WorldWideScience

Sample records for identify molecular defects

  1. Molecular defects identified by whole exome sequencing in a child with Fanconi anemia.

    Science.gov (United States)

    Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua

    2013-11-10

    Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.

  2. Defective myoblasts identified in Duchenne muscular dystrophy.

    OpenAIRE

    Blau, H M; Webster, C; Pavlath, G K

    1983-01-01

    A defect in the proliferative capacity of satellite cells, mononucleated precursors of mature muscle fibers, was found in clonal analyses of cells cultured from Duchenne muscular dystrophy (DMD) patients. The total yield of myoblasts per gram of muscle biopsy was decreased to 5% of normal. Of the DMD myoblast clones obtained, a large proportion contained a morphological class of flat distended cells that had an increased generation time and ceased to proliferate beyond 100-1,000 cells but cou...

  3. Identifying subsurface detachment defects by acoustic tracing

    Czech Academy of Sciences Publication Activity Database

    Sklodowski, R.; Drdácký, Miloš; Sklodowski, M.

    2013-01-01

    Roč. 56, June (2013), s. 56-64 ISSN 0963-8695 R&D Projects: GA ČR(CZ) GBP105/12/G059 Institutional support: RVO:68378297 Keywords : acoustic excitation * plaster detachment defects * frequency response * inspection systems * signal processing Subject RIV: JN - Civil Engineering Impact factor: 1.717, year: 2013 http://www.sciencedirect.com/science/article/pii/S0963869513000303

  4. The molecular basis of hereditary enamel defects in humans.

    Science.gov (United States)

    Wright, J T; Carrion, I A; Morris, C

    2015-01-01

    The formation of human enamel is highly regulated at the molecular level and involves thousands of genes. Requisites for development of this highly mineralized tissue include cell differentiation; production of a unique extracellular matrix; processing of the extracellular matrix; altering of cell function during different stages of enamel formation; cell movement and attachment; regulation of ion and protein movement; and regulation of hydration, pH, and other conditions of the microenvironment, to name just a few. Not surprising, there is a plethora of hereditary conditions with an enamel phenotype. The objective of this review was to identify the hereditary conditions listed on Online Mendelian Inheritance in Man (OMIM) that have an associated enamel phenotype and whether a causative gene has been identified. The OMIM database was searched with the terms amelogenesis, enamel, dental, and tooth, and all results were screened by 2 individuals to determine if an enamel phenotype was identified. Gene and gene product function was reviewed on OMIM and from publications identified in PubMed. The search strategy revealed 91 conditions listed in OMIM as having an enamel phenotype, and of those, 71 have a known molecular etiology or linked genetic loci. The purported protein function of those conditions with a known genetic basis included enzymes, regulatory proteins, extracellular matrix proteins, transcription factors, and transmembrane proteins. The most common enamel phenotype was a deficient amount of enamel, or enamel hypoplasia, with hypomineralization defects being reported less frequently. Knowing these molecular defects allows an initial cataloging of molecular pathways that lead to hereditary enamel defects in humans. This knowledge provides insight into the diverse molecular pathways involved in enamel formation and can be useful when searching for the genetic etiology of hereditary conditions that involve enamel. © International & American Associations for

  5. The Molecular Basis of Hereditary Enamel Defects in Humans

    Science.gov (United States)

    Carrion, I.A.; Morris, C.

    2015-01-01

    The formation of human enamel is highly regulated at the molecular level and involves thousands of genes. Requisites for development of this highly mineralized tissue include cell differentiation; production of a unique extracellular matrix; processing of the extracellular matrix; altering of cell function during different stages of enamel formation; cell movement and attachment; regulation of ion and protein movement; and regulation of hydration, pH, and other conditions of the microenvironment, to name just a few. Not surprising, there is a plethora of hereditary conditions with an enamel phenotype. The objective of this review was to identify the hereditary conditions listed on Online Mendelian Inheritance in Man (OMIM) that have an associated enamel phenotype and whether a causative gene has been identified. The OMIM database was searched with the terms amelogenesis, enamel, dental, and tooth, and all results were screened by 2 individuals to determine if an enamel phenotype was identified. Gene and gene product function was reviewed on OMIM and from publications identified in PubMed. The search strategy revealed 91 conditions listed in OMIM as having an enamel phenotype, and of those, 71 have a known molecular etiology or linked genetic loci. The purported protein function of those conditions with a known genetic basis included enzymes, regulatory proteins, extracellular matrix proteins, transcription factors, and transmembrane proteins. The most common enamel phenotype was a deficient amount of enamel, or enamel hypoplasia, with hypomineralization defects being reported less frequently. Knowing these molecular defects allows an initial cataloging of molecular pathways that lead to hereditary enamel defects in humans. This knowledge provides insight into the diverse molecular pathways involved in enamel formation and can be useful when searching for the genetic etiology of hereditary conditions that involve enamel. PMID:25389004

  6. Convergent molecular defects underpin diverse neurodegenerative diseases.

    Science.gov (United States)

    Tofaris, George K; Buckley, Noel J

    2018-02-19

    In our ageing population, neurodegenerative disorders carry an enormous personal, societal and economic burden. Although neurodegenerative diseases are often thought of as clinicopathological entities, increasing evidence suggests a considerable overlap in the molecular underpinnings of their pathogenesis. Such overlapping biological processes include the handling of misfolded proteins, defective organelle trafficking, RNA processing, synaptic health and neuroinflammation. Collectively but in different proportions, these biological processes in neurons or non-neuronal cells lead to regionally distinct patterns of neuronal vulnerability and progression of pathology that could explain the disease symptomology. With the advent of patient-derived cellular models and novel genetic manipulation tools, we are now able to interrogate this commonality despite the cellular complexity of the brain in order to develop novel therapeutic strategies to prevent or arrest neurodegeneration. Here, we describe broadly these concepts and their relevance across neurodegenerative diseases. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  7. Physisorption of molecular hydrogen on carbon nanotube with vacant defects

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Gang; Shen, Huaze; Wang, Enge; Xu, Limei, E-mail: limei.xu@pku.edu.cn [International Center for Quantum Materials and School of Physics, Peking University, Beijing 100871 (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Tangpanitanon, Jirawat [University of Cambridge, Cambridge, Cambridgeshire CB2 1TP (United Kingdom); Wen, Bo [International Center for Quantum Materials and School of Physics, Peking University, Beijing 100871 (China); Beijing Computational Science Research Center, Heqing Street, Haidian District, Beijing 100084 (China); Xue, Jianming [State Key Laboratory of Nuclear Physics and Technology, School of Physics, Peking University, Beijing 100871 (China); Center for Applied Physics and Technology, Peking University, Beijing 100871 (China)

    2014-05-28

    Physisorption of molecular hydrogen on single-walled carbon nanotubes (SWCNTs) is important for its engineering applications and hydrogen energy storage. Using molecular dynamics simulation, we study the physisorption of molecular hydrogen on a SWCNT with a vacant defect, focusing on the effect of the vacant defect size and external parameters such as temperature and pressure. We find that hydrogen can be physisorbed inside a SWCNT through a vacant defect when the defect size is above a threshold. By controlling the size of the defects, we are able to extract hydrogen molecules from a gas mixture and store them inside the SWCNT. We also find that external parameters, such as low temperature and high pressure, enhance the physisorption of hydrogen molecules inside the SWCNT. In addition, the storage efficiency can be improved by introducing more defects, i.e., reducing the number of carbon atoms on the SWCNT.

  8. Physisorption of molecular hydrogen on carbon nanotube with vacant defects

    Science.gov (United States)

    Sun, Gang; Tangpanitanon, Jirawat; Shen, Huaze; Wen, Bo; Xue, Jianming; Wang, Enge; Xu, Limei

    2014-05-01

    Physisorption of molecular hydrogen on single-walled carbon nanotubes (SWCNTs) is important for its engineering applications and hydrogen energy storage. Using molecular dynamics simulation, we study the physisorption of molecular hydrogen on a SWCNT with a vacant defect, focusing on the effect of the vacant defect size and external parameters such as temperature and pressure. We find that hydrogen can be physisorbed inside a SWCNT through a vacant defect when the defect size is above a threshold. By controlling the size of the defects, we are able to extract hydrogen molecules from a gas mixture and store them inside the SWCNT. We also find that external parameters, such as low temperature and high pressure, enhance the physisorption of hydrogen molecules inside the SWCNT. In addition, the storage efficiency can be improved by introducing more defects, i.e., reducing the number of carbon atoms on the SWCNT.

  9. Physisorption of molecular hydrogen on carbon nanotube with vacant defects

    International Nuclear Information System (INIS)

    Sun, Gang; Shen, Huaze; Wang, Enge; Xu, Limei; Tangpanitanon, Jirawat; Wen, Bo; Xue, Jianming

    2014-01-01

    Physisorption of molecular hydrogen on single-walled carbon nanotubes (SWCNTs) is important for its engineering applications and hydrogen energy storage. Using molecular dynamics simulation, we study the physisorption of molecular hydrogen on a SWCNT with a vacant defect, focusing on the effect of the vacant defect size and external parameters such as temperature and pressure. We find that hydrogen can be physisorbed inside a SWCNT through a vacant defect when the defect size is above a threshold. By controlling the size of the defects, we are able to extract hydrogen molecules from a gas mixture and store them inside the SWCNT. We also find that external parameters, such as low temperature and high pressure, enhance the physisorption of hydrogen molecules inside the SWCNT. In addition, the storage efficiency can be improved by introducing more defects, i.e., reducing the number of carbon atoms on the SWCNT

  10. Clinicopathologic factors identify sporadic mismatch repair-defective colon cancers

    DEFF Research Database (Denmark)

    Halvarsson, Britta; Anderson, Harald; Domanska, Katarina

    2008-01-01

    Identification of sporadic mismatch repair (MMR)-defective colon cancers is increasingly demanded for decisions on adjuvant therapies. We evaluated clinicopathologic factors for the identification of these prognostically favorable tumors. Histopathologic features in 238 consecutive colon cancers...... and excluded 61.5% of the tumors from MMR testing. This clinicopathologic index thus successfully selects MMR-defective colon cancers. Udgivelsesdato: 2008-Feb...

  11. Estimates of point defect production in α-quartz using molecular dynamics simulations

    Science.gov (United States)

    Cowen, Benjamin J.; El-Genk, Mohamed S.

    2017-07-01

    Molecular dynamics (MD) simulations are performed to investigate the production of point defects in α-quartz by oxygen and silicon primary knock-on atoms (PKAs) of 0.25-2 keV. The Wigner-Seitz (WS) defect analysis is used to identify the produced vacancies, interstitials, and antisites, and the coordination defect analysis is used to identify the under and over-coordinated oxygen and silicon atoms. The defects at the end of the ballistic phase and the residual defects, after annealing, increase with increased PKA energy, and are statistically the same for the oxygen and silicon PKAs. The WS defect analysis results show that the numbers of the oxygen vacancies and interstitials (VO, Oi) at the end of the ballistic phase is the highest, followed closely by those of the silicon vacancies and interstitials (VSi, Sii). The number of the residual oxygen and silicon vacancies and interstitials are statistically the same. In addition, the under-coordinated OI and SiIII, which are the primary defects during the ballistic phase, have high annealing efficiencies (>89%). The over-coordinated defects of OIII and SiV, which are not nearly as abundant in the ballistic phase, have much lower annealing efficiencies (PKA energy.

  12. Extracting and identifying concrete structural defects in GPR images

    Science.gov (United States)

    Ye, Qiling; Jiao, Liangbao; Liu, Chuanxin; Cao, Xuehong; Huston, Dryver; Xia, Tian

    2018-03-01

    Traditionally most GPR data interpretations are performed manually. With the advancement of computing technologies, how to automate GPR data interpretation to achieve high efficiency and accuracy has become an active research subject. In this paper, analytical characterizations of major defects in concrete structures, including delamination, air void and moisture in GPR images, are performed. In the study, the image features of different defects are compared. Algorithms are developed for defect feature extraction and identification. For validations, both simulation results and field test data are utilized.

  13. Clinicopathologic factors identify sporadic mismatch repair-defective colon cancers

    DEFF Research Database (Denmark)

    Halvarsson, Britta; Anderson, Harald; Domanska, Katarina

    2008-01-01

    Identification of sporadic mismatch repair (MMR)-defective colon cancers is increasingly demanded for decisions on adjuvant therapies. We evaluated clinicopathologic factors for the identification of these prognostically favorable tumors. Histopathologic features in 238 consecutive colon cancers...

  14. Congenital heart defects in molecularly proven Kabuki syndrome patients.

    Science.gov (United States)

    Digilio, Maria Cristina; Gnazzo, Maria; Lepri, Francesca; Dentici, Maria Lisa; Pisaneschi, Elisa; Baban, Anwar; Passarelli, Chiara; Capolino, Rossella; Angioni, Adriano; Novelli, Antonio; Marino, Bruno; Dallapiccola, Bruno

    2017-11-01

    The prevalence of congenital heart defects (CHD) in Kabuki syndrome ranges from 28% to 80%. Between January 2012 and December 2015, 28 patients had a molecularly proven diagnosis of Kabuki syndrome. Pathogenic variants in KMT2D (MLL2) were detected in 27 patients, and in KDM6A gene in one. CHD was diagnosed in 19/27 (70%) patients with KMT2D (MLL2) variant, while the single patient with KDM6A change had a normal heart. The anatomic types among patients with CHD included aortic coarctation (4/19 = 21%) alone or associated with an additional CHD, bicuspid aortic valve (4/19 = 21%) alone or associated with an additional CHD, perimembranous subaortic ventricular septal defect (3/19 = 16%), atrial septal defect ostium secundum type (3/19 = 16%), conotruncal heart defects (3/19 = 16%). Additional CHDs diagnosed in single patients included aortic dilatation with mitral anomaly and hypoplastic left heart syndrome. We also reviewed CHDs in patients with a molecular diagnosis of Kabuki syndrome reported in the literature. In conclusion, a CHD is detected in 70% of patients with KMT2D (MLL2) pathogenic variants, most commonly left-sided obstructive lesions, including multiple left-sided obstructions similar to those observed in the spectrum of the Shone complex, and septal defects. Clinical management of Kabuki syndrome should include echocardiogram at the time of diagnosis, with particular attention to left-sided obstructive lesions and mitral anomalies, and annual monitoring for aortic arch dilatation. © 2017 Wiley Periodicals, Inc.

  15. Molecular-dynamics simulation of defect formation energy in boron nitride nanotubes

    International Nuclear Information System (INIS)

    Moon, W.H.; Hwang, H.J.

    2004-01-01

    We investigate the defect formation energy of boron nitride nanotubes (BNNTs) using molecular dynamics simulation. Although the defect with tetragon-octagon pairs (TOP) is favored in the flat BNNTs cap, BN clusters, and the growth of BNNTs, the formation energy of the TOP defect is significantly higher than that of the pentagon-heptagon pairs (PHP) defect in BNNTs. The PHP defect reduces the effect of the structural distortion caused by the TOP defect, in spite of homoelemental bonds. The instability of the TOP defect generates the structural transformation into BNNTs with no defect at about 1500 K. This mechanism shows that the TOP defect is less favored in case of BNNTs

  16. Displacement cascades and defects annealing in tungsten, Part I: Defect database from molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Setyawan, Wahyu [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Nandipati, Giridhar [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Roche, Kenneth J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Univ. of Washington, Seattle, WA (United States); Heinisch, Howard L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wirth, Brian D. [Univ. of Tennessee, Knoxville, TN (United States); Oak Ridge National Lab., Oak Ridge, TN (United States); Kurtz, Richard J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2015-07-01

    Molecular dynamics simulations have been used to generate a comprehensive database of surviving defects due to displacement cascades in bulk tungsten. Twenty-one data points of primary knock-on atom (PKA) energies ranging from 100 eV (sub-threshold energy) to 100 keV (~780×Ed, where Ed = 128 eV is the average displacement threshold energy) have been completed at 300 K, 1025 K and 2050 K. Within this range of PKA energies, two regimes of power-law energy-dependence of the defect production are observed. A distinct power-law exponent characterizes the number of Frenkel pairs produced within each regime. The two regimes intersect at a transition energy which occurs at approximately 250×Ed. The transition energy also marks the onset of the formation of large self-interstitial atom (SIA) clusters (size 14 or more). The observed defect clustering behavior is asymmetric, with SIA clustering increasing with temperature, while the vacancy clustering decreases. This asymmetry increases with temperature such that at 2050 K (~0.5Tm) practically no large vacancy clusters are formed, meanwhile large SIA clusters appear in all simulations. The implication of such asymmetry on the long-term defect survival and damage accumulation is discussed. In addition, <100> {110} SIA loops are observed to form directly in the highest energy cascades, while vacancy <100> loops are observed to form at the lowest temperature and highest PKA energies, although the appearance of both the vacancy and SIA loops with Burgers vector of <100> type is relatively rare.

  17. Feasibility of identifying families for genetic studies of birth defects using the National Health Interview Survey

    Directory of Open Access Journals (Sweden)

    Nolan Vikki G

    2004-05-01

    Full Text Available Abstract Background The purpose of this study was to determine whether the National Health Interview Survey is a useful source to identify informative families for genetic studies of birth defects. Methods The 1994/1995 National Health Interview Survey (NHIS was used to identify households where individuals with two or more birth defects reside. Four groups of households were identified: 1 single non-familial (one individual with one birth defect; 2 single familial (more than one individual with one birth defect; 3 multiple non-familial (one individual with more than one birth defect, and 4 multiple familial (more than one individual with more than one birth defect. The March 2000 U.S. Census on households was used to estimate the total number of households in which there are individuals with birth defects. Results Of a total of 28,094 households and surveyed about birth defects and impairments, 1,083 single non-familial, 55 multiple non-familial, 54 single familial, and 8 multiple familial households were identified. Based on the 2000 U.S. census, it is estimated that there are 4,472,385 households where at least one person has one birth defect in the United States and in 234,846 of them there are at least two affected individuals. Western states had the highest prevalence rates. Conclusions Population-based methods, such as the NHIS, are modestly useful to identify the number and the regions where candidate families for genetic studies of birth defects reside. Clinic based studies and birth defects surveillance systems that collect family history offer better probability of ascertainment.

  18. Impact of extended defects on recombination in CdTe heterostructures grown by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Zaunbrecher, Katherine N. [Department of Physics, Colorado State University, Fort Collins, Colorado 80523 (United States); National Renewable Energy Laboratory, Golden, Colorado 80401 (United States); Kuciauskas, Darius; Dippo, Pat; Barnes, Teresa M. [National Renewable Energy Laboratory, Golden, Colorado 80401 (United States); Swartz, Craig H.; Edirisooriya, Madhavie; Ogedengbe, Olanrewaju S.; Sohal, Sandeep; Hancock, Bobby L.; LeBlanc, Elizabeth G.; Jayathilaka, Pathiraja A. R. D.; Myers, Thomas H. [Materials Science, Engineering and Commercialization Program, Texas State University, San Marcos, Texas 78666 (United States)

    2016-08-29

    Heterostructures with CdTe and CdTe{sub 1-x}Se{sub x} (x ∼ 0.01) absorbers between two wider-band-gap Cd{sub 1-x}Mg{sub x}Te barriers (x ∼ 0.25–0.3) were grown by molecular beam epitaxy to study carrier generation and recombination in bulk materials with passivated interfaces. Using a combination of confocal photoluminescence (PL), time-resolved PL, and low-temperature PL emission spectroscopy, two extended defect types were identified and the impact of these defects on charge-carrier recombination was analyzed. The dominant defects identified by confocal PL were dislocations in samples grown on (211)B CdTe substrates and crystallographic twinning-related defects in samples on (100)-oriented InSb substrates. Low-temperature PL shows that twin-related defects have a zero-phonon energy of 1.460 eV and a Huang-Rhys factor of 1.50, while dislocation-dominated samples have a 1.473-eV zero-phonon energy and a Huang-Rhys factor of 1.22. The charge carrier diffusion length near both types of defects is ∼6 μm, suggesting that recombination is limited by diffusion dynamics. For heterostructures with a low concentration of extended defects, the bulk lifetime was determined to be 2.2 μs with an interface recombination velocity of 160 cm/s and an estimated radiative lifetime of 91 μs.

  19. Molecular dynamics simulation of defect formation during energetic Cu deposition

    International Nuclear Information System (INIS)

    Gilmore, Charles M.; Sprague, James A.

    2002-01-01

    The deposition of energetic Cu atoms from 5 to 80 eV onto (0 0 1) Cu was simulated with molecular dynamics. The Cu-Cu interaction potential was a spline of the embedded atom potential developed from equilibrium data, and the universal scattering potential. Incident Cu atoms substituted for first layer substrate atoms by an exchange process at energies as low as 5 eV. Incident Cu atoms of 20 eV penetrated to the second substrate layer, and 20 eV was sufficient energy to produce interstitial defects. Incident atoms of 80 eV penetrated to the third atomic layer, produced interstitials 12 atomic layers into the substrate by focused replacement collision sequences, and produced sputtered atoms with a 16% yield. Interstitial clusters of up to 7 atoms were observed. The observed mechanisms of film growth included: the direct deposition of atoms into film equilibrium atom positions, the exchange of substrate atoms to equilibrium film atoms positions, and the migration of interstitials to equilibrium film atom positions. The relative frequency of each process was a function of incident energy. Since all observed growth mechanisms resulted in film atoms in equilibrium atomic positions, these simulations suggest that stresses in homoepitaxial Cu thin films are due to point defects. Vacancies would produce tensile strain and interstitial atoms would produce compressive strain in the films. It is proposed that immobile interstitial clusters could be responsible for retaining interstitial atoms and clusters in growing metal thin films

  20. BDA: A novel method for identifying defects in body-centered cubic crystals.

    Science.gov (United States)

    Möller, Johannes J; Bitzek, Erik

    2016-01-01

    The accurate and fast identification of crystallographic defects plays a key role for the analysis of atomistic simulation output data. For face-centered cubic (fcc) metals, most existing structure analysis tools allow for the direct distinction of common defects, such as stacking faults or certain low-index surfaces. For body-centered cubic (bcc) metals, on the other hand, a robust way to identify such defects is currently not easily available. We therefore introduce a new method for analyzing atomistic configurations of bcc metals, the BCC Defect Analysis (BDA). It uses existing structure analysis algorithms and combines their results to uniquely distinguish between typical defects in bcc metals. In essence, the BDA method offers the following features:•Identification of typical defect structures in bcc metals.•Reduction of erroneously identified defects by iterative comparison to the defects in the atom's neighborhood.•Availability as ready-to-use Python script for the widespread visualization tool OVITO [http://ovito.org].

  1. Thermal buckling behavior of defective CNTs under pre-load: A molecular dynamics study.

    Science.gov (United States)

    Mehralian, Fahimeh; Tadi Beni, Yaghoub; Kiani, Yaser

    2017-05-01

    Current study is concentrated on the extraordinary properties of defective carbon nanotubes (CNTs). The role of vacancy defects in thermal buckling response of precompressed CNTs is explored via molecular dynamics (MD) simulations. Defective CNTs are initially compressed at a certain ratio of their critical buckling strain and then undergo a uniform temperature rise. Comprehensive study is implemented on both armchair and zigzag CNTs with different vacancy defects including monovacancy, symmetric bivacancy and asymmetric bivacancy. The results reveal that defects have a pronounced impact on the buckling behavior of CNTs; interestingly, defective CNTs under compressive pre-load show higher resistance to thermal buckling than pristine ones. In the following, the buckling response of defective CNTs is shown to be dependent on the vacancy defects, location of defects and chirality. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Autism in Phenylketonuria Patients: From Clinical Presentation to Molecular Defects.

    Science.gov (United States)

    Khemir, Sameh; Halayem, Soumeyya; Azzouz, Hatem; Siala, Hajer; Ferchichi, Maherzia; Guedria, Asma; Bedoui, Amel; Abdelhak, Sonia; Messaoud, Taieb; Tebib, Neji; Belhaj, Ahlem; Kaabachi, Naziha

    2016-06-01

    Autism has been reported in untreated patients with phenylketonuria. The authors aimed to explore autism in 15 Tunisian and 4 Algerian phenylketonuria patients, and report their clinical, biochemical and molecular peculiarities. The Childhood Autism Rating Scale and the Autism Diagnostic Interview-Revised were used for the diagnosis of autism. Five exons of phenylalanine hydroxylase gene (7, 6, 10, 11, and 5) were amplified by polymerase chain reaction and directly sequenced. Among these patients, 15 were suffering from autism at the time of evaluation. Six mutations were identified: p.E280K, p.G352Vfs, IVS10nt11, p.I224T, p.R261Q, and p.R252W. There was no correlation between autism and mutations affecting the phenylalanine hydroxylase gene, but the age of diet onset was the determining factor in autistic symptoms' evolution. © The Author(s) 2016.

  3. Correlation between electron-irradiation defects and applied stress in graphene: A molecular dynamics study

    Energy Technology Data Exchange (ETDEWEB)

    Kida, Shogo; Yamamoto, Masaya; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki, E-mail: yasuda@pe.osakafu-u.ac.jp [Department of Physics and Electronics, Osaka Prefecture University, Sakai, Osaka 599-8531 (Japan); Tada, Kazuhiro [Department of Electrical and Control Systems Engineering, National Institute of Technology, Toyama College, Toyama 939-8630 (Japan)

    2015-09-15

    Molecular dynamics (MD) simulations are performed to study the correlation between electron irradiation defects and applied stress in graphene. The electron irradiation effect is introduced by the binary collision model in the MD simulation. By applying a tensile stress to graphene, the number of adatom-vacancy (AV) and Stone–Wales (SW) defects increase under electron irradiation, while the number of single-vacancy defects is not noticeably affected by the applied stress. Both the activation and formation energies of an AV defect and the activation energy of an SW defect decrease when a tensile stress is applied to graphene. Applying tensile stress also relaxes the compression stress associated with SW defect formation. These effects induced by the applied stress cause the increase in AV and SW defect formation under electron irradiation.

  4. Process and device for identifying nuclear reactor neutron absorber rod etancheity defect

    International Nuclear Information System (INIS)

    Pelletier, J.; Parrat, D.

    1990-01-01

    For identifying defects in the sealing of neutron absorbing rods. The rod is placed in a pressure tight enclosure filled with a chemically agressive solution. After a time the pressure is released to allow the solution come out of the rod. An analysis of the solution allows the detection of radioactive isotopes of metals which are in the rod [fr

  5. Proteomic-based detection of a protein cluster dysregulated during cardiovascular development identifies biomarkers of congenital heart defects.

    Directory of Open Access Journals (Sweden)

    Anjali K Nath

    Full Text Available Cardiovascular development is vital for embryonic survival and growth. Early gestation embryo loss or malformation has been linked to yolk sac vasculopathy and congenital heart defects (CHDs. However, the molecular pathways that underlie these structural defects in humans remain largely unknown hindering the development of molecular-based diagnostic tools and novel therapies.Murine embryos were exposed to high glucose, a condition known to induce cardiovascular defects in both animal models and humans. We further employed a mass spectrometry-based proteomics approach to identify proteins differentially expressed in embryos with defects from those with normal cardiovascular development. The proteins detected by mass spectrometry (WNT16, ST14, Pcsk1, Jumonji, Morca2a, TRPC5, and others were validated by Western blotting and immunoflorescent staining of the yolk sac and heart. The proteins within the proteomic dataset clustered to adhesion/migration, differentiation, transport, and insulin signaling pathways. A functional role for several proteins (WNT16, ADAM15 and NOGO-A/B was demonstrated in an ex vivo model of heart development. Additionally, a successful application of a cluster of protein biomarkers (WNT16, ST14 and Pcsk1 as a prenatal screen for CHDs was confirmed in a study of human amniotic fluid (AF samples from women carrying normal fetuses and those with CHDs.The novel finding that WNT16, ST14 and Pcsk1 protein levels increase in fetuses with CHDs suggests that these proteins may play a role in the etiology of human CHDs. The information gained through this bed-side to bench translational approach contributes to a more complete understanding of the protein pathways dysregulated during cardiovascular development and provides novel avenues for diagnostic and therapeutic interventions, beneficial to fetuses at risk for CHDs.

  6. Nonlinear effects in defect production by atomic and molecular ion implantation

    International Nuclear Information System (INIS)

    David, C.; Dholakia, Manan; Chandra, Sharat; Nair, K. G. M.; Panigrahi, B. K.; Amirthapandian, S.; Amarendra, G.; Varghese Anto, C.; Santhana Raman, P.; Kennedy, John

    2015-01-01

    This report deals with studies concerning vacancy related defects created in silicon due to implantation of 200 keV per atom aluminium and its molecular ions up to a plurality of 4. The depth profiles of vacancy defects in samples in their as implanted condition are carried out by Doppler broadening spectroscopy using low energy positron beams. In contrast to studies in the literature reporting a progressive increase in damage with plurality, implantation of aluminium atomic and molecular ions up to Al 3 , resulted in production of similar concentration of vacancy defects. However, a drastic increase in vacancy defects is observed due to Al 4 implantation. The observed behavioural trend with respect to plurality has even translated to the number of vacancies locked in vacancy clusters, as determined through gold labelling experiments. The impact of aluminium atomic and molecular ions simulated using MD showed a monotonic increase in production of vacancy defects for cluster sizes up to 4. The trend in damage production with plurality has been explained on the basis of a defect evolution scheme in which for medium defect concentrations, there is a saturation of the as-implanted damage and an increase for higher defect concentrations

  7. A targeted sequencing panel identifies rare damaging variants in multiple genes in the cranial neural tube defect, anencephaly.

    Science.gov (United States)

    Ishida, M; Cullup, T; Boustred, C; James, C; Docker, J; English, C; Lench, N; Copp, A J; Moore, G E; Greene, N D E; Stanier, P

    2018-04-01

    Neural tube defects (NTDs) affecting the brain (anencephaly) are lethal before or at birth, whereas lower spinal defects (spina bifida) may lead to lifelong neurological handicap. Collectively, NTDs rank among the most common birth defects worldwide. This study focuses on anencephaly, which despite having a similar frequency to spina bifida and being the most common type of NTD observed in mouse models, has had more limited inclusion in genetic studies. A genetic influence is strongly implicated in determining risk of NTDs and a molecular diagnosis is of fundamental importance to families both in terms of understanding the origin of the condition and for managing future pregnancies. Here we used a custom panel of 191 NTD candidate genes to screen 90 patients with cranial NTDs (n = 85 anencephaly and n = 5 craniorachischisis) with a targeted exome sequencing platform. After filtering and comparing to our in-house control exome database (N = 509), we identified 397 rare variants (minor allele frequency, MAF < 1%), 21 of which were previously unreported and predicted damaging. This included 1 frameshift (PDGFRA), 2 stop-gained (MAT1A; NOS2) and 18 missense variations. Together with evidence for oligogenic inheritance, this study provides new information on the possible genetic causation of anencephaly. © 2017 The Authors. Clinical Genetics published by John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Identifying Structural Flow Defects in Disordered Solids Using Machine-Learning Methods

    Science.gov (United States)

    Cubuk, E. D.; Schoenholz, S. S.; Rieser, J. M.; Malone, B. D.; Rottler, J.; Durian, D. J.; Kaxiras, E.; Liu, A. J.

    2015-03-01

    We use machine-learning methods on local structure to identify flow defects—or particles susceptible to rearrangement—in jammed and glassy systems. We apply this method successfully to two very different systems: a two-dimensional experimental realization of a granular pillar under compression and a Lennard-Jones glass in both two and three dimensions above and below its glass transition temperature. We also identify characteristics of flow defects that differentiate them from the rest of the sample. Our results show it is possible to discern subtle structural features responsible for heterogeneous dynamics observed across a broad range of disordered materials.

  9. Molecular marker studies in riverine buffaloes, for characterization and diagnosis of genetic defects

    International Nuclear Information System (INIS)

    Yadav, B.R.

    2005-01-01

    The buffalo is probably the last livestock species to have been domesticated, with many genetic, physiological and behavioural traits not yet well understood. Molecular markers have been used for characterizing animals and breeds, diagnosing diseases and identifying anatomical and physiological anomalies. RFLP studies showed low heterozygosity, but genomic and oligonucleotide probes showed species-specific bands useful for identification of carcass or other unknown samples. Use of RAPD revealed band frequencies, band sharing frequencies, genetic distances, and genetic and identity indexes in different breeds. Bovine microsatellite primers indicate that 70.9% of bovine loci were conserved in buffalo. Allele numbers, sizes, frequencies, heterozygosity and polymorphism information content showed breed-specific patterns. Different marker types - genomic and oligonucleotide probes, RAPD and microsatellites - are useful in parent identification. Individual specific DNA fingerprinting techniques were applied with twin-born animal (XX/XY) chimerism, sex identification, anatomically defective and XO individuals. Molecular markers are a potential tool for geneticists and breeders to evaluate existing germplasm and to manipulate it to develop character-specific strains and to provide the basis for effective genetic conservation. (author)

  10. Molecular dynamics study of vacancy-like defects in a model glass : static behaviour

    Science.gov (United States)

    Delaye, J. M.; Limoge, Y.

