data exchange. There have been two main approaches published in the literature for implementing such "AER Generator" circuits. They differ on the way of handling event collisions coming from the array of neurons. One approach is based on detecting and discarding collisions, while the other incorporates arbitration for sequencing colliding events . The first approach is supposed to be simpler and faster, while the second is able to handle much higher event traffic. In this article we will concentrate on the second arbiter-based approach. Boahen has been publishing several techniques for implementing and improving the arbiter based approach. Originally, he proposed an arbitration squeme by rows, followed by a column arbitration. In this scheme, while one neuron was selected by the arbiters to transmit his event out of the chip, the rest of neurons in the array were

  15. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  16. Event-by-event jet quenching

    Energy Technology Data Exchange (ETDEWEB)

    Fries, R.J.; Rodriguez, R.; Ramirez, E.

    2010-08-14

    High momentum jets and hadrons can be used as probes for the quark gluon plasma (QGP) formed in nuclear collisions at high energies. We investigate the influence of fluctuations in the fireball on jet quenching observables by comparing propagation of light quarks and gluons through averaged, smooth QGP fireballs with event-by-event jet quenching using realistic inhomogeneous fireballs. We find that the transverse momentum and impact parameter dependence of the nuclear modification factor R{sub AA} can be fit well in an event-by-event quenching scenario within experimental errors. However the transport coefficient {cflx q} extracted from fits to the measured nuclear modification factor R{sub AA} in averaged fireballs underestimates the value from event-by-event calculations by up to 50%. On the other hand, after adjusting {cflx q} to fit R{sub AA} in the event-by-event analysis we find residual deviations in the azimuthal asymmetry v{sub 2} and in two-particle correlations, that provide a possible faint signature for a spatial tomography of the fireball. We discuss a correlation function that is a measure for spatial inhomogeneities in a collision and can be constrained from data.

  17. Event-by-event jet quenching

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, R. [Cyclotron Institute and Physics Department, Texas A and M University, College Station, TX 77843 (United States); Fries, R.J., E-mail: rjfries@comp.tamu.ed [Cyclotron Institute and Physics Department, Texas A and M University, College Station, TX 77843 (United States); RIKEN/BNL Research Center, Brookhaven National Laboratory, Upton, NY 11973 (United States); Ramirez, E. [Physics Department, University of Texas El Paso, El Paso, TX 79968 (United States)

    2010-09-27

    High momentum jets and hadrons can be used as probes for the quark gluon plasma (QGP) formed in nuclear collisions at high energies. We investigate the influence of fluctuations in the fireball on jet quenching observables by comparing propagation of light quarks and gluons through averaged, smooth QGP fireballs with event-by-event jet quenching using realistic inhomogeneous fireballs. We find that the transverse momentum and impact parameter dependence of the nuclear modification factor R{sub AA} can be fit well in an event-by-event quenching scenario within experimental errors. However the transport coefficient q extracted from fits to the measured nuclear modification factor R{sub AA} in averaged fireballs underestimates the value from event-by-event calculations by up to 50%. On the other hand, after adjusting q to fit R{sub AA} in the event-by-event analysis we find residual deviations in the azimuthal asymmetry v{sub 2} and in two-particle correlations, that provide a possible faint signature for a spatial tomography of the fireball. We discuss a correlation function that is a measure for spatial inhomogeneities in a collision and can be constrained from data.

  18. Event-by-event fluctuations at SPS

    CERN Document Server

    Appelshauser, Harald; Adamova, D.; Agakichiev, G.; Belaga, V.; Braun-Munzinger, P.; Castillo, A.; Cherlin, A.; Damjanovic, S.; Dietel, T.; Dietrich, L.; Drees, A.; Esumi, S.I.; Filimonov, K.; Fomenko, K.; Fraenkel, Z.; Garabatos, C.; Glassel, P.; Hering, G.; Holeczek, J.; Kushpil, V.; Lenkeit, B.; Ludolphs, W.; Maas, A.; Marn, A.; Milosevic, J.; Milov, A.; Miskowiec, D.; Panebrattsev, Yu.; Petchenova, O.; Petracek, V.; Pfeiffer, A.; Rak, J.; Ravinovich, I.; Rehak, P.; Schmitz, W.; Schukraft, J.; Sedykh, S.; Shimansky, S.; Slvova, J.; Stachel, J.; Sumbera, M.; Tilsner, H.; Tserruya, Itzhak; Wessels, J.P.; Wienold, T.; Windelband, B.; Wurm, J.P.; Xie, W.; Yurevich, S.; Yurevich, V.; Appelshauser, Harald; Sako, Hiro

    2005-01-01

    Results on event-by-event fluctuations of the mean transverse momentum and net charge in Pb-Au collisions, measured by the CERES Collaboration at CERN-SPS, are presented. We discuss the centrality and beam energy dependence and compare our data to cascade calculations.

  19. Molecular modeling, dynamics studies and density functional theory approaches to identify potential inhibitors of SIRT4 protein from Homo sapiens : a novel target for the treatment of type 2 diabetes.

    Science.gov (United States)

    Choubey, Sanjay K; Prabhu, Dhamodharan; Nachiappan, Mutharasappan; Biswal, Jayshree; Jeyakanthan, Jeyaraman

    2017-11-01

    Type 2 diabetes is one of the biggest health challenges in the world and WHO projects it to be the 7th leading cause of death in 2030. It is a chronic condition affecting the way our body metabolizes sugar. Insulin resistance is high risk factor marked by expression of Lipoprotein Lipases and Peroxisome Proliferator-Activated Receptor that predisposes to type 2 diabetes. AMP-dependent protein kinase in AMPK signaling pathway is a central sensor of energy status. Deregulation of AMPK signaling leads to inflammation, oxidative stress, and deactivation of autophagy which are implicated in pathogenesis of insulin resistance. SIRT4 protein deactivates AMPK as well as directly inhibits insulin secretion. SIRT4 overexpression leads to dyslipidimeia, decreased fatty acid oxidation, and lipogenesis which are the characteristic features of insulin resistance promoting type 2 diabetes. This makes SIRT4 a novel therapeutic target to control type 2 diabetes. Virtual screening and molecular docking studies were performed to obtain potential ligands. To further optimize the geometry of protein-ligand complexes Quantum Polarized Ligand Docking was performed. Binding Free Energy was calculated for the top three ligand molecules. In view of exploring the stereoelectronic features of the ligand, density functional theory approach was implemented at B3LYP/6-31G* level. 30 ns MD simulation studies of the protein-ligand complexes were done. The present research work proposes ZINC12421989 as potential inhibitor of SIRT4 with docking score (-7.54 kcal/mol), docking energy (-51.34 kcal/mol), binding free energy (-70.21 kcal/mol), and comparatively low energy gap (-0.1786 eV) for HOMO and LUMO indicating reactivity of the lead molecule.