    1993-10-01

    The possibility of defining vacancy-like defects in a Lennard-Jones glass is searched for in a systematic manner. Considering different relaxation levels of the same system, as well as different external pressures, we use a Molecular Dynamics simulation method, to study at constant volume or external pressure, the relaxation of a “piece” of glass, after the sudden removal of an atom. Three typical kinds of behaviour can be observed: the persistence of the empty volume left by the missing atom, its migration by clearly identifiable atomic jumps and the dissipation “on the spot”. A careful analysis of the probabilities of these three kinds of behaviour shows that a meaningful definition of vacancy-like defects can be given in a Lennard-Jones glass. Dans cet article, nous nous penchons de façon systématique sur la possibilité de définir des défauts de type lacunaire dans un verre de Lennard-Jones, à différents niveaux de relaxation et de pression, par une méthode de simulation numérique en dynamique moléculaire à volume ou à pression constants. Le défaut est créé en supprimant un atome et en suivant la réponse du système. Nous observons trois comportements typiques : la persistance sur place du “trou” laissé par l'atome supprimé, sa migration par des sauts atomiques clairement identifiés et enfin sa dissipation sur place. Une analyse détaillée de ces trois comportements montre qu'il est possible dans un verre de Lennard-Jones de définir des défauts de type lacunaire.

  11. Molecular dynamics simulations of high energy cascade in ordered alloys: Defect production and subcascade division

    Energy Technology Data Exchange (ETDEWEB)

    Crocombette, Jean-Paul, E-mail: jpcrocombette@cea.fr [CEA, DEN, Service de Recherches de Métallurgie Physique, UPSay, F-91191 Gif-sur-Yvette (France); Van Brutzel, Laurent [CEA, DEN, Service de Corrosion et du Comportement des Matériaux dans leur Environnement, UPSay, F-91191 Gif-sur-Yvette (France); Simeone, David [CEA, DEN, Service de Recherches de Métallurgie Appliqué, Matériaux Fonctionnels pour l' Energie, CNRS-CEA-ECP, UPSay, F-91191 Gif-sur-Yvette (France); Luneville, Laurence [CEA, DEN, Service d' Etudes des Réacteurs et de Mathématiques Appliquées, Matériaux Fonctionnels pour l' Energie, CNRS-CEA-ECP, UPSay, F-91191 Gif-sur-Yvette (France)

    2016-06-15

    Displacement cascades have been calculated in two ordered alloys (Ni{sub 3}Al and UO{sub 2}) in the molecular dynamics framework using the CMDC (Cell Molecular Dynamics for Cascade) code (J.-P. Crocombette and T. Jourdan, Nucl. Instrum. Meth. B 352, 9 (2015)) for energies ranking between 0.1 and 580 keV. The defect production has been compared to the prediction of the NRT (Norgett, Robinson and Torrens) standard. One observes a decrease with energy of the number of defects compared to the NRT prediction at intermediate energies but, unlike what is commonly observed in elemental solids, the number of produced defects does not always turn to a linear variation with ballistic energy at high energies. The fragmentation of the cascade into subcascades has been studied through the analysis of surviving defect pockets. It appears that the common knowledge equivalence of linearity of defect production and subcascades division does not hold in general for alloys. We calculate the average number of subcascades and average number of defects per subcascades as a function of ballistic energy. We find an unexpected variety of behaviors for these two average quantities above the threshold for subcascade formation.

  12. Molecular dynamics simulations of high energy cascade in ordered alloys: Defect production and subcascade division

    International Nuclear Information System (INIS)

    Crocombette, Jean-Paul; Van Brutzel, Laurent; Simeone, David; Luneville, Laurence

    2016-01-01

    Displacement cascades have been calculated in two ordered alloys (Ni_3Al and UO_2) in the molecular dynamics framework using the CMDC (Cell Molecular Dynamics for Cascade) code (J.-P. Crocombette and T. Jourdan, Nucl. Instrum. Meth. B 352, 9 (2015)) for energies ranking between 0.1 and 580 keV. The defect production has been compared to the prediction of the NRT (Norgett, Robinson and Torrens) standard. One observes a decrease with energy of the number of defects compared to the NRT prediction at intermediate energies but, unlike what is commonly observed in elemental solids, the number of produced defects does not always turn to a linear variation with ballistic energy at high energies. The fragmentation of the cascade into subcascades has been studied through the analysis of surviving defect pockets. It appears that the common knowledge equivalence of linearity of defect production and subcascades division does not hold in general for alloys. We calculate the average number of subcascades and average number of defects per subcascades as a function of ballistic energy. We find an unexpected variety of behaviors for these two average quantities above the threshold for subcascade formation.

  13. Investigation of impurity defects in α-iron by molecular dynamics method

    International Nuclear Information System (INIS)

    Kevorkyan, Yu.R.

    1986-01-01

    Investigation of the configuration of impurity defects in α-iron by the molecular dynamics method is presented. The Jhonson model potential has been used to calculate the interaction of matrix atoms. The impurity-matrix atom interaction is described by the same form of the potential shifted along the axis of interatomic distances for a definite value. The correspondence between the shift value and change in the radius of the impurity defect is established on the basis of calculation of the relaxation volume. Possible configurations of the impurity - interstitial matrix atom complexes are obtained for the given model of the impurity defect, dimensional boundaries of possible transitions between different configurations are determined. Formation and bound energies, relaxation volumes of impurity defects are calculated

  14. Large-Scale Molecular Simulations on the Mechanical Response and Failure Behavior of a defective Graphene: Cases of 5-8-5 Defects

    Science.gov (United States)

    Wang, Shuaiwei; Yang, Baocheng; Yuan, Jinyun; Si, Yubing; Chen, Houyang

    2015-10-01

    Understanding the effect of defects on mechanical responses and failure behaviors of a graphene membrane is important for its applications. As examples, in this paper, a family of graphene with various 5-8-5 defects are designed and their mechanical responses are investigated by employing molecular dynamics simulations. The dependence of fracture strength and strain as well as Young’s moduli on the nearest neighbor distance and defect types is examined. By introducing the 5-8-5 defects into graphene, the fracture strength and strain become smaller. However, the Young’s moduli of DL (Linear arrangement of repeat unit 5-8-5 defect along zigzag-direction of graphene), DS (a Slope angle between repeat unit 5-8-5 defect and zigzag direction of graphene) and DZ (Zigzag-like 5-8-5 defects) defects in the zigzag direction become larger than those in the pristine graphene in the same direction. A maximum increase of 11.8% of Young’s modulus is obtained. Furthermore, the brittle cracking mechanism is proposed for the graphene with 5-8-5 defects. The present work may provide insights in controlling the mechanical properties by preparing defects in the graphene, and give a full picture for the applications of graphene with defects in flexible electronics and nanodevices.

  15. A comparison of neural tube defects identified by two independent routine recording systems for congenital malformations in Northern Ireland.

    Science.gov (United States)

    Nevin, N C; McDonald, J R; Walby, A L

    1978-12-01

    The efficiency of two systems for recording congenital malformations has been compared; one system, the Registrar General's Congenital Malformation Notification, is based on registering all malformed infants, and the other, the Child Health System, records all births. In Northern Ireland for three years [1974--1976], using multiple sources of ascertainment, a total of 686 infants with neural tube defects was identified among 79 783 live and stillbirths. The incidence for all neural tube defects in 8 60 per 1 000 births. The Registrar General's Congenital Malformation Notification System identified 83.6% whereas the Child Health System identified only 63.3% of all neural tube defects. Both systems together identified 86.2% of all neural tube defects. The two systems are suitable for monitoring of malformations and the addition of information from the Genetic Counselling Clinics would enhance the data for epidemiological studies.

  16. Disorder and defect formation mechanisms in molecular-beam-epitaxy grown silicon epilayers

    International Nuclear Information System (INIS)

    Akbari-Sharbaf, Arash; Baribeau, Jean-Marc; Wu, Xiaohua; Lockwood, David J.; Fanchini, Giovanni

    2013-01-01

    We investigate the role of disorder, stress and crystallite size in determining the density of defects in disordered and partially ordered silicon thin films deposited at low or moderate temperatures by molecular beam epitaxy. We find that the paramagnetic defect density measured by electron spin resonance (ESR) is strongly dependent on the growth temperature of the films, decreasing from ∼ 2 · 10 19 cm −3 at 98 °C to ∼ 1 · 10 18 cm −3 at 572 °C. The physical nature of the defects is strongly dependent on the range of order in the films: ESR spectra consistent with dangling bonds in an amorphous phase are observed at the lowest temperatures, while the ESR signal gradually becomes more anisotropic as medium-range order improves and the stress level (measured both by X-ray diffraction and Raman spectroscopy) is released in more crystalline films. Anisotropic ESR spectra consistent with paramagnetic defects embedded in an epitaxial phase are observed at the highest growth temperature (572 °C). - Highlights: ► Disordered Si epilayers were grown by molecular beam epitaxy. ► Growth has been carried out at temperatures T = 98 °C–514 °C. ► A correlation between defect density and disorder in the films has been found. ► Lack of medium range order and stress cause the formation of defects at low T. ► At high T, defects are associated to grain boundaries and oriented stacking faults

  17. Role of the bond defect for structural transformations between crystalline and amorphous silicon: A molecular-dynamics study

    International Nuclear Information System (INIS)

    Stock, D. M.; Weber, B.; Gaertner, K.

    2000-01-01

    The relation between the bond defect, which is a topological defect, and structural transformations between crystalline and amorphous silicon, is studied by molecular-dynamics simulations. The investigation of 1-keV boron implantation into crystalline silicon proves that the bond defect can also be generated directly by collisional-induced bond switching in addition to its formation by incomplete recombination of primary defects. This supports the assumption that the bond defect may play an important role in the amorphization process of silicon by light ions. The analysis of the interface between (001) silicon and amorphous silicon shows that there are two typical defect configurations at the interface which result from two different orientations of the bond defect with respect to the interface. Thus the bond defect appears to be a characteristic structural feature of the interface. Moreover, annealing results indicate that the bond defect acts as a growth site for interface-mediated crystallization

  18. A large-scale molecular dynamics study of the divacancy defect in graphene

    International Nuclear Information System (INIS)

    Leyssale, Jean-Marc; Vignoles, Gerard L.

    2014-01-01

    We report on the dynamical behavior of single divacancy defects in large graphene sheets as studied by extensive classical molecular dynamics (MD) simulations at high temperatures and static calculations. In the first part of the paper, the ability of the used interatomic potential to properly render the stability and dynamics (energy barriers) of such defects is validated against electronic structure calculations from the literature. Then, results from MD simulations are presented. In agreement with recent TEM studies, some mobility is observed through a series of Stone-Wales-like bond rotations involving the 5-8-5, 555-777, and 5555-6-7777 reconstructions. Although these three structures are by far the most probable structures of the DV defect, not less than 18 other full reconstructions, including the experimentally observed 55-66-77 defect, were occasionally observed in the ∼1.5 μs of MD trajectories analyzed in this work. Most of these additional reconstructions have moderate formation energies and can be formed by a bond rotation mechanism from one of the aforementioned structures, with a lower activation energy than the one required to form a Stone-Wales defect in graphene. Therefore their future experimental observation is highly probable. The results presented here also suggest that the barrier to a conventional Stone-Wales transformation (the formation of two pentagon/heptagon pairs from four hexagons) can be significantly reduced in the vicinity of an existing defect, strengthening a recently proposed melting mechanism for graphene based on the aggregation of Stone-Wales defects. From a structural point of view, in addition to pentagons, heptagons, and octagons, these new DV reconstructions can also contain four- and nine-member rings and show a particularly large spatial extent of up to 13 rings (42 atoms) against three (14 atoms) for the original 5-8-5 defect. (authors)

  19. Thermodynamical analyses of molecular simulations of dislocation-defect interactions: simulations at 0 K

    International Nuclear Information System (INIS)

    Monnet, G.

    2008-01-01

    Full text of publication follows. Static molecular (SM) simulations of dislocation-defect interaction are analysed through a framework of different interaction regimes, in which the applied work has different roles. In most regimes, the applied work is transformed into elastic energy, a dissipative energy resulting from the lattice friction and a large quantity of energy needed to enable the dislocation to bow out when it is pinned by the defect. While the dissipative work is entirely evacuated in SM simulations, the elastic and curvature energies contribute to a large increase of the internal energy of the system. A method is presented in this work to evaluate the curvature energy and the result is compared to prediction of the line tension model. These analyses allow the determination of the dislocation-defect interaction energy. (author)

  20. Molecular dynamics calculations of defect energetics in β-SiC

    International Nuclear Information System (INIS)

    Huang, H.; El-Azab, A.; Ghoniem, N.

    1993-01-01

    The Molecular Dynamics (MD) method is used to calculate defect energetics in β-silicon carbide. Many-body interaction effects in this covalent material are accounted for by using a hybrid of two-body and three-body potentials. Calculated bulk properties of β-SiC based on this potential are in agreement with experimental data to within 17%. A micro-crystal is constructed to represent the computational cell and external forces are applied to the micro-crystal so that it behaves as a part of an infinite medium. The potential energy for the unperturbed computational cell is first calculated. The cell is then set at a defect configuration and relaxed, and the potential energy of the relaxed cell is calculated. The difference between the potential energy of the unperturbed cell and that of the defect-containing cell is used to calculate the formation and binding energies of point defects, defect clusters and helium-vacancy clusters in SiC

  1. Three-dimensional interactive Molecular Dynamics program for the study of defect dynamics in crystals

    Science.gov (United States)

    Patriarca, M.; Kuronen, A.; Robles, M.; Kaski, K.

    2007-01-01

    The study of crystal defects and the complex processes underlying their formation and time evolution has motivated the development of the program ALINE for interactive molecular dynamics experiments. This program couples a molecular dynamics code to a Graphical User Interface and runs on a UNIX-X11 Window System platform with the MOTIF library, which is contained in many standard Linux releases. ALINE is written in C, thus giving the user the possibility to modify the source code, and, at the same time, provides an effective and user-friendly framework for numerical experiments, in which the main parameters can be interactively varied and the system visualized in various ways. We illustrate the main features of the program through some examples of detection and dynamical tracking of point-defects, linear defects, and planar defects, such as stacking faults in lattice-mismatched heterostructures. Program summaryTitle of program:ALINE Catalogue identifier:ADYJ_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADYJ_v1_0 Program obtainable from: CPC Program Library, Queen University of Belfast, N. Ireland Computer for which the program is designed and others on which it has been tested: Computers:DEC ALPHA 300, Intel i386 compatible computers, G4 Apple Computers Installations:Laboratory of Computational Engineering, Helsinki University of Technology, Helsinki, Finland Operating systems under which the program has been tested:True64 UNIX, Linux-i386, Mac OS X 10.3 and 10.4 Programming language used:Standard C and MOTIF libraries Memory required to execute with typical data:6 Mbytes but may be larger depending on the system size No. of lines in distributed program, including test data, etc.:16 901 No. of bytes in distributed program, including test data, etc.:449 559 Distribution format:tar.gz Nature of physical problem:Some phenomena involving defects take place inside three-dimensional crystals at times which can be hardly predicted. For this reason they are

  2. Genomic analyses identify molecular subtypes of pancreatic cancer.

    Science.gov (United States)

    Bailey, Peter; Chang, David K; Nones, Katia; Johns, Amber L; Patch, Ann-Marie; Gingras, Marie-Claude; Miller, David K; Christ, Angelika N; Bruxner, Tim J C; Quinn, Michael C; Nourse, Craig; Murtaugh, L Charles; Harliwong, Ivon; Idrisoglu, Senel; Manning, Suzanne; Nourbakhsh, Ehsan; Wani, Shivangi; Fink, Lynn; Holmes, Oliver; Chin, Venessa; Anderson, Matthew J; Kazakoff, Stephen; Leonard, Conrad; Newell, Felicity; Waddell, Nick; Wood, Scott; Xu, Qinying; Wilson, Peter J; Cloonan, Nicole; Kassahn, Karin S; Taylor, Darrin; Quek, Kelly; Robertson, Alan; Pantano, Lorena; Mincarelli, Laura; Sanchez, Luis N; Evers, Lisa; Wu, Jianmin; Pinese, Mark; Cowley, Mark J; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chantrill, Lorraine A; Mawson, Amanda; Humphris, Jeremy; Chou, Angela; Pajic, Marina; Scarlett, Christopher J; Pinho, Andreia V; Giry-Laterriere, Marc; Rooman, Ilse; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Merrett, Neil D; Toon, Christopher W; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Moran-Jones, Kim; Jamieson, Nigel B; Graham, Janet S; Duthie, Fraser; Oien, Karin; Hair, Jane; Grützmann, Robert; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Corbo, Vincenzo; Bassi, Claudio; Rusev, Borislav; Capelli, Paola; Salvia, Roberto; Tortora, Giampaolo; Mukhopadhyay, Debabrata; Petersen, Gloria M; Munzy, Donna M; Fisher, William E; Karim, Saadia A; Eshleman, James R; Hruban, Ralph H; Pilarsky, Christian; Morton, Jennifer P; Sansom, Owen J; Scarpa, Aldo; Musgrove, Elizabeth A; Bailey, Ulla-Maja Hagbo; Hofmann, Oliver; Sutherland, Robert L; Wheeler, David A; Gill, Anthony J; Gibbs, Richard A; Pearson, John V; Waddell, Nicola; Biankin, Andrew V; Grimmond, Sean M

    2016-03-03

    Integrated genomic analysis of 456 pancreatic ductal adenocarcinomas identified 32 recurrently mutated genes that aggregate into 10 pathways: KRAS, TGF-β, WNT, NOTCH, ROBO/SLIT signalling, G1/S transition, SWI-SNF, chromatin modification, DNA repair and RNA processing. Expression analysis defined 4 subtypes: (1) squamous; (2) pancreatic progenitor; (3) immunogenic; and (4) aberrantly differentiated endocrine exocrine (ADEX) that correlate with histopathological characteristics. Squamous tumours are enriched for TP53 and KDM6A mutations, upregulation of the TP63∆N transcriptional network, hypermethylation of pancreatic endodermal cell-fate determining genes and have a poor prognosis. Pancreatic progenitor tumours preferentially express genes involved in early pancreatic development (FOXA2/3, PDX1 and MNX1). ADEX tumours displayed upregulation of genes that regulate networks involved in KRAS activation, exocrine (NR5A2 and RBPJL), and endocrine differentiation (NEUROD1 and NKX2-2). Immunogenic tumours contained upregulated immune networks including pathways involved in acquired immune suppression. These data infer differences in the molecular evolution of pancreatic cancer subtypes and identify opportunities for therapeutic development.

  3. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    Science.gov (United States)

    2011-01-01

    Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples). Four distinct clusters were identified by Principal Components Analysis (PCA) in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples) using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p INSS stage 4 and/or dead of disease, p < 0.05, Fisher's exact test). Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group's specific characteristics. PMID:21492432

  4. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    Directory of Open Access Journals (Sweden)

    Kogner Per

    2011-04-01

    Full Text Available Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB; Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples. Four distinct clusters were identified by Principal Components Analysis (PCA in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p ALK, BIRC5, and PHOX2B, and was significantly associated with higher tumour stage, poor outcome and poor survival compared to the Type 1-corresponding favourable group (INSS stage 4 and/or dead of disease, p Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group's specific characteristics.

  5. Pluripotent cell models of fanconi anemia identify the early pathological defect in human hemoangiogenic progenitors.

    Science.gov (United States)

    Suzuki, Naoya M; Niwa, Akira; Yabe, Miharu; Hira, Asuka; Okada, Chihiro; Amano, Naoki; Watanabe, Akira; Watanabe, Ken-Ichiro; Heike, Toshio; Takata, Minoru; Nakahata, Tatsutoshi; Saito, Megumu K

    2015-04-01

    Fanconi anemia (FA) is a disorder of genomic instability characterized by progressive bone marrow failure (BMF), developmental abnormalities, and an increased susceptibility to cancer. Although various consequences in hematopoietic stem/progenitor cells have been attributed to FA-BMF, the quest to identify the initial pathological event is still ongoing. To address this issue, we established induced pluripotent stem cells (iPSCs) from fibroblasts of six patients with FA and FANCA mutations. An improved reprogramming method yielded iPSC-like colonies from all patients, and iPSC clones were propagated from two patients. Quantitative evaluation of the differentiation ability demonstrated that the differentiation propensity toward the hematopoietic and endothelial lineages is already defective in early hemoangiogenic progenitors. The expression levels of critical transcription factors were significantly downregulated in these progenitors. These data indicate that the hematopoietic consequences in FA patients originate from the early hematopoietic stage and highlight the potential usefulness of iPSC technology for elucidating the pathogenesis of FA-BMF. ©AlphaMed Press.

  6. Identifying the influence of the intrinsic defects in Gd-doped ZnO thin-films

    KAUST Repository

    Flemban, Tahani H.; Sequeira, M. C.; Zhang, Z.; Venkatesh, S.; Alves, E.; Lorenz, K.; Roqan, Iman S.

    2016-01-01

    Gd-doped ZnO thin films were prepared using pulsed laser deposition at different oxygen pressures and varied Gd concentrations. The effects of oxygen deficiency-related defects on the Gd incorporation, optical and structural properties, were explored by studying the impact of oxygen pressure during deposition and post-growth thermal annealing in vacuum. Rutherford Backscattering Spectrometry revealed that the Gd concentration increases with increasing oxygen pressure for samples grown with the same Gd-doped ZnO target. Unexpectedly, the c-lattice parameter of the samples tends to decrease with increasing Gd concentration, suggesting that Gd-defect complexes play an important role in the structural properties. Using low-temperature photoluminescence(PL), Raman measurements and density functional theory calculations, we identified oxygen vacancies as the dominant intrinsic point defects. PL spectra show a defect band related to oxygen vacancies for samples grown at oxygen deficiency.

  7. Identifying the influence of the intrinsic defects in Gd-doped ZnO thin-films

    KAUST Repository

    Flemban, Tahani H.

    2016-02-08

    Gd-doped ZnO thin films were prepared using pulsed laser deposition at different oxygen pressures and varied Gd concentrations. The effects of oxygen deficiency-related defects on the Gd incorporation, optical and structural properties, were explored by studying the impact of oxygen pressure during deposition and post-growth thermal annealing in vacuum. Rutherford Backscattering Spectrometry revealed that the Gd concentration increases with increasing oxygen pressure for samples grown with the same Gd-doped ZnO target. Unexpectedly, the c-lattice parameter of the samples tends to decrease with increasing Gd concentration, suggesting that Gd-defect complexes play an important role in the structural properties. Using low-temperature photoluminescence(PL), Raman measurements and density functional theory calculations, we identified oxygen vacancies as the dominant intrinsic point defects. PL spectra show a defect band related to oxygen vacancies for samples grown at oxygen deficiency.

  8. A molecular dynamics simulation study of irradiation induced defects in gold nanowire

    Science.gov (United States)

    Liu, Wenqiang; Chen, Piheng; Qiu, Ruizhi; Khan, Maaz; Liu, Jie; Hou, Mingdong; Duan, Jinglai

    2017-08-01

    Displacement cascade in gold nanowires was studied using molecular dynamics computer simulations. Primary knock-on atoms (PKAs) with different kinetic energies were initiated either at the surface or at the center of the nanowires. We found three kinds of defects that were induced by the cascade, including point defects, stacking faults and crater at the surface. The starting points of PKAs influence the number of residual point defects, and this consequently affect the boundary of anti-radiation window which was proposed by calculation of diffusion of point defects to the free surface of nanowires. Formation of stacking faults that expanded the whole cross-section of gold nanowires was observed when the PKA's kinetic energy was higher than 5 keV. Increasing the PKA's kinetic energy up to more than 10 keV may lead to the formation of crater at the surface of nanowires due to microexplosion of hot atoms. At this energy, PKAs started from the center of nanowires can also result in the creation of crater because length of cascade region is comparable to diameter of nanowires. Both the two factors, namely initial positions of PKAs as well as the craters induced by higher energy irradiation, would influence the ability of radiation resistance of metal nanowires.

  9. Positron annihilation studies of defects in molecular beam epitaxy grown III-V layers

    International Nuclear Information System (INIS)

    Umlor, M.T.; Keeble, D.J.; Cooke, P.W.

    1994-01-01

    A summary of recent positron annihilation experiments on molecular beam epitaxy (MBE) grown III-V layers is Presented. Variable energy positron beam measurements on Al 0.32 Ga 0.68 As undoped and Si doped have been completed. Positron trapping at a open volume defect in Al 0.32 Ga 0.68 :Si for temperatures from 300 to 25 K in the dark was observed. The positron trap was lost after 1.3 eV illumination at 25K. These results indicate an open volume defect is associated with the local structure of the deep donor state of the DX center. Stability of MBE GaAs to thermal annealing war, investigated over the temperature range of 230 to 700 degrees C, Proximity wafer furnace anneals in flowing argon were used, Samples grown above 450 degrees C were shown to be stable but for sample below this temperature an anneal induced vacancy related defect was produced for anneals between 400 and 500 degrees C. The nature of the defect was shown to be different for material grown at 350 and 230 degrees C. Activation energies of 2.5 eV to 2.3 eV were obtained from isochronal anneal experiments for samples grown at 350 and 230 degrees C, respectively

  10. USING THE PARETO DIAGRAM AND FMEA (FAILURE MODE AND EFFECTS ANALYSIS TO IDENTIFY KEY DEFECTS IN A PRODUCT

    Directory of Open Access Journals (Sweden)

    Michał ZASADZIEŃ

    2014-10-01

    Full Text Available The article presents the results of studies conducted in a company manufacturing aluminium forgings for the automotive industry. The aim of the research was to identify the defects which form during the production process as well as the locations and causes of their occurrence. Selected quality management tools were used in the process. Based on the FMEA and the costs generated by the identified defects, a hierarchy of them was created for the company along with a proposal of improvements in case of the most significant ones in order to reduce their number and increase the detection efficiency.

  11. A 6-gene signature identifies four molecular subgroups of neuroblastoma

    LENUS (Irish Health Repository)

    Abel, Frida

    2011-04-14

    Abstract Background There are currently three postulated genomic subtypes of the childhood tumour neuroblastoma (NB); Type 1, Type 2A, and Type 2B. The most aggressive forms of NB are characterized by amplification of the oncogene MYCN (MNA) and low expression of the favourable marker NTRK1. Recently, mutations or high expression of the familial predisposition gene Anaplastic Lymphoma Kinase (ALK) was associated to unfavourable biology of sporadic NB. Also, various other genes have been linked to NB pathogenesis. Results The present study explores subgroup discrimination by gene expression profiling using three published microarray studies on NB (47 samples). Four distinct clusters were identified by Principal Components Analysis (PCA) in two separate data sets, which could be verified by an unsupervised hierarchical clustering in a third independent data set (101 NB samples) using a set of 74 discriminative genes. The expression signature of six NB-associated genes ALK, BIRC5, CCND1, MYCN, NTRK1, and PHOX2B, significantly discriminated the four clusters (p < 0.05, one-way ANOVA test). PCA clusters p1, p2, and p3 were found to correspond well to the postulated subtypes 1, 2A, and 2B, respectively. Remarkably, a fourth novel cluster was detected in all three independent data sets. This cluster comprised mainly 11q-deleted MNA-negative tumours with low expression of ALK, BIRC5, and PHOX2B, and was significantly associated with higher tumour stage, poor outcome and poor survival compared to the Type 1-corresponding favourable group (INSS stage 4 and\\/or dead of disease, p < 0.05, Fisher\\'s exact test). Conclusions Based on expression profiling we have identified four molecular subgroups of neuroblastoma, which can be distinguished by a 6-gene signature. The fourth subgroup has not been described elsewhere, and efforts are currently made to further investigate this group\\'s specific characteristics.

  12. Identifying molecular targets of lifestyle modifications in colon cancer prevention

    Directory of Open Access Journals (Sweden)

    Molly Marie Derry

    2013-05-01

    Full Text Available One in four deaths in the United States is cancer-related, and colorectal cancer (CRC is the second leading cause of cancer-associated deaths. Screening strategies are utilized but have not reduced disease incidence or mortality. In this regard, there is an interest in cancer preventive strategies focusing on lifestyle intervention, where specific etiologic factors involved in cancer initiation, promotion, and progression could be targeted. For example, exposure to dietary carcinogens, such as nitrosamines and polycyclic aromatic hydrocarbons influences colon carcinogenesis. Furthermore, dietary deficiencies could alter sensitivity to genetic damage and influence carcinogen metabolism contributing to CRC. High alcohol consumption increases the risk of mutations including the fact that acetaldehyde, an ethanol metabolite, is classified as a group 1 carcinogen. Tobacco smoke exposure is also a risk factor for cancer development; ~20% of CRCs are associated with smoking. Additionally, obese patients have a higher risk of cancer development, which is further supported by the fact that physical activity decreases CRC risk by 55%. Similarly, chronic inflammatory conditions also increase the risk of CRC development. Moreover, the circadian clock alters digestion and regulates other biochemical, physiological and behavioral processes that could positively influence CRC. Taken together, colon carcinogenesis involves a number of etiological factors, and therefore, to create effective preventive strategies, molecular targets need to be identified and beleaguered prior to disease progression. With this in mind, the following is a comprehensive review identifying downstream target proteins of the above lifestyle risk factors, which are modulated during colon carcinogenesis and could be targeted for CRC prevention by novel agents including phytochemicals.

  13. Molecular dynamics simulation on the formation and annihilation behaviors of radiation defects in Li2O

    International Nuclear Information System (INIS)

    Takuji Oda; Satoru Tanaka; Yasuhisa Oya

    2006-01-01

    The influence of radiation defects is one of the main factors that determine tritium release behavior from blanket breeding materials in fusion reactors. Classical molecular dynamics simulation (MD) is a powerful technique to investigate the radiation damage processes, because it can provide atomic-scale information on the defects. In this study, we conducted radiation simulation for Li 2 O using MD and analyzed formation and annihilation behaviors of radiation defects, as a fundamental research for radiation response of Li-containing oxides. Buckingham type two-body potential model was used. In order to remove the unphysical impulsive force at short inter-ionic distances in Buckingham model, each potential function was connected to that of the ZBL potential models at around 0.8 A. NEV ensemble was employed with the initial simulation temperature of 0 K. 10 x 10 x 10 supercell consisting of 4000 Li 2 O was used as a unit cell under 3D periodic boundary conditions. Radiation simulation was initiated by introducing an energy of a certain direction to an ion, as a displacement energy. The lowest displacement energy by which a defect was created and survived beyond 5 ps was regarded as the threshold energy. 42 and 21 displacement directions were surveyed for Li and O, respectively, based on the symmetry of the Li 2 O crystal. In both Li and O defect formations, [100] displacement shows significantly lower threshold energy than [111] displacement. Li defects were easily created than O defects almost in all directions. In fact, the average threshold energy except [111] displacement, which possesses extremely high threshold energy, was 21 eV for Li and 49 eV for O. In some cases, no defect could survive beyond 5 ps even by higher displacement energies than the threshold energy, due to the self-annealing effect. The self-annealing completed basically within 1 ps after introduction of displacement energy. At around this time, velocity distribution of all ions in the system

  14. Threshold defect production in silicon determined by density functional theory molecular dynamics simulations

    International Nuclear Information System (INIS)

    Holmstroem, E.; Kuronen, A.; Nordlund, K.

    2008-01-01

    We studied threshold displacement energies for creating stable Frenkel pairs in silicon using density functional theory molecular dynamics simulations. The average threshold energy over all lattice directions was found to be 36±2 STAT ±2 SYST eV, and thresholds in the directions and were found to be 20±2 SYST eV and 12.5±1.5 SYST eV, respectively. Moreover, we found that in most studied lattice directions, a bond defect complex is formed with a lower threshold than a Frenkel pair. The average threshold energy for producing either a bond defect or a Frenkel pair was found to be 24±1 STAT ±2 SYST eV

  15. Adsorption modes of molecular iodine on defected boron nitrides: A DFT study

    Science.gov (United States)

    Arabieh, Masoud; Azar, Yavar Taghipour

    2018-03-01

    The interaction of molecular iodine with pristine and monovacant boron-nitride quantum dots (QDs) have been investigated using density functional theory. It was found that removing one B or N single atom significantly decreased the calculated Eg values at various exchange functional. In B-defected BN system, the localized spin densities canceled each other and overall polarization of system was found to be equal to unity. For N-defected system there was smaller spin densities localized on each closest B atoms. Both B- and N-vacancies caused appearance of new states in gap region. Our calculation revealed that spin density and polarization of defected system are localized on vacancy region and other atoms did not take part in this polarization. The results of electron localization function for N-DBN showed there was high density region at the position of removed nitrogen atom. The calculated adsorption energies implied that there was no significant chemical interaction between iodine molecule and pristine BN sheet. We suggested that when a deficiency was imposed to the BN sheet, the reactivity of the modified system toward iodine molecule significantly could increase. We found strong interaction between iodine and nitrogen atoms of B-DBN system. In the case of I2/N-DBN system the neighbor atoms had no contribution in spin polarization of the system and it seemed that all spin density of system transferred to the iodine molecule after adsorption. Strong correlation between molecular iodine orientation and BN-QDs via their interactions type has been clarified in this work. These findings may provide a deeper insight into halogen molecules interactions with low dimensional defected boron nitrides.

  16. Mechanisms of defect production and atomic mixing in high energy displacement cascades: A molecular dynamics study

    International Nuclear Information System (INIS)

    Diaz de la Rubia, T.; Guinan, M.W.

    1991-01-01

    We have performed molecular dynamics computer simulation studies of displacement cascades in Cu at low temperature. For 25 keV recoils we observe the splitting of a cascade into subcascades and show that cascades in Cu may lead to the formation of vacancy and interstitial dislocation loops. We discuss a new mechanism of defect production based on the observation of interstitial prismatic dislocation loop punching from cascades at 10 K. We also show that below the subcascade threshold, atomic mixing in the cascade is recoil-energy dependent and obtain a mixing efficiency that scales as the square root of the primary recoil energy. 44 refs., 12 figs

  17. Low defect densities in molecular beam epitaxial GaAs achieved by isoelectronic In doping

    Science.gov (United States)

    Bhattacharya, P. K.; Dhar, S.; Berger, P.; Juang, F.-Y.

    1986-01-01

    A study has been made of the effects of adding small amounts of In (0.2-1.2 pct) to GaAs grown by molecular beam epitaxy. The density of four electron traps decreases in concentration by an order of magnitude, and the peak intensities of prominent emissions in the excitonic spectra are reduced with increase in In content. Based on the higher surface migration rate of In, compared to Ga, at the growth temperatures it is apparent that the traps and the excitonic transitions are related to point defects. This agrees with earlier observations by Briones and Collins (1982) and Skromme et al. (1985).

  18. Pollen developmental defects in ZD-CMS rice line explored by cytological, molecular and proteomic approaches.

    Science.gov (United States)

    Yan, Junjie; Tian, Han; Wang, Shuzhen; Shao, Jinzhen; Zheng, Yinzhen; Zhang, Hongyuan; Guo, Lin; Ding, Yi

    2014-08-28

    Cytoplasmic male sterility (CMS) is a widely observed phenomenon, which is especially useful in hybrid seed production. Meixiang A (MxA) is a new rice CMS line derived from a pollen-free sterile line named Yunnan ZidaoA (ZD-CMS). In this study, a homologous WA352 gene with variation in two nucleotides was identified in MxA. Cytological analysis revealed that MxA was aborted in the early uninucleate stage. The protein expression profiles of MxA and its maintainer line MeixiangB (MxB) were systematically compared using iTRAQ-based quantitative proteomics technology using young florets at the early uninucleate stage. A total of 688 proteins were quantified in both rice lines, and 45 of these proteins were found to be differentially expressed. Bioinformatics analysis indicated a large number of the proteins involved in carbohydrate metabolism or the stress response were downregulated in MxA, suggesting that these metabolic processes had been hindered during pollen development in MxA. The ROS (reactive oxygen species) level was increased in the mitochondrion of MxA, and further ultrastructural analysis showed the mitochondria with disrupted cristae in the rice CMS line MxA. These findings substantially contribute to our knowledge of pollen developmental defects in ZD-CMS rice line. MeixiangA (MxA) is a new type of rice CMS line, which is derived from pollen-free sterile line Yunnan ZidaoA. In this study, the cytological, molecular and proteomic approaches were used to study the characteristics of this new CMS line. Cytological study indicates the CMS line is aborted at the early uninucleate stage. A potential sterile gene ZD352 is identified in MxA, the protein product of which is mainly accumulated at the MMC/Meiotic stage. iTRAQ based proteomic analysis is performed to study the relevant proteins involved in the CMS occurance, 45 proteins are found to be significant differentially expressed and these proteins are involved in many cellular processes such as

  19. Identifying apple surface defects using principal components analysis and artifical neural networks

    Science.gov (United States)

    Artificial neural networks and principal components were used to detect surface defects on apples in near-infrared images. Neural networks were trained and tested on sets of principal components derived from columns of pixels from images of apples acquired at two wavelengths (740 nm and 950 nm). I...

  20. Effect of point defects on the thermal conductivity of UO2: molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xiang-Yang [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stanek, Christopher Richard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Andersson, Anders David Ragnar [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-07-21

    The thermal conductivity of uranium dioxide (UO2) fuel is an important materials property that affects fuel performance since it is a key parameter determining the temperature distribution in the fuel, thus governing, e.g., dimensional changes due to thermal expansion, fission gas release rates, etc. [1] The thermal conductivity of UO2 nuclear fuel is also affected by fission gas, fission products, defects, and microstructural features such as grain boundaries. Here, molecular dynamics (MD) simulations are carried out to determine quantitatively, the effect of irradiation induced point defects on the thermal conductivity of UO2, as a function of defect concentrations, for a range of temperatures, 300 – 1500 K. The results will be used to develop enhanced continuum thermal conductivity models for MARMOT and BISON by INL. These models express the thermal conductivity as a function of microstructure state-variables, thus enabling thermal conductivity models with closer connection to the physical state of the fuel [2].

  1. A further case of a Prader-Willi syndrome phenotype in a patient with Angelman syndrome molecular defect

    Directory of Open Access Journals (Sweden)

    De Molfetta Greice Andreotti

    2002-01-01

    Full Text Available Angelman syndrome (AS and Prader-Willi syndrome (PWS are distinct human neurogenetic disorders; however, a clinical overlap between AS and PWS has been identified. We report on a further case of a patient showing the PWS phenotype with the AS molecular defect. Despite the PWS phenotype, the DNA methylation analysis of SNRPN revealed an AS pattern. Cytogenetic and FISH analysis showed normal chromosomes 15 and microsatellite analysis showed heterozygous loci inside and outside the 15q11-13 region. The presence of these atypical cases could be more frequent than previously expected and we reinforce that the DNA methylation analysis is important for the correct diagnosis of severe mental deficiency, congenital hypotonia and obesity.

  2. Molecular defects of the growth hormone receptor gene, including a new mutation, in Laron syndrome patients in Israel: relationship between defects and ethnic groups.

    Science.gov (United States)

    Shevah, Orit; Rubinstein, Menachem; Laron, Zvi

    2004-10-01

    Laron Syndrome, first described in Israel, is a form of dwarfism similar to isolated growth hormone deficiency caused by molecular defects in the GH receptor gene. To characterize the molecular defects of the GH-R in Laron syndrome patients followed in our clinic. Of the 63 patients in the cohort, we investigated 31 patients and 32 relatives belonging to several ethnic origins. Molecular analysis of the GH-R gene was performed using the single strand conformation polymorphism and DNA sequencing techniques. Eleven molecular defects including a novel mutation were found. Twenty-two patients carried mutations in the extracellular domain, one in the transmembrane domain, and 3 siblings with typical Laron syndrome presented a normal GH-R. Of interest are, on one hand, different mutations within the same ethnic groups: W-15X and 5, 6 exon deletion in Jewish-Iraqis, and E180 splice and 5, 6 exon deletion in Jewish-Moroccans; and on the other hand, identical findings in patients from distinct regions: the 785-1 G to T mutation in an Israeli-Druze and a Peruvian patient. A polymorphism in exon 6, Gly168Gly, was found in 15 probands. One typical Laron patient from Greece was heterozygous for R43X in exon 4 and heterozygous for Gly168Gly. In addition, a novel mutation in exon 5: substitution of T to G replacing tyrosine 86 for aspartic acid (Y86D) is described. This study demonstrates: a) an increased focal incidence of Laron syndrome in different ethnic groups from our area with a high incidence of consanguinity; and b) a relationship between molecular defects of the GH-R, ethnic group and geographic area.

  3. Computer Vision System For Locating And Identifying Defects In Hardwood Lumber

    Science.gov (United States)

    Conners, Richard W.; Ng, Chong T.; Cho, Tai-Hoon; McMillin, Charles W.

    1989-03-01

    This paper describes research aimed at developing an automatic cutup system for use in the rough mills of the hardwood furniture and fixture industry. In particular, this paper describes attempts to create the vision system that will power this automatic cutup system. There are a number of factors that make the development of such a vision system a challenge. First there is the innate variability of the wood material itself. No two species look exactly the same, in fact, they can have a significant visual difference in appearance among species. Yet a truly robust vision system must be able to handle a variety of such species, preferably with no operator intervention required when changing from one species to another. Secondly, there is a good deal of variability in the definition of what constitutes a removable defect. The hardwood furniture and fixture industry is diverse in the nature of the products that it makes. The products range from hardwood flooring to fancy hardwood furniture, from simple mill work to kitchen cabinets. Thus depending on the manufacturer, the product, and the quality of the product the nature of what constitutes a removable defect can and does vary. The vision system must be such that it can be tailored to meet each of these unique needs, preferably without any additional program modifications. This paper will describe the vision system that has been developed. It will assess the current system capabilities, and it will discuss the directions for future research. It will be argued that artificial intelligence methods provide a natural mechanism for attacking this computer vision application.

  4. Novel Mutation of LRP6 Identified in Chinese Han Population Links Canonical WNT Signaling to Neural Tube Defects.

    Science.gov (United States)

    Shi, Zhiwen; Yang, Xueyan; Li, Bin-Bin; Chen, Shuxia; Yang, Luming; Cheng, Liangping; Zhang, Ting; Wang, Hongyan; Zheng, Yufang

    2018-01-15

    Neural tube defects (NTDs), the second most frequent cause of human congenital abnormalities, are debilitating birth defects due to failure of neural tube closure. It has been shown that noncanonical WNT/planar cell polarity (PCP) signaling is required for convergent extension (CE), the initiation step of neural tube closure (NTC). But the effect of canonical WNT//β-catenin signaling during NTC is still elusive. LRP6 (low density lipoprotein receptor related proteins 6) was identified as a co-receptor for WNT/β-catenin signaling, but recent studies showed that it also can mediate WNT/PCP signaling. In this study, we screened mutations in the LRP6 gene in 343 NTDs and 215 ethnically matched normal controls of Chinese Han population. Three rare missense mutations (c.1514A>G, p.Y505C); c.2984A>G, p.D995G; and c.4280C>A, p.P1427Q) of the LRP6 gene were identified in Chinese NTD patients. The Y505C mutation is a loss-of-function mutation on both WNT/β-catenin and PCP signaling. The D995G mutation only partially lost inhibition on PCP signaling without affecting WNT/β-catenin signaling. The P1427Q mutation dramatically increased WNT/β-catenin signaling but only mildly loss of inhibition on PCP signaling. All three mutations failed to rescue CE defects caused by lrp6 morpholino oligos knockdown in zebrafish. Of interest, when overexpressed, D995G did not induce any defects, but Y505C and P1427Q caused more severe CE defects in zebrafish. Our results suggested that over-active canonical WNT signaling induced by gain-of-function mutation in LRP6 could also contribute to human NTDs, and a balanced WNT/β-catenin and PCP signaling is probably required for proper neural tube development. Birth Defects Research 110:63-71, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  5. Molecular dynamics study on welding a defected graphene by a moving fullerene

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Kun, E-mail: kuncai99@163.com [College of Water Resources and Architectural Engineering, Northwest A& F University, Yangling 712100 (China); Research School of Engineering, The Australian National University, ACT 2601 (Australia); Wan, Jing; Yu, Jingzhou; Cai, Haifang [College of Water Resources and Architectural Engineering, Northwest A& F University, Yangling 712100 (China); Qin, Qinghua [Research School of Engineering, The Australian National University, ACT 2601 (Australia)

    2016-07-30

    Highlights: • Fullerene (FN) is adopted to weld the gap on a graphene (GN) sheet using molecular dynamics simulation. • The mechanism is that the dangling sp{sup 1} carbon atoms on both sides of gap are excited by FN to form new sp{sup 2}-sp{sup 2} carbon bonds. • The velocity of FN influences the welding result due to the fact that the deformation of GN depends on the velocity of FN. • A complex nanostructure, e.g., cone, can be formed by the present method, which will be applicable in nano fabrication/manufacturing. - Abstract: When a composite nanostructure is fabricated through van der Waals interaction only, the interaction among components may be sensitive to environmental conditions. To endow such a structure with relative stability, new covalent bonds should be applied. In this paper, a welding method for welding a circular graphene with a defect gap through a moving fullerene (C240 or C540 buckyball) is presented. When the buckyball moves above the gap, the two faces of the gap are attracted to each other and the distance between the two faces is shortened. When the dangling carbon atoms on both faces of the gap are excited to form new normal sp{sup 2}-sp{sup 2} carbon bonds, the gap can be sewn up quickly. Molecular dynamics simulations are presented to demonstrate the welding process. When the gap is a sector, an ideal cone can be fabricated using the present method.

  6. Molecular dynamics study on welding a defected graphene by a moving fullerene

    International Nuclear Information System (INIS)

    Cai, Kun; Wan, Jing; Yu, Jingzhou; Cai, Haifang; Qin, Qinghua

    2016-01-01

    Highlights: • Fullerene (FN) is adopted to weld the gap on a graphene (GN) sheet using molecular dynamics simulation. • The mechanism is that the dangling sp"1 carbon atoms on both sides of gap are excited by FN to form new sp"2-sp"2 carbon bonds. • The velocity of FN influences the welding result due to the fact that the deformation of GN depends on the velocity of FN. • A complex nanostructure, e.g., cone, can be formed by the present method, which will be applicable in nano fabrication/manufacturing. - Abstract: When a composite nanostructure is fabricated through van der Waals interaction only, the interaction among components may be sensitive to environmental conditions. To endow such a structure with relative stability, new covalent bonds should be applied. In this paper, a welding method for welding a circular graphene with a defect gap through a moving fullerene (C240 or C540 buckyball) is presented. When the buckyball moves above the gap, the two faces of the gap are attracted to each other and the distance between the two faces is shortened. When the dangling carbon atoms on both faces of the gap are excited to form new normal sp"2-sp"2 carbon bonds, the gap can be sewn up quickly. Molecular dynamics simulations are presented to demonstrate the welding process. When the gap is a sector, an ideal cone can be fabricated using the present method.

  7. Defect distribution in low-temperature molecular beam epitaxy grown Si/Si(100), improved depth profiling with monoenergetic positrons

    International Nuclear Information System (INIS)

    Szeles, C.; Asoka-Kumar, P.; Lynn, K.G.; Gossmann, H.; Unterwald, F.C.; Boone, T.

    1995-01-01

    The depth distribution of open-volume defects has been studied in Si(100) crystals grown by molecular beam epitaxy at 300 degree C by the variable-energy monoenergetic positron beam technique combined with well-controlled chemical etching. This procedure gave a 10 nm depth resolution which is a significant improvement over the inherent depth resolving power of the positron beam technique. The epitaxial layer was found to grow defect-free up to 80 nm, from the interface, where small vacancy clusters, larger than divacancies, appear. The defect density then sharply increases toward the film surface. The result clearly shows that the nucleation of small open-volume defects is a precursor state to the breakdown of epitaxy and to the evolution of an amorphous film

  8. Molecular profiling identifies prognostic markers of stage IA lung adenocarcinoma.

    Science.gov (United States)

    Zhang, Jie; Shao, Jinchen; Zhu, Lei; Zhao, Ruiying; Xing, Jie; Wang, Jun; Guo, Xiaohui; Tu, Shichun; Han, Baohui; Yu, Keke

    2017-09-26

    We previously showed that different pathologic subtypes were associated with different prognostic values in patients with stage IA lung adenocarcinoma (AC). We hypothesize that differential gene expression profiles of different subtypes may be valuable factors for prognosis in stage IA lung adenocarcinoma. We performed microarray gene expression profiling on tumor tissues micro-dissected from patients with acinar and solid predominant subtypes of stage IA lung adenocarcinoma. These patients had undergone a lobectomy and mediastinal lymph node dissection at the Shanghai Chest Hospital, Shanghai, China in 2012. No patient had preoperative treatment. We performed the Gene Set Enrichment Analysis (GSEA) analysis to look for gene expression signatures associated with tumor subtypes. The histologic subtypes of all patients were classified according to the 2015 WHO lung Adenocarcinoma classification. We found that patients with the solid predominant subtype are enriched for genes involved in RNA polymerase activity as well as inactivation of the p53 pathway. Further, we identified a list of genes that may serve as prognostic markers for stage IA lung adenocarcinoma. Validation in the TCGA database shows that these genes are correlated with survival, suggesting that they are novel prognostic factors for stage IA lung adenocarcinoma. In conclusion, we have uncovered novel prognostic factors for stage IA lung adenocarcinoma using gene expression profiling in combination with histopathology subtyping.

  9. Cellular and Molecular Defects Underlying Invasive Fungal Infections—Revelations from Endemic Mycoses

    Directory of Open Access Journals (Sweden)

    Pamela P. Lee

    2017-06-01

    Full Text Available The global burden of fungal diseases has been increasing, as a result of the expanding number of susceptible individuals including people living with human immunodeficiency virus (HIV, hematopoietic stem cell or organ transplant recipients, patients with malignancies or immunological conditions receiving immunosuppressive treatment, premature neonates, and the elderly. Opportunistic fungal pathogens such as Aspergillus, Candida, Cryptococcus, Rhizopus, and Pneumocystis jiroveci are distributed worldwide and constitute the majority of invasive fungal infections (IFIs. Dimorphic fungi such as Histoplasma capsulatum, Coccidioides spp., Paracoccidioides spp., Blastomyces dermatiditis, Sporothrix schenckii, Talaromyces (Penicillium marneffei, and Emmonsia spp. are geographically restricted to their respective habitats and cause endemic mycoses. Disseminated histoplasmosis, coccidioidomycosis, and T. marneffei infection are recognized as acquired immunodeficiency syndrome (AIDS-defining conditions, while the rest also cause high rate of morbidities and mortalities in patients with HIV infection and other immunocompromised conditions. In the past decade, a growing number of monogenic immunodeficiency disorders causing increased susceptibility to fungal infections have been discovered. In particular, defects of the IL-12/IFN-γ pathway and T-helper 17-mediated response are associated with increased susceptibility to endemic mycoses. In this review, we put together the various forms of endemic mycoses on the map and take a journey around the world to examine how cellular and molecular defects of the immune system predispose to invasive endemic fungal infections, including primary immunodeficiencies, individuals with autoantibodies against interferon-γ, and those receiving biologic response modifiers. Though rare, these conditions provide importance insights to host defense mechanisms against endemic fungi, which can only be appreciated in unique

  10. Identifying open-volume defects in doped and undoped perovskite-type LaCoO3, PbTiO3, and BaTiO3

    International Nuclear Information System (INIS)

    Ghosh, Vinita J.; Nielsen, Bent; Friessnegg, Thomas

    2000-01-01

    Dopants, vacancies, and impurity-vacancy clusters have a substantial impact on the properties of perovskite-type metal oxides (general formula ABO 3 ). In order to determine synthesis and processing conditions that optimize the desirable properties of these materials a careful study of these defects is required. It is essential to identify the defects and to map the defect densities. Positron annihilation spectroscopy has often been used to identify vacancy-type defects. Calculations of the positron lifetime and Doppler-broadened profiles of the positron-electron annihilation radiation in undoped and doped LaCoO 3 , PbTiO 3 , and BaTiO 3 are reported, and compared with available experimental data. The results show that these positron techniques are excellent for studying open-volume defects, vacancy-impurity complexes, and for identifying the sublattice occupied by the dopants. (c) 2000 The American Physical Society

  11. Identification and molecular characterization of a naturally occurring RNA virus mutant defective in the initiation of host recovery

    International Nuclear Information System (INIS)

    Xin Hongwu; Ding Shouwei

    2003-01-01

    The host recovery response is characterized by the disappearance of disease symptoms and activation of the RNA silencing virus resistance in the new growth following an initial symptomatic infection. However, it is not clear what triggers the initiation of recovery, which occurs naturally only in some virus-host interactions. Here we report the identification and characterization of a spontaneous mutant of Tobacco streak virus (TSV) that became defective in triggering recovery in tobacco plants. Infectious full-length cDNA clones corresponding to the tripartite RNA genome were constructed from both the wild-type and the nonrecovery mutant of TSV (TSVnr), the first sets of infectious cDNA clones from an Ilarvirus. Genetic and molecular analyses identified an A → G mutation in the TSVnr genome that was sufficient to confer nonrecovery when introduced into TSV. The mutation was located in the intergenic region of RNA 3 upstream of the mapped transcriptional start site of the coat protein mRNA. Intriguingly, induction of recovery by TSV was not accompanied by virus clearance and TSV consistently accumulated to significantly higher levels than TSVnr did even though TSVnr-infected plants displayed severe symptoms throughout the course of infection. Thus, our findings indicate that recovery of host can be initiated by minimal genetic changes in a viral genome and may occur in the absence of virus clearance. Mechanisms possibly involved in the initiation of host recovery are discussed

  12. Synthetic lethality between gene defects affecting a single non-essential molecular pathway with reversible steps.

    Directory of Open Access Journals (Sweden)

    Andrei Zinovyev

    2013-04-01

    Full Text Available Systematic analysis of synthetic lethality (SL constitutes a critical tool for systems biology to decipher molecular pathways. The most accepted mechanistic explanation of SL is that the two genes function in parallel, mutually compensatory pathways, known as between-pathway SL. However, recent genome-wide analyses in yeast identified a significant number of within-pathway negative genetic interactions. The molecular mechanisms leading to within-pathway SL are not fully understood. Here, we propose a novel mechanism leading to within-pathway SL involving two genes functioning in a single non-essential pathway. This type of SL termed within-reversible-pathway SL involves reversible pathway steps, catalyzed by different enzymes in the forward and backward directions, and kinetic trapping of a potentially toxic intermediate. Experimental data with recombinational DNA repair genes validate the concept. Mathematical modeling recapitulates the possibility of kinetic trapping and revealed the potential contributions of synthetic, dosage-lethal interactions in such a genetic system as well as the possibility of within-pathway positive masking interactions. Analysis of yeast gene interaction and pathway data suggests broad applicability of this novel concept. These observations extend the canonical interpretation of synthetic-lethal or synthetic-sick interactions with direct implications to reconstruct molecular pathways and improve therapeutic approaches to diseases such as cancer.

  13. Using Genetic Buffering Relationships Identified in Fission Yeast To Elucidate the Molecular Pathology of Tuberous Sclerosis

    Science.gov (United States)

    2016-07-01

    tsc1 and tsc2 loss of function mutations in Schizosaccharomyces pombe. Northeast Regional Yeast Meeting, June 16-17, University at Buffalo, The State...AWARD NUMBER: W81XWH-14-1-0169 TITLE: Using Genetic Buffering Relationships Identified in Fission Yeast To Elucidate the Molecular Pathology of...SUBTITLE Using Genetic Buffering Relationships Identified in Fission 5a. CONTRACT NUMBER W81XWH-14-1-0169 Yeast to Elucidate the Molecular Pathology

  14. Growth of defect-free GaAsSbN axial nanowires via self-catalyzed molecular beam epitaxy

    Science.gov (United States)

    Sharma, Manish; Deshmukh, Prithviraj; Kasanaboina, Pavan; Reynolds, C. Lewis, Jr.; Liu, Yang; Iyer, Shanthi

    2017-12-01

    Bandgap reduction of 10% by incorporation of a dilute amount of N is reported for the first time, in axial GaAsSb nanowires (NWs) grown on Si (111) via Ga-assisted molecular beam epitaxy. Impact of N incorporation on the surface morphology, NW growth kinetics, and their structural and optical properties were examined. Dilute nitride NWs with Sb composition of 7 at% did not exhibit any noticeable planar defects, as revealed by the absence of satellite twin peaks in the selected-area diffraction pattern and high-resolution transmission electron microscopy imaging. Point defects were also minimal in as-grown dilute nitride NWs, as ascertained from the comparison of low-temperature photoluminescence spectra as well as the shape and shift of Raman modes, with in situ annealed NWs in different ambients. Evidence of enhanced incorporation of N was found in the NWs in situ annealed in N ambient, but with deteriorated optical quality due to simultaneous creation of N-induced defects. The lack of any noticeable defects in the as-grown GaAsSbN NWs demonstrates the advantage of the vapor-liquid-solid mechanism responsible for growth of axial configuration over the vapor-solid growth mechanism for core-shell NWs as well as their thin film counterpart, which commonly exhibit N-induced point defects.

  15. Combining the 3D model generated from point clouds and thermography to identify the defects presented on the facades of a building

    Science.gov (United States)

    Huang, Yishuo; Chiang, Chih-Hung; Hsu, Keng-Tsang

    2018-03-01

    Defects presented on the facades of a building do have profound impacts on extending the life cycle of the building. How to identify the defects is a crucial issue; destructive and non-destructive methods are usually employed to identify the defects presented on a building. Destructive methods always cause the permanent damages for the examined objects; on the other hand, non-destructive testing (NDT) methods have been widely applied to detect those defects presented on exterior layers of a building. However, NDT methods cannot provide efficient and reliable information for identifying the defects because of the huge examination areas. Infrared thermography is often applied to quantitative energy performance measurements for building envelopes. Defects on the exterior layer of buildings may be caused by several factors: ventilation losses, conduction losses, thermal bridging, defective services, moisture condensation, moisture ingress, and structure defects. Analyzing the collected thermal images can be quite difficult when the spatial variations of surface temperature are small. In this paper the authors employ image segmentation to cluster those pixels with similar surface temperatures such that the processed thermal images can be composed of limited groups. The surface temperature distribution in each segmented group is homogenous. In doing so, the regional boundaries of the segmented regions can be identified and extracted. A terrestrial laser scanner (TLS) is widely used to collect the point clouds of a building, and those point clouds are applied to reconstruct the 3D model of the building. A mapping model is constructed such that the segmented thermal images can be projected onto the 2D image of the specified 3D building. In this paper, the administrative building in Chaoyang University campus is used as an example. The experimental results not only provide the defect information but also offer their corresponding spatial locations in the 3D model.

  16. Molecular analysis of expansion, differentiation, and growth factor treatment of human chondrocytes identifies differentiation markers and growth-related genes.

    Science.gov (United States)

    Benz, Karin; Breit, Stephen; Lukoschek, Martin; Mau, Hans; Richter, Wiltrud

    2002-04-26

    This study is intended to optimise expansion and differentiation of cultured human chondrocytes by growth factor application and to identify molecular markers to monitor their differentiation state. We dissected the molecular consequences of matrix release, monolayer, and 3D-alginate culture, growth factor optimised expansion, and re-differentiation protocols by gene expression analysis. Among 19 common cartilage molecules assessed by cDNA array, six proved best to monitor differentiation. Instant down-regulation at release of cells from the matrix was strongest for COL 2A1, fibromodulin, and PRELP while LUM, CHI3L1, and CHI3L2 were expansion-related. Both gene sets reflected the physiologic effects of the most potent growth-inducing (PDGF-BB) and proteoglycan-inducing (BMP-4) factors. Only CRTAC1 expression correlated with 2D/3D switches while the molecular phenotype of native chondrocytes was not restored. The markers and optimised protocols we suggest can help to improve cell therapy of cartilage defects and chondrocyte differentiation from stem cell sources.

  17. Comprehensive profiling of DNA repair defects in breast cancer identifies a novel class of endocrine therapy resistance drivers.

    Science.gov (United States)

    Anurag, Meenakshi; Punturi, Nindo; Hoog, Jeremy; Bainbridge, Matthew N; Ellis, Matthew J; Haricharan, Svasti

    2018-05-23

    This study was undertaken to conduct a comprehensive investigation of the role of DNA damage repair (DDR) defects in poor outcome ER+ disease. Expression and mutational status of DDR genes in ER+ breast tumors were correlated with proliferative response in neoadjuvant aromatase inhibitor therapy trials (discovery data set), with outcomes in METABRIC, TCGA and Loi data sets (validation data sets), and in patient derived xenografts. A causal relationship between candidate DDR genes and endocrine treatment response, and the underlying mechanism, was then tested in ER+ breast cancer cell lines. Correlations between loss of expression of three genes: CETN2 (p<0.001) and ERCC1 (p=0.01) from the nucleotide excision repair (NER) and NEIL2 (p=0.04) from the base excision repair (BER) pathways were associated with endocrine treatment resistance in discovery data sets, and subsequently validated in independent patient cohorts. Complementary mutation analysis supported associations between mutations in NER and BER pathways and reduced endocrine treatment response. A causal role for CETN2, NEIL2 and ERCC1 loss in intrinsic endocrine resistance was experimentally validated in ER+ breast cancer cell lines, and in ER+ patient-derived xenograft models. Loss of CETN2, NEIL2 or ERCC1 induced endocrine treatment response by dysregulating G1/S transition, and therefore, increased sensitivity to CDK4/6 inhibitors. A combined DDR signature score was developed that predicted poor outcome in multiple patient cohorts. This report identifies DDR defects as a new class of endocrine treatment resistance drivers and indicates new avenues for predicting efficacy of CDK4/6 inhibition in the adjuvant treatment setting. Copyright ©2018, American Association for Cancer Research.

  18. RNA-based mutation analysis identifies an unusual MSH6 splicing defect and circumvents PMS2 pseudogene interference.

    Science.gov (United States)

    Etzler, J; Peyrl, A; Zatkova, A; Schildhaus, H-U; Ficek, A; Merkelbach-Bruse, S; Kratz, C P; Attarbaschi, A; Hainfellner, J A; Yao, S; Messiaen, L; Slavc, I; Wimmer, K

    2008-02-01

    Heterozygous germline mutations in one of the mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2 cause hereditary nonpolyposis colorectal cancer (HNPCC) or Lynch syndrome, a dominantly inherited cancer susceptibility syndrome. Recent reports provide evidence for a novel recessively inherited cancer syndrome with constitutive MMR deficiency due to biallelic germline mutations in one of the MMR genes. MMR-deficiency (MMR-D) syndrome is characterized by childhood brain tumors, hematological and/or gastrointestinal malignancies, and signs of neurofibromatosis type 1 (NF1). We established an RNA-based mutation detection assay for the four MMR genes, since 1) a number of splicing defects may escape detection by the analysis of genomic DNA, and 2) DNA-based mutation detection in the PMS2 gene is severely hampered by the presence of multiple highly similar pseudogenes, including PMS2CL. Using this assay, which is based on direct cDNA sequencing of RT-PCR products, we investigated two families with children suspected to suffer from MMR-D syndrome. We identified a homozygous complex MSH6 splicing alteration in the index patients of the first family and a novel homozygous PMS2 mutation (c.182delA) in the index patient of the second family. Furthermore, we demonstrate, by the analysis of a PMS2/PMS2CL "hybrid" allele carrier, that RNA-based PMS2 testing effectively avoids the caveats of genomic DNA amplification approaches; i.e., pseudogene coamplification as well as allelic dropout, and will, thus, allow more sensitive mutation analysis in MMR deficiency and in HNPCC patients with PMS2 defects. (c) 2007 Wiley-Liss, Inc.

  19. Coarse-grained molecular dynamics modeling of the kinetics of lamellar block copolymer defect annealing

    Science.gov (United States)

    Peters, Andrew J.; Lawson, Richard A.; Nation, Benjamin D.; Ludovice, Peter J.; Henderson, Clifford L.

    2016-01-01

    State-of-the-art block copolymer (BCP)-directed self-assembly (DSA) methods still yield defect densities orders of magnitude higher than is necessary in semiconductor fabrication despite free-energy calculations that suggest equilibrium defect densities are much lower than is necessary for economic fabrication. This disparity suggests that the main problem may lie in the kinetics of defect removal. This work uses a coarse-grained model to study the rates, pathways, and dependencies of healing a common defect to give insight into the fundamental processes that control defect healing and give guidance on optimal process conditions for BCP-DSA. It is found that bulk simulations yield an exponential drop in defect heal rate above χN˜30. Thin films show no change in rate associated with the energy barrier below χN˜50, significantly higher than the χN values found previously for self-consistent field theory studies that neglect fluctuations. Above χN˜50, the simulations show an increase in energy barrier scaling with 1/2 to 1/3 of the bulk systems. This is because thin films always begin healing at the free interface or the BCP-underlayer interface, where the increased A-B contact area associated with the transition state is minimized, while the infinitely thick films cannot begin healing at an interface.

  20. Effect of growth temperature on defects in epitaxial GaN film grown by plasma assisted molecular beam epitaxy

    Directory of Open Access Journals (Sweden)

    S. S. Kushvaha

    2014-02-01

    Full Text Available We report the effect of growth temperature on defect states of GaN epitaxial layers grown on 3.5 μm thick GaN epi-layer on sapphire (0001 substrates using plasma assisted molecular beam epitaxy. The GaN samples grown at three different substrate temperatures at 730, 740 and 750 °C were characterized using atomic force microscopy and photoluminescence spectroscopy. The atomic force microscopy images of these samples show the presence of small surface and large hexagonal pits on the GaN film surfaces. The surface defect density of high temperature grown sample is smaller (4.0 × 108 cm−2 at 750 °C than that of the low temperature grown sample (1.1 × 109 cm−2 at 730 °C. A correlation between growth temperature and concentration of deep centre defect states from photoluminescence spectra is also presented. The GaN film grown at 750 °C exhibits the lowest defect concentration which confirms that the growth temperature strongly influences the surface morphology and affects the optical properties of the GaN epitaxial films.