  20. Molecular hematology

    National Research Council Canada - National Science Library

    Provan, Drew; Gribben, John

    2010-01-01

    ... The molecular basis of hemophilia, 219 Paul LF Giangrande 4 The genetics of acute myeloid leukemias, 42 Carolyn J Owen & Jude Fitzgibbon 19 The molecular basis of von Willebrand disease, 233 Luciano Baronc...

  1. CATASTROPHIC EVENTS MODELING

    Directory of Open Access Journals (Sweden)

    Ciumas Cristina

    2013-07-01

    Full Text Available This paper presents the emergence and evolution of catastrophe models (cat models. Starting with the present context of extreme weather events and features of catastrophic risk (cat risk we’ll make a chronological illustration from a theoretical point of view of the main steps taken for building such models. In this way the importance of interdisciplinary can be observed. The first cat model considered contains three modules. For each of these indentified modules: hazard, vulnerability and financial losses a detailed overview and also an exemplification of a potential case of an earthquake that measures more than 7 on Richter scale occurring nowadays in Bucharest will be provided. The key areas exposed to earthquake in Romania will be identified. Then, based on past catastrophe data and taking into account present conditions of housing stock, insurance coverage and the population of Bucharest the impact will be quantified by determining potential losses. In order to accomplish this work we consider a scenario with data representing average values for: dwelling’s surface, location, finishing works. On each step we’ll make a reference to the earthquake on March 4 1977 to see what would happen today if a similar event occurred. The value of Bucharest housing stock will be determined taking firstly the market value, then the replacement value and ultimately the real value to quantify potential damages. Through this approach we can find the insurance coverage of potential losses and also the uncovered gap. A solution that may be taken into account by public authorities, for example by Bucharest City Hall will be offered: in case such an event occurs the impossibility of paying compensations to insured people, rebuilding infrastructure and public buildings and helping the suffering persons should be avoided. An actively public-private partnership should be created between government authorities, the Natural Disaster Insurance Pool, private

  2. Episodes, events, and models

    Directory of Open Access Journals (Sweden)

    Sangeet eKhemlani

    2015-10-01

    Full Text Available We describe a novel computational theory of how individuals segment perceptual information into representations of events. The theory is inspired by recent findings in the cognitive science and cognitive neuroscience of event segmentation. In line with recent theories, it holds that online event segmentation is automatic, and that event segmentation yields mental simulations of events. But it posits two novel principles as well: first, discrete episodic markers track perceptual and conceptual changes, and can be retrieved to construct event models. Second, the process of retrieving and reconstructing those episodic markers is constrained and prioritized. We describe a computational implementation of the theory, as well as a robotic extension of the theory that demonstrates the processes of online event segmentation and event model construction. The theory is the first unified computational account of event segmentation and temporal inference. We conclude by demonstrating now neuroimaging data can constrain and inspire the construction of process-level theories of human reasoning.

  3. Screening and evaluation of First Half 1980 licensee event reports

    International Nuclear Information System (INIS)

    Waage, J.M.

    1981-05-01

    This program was established to identify those events which contain important operating experience and to communicate the insights gained from evaluation of such events to other plant owners and operators. This report represents a summary of that work for the LERs produced during roughly the first half of 1980. It discusses events of major significance reported during that period and summarizes those events which were identified as important. Several generic problem areas are discussed. Six major significant events took place during this period

  4. Dynamics of Charged Events

    International Nuclear Information System (INIS)

    Bachas, Constantin; Bunster, Claudio; Henneaux, Marc

    2009-01-01

    In three spacetime dimensions the world volume of a magnetic source is a single point, an event. We make the event dynamical by regarding it as the imprint of a flux-carrying particle impinging from an extra dimension. This can be generalized to higher spacetime dimensions and to extended events. We exhibit universal observable consequences of the existence of events and argue that events are as important as particles or branes. We explain how events arise on the world volume of membranes in M theory, and in a Josephson junction in superconductivity.

  5. The global event system

    International Nuclear Information System (INIS)

    Winans, J.

    1994-01-01

    The support for the global event system has been designed to allow an application developer to control the APS event generator and receiver boards. This is done by the use of four new record types. These records are customized and are only supported by the device support modules for the APS event generator and receiver boards. The use of the global event system and its associated records should not be confused with the vanilla EPICS events and the associated event records. They are very different

  6. Unusual event report from Oskarshamn

    International Nuclear Information System (INIS)

    1996-01-01

    The title of the report was intended to reflect the cause of the shutdown and the report to be regarded as a summary of the deficiencies that had been revealed and remedied. No single deficiency was regarded as reportable as an unusual event, but taken together the identified deficiencies deviated from the assumed safety level to the extent that it should be reported. The unusual event report refers to two main documents presenting measures taken to return to reported safety level, one concerning technical and one organizational measures

  7. New molecular identifiers for Simulium limbatum and Simulium incrustatum s.l. and the detection of genetic substructure with potential implications for onchocerciasis epidemiology in the Amazonia focus of Brazil.

    Science.gov (United States)

    Conceição, Priscila A; Crainey, James L; Almeida, Tatiana P; Shelley, Anthony J; Luz, Sergio L B

    2013-08-01

    The Amazonia onchocerciasis focus of southern Venezuela and northern Brazil is the larger of the two remaining Latin American onchocerciasis foci where disease transmission still occurs and is often regarded as the most challenging of all the Latin American foci to eliminate onchocerciasis. The site is home to a population of over 20,000 semi-nomadic, hunter-gatherer Yanomami people and is made-up of a mosaic of rainforest and savannah ecologies, which are influenced by the area's undulating terrain and rich geological diversity. At least six blackfly vectors have been implicated in onchocerciasis transmission in this focus; however, because of the difficulty in their routine identification the relative importance of each has been obscured. Simulium limbatum and Simulium incrustatum s.l. have both been recorded as vectors in the Amazonia focus, but they are difficult to discriminate morphologically and thus the ecological range of these species, and indeed the presence of S. limbatum in the Amazonia focus at all, have remained controversial. In the work described here, we report 15 S. incrustatum s.l. CO1 sequences and 27 S. limbatum sequences obtained from field-caught adult female blackflies collected from forest and savannah localities, inside and just outside the Amazonia focus. Phylogenetic analysis with the sequences generated in this study, showed that both the S. limbatum and the S. incrustatum s.l. CO1 sequences obtained (even from specimens living in sympatry) all fell into discrete species-specific bootstrap-supported monophyletic groups and thus confirmed the utility of the CO1 gene for identifying both these species inside the Amazonia focus. As the S. limbatum-exclusive cluster included CO1 sequences obtained from forest-caught and morphologically identified specimens these results provide the clearest evidence yet of the presence of S. limbatum inside the Amazonia focus. The question, however, of whether S. limbatum is actually a vector in the focus

  8. Event by event physics in ALICE

    CERN Document Server

    Christakoglou, Panos

    2009-01-01

    Fluctuations of thermodynamic quantities are fundamental for the study of the QGP phase transition. The ALICE experiment is well suited for precise event-by-event measurements of various quantities. In this article, we review the capabilities of ALICE to study the fluctuations of several key observables such as the net charge, the temperature, and the particle ratios. Among the observables related to correlations, we review the balance functions and the long range correlations.