  1. Partial correction of a severe molecular defect in hemophilia A, because of errors during expression of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Young, M.; Antonarakis, S.E. [Univ. of Geneva (Switzerland); Inaba, Hiroshi [Tokyo Medical College (Japan)] [and others

    1997-03-01

    Although the molecular defect in patients in a Japanese family with mild to moderately severe hemophilia A was a deletion of a single nucleotide T within an A{sub 8}TA{sub 2} sequence of exon 14 of the factor VIII gene, the severity of the clinical phenotype did not correspond to that expected of a frameshift mutation. A small amount of functional factor VIII protein was detected in the patient`s plasma. Analysis of DNA and RNA molecules from normal and affected individuals and in vitro transcription/translation suggested a partial correction of the molecular defect, because of the following: (i) DNA replication/RNA transcription errors resulting in restoration of the reading frame and/or (ii) {open_quotes}ribosomal frameshifting{close_quotes} resulting in the production of normal factor VIII polypeptide and, thus, in a milder than expected hemophilia A. All of these mechanisms probably were promoted by the longer run of adenines, A{sub 10} instead of A{sub 8}TA{sub 2}, after the delT. Errors in the complex steps of gene expression therefore may partially correct a severe frameshift defect and ameliorate an expected severe phenotype. 36 refs., 6 figs.

  2. Molecular dynamics study on the interaction of a dislocation and radiation induced defect clusters in Fcc crystals

    International Nuclear Information System (INIS)

    Hideo, Kaburaki; Tomoko, Kadoyoshi; Futoshi, Shimizu; Hajime; Kimizuka; Shiro, Jitsukawa

    2003-01-01

    Irradiation of high-energy neutrons and charged particles into solids is known to cause a significant change in mechanical properties, in particular, hardening of metals. Hardening of solids arises as a result of interactions of dislocations with irradiation induced defect clusters. Molecular dynamics method combined with the visualization method has been used to elucidate these complex pinning structures in details. In particular, we have successfully observed the transient process for the formation of a super-jog from an edge dislocation and interstitial and vacancy clusters under irradiation cascade conditions. Parallel molecular dynamics programs, called as Parallel Molecular Dynamics Stencil (PMDS), have been developed in order to perform these large scale simulations for materials simulations. The contents of the program and its parallel performance are also reported. (authors)

  3. Coarse-grained molecular dynamics modeling of the kinetics of lamellar BCP defect annealing

    Science.gov (United States)

    Peters, Andrew J.; Lawson, Richard A.; Nation, Benjamin D.; Ludovice, Peter J.; Henderson, Clifford L.

    2015-03-01

    Directed self-assembly of block copolymers (BCPs) is a process that has received great interest in the field of nanomanufacturing in the past decade, and great strides towards forming high quality aligned patterns have been made. But state of the art methods still yield defectivities orders of magnitude higher than is necessary in semi-conductor fabrication even though free energy calculations suggest that equilibrium defectivities are much lower than is necessary for economic semi-conductor fabrication. This disparity suggests that the main problem may lie in the kinetics of defect removal. This work uses a coarse-grained model to study the rates, pathways, and dependencies of healing a common defect to give insight into the fundamental processes that control defect healing and give guidance on optimal process conditions for BCP-DSA. It is found that infinitely thick films yield an exponential drop in defect heal rate above χN ~ 30. Below χN ~ 30, the rate of transport was similar to the rate at which the transition state was reached so that the overall rate changed only slightly. The energy barrier in periodic simulations increased with 0.31 χN on average. Thin film simulations show no change in rate associated with the energy barrier below χN ~ 50, and then show an increase in energy barrier scaling with 0.16χN. Thin film simulations always begin to heal at either the free interface or the BCP-underlayer interface where the increased A-B contact area associated with the transition state will be minimized, while the infinitely thick films must start healing in the bulk where the A-B contact area is increased. It is also found that cooperative chain movement is required for the defect to start healing.

  4. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles

    Directory of Open Access Journals (Sweden)

    Farshad Farshidfar

    2017-03-01

    Full Text Available Cholangiocarcinoma (CCA is an aggressive malignancy of the bile ducts, with poor prognosis and limited treatment options. Here, we describe the integrated analysis of somatic mutations, RNA expression, copy number, and DNA methylation by The Cancer Genome Atlas of a set of predominantly intrahepatic CCA cases and propose a molecular classification scheme. We identified an IDH mutant-enriched subtype with distinct molecular features including low expression of chromatin modifiers, elevated expression of mitochondrial genes, and increased mitochondrial DNA copy number. Leveraging the multi-platform data, we observed that ARID1A exhibited DNA hypermethylation and decreased expression in the IDH mutant subtype. More broadly, we found that IDH mutations are associated with an expanded histological spectrum of liver tumors with molecular features that stratify with CCA. Our studies reveal insights into the molecular pathogenesis and heterogeneity of cholangiocarcinoma and provide classification information of potential therapeutic significance.

  5. Identifying molecular subtypes in human colon cancer using gene expression and DNA methylation microarray data

    OpenAIRE

    REN, ZHONGLU; WANG, WENHUI; LI, JINMING

    2015-01-01

    Identifying colon cancer subtypes based on molecular signatures may allow for a more rational, patient-specific approach to therapy in the future. Classifications using gene expression data have been attempted before with little concordance between the different studies carried out. In this study we aimed to uncover subtypes of colon cancer that have distinct biological characteristics and identify a set of novel biomarkers which could best reflect the clinical and/or biological characteristi...

  6. Improved tensile and buckling behavior of defected carbon nanotubes utilizing boron nitride coating – A molecular dynamic study

    Energy Technology Data Exchange (ETDEWEB)

    Badjian, H.; Setoodeh, A.R., E-mail: setoodeh@sutech.ac.ir

    2017-02-15

    Synthesizing inorganic nanostructures such as boron nitride nanotubes (BNNTs) have led to immense studies due to their many interesting functional features such as piezoelectricity, high temperature resistance to oxygen, electrical insulation, high thermal conductivity and very long lengths as physical features. In order to utilize the superior properties of pristine and defected carbon nanotubes (CNTs), a hybrid nanotube is proposed in this study by forming BNNTs surface coating on the CNTs. The benefits of such coating on the tensile and buckling behavior of single-walled CNTs (SWCNTs) are illustrated through molecular dynamics (MD) simulations of the resulted nanostructures during the deformation. The AIREBO and Tersoff-Brenner potentials are employed to model the interatomic forces between the carbon and boron nitride atoms, respectively. The effects of chiral indices, aspect ratio, presence of mono-vacancy defects and coating dimension on coated/non-coated CNTs are examined. It is demonstrated that the coated defective CNTs exhibit remarkably enhanced ultimate strength, buckling load capacity and Young's modulus. The proposed coating not only enhances the mechanical properties of the resulted nanostructure, but also conceals it from few external factors impacting the behavior of the CNT such as humidity and high temperature.

  7. A Systems Biology Framework Identifies Molecular Underpinnings of Coronary Heart Disease

    Science.gov (United States)

    Huan, Tianxiao; Zhang, Bin; Wang, Zhi; Joehanes, Roby; Zhu, Jun; Johnson, Andrew D.; Ying, Saixia; Munson, Peter J.; Raghavachari, Nalini; Wang, Richard; Liu, Poching; Courchesne, Paul; Hwang, Shih-Jen; Assimes, Themistocles L.; McPherson, Ruth; Samani, Nilesh J.; Schunkert, Heribert; Meng, Qingying; Suver, Christine; O'Donnell, Christopher J.; Derry, Jonathan; Yang, Xia; Levy, Daniel

    2013-01-01

    Objective Genetic approaches have identified numerous loci associated with coronary heart disease (CHD). The molecular mechanisms underlying CHD gene-disease associations, however, remain unclear. We hypothesized that genetic variants with both strong and subtle effects drive gene subnetworks that in turn affect CHD. Approach and Results We surveyed CHD-associated molecular interactions by constructing coexpression networks using whole blood gene expression profiles from 188 CHD cases and 188 age- and sex-matched controls. 24 coexpression modules were identified including one case-specific and one control-specific differential module (DM). The DMs were enriched for genes involved in B-cell activation, immune response, and ion transport. By integrating the DMs with altered gene expression associated SNPs (eSNPs) and with results of GWAS of CHD and its risk factors, the control-specific DM was implicated as CHD-causal based on its significant enrichment for both CHD and lipid eSNPs. This causal DM was further integrated with tissue-specific Bayesian networks and protein-protein interaction networks to identify regulatory key driver (KD) genes. Multi-tissue KDs (SPIB and TNFRSF13C) and tissue-specific KDs (e.g. EBF1) were identified. Conclusions Our network-driven integrative analysis not only identified CHD-related genes, but also defined network structure that sheds light on the molecular interactions of genes associated with CHD risk. PMID:23539213

  8. Identifying the molecular functions of electron transport proteins using radial basis function networks and biochemical properties.

    Science.gov (United States)

    Le, Nguyen-Quoc-Khanh; Nguyen, Trinh-Trung-Duong; Ou, Yu-Yen

    2017-05-01

    The electron transport proteins have an important role in storing and transferring electrons in cellular respiration, which is the most proficient process through which cells gather energy from consumed food. According to the molecular functions, the electron transport chain components could be formed with five complexes with several different electron carriers and functions. Therefore, identifying the molecular functions in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. This work includes two phases for discriminating electron transport proteins from transport proteins and classifying categories of five complexes in electron transport proteins. In the first phase, the performances from PSSM with AAIndex feature set were successful in identifying electron transport proteins in transport proteins with achieved sensitivity of 73.2%, specificity of 94.1%, and accuracy of 91.3%, with MCC of 0.64 for independent data set. With the second phase, our method can approach a precise model for identifying of five complexes with different molecular functions in electron transport proteins. The PSSM with AAIndex properties in five complexes achieved MCC of 0.51, 0.47, 0.42, 0.74, and 1.00 for independent data set, respectively. We suggest that our study could be a power model for determining new proteins that belongs into which molecular function of electron transport proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. NEWLY IDENTIFIED EXTENDED GREEN OBJECTS (EGOs) FROM THE SPITZER GLIMPSE II SURVEY. II. MOLECULAR CLOUD ENVIRONMENTS

    Energy Technology Data Exchange (ETDEWEB)

    Chen Xi; Gan Conggui; Shen Zhiqiang [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, Shanghai 200030 (China); Ellingsen, Simon P.; Titmarsh, Anita [School of Mathematics and Physics, University of Tasmania, Hobart, Tasmania (Australia); He Jinhua, E-mail: chenxi@shao.ac.cn [Key Laboratory for the Structure and Evolution of Celestial Objects, Yunnan Astronomical Observatory/National Astronomical Observatory, Chinese Academy of Sciences, P.O. Box 110, Kunming 650011, Yunnan Province (China)

    2013-06-01

    We have undertaken a survey of molecular lines in the 3 mm band toward 57 young stellar objects using the Australia Telescope National Facility Mopra 22 m radio telescope. The target sources were young stellar objects with active outflows (extended green objects (EGOs)) newly identified from the GLIMPSE II survey. We observe a high detection rate (50%) of broad line wing emission in the HNC and CS thermal lines, which combined with the high detection rate of class I methanol masers toward these sources (reported in Paper I) further demonstrates that the GLIMPSE II EGOs are associated with outflows. The physical and kinematic characteristics derived from the 3 mm molecular lines for these newly identified EGOs are consistent with these sources being massive young stellar objects with ongoing outflow activity and rapid accretion. These findings support our previous investigations of the mid-infrared properties of these sources and their association with other star formation tracers (e.g., infrared dark clouds, methanol masers and millimeter dust sources) presented in Paper I. The high detection rate (64%) of the hot core tracer CH{sub 3}CN reveals that the majority of these new EGOs have evolved to the hot molecular core stage. Comparison of the observed molecular column densities with predictions from hot core chemistry models reveals that the newly identified EGOs from the GLIMPSE II survey are members of the youngest hot core population, with an evolutionary time scale of the order of 10{sup 3} yr.

  10. Probing molecular mechanisms of the Hsp90 chaperone: biophysical modeling identifies key regulators of functional dynamics.

    Directory of Open Access Journals (Sweden)

    Anshuman Dixit

    Full Text Available Deciphering functional mechanisms of the Hsp90 chaperone machinery is an important objective in cancer biology aiming to facilitate discovery of targeted anti-cancer therapies. Despite significant advances in understanding structure and function of molecular chaperones, organizing molecular principles that control the relationship between conformational diversity and functional mechanisms of the Hsp90 activity lack a sufficient quantitative characterization. We combined molecular dynamics simulations, principal component analysis, the energy landscape model and structure-functional analysis of Hsp90 regulatory interactions to systematically investigate functional dynamics of the molecular chaperone. This approach has identified a network of conserved regions common to the Hsp90 chaperones that could play a universal role in coordinating functional dynamics, principal collective motions and allosteric signaling of Hsp90. We have found that these functional motifs may be utilized by the molecular chaperone machinery to act collectively as central regulators of Hsp90 dynamics and activity, including the inter-domain communications, control of ATP hydrolysis, and protein client binding. These findings have provided support to a long-standing assertion that allosteric regulation and catalysis may have emerged via common evolutionary routes. The interaction networks regulating functional motions of Hsp90 may be determined by the inherent structural architecture of the molecular chaperone. At the same time, the thermodynamics-based "conformational selection" of functional states is likely to be activated based on the nature of the binding partner. This mechanistic model of Hsp90 dynamics and function is consistent with the notion that allosteric networks orchestrating cooperative protein motions can be formed by evolutionary conserved and sparsely connected residue clusters. Hence, allosteric signaling through a small network of distantly connected

  11. Cortical GABA markers identify a molecular subtype of psychotic and bipolar disorders.

    Science.gov (United States)

    Volk, D W; Sampson, A R; Zhang, Y; Edelson, J R; Lewis, D A

    2016-09-01

    Deficits in gamma aminobutyric acid (GABA) neuron-related markers, including the GABA-synthesizing enzyme GAD67, the calcium-binding protein parvalbumin, the neuropeptide somatostatin, and the transcription factor Lhx6, are most pronounced in a subset of schizophrenia subjects identified as having a 'low GABA marker' (LGM) molecular phenotype. Furthermore, schizophrenia shares degrees of genetic liability, clinical features and cortical circuitry abnormalities with schizoaffective disorder and bipolar disorder. Therefore, we determined the extent to which a similar LGM molecular phenotype may also exist in subjects with these disorders. Transcript levels for GAD67, parvalbumin, somatostatin, and Lhx6 were quantified using quantitative PCR in prefrontal cortex area 9 of 184 subjects with a diagnosis of schizophrenia (n = 39), schizoaffective disorder (n = 23) or bipolar disorder (n = 35), or with a confirmed absence of any psychiatric diagnoses (n = 87). A blinded clustering approach was employed to determine the presence of a LGM molecular phenotype across all subjects. Approximately 49% of the subjects with schizophrenia, 48% of the subjects with schizoaffective disorder, and 29% of the subjects with bipolar disorder, but only 5% of unaffected subjects, clustered in the cortical LGM molecular phenotype. These findings support the characterization of psychotic and bipolar disorders by cortical molecular phenotype which may help elucidate more pathophysiologically informed and personalized medications.

  12. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers

    OpenAIRE

    Taïbi, Khaled; Campo, Antonio D. del; Vilagrosa Carmona, Alberto; Bellés, José M.; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J.; López-Nicolás, José M.; Mulet, José M.

    2017-01-01

    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of pre...

  13. MicroRNA Expression Profiling Identifies Molecular Diagnostic Signatures for Anaplastic Large Cell Lymphoma

    DEFF Research Database (Denmark)

    Liu, Cuiling; Iqbal, Javeed; Teruya-Feldstein, Julie

    2013-01-01

    distinct clustering of ALCL, PTCL-NOS, and the AITL subtype of PTCL. Cases of ALK(+) ALCL and ALK(-) ALCL were interspersed in unsupervised analysis, suggesting a close relationship at the molecular level. We identified an miRNA signature of 7 miRNAs (5 upregulated: miR-512-3p, miR-886-5p, miR-886-3p, mi...

  14. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers

    OpenAIRE

    Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E.M.

    2016-01-01

    Background The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequ...

  15. Anisotropic frictional heating and defect generation in cyclotrimethylene-trinitramine molecular crystals

    Science.gov (United States)

    Rajak, Pankaj; Mishra, Ankit; Sheng, Chunyang; Tiwari, Subodh; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya

    2018-05-01

    Anisotropic frictional response and corresponding heating in cyclotrimethylene-trinitramine molecular crystals are studied using molecular dynamics simulations. The nature of damage and temperature rise due to frictional forces is monitored along different sliding directions on the primary slip plane, (010), and on non-slip planes, (100) and (001). Correlations between the friction coefficient, deformation, and frictional heating are established. We find that the friction coefficients on slip planes are smaller than those on non-slip planes. In response to sliding on a slip plane, the crystal deforms easily via dislocation generation and shows less heating. On non-slip planes, due to the inability of the crystal to deform via dislocation generation, a large damage zone is formed just below the contact area, accompanied by the change in the molecular ring conformation from chair to boat/half-boat. This in turn leads to a large temperature rise below the contact area.

  16. Molecular subtypes of osteosarcoma identified by reducing tumor heterogeneity through an interspecies comparative approach

    Science.gov (United States)

    Scott, Milcah C.; Sarver, Aaron L.; Gavin, Katherine J.; Thayanithy, Venugopal; Getzy, David M.; Newman, Robert A.; Cutter, Gary R.; Lindblad-Toh, Kerstin; Kisseberth, William C.; Hunter, Lawrence E.; Subramanian, Subbaya; Breen, Matthew; Modiano, Jaime F.

    2011-01-01

    The heterogeneous and chaotic nature of osteosarcoma has confounded accurate molecular classification, prognosis, and prediction for this tumor. The occurrence of spontaneous osteosarcoma is largely confined to humans and dogs. While the clinical features are remarkably similar in both species, the organization of dogs into defined breeds provides a more homogeneous genetic background that may increase the likelihood to uncover molecular subtypes for this complex disease. We thus hypothesized that molecular profiles derived from canine osteosarcoma would aid in molecular subclassification of this disease when applied to humans. To test the hypothesis, we performed genome wide gene expression profiling in a cohort of dogs with osteosarcoma, primarily from high-risk breeds. To further reduce inter-sample heterogeneity, we assessed tumor-intrinsic properties through use of an extensive panel of osteosarcoma-derived cell lines. We observed strong differential gene expression that segregated samples into two groups with differential survival probabilities. Groupings were characterized by the inversely correlated expression of genes associated with G2/M transition and DNA damage checkpoint and microenvironment-interaction categories. This signature was preserved in data from whole tumor samples of three independent dog osteosarcoma cohorts, with stratification into the two expected groups. Significantly, this restricted signature partially overlapped a previously defined, predictive signature for soft tissue sarcomas, and it unmasked orthologous molecular subtypes and their corresponding natural histories in five independent data sets from human patients with osteosarcoma. Our results indicate that the narrower genetic diversity of dogs can be utilized to group complex human osteosarcoma into biologically and clinically relevant molecular subtypes. This in turn may enhance prognosis and prediction, and identify relevant therapeutic targets. PMID:21621658

  17. Analysis of nano-sized irradiation-induced defects in Fe-base materials by means of small angle neutron scattering and molecular dynamics simulations

    International Nuclear Information System (INIS)

    Yu, G.

    2008-12-01

    of RAFM steels with Molecular Dynamics (MD) simulations of main expected nano-sized defects in irradiated pure Fe and Fe-He alloys, as model materials for RAFM steels, and simulations of their corresponding TEM images and SANS signals. In particular, the SANS signal of various types of defects was simulated for the first time. The methodology used in this work was the following: (i) SANS experiments were performed by applying a strong saturating magnetic field to unirradiated and irradiated specimens of three types of RAFM steels, namely the European EUROFER 97, the Japanese F82H and the Swiss OPTIMAX A steels. The available irradiated specimens included specimens which had been irradiated with 590 MeV protons in the Proton IRradiation EXperiment (PIREX) facility at the Paul Scherrer Institute (PSI) at temperatures in the range of 50-350 °C to doses in the range of 0.3-2.0 dpa. SANS spectra as well as values of the so-called A ratio, which represents the ratio of the total scattered intensity to the nuclear scattered intensity, were obtained for the various irradiation doses and temperatures investigated. (ii) MD simulations of atomic displacement cascades in pure Fe and in Fe-He alloys were performed using Embedded Atom Method (EAM) many-body interatomic potentials. The main nano-sized defects that should be produced in RAFM steels under irradiation were created by means of MD in pure Fe. These included dislocation loops of various types, voids, helium bubbles with various He concentration and Cr precipitates. (iii) TEM images of cascade damage and all the defects created by MD were simulated in the dark field/weak beam imaging modes by using the Electron Microscopy Software (EMS) developed by P.A. Stadelmann (EPFL) and analyzed in terms of variations of contrast intensities versus depth inside the specimen. (iv) The SANS signal provided by cascade damage and all the defects created by MD was simulated by using a slightly modified version of EMS, accounting for

  18. The cellular and molecular etiology of the craniofacial defects in the avian ciliopathic mutant talpid2

    Science.gov (United States)

    talpid2 is an avian autosomal recessive mutant with a myriad of congenital malformations, including polydactyly and facial clefting. Although phenotypically similar to talpid3, talpid2 has a distinct facial phenotype and an unknown cellular, molecular and genetic basis. We set out to determine the e...

  19. Defect properties of InGaAsN layers grown as sub-monolayer digital alloys by molecular beam epitaxy

    Science.gov (United States)

    Baranov, Artem I.; Gudovskikh, Alexander S.; Kudryashov, Dmitry A.; Lazarenko, Alexandra A.; Morozov, Ivan A.; Mozharov, Alexey M.; Nikitina, Ekaterina V.; Pirogov, Evgeny V.; Sobolev, Maxim S.; Zelentsov, Kirill S.; Egorov, Anton Yu.; Darga, Arouna; Le Gall, Sylvain; Kleider, Jean-Paul

    2018-04-01

    The defect properties of InGaAsN dilute nitrides grown as sub-monolayer digital alloys (SDAs) by molecular beam epitaxy for photovoltaic application were studied by space charge capacitance spectroscopy. Alloys of i-InGaAsN (Eg = 1.03 eV) were lattice-matched grown on GaAs wafers as a superlattice of InAs/GaAsN with one monolayer of InAs (solar cells. Low p-type background doping was demonstrated at room temperature in samples with InGaAsN layers 900 nm and 1200 nm thick (less 1 × 1015 cm-3). According to admittance spectroscopy and deep-level transient spectroscopy measurements, the SDA approach leads to defect-free growth up to a thickness of 900 nm. An increase in thickness to 1200 nm leads to the formation of non-radiative recombination centers with an activation energy of 0.5 eV (NT = 8.4 × 1014 cm-3) and a shallow defect level at 0.20 eV. The last one leads to the appearance of additional doping, but its concentration is low (NT = 5 × 1014 cm-3) so it does not affect the photoelectric properties. However, further increase in thickness to 1600 nm, leads to significant growth of its concentration to (3-5) × 1015 cm-3, while the concentration of deep levels becomes 1.3 × 1015 cm-3. Therefore, additional free charge carriers appearing due to ionization of the shallow level change the band diagram from p-i-n to p-n junction at room temperature. It leads to a drop of the external quantum efficiency due to the effect of pulling electric field decrease in the p-n junction and an increased number of non-radiative recombination centers that negatively impact lifetimes in InGaAsN.

  20. Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

    Directory of Open Access Journals (Sweden)

    Nikhil Moorchung

    2013-01-01

    Full Text Available Introduction: Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. Materials and Methods: 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR-based allele-specific Amplification Refractory Mutation System (ARMS. Molecular analysis for the sickle cell mutation was done by standard methods. Results: The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23% of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Discussion and Conclusion: Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

  1. Comparing hair-morphology and molecular methods to identify fecal samples from Neotropical felids.

    Directory of Open Access Journals (Sweden)

    Carlos C Alberts

    Full Text Available To avoid certain problems encountered with more-traditional and invasive methods in behavioral-ecology studies of mammalian predators, such as felids, molecular approaches have been employed to identify feces found in the field. However, this method requires a complete molecular biology laboratory, and usually also requires very fresh fecal samples to avoid DNA degradation. Both conditions are normally absent in the field. To address these difficulties, identification based on morphological characters (length, color, banding, scales and medullar patterns of hairs found in feces could be employed as an alternative. In this study we constructed a morphological identification key for guard hairs of eight Neotropical felids (jaguar, oncilla, Geoffroy's cat, margay, ocelot, Pampas cat, puma and jaguarundi and compared its efficiency to that of a molecular identification method, using the ATP6 region as a marker. For this molecular approach, we simulated some field conditions by postponing sample-conservation procedures. A blind test of the identification key obtained a nearly 70% overall success rate, which we considered equivalent to or better than the results of some molecular methods (probably due to DNA degradation found in other studies. The jaguar, puma and jaguarundi could be unequivocally discriminated from any other Neotropical felid. On a scale ranging from inadequate to excellent, the key proved poor only for the margay, with only 30% of its hairs successfully identified using this key; and have intermediate success rates for the remaining species, the oncilla, Geoffroy's cat, ocelot and Pampas cat, were intermediate. Complementary information about the known distributions of felid populations may be necessary to substantially improve the results obtained with the key. Our own molecular results were even better, since all blind-tested samples were correctly identified. Part of these identifications were made from samples kept in suboptimal

  2. Array-based molecular karyotyping in 115 VATER/VACTERL and VATER/VACTERL-like patients identifies disease-causing copy number variations.

    Science.gov (United States)

    Zhang, Rong; Marsch, Florian; Kause, Franziska; Degenhardt, Franziska; Schmiedeke, Eeberhard; Märzheuser, Stefanie; Hoppe, Bernd; Bachour, Haitham; Boemers, Thomas M; Schäfer, Matthias; Spychalski, Nicole; Neser, Jörg; Leonhardt, Johannes; Kosch, Ferdinand; Ure, Benno; Gómez, Barbara; Lacher, Martin; Deffaa, Oliver J; Palta, Markus; Wittekindt, Boris; Kleine, Katharina; Schmedding, Andrea; Grasshoff-Derr, Sabine; Ven, Amelie van der; Heilmann-Heimbach, Stefanie; Zwink, Nadine; Jenetzky, Ekkehart; Ludwig, Michael; Reutter, Heiko

    2017-07-17

    The acronym VATER/VACTERL refers to the rare nonrandom association of the following component features (CF): vertebral defects (V), anorectal malformations (A), cardiac defects (C), tracheoesophageal fistula with or without esophageal atresia, renal malformations (R), and limb defects (L). Patients presenting with at least three CFs are diagnosed as having VATER/VACTERL association while patients presenting with only two CFs are diagnosed as having VATER/VACTERL-like phenotypes. Recently, rare causative copy number variations (CNVs) have been identified in patients with VATER/VACTERL association and VATER/VACTERL-like phenotypes. To detect further causative CNVs we performed array based molecular karyotyping in 75 VATER/VACTERL and 40 VATER/VACTERL-like patients. Following the application of stringent filter criteria, we identified 13 microdeletions and seven microduplications in 20 unrelated patients all of which were absent in 1,307 healthy inhouse controls (n microdeletion at 17q12 was confirmed to be de novo. Three microdeletions at 5q23.1, 16q23.3, 22q11.21, and one microduplication at 10q11.21 were all absent in the available parent. Microdeletion of chromosomal region 22q11.21 was previously found in VATER/VACTERL patients rendering it to be causative in our patient. The remaining 15 CNVs were inherited from a healthy parent. In two of 115 patients' causative CNVs were found (2%). The remaining identified rare CNVs represent candidates for further evaluation. Rare inherited CNVs may constitute modifiers of, or contributors to, multifactorial VATER/VACTERL or VATER/VACTERL-like phenotypes. Birth Defects Research 109:1063-1069, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  3. Pathophysiology of Adipocyte Defects and Dyslipidemia in HIV Lipodystrophy: New Evidence from Metabolic and Molecular Studies

    OpenAIRE

    Ashok Balasubramanyam; Rajagopal V. Sekhar; Farook Jahoor; Henry J. Pownall; Dorothy Lewis

    2006-01-01

    Despite a burgeoning mass of descriptive information regarding the epidemiology, clinical features, body composition changes, hormonal alterations and dyslipidemic patterns in patients with HIV lipodystrophy syndrome (HLS), the specific biochemical pathways that are dysregulated in the condition and the molecular mechanisms that lead to their dysfunction, remain relatively unexplored. In this paper, we review studies that detail the metabolic basis of the dyslipidemia - specifically, the hype...

  4. Quantitative proteomics identify molecular targets that are crucial in larval settlement and metamorphosis of bugula neritina

    KAUST Repository

    Zhang, Huoming

    2011-01-07

    The marine invertebrate Bugula neritina has a biphasic life cycle that consists of a swimming larval stage and a sessile juvenile and adult stage. The attachment of larvae to the substratum and their subsequent metamorphosis have crucial ecological consequences. Despite many studies on this species, little is known about the molecular mechanism of these processes. Here, we report a comparative study of swimming larvae and metamorphosing individuals at 4 and 24 h postattachment using label-free quantitative proteomics. We identified more than 1100 proteins at each stage, 61 of which were differentially expressed. Specifically, proteins involved in energy metabolism and structural molecules were generally down-regulated, whereas proteins involved in transcription and translation, the extracellular matrix, and calcification were strongly up-regulated during metamorphosis. Many tightly regulated novel proteins were also identified. Subsequent analysis of the temporal and spatial expressions of some of the proteins and an assay of their functions indicated that they may have key roles in metamorphosis of B. neritina. These findings not only provide molecular evidence with which to elucidate the substantial changes in morphology and physiology that occur during larval attachment and metamorphosis but also identify potential targets for antifouling treatment. © 2011 American Chemical Society.

  5. Identifying molecular subtypes in human colon cancer using gene expression and DNA methylation microarray data.

    Science.gov (United States)

    Ren, Zhonglu; Wang, Wenhui; Li, Jinming

    2016-02-01

    Identifying colon cancer subtypes based on molecular signatures may allow for a more rational, patient-specific approach to therapy in the future. Classifications using gene expression data have been attempted before with little concordance between the different studies carried out. In this study we aimed to uncover subtypes of colon cancer that have distinct biological characteristics and identify a set of novel biomarkers which could best reflect the clinical and/or biological characteristics of each subtype. Clustering analysis and discriminant analysis were utilized to discover the subtypes in two different molecular levels on 153 colon cancer samples from The Cancer Genome Atlas (TCGA) Data Portal. At gene expression level, we identified two major subtypes, ECL1 (expression cluster 1) and ECL2 (expression cluster 2) and a list of signature genes. Due to the heterogeneity of colon cancer, the subtype ECL1 can be further subdivided into three nested subclasses, and HOTAIR were found upregulated in subclass 2. At DNA methylation level, we uncovered three major subtypes, MCL1 (methylation cluster 1), MCL2 (methylation cluster 2) and MCL3 (methylation cluster 3). We found only three subtypes of CpG island methylator phenotype (CIMP) in colon cancer instead of the four subtypes in the previous reports, and we found no sufficient evidence to subdivide MCL3 into two distinct subgroups.

  6. New jump mechanisms for dumbbell and induced migration of point defects by molecular dynamics simulation

    International Nuclear Information System (INIS)

    Doan, N.V.; Pontikis, V.; Tenenbaum, A.

    1978-01-01

    The induced migration of the (100) - dumbbell is studied using the molecular dynamics simulation. Two new types of jumps are discovered for the dumbbell: first the jump takes place through an intermediate crowdion configuration (110), then the crowdion is converted into the dumbbell configuration with some other orientation. The threshold energy is found for different knocked-on directions. The dependence of the interstitial jump frequency on the incident electron energy is determined for copper. The induced interstitial migration shows a maximum value, but for an electron energy around 15 Kev. The effect of new jump mechanisms on the effective recombination volume is discussed

  7. Using molecular tools to identify the geographical origin of a case of human brucellosis.

    Science.gov (United States)

    Muchowski, J K; Koylass, M S; Dainty, A C; Stack, J A; Perrett, L; Whatmore, A M; Perrier, C; Chircop, S; Demicoli, N; Gatt, A B; Caruana, P A; Gopaul, K K

    2015-10-01

    Although Malta is historically linked with the zoonosis brucellosis, there had not been a case of the disease in either the human or livestock population for several years. However, in July 2013 a case of human brucellosis was identified on the island. To determine whether this recent case originated in Malta, four isolates from this case were subjected to molecular analysis. Molecular profiles generated using multilocus sequence analysis and multilocus variable number tandem repeat for the recent human case isolates and 11 Brucella melitensis strains of known Maltese origin were compared with others held on in-house and global databases. While the 11 isolates of Maltese origin formed a distinct cluster, the recent human isolation was not associated with these strains but instead clustered with isolates originating from the Horn of Africa. These data was congruent with epidemiological trace-back showed that the individual had travelled to Malta from Eritrea. This work highlights the potential of using molecular typing data to aid in epidemiological trace-back of Brucella isolations and assist in monitoring of the effectiveness of brucellosis control schemes.