  9. Cardiovascular Molecular Imaging

    International Nuclear Information System (INIS)

    Lee, Kyung Han

    2009-01-01

    Molecular imaging strives to visualize processes in living subjects at the molecular level. Monitoring biochemical processes at this level will allow us to directly track biological processes and signaling events that lead to pathophysiological abnormalities, and help make personalized medicine a reality by allowing evaluation of therapeutic efficacies on an individual basis. Although most molecular imaging techniques emerged from the field of oncology, they have now gradually gained acceptance by the cardiovascular community. Hence, the availability of dedicated high-resolution small animal imaging systems and specific targeting imaging probes is now enhancing our understanding of cardiovascular diseases and expediting the development of newer therapies. Examples include imaging approaches to evaluate and track the progress of recent genetic and cellular therapies for treatment of myocardial ischemia. Other areas include in vivo monitoring of such key molecular processes as angiogenesis and apoptosis. Cardiovascular molecular imaging is already an important research tool in preclinical experiments. The challenge that lies ahead is to implement these techniques into the clinics so that they may help fulfill the promise of molecular therapies and personalized medicine, as well as to resolve disappointments and controversies surrounding the field

  10. Computational challenges in modeling gene regulatory events.

    Science.gov (United States)

    Pataskar, Abhijeet; Tiwari, Vijay K

    2016-10-19

    Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.

  11. Conferences and Events

    International Development Research Centre (IDRC) Digital Library (Canada)

    André Lavoie

    2016-06-14

    Jun 14, 2016 ... Approved by the Management Executive Committee. - 1 - ... Event ‒ represents activities related to IDRC operations and may include both ... Events include business meetings; corporate, branch or divisional management.

  12. Initiating events frequency determination

    International Nuclear Information System (INIS)

    Simic, Z.; Mikulicic, V.; Vukovic, I.

    2004-01-01

    The paper describes work performed for the Nuclear Power Station (NPS). Work is related to the periodic initiating events frequency update for the Probabilistic Safety Assessment (PSA). Data for all relevant NPS initiating events (IE) were reviewed. The main focus was on events occurring during most recent operating history (i.e., last four years). The final IE frequencies were estimated by incorporating both NPS experience and nuclear industry experience. Each event was categorized according to NPS individual plant examination (IPE) initiating events grouping approach. For the majority of the IE groups, few, or no events have occurred at the NPS. For those IE groups with few or no NPS events, the final estimate was made by means of a Bayesian update with general nuclear industry values. Exceptions are rare loss-of-coolant-accidents (LOCA) events, where evaluation of engineering aspects is used in order to determine frequency.(author)

  13. Advertising Effectiveness In Events

    OpenAIRE

    Jain, Sushilkumar

    2012-01-01

    Confronted with decreasing effectiveness of the classic marketing communications, events have become an increasingly popular alternative for marketers. Events constitute one of the most exciting and fastest growing forms of leisure and business. With time, the decreasing effectiveness of classical marketing communications boosted the use of events for marketing and making brand awareness. Event marketing is seen as the unique opportunity to integrate the firm’s communication activities like p...

  14. Molecular dissection of Norrie disease.

    Science.gov (United States)

    Berger, W

    1998-01-01

    Norrie disease (ND) is a severe form of congenital blindness accompanied by mental retardation and/or deafness in at least one third of the patients. This article summarizes advances in the molecular genetic analysis of this disease during the last 13 years, including mapping and cloning of the human gene and the generation and characterization of a mouse model. Genetic linkage studies and physical mapping strategies have assigned the ND locus to the proximal short arm of the human X chromosome. The identification of chromosomal rearrangements in several patients, such as microdeletions, enabled the isolation of the ND gene by a positional cloning approach. Numerous point mutations in this gene have been identified in three distinct clinical entities: (1) ND, (2) familial and sporadic exudative vitreoretinopathy, and (3) retinopathy of prematurity. The gene encodes a relatively small protein, consisting of 133 amino acids. The function of the gene product is yet unknown, although homologies with known proteins and molecular modelling data suggest a role in the regulation of cell interaction or differentiation processes. A mouse model has been generated to shed more light on early pathogenic events involved in ND and allelic disorders. The mouse homologous protein is highly identical (94%) to the human polypeptide. The gene is expressed in the neuronal layers of the mouse retina, the cerebellum and olfactory epithelium. Mutant mice show snowflake-like opacities within the vitreous, dysgenesis of the ganglion cell layer and occasionally degeneration of photoreceptor cells. The mouse phenotype does not include phthisis bulbi and, overall, resembles a mild form of ND. Electrophysiological studies revealed a severely altered electroretinogram b-wave. These results suggest a primary defect in the inner neuronal layers of the retina. Defects in the vitreous and photoreceptor cell layer are most likely secondary effects. Further histological, functional and molecular

  15. CRITICAL EVENTS IN CONSTRUCTION PROCESS

    DEFF Research Database (Denmark)

    Jørgensen, Kirsten; Rasmussen, Grane Mikael Gregaard

    2009-01-01

    cause-effects of failures and defects in the construction industry by using an analytical approach (The bowtie model) which is developed in the accident research. Using this model clarifies the relationships within the chain of failures that causes critical events with undesirable consequences......Function failures, defects and poor communication are major problems in the construction industry. These failures and defects are caused by a row of critical events in the construction process. The purpose of this paper is to define “critical events” in the construction process and to investigate....... In this way the causes of failures and the relationships between various failures are rendered visible. A large construction site was observed from start to finish as the empirical element in the research. The research focuses on all kinds of critical events identified throughout every phase during...

  16. A Mosque event

    DEFF Research Database (Denmark)

    Simonsen, Kirsten; Neergaard, Maja de; Koefoed, Lasse Martin

    2017-01-01

    and public imaginations attached to it. And they are connected to a specific event – the opening of the mosque. In the first part, a conceptual framework is presented bringing together literature on three notions: encounters, visibility and the event. Following this, the paper explores the opening event...

  17. On semirecurrent events

    International Nuclear Information System (INIS)

    Dvurechenskij, A.

    1984-01-01

    In some problems of the mathematical theory of particle counters, film or filmless measurements of track ionization in high energy physics,queueing theory, random walks, etc., the classes of emirecurrent and m-semirecurrent events, which generalize the recurrent events and the recurrent events with delay, appeared. In the paper their basic properties, and some relationships between them are shown

  18. Probabilistic Cross-Identification of Cosmic Events

    OpenAIRE

    Budavari, Tamas

    2011-01-01

    We discuss a novel approach to identifying cosmic events in separate and independent observations. In our focus are the true events, such as supernova explosions, that happen once, hence, whose measurements are not repeatable. Their classification and analysis have to make the best use of all the available data. Bayesian hypothesis testing is used to associate streams of events in space and time. Probabilities are assigned to the matches by studying their rates of occurrence. A case study of ...

  19. Specific Reaction Patterns to Distinct Positive Emotional Cues Related to Incentive Motivation in Dependence of the Taq1A-Polymorphism: Molecular Genetic Associations of Early and Late Event-Related Potentials.

    Science.gov (United States)

    Munk, Aisha J L; Wielpuetz, Catrin; Osinsky, Roman; Müller, Erik M; Grant, Phillip; Hennig, Jürgen

    2016-01-01

    Early and late event-related potential (ERP) responses, representing early subconscious and late motivational processes, were recorded for positive emotional words related to 'wanting' and 'liking', in dependence of the dopamine-related Taq1A genotype (ANKK1/DRD2). Research suggests that 'wanting' as opposed to 'liking' is related to dopaminergic processes. Therefore, it was hypothesized that risk allele carriers of the Taq1A polymorphism exhibit late ERP changes in reaction to words representing incentive motivation, i.e. 'wanting' (word categories 'lust' and 'anticipation'), but not to words representing 'liking' ('closeness'). Seventy-two male participants performed an emotional-word Stroop task during EEG recording and were genotyped according to the Taq1A polymorphism of ANKK1/DRD2. Positive emotional words related to anticipation and lust revealed blunted responses in the late positive potential (LPP) in carriers of the A1 allele, an effect absent in response to 'liking'-related words. These differences were not evident in the earlier posterior negativity (EPN). As no differences in dependence of the Taq1A genotype were observed in reaction to 'wanting'- and 'liking'-related words in the EPN, but merely in the LPP, it can be assumed that incentive-motivational stimuli only modify motivation-related ERP responses in carriers of the A1 allele of the Taq1A polymorphism, indicating the role of dopamine in late ERP components. © 2016 S. Karger AG, Basel.

  20. Life Events, Sibling Warmth, and Youths' Adjustment

    Science.gov (United States)

    Waite, Evelyn B.; Shanahan, Lilly; Calkins, Susan D.; Keane, Susan P.; O'Brien, Marion

    2011-01-01

    Sibling warmth has been identified as a protective factor from life events, but stressor-support match-mismatch and social domains perspectives suggest that sibling warmth may not efficiently protect youths from all types of life events. We tested whether sibling warmth moderated the association between each of family-wide, youths' personal, and…

  1. Traumatic Childhood Events and Autism Spectrum Disorder

    Science.gov (United States)

    Kerns, Connor Morrow; Newschaffer, Craig J.; Berkowitz, Steven J.

    2015-01-01

    Traumatic childhood events are associated with a wide range of negative physical, psychological and adaptive outcomes over the life course and are one of the few identifiable causes of psychiatric illness. Children with autism spectrum disorder (ASD) may be at increased risk for both encountering traumatic events and developing traumatic sequelae;…

  2. Negated bio-events: analysis and identification

    Science.gov (United States)

    2013-01-01

    Background Negation occurs frequently in scientific literature, especially in biomedical literature. It has previously been reported that around 13% of sentences found in biomedical research articles contain negation. Historically, the main motivation for identifying negated events has been to ensure their exclusion from lists of extracted interactions. However, recently, there has been a growing interest in negative results, which has resulted in negation detection being identified as a key challenge in biomedical relation extraction. In this article, we focus on the problem of identifying negated bio-events, given gold standard event annotations. Results We have conducted a detailed analysis of three open access bio-event corpora containing negation information (i.e., GENIA Event, BioInfer and BioNLP’09 ST), and have identified the main types of negated bio-events. We have analysed the key aspects of a machine learning solution to the problem of detecting negated events, including selection of negation cues, feature engineering and the choice of learning algorithm. Combining the best solutions for each aspect of the problem, we propose a novel framework for the identification of negated bio-events. We have evaluated our system on each of the three open access corpora mentioned above. The performance of the system significantly surpasses the best results previously reported on the BioNLP’09 ST corpus, and achieves even better results on the GENIA Event and BioInfer corpora, both of which contain more varied and complex events. Conclusions Recently, in the field of biomedical text mining, the development and enhancement of event-based systems has received significant interest. The ability to identify negated events is a key performance element for these systems. We have conducted the first detailed study on the analysis and identification of negated bio-events. Our proposed framework can be integrated with state-of-the-art event extraction systems. The

  3. Tiered High-Throughput Screening Approach to Identify ...

    Science.gov (United States)

    High-throughput screening (HTS) for potential thyroid–disrupting chemicals requires a system of assays to capture multiple molecular-initiating events (MIEs) that converge on perturbed thyroid hormone (TH) homeostasis. Screening for MIEs specific to TH-disrupting pathways is limited in the US EPA ToxCast screening assay portfolio. To fill one critical screening gap, the Amplex UltraRed-thyroperoxidase (AUR-TPO) assay was developed to identify chemicals that inhibit TPO, as decreased TPO activity reduces TH synthesis. The ToxCast Phase I and II chemical libraries, comprised of 1,074 unique chemicals, were initially screened using a single, high concentration to identify potential TPO inhibitors. Chemicals positive in the single concentration screen were retested in concentration-response. Due to high false positive rates typically observed with loss-of-signal assays such as AUR-TPO, we also employed two additional assays in parallel to identify possible sources of nonspecific assay signal loss, enabling stratification of roughly 300 putative TPO inhibitors based upon selective AUR-TPO activity. A cell-free luciferase inhibition assay was used to identify nonspecific enzyme inhibition among the putative TPO inhibitors, and a cytotoxicity assay using a human cell line was used to estimate the cellular tolerance limit. Additionally, the TPO inhibition activities of 150 chemicals were compared between the AUR-TPO and an orthogonal peroxidase oxidation assay using

  4. Event-by-Event Observables and Fluctuations

    International Nuclear Information System (INIS)

    Petersen, Hannah

    2013-01-01

    In this talk the status and open questions of the phenomenological description of all the stages of a heavy ion reaction are highlighted. Special emphasis is put on event-by-event fluctuations and associated observables. The first part is concentrated on high RHIC and LHC energies and the second part reviews the challenges for modeling heavy ion reactions at lower beam energies in a more realistic fashion. Overall, the main conclusion is that sophisticated theoretical dynamical approaches that describe many observables in the same framework are essential for the quantitative understanding of the properties of hot and dense nuclear matter

  5. Diet, lifestyle, and molecular alterations that drive colorectal carcinogenesis

    NARCIS (Netherlands)

    Diergaarde, B.

    2004-01-01

    Environmental factors have been repeatedly implicated in the etiology of colorectal cancer, and much is known about the molecular events involved in colorectal carcinogenesis. The relationships between environmental risk factors and the molecular alterations that drive colorectal carcinogenesis are

  6. Molecular Diagnostics

    OpenAIRE

    Choe, Hyonmin; Deirmengian, Carl A.; Hickok, Noreen J.; Morrison, Tiffany N.; Tuan, Rocky S.