  8. Formation of grown-in defects in molecular beam epitaxial Ga(In)NP: Effects of growth conditions and postgrowth treatments

    International Nuclear Information System (INIS)

    Dagnelund, D.; Buyanova, I. A.; Wang, X. J.; Chen, W. M.; Utsumi, A.; Furukawa, Y.; Wakahara, A.; Yonezu, H.

    2008-01-01

    Effects of growth conditions and post-growth treatments, such as presence of N ions, N 2 flow, growth temperature, In alloying, and postgrowth rapid thermal annealing (RTA), on formation of grown-in defects in Ga(In)NP prepared by molecular beam epitaxy are studied in detail by the optically detected magnetic resonance (ODMR) technique. Several common residual defects, such as two Ga-interstitial defects (i.e., Ga i -A and Ga i -B) and two unidentified defects with a g factor around 2 (denoted by S1 and S2), are closely monitored. Bombardment of impinging N ions on grown sample surface is found to facilitate formation of these defects. Higher N 2 flow is shown to have an even more profound effect than a higher number of ions in introducing these defects. Incorporation of a small amount of In (e.g., 5.1%) in GaNP seems to play a minor role in the formation of the defects. In GaInNP with 45% of In; however, the defects were found to be abundant. Effect of RTA on the defects is found to depend on initial configurations of Ga i -related defects formed during the growth. In the alloys where the Ga i -A and Ga i -B defects are absent in the as-grown samples (i.e., GaNP grown at a low temperature of 460 deg. C), the concentrations of the two Ga i defects are found to increase after postgrowth RTA. This indicates that the defects originally introduced in the as-grown alloys have been transformed into the more thermally stable Ga i -A and Ga i -B during RTA. On the other hand, when the Ga i -A and Ga i -B are readily abundant (e.g., at higher growth temperatures (≥500 deg. C), RTA leads to a slight reduction of the Ga i -A and Ga i -B ODMR signals. The S2 defect is also shown to be thermally stable upon the RTA treatment

  9. The intellectual capacity of patients with Laron syndrome (LS) differs with various molecular defects of the growth hormone receptor gene. Correlation with CNS abnormalities.

    Science.gov (United States)

    Shevah, O; Kornreich, L; Galatzer, A; Laron, Z

    2005-12-01

    The correlation between the molecular defects of the GH receptor (R), psychosocial development and brain abnormalities were evaluated in 10 patients with Laron syndrome (LS), in whom all data were available. The findings revealed that the intelligence quotient (IQ) and abnormalities in the brain of the patients with LS differ with various molecular defects of the GH-receptor. The most severe mental deficits and brain pathology occurred in patients with 3, 5, 6 exon deletion. Patients with point mutations in exons 2, 4 and 7 presented various degrees of medium to mild CNS abnormalities that correlated with the IQ. Notably, the patient with the E180 splice mutation in exon 6 had a normal IQ, which fits the report on normal IQ in a large Ecuadorian cohort with the same mutation. This is the first report to support a correlation between IQ, brain abnormalities and localization of the molecular defects in the GH-R gene. As all patients with LS are IGF-I-deficient, it must be assumed that other as yet unknown factors related to the molecular defects in the GH-R are the major cause of the differences in intellect and brain abnormalities.

  10. Comprehensive expression profiling of tumor cell lines identifies molecular signatures of melanoma progression.

    Directory of Open Access Journals (Sweden)

    Byungwoo Ryu

    2007-07-01

    Full Text Available Gene expression profiling has revolutionized our ability to molecularly classify primary human tumors and significantly enhanced the development of novel tumor markers and therapies; however, progress in the diagnosis and treatment of melanoma over the past 3 decades has been limited, and there is currently no approved therapy that significantly extends lifespan in patients with advanced disease. Profiling studies of melanoma to date have been inconsistent due to the heterogeneous nature of this malignancy and the limited availability of informative tissue specimens from early stages of disease.In order to gain an improved understanding of the molecular basis of melanoma progression, we have compared gene expression profiles from a series of melanoma cell lines representing discrete stages of malignant progression that recapitulate critical characteristics of the primary lesions from which they were derived. Here we describe the unsupervised hierarchical clustering of profiling data from melanoma cell lines and melanocytes. This clustering identifies two distinctive molecular subclasses of melanoma segregating aggressive metastatic tumor cell lines from less-aggressive primary tumor cell lines. Further analysis of expression signatures associated with melanoma progression using functional annotations categorized these transcripts into three classes of genes: 1 Upregulation of activators of cell cycle progression, DNA replication and repair (CDCA2, NCAPH, NCAPG, NCAPG2, PBK, NUSAP1, BIRC5, ESCO2, HELLS, MELK, GINS1, GINS4, RAD54L, TYMS, and DHFR, 2 Loss of genes associated with cellular adhesion and melanocyte differentiation (CDH3, CDH1, c-KIT, PAX3, CITED1/MSG-1, TYR, MELANA, MC1R, and OCA2, 3 Upregulation of genes associated with resistance to apoptosis (BIRC5/survivin. While these broad classes of transcripts have previously been implicated in the progression of melanoma and other malignancies, the specific genes identified within each class

  11. Chromosomal Instability and Molecular Defects in Induced Pluripotent Stem Cells from Nijmegen Breakage Syndrome Patients

    Directory of Open Access Journals (Sweden)

    Tomer Halevy

    2016-08-01

    Full Text Available Nijmegen breakage syndrome (NBS results from the absence of the NBS1 protein, responsible for detection of DNA double-strand breaks (DSBs. NBS is characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. Here, we show successful reprogramming of NBS fibroblasts into induced pluripotent stem cells (NBS-iPSCs. Our data suggest a strong selection for karyotypically normal fibroblasts to go through the reprogramming process. NBS-iPSCs then acquire numerous chromosomal aberrations and show a delayed response to DSB induction. Furthermore, NBS-iPSCs display slower growth, mitotic inhibition, a reduced apoptotic response to stress, and abnormal cell-cycle-related gene expression. Importantly, NBS neural progenitor cells (NBS-NPCs show downregulation of neural developmental genes, which seems to be mediated by P53. Our results demonstrate the importance of NBS1 in early human development, shed light on the molecular mechanisms underlying this severe syndrome, and further expand our knowledge of the genomic stress cells experience during the reprogramming process.

  12. Molecular dynamics simulation on mechanical properties of crystalline CoSb3 with vacancy defect

    International Nuclear Information System (INIS)

    Yang Xuqiu; Zhai Pengcheng; Liu Lisheng; Zhang Qingjie

    2012-01-01

    The present work has investigated the tensile mechanical behavior of the skutterudite CoSb 3 single-crystal in the presence of antimony vacancies, since the antimony atoms in CoSb 3 are active and are usually easy to lose in practice. The molecular dynamics simulation method is employed. The vacancy atoms, whose fraction is limited up to 5%, are chosen randomly. The virtual uniaxial tension is carried out by strain controlling along a principal crystallographic direction at 300 K. The specimens with vacancies show similar stress-strain response features to there of the perfect crystal. However, the effective Young's modulus decreases linearly with the increase of the vacancy content, and the ultimate strength drops substantially from no vacancy to even a small vacancy fraction. Temperature dependence of the simulation results is also considered. Both Young's modulus and the ultimate strength exhibit an approximately linear reduction with increasing temperature for a specific vacancy fraction, and moreover, the reduction rate is comparable for different vacancy fractions. The Vacancy distribution effect is briefly discussed as well. As the vacancy concentration becomes uniform, the ultimate strength of the material would be promoted significantly.

  13. Dissecting molecular stress networks: identifying nodes of divergence between life-history phenotypes.

    Science.gov (United States)

    Schwartz, Tonia S; Bronikowski, Anne M

    2013-02-01

    The complex molecular network that underlies physiological stress response is comprised of nodes (proteins, metabolites, mRNAs, etc.) whose connections span cells, tissues and organs. Variable nodes are points in the network upon which natural selection may act. Thus, identifying variable nodes will reveal how this molecular stress network may evolve among populations in different habitats and how it might impact life-history evolution. Here, we use physiological and genetic assays to test whether laboratory-born juveniles from natural populations of garter snakes (Thamnophis elegans), which have diverged in their life-history phenotypes, vary concomitantly at candidate nodes of the stress response network, (i) under unstressed conditions and (ii) in response to an induced stress. We found that two common measures of stress (plasma corticosterone and liver gene expression of heat shock proteins) increased under stress in both life-history phenotypes. In contrast, the phenotypes diverged at four nodes both under unstressed conditions and in response to stress: circulating levels of reactive oxygen species (superoxide, H(2)O(2)); liver gene expression of GPX1 and erythrocyte DNA damage. Additionally, allele frequencies for SOD2 diverge from neutral markers, suggesting diversifying selection on SOD2 alleles. This study supports the hypothesis that these life-history phenotypes have diverged at the molecular level in how they respond to stress, particularly in nodes regulating oxidative stress. Furthermore, the differences between the life-history phenotypes were more pronounced in females. We discuss the responses to stress in the context of the associated life-history phenotype and the evolutionary pressures thought to be responsible for divergence between the phenotypes. © 2012 Blackwell Publishing Ltd.

  14. Gene expression analysis to identify molecular correlates of pre- and post-conditioning derived neuroprotection.

    Science.gov (United States)

    Prasad, Shiv S; Russell, Marsha; Nowakowska, Margeryta; Williams, Andrew; Yauk, Carole

    2012-06-01

    Mild ischaemic exposures before or after severe injurious ischaemia that elicit neuroprotective responses are referred to as preconditioning and post-conditioning. The corresponding molecular mechanisms of neuroprotection are not completely understood. Identification of the genes and associated pathways of corresponding neuroprotection would provide insight into neuronal survival, potential therapeutic approaches and assessments of therapies for stroke. The objectives of this study were to use global gene expression approach to infer the molecular mechanisms in pre- and post-conditioning-derived neuroprotection in cortical neurons following oxygen and glucose deprivation (OGD) in vitro and then to apply these findings to predict corresponding functional pathways. To this end, microarray analysis was applied to rat cortical neurons with or without the pre- and post-conditioning treatments at 3-h post-reperfusion, and differentially expressed transcripts were subjected to statistical, hierarchical clustering and pathway analyses. The expression patterns of 3,431 genes altered under all conditions of ischaemia (with and without pre- or post-conditioning). We identified 1,595 genes that were commonly regulated within both the pre- and post-conditioning treatments. Cluster analysis revealed that transcription profiles clustered tightly within controls, non-conditioned OGD and neuroprotected groups. Two clusters defining neuroprotective conditions associated with up- and downregulated genes were evident. The five most upregulated genes within the neuroprotective clusters were Tagln, Nes, Ptrf, Vim and Adamts9, and the five most downregulated genes were Slc7a3, Bex1, Brunol4, Nrxn3 and Cpne4. Pathway analysis revealed that the intracellular and second messenger signalling pathways in addition to cell death were predominantly associated with downregulated pre- and post-conditioning associated genes, suggesting that modulation of cell death and signal transduction pathways

  15. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    International Nuclear Information System (INIS)

    Bukkuru, S.; Bhardwaj, U.; Warrier, M.; Rao, A.D.P.; Valsakumar, M.C.

    2017-01-01

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values “r” to the lattice constant “a” lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods. - Highlights: • Max-Space Clustering (MSC) method is developed to identify interstitials in crystals. • MSC provides a structured way to identify the temperature dependent cut-off radius. • It is compared with widely used sphere methods and found to be better. • MSC coupled with graph tree optimization can be used to obtain diffusion trajectory. • Cascade simulations of Fe, W are carried out and results are compared with various methods.

  16. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Bukkuru, S., E-mail: srinivasaraobukkuru@gmail.com [Dept. of Nuclear Physics, Andhra University, Visakhapatnam 530003 (India); Bhardwaj, U., E-mail: haptork@gmail.com [Computational Analysis Division, BARC, Visakhapatnam 530012, Andhra Pradesh (India); Warrier, M., E-mail: manoj.warrier@gmail.com [Computational Analysis Division, BARC, Visakhapatnam 530012, Andhra Pradesh (India); Rao, A.D.P., E-mail: adp_rao_99@yahoo.com [Dept. of Nuclear Physics, Andhra University, Visakhapatnam 530003 (India); Valsakumar, M.C., E-mail: mc.valsakumar@gmail.com [IIT Palakkad, Kozhippara P.O., Palakkad 678557, Kerala (India)

    2017-02-15

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values “r” to the lattice constant “a” lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods. - Highlights: • Max-Space Clustering (MSC) method is developed to identify interstitials in crystals. • MSC provides a structured way to identify the temperature dependent cut-off radius. • It is compared with widely used sphere methods and found to be better. • MSC coupled with graph tree optimization can be used to obtain diffusion trajectory. • Cascade simulations of Fe, W are carried out and results are compared with various methods.

  17. Duodenoscope-Related Outbreak of a Carbapenem-Resistant Klebsiella pneumoniae Identified Using Advanced Molecular Diagnostics.

    Science.gov (United States)

    Humphries, Romney M; Yang, Shuan; Kim, Stephen; Muthusamy, Venkatara Raman; Russell, Dana; Trout, Alisa M; Zaroda, Teresa; Cheng, Quen J; Aldrovandi, Grace; Uslan, Daniel Zachary; Hemarajata, Peera; Rubin, Zachary Aaron

    2017-10-01

    Carbapenem-resistant Klebsiella pneumoniae infections are increasingly prevalent in North American hospitals. We describe an outbreak of carbapenem-resistant K. pneumoniae containing the blaOXA-232 gene transmitted by contaminated duodenoscopes during endoscopic retrograde cholangiopancreatography (ERCP) procedures. An outbreak investigation was performed when 9 patients with blaOXA-232 carbapenem-resistant K. pneumoniae infections were identified at a tertiary care hospital. The investigation included 2 case-control studies, review of duodenoscope reprocessing procedures, and culture of devices. Carbapenem-resistant Enterobacteriacieae (CRE) isolates were evaluated with polymerase chain reaction analysis for carbapenemase genes, and isolates with the blaOXA-232 gene were subjected to whole-genome sequencing and chromosome single-nucleotide polymorphism analysis. On recognition of ERCP as a key risk factor for infection, targeted patient notification and CRE screening cultures were performed. Molecular testing ultimately identified 17 patients with blaOxa-232 carbapenem-resistant K. pneumoniae isolates, including 9 with infections, 7 asymptomatic carriers who had undergone ERCP, and 1 additional patient who had been hospitalized in India and was probably the initial carrier. Two case-control studies established a point-source outbreak associated with 2 specific duodenoscopes. A field investigation of the use, reprocessing, and storage of deuodenoscopes did not identify deviations from US Food and Drug Administration or manufacturer recommendations for reprocessing. This outbreak demonstrated the previously underappreciated potential for duodenoscopes to transmit disease, even after undergoing high-level disinfection according to manufacturers' guidelines.

  18. Identifying self-interstitials of bcc and fcc crystals in molecular dynamics

    Science.gov (United States)

    Bukkuru, S.; Bhardwaj, U.; Warrier, M.; Rao, A. D. P.; Valsakumar, M. C.

    2017-02-01

    Identification of self-interstitials in molecular dynamics (MD) simulations is of critical importance. There exist several criteria for identifying the self-interstitial. Most of the existing methods use an assumed cut-off value for the displacement of an atom from its lattice position to identify the self-interstitial. The results obtained are affected by the chosen cut-off value. Moreover, these chosen cut-off values are independent of temperature. We have developed a novel unsupervised learning algorithm called Max-Space Clustering (MSC) to identify an appropriate cut-off value and its dependence on temperature. This method is compared with some widely used methods such as effective sphere (ES) method and nearest neighbor sphere (NNS) method. The cut-off radius obtained using our method shows a linear variation with temperature. The value of cut-off radius and its temperature dependence is derived for five bcc (Cr, Fe, Mo, Nb, W) and six fcc (Ag, Au, Cu, Ni, Pd, Pt) crystals. It is seen that the ratio of the cut-off values "r" to the lattice constant "a" lies between 0.23 and 0.3 at 300 K and this ratio is on an average smaller for the fcc crystals. Collision cascade simulations are carried out for Primary knock-on Atom (PKA) energies of 5 keV in Fe (at 300 K and 1000 K) and W (at 300 K and 2500 K) and the results are compared using the various methods.

  19. Subjects with molecularly defined familial hypercholesterolemia or familial defective apoB-100 are not being adequately treated.

    Directory of Open Access Journals (Sweden)

    Trond P Leren

    2011-02-01

    Full Text Available To study whether subjects with a molecular genetic diagnosis of familial hypercholesterolemia (FH or familial defective apoB-100 (FDB are being adequately treated.A questionnaire regarding medical history was sent to 2611 subjects who had been provided with a molecular genetic diagnosis of FH or FDB, and a blood sample was obtained for lipid measurements.956 (36.6% of the 2611 subjects participated. The mean age for starting lipid-lowering therapy was 33.4 (±12.1 years. Among those below 18 years of age, only 20.4% were on lipid-lowering drugs, whereas 89.1% of those aged 18 and above were on lipid-lowering drugs. The mean levels of total serum cholesterol and LDL-cholesterol were 5.7 (±1.5 mmol/l and 3.9 (±1.3 mmol/l, respectively. Among those who were on lipid-lowering drugs, 29.0% and 12.2% had levels of LDL cholesterol below 3.0 mmol/l and 2.6 mmol/l, respectively. Only 47.3% of the 956 subjects were considered as being adequately treated largely due to a failure to titrate their drug regimens. From the use of cholesterol-years score, lipid-lowering therapy must start before the age of 20 in order to prevent the subjects from contracting premature coronary heart disease.The majority of FH/FDB subjects are being diagnosed late in life and are not being adequately treated. In order to prevent them from contracting premature coronary heart disease, it is key that levels of LDL cholesterol are normalized from a young age and that sufficient doses of lipid-lowering drugs are being used.

  20. A mouse model of alcoholic liver fibrosis-associated acute kidney injury identifies key molecular pathways

    International Nuclear Information System (INIS)

    Furuya, Shinji; Chappell, Grace A.; Iwata, Yasuhiro; Uehara, Takeki; Kato, Yuki; Kono, Hiroshi; Bataller, Ramon; Rusyn, Ivan

    2016-01-01

    Clinical data strongly indicate that acute kidney injury (AKI) is a critical complication in alcoholic hepatitis, an acute-on-chronic form of liver failure in patients with advanced alcoholic fibrosis. Development of targeted therapies for AKI in this setting is hampered by the lack of an animal model. To enable research into molecular drivers and novel therapies for fibrosis- and alcohol-associated AKI, we aimed to combine carbon tetrachloride (CCl 4 )-induced fibrosis with chronic intra-gastric alcohol feeding. Male C57BL/6J mice were administered a low dose of CCl 4 (0.2 ml/kg 2 × week/6 weeks) followed by alcohol intragastrically (up to 25 g/kg/day for 3 weeks) and with continued CCl 4 . We observed that combined treatment with CCl 4 and alcohol resulted in severe liver injury, more pronounced than using each treatment alone. Importantly, severe kidney injury was evident only in the combined treatment group. This mouse model reproduced distinct pathological features consistent with AKI in human alcoholic hepatitis. Transcriptomic analysis of kidneys revealed profound effects in the combined treatment group, with enrichment for damage-associated pathways, such as apoptosis, inflammation, immune-response and hypoxia. Interestingly, Havcr1 and Lcn2, biomarkers of AKI, were markedly up-regulated. Overall, this study established a novel mouse model of fibrosis- and alcohol-associated AKI and identified key mechanistic pathways. - Highlights: • Acute kidney injury (AKI) is a critical complication in alcoholic hepatitis • We developed a novel mouse model of fibrosis- and alcohol-associated AKI • This model reproduces key molecular and pathological features of human AKI • This animal model can help identify new targeted therapies for alcoholic hepatitis

  1. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers.

    Science.gov (United States)

    Taïbi, Khaled; Del Campo, Antonio D; Vilagrosa, Alberto; Bellés, José M; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J; López-Nicolás, José M; Mulet, José M

    2017-01-01

    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of predicting the ability of formerly uncharacterized seedlings to cope with drought stress. Gas-exchange, water potential, photosynthetic pigments, soluble sugars, free amino acids, glutathione and proteomic analyses were carried out on control and drought-stressed seedlings in greenhouse conditions. Gas-exchange determinations were also assessed in field-planted seedlings in order to validate the greenhouse experimental conditions. Drought-tolerant seed sources presented higher values of photosynthetic rates, water use efficiency, photosynthetic pigments and soluble carbohydrates concentrations. We observed the same pattern of variation of photosynthesis rate and maximal efficiency of PSII in field. Interestingly drought-tolerant seed sources exhibited increased levels of glutathione, methionine and cysteine. The proteomic profile of drought tolerant seedlings identified two heat shock proteins and an enzyme related to methionine biosynthesis that were not present in drought sensitive seedlings, pointing to the synthesis of sulfur amino acids as a limiting factor for drought tolerance in Pinus halepensis . Our results established physiological and molecular traits useful as distinctive markers to predict drought tolerance in Pinus halepensis provenances that could be reliably used in reforestation programs in drought prone areas.

  2. A mouse model of alcoholic liver fibrosis-associated acute kidney injury identifies key molecular pathways

    Energy Technology Data Exchange (ETDEWEB)

    Furuya, Shinji; Chappell, Grace A.; Iwata, Yasuhiro [Department of Veterinary Integrative Biosciences, Texas A& M University, College Station, TX (United States); Uehara, Takeki; Kato, Yuki [Laboratory of Veterinary Pathology, Osaka Prefecture University, Osaka (Japan); Kono, Hiroshi [First Department of Surgery, University of Yamanashi, Yamanashi (Japan); Bataller, Ramon [Division of Gastroenterology & Hepatology, Department of Medicine, University of North Carolina, Chapel Hill, NC (United States); Rusyn, Ivan, E-mail: irusyn@tamu.edu [Department of Veterinary Integrative Biosciences, Texas A& M University, College Station, TX (United States)

    2016-11-01

    Clinical data strongly indicate that acute kidney injury (AKI) is a critical complication in alcoholic hepatitis, an acute-on-chronic form of liver failure in patients with advanced alcoholic fibrosis. Development of targeted therapies for AKI in this setting is hampered by the lack of an animal model. To enable research into molecular drivers and novel therapies for fibrosis- and alcohol-associated AKI, we aimed to combine carbon tetrachloride (CCl{sub 4})-induced fibrosis with chronic intra-gastric alcohol feeding. Male C57BL/6J mice were administered a low dose of CCl{sub 4} (0.2 ml/kg 2 × week/6 weeks) followed by alcohol intragastrically (up to 25 g/kg/day for 3 weeks) and with continued CCl{sub 4}. We observed that combined treatment with CCl{sub 4} and alcohol resulted in severe liver injury, more pronounced than using each treatment alone. Importantly, severe kidney injury was evident only in the combined treatment group. This mouse model reproduced distinct pathological features consistent with AKI in human alcoholic hepatitis. Transcriptomic analysis of kidneys revealed profound effects in the combined treatment group, with enrichment for damage-associated pathways, such as apoptosis, inflammation, immune-response and hypoxia. Interestingly, Havcr1 and Lcn2, biomarkers of AKI, were markedly up-regulated. Overall, this study established a novel mouse model of fibrosis- and alcohol-associated AKI and identified key mechanistic pathways. - Highlights: • Acute kidney injury (AKI) is a critical complication in alcoholic hepatitis • We developed a novel mouse model of fibrosis- and alcohol-associated AKI • This model reproduces key molecular and pathological features of human AKI • This animal model can help identify new targeted therapies for alcoholic hepatitis.

  3. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers

    Directory of Open Access Journals (Sweden)

    Khaled Taïbi

    2017-07-01

    Full Text Available Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of predicting the ability of formerly uncharacterized seedlings to cope with drought stress. Gas-exchange, water potential, photosynthetic pigments, soluble sugars, free amino acids, glutathione and proteomic analyses were carried out on control and drought-stressed seedlings in greenhouse conditions. Gas-exchange determinations were also assessed in field-planted seedlings in order to validate the greenhouse experimental conditions. Drought-tolerant seed sources presented higher values of photosynthetic rates, water use efficiency, photosynthetic pigments and soluble carbohydrates concentrations. We observed the same pattern of variation of photosynthesis rate and maximal efficiency of PSII in field. Interestingly drought-tolerant seed sources exhibited increased levels of glutathione, methionine and cysteine. The proteomic profile of drought tolerant seedlings identified two heat shock proteins and an enzyme related to methionine biosynthesis that were not present in drought sensitive seedlings, pointing to the synthesis of sulfur amino acids as a limiting factor for drought tolerance in Pinus halepensis. Our results established physiological and molecular traits useful as distinctive markers to predict drought tolerance in Pinus halepensis provenances that could be reliably used in reforestation programs in drought prone areas.

  4. Ab initio R-matrix/Multi-channel Quantum Defect Theory applied to Molecular Core Excitation and Ionization

    International Nuclear Information System (INIS)

    Hiyama, M.; Kosugi, N.

    2004-01-01

    Full text: Ab initio R-matrix/MQDT approach, which is a combination of ab initio R-matrix techniques and the multi channel quantum defect theory (MQDT), has recently been developed by one of the present authors (MH) and Child, to successfully obtain the potential energy curves of Rydberg states converging to not only the lowest but also the higher ionized states. This approach is also applied to estimate the valence state interaction with Rydberg and continuum (ionization) channels. Very recently we have made an original ab initio polyatomic R-matrix/MQDT program package, GSCF4R based on Gaussian type basis functions for the bound and continuum states, to extensively study molecular excitation and ionization in the X-ray region as well as in the VUV region. We are going to report the results for core excitation and ionization of diatomic molecules such as NO and O 2 to show that the R-matrix/MQDT method is indispensable to describe the core-to-Rydberg states with the higher quantum number and the continuum states. These results lead us to the conclusion that the close-coupling approximation augmented with the correlation term within the R-matrix/MQDT formalism is powerful to calculate the Rydberg-valence mixing and the interchannel coupling between several core-ionized states

  5. Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

    Science.gov (United States)

    Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

    2007-10-01

    AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

  6. Point defects in solids

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    The principal properties of point defects are studied: thermodynamics, electronic structure, interactions with etended defects, production by irradiation. Some measuring methods are presented: atomic diffusion, spectroscopic methods, diffuse scattering of neutron and X rays, positron annihilation, molecular dynamics. Then points defects in various materials are investigated: ionic crystals, oxides, semiconductor materials, metals, intermetallic compounds, carbides, nitrides [fr

  7. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers.

    Science.gov (United States)

    Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E M

    2016-10-08

    The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequencing, different barcodes can be inserted at each fragment end to either increase the number of multiplexed samples in the library or to use one of the barcodes as UMI. Alternatively, UMIs can be combined with the sample barcodes into composite barcodes, or with standard Illumina® indexing. Subsequent analysis must take read duplicates and sample identity into account, by identifying UMIs. Existing tools do not support these complex barcoding configurations and custom code development is frequently required. Here, we present Je, a suite of tools that accommodates complex barcoding strategies, extracts UMIs and filters read duplicates taking UMIs into account. Using Je on publicly available scRNA-seq and iCLIP data containing UMIs, the number of unique reads increased by up to 36 %, compared to when UMIs are ignored. Je is implemented in JAVA and uses the Picard API. Code, executables and documentation are freely available at http://gbcs.embl.de/Je . Je can also be easily installed in Galaxy through the Galaxy toolshed.

  8. Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing.

    Science.gov (United States)

    Hong, Jungeui; Gresham, David

    2017-11-01

    Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

  9. Molecular markers for identifying a new selected variety of Pacific white shrimp Litopenaeus vannamei

    Science.gov (United States)

    Yu, Yang; Zhang, Xiaojun; Liu, Jingwen; Li, Fuhua; Huang, Hao; Li, Yijun; Liu, Xiaolin; Xiang, Jianhai

    2015-01-01

    Selective breeding of the Pacific white shrimp Litopenaeus vannamei during the last decade has produced new varieties exhibiting high growth rates and disease resistance. However, the identification of new varieties of shrimps from their phenotypic characters is difficult. This study introduces a new approach for identifying varieties of shrimps using molecular markers of microsatellites and mitochondrial control region sequences. The method was employed to identify a new selected variety, Kehai No. 1 (KH-1), from three representative stocks (control group): Zhengda; Tongwei; and a stock collected from Fujian Province, which is now cultured in mainland China. By pooled genotyping of KH-1 and the control group, five microsatellites showing differences between KH-1 and the control group were screened out. Individual genotyping data confirmed the results from pooled genotyping. The genotyping data for the five microsatellites were applied to the assignment analysis of the KH-1 group and the control group using the partial Bayesian assignment method in GENECLASS2. By sequencing the mitochondrial control regions of individuals from the KH-1 and control group, four haplotypes were observed in the KH-1 group, whereas 14 haplotypes were obtained in the control group. By combining the microsatellite assignment analysis with mitochondrial control region analysis, the average accuracy of identification of individuals in the KH-1 group and control group reached 89%. The five selected microsatellite loci and mitochondrial control region sequences were highly polymorphic and could be used to distinguish new selected varieties of L. vannamei from other populations cultured in China.

  10. Novel Genetic Variants of Sporadic Atrial Septal Defect (ASD) in a Chinese Population Identified by Whole-Exome Sequencing (WES).

    Science.gov (United States)

    Liu, Yong; Cao, Yu; Li, Yaxiong; Lei, Dongyun; Li, Lin; Hou, Zong Liu; Han, Shen; Meng, Mingyao; Shi, Jianlin; Zhang, Yayong; Wang, Yi; Niu, Zhaoyi; Xie, Yanhua; Xiao, Benshan; Wang, Yuanfei; Li, Xiao; Yang, Lirong; Wang, Wenju; Jiang, Lihong

    2018-03-05

    BACKGROUND Recently, mutations in several genes have been described to be associated with sporadic ASD, but some genetic variants remain to be identified. The aim of this study was to use whole-exome sequencing (WES) combined with bioinformatics analysis to identify novel genetic variants in cases of sporadic congenital ASD, followed by validation by Sanger sequencing. MATERIAL AND METHODS Five Han patients with secundum ASD were recruited, and their tissue samples were analyzed by WES, followed by verification by Sanger sequencing of tissue and blood samples. Further evaluation using blood samples included 452 additional patients with sporadic secundum ASD (212 male and 240 female patients) and 519 healthy subjects (252 male and 267 female subjects) for further verification by a multiplexed MassARRAY system. Bioinformatic analyses were performed to identify novel genetic variants associated with sporadic ASD. RESULTS From five patients with sporadic ASD, a total of 181,762 genomic variants in 33 exon loci, validated by Sanger sequencing, were selected and underwent MassARRAY analysis in 452 patients with ASD and 519 healthy subjects. Three loci with high mutation frequencies, the 138665410 FOXL2 gene variant, the 23862952 MYH6 gene variant, and the 71098693 HYDIN gene variant were found to be significantly associated with sporadic ASD (PASD (PASD, and supported the use of WES and bioinformatics analysis to identify disease-associated mutations.