    2015-01-01

    Orthopaedic infections are complex conditions that require immediate diagnosis and accurate identification of the causative organisms to facilitate appropriate management. Conventional methodologies for diagnosis of these infections sometimes lack accuracy or sufficient rapidity. Current molecular diagnostics are an emerging area of bench-to-bedside research in orthopaedic infections. Examples of promising molecular diagnostics include measurement of a specific biomarker in the synovial fluid...

  7. Molecular genetics

    International Nuclear Information System (INIS)

    Parkinson, D.R.; Krontiris, T.G.

    1986-01-01

    In this chapter the authors review new findings concerning the molecular genetics of malignant melanoma in the context of other information obtained from clinical, epidemiologic, and cytogenetic studies in this malignancy. These new molecular approaches promise to provide a more complete understanding of the mechanisms involved in the development of melanoma, thereby suggesting new methods for its treatment and prevention

  8. Molecular Modeling

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 9; Issue 5. Molecular Modeling: A Powerful Tool for Drug Design and Molecular Docking. Rama Rao Nadendla. General Article Volume 9 Issue 5 May 2004 pp 51-60. Fulltext. Click here to view fulltext PDF. Permanent link:

  9. Learning and Memory, Part II: Molecular Mechanisms of Synaptic Plasticity

    Science.gov (United States)

    Lombroso, Paul; Ogren, Marilee

    2009-01-01

    The molecular events that are responsible for strengthening synaptic connections and how these are linked to memory and learning are discussed. The laboratory preparations that allow the investigation of these events are also described.

  10. Identifying patient risks during hospitalization

    Directory of Open Access Journals (Sweden)

    Lucélia Ferreira Lima

    2008-12-01

    Full Text Available Objective: To identify the risks reported at a public institution andto know the main patient risks from the nursing staff point of view.Methods: A retrospective, descriptive and exploratory study. Thesurvey was developed at a hospital in the city of Taboão da Serra, SãoPaulo, Brazil. The study included all nurses working in care areas whoagreed to participate in the study. At the same time, sentinel eventsoccurring in the period from July 2006 to July 2007 were identified.Results: There were 440 sentinel events reported, and the main risksincluded patient falls, medication errors and pressure ulcers. Sixty-fivenurses were interviewed. They also reported patient falls, medicationerrors and pressure ulcers as the main risks. Conclusions: Riskassessment and implementation of effective preventive actions arenecessary to ensure patient’s safety. Involvement of a multidisciplinaryteam is one of the steps for a successful process.

  11. General perspectives for molecular nuclear imaging

    International Nuclear Information System (INIS)

    Chung, June Key

    2004-01-01

    Molecular imaging provides a visualization of normal as well as abnormal cellular processes at a molecular or genetic level rather than at an anatomical level. Conventional medical imaging methods utilize the imaging signals produced by nonspecific physico-chemical interaction. However, molecular imaging methods utilize the imaging signals derived from specific cellular or molecular events. Because molecular and genetic changes precede anatomical change in the course of disease development, molecular imaging can detect early events in disease progression. In the near future, through molecular imaging we can understand basic mechanisms of disease, and diagnose earlier and, subsequently, treat earlier intractable disease such as cancer, neuro-degenerative diseases, and immunologic disorders. In beginning period, nuclear medicine started as a molecular imaging, and has had a leading role in the field of molecular imaging. But recently molecular imaging has been rapidly developed. Besides nuclear imaging, molecular imaging methods such as optical imaging, magnetic resonance imaging are emerging. Each imaging modalities have their advantages and weaknesses. The opportunities from molecular imaging look bright. We should try nuclear medicine continues to have a leading role in molecular imaging

  12. Soundscapes, events, resistance

    Directory of Open Access Journals (Sweden)

    Andrea Mubi Brighenti

    2008-12-01

    Full Text Available Put it bluntly, a soundscape is the sonic counterpart, or component, of landscape. From such minimal assumption, some interesting consequences follow: just as landscape is far from being a simple stage-set upon which events take place, soundscape, too, is itself evental, i.e., it consists of events. Not only because its nature, far from being acoustics is always ‘psychoacoustics’, as Murray Schafer (1977/1994 first argued. Processes of environmental perception are of course there.

  13. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    OpenAIRE

    Abel, Frida; Dalevi, Daniel; Nethander, Maria; Jörnsten, Rebecka; De Preter, Katleen; Vermeulen, Joëlle; Stallings, Raymond; Kogner, Per; Maris, John; Nilsson, Staffan

    2011-01-01

    Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linke...

  14. Identifying molecular markers associated with stigma characteristics in rice

    Science.gov (United States)

    Stigma characteristics play essential roles in hybrid seed production of rice and marker-assisted breeding plays essential role because they are quantitatively inherited with single-flowered perfect spikelet. Ninety four accessions originated from 47 countries were selected from the USDA rice core c...

  15. Identifying Slow Molecular Motions in Complex Chemical Reactions.

    Science.gov (United States)

    Piccini, GiovanniMaria; Polino, Daniela; Parrinello, Michele

    2017-09-07

    We have studied the cyclization reaction of deprotonated 4-chloro-1-butanethiol to tetrahydrothiophene by means of well-tempered metadynamics. To properly select the collective variables, we used the recently proposed variational approach to conformational dynamics within the framework of metadyanmics. This allowed us to select the appropriate linear combinations from a set of collective variables representing the slow degrees of freedom that best describe the slow modes of the reaction. We performed our calculations at three different temperatures, namely, 300, 350, and 400 K. We show that the choice of such collective variables allows one to easily interpret the complex free-energy surface of such a reaction by univocal identification of the conformers belonging to reactants and product states playing a fundamental role in the reaction mechanism.

  16. Identifying Molecular Targets for PTSD Treatment Using Single Prolonged Stress

    Science.gov (United States)

    2015-10-01

    in the locus coeruleus. Based on our findings we hypothesize that SPS alters glucocorticoid and beta adrenergic receptor (β-AR) expression leading...individual was a recent graduate from PhD training and came with expertise in animal behavioral tests of anxiety . During her first 6 months of work, she has... Anxiety Disorders, 2013, 3,22; Psychopharmacology, 2014, DOI:10.1007/s00213-014-3635-x). Dr. George has also been promoted within the University of

  17. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS

    Science.gov (United States)

    Hepatitis E virus (HEV) is a waterborne emerging pathogen that causes significant illness in the developing world. Thus far, an HEV outbreak has not been reported in the U.S., although a swine variant of the virus is common in Midwestern hogs. Because viruses isolated from two ...