  11. Cartography of Pathway Signal Perturbations Identifies Distinct Molecular Pathomechanisms in Malignant and Chronic Lung Diseases

    Science.gov (United States)

    Arakelyan, Arsen; Nersisyan, Lilit; Petrek, Martin; Löffler-Wirth, Henry; Binder, Hans

    2016-01-01

    Lung diseases are described by a wide variety of developmental mechanisms and clinical manifestations. Accurate classification and diagnosis of lung diseases are the bases for development of effective treatments. While extensive studies are conducted toward characterization of various lung diseases at molecular level, no systematic approach has been developed so far. Here we have applied a methodology for pathway-centered mining of high throughput gene expression data to describe a wide range of lung diseases in the light of shared and specific pathway activity profiles. We have applied an algorithm combining a Pathway Signal Flow (PSF) algorithm for estimation of pathway activity deregulation states in lung diseases and malignancies, and a Self Organizing Maps algorithm for classification and clustering of the pathway activity profiles. The analysis results allowed clearly distinguish between cancer and non-cancer lung diseases. Lung cancers were characterized by pathways implicated in cell proliferation, metabolism, while non-malignant lung diseases were characterized by deregulations in pathways involved in immune/inflammatory response and fibrotic tissue remodeling. In contrast to lung malignancies, chronic lung diseases had relatively heterogeneous pathway deregulation profiles. We identified three groups of interstitial lung diseases and showed that the development of characteristic pathological processes, such as fibrosis, can be initiated by deregulations in different signaling pathways. In conclusion, this paper describes the pathobiology of lung diseases from systems viewpoint using pathway centered high-dimensional data mining approach. Our results contribute largely to current understanding of pathological events in lung cancers and non-malignant lung diseases. Moreover, this paper provides new insight into molecular mechanisms of a number of interstitial lung diseases that have been studied to a lesser extent. PMID:27200087

  12. Molecular genetic studies in Saudi population; identified variants from GWAS and meta-analysis in stroke.

    Science.gov (United States)

    Alharbi, Khalid Khalaf; Ali Khan, Imran; Alotaibi, Mohammad Abdullah; Saud Aloyaid, Abdullah; Al-Basheer, Haifa Abdulaziz; Alghamdi, Naelah Abdullah; Al-Baradie, Raid Saleem; Al-Sulaiman, A M

    2018-01-01

    Stroke is a multifactorial and heterogeneous disorder, correlates with heritability and considered as one of the major diseases. The prior reports performed the variable models such as genome-wide association studies (GWAS), replication, case-control, cross-sectional and meta-analysis studies and still, we lack diagnostic marker in the global world. There are limited studies were carried out in Saudi population, and we aim to investigate the molecular association of single nucleotide polymorphisms (SNPs) identified through GWAS and meta-analysis studies in stroke patients in the Saudi population. In this case-control study, we have opted gender equality of 207 cases and 207 controls from the capital city of Saudi Arabia in King Saud University Hospital. The peripheral blood (5 ml) sample will be collected in two different vacutainers, and three mL of the coagulated blood will be used for lipid analysis (biochemical tests) and two mL will be used for DNA analysis (molecular tests). Genomic DNA will be extracted with the collected blood samples, and specific primers will be designed for the opted SNPs ( SORT1 -rs646218 and OLR1 -rs11053646 polymorphisms) and PCR-RFLP will be performed and randomly DNA sequencing will be carried out to cross check the results. The rs646218 and rs11053646 polymorphisms were significantly associated with allele, genotype and dominant models with and without crude odds ratios (OR's) and Multiple logistic regression analysis (p Saudi population. The current results were in the association with the prior study results documented through GWAS and meta-analysis association. However, other ethnic population studies should be performed to rule out in the human hereditary diseases.

  13. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia.

    Science.gov (United States)

    van Uitert, Miranda; Moerland, Perry D; Enquobahrie, Daniel A; Laivuori, Hannele; van der Post, Joris A M; Ris-Stalpers, Carrie; Afink, Gijs B

    2015-01-01

    Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia gene expression signature, we performed a meta-analysis on the original data of 11 placenta RNA microarray experiments, representing 139 normotensive and 116 preeclamptic pregnancies. Microarray data were pre-processed and analyzed using standardized bioinformatics and statistical procedures and the effect sizes were combined using an inverse-variance random-effects model. Interactions between genes in the resulting gene expression signature were identified by pathway analysis (Ingenuity Pathway Analysis, Gene Set Enrichment Analysis, Graphite) and protein-protein associations (STRING). This approach has resulted in a comprehensive list of differentially expressed genes that led to a 388-gene meta-signature of preeclamptic placenta. Pathway analysis highlights the involvement of the previously identified hypoxia/HIF1A pathway in the establishment of the preeclamptic gene expression profile, while analysis of protein interaction networks indicates CREBBP/EP300 as a novel element central to the preeclamptic placental transcriptome. In addition, there is an apparent high incidence of preeclampsia in women carrying a child with a mutation in CREBBP/EP300 (Rubinstein-Taybi Syndrome). The 388-gene preeclampsia meta-signature offers a vital starting point for further studies into the relevance of these genes (in particular CREBBP/EP300) and their concomitant pathways as biomarkers or functional molecules in preeclampsia. This will result in a better understanding of the molecular basis of this disease and opens up the opportunity to develop rational therapies targeting the placental dysfunction causal to preeclampsia.

  14. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia.

    Directory of Open Access Journals (Sweden)

    Miranda van Uitert

    Full Text Available Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia gene expression signature, we performed a meta-analysis on the original data of 11 placenta RNA microarray experiments, representing 139 normotensive and 116 preeclamptic pregnancies. Microarray data were pre-processed and analyzed using standardized bioinformatics and statistical procedures and the effect sizes were combined using an inverse-variance random-effects model. Interactions between genes in the resulting gene expression signature were identified by pathway analysis (Ingenuity Pathway Analysis, Gene Set Enrichment Analysis, Graphite and protein-protein associations (STRING. This approach has resulted in a comprehensive list of differentially expressed genes that led to a 388-gene meta-signature of preeclamptic placenta. Pathway analysis highlights the involvement of the previously identified hypoxia/HIF1A pathway in the establishment of the preeclamptic gene expression profile, while analysis of protein interaction networks indicates CREBBP/EP300 as a novel element central to the preeclamptic placental transcriptome. In addition, there is an apparent high incidence of preeclampsia in women carrying a child with a mutation in CREBBP/EP300 (Rubinstein-Taybi Syndrome. The 388-gene preeclampsia meta-signature offers a vital starting point for further studies into the relevance of these genes (in particular CREBBP/EP300 and their concomitant pathways as biomarkers or functional molecules in preeclampsia. This will result in a better understanding of the molecular basis of this disease and opens up the opportunity to develop rational therapies targeting the placental dysfunction causal to preeclampsia.

  15. Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy-

    Science.gov (United States)

    Ishitani, Y.

    2017-12-01

    Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.

  16. Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations.

    Science.gov (United States)

    Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J

    2014-07-01

    Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts

  17. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life

    Directory of Open Access Journals (Sweden)

    Reusch Thorsten BH

    2011-01-01

    Full Text Available Abstract Background Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L. Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. Results In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. Conclusions These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  18. Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life.

    Science.gov (United States)

    Wissler, Lothar; Codoñer, Francisco M; Gu, Jenny; Reusch, Thorsten B H; Olsen, Jeanine L; Procaccini, Gabriele; Bornberg-Bauer, Erich

    2011-01-12

    Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs) of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L.) Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica) and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.

  19. LUMINOSITY FUNCTIONS OF SPITZER-IDENTIFIED PROTOSTARS IN NINE NEARBY MOLECULAR CLOUDS

    Energy Technology Data Exchange (ETDEWEB)

    Kryukova, E.; Megeath, S. T.; Allen, T. S. [Department of Physics and Astronomy, University of Toledo, Toledo, OH (United States); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA (United States); Pipher, J. [Department of Physics and Astronomy, University of Rochester, Rochester, NY (United States); Allen, L. E. [National Optical Astronomy Observatories, Tucson, AZ (United States); Myers, P. C. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States); Muzerolle, J. [Space Telescope Science Institute, Baltimore, MD (United States)

    2012-08-15

    We identify protostars in Spitzer surveys of nine star-forming (SF) molecular clouds within 1 kpc: Serpens, Perseus, Ophiuchus, Chamaeleon, Lupus, Taurus, Orion, Cep OB3, and Mon R2, which combined host over 700 protostar candidates. These clouds encompass a variety of SF environments, including both low-mass and high-mass SF regions, as well as dense clusters and regions of sparsely distributed star formation. Our diverse cloud sample allows us to compare protostar luminosity functions in these varied environments. We combine near- and mid-infrared photometry from the Two Micron All Sky Survey and Spitzer to create 1-24 {mu}m spectral energy distributions (SEDs). Using protostars from the c2d survey with well-determined bolometric luminosities, we derive a relationship between bolometric luminosity, mid-IR luminosity (integrated from 1-24 {mu}m), and SED slope. Estimations of the bolometric luminosities for protostar candidates are combined to create luminosity functions for each cloud. Contamination due to edge-on disks, reddened Class II sources, and galaxies is estimated and removed from the luminosity functions. We find that luminosity functions for high-mass SF clouds (Orion, Mon R2, and Cep OB3) peak near 1 L{sub Sun} and show a tail extending toward luminosities above 100 L{sub Sun }. The luminosity functions of the low-mass SF clouds (Serpens, Perseus, Ophiuchus, Taurus, Lupus, and Chamaeleon) do not exhibit a common peak, however the combined luminosity function of these regions peaks below 1 L{sub Sun }. Finally, we examine the luminosity functions as a function of the local surface density of young stellar objects. In the Orion molecular clouds, we find a significant difference between the luminosity functions of protostars in regions of high and low stellar density, the former of which is biased toward more luminous sources. This may be the result of primordial mass segregation, although this interpretation is not unique. We compare our luminosity

  20. LUMINOSITY FUNCTIONS OF SPITZER-IDENTIFIED PROTOSTARS IN NINE NEARBY MOLECULAR CLOUDS

    International Nuclear Information System (INIS)

    Kryukova, E.; Megeath, S. T.; Allen, T. S.; Gutermuth, R. A.; Pipher, J.; Allen, L. E.; Myers, P. C.; Muzerolle, J.

    2012-01-01

    We identify protostars in Spitzer surveys of nine star-forming (SF) molecular clouds within 1 kpc: Serpens, Perseus, Ophiuchus, Chamaeleon, Lupus, Taurus, Orion, Cep OB3, and Mon R2, which combined host over 700 protostar candidates. These clouds encompass a variety of SF environments, including both low-mass and high-mass SF regions, as well as dense clusters and regions of sparsely distributed star formation. Our diverse cloud sample allows us to compare protostar luminosity functions in these varied environments. We combine near- and mid-infrared photometry from the Two Micron All Sky Survey and Spitzer to create 1-24 μm spectral energy distributions (SEDs). Using protostars from the c2d survey with well-determined bolometric luminosities, we derive a relationship between bolometric luminosity, mid-IR luminosity (integrated from 1-24 μm), and SED slope. Estimations of the bolometric luminosities for protostar candidates are combined to create luminosity functions for each cloud. Contamination due to edge-on disks, reddened Class II sources, and galaxies is estimated and removed from the luminosity functions. We find that luminosity functions for high-mass SF clouds (Orion, Mon R2, and Cep OB3) peak near 1 L ☉ and show a tail extending toward luminosities above 100 L ☉ . The luminosity functions of the low-mass SF clouds (Serpens, Perseus, Ophiuchus, Taurus, Lupus, and Chamaeleon) do not exhibit a common peak, however the combined luminosity function of these regions peaks below 1 L ☉ . Finally, we examine the luminosity functions as a function of the local surface density of young stellar objects. In the Orion molecular clouds, we find a significant difference between the luminosity functions of protostars in regions of high and low stellar density, the former of which is biased toward more luminous sources. This may be the result of primordial mass segregation, although this interpretation is not unique. We compare our luminosity functions to those

  1. Molecular evolution of rbcL in three gymnosperm families: identifying adaptive and coevolutionary patterns

    LENUS (Irish Health Repository)

    Sen, Lin

    2011-06-03

    Abstract Background The chloroplast-localized ribulose-1, 5-biphosphate carboxylase\\/oxygenase (Rubisco), the primary enzyme responsible for autotrophy, is instrumental in the continual adaptation of plants to variations in the concentrations of CO2. The large subunit (LSU) of Rubisco is encoded by the chloroplast rbcL gene. Although adaptive processes have been previously identified at this gene, characterizing the relationships between the mutational dynamics at the protein level may yield clues on the biological meaning of such adaptive processes. The role of such coevolutionary dynamics in the continual fine-tuning of RbcL remains obscure. Results We used the timescale and phylogenetic analyses to investigate and search for processes of adaptive evolution in rbcL gene in three gymnosperm families, namely Podocarpaceae, Taxaceae and Cephalotaxaceae. To understand the relationships between regions identified as having evolved under adaptive evolution, we performed coevolutionary analyses using the software CAPS. Importantly, adaptive processes were identified at amino acid sites located on the contact regions among the Rubisco subunits and on the interface between Rubisco and its activase. Adaptive amino acid replacements at these regions may have optimized the holoenzyme activity. This hypothesis was pinpointed by evidence originated from our analysis of coevolution that supported the correlated evolution between Rubisco and its activase. Interestingly, the correlated adaptive processes between both these proteins have paralleled the geological variation history of the concentration of atmospheric CO2. Conclusions The gene rbcL has experienced bursts of adaptations in response to the changing concentration of CO2 in the atmosphere. These adaptations have emerged as a result of a continuous dynamic of mutations, many of which may have involved innovation of functional Rubisco features. Analysis of the protein structure and the functional implications of such

  2. Isolation and molecular characterization of dTnp1, a mobile and defective transposable element of Nicotiana plumbaginifolia.

    Science.gov (United States)

    Meyer, C; Pouteau, S; Rouzé, P; Caboche, M

    1994-01-01

    By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.

  3. Comparative metatranscriptomics identifies molecular bases for the physiological responses of phytoplankton to varying iron availability.

    Science.gov (United States)

    Marchetti, Adrian; Schruth, David M; Durkin, Colleen A; Parker, Micaela S; Kodner, Robin B; Berthiaume, Chris T; Morales, Rhonda; Allen, Andrew E; Armbrust, E Virginia

    2012-02-07

    In vast expanses of the oceans, growth of large phytoplankton such as diatoms is limited by iron availability. Diatoms respond almost immediately to the delivery of iron and rapidly compose the majority of phytoplankton biomass. The molecular bases underlying the subsistence of diatoms in iron-poor waters and the plankton community dynamics that follow iron resupply remain largely unknown. Here we use comparative metatranscriptomics to identify changes in gene expression associated with iron-stimulated growth of diatoms and other eukaryotic plankton. A microcosm iron-enrichment experiment using mixed-layer waters from the northeastern Pacific Ocean resulted in increased proportions of diatom transcripts and reduced proportions of transcripts from most other taxa within 98 h after iron addition. Hundreds of diatom genes were differentially expressed in the iron-enriched community compared with the iron-limited community; transcripts of diatom genes required for synthesis of photosynthesis and chlorophyll components, nitrate assimilation and the urea cycle, and synthesis of carbohydrate storage compounds were significantly overrepresented. Transcripts of genes encoding rhodopsins in eukaryotic phytoplankton were significantly underrepresented following iron enrichment, suggesting rhodopsins help cells cope with low-iron conditions. Oceanic diatoms appear to display a distinctive transcriptional response to iron enrichment that allows chemical reduction of available nitrogen and carbon sources along with a continued dependence on iron-free photosynthetic proteins rather than substituting for iron-containing functional equivalents present within their gene repertoire. This ability of diatoms to divert their newly acquired iron toward nitrate assimilation may underlie why diatoms consistently dominate iron enrichments in high-nitrate, low-chlorophyll regions.

  4. A systems biology strategy to identify molecular mechanisms of action and protein indicators of traumatic brain injury.

    Science.gov (United States)

    Yu, Chenggang; Boutté, Angela; Yu, Xueping; Dutta, Bhaskar; Feala, Jacob D; Schmid, Kara; Dave, Jitendra; Tawa, Gregory J; Wallqvist, Anders; Reifman, Jaques

    2015-02-01

    The multifactorial nature of traumatic brain injury (TBI), especially the complex secondary tissue injury involving intertwined networks of molecular pathways that mediate cellular behavior, has confounded attempts to elucidate the pathology underlying the progression of TBI. Here, systems biology strategies are exploited to identify novel molecular mechanisms and protein indicators of brain injury. To this end, we performed a meta-analysis of four distinct high-throughput gene expression studies involving different animal models of TBI. By using canonical pathways and a large human protein-interaction network as a scaffold, we separately overlaid the gene expression data from each study to identify molecular signatures that were conserved across the different studies. At 24 hr after injury, the significantly activated molecular signatures were nonspecific to TBI, whereas the significantly suppressed molecular signatures were specific to the nervous system. In particular, we identified a suppressed subnetwork consisting of 58 highly interacting, coregulated proteins associated with synaptic function. We selected three proteins from this subnetwork, postsynaptic density protein 95, nitric oxide synthase 1, and disrupted in schizophrenia 1, and hypothesized that their abundance would be significantly reduced after TBI. In a penetrating ballistic-like brain injury rat model of severe TBI, Western blot analysis confirmed our hypothesis. In addition, our analysis recovered 12 previously identified protein biomarkers of TBI. The results suggest that systems biology may provide an efficient, high-yield approach to generate testable hypotheses that can be experimentally validated to identify novel mechanisms of action and molecular indicators of TBI. © 2014 The Authors. Journal of Neuroscience Research Published by Wiley Periodicals, Inc.

  5. A suite of molecular markers for identifying species, detecting introgression and describing population structure in spadefoot toads (Spea spp.).

    Science.gov (United States)

    Pfennig, Karin S; Allenby, Ashley; Martin, Ryan A; Monroy, Anaïs; Jones, Corbin D

    2012-09-01

    Two congeneric species of spadefoot toad, Spea multiplicata and Spea bombifrons, have been the focus of hybridization studies since the 1970s. Because complex hybrids are not readily distinguished phenotypically, genetic markers are needed to identify introgressed individuals. We therefore developed a set of molecular markers (amplified fragment length polymorphism, polymerase chain reaction-restriction fragment length polymorphism and single nucleotide polymorphism) for identifying pure-species, F1 hybrids and more complex introgressed types. To do so, we tested a series of markers across both species and known hybrids using populations in both allopatry and sympatry. We retained those markers that differentiated the two pure-species and also consistently identified known species hybrids. These markers are well suited for identifying hybrids between these species. Moreover, those markers that show variation within each species can be used in conjunction with existing molecular markers in studies of population structure and gene flow. © 2012 Blackwell Publishing Ltd.

  6. Galleria mellonella model identifies highly virulent strains among all major molecular types of Cryptococcus gattii.

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    Full Text Available Cryptococcosis is mainly caused by Cryptococcus neoformans. However, the number of cases due to C. gattii is increasing, affecting mainly immunocompetent hosts. C. gattii is divided into four major molecular types, VGI to VGIV, which differ in their host range, epidemiology, antifungal susceptibility and geographic distribution. Besides studies on the Vancouver Island outbreak strains, which showed that the subtype VGIIa is highly virulent compared to the subtype VGIIb, little is known about the virulence of the other major molecular types. To elucidate the virulence potential of the major molecular types of C. gattii, Galleria mellonella larvae were inoculated with ten globally selected strains per molecular type. Survival rates were recorded and known virulence factors were studied. One VGII, one VGIII and one VGIV strain were more virulent (p 0.05, 21 (five VGI, five VGII, four VGIII and seven VGIV were less virulent (p <0.05 while one strain of each molecular type were avirulent. Cell and capsule size of all strains increased markedly during larvae infection (p <0.001. No differences in growth rate at 37°C were observed. Melanin synthesis was directly related with the level of virulence: more virulent strains produced more melanin than less virulent strains (p <0.05. The results indicate that all C. gattii major molecular types exhibit a range of virulence, with some strains having the potential to be more virulent. The study highlights the necessity to further investigate the genetic background of more and less virulent strains in order to recognize critical features, other than the known virulence factors (capsule, melanin and growth at mammalian body temperature, that maybe crucial for the development and progression of cryptococcosis.

  7. Whole-genome sequencing and comprehensive molecular profiling identify new driver mutations in gastric cancer

    NARCIS (Netherlands)

    Wang, Kai; Yuen, Siu Tsan; Xu, Jiangchun; Lee, Siu Po; Yan, Helen H N; Shi, Stephanie T; Siu, Hoi Cheong; Deng, Shibing; Chu, Kent Man; Law, Simon; Chan, Kok Hoe; Chan, Annie S Y; Tsui, Wai Yin; Ho, Siu Lun; Chan, Anthony K W; Man, Jonathan L K; Foglizzo, Valentina; Ng, Man Kin; Chan, April S; Ching, Yick Pang; Cheng, Grace H W; Xie, Tao; Fernandez, Julio; Li, Vivian S W; Clevers, Hans; Rejto, Paul A; Mao, Mao; Leung, Suet Yi

    Gastric cancer is a heterogeneous disease with diverse molecular and histological subtypes. We performed whole-genome sequencing in 100 tumor-normal pairs, along with DNA copy number, gene expression and methylation profiling, for integrative genomic analysis. We found subtype-specific genetic and

  8. MgH Rydberg series: Transition energies from electron propagator theory and oscillator strengths from the molecular quantum defect orbital method

    Science.gov (United States)

    Corzo, H. H.; Velasco, A. M.; Lavín, C.; Ortiz, J. V.

    2018-02-01

    Vertical excitation energies belonging to several Rydberg series of MgH have been inferred from 3+ electron-propagator calculations of the electron affinities of MgH+ and are in close agreement with experiment. Many electronically excited states with n > 3 are reported for the first time and new insight is given on the assignment of several Rydberg series. Valence and Rydberg excited states of MgH are distinguished respectively by high and low pole strengths corresponding to Dyson orbitals of electron attachment to the cation. By applying the Molecular Quantum Defect Orbital method, oscillator strengths for electronic transitions involving Rydberg states also have been determined.

  9. New technique of identifying the hierarchy of dynamic domains in proteins using a method of molecular dynamics simulations

    Directory of Open Access Journals (Sweden)

    Yesylevskyy S. O.

    2010-04-01

    Full Text Available Aim. Despite a large number of existing domain identification techniques there is no universally accepted method, which identifies the hierarchy of dynamic domains using the data of molecular dynamics (MD simulations. The goal of this work is to develop such technique. Methods. The dynamic domains are identified by eliminating systematic motions from MD trajectories recursively in a model-free manner. Results. The technique called the Hierarchical Domain-Wise Alignment (HDWA to identify hierarchically organized dynamic domains in proteins using the MD trajectories has been developed. Conclusion. A new method of domain identification in proteins is proposed

  10. Ultra-selective defect-free interfacially polymerized molecular sieve thin-film composite membranes for H2 purification

    KAUST Repository

    Ali, Zain; Pacheco Oreamuno, Federico; Litwiller, Eric; Wang, Yingge; Han, Yu; Pinnau, Ingo

    2017-01-01

    method for reverse osmosis membranes. Defect-free thin-film composite membranes were formed demonstrating unprecedented mixed-gas H2/CO2 selectivity of ≈ 50 at 140 °C with H2 permeance of 350 GPU, surpassing the permeance/selectivity upper bound of all

  11. Molecular Imaging to Identify Tumor Recurrence following Chemoradiation in a Hostile Surgical Environment

    Directory of Open Access Journals (Sweden)

    Olugbenga T. Okusanya

    2015-01-01

    Full Text Available Surgical biopsy of potential tumor recurrence is a common challenge facing oncologists, surgeons, and cancer patients. Imaging modalities have limited ability to accurately detect recurrent cancer in fields affected by previous surgery, chemotherapy, or radiation. However, definitive tissue diagnosis is often needed to initiate treatment and to direct therapy. We sought to determine if a targeted fluorescent intraoperative molecular imaging technique could be applied in a clinical setting to assist a surgical biopsy in a “hostile” field. We describe the use of a folate-fluorescein conjugate to direct the biopsy of a suspected recurrent lung adenocarcinoma invading the mediastinum that had been previously treated with chemoradiation. We found that intraoperative imaging allowed the identification of small viable tumor deposits that were otherwise indistinguishable from scar and necrosis. Our operative observations were confirmed by histology, fluorescence microscopy, and immunohistochemistry. Our results demonstrate one possible application and clinical value of intraoperative molecular imaging.

  12. Utilizing Endoscopic Ultrasound-Guided Fine Needle Aspiration in Identifying Molecular Targets for Pancreatic Cancer

    OpenAIRE

    Onyekachi Henry Ogbonna; Muhammad Wasif Saif

    2013-01-01

    Pancreatic cancer remains a devastating disease, with poor survival rates and high recurrence rates with current treatmentregimens. Over the years we have come to understand the complex biology of this cancer, involving cross-talking signalingpathways that proffers resistance to current therapy. Several molecularly targeted agents remain in development. At the2013 American Society of Clinical Oncology (ASCO) Annual Meeting, an abstract (#4051) was presented which exploredusing endoscopic ultr...

  13. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Hrabcová, M.; Pecková, Hana; Patra, Sneha; Kodádková, Alena; Jurajda, Pavel; Tyml, Tomáš; Holzer, Astrid S.

    2014-01-01

    Roč. 44, č. 8 (2014), s. 565-577 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GPP506/11/P724; GA ČR GBP505/12/G112; GA AV ČR(CZ) M200961205 Institutional support: RVO:60077344 ; RVO:68081766 Keywords : Buddenbrockia * Tetracapsuloides * diversity * phylogeny * Bryozoa * fish * cryptic * worm Subject RIV: EB - Genetics ; Molecular Biology; EG - Zoology (UBO-W) Impact factor: 3.872, year: 2014

  14. The Use of Patient-Specific Induced Pluripotent Stem Cells (iPSCs to Identify Osteoclast Defects in Rare Genetic Bone Disorders

    Directory of Open Access Journals (Sweden)

    I-Ping Chen

    2014-12-01

    Full Text Available More than 500 rare genetic bone disorders have been described, but for many of them only limited treatment options are available. Challenges for studying these bone diseases come from a lack of suitable animal models and unavailability of skeletal tissues for studies. Effectors for skeletal abnormalities of bone disorders may be abnormal bone formation directed by osteoblasts or anomalous bone resorption by osteoclasts, or both. Patient-specific induced pluripotent stem cells (iPSCs can be generated from somatic cells of various tissue sources and in theory can be differentiated into any desired cell type. However, successful differentiation of hiPSCs into functional bone cells is still a challenge. Our group focuses on the use of human iPSCs (hiPSCs to identify osteoclast defects in craniometaphyseal dysplasia. In this review, we describe the impact of stem cell technology on research for better treatment of such disorders, the generation of hiPSCs from patients with rare genetic bone disorders and current protocols for differentiating hiPSCs into osteoclasts.

  15. An organelle-specific protein landscape identifies novel diseases and molecular mechanisms.

    Science.gov (United States)

    Boldt, Karsten; van Reeuwijk, Jeroen; Lu, Qianhao; Koutroumpas, Konstantinos; Nguyen, Thanh-Minh T; Texier, Yves; van Beersum, Sylvia E C; Horn, Nicola; Willer, Jason R; Mans, Dorus A; Dougherty, Gerard; Lamers, Ideke J C; Coene, Karlien L M; Arts, Heleen H; Betts, Matthew J; Beyer, Tina; Bolat, Emine; Gloeckner, Christian Johannes; Haidari, Khatera; Hetterschijt, Lisette; Iaconis, Daniela; Jenkins, Dagan; Klose, Franziska; Knapp, Barbara; Latour, Brooke; Letteboer, Stef J F; Marcelis, Carlo L; Mitic, Dragana; Morleo, Manuela; Oud, Machteld M; Riemersma, Moniek; Rix, Susan; Terhal, Paulien A; Toedt, Grischa; van Dam, Teunis J P; de Vrieze, Erik; Wissinger, Yasmin; Wu, Ka Man; Apic, Gordana; Beales, Philip L; Blacque, Oliver E; Gibson, Toby J; Huynen, Martijn A; Katsanis, Nicholas; Kremer, Hannie; Omran, Heymut; van Wijk, Erwin; Wolfrum, Uwe; Kepes, François; Davis, Erica E; Franco, Brunella; Giles, Rachel H; Ueffing, Marius; Russell, Robert B; Roepman, Ronald

    2016-05-13

    Cellular organelles provide opportunities to relate biological mechanisms to disease. Here we use affinity proteomics, genetics and cell biology to interrogate cilia: poorly understood organelles, where defects cause genetic diseases. Two hundred and seventeen tagged human ciliary proteins create a final landscape of 1,319 proteins, 4,905 interactions and 52 complexes. Reverse tagging, repetition of purifications and statistical analyses, produce a high-resolution network that reveals organelle-specific interactions and complexes not apparent in larger studies, and links vesicle transport, the cytoskeleton, signalling and ubiquitination to ciliary signalling and proteostasis. We observe sub-complexes in exocyst and intraflagellar transport complexes, which we validate biochemically, and by probing structurally predicted, disruptive, genetic variants from ciliary disease patients. The landscape suggests other genetic diseases could be ciliary including 3M syndrome. We show that 3M genes are involved in ciliogenesis, and that patient fibroblasts lack cilia. Overall, this organelle-specific targeting strategy shows considerable promise for Systems Medicine.

  16. More on contamination: the use of asymmetric molecular behavior to identify authentic ancient human DNA

    DEFF Research Database (Denmark)

    Malmström, Helena; Svensson, Emma M; Gilbert, M Thomas P

    2007-01-01

    concerning the authenticity of such data. Although several methods have been developed to the purpose of authenticating ancient DNA (aDNA) results, while they are useful in faunal research, most of the methods have proven complicated to apply to ancient human DNA. Here, we investigate in detail...... the reliability of one of the proposed criteria, that of appropriate molecular behavior. Using real-time polymerase chain reaction (PCR) and pyrosequencing, we have quantified the relative levels of authentic aDNA and contaminant human DNA sequences recovered from archaeological dog and cattle remains. In doing...

  17. Cancer in silico drug discovery: a systems biology tool for identifying candidate drugs to target specific molecular tumor subtypes.

    Science.gov (United States)

    San Lucas, F Anthony; Fowler, Jerry; Chang, Kyle; Kopetz, Scott; Vilar, Eduardo; Scheet, Paul

    2014-12-01

    Large-scale cancer datasets such as The Cancer Genome Atlas (TCGA) allow researchers to profile tumors based on a wide range of clinical and molecular characteristics. Subsequently, TCGA-derived gene expression profiles can be analyzed with the Connectivity Map (CMap) to find candidate drugs to target tumors with specific clinical phenotypes or molecular characteristics. This represents a powerful computational approach for candidate drug identification, but due to the complexity of TCGA and technology differences between CMap and TCGA experiments, such analyses are challenging to conduct and reproduce. We present Cancer in silico Drug Discovery (CiDD; scheet.org/software), a computational drug discovery platform that addresses these challenges. CiDD integrates data from TCGA, CMap, and Cancer Cell Line Encyclopedia (CCLE) to perform computational drug discovery experiments, generating hypotheses for the following three general problems: (i) determining whether specific clinical phenotypes or molecular characteristics are associated with unique gene expression signatures; (ii) finding candidate drugs to repress these expression signatures; and (iii) identifying cell lines that resemble the tumors being studied for subsequent in vitro experiments. The primary input to CiDD is a clinical or molecular characteristic. The output is a biologically annotated list of candidate drugs and a list of cell lines for in vitro experimentation. We applied CiDD to identify candidate drugs to treat colorectal cancers harboring mutations in BRAF. CiDD identified EGFR and proteasome inhibitors, while proposing five cell lines for in vitro testing. CiDD facilitates phenotype-driven, systematic drug discovery based on clinical and molecular data from TCGA. ©2014 American Association for Cancer Research.

  18. Early and long-standing rheumatoid arthritis: distinct molecular signatures identified by gene-expression profiling in synovia

    Science.gov (United States)

    Lequerré, Thierry; Bansard, Carine; Vittecoq, Olivier; Derambure, Céline; Hiron, Martine; Daveau, Maryvonne; Tron, François; Ayral, Xavier; Biga, Norman; Auquit-Auckbur, Isabelle; Chiocchia, Gilles; Le Loët, Xavier; Salier, Jean-Philippe

    2009-01-01

    Introduction Rheumatoid arthritis (RA) is a heterogeneous disease and its underlying molecular mechanisms are still poorly understood. Because previous microarray studies have only focused on long-standing (LS) RA compared to osteoarthritis, we aimed to compare the molecular profiles of early and LS RA versus control synovia. Methods Synovial biopsies were obtained by arthroscopy from 15 patients (4 early untreated RA, 4 treated LS RA and 7 controls, who had traumatic or mechanical lesions). Extracted mRNAs were used for large-scale gene-expression profiling. The different gene-expression combinations identified by comparison of profiles of early, LS RA and healthy synovia were linked to the biological processes involved in each situation. Results Three combinations of 719, 116 and 52 transcripts discriminated, respectively, early from LS RA, and early or LS RA from healthy synovia. We identified several gene clusters and distinct molecular signatures specifically expressed during early or LS RA, thereby suggesting the involvement of different pathophysiological mechanisms during the course of RA. Conclusions Early and LS RA have distinct molecular signatures with different biological processes participating at different times during the course of the disease. These results suggest that better knowledge of the main biological processes involved at a given RA stage might help to choose the most appropriate treatment. PMID:19563633

  19. Single nickel-related defects in molecular-sized nanodiamonds for multicolor bioimaging: an ab initio study

    Science.gov (United States)

    Thiering, Gergő; Londero, Elisa; Gali, Adam

    2014-09-01

    Fluorescent nanodiamonds constitute an outstanding alternative to semiconductor quantum dots and dye molecules for in vivo biomarker applications, where the fluorescence comes from optically active point defects acting as color centers in the nanodiamonds. For practical purposes, these color centers should be photostable as a function of the laser power or the surface termination of nanodiamonds. Furthermore, they should exhibit a sharp and nearly temperature-independent zero-phonon line. In this study, we show by hybrid density functional theory calculations that nickel doped nanodiamonds exhibit the desired properties, thus opening the avenue to practical applications. In particular, harnessing the strong quantum confinement effect in molecule-sized nanodiamonds is very promising for achieving multicolor imaging by single nickel-related defects.