  18. Identifying Molecular Targets For PTSD Treatment Using Single Prolonged Stress

    Science.gov (United States)

    2014-10-01

    Post - traumatic stress disorder ( PTSD ) is a chronic, debilitating psychiatric disorder that can...SPS animals. Post - traumatic stress disorder ( PTSD ) is associated with neurocognitive impairments that have been attributed to functional deficits...and resilience. 2. KEYWORDS Post - traumatic stress disorder , Single Prolonged Stress , Neurobiological Mechanisms 5 3. ACCOMPLISHMENTS

  19. New St-chromosome-specific molecular markers for identifying ...

    Indian Academy of Sciences (India)

    et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

  20. Disease management research using event graphs.

    Science.gov (United States)

    Allore, H G; Schruben, L W

    2000-08-01

    Event Graphs, conditional representations of stochastic relationships between discrete events, simulate disease dynamics. In this paper, we demonstrate how Event Graphs, at an appropriate abstraction level, also extend and organize scientific knowledge about diseases. They can identify promising treatment strategies and directions for further research and provide enough detail for testing combinations of new medicines and interventions. Event Graphs can be enriched to incorporate and validate data and test new theories to reflect an expanding dynamic scientific knowledge base and establish performance criteria for the economic viability of new treatments. To illustrate, an Event Graph is developed for mastitis, a costly dairy cattle disease, for which extensive scientific literature exists. With only a modest amount of imagination, the methodology presented here can be seen to apply modeling to any disease, human, plant, or animal. The Event Graph simulation presented here is currently being used in research and in a new veterinary epidemiology course. Copyright 2000 Academic Press.

  1. A review for identification of initiating events in event tree development process on nuclear power plants

    International Nuclear Information System (INIS)

    Riyadi, Eko H.

    2014-01-01

    Initiating event is defined as any event either internal or external to the nuclear power plants (NPPs) that perturbs the steady state operation of the plant, if operating, thereby initiating an abnormal event such as transient or loss of coolant accident (LOCA) within the NPPs. These initiating events trigger sequences of events that challenge plant control and safety systems whose failure could potentially lead to core damage or large early release. Selection for initiating events consists of two steps i.e. first step, definition of possible events, such as by evaluating a comprehensive engineering, and by constructing a top level logic model. Then the second step, grouping of identified initiating event's by the safety function to be performed or combinations of systems responses. Therefore, the purpose of this paper is to discuss initiating events identification in event tree development process and to reviews other probabilistic safety assessments (PSA). The identification of initiating events also involves the past operating experience, review of other PSA, failure mode and effect analysis (FMEA), feedback from system modeling, and master logic diagram (special type of fault tree). By using the method of study for the condition of the traditional US PSA categorization in detail, could be obtained the important initiating events that are categorized into LOCA, transients and external events

  2. A review for identification of initiating events in event tree development process on nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Riyadi, Eko H., E-mail: e.riyadi@bapeten.go.id [Center for Regulatory Assessment of Nuclear Installation and Materials, Nuclear Energy Regulatory Agency (BAPETEN), Jl. Gajah Mada 8 Jakarta 10120 (Indonesia)

    2014-09-30

    Initiating event is defined as any event either internal or external to the nuclear power plants (NPPs) that perturbs the steady state operation of the plant, if operating, thereby initiating an abnormal event such as transient or loss of coolant accident (LOCA) within the NPPs. These initiating events trigger sequences of events that challenge plant control and safety systems whose failure could potentially lead to core damage or large early release. Selection for initiating events consists of two steps i.e. first step, definition of possible events, such as by evaluating a comprehensive engineering, and by constructing a top level logic model. Then the second step, grouping of identified initiating event's by the safety function to be performed or combinations of systems responses. Therefore, the purpose of this paper is to discuss initiating events identification in event tree development process and to reviews other probabilistic safety assessments (PSA). The identification of initiating events also involves the past operating experience, review of other PSA, failure mode and effect analysis (FMEA), feedback from system modeling, and master logic diagram (special type of fault tree). By using the method of study for the condition of the traditional US PSA categorization in detail, could be obtained the important initiating events that are categorized into LOCA, transients and external events.

  3. Analysis for Human-related Events during the Overhaul

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ji Tae; Kim, Min Chull; Choi, Dong Won; Lee, Durk Hun [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2011-10-15

    The event frequency due to human error is decreasing among 20 operating Nuclear Power Plants (NPPs) excluding the NPP (Shin-Kori unit-1) in the commissioning stage since 2008. However, the events due to human error during an overhaul (O/H) occur annually (see Table I). An analysis for human-related events during the O/H was performed. Similar problems were identified for each event from the analysis and also, organizational and safety cultural factors were also identified

  4. OAE: The Ontology of Adverse Events.

    Science.gov (United States)

    He, Yongqun; Sarntivijai, Sirarat; Lin, Yu; Xiang, Zuoshuang; Guo, Abra; Zhang, Shelley; Jagannathan, Desikan; Toldo, Luca; Tao, Cui; Smith, Barry

    2014-01-01

    A medical intervention is a medical procedure or application intended to relieve or prevent illness or injury. Examples of medical interventions include vaccination and drug administration. After a medical intervention, adverse events (AEs) may occur which lie outside the intended consequences of the intervention. The representation and analysis of AEs are critical to the improvement of public health. The Ontology of Adverse Events (OAE), previously named Adverse Event Ontology (AEO), is a community-driven ontology developed to standardize and integrate data relating to AEs arising subsequent to medical interventions, as well as to support computer-assisted reasoning. OAE has over 3,000 terms with unique identifiers, including terms imported from existing ontologies and more than 1,800 OAE-specific terms. In OAE, the term 'adverse event' denotes a pathological bodily process in a patient that occurs after a medical intervention. Causal adverse events are defined by OAE as those events that are causal consequences of a medical intervention. OAE represents various adverse events based on patient anatomic regions and clinical outcomes, including symptoms, signs, and abnormal processes. OAE has been used in the analysis of several different sorts of vaccine and drug adverse event data. For example, using the data extracted from the Vaccine Adverse Event Reporting System (VAERS), OAE was used to analyse vaccine adverse events associated with the administrations of different types of influenza vaccines. OAE has also been used to represent and classify the vaccine adverse events cited in package inserts of FDA-licensed human vaccines in the USA. OAE is a biomedical ontology that logically defines and classifies various adverse events occurring after medical interventions. OAE has successfully been applied in several adverse event studies. The OAE ontological framework provides a platform for systematic representation and analysis of adverse events and of the factors (e

  5. Molecular geometry

    CERN Document Server

    Rodger, Alison

    1995-01-01

    Molecular Geometry discusses topics relevant to the arrangement of atoms. The book is comprised of seven chapters that tackle several areas of molecular geometry. Chapter 1 reviews the definition and determination of molecular geometry, while Chapter 2 discusses the unified view of stereochemistry and stereochemical changes. Chapter 3 covers the geometry of molecules of second row atoms, and Chapter 4 deals with the main group elements beyond the second row. The book also talks about the complexes of transition metals and f-block elements, and then covers the organometallic compounds and trans

  6. Features, Events, and Processes: Disruptive Events

    International Nuclear Information System (INIS)

    J. King

    2004-01-01

    The primary purpose of this analysis is to evaluate seismic- and igneous-related features, events, and processes (FEPs). These FEPs represent areas of natural system processes that have the potential to produce disruptive events (DE) that could impact repository performance and are related to the geologic processes of tectonism, structural deformation, seismicity, and igneous activity. Collectively, they are referred to as the DE FEPs. This evaluation determines which of the DE FEPs are excluded from modeling used to support the total system performance assessment for license application (TSPA-LA). The evaluation is based on the data and results presented in supporting analysis reports, model reports, technical information, or corroborative documents that are cited in the individual FEP discussions in Section 6.2 of this analysis report

  7. Features, Events, and Processes: Disruptive Events

    Energy Technology Data Exchange (ETDEWEB)

    J. King

    2004-03-31

    The primary purpose of this analysis is to evaluate seismic- and igneous-related features, events, and processes (FEPs). These FEPs represent areas of natural system processes that have the potential to produce disruptive events (DE) that could impact repository performance and are related to the geologic processes of tectonism, structural deformation, seismicity, and igneous activity. Collectively, they are referred to as the DE FEPs. This evaluation determines which of the DE FEPs are excluded from modeling used to support the total system performance assessment for license application (TSPA-LA). The evaluation is based on the data and results presented in supporting analysis reports, model reports, technical information, or corroborative documents that are cited in the individual FEP discussions in Section 6.2 of this analysis report.

  8. Safeguards summary event list (SSEL)

    International Nuclear Information System (INIS)

    Davidson, J.J.; MacMurdy, P.H.

    1980-12-01

    The List contains nine categories of events involving NRC licensed material or licensees. It is deliberately broad in scope for two main reasons. First, the list is designed to serve as a reference document. It is as complete and accurate as possible. Second, the list is intended to provide as broad a perspective of the nature of licensee-related events as possible. The nine categories of events are as follows: bomb-related events; intrusion events; missing and/or allegedly stolen events; transportation-related events; vandalism events; arson events; firearms-related events; sabotage events; and miscellaneous events

  9. Features, Events, and Processes: Disruptive Events

    Energy Technology Data Exchange (ETDEWEB)

    P. Sanchez

    2004-11-08

    The purpose of this analysis report is to evaluate and document the inclusion or exclusion of the disruptive events features, events, and processes (FEPs) with respect to modeling used to support the total system performance assessment for license application (TSPA-LA). A screening decision, either ''Included'' or ''Excluded,'' is given for each FEP, along with the technical basis for screening decisions. This information is required by the U.S. Nuclear Regulatory Commission (NRC) at 10 CFR 63.114 (d), (e), and (f) [DIRS 156605]. The FEPs addressed in this report deal with both seismic and igneous disruptive events, such as fault displacements through the repository and an igneous intrusion into the repository. For included FEPs, this analysis summarizes the implementation of the FEP in TSPA-LA (i.e., how the FEP is included). For excluded FEPs, this analysis provides the technical basis for exclusion from TSPA-LA (i.e., why the FEP is excluded). Previous versions of this report were developed to support the total system performance assessments (TSPA) for various prior repository designs. This revision addresses the repository design for the license application (LA).

  10. Features, Events, and Processes: Disruptive Events

    International Nuclear Information System (INIS)

    P. Sanchez

    2004-01-01

    The purpose of this analysis report is to evaluate and document the inclusion or exclusion of the disruptive events features, events, and processes (FEPs) with respect to modeling used to support the total system performance assessment for license application (TSPA-LA). A screening decision, either ''Included'' or ''Excluded,'' is given for each FEP, along with the technical basis for screening decisions. This information is required by the U.S. Nuclear Regulatory Commission (NRC) at 10 CFR 63.114 (d), (e), and (f) [DIRS 156605]. The FEPs addressed in this report deal with both seismic and igneous disruptive events, such as fault displacements through the repository and an igneous intrusion into the repository. For included FEPs, this analysis summarizes the implementation of the FEP in TSPA-LA (i.e., how the FEP is included). For excluded FEPs, this analysis provides the technical basis for exclusion from TSPA-LA (i.e., why the FEP is excluded). Previous versions of this report were developed to support the total system performance assessments (TSPA) for various prior repository designs. This revision addresses the repository design for the license application (LA)

  11. Risk analysis of brachytherapy events

    International Nuclear Information System (INIS)

    Buricova, P.; Zackova, H.; Hobzova, L.; Novotny, J.; Kindlova, A.

    2005-01-01

    For prevention radiological events it is necessary to identify hazardous situation and to analyse the nature of committed errors. Though the recommendation on the classification and prevention of radiological events: Radiological accidents has been prepared in the framework of Czech Society of Radiation Oncology, Biology and Physics and it was approved by Czech regulatory body (SONS) in 1999, only a few reports have been submitted up to now from brachytherapy practice. At the radiotherapy departments attention has been paid more likely to the problems of dominant teletherapy treatments. But in the two last decades the usage of brachytherapy methods has gradually increased because .nature of this treatment well as the possibilities of operating facility have been completely changed: new radionuclides of high activity are introduced and sophisticate afterloading systems controlled by computers are used. Consequently also the nature of errors, which can occurred in the clinical practice, has been changing. To determine the potentially hazardous parts of procedure the so-called 'process tree', which follows the flow of entire treatment process, has been created for most frequent type of applications. Marking the location of errors on the process tree indicates where failures occurred and accumulation of marks along branches show weak points in the process. Analysed data provide useful information to prevent medical events in brachytherapy .The results strength the requirements given in Recommendations of SONS and revealed the need for its amendment. They call especially for systematic registration of the events. (authors)

  12. The CBM first-level event selector

    Energy Technology Data Exchange (ETDEWEB)

    Cuveland, Jan de; Lindenstruth, Volker [Frankfurt Institute for Advanced Studies, Goethe University, Frankfurt (Germany)

    2015-07-01

    The CBM experiment currently under construction at GSI/FAIR is designed to study QCD predictions at high baryon densities. The CBM First-Level Event Selector (FLES) is the central event selection system of the experiment. Designed as a high-performance computer cluster, its task is an online analysis of the physics data including full event reconstruction at an incoming data rate exceeding 1 TByte/s. The CBM detector systems are free-running and self-triggered, delivering time-stamped data streams. As there is no inherent event separation, traditional approaches for global event building and event selection are not directly applicable. Instead of event building, the FLES combines the data from approximately 1000 input links to self-contained, overlapping processing intervals and distributes them to compute nodes. It employs a high-bandwidth InfiniBand network as well as dedicated custom FPGA input boards providing time-addressed access to buffered data. Subsequently, specialized event selection algorithms analyze these processing intervals in 4-D, identify events, and select those relevant for storage depending on the chosen CBM setup and selection scenario. This presentation outlines the design of the CBM First-level Event Selector and summarizes the results from first prototype systems.

  13. Human Performance Event Database

    International Nuclear Information System (INIS)

    Trager, E. A.