  20. Single nickel-related defects in molecular-sized nanodiamonds for multicolor bioimaging: an ab initio study.

    Science.gov (United States)

    Thiering, Gergő; Londero, Elisa; Gali, Adam

    2014-10-21

    Fluorescent nanodiamonds constitute an outstanding alternative to semiconductor quantum dots and dye molecules for in vivo biomarker applications, where the fluorescence comes from optically active point defects acting as color centers in the nanodiamonds. For practical purposes, these color centers should be photostable as a function of the laser power or the surface termination of nanodiamonds. Furthermore, they should exhibit a sharp and nearly temperature-independent zero-phonon line. In this study, we show by hybrid density functional theory calculations that nickel doped nanodiamonds exhibit the desired properties, thus opening the avenue to practical applications. In particular, harnessing the strong quantum confinement effect in molecule-sized nanodiamonds is very promising for achieving multicolor imaging by single nickel-related defects.

  1. [Treatment of acute full-thickness chondral defects with high molecular weight hyaluronic acid; an experimental model].

    Science.gov (United States)

    Figueroa, D; Espinosa, M; Calvo, R; Scheu, M; Valderrama, J J; Gallegos, M; Conget, P

    2014-01-01

    To evaluate the effect of 2 different protocols of intra-articular hyaluronic acid (HA, hylan G-F20) to articular cartilage regeneration in acute full-thickness chondral defects. Full-thickness chondral defects of 3 x 6 mm were performed into the lateral femoral condyles of New Zealand rabbits, treated with a single or three doses of HA. The animals were sacrified at 12 weeks and the regenerated tissue was evaluated by direct observation and histology with the ICRS scale. Macroscopically, in both groups treated with HA the defects were filled with irregular tissue with areas similar to hyaline cartilage and others in which depressed areas with exposed subchondral bone were observed. Histological analysis showed in both groups treated with HA a hyaline-like cartilage compared to control group. However, the score of the International Cartilage Repair Society (ICRS) scale did not show differences between the groups treated with HA. The use of single dose or 3 doses of AH in acute chondral lesions has a limited and similar benefit in articular cartilage regeneration. Copyright © 2014 SECOT. Published by Elsevier Espana. All rights reserved.

  2. RNA sequencing of Populus x canadensis roots identifies key molecular mechanisms underlying physiological adaption to excess zinc.

    Directory of Open Access Journals (Sweden)

    Andrea Ariani

    Full Text Available Populus x canadensis clone I-214 exhibits a general indicator phenotype in response to excess Zn, and a higher metal uptake in roots than in shoots with a reduced translocation to aerial parts under hydroponic conditions. This physiological adaptation seems mainly regulated by roots, although the molecular mechanisms that underlie these processes are still poorly understood. Here, differential expression analysis using RNA-sequencing technology was used to identify the molecular mechanisms involved in the response to excess Zn in root. In order to maximize specificity of detection of differentially expressed (DE genes, we consider the intersection of genes identified by three distinct statistical approaches (61 up- and 19 down-regulated and validate them by RT-qPCR, yielding an agreement of 93% between the two experimental techniques. Gene Ontology (GO terms related to oxidation-reduction processes, transport and cellular iron ion homeostasis were enriched among DE genes, highlighting the importance of metal homeostasis in adaptation to excess Zn by P. x canadensis clone I-214. We identified the up-regulation of two Populus metal transporters (ZIP2 and NRAMP1 probably involved in metal uptake, and the down-regulation of a NAS4 gene involved in metal translocation. We identified also four Fe-homeostasis transcription factors (two bHLH38 genes, FIT and BTS that were differentially expressed, probably for reducing Zn-induced Fe-deficiency. In particular, we suggest that the down-regulation of FIT transcription factor could be a mechanism to cope with Zn-induced Fe-deficiency in Populus. These results provide insight into the molecular mechanisms involved in adaption to excess Zn in Populus spp., but could also constitute a starting point for the identification and characterization of molecular markers or biotechnological targets for possible improvement of phytoremediation performances of poplar trees.

  3. Molecular diagnostics to identify fungal plant pathogens – A review of current methods

    OpenAIRE

    Bernreiter, Andreas

    2017-01-01

    La siguiente revisión ofrece una visión amplia de los métodos actuales utilizados para la identificación de hongos fitopatógenos. Además, se presentan estudios previos centrados en patógenos relevantes para el Ecuador y una breve discusión sobre el futuro del diagnóstico en fitopatología. En la actualidad, las herramientas de diagnóstico que aplican biología molecular se basan en la tecnología de reacción en cadena de la polimerasa (PCR). Se presenta una selección de tecnologías basadas en PC...

  4. Using combined morphological, allometric and molecular approaches to identify species of the genus Raillietiella (Pentastomida.

    Directory of Open Access Journals (Sweden)

    Crystal Kelehear

    Full Text Available Taxonomic studies of parasites can be severely compromised if the host species affects parasite morphology; an uncritical analysis might recognize multiple taxa simply because of phenotypically plastic responses of parasite morphology to host physiology. Pentastomids of the genus Raillietiella are endoparasitic crustaceans primarily infecting the respiratory system of carnivorous reptiles, but also recorded from bufonid anurans. The delineation of pentastomids at the generic level is clear, but the taxonomic status of many species is not. We collected raillietiellids from lungs of the invasive cane toad (Rhinella marina, the invasive Asian house gecko (Hemidactylus frenatus, and a native tree frog (Litoria caerulea in tropical Australia, and employed a combination of genetic analyses, and traditional and novel morphological methods to clarify their identity. Conventional analyses of parasite morphology (which focus on raw values of morphological traits revealed two discrete clusters in terms of pentastome hook size, implying two different species of pentastomes: one from toads and a tree frog (Raillietiella indica and another from lizards (Raillietiella frenatus. However, these clusters disappeared in allometric analyses that took pentastome body size into account, suggesting that only a single pentastome taxon may be involved. Our molecular data revealed no genetic differences between parasites in toads versus lizards, confirming that there was only one species: R. frenatus. This pentastome (previously known only from lizards clearly is also capable of maturing in anurans. Our analyses show that the morphological features used in pentastomid taxonomy change as the parasite transitions through developmental stages in the definitive host. To facilitate valid descriptions of new species of pentastomes, future taxonomic work should include both morphological measurements (incorporating quantitative measures of body size and hook bluntness and

  5. ApoE4-specific Misfolded Intermediate Identified by Molecular Dynamics Simulations.

    Directory of Open Access Journals (Sweden)

    Benfeard Williams

    2015-10-01

    Full Text Available The increased risk of developing Alzheimer's disease (AD is associated with the APOE gene, which encodes for three variants of Apolipoprotein E, namely E2, E3, E4, differing only by two amino acids at positions 112 and 158. ApoE4 is known to be the strongest risk factor for AD onset, while ApoE3 and ApoE2 are considered to be the AD-neutral and AD-protective isoforms, respectively. It has been hypothesized that the ApoE isoforms may contribute to the development of AD by modifying the homeostasis of ApoE physiological partners and AD-related proteins in an isoform-specific fashion. Here we find that, despite the high sequence similarity among the three ApoE variants, only ApoE4 exhibits a misfolded intermediate state characterized by isoform-specific domain-domain interactions in molecular dynamics simulations. The existence of an ApoE4-specific intermediate state can contribute to the onset of AD by altering multiple cellular pathways involved in ApoE-dependent lipid transport efficiency or in AD-related protein aggregation and clearance. We present what we believe to be the first structural model of an ApoE4 misfolded intermediate state, which may serve to elucidate the molecular mechanism underlying the role of ApoE4 in AD pathogenesis. The knowledge of the structure for the ApoE4 folding intermediate provides a new platform for the rational design of alternative therapeutic strategies to fight AD.

  6. Molecular markers for tolerance of European ash (Fraxinus excelsior) to dieback disease identified using Associative Transcriptomics

    DEFF Research Database (Denmark)

    Harper, Andrea L.; McKinney, Lea Vig; Nielsen, Lene Rostgaard

    2016-01-01

    panel scored for disease symptoms and identified markers strongly associated with canopy damage in infected trees. Using these markers we predicted phenotypes in a test panel of unrelated trees, successfully identifying individuals with a low level of susceptibility to the disease. Co......Tree disease epidemics are a global problem, impacting food security, biodiversity and national economies. The potential for conservation and breeding in trees is hampered by complex genomes and long lifecycles, with most species lacking genomic resources. The European Ash tree Fraxinus excelsior...

  7. Molecular Epidemiology Identifies HIV Transmission Networks Associated With Younger Age and Heterosexual Exposure Among Korean Individuals

    OpenAIRE

    Chin, Bum Sik; Chaillon, Antoine; Mehta, Sanjay R.; Wertheim, Joel O.; Kim, Gayeon; Shin, Hyoung-Shik; Smith, Davey M.

    2016-01-01

    To evaluate if HIV transmission networks could be elucidated from data collected in a short time frame, 131 HIV-1 pol sequences were analyzed which were generated from treatment-naïve Korean individuals who were sequentially identified over 1 year. A transmission linkage was inferred when there was a genetic distance

  8. Molecular docking and NMR binding studies to identify novel inhibitors of human phosphomevalonate kinase

    Energy Technology Data Exchange (ETDEWEB)

    Boonsri, Pornthip [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States); Department of Chemistry, NANOTEC Center of Nanotechnology, National Nanotechnology Center, Faculty of Science, Kasetsart University, Bangkok 10900 (Thailand); Neumann, Terrence S.; Olson, Andrew L.; Cai, Sheng [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States); Herdendorf, Timothy J.; Miziorko, Henry M. [Division of Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Hannongbua, Supa [Department of Chemistry, NANOTEC Center of Nanotechnology, National Nanotechnology Center, Faculty of Science, Kasetsart University, Bangkok 10900 (Thailand); Sem, Daniel S., E-mail: daniel.sem@cuw.edu [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Natural and synthetic inhibitors of human phosphomevalonate kinase identified. Black-Right-Pointing-Pointer Virtual screening yielded a hit rate of 15%, with inhibitor K{sub d}'s of 10-60 {mu}M. Black-Right-Pointing-Pointer NMR studies indicate significant protein conformational changes upon binding. -- Abstract: Phosphomevalonate kinase (PMK) phosphorylates mevalonate-5-phosphate (M5P) in the mevalonate pathway, which is the sole source of isoprenoids and steroids in humans. We have identified new PMK inhibitors with virtual screening, using autodock. Promising hits were verified and their affinity measured using NMR-based {sup 1}H-{sup 15}N heteronuclear single quantum coherence (HSQC) chemical shift perturbation and fluorescence titrations. Chemical shift changes were monitored, plotted, and fitted to obtain dissociation constants (K{sub d}). Tight binding compounds with K{sub d}'s ranging from 6-60 {mu}M were identified. These compounds tended to have significant polarity and negative charge, similar to the natural substrates (M5P and ATP). HSQC cross peak changes suggest that binding induces a global conformational change, such as domain closure. Compounds identified in this study serve as chemical genetic probes of human PMK, to explore pharmacology of the mevalonate pathway, as well as starting points for further drug development.

  9. Discovery and molecular characterization of a new luteovirus identified by high-throughput sequencing from apple

    Science.gov (United States)

    ‘Rapid Apple Decline’ (RAD) is a newly emerging problem of young, dwarf apple trees in the northeastern USA. The affected trees show trunk necrosis, bark cracking and canker formation before collapsing in the summer. In this study, a new luteovirus and three common viruses were identified from apple...

  10. Meta-Analysis of Placental Transcriptome Data Identifies a Novel Molecular Pathway Related to Preeclampsia

    NARCIS (Netherlands)

    van Uitert, Miranda; Moerland, Perry D.; Enquobahrie, Daniel A.; Laivuori, Hannele; van der Post, Joris A. M.; Ris-Stalpers, Carrie; Afink, Gijs B.

    2015-01-01

    Studies using the placental transcriptome to identify key molecules relevant for preeclampsia are hampered by a relatively small sample size. In addition, they use a variety of bioinformatics and statistical methods, making comparison of findings challenging. To generate a more robust preeclampsia

  11. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS IN WATER

    Science.gov (United States)

    Hepatitis E virus (HEV) causes an infectious form of hepatitis associated with contaminated water. By analyzing the sequence of several HEV isolates, a reverse transciption-polymerase chain reaction method was developed and optimized that should be able to identify all of the kn...

  12. Microscopic and Molecular Tracing of Cryptosporidium Oocysts: Identifying a Possible Reservoir of Infection in Red Grouse

    Directory of Open Access Journals (Sweden)

    David Baines

    2017-11-01

    Full Text Available Infection by Cryptosporidium baileyi causes respiratory cryptosporidiosis in red grouse Lagopus lagopus scotica. First diagnosed in 2010, it has since been detected across half of moors managed for grouse shooting in northern England. We hypothesised that contaminated grouse faeces within communal trays visited by grouse containing grit coated with flubendazole, provided to control Trichostrongylus tenuis parasites of grouse, is a reservoir of infection. To establish the basis to this hypothesis, contents of 23 trays from a grouse moor were examined for Cryptosporidium oocysts. Contents were subjected to Immuno Magnetic Separation oocyst concentration techniques prior to examination by Immuno Fluorescence Antibody Test microscopy and molecular analysis on the 18S rRNA gene. Seven of 13 (54% grit trays known to be used by infected grouse were positive for Cryptosporidium by IMS-IFAT, compared to two of 10 (20% random background trays. Ten of the 13 (77% trays used by infected birds amplified positive for Cryptosporidium by Polymerase Chain Reaction and three of the 10 (30% random trays. All PCR amplified products sequenced matched with C. baileyi, with C. parvum also present in one tray. These data suggest that trays used to “worm” grouse may act as reservoirs of Cryptosporidium infection and their future design may need to be reconsidered to minimise contamination.

  13. Antimycobacterial drug discovery using Mycobacteria-infected amoebae identifies anti-infectives and new molecular targets.

    Science.gov (United States)

    Trofimov, Valentin; Kicka, Sébastien; Mucaria, Sabrina; Hanna, Nabil; Ramon-Olayo, Fernando; Del Peral, Laura Vela-Gonzalez; Lelièvre, Joël; Ballell, Lluís; Scapozza, Leonardo; Besra, Gurdyal S; Cox, Jonathan A G; Soldati, Thierry

    2018-03-02

    Tuberculosis remains a serious threat to human health world-wide, and improved efficiency of medical treatment requires a better understanding of the pathogenesis and the discovery of new drugs. In the present study, we performed a whole-cell based screen in order to complete the characterization of 168 compounds from the GlaxoSmithKline TB-set. We have established and utilized novel previously unexplored host-model systems to characterize the GSK compounds, i.e. the amoeboid organisms D. discoideum and A. castellanii, as well as a microglial phagocytic cell line, BV2. We infected these host cells with Mycobacterium marinum to monitor and characterize the anti-infective activity of the compounds with quantitative fluorescence measurements and high-content microscopy. In summary, 88.1% of the compounds were confirmed as antibiotics against M. marinum, 11.3% and 4.8% displayed strong anti-infective activity in, respectively, the mammalian and protozoan infection models. Additionally, in the two systems, 13-14% of the compounds displayed pro-infective activity. Our studies underline the relevance of using evolutionarily distant pathogen and host models in order to reveal conserved mechanisms of virulence and defence, respectively, which are potential "universal" targets for intervention. Subsequent mechanism of action studies based on generation of over-expresser M. bovis BCG strains, generation of spontaneous resistant mutants and whole genome sequencing revealed four new molecular targets, including FbpA, MurC, MmpL3 and GlpK.

  14. Galactosemia: A strategy to identify new biochemical phenotypes and molecular genotypes

    Energy Technology Data Exchange (ETDEWEB)

    Elsas, L.J.; Langley, S.; Steele, E.; Evinger, J.; Brown, A.; Singh, R.; Fernhoff, P.; Hjelm, L.N.; Dembure, P.P.; Fridovich-Keil, J.L. [Emory Univ. School of Medicine, Atlanta, GA (United States)

    1995-03-01

    We describe a stratagem for identifying new mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. GALT enzyme activity and isoforms were defined in erythrocytes from probands and their first-degree relatives. If the biochemical phenotypes segregated in an autosomal recesssive pattern, we screened for common mutations by using multiplex PCR and restriction endonuclease digestions. If common mutant alleles were not present, the 11 exons of the GALT gene were amplified by PCR, and variations from the normal nucleotide sequences were identified by SSCP. The suspected region(s) was then analyzed by direct DNA sequencing. We identified 86 mutant GALT alleles that reduced erythrocyte GALT activity. Seventy-five of these GALT genomes had abnormal SSCP patterns, of which 41 were sequenced, yielding 12 new and 21 previously reported, rare mutations. Among the novel group of 12 new mutations, an unusual biochemical phenotype was found in a family whose newborn proband has classical galactosemia. He had inherited two mutations in cis (N314D-E204K) from his father, whose GALT activity was near normal, and an additional GALT mutation in the splice-acceptor site of intron C (IVSC) from his mother. The substitution of a positively charged E204K mutation created a unique isoform-banding pattern. An asymptomatic sister`s GALT genes carries three mutations (E203K-N314D/N314D) with eight distinct isoform bands. Surprisingly, her erythrocytes have normal GALT activity. We conclude that the synergism of pedigree, biochemical, SSCP, and direct GALT gene analyses is an efficient protocol for identifying new mutations and speculate that E203K and N314D codon changes produce intra-allelic complementation when in cis. 40 refs., 4 figs., 3 tabs.

  15. Morphological and molecular methods to identify butternut (Juglans cinerea) and butternut hybrids: relevance to butternut conservation.

    Science.gov (United States)

    Ross-Davis, Amy; Huang, Zhonglian; McKenna, James; Ostry, Michael; Woeste, Keith

    2008-07-01

    Butternut (Juglans cinerea L.) is a native, cold-tolerant, hard-mast species formerly valued for its nuts and wood, which is now endangered. The most immediate threat to butternut restoration is the spread of butternut canker disease, caused by the exotic fungus Sirococcus clavigignenti-juglandacearum Nair, Kostichka & Kuntz. Other threats include the hybridization of butternut with the exotic Japanese walnut (Juglans ailantifolia Carr.) and poor regeneration. The hybrids, known as buartnuts, are vegetatively vigorous, highly fecund, more resistant than butternut to butternut canker disease and difficult to identify. We review the vegetative and reproductive morphological traits that distinguish butternut from hybrids and identify those that can be used by field biologists to separate the taxa. No single trait was sufficient to separate butternut from hybrids, but pith color, lenticel size, shape and abundance, and the presence or absence of a notch in the upper margin of leaf scars, can be used in combination with other traits to identify butternuts and exclude most hybrids. In at least one butternut population, reduced symptoms of butternut canker disease were significantly associated with a dark barked phenotype. We also describe two randomly amplified polymorphic DNA (RAPD) markers that differentiate butternuts from hybrids based on DNA polymorphism. Together, these results should assist in the identification and testing of non-hybrid butternut for breeding and reintroduction of the species to its former habitats.

  16. A systems biology pipeline identifies new immune and disease related molecular signatures and networks in human cells during microgravity exposure.

    Science.gov (United States)

    Mukhopadhyay, Sayak; Saha, Rohini; Palanisamy, Anbarasi; Ghosh, Madhurima; Biswas, Anupriya; Roy, Saheli; Pal, Arijit; Sarkar, Kathakali; Bagh, Sangram

    2016-05-17

    Microgravity is a prominent health hazard for astronauts, yet we understand little about its effect at the molecular systems level. In this study, we have integrated a set of systems-biology tools and databases and have analysed more than 8000 molecular pathways on published global gene expression datasets of human cells in microgravity. Hundreds of new pathways have been identified with statistical confidence for each dataset and despite the difference in cell types and experiments, around 100 of the new pathways are appeared common across the datasets. They are related to reduced inflammation, autoimmunity, diabetes and asthma. We have identified downregulation of NfκB pathway via Notch1 signalling as new pathway for reduced immunity in microgravity. Induction of few cancer types including liver cancer and leukaemia and increased drug response to cancer in microgravity are also found. Increase in olfactory signal transduction is also identified. Genes, based on their expression pattern, are clustered and mathematically stable clusters are identified. The network mapping of genes within a cluster indicates the plausible functional connections in microgravity. This pipeline gives a new systems level picture of human cells under microgravity, generates testable hypothesis and may help estimating risk and developing medicine for space missions.

  17. A systems biology pipeline identifies new immune and disease related molecular signatures and networks in human cells during microgravity exposure

    Science.gov (United States)

    Mukhopadhyay, Sayak; Saha, Rohini; Palanisamy, Anbarasi; Ghosh, Madhurima; Biswas, Anupriya; Roy, Saheli; Pal, Arijit; Sarkar, Kathakali; Bagh, Sangram

    2016-05-01

    Microgravity is a prominent health hazard for astronauts, yet we understand little about its effect at the molecular systems level. In this study, we have integrated a set of systems-biology tools and databases and have analysed more than 8000 molecular pathways on published global gene expression datasets of human cells in microgravity. Hundreds of new pathways have been identified with statistical confidence for each dataset and despite the difference in cell types and experiments, around 100 of the new pathways are appeared common across the datasets. They are related to reduced inflammation, autoimmunity, diabetes and asthma. We have identified downregulation of NfκB pathway via Notch1 signalling as new pathway for reduced immunity in microgravity. Induction of few cancer types including liver cancer and leukaemia and increased drug response to cancer in microgravity are also found. Increase in olfactory signal transduction is also identified. Genes, based on their expression pattern, are clustered and mathematically stable clusters are identified. The network mapping of genes within a cluster indicates the plausible functional connections in microgravity. This pipeline gives a new systems level picture of human cells under microgravity, generates testable hypothesis and may help estimating risk and developing medicine for space missions.

  18. Quantum Mechanics/Molecular Mechanics Simulations Identify the Ring-Opening Mechanism of Creatininase.

    Science.gov (United States)

    Jitonnom, Jitrayut; Mujika, Jon I; van der Kamp, Marc W; Mulholland, Adrian J

    2017-12-05

    Creatininase catalyzes the conversion of creatinine (a biosensor for kidney function) to creatine via a two-step mechanism: water addition followed by ring opening. Water addition is common to other known cyclic amidohydrolases, but the precise mechanism for ring opening is still under debate. The proton donor in this step is either His178 or a water molecule bound to one of the metal ions, and the roles of His178 and Glu122 are unclear. Here, the two possible reaction pathways have been fully examined by means of combined quantum mechanics/molecular mechanics simulations at the SCC-DFTB/CHARMM22 level of theory. The results indicate that His178 is the main catalytic residue for the whole reaction and explain its role as proton shuttle during the ring-opening step. In the first step, His178 provides electrostatic stabilization to the gem-diolate tetrahedral intermediate. In the second step, His178 abstracts the hydroxyl proton of the intermediate and delivers it to the cyclic amide nitrogen, leading to ring opening. The latter is the rate-limiting step with a free energy barrier of 18.5 kcal/mol, in agreement with the experiment. We find that Glu122 must be protonated during the enzyme reaction, so that it can form a stable hydrogen bond with its neighboring water molecule. Simulations of the E122Q mutant showed that this replacement disrupts the H-bond network formed by three conserved residues (Glu34, Ser78, and Glu122) and water, increasing the energy barrier. Our computational studies provide a comprehensive explanation for previous structural and kinetic observations, including why the H178A mutation causes a complete loss of activity but the E122Q mutation does not.

  19. Molecular Method Development to Identify Foodborne Sarcocystishominis in Raw Beef Commercial Hamburger

    Directory of Open Access Journals (Sweden)

    Bahador Hajimohammadi

    2014-11-01

    Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.

  20. MPV17-related mitochondrial DNA maintenance defect: New cases and review of clinical, biochemical, and molecular aspects.

    Science.gov (United States)

    El-Hattab, Ayman W; Wang, Julia; Dai, Hongzheng; Almannai, Mohammed; Staufner, Christian; Alfadhel, Majid; Gambello, Michael J; Prasun, Pankaj; Raza, Saleem; Lyons, Hernando J; Afqi, Manal; Saleh, Mohammed A M; Faqeih, Eissa A; Alzaidan, Hamad I; Alshenqiti, Abduljabbar; Flore, Leigh Anne; Hertecant, Jozef; Sacharow, Stephanie; Barbouth, Deborah S; Murayama, Kei; Shah, Amit A; Lin, Henry C; Wong, Lee-Jun C

    2018-04-01

    Mitochondrial DNA (mtDNA) maintenance defects are a group of diseases caused by deficiency of proteins involved in mtDNA synthesis, mitochondrial nucleotide supply, or mitochondrial dynamics. One of the mtDNA maintenance proteins is MPV17, which is a mitochondrial inner membrane protein involved in importing deoxynucleotides into the mitochondria. In 2006, pathogenic variants in MPV17 were first reported to cause infantile-onset hepatocerebral mtDNA depletion syndrome and Navajo neurohepatopathy. To date, 75 individuals with MPV17-related mtDNA maintenance defect have been reported with 39 different MPV17 pathogenic variants. In this report, we present an additional 25 affected individuals with nine novel MPV17 pathogenic variants. We summarize the clinical features of all 100 affected individuals and review the total 48 MPV17 pathogenic variants. The vast majority of affected individuals presented with an early-onset encephalohepatopathic disease characterized by hepatic and neurological manifestations, failure to thrive, lactic acidemia, and mtDNA depletion detected mainly in liver tissue. Rarely, MPV17 deficiency can cause a late-onset neuromyopathic disease characterized by myopathy and peripheral neuropathy with no or minimal liver involvement. Approximately half of the MPV17 pathogenic variants are missense. A genotype with biallelic missense variants, in particular homozygous p.R50Q, p.P98L, and p.R41Q, can carry a relatively better prognosis. © 2017 Wiley Periodicals, Inc.

  1. Identifying Genetic Hotspots by Mapping Molecular Diversity of Widespread Trees: When Commonness Matters.

    Science.gov (United States)

    Souto, Cintia P; Mathiasen, Paula; Acosta, María Cristina; Quiroga, María Paula; Vidal-Russell, Romina; Echeverría, Cristian; Premoli, Andrea C

    2015-01-01

    Conservation planning requires setting priorities at the same spatial scale at which decision-making processes are undertaken considering all levels of biodiversity, but current methods for identifying biodiversity hotspots ignore its genetic component. We developed a fine-scale approach based on the definition of genetic hotspots, which have high genetic diversity and unique variants that represent their evolutionary potential and evolutionary novelties. Our hypothesis is that wide-ranging taxa with similar ecological tolerances, yet of phylogenetically independent lineages, have been and currently are shaped by ecological and evolutionary forces that result in geographically concordant genetic patterns. We mapped previously published genetic diversity and unique variants of biparentally inherited markers and chloroplast sequences for 9 species from 188 and 275 populations, respectively, of the 4 woody dominant families of the austral temperate forest, an area considered a biodiversity hotspot. Spatial distribution patterns of genetic polymorphisms differed among taxa according to their ecological tolerances. Eight genetic hotspots were detected and we recommend conservation actions for some in the southern Coastal Range in Chile. Existing spatially explicit genetic data from multiple populations and species can help to identify biodiversity hotspots and guide conservation actions to establish science-based protected areas that will preserve the evolutionary potential of key habitats and species. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Integrated analysis of the molecular action of Vorinostat identifies epi-sensitised targets for combination therapy.

    Science.gov (United States)

    Hay, Jodie F; Lappin, Katrina; Liberante, Fabio; Kettyle, Laura M; Matchett, Kyle B; Thompson, Alexander; Mills, Ken I

    2017-09-15

    Several histone deacetylase inhibitors including Vorinostat have received FDA approval for the treatment of haematological malignancies. However, data from these trials indicate that Vorinostat has limited efficacy as a monotherapy, prompting the need for rational design of combination therapies. A number of epi-sensitised pathways, including sonic hedgehog (SHH), were identified in AML cells by integration of global patterns of histone H3 lysine 9 (H3K9) acetylation with transcriptomic analysis following Vorinostat-treatment. Direct targeting of the SHH pathway with SANT-1, following Vorinostat induced epi-sensitisation, resulted in synergistic cell death of AML cells. In addition, xenograft studies demonstrated that combination therapy induced a marked reduction in leukemic burden compared to control or single agents. Together, the data supports epi-sensitisation as a potential component of the strategy for the rational development of combination therapies in AML.

  3. Clinical and molecular characterization of a novel INS mutation identified in patients with MODY phenotype.

    Science.gov (United States)

    Piccini, Barbara; Artuso, Rosangela; Lenzi, Lorenzo; Guasti, Monica; Braccesi, Giulia; Barni, Federica; Casalini, Emilio; Giglio, Sabrina; Toni, Sonia

    2016-11-01

    Correct diagnosis of Maturity-Onset Diabetes of the Young (MODY) is based on genetic tests requiring an appropriate subject selection by clinicians. Mutations in the insulin (INS) gene rarely occur in patients with MODY. This study is aimed at determining the genetic background and clinical phenotype in patients with suspected MODY. 34 patients with suspected MODY, negative for mutations in the GCK, HNF1α, HNF4α, HNF1β and PDX1 genes, were screened by next generation sequencing (NGS). A heterozygous INS mutation was identified in 4 members of the same family. First genetic tests performed identified two heterozygous silent nucleotide substitutions in MODY3/HNF1α gene. An ineffective attempt to suspend insulin therapy, administering repaglinide and sulphonylureas, was made. DNA was re-sequenced by NGS investigating a set of 102 genes. Genes implicated in the pathway of pancreatic β-cells, candidate genes for type 2 diabetes mellitus and genes causative of diabetes in mice were selected. A novel heterozygous variant in human preproinsulin INS gene (c.125T > C) was found in the affected family members. The new INS mutation broadens the spectrum of possible INS phenotypes. Screening for INS mutations is warranted not only in neonatal diabetes but also in MODYx patients and in selected patients with type 1 diabetes mellitus negative for autoantibodies. Subjects with complex diseases without a specific phenotype should be studied by NGS because Sanger sequencing is ineffective and time consuming in detecting rare variants. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. A molecular systems approach to modelling human skin pigmentation: identifying underlying pathways and critical components.

    Science.gov (United States)

    Raghunath, Arathi; Sambarey, Awanti; Sharma, Neha; Mahadevan, Usha; Chandra, Nagasuma

    2015-04-29

    Ultraviolet radiations (UV) serve as an environmental stress for human skin, and result in melanogenesis, with the pigment melanin having protective effects against UV induced damage. This involves a dynamic and complex regulation of various biological processes that results in the expression of melanin in the outer most layers of the epidermis, where it can exert its protective effect. A comprehensive understanding of the underlying cross talk among different signalling molecules and cell types is only possible through a systems perspective. Increasing incidences of both melanoma and non-melanoma skin cancers necessitate the need to better comprehend UV mediated effects on skin pigmentation at a systems level, so as to ultimately evolve knowledge-based strategies for efficient protection and prevention of skin diseases. A network model for UV-mediated skin pigmentation in the epidermis was constructed and subjected to shortest path analysis. Virtual knock-outs were carried out to identify essential signalling components. We describe a network model for UV-mediated skin pigmentation in the epidermis. The model consists of 265 components (nodes) and 429 directed interactions among them, capturing the manner in which one component influences the other and channels information. Through shortest path analysis, we identify novel signalling pathways relevant to pigmentation. Virtual knock-outs or perturbations of specific nodes in the network have led to the identification of alternate modes of signalling as well as enabled determining essential nodes in the process. The model presented provides a comprehensive picture of UV mediated signalling manifesting in human skin pigmentation. A systems perspective helps provide a holistic purview of interconnections and complexity in the processes leading to pigmentation. The model described here is extensive yet amenable to expansion as new data is gathered. Through this study, we provide a list of important proteins essential

  5. Rational approach to identify newer caspase-1 inhibitors using pharmacophore based virtual screening, docking and molecular dynamic simulation studies.

    Science.gov (United States)

    Patel, Shivani; Modi, Palmi; Chhabria, Mahesh

    2018-05-01

    Caspase-1 is a key endoprotease responsible for the post-translational processing of pro-inflammatory cytokines IL-1β, 18 & 33. Excessive secretion of IL-1β leads to numerous inflammatory and autoimmune diseases. Thus caspase-1 inhibition would be considered as an important therapeutic strategy for development of newer anti-inflammatory agents. Here we have employed an integrated virtual screening by combining pharmacophore mapping and docking to identify small molecules as caspase-1 inhibitors. The ligand based 3D pharmacophore model was generated having the essential structural features of (HBA, HY & RA) using a data set of 27 compounds. A validated pharmacophore hypothesis (Hypo 1) was used to screen ZINC and Minimaybridge chemical databases. The retrieved virtual hits were filtered by ADMET properties and molecular docking analysis. Subsequently, the cross-docking study was also carried out using crystal structure of caspase-1, 3, 7 and 8 to identify the key residual interaction for specific caspase-1 inhibition. Finally, the best mapped and top scored (ZINC00885612, ZINC72003647, BTB04175 and BTB04410) molecules were subjected to molecular dynamics simulation for accessing the dynamic structure of protein after ligand binding. This study identifies the most promising hits, which can be leads for the development of novel caspase-1 inhibitors as anti-inflammatory agents. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Ultra-selective defect-free interfacially polymerized molecular sieve thin-film composite membranes for H2 purification

    KAUST Repository

    Ali, Zain

    2017-10-10

    Purification is a major bottleneck towards generating low-cost commercial hydrogen. In this work, inexpensive high-performance H2 separating membranes were fabricated by modifying the commercially successful interfacial polymerization production method for reverse osmosis membranes. Defect-free thin-film composite membranes were formed demonstrating unprecedented mixed-gas H2/CO2 selectivity of ≈ 50 at 140 °C with H2 permeance of 350 GPU, surpassing the permeance/selectivity upper bound of all known polymer membranes by a wide margin. The combination of exceptional separation performance and low manufacturing cost makes them excellent candidates for cost-effective hydrogen purification from steam cracking and similar processes.