    1998-01-01

    The purpose of this paper is to describe several aspects of a Human Performance Event Database (HPED) that is being developed by the Nuclear Regulatory Commission. These include the background, the database structure and basis for the structure, the process for coding and entering event records, the results of preliminary analyses of information in the database, and plans for the future. In 1992, the Office for Analysis and Evaluation of Operational Data (AEOD) within the NRC decided to develop a database for information on human performance during operating events. The database was needed to help classify and categorize the information to help feedback operating experience information to licensees and others. An NRC interoffice working group prepared a list of human performance information that should be reported for events and the list was based on the Human Performance Investigation Process (HPIP) that had been developed by the NRC as an aid in investigating events. The structure of the HPED was based on that list. The HPED currently includes data on events described in augmented inspection team (AIT) and incident investigation team (IIT) reports from 1990 through 1996, AEOD human performance studies from 1990 through 1993, recent NRR special team inspections, and licensee event reports (LERs) that were prepared for the events. (author)

  14. The Agency of Event

    DEFF Research Database (Denmark)

    Nicholas, Paul; Tamke, Martin; Riiber, Jacob

    2014-01-01

    This paper explores the notion of agency within event-based models. We present an event-based modeling approach that links interdependent generative, analytic and decision making sub-models within a system of exchange. Two case study projects demonstrate the underlying modeling concepts and metho...

  15. Intermediate mass dimuon events

    International Nuclear Information System (INIS)

    Moser, H.-G.

    1985-01-01

    We report the observation of 67 dimuon events at the CERN p anti p collider with the UA1 detector. The events will be interpreted in terms of the Drell-Yan mechanism, J/PSI and UPSILON decays and heavy flavour production. (author)

  16. The Blayais event

    International Nuclear Information System (INIS)

    2000-01-01

    This document provides the main events occurred to the Blayais installation during the year 2000. For each events, the detailed chronology, the situation analysis, the crisis management and the public information are provided. Some recommendations are also provided by the nuclear safety authorities. (A.L.B.)

  17. Molecular Electronics

    DEFF Research Database (Denmark)

    Jennum, Karsten Stein

    This thesis includes the synthesis and characterisation of organic compounds designed for molecular electronics. The synthesised organic molecules are mainly based on two motifs, the obigo(phenyleneethynylenes) (OPE)s and tetrathiafulvalene (TTF) as shown below. These two scaffolds (OPE and TTF......) are chemically merged together to form cruciform-like structures that are an essential part of the thesis. The cruciform molecules were subjected to molecular conductance measurements to explore their capability towards single-crystal field-effect transistors (Part 1), molecular wires, and single electron......, however, was obtained by a study of a single molecular transistor. The investigated OPE5-TTF compound was captured in a three-terminal experiment, whereby manipulation of the molecule’s electronic spin was possible in different charge states. Thus, we demonstrated how the cruciform molecules could...

  18. Molecular sciences

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    The research in molecular sciences summarized includes photochemistry, radiation chemistry, geophysics, electromechanics, heavy-element oxidizers , heavy element chemistry collisions, atoms, organic solids. A list of publications is included

  19. Impact of Laboratory Cross-Contamination on Molecular Epidemiology Studies of Tuberculosis

    Science.gov (United States)

    Martínez, Miguel; de Viedma, Darío García; Alonso, María; Andrés, Sandra; Bouza, Emilio; Cabezas, Teresa; Cabeza, Isabel; Reyes, Armando; Sánchez-Yebra, Waldo; Rodríguez, Manuel; Sánchez, M. Isabel; Rogado, M. Cruz; Fernández, Rosa; Peñafiel, Teresa; Martínez, Juan; Barroso, Pilar; Lucerna, M. Ángeles; Diez, L. Felipe; Gutiérrez, Carmelo

    2006-01-01

    Laboratory cross-contamination by Mycobacterium tuberculosis is known to be responsible for the misdiagnosis of tuberculosis, but its impact on other contexts has not been analyzed. We present the findings of a molecular epidemiology analysis in which the recent transmission events identified by a genotyping reference center were overestimated as a result of unnoticed laboratory cross-contamination in the original diagnostic laboratories. PMID:16891518

  20. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  1. Extended Lagrangian Born-Oppenheimer molecular dynamics simulations of the shock-induced chemistry of phenylacetylene

    Energy Technology Data Exchange (ETDEWEB)

    Cawkwell, M. J., E-mail: cawkwell@lanl.gov; Niklasson, Anders M. N. [Theoretical Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Dattelbaum, Dana M. [Weapons Experiments Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

    2015-02-14

    The initial chemical events that occur during the shock compression of liquid phenylacetylene have been investigated using self-consistent tight binding molecular dynamics simulations. The extended Lagrangian Born-Oppenheimer molecular dynamics formalism enabled us to compute microcanonical trajectories with precise conservation of the total energy. Our simulations revealed that the first density-increasing step under shock compression arises from the polymerization of phenylacetylene molecules at the acetylene moiety. The application of electronic structure-based molecular dynamics with long-term conservation of the total energy enabled us to identify electronic signatures of reactivity via monitoring changes in the HOMO-LUMO gap, and to capture directly adiabatic shock heating, transient non-equilibrium states, and changes in temperature arising from exothermic chemistry in classical molecular dynamics trajectories.

  2. Extended Lagrangian Born-Oppenheimer molecular dynamics simulations of the shock-induced chemistry of phenylacetylene.

    Science.gov (United States)

    Cawkwell, M J; Niklasson, Anders M N; Dattelbaum, Dana M

    2015-02-14

    The initial chemical events that occur during the shock compression of liquid phenylacetylene have been investigated using self-consistent tight binding molecular dynamics simulations. The extended Lagrangian Born-Oppenheimer molecular dynamics formalism enabled us to compute microcanonical trajectories with precise conservation of the total energy. Our simulations revealed that the first density-increasing step under shock compression arises from the polymerization of phenylacetylene molecules at the acetylene moiety. The application of electronic structure-based molecular dynamics with long-term conservation of the total energy enabled us to identify electronic signatures of reactivity via monitoring changes in the HOMO-LUMO gap, and to capture directly adiabatic shock heating, transient non-equilibrium states, and changes in temperature arising from exothermic chemistry in classical molecular dynamics trajectories.

  3. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  4. Life events and escape in conversion disorder.

    Science.gov (United States)

    Nicholson, T R; Aybek, S; Craig, T; Harris, T; Wojcik, W; David, A S; Kanaan, R A

    2016-09-01

    Psychological models of conversion disorder (CD) traditionally assume that psychosocial stressors are identifiable around symptom onset. In the face of limited supportive evidence such models are being challenged. Forty-three motor CD patients, 28 depression patients and 28 healthy controls were assessed using the Life Events and Difficulties Schedule in the year before symptom onset. A novel 'escape' rating for events was developed to test the Freudian theory that physical symptoms of CD could provide escape from stressors, a form of 'secondary gain'. CD patients had significantly more severe life events and 'escape' events than controls. In the month before symptom onset at least one severe event was ident