  7. Thermal transport in UO2 with defects and fission products by molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xiang-Yang [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Cooper, Michael William Donald [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Mcclellan, Kenneth James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Lashley, Jason Charles [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Byler, Darrin David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stanek, Christopher Richard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Andersson, Anders David Ragnar [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-14

    The importance of the thermal transport in nuclear fuel has motivated a wide range of experimental and modelling studies. In this report, the reduction of thermal transport in UO2 due to defects and fission products has been investigated using non-equilibrium MD simulations, with two sets of empirical potentials for studying the degregation of UO2 thermal conductivity including a Buckingham type interatomic potential and a recently developed EAM type interatomic potential. Additional parameters for U5+ and Zr4+ in UO2 have been developed for the EAM potential. The thermal conductivity results from MD simulations are then corrected for the spin-phonon scattering through Callaway model formulations. To validate the modelling results, comparison was made with experimental measurements on single crystal hyper-stoichiometric UO2+x samples.

  8. A molecular method to detect and identify the native species of southwestern Atlantic Crassostrea (Mollusca: Ostreidae

    Directory of Open Access Journals (Sweden)

    Sandra Ludwig

    2011-08-01

    Full Text Available Among oysters, species of Crassostrea (Sacco, 1897 are the most attractive to aquaculture. In Brazil, the genus is represented by C. rhizophorae (Guilding, 1828 and C. brasiliana (Lamarck, 1819. Because the maturation and breeding technology is not well developed for these species, aquaculturists need a reliable method to decide the correct time to place spat collectors in the field, and to identify both species, which are morphologically similar. In this study a specific Multiplex PCR protocol was developed, using one pair of universal primers from 18S rDNA as a positive control and a pair of specific primers for each target species. The sensitivity and specificity of the protocol was evaluated. It detected C. rhizophorae DNA in low concentrations, and C. brasiliana DNA in even lower concentrations. Further, the Multiplex PCR proved efficient in detecting DNA in concentrations equivalent to that of a single larva of each species, either separated or combined, when mixed with total DNA extract of a plankton sample representing 1000 L of filtered water. Field tests confirmed the applicability of the protocol, which holds the promise to become an important tool for aquaculture or conservation programs, allowing for the continuous monitoring of the life cycle of C. brasiliana and C. rhizophorae, by detecting the right periods of larval release and settlement.

  9. Distinct forms of the β subunit of GTP-binding regulatory proteins identified by molecular cloning

    International Nuclear Information System (INIS)

    Fong, H.K.W.; Amatruda, T.T. III; Birren, B.W.; Simon, M.I.

    1987-01-01

    Two distinct β subunits of guanine nucleotide-binding regulatory proteins have been identified by cDNA cloning and are referred to as β 1 and β 1 subunits. The bovine transducin β subunit (β 1 ) has been cloned previously. The author now isolated and analyzed cDNA clones that encode the β 2 subunit from bovine adrenal, bovine brain, and a human myeloid leukemia cell line, HL-60. The 340-residue M/sub r/ 37,329 Β 2 protein is 90% identical with β 1 in predicted amino acid sequence, and it is also organized as a series of repetitive homologous segments. The major mRNA that encodes the bovine β 2 subunit is 1.7 kilobases in length. It is expressed at lower levels than β 1 subunit mRNA in all tissues examined. The β 1 and β 2 messages are expressed in cloned human cell lines. Hybridization of cDNA probes to bovine DNA showed that β 1 and β 2 are encoded by separate genes. The amino acid sequences for the bovine and human β 2 subunit are identical, as are the amino acid sequences for the bovine and human β 1 subunit. This evolutionary conservation suggests that the two β subunits have different roles in the signal transduction process

  10. Molecular characterization of a new efficiently transducing bacteriophage identified in meticillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Varga, Marian; Pantůček, Roman; Růžičková, Vladislava; Doškař, Jirˇí

    2016-01-01

    In Staphylococcus aureus, generalized transduction mediated by temperate bacteriophages represents a highly efficient way of transferring antibiotic resistance genes between strains. In the present study, we identified and characterized in detail a new efficiently transducing bacteriophage of the family Siphoviridae, designated ϕJB, which resides as a prophage in the meticillin-resistant S. aureus (MRSA) strain Jevons B. Whole-genome sequencing followed by detailed in silico analysis uncovered a linear dsDNA genome consisting of 43 ,12 bp and comprising 70 ORFs, of which ∼40 encoded proteins with unknown function. A global genome alignment of ϕJB and other efficiently transducing phages ϕ11, ϕ53, ϕ80, ϕ80α and ϕNM4 showed a high degree of homology with ϕNM4 and substantial differences with regard to other phages. Using a model transduction system with a well-defined donor and recipient, ϕJB transferred the tetracycline resistance plasmid pT181 and a penicillinase plasmid with outstanding frequencies, beating most of the above-mentioned phages by an order of magnitude. Moreover, ϕJB demonstrated high frequencies of transferring antibiotic resistance plasmids even upon induction from a lysogenic donor strain. Considering such transducing potential, ϕJB and related bacteriophages may serve as a suitable tool for elucidating the nature of transduction and its contribution to the spread of antibiotic resistance genes in naturally occurring MRSA populations.

  11. Birth Defects

    Science.gov (United States)

    A birth defect is a problem that happens while a baby is developing in the mother's body. Most birth defects happen during the first 3 months of ... in the United States is born with a birth defect. A birth defect may affect how the ...

  12. Identifying the pattern of molecular evolution for Zaire ebolavirus in the 2014 outbreak in West Africa.

    Science.gov (United States)

    Liu, Si-Qing; Deng, Cheng-Lin; Yuan, Zhi-Ming; Rayner, Simon; Zhang, Bo

    2015-06-01

    The current Ebola virus disease (EVD) epidemic has killed more than all previous Ebola outbreaks combined and, even as efforts appear to be bringing the outbreak under control, the threat of reemergence remains. The availability of new whole-genome sequences from West Africa in 2014 outbreak, together with those from the earlier outbreaks, provide an opportunity to investigate the genetic characteristics, the epidemiological dynamics and the evolutionary history for Zaire ebolavirus (ZEBOV). To investigate the evolutionary properties of ZEBOV in this outbreak, we examined amino acid mutations, positive selection, and evolutionary rates on the basis of 123 ZEBOV genome sequences. The estimated phylogenetic relationships within ZEBOV revealed that viral sequences from the same period or location formed a distinct cluster. The West Africa viruses probably derived from Middle Africa, consistent with results from previous studies. Analysis of the seven protein regions of ZEBOV revealed evidence of positive selection acting on the GP and L genes. Interestingly, all putatively positive-selected sites identified in the GP are located within the mucin-like domain of the solved structure of the protein, suggesting a possible role in the immune evasion properties of ZEBOV. Compared with earlier outbreaks, the evolutionary rate of GP gene was estimated to significantly accelerate in the 2014 outbreak, suggesting that more ZEBOV variants are generated for human to human transmission during this sweeping epidemic. However, a more balanced sample set and next generation sequencing datasets would help achieve a clearer understanding at the genetic level of how the virus is evolving and adapting to new conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. A concerted kinase interplay identifies PPARgamma as a molecular target of ghrelin signaling in macrophages.

    Directory of Open Access Journals (Sweden)

    Annie Demers

    2009-11-01

    Full Text Available The peroxisome proliferator-activator receptor PPARgamma plays an essential role in vascular biology, modulating macrophage function and atherosclerosis progression. Recently, we have described the beneficial effect of combined activation of the ghrelin/GHS-R1a receptor and the scavenger receptor CD36 to induce macrophage cholesterol release through transcriptional activation of PPARgamma. Although the interplay between CD36 and PPARgamma in atherogenesis is well recognized, the contribution of the ghrelin receptor to regulate PPARgamma remains unknown. Here, we demonstrate that ghrelin triggers PPARgamma activation through a concerted signaling cascade involving Erk1/2 and Akt kinases, resulting in enhanced expression of downstream effectors LXRalpha and ABC sterol transporters in human macrophages. These effects were associated with enhanced PPARgamma phosphorylation independently of the inhibitory conserved serine-84. Src tyrosine kinase Fyn was identified as being recruited to GHS-R1a in response to ghrelin, but failure of activated Fyn to enhance PPARgamma Ser-84 specific phosphorylation relied on the concomitant recruitment of docking protein Dok-1, which prevented optimal activation of the Erk1/2 pathway. Also, substitution of Ser-84 preserved the ghrelin-induced PPARgamma activity and responsiveness to Src inhibition, supporting a mechanism independent of Ser-84 in PPARgamma response to ghrelin. Consistent with this, we found that ghrelin promoted the PI3-K/Akt pathway in a Galphaq-dependent manner, resulting in Akt recruitment to PPARgamma, enhanced PPARgamma phosphorylation and activation independently of Ser-84, and increased expression of LXRalpha and ABCA1/G1. Collectively, these results illustrate a complex interplay involving Fyn/Dok-1/Erk and Galphaq/PI3-K/Akt pathways to transduce in a concerted manner responsiveness of PPARgamma to ghrelin in macrophages.

  14. Exome sequencing and CRISPR/Cas genome editing identify mutations of ZAK as a cause of limb defects in humans and mice

    NARCIS (Netherlands)

    Spielmann, M.; Kakar, N.; Tayebi, N.; Leettola, C.; Nurnberg, G.; Sowada, N.; Lupianez, D.G.; Harabula, I.; Flottmann, R.; Horn, D.; Chan, W.L.; Wittler, L.; Yilmaz, R.; Altmuller, J.; Thiele, H.; Bokhoven, H. van; Schwartz, C.E.; Nurnberg, P.; Bowie, J.U.; Ahmad, J.; Kubisch, C.; Mundlos, S.; Borck, G.

    2016-01-01

    The CRISPR/Cas technology enables targeted genome editing and the rapid generation of transgenic animal models for the study of human genetic disorders. Here we describe an autosomal recessive human disease in two unrelated families characterized by a split-foot defect, nail abnormalities of the

  15. Designing topological defects in 2D materials using scanning probe microscopy and a self-healing mechanism: a density functional-based molecular dynamics study

    Science.gov (United States)

    Popov, Igor; Đurišić, Ivana; Belić, Milivoj R.

    2017-12-01

    Engineering of materials at the atomic level is one of the most important aims of nanotechnology. The unprecedented ability of scanning probe microscopy to address individual atoms opened up the possibilities for nanomanipulation and nanolitography of surfaces and later on of two-dimensional materials. While the state-of-the-art scanning probe lithographic methods include, primarily, adsorption, desorption and repositioning of adatoms and molecules on substrates or tailoring nanoribbons by etching of trenches, the precise modification of the intrinsic atomic structure of materials is yet to be advanced. Here we introduce a new concept, scanning probe microscopy with a rotating tip, for engineering of the atomic structure of membranes based on two-dimensional materials. In order to indicate the viability of the concept, we present our theoretical research, which includes atomistic modeling, molecular dynamics simulations, Fourier analysis and electronic transport calculations. While stretching can be employed for fabrication of atomic chains only, our comprehensive molecular dynamics simulations indicate that nanomanipulation by scanning probe microscopy with a rotating tip is capable of assembling a wide range of topological defects in two-dimensional materials in a rather controllable and reproducible manner. We analyze two possibilities. In the first case the probe tip is retracted from the membrane while in the second case the tip is released beneath the membrane allowing graphene to freely relax and self-heal the pore made by the tip. The former approach with the tip rotation can be achieved experimentally by rotation of the sample, which is equivalent to rotation of the tip, whereas irradiation of the membrane by nanoclusters can be utilized for the latter approach. The latter one has the potential to yield a yet richer diversity of topological defects on account of a lesser determinacy. If successfully realized experimentally the concept proposed here could

  16. Defective Glycinergic Synaptic Transmission in Zebrafish Motility Mutants

    OpenAIRE

    Hirata, Hiromi; Carta, Eloisa; Yamanaka, Iori; Harvey, Robert J.; Kuwada, John Y.

    2010-01-01

    Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo) mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR) β subunit genes. These mutants exhibit a loss of glycinergic synaptic ...

  17. Challenges in analysing and visualizing large-scale molecular dynamics simulations: domain and defect formation in lung surfactant monolayers

    International Nuclear Information System (INIS)

    Mendez-Villuendas, E; Baoukina, S; Tieleman, D P

    2012-01-01

    Molecular dynamics simulations have rapidly grown in size and complexity, as computers have become more powerful and molecular dynamics software more efficient. Using coarse-grained models like MARTINI system sizes of the order of 50 nm × 50 nm × 50 nm can be simulated on commodity clusters on microsecond time scales. For simulations of biological membranes and monolayers mimicking lung surfactant this enables large-scale transformation and complex mixtures of lipids and proteins. Here we use a simulation of a monolayer with three phospholipid components, cholesterol, lung surfactant proteins, water, and ions on a ten microsecond time scale to illustrate some current challenges in analysis. In the simulation, phase separation occurs followed by formation of a bilayer fold in which lipids and lung surfactant protein form a highly curved structure in the aqueous phase. We use Voronoi analysis to obtain detailed physical properties of the different components and phases, and calculate local mean and Gaussian curvatures of the bilayer fold.

  18. A comprehensive molecular study on Coffin-Siris and Nicolaides-Baraitser syndromes identifies a broad molecular and clinical spectrum converging on altered chromatin remodeling.

    Science.gov (United States)

    Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Steiner-Haldenstätt, Sabine; Pohl, Esther; Li, Yun; Milz, Esther; Martin, Marcel; Thiele, Holger; Altmüller, Janine; Alanay, Yasemin; Kayserili, Hülya; Klein-Hitpass, Ludger; Böhringer, Stefan; Wollstein, Andreas; Albrecht, Beate; Boduroglu, Koray; Caliebe, Almuth; Chrzanowska, Krystyna; Cogulu, Ozgur; Cristofoli, Francesca; Czeschik, Johanna Christina; Devriendt, Koenraad; Dotti, Maria Teresa; Elcioglu, Nursel; Gener, Blanca; Goecke, Timm O; Krajewska-Walasek, Malgorzata; Guillén-Navarro, Encarnación; Hayek, Joussef; Houge, Gunnar; Kilic, Esra; Simsek-Kiper, Pelin Özlem; López-González, Vanesa; Kuechler, Alma; Lyonnet, Stanislas; Mari, Francesca; Marozza, Annabella; Mathieu Dramard, Michèle; Mikat, Barbara; Morin, Gilles; Morice-Picard, Fanny; Ozkinay, Ferda; Rauch, Anita; Renieri, Alessandra; Tinschert, Sigrid; Utine, G Eda; Vilain, Catheline; Vivarelli, Rossella; Zweier, Christiane; Nürnberg, Peter; Rahmann, Sven; Vermeesch, Joris; Lüdecke, Hermann-Josef; Zeschnigk, Michael; Wollnik, Bernd

    2013-12-20

    Chromatin remodeling complexes are known to modify chemical marks on histones or to induce conformational changes in the chromatin in order to regulate transcription. De novo dominant mutations in different members of the SWI/SNF chromatin remodeling complex have recently been described in individuals with Coffin-Siris (CSS) and Nicolaides-Baraitser (NCBRS) syndromes. Using a combination of whole-exome sequencing, NGS-based sequencing of 23 SWI/SNF complex genes, and molecular karyotyping in 46 previously undescribed individuals with CSS and NCBRS, we identified a de novo 1-bp deletion (c.677delG, p.Gly226Glufs*53) and a de novo missense mutation (c.914G>T, p.Cys305Phe) in PHF6 in two individuals diagnosed with CSS. PHF6 interacts with the nucleosome remodeling and deacetylation (NuRD) complex implicating dysfunction of a second chromatin remodeling complex in the pathogenesis of CSS-like phenotypes. Altogether, we identified mutations in 60% of the studied individuals (28/46), located in the genes ARID1A, ARID1B, SMARCB1, SMARCE1, SMARCA2, and PHF6. We show that mutations in ARID1B are the main cause of CSS, accounting for 76% of identified mutations. ARID1B and SMARCB1 mutations were also found in individuals with the initial diagnosis of NCBRS. These individuals apparently belong to a small subset who display an intermediate CSS/NCBRS phenotype. Our proposed genotype-phenotype correlations are important for molecular screening strategies.

  19. MelanomaDB: a Web Tool for Integrative Analysis of Melanoma Genomic Information to Identify Disease-Associated Molecular Pathways

    Directory of Open Access Journals (Sweden)

    Alexander Joseph Trevarton

    2013-07-01

    Full Text Available Despite on-going research, metastatic melanoma survival rates remain low and treatment options are limited. Researchers can now access a rapidly growing amount of molecular and clinical information about melanoma. This information is becoming difficult to assemble and interpret due to its dispersed nature, yet as it grows it becomes increasingly valuable for understanding melanoma. Integration of this information into a comprehensive resource to aid rational experimental design and patient stratification is needed. As an initial step in this direction, we have assembled a web-accessible melanoma database, MelanomaDB, which incorporates clinical and molecular data from publically available sources, which will be regularly updated as new information becomes available. This database allows complex links to be drawn between many different aspects of melanoma biology: genetic changes (e.g. mutations in individual melanomas revealed by DNA sequencing, associations between gene expression and patient survival, data concerning drug targets, biomarkers, druggability and clinical trials, as well as our own statistical analysis of relationships between molecular pathways and clinical parameters that have been produced using these data sets. The database is freely available at http://genesetdb.auckland.ac.nz/melanomadb/about.html . A subset of the information in the database can also be accessed through a freely available web application in the Illumina genomic cloud computing platform BaseSpace at http://www.biomatters.com/apps/melanoma-profiler-for-research . This illustrates dysregulation of specific signalling pathways, both across 310 exome-sequenced melanomas and in individual tumours and identifies novel features about the distribution of somatic variants in melanoma. We suggest that this database can provide a context in which to interpret the tumour molecular profiles of individual melanoma patients relative to biological information and available

  20. Molecular beam epitaxy of GaN(0001) utilizing NH3 and/or NH+x ions: Growth kinetics and defect structure

    International Nuclear Information System (INIS)

    Lee, N.; Powell, R.C.; Kim, Y.; Greene, J.E.

    1995-01-01

    Gas-source molecular beam epitaxy (GS-MBE), utilizing Ga and NH 3 , and reactive-ion MBE (RIMBE), incorporating both thermal NH 3 and low-energy NH + x ions, were used to grow single crystal GaN(0001) layers on Al 2 O 3 (0001) at temperatures T s between 700 and 850 degree C with deposition rates of 0.2--0.5 μm h -1 . The RIMBE experiments were carried out with incident NH + x /Ga flux ratios J NH + x /J Ga =1.9--3.2 and NH + x acceleration energies E NH + x =45--90 eV. Plan-view and cross-sectional transmission electron microscopy analyses showed that the primary defects in the GS-MBE films were threading dislocations having either pure edge or mixed edge/screw characteristics with Burgers vectors bar b=1/3 left-angle 2 bar 1 bar 10 right-angle, basal-plane stacking faults with displacement vectors bar R=1/6 left-angle 02 bar 23 right-angle, and prismatic stacking faults with bar R=1/2 left-angle bar 1101 right-angle. In the case of RIMBE films, no stacking faults or residual ion-induced defects were observed with E NH + x =45 eV and T s ≥800 degree C. However, increasing E NH + x to ≥60 eV at T s =800 degree C gave rise to the formation of residual ion-induced point-defect clusters observable by transmission electron microscopy (TEM). Increasing T s to 850 degree C with E NH + x ≥60 eV resulted in the ion-induced defects aggregating to form interstitial basal and prismatic dislocation loops, whose number densities depended upon the ion flux, with Burgers vectors 1/2 left-angle 0001 right-angle and 1/3 left-angle 2 bar 1 bar 10 right-angle, respectively. (Abstract Truncated)

  1. Molecular dynamics studies of defect formation during heteroepitaxial growth of InGaN alloys on (0001) GaN surfaces.

    Science.gov (United States)

    Gruber, J; Zhou, X W; Jones, R E; Lee, S R; Tucker, G J

    2017-05-21

    We investigate the formation of extended defects during molecular-dynamics (MD) simulations of GaN and InGaN growth on (0001) and ([Formula: see text]) wurtzite-GaN surfaces. The simulated growths are conducted on an atypically large scale by sequentially injecting nearly a million individual vapor-phase atoms towards a fixed GaN surface; we apply time-and-position-dependent boundary constraints that vary the ensemble treatments of the vapor-phase, the near-surface solid-phase, and the bulk-like regions of the growing layer. The simulations employ newly optimized Stillinger-Weber In-Ga-N-system potentials, wherein multiple binary and ternary structures are included in the underlying density-functional-theory training sets, allowing improved treatment of In-Ga-related atomic interactions. To examine the effect of growth conditions, we study a matrix of >30 different MD-growth simulations for a range of In x Ga 1-x N-alloy compositions (0 ≤  x  ≤ 0.4) and homologous growth temperatures [0.50 ≤  T/T * m ( x ) ≤ 0.90], where T * m ( x ) is the simulated melting point. Growths conducted on polar (0001) GaN substrates exhibit the formation of various extended defects including stacking faults/polymorphism, associated domain boundaries, surface roughness, dislocations, and voids. In contrast, selected growths conducted on semi-polar ([Formula: see text]) GaN, where the wurtzite-phase stacking sequence is revealed at the surface, exhibit the formation of far fewer stacking faults. We discuss variations in the defect formation with the MD growth conditions, and we compare the resulting simulated films to existing experimental observations in InGaN/GaN. While the palette of defects observed by MD closely resembles those observed in the past experiments, further work is needed to achieve truly predictive large-scale simulations of InGaN/GaN crystal growth using MD methodologies.

  2. Genome-wide association study of multiple congenital heart disease phenotypes identifies a susceptibility locus for atrial septal defect at chromosome 4p16

    Science.gov (United States)

    Cordell, Heather J.; Bentham, Jamie; Topf, Ana; Zelenika, Diana; Heath, Simon; Mamasoula, Chrysovalanto; Cosgrove, Catherine; Blue, Gillian; Granados-Riveron, Javier; Setchfield, Kerry; Thornborough, Chris; Breckpot, Jeroen; Soemedi, Rachel; Martin, Ruairidh; Rahman, Thahira J.; Hall, Darroch; van Engelen, Klaartje; Moorman, Antoon F.M.; Zwinderman, Aelko H; Barnett, Phil; Koopmann, Tamara T.; Adriaens, Michiel E.; Varro, Andras; George, Alfred L.; dos Remedios, Christobal; Bishopric, Nanette H.; Bezzina, Connie R.; O’Sullivan, John; Gewillig, Marc; Bu’Lock, Frances A.; Winlaw, David; Bhattacharya, Shoumo; Devriendt, Koen; Brook, J. David; Mulder, Barbara J.M.; Mital, Seema; Postma, Alex V.; Lathrop, G. Mark; Farrall, Martin; Goodship, Judith A.; Keavney, Bernard D.

    2013-01-01

    We carried out a genome-wide association study (GWAS) of congenital heart disease (CHD). Our discovery cohort comprised 1,995 CHD cases and 5,159 controls, and included patients from each of the three major clinical CHD categories (septal, obstructive and cyanotic defects). When all CHD phenotypes were considered together, no regions achieved genome-wide significant association. However, a region on chromosome 4p16, adjacent to the MSX1 and STX18 genes, was associated (P=9.5×10−7) with the risk of ostium secundum atrial septal defect (ASD) in the discovery cohort (N=340 cases), and this was replicated in a further 417 ASD cases and 2520 controls (replication P=5.0×10−5; OR in replication cohort 1.40 [95% CI 1.19-1.65]; combined P=2.6×10−10). Genotype accounted for ~9% of the population attributable risk of ASD. PMID:23708191

  3. Antibiotic discovery throughout the Small World Initiative: A molecular strategy to identify biosynthetic gene clusters involved in antagonistic activity.

    Science.gov (United States)

    Davis, Elizabeth; Sloan, Tyler; Aurelius, Krista; Barbour, Angela; Bodey, Elijah; Clark, Brigette; Dennis, Celeste; Drown, Rachel; Fleming, Megan; Humbert, Allison; Glasgo, Elizabeth; Kerns, Trent; Lingro, Kelly; McMillin, MacKenzie; Meyer, Aaron; Pope, Breanna; Stalevicz, April; Steffen, Brittney; Steindl, Austin; Williams, Carolyn; Wimberley, Carmen; Zenas, Robert; Butela, Kristen; Wildschutte, Hans

    2017-06-01

    The emergence of bacterial pathogens resistant to all known antibiotics is a global health crisis. Adding to this problem is that major pharmaceutical companies have shifted away from antibiotic discovery due to low profitability. As a result, the pipeline of new antibiotics is essentially dry and many bacteria now resist the effects of most commonly used drugs. To address this global health concern, citizen science through the Small World Initiative (SWI) was formed in 2012. As part of SWI, students isolate bacteria from their local environments, characterize the strains, and assay for antibiotic production. During the 2015 fall semester at Bowling Green State University, students isolated 77 soil-derived bacteria and genetically characterized strains using the 16S rRNA gene, identified strains exhibiting antagonistic activity, and performed an expanded SWI workflow using transposon mutagenesis to identify a biosynthetic gene cluster involved in toxigenic compound production. We identified one mutant with loss of antagonistic activity and through subsequent whole-genome sequencing and linker-mediated PCR identified a 24.9 kb biosynthetic gene locus likely involved in inhibitory activity in that mutant. Further assessment against human pathogens demonstrated the inhibition of Bacillus cereus, Listeria monocytogenes, and methicillin-resistant Staphylococcus aureus in the presence of this compound, thus supporting our molecular strategy as an effective research pipeline for SWI antibiotic discovery and genetic characterization. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  4. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    Directory of Open Access Journals (Sweden)

    Tung Shu-Yun

    2011-04-01

    Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.

  5. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Tanaka, K.; Satokata, I.; Ogita, Z.; Uchida, T.; Okada, Y.

    1989-01-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene

  6. Global transcriptomic profiling of aspen trees under elevated [CO2] to identify potential molecular mechanisms responsible for enhanced radial growth.

    Science.gov (United States)

    Wei, Hairong; Gou, Jiqing; Yordanov, Yordan; Zhang, Huaxin; Thakur, Ramesh; Jones, Wendy; Burton, Andrew

    2013-03-01

    Aspen (Populus tremuloides) trees growing under elevated [CO(2)] at a free-air CO(2) enrichment (FACE) site produced significantly more biomass than control trees. We investigated the molecular mechanisms underlying the observed increase in biomass by producing transcriptomic profiles of the vascular cambium zone (VCZ) and leaves, and then performed a comparative study to identify significantly changed genes and pathways after 12 years exposure to elevated [CO(2)]. In leaves, elevated [CO(2)] enhanced expression of genes related to Calvin cycle activity and linked pathways. In the VCZ, the pathways involved in cell growth, cell division, hormone metabolism, and secondary cell wall formation were altered while auxin conjugation, ABA synthesis, and cytokinin glucosylation and degradation were inhibited. Similarly, the genes involved in hemicellulose and pectin biosynthesis were enhanced, but some genes that catalyze important steps in lignin biosynthesis pathway were inhibited. Evidence from systemic analysis supported the functioning of multiple molecular mechanisms that underpin the enhanced radial growth in response to elevated [CO(2)].

  7. Distinct Molecular Signature of Murine Fetal Liver and Adult Hematopoietic Stem Cells Identify Novel Regulators of Hematopoietic Stem Cell Function.

    Science.gov (United States)

    Manesia, Javed K; Franch, Monica; Tabas-Madrid, Daniel; Nogales-Cadenas, Ruben; Vanwelden, Thomas; Van Den Bosch, Elisa; Xu, Zhuofei; Pascual-Montano, Alberto; Khurana, Satish; Verfaillie, Catherine M

    2017-04-15

    During ontogeny, fetal liver (FL) acts as a major site for hematopoietic stem cell (HSC) maturation and expansion, whereas HSCs in the adult bone marrow (ABM) are largely quiescent. HSCs in the FL possess faster repopulation capacity as compared with ABM HSCs. However, the molecular mechanism regulating the greater self-renewal potential of FL HSCs has not yet extensively been assessed. Recently, we published RNA sequencing-based gene expression analysis on FL HSCs from 14.5-day mouse embryo (E14.5) in comparison to the ABM HSCs. We reanalyzed these data to identify key transcriptional regulators that play important roles in the expansion of HSCs during development. The comparison of FL E14.5 with ABM HSCs identified more than 1,400 differentially expressed genes. More than 200 genes were shortlisted based on the gene ontology (GO) annotation term "transcription." By morpholino-based knockdown studies in zebrafish, we assessed the function of 18 of these regulators, previously not associated with HSC proliferation. Our studies identified a previously unknown role for tdg, uhrf1, uchl5, and ncoa1 in the emergence of definitive hematopoiesis in zebrafish. In conclusion, we demonstrate that identification of genes involved in transcriptional regulation differentially expressed between expanding FL HSCs and quiescent ABM HSCs, uncovers novel regulators of HSC function.

  8. Deep level defects in Ge-doped (010) β-Ga2O3 layers grown by plasma-assisted molecular beam epitaxy

    Science.gov (United States)

    Farzana, Esmat; Ahmadi, Elaheh; Speck, James S.; Arehart, Aaron R.; Ringel, Steven A.

    2018-04-01

    Deep level defects were characterized in Ge-doped (010) β-Ga2O3 layers grown by plasma-assisted molecular beam epitaxy (PAMBE) using deep level optical spectroscopy (DLOS) and deep level transient (thermal) spectroscopy (DLTS) applied to Ni/β-Ga2O3:Ge (010) Schottky diodes that displayed Schottky barrier heights of 1.50 eV. DLOS revealed states at EC - 2.00 eV, EC - 3.25 eV, and EC - 4.37 eV with concentrations on the order of 1016 cm-3, and a lower concentration level at EC - 1.27 eV. In contrast to these states within the middle and lower parts of the bandgap probed by DLOS, DLTS measurements revealed much lower concentrations of states within the upper bandgap region at EC - 0.1 - 0.2 eV and EC - 0.98 eV. There was no evidence of the commonly observed trap state at ˜EC - 0.82 eV that has been reported to dominate the DLTS spectrum in substrate materials synthesized by melt-based growth methods such as edge defined film fed growth (EFG) and Czochralski methods [Zhang et al., Appl. Phys. Lett. 108, 052105 (2016) and Irmscher et al., J. Appl. Phys. 110, 063720 (2011)]. This strong sensitivity of defect incorporation on crystal growth method and conditions is unsurprising, which for PAMBE-grown β-Ga2O3:Ge manifests as a relatively "clean" upper part of the bandgap. However, the states at ˜EC - 0.98 eV, EC - 2.00 eV, and EC - 4.37 eV are reminiscent of similar findings from these earlier results on EFG-grown materials, suggesting that possible common sources might also be present irrespective of growth method.

  9. Mechanisms to medicines: elucidating neural and molecular substrates of fear extinction to identify novel treatments for anxiety disorders

    Science.gov (United States)

    Bukalo, Olena; Pinard, Courtney R; Holmes, Andrew

    2014-01-01

    The burden of anxiety disorders is growing, but the efficacy of available anxiolytic treatments remains inadequate. Cognitive behavioural therapy for anxiety disorders focuses on identifying and modifying maladaptive patterns of thinking and behaving, and has a testable analogue in rodents in the form of fear extinction. A large preclinical literature has amassed in recent years describing the neural and molecular basis of fear extinction in rodents. In this review, we discuss how this work is being harnessed to foster translational research on anxiety disorders and facilitate the search for new anxiolytic treatments. We begin by summarizing the anatomical and functional connectivity of a medial prefrontal cortex (mPFC)–amygdala circuit that subserves fear extinction, including new insights from optogenetics. We then cover some of the approaches that have been taken to model impaired fear extinction and associated impairments with mPFC–amygdala dysfunction. The principal goal of the review is to evaluate evidence that various neurotransmitter and neuromodulator systems mediate fear extinction by modulating the mPFC–amygdala circuitry. To that end, we describe studies that have tested how fear extinction is impaired or facilitated by pharmacological manipulations of dopamine, noradrenaline, 5-HT, GABA, glutamate, neuropeptides, endocannabinoids and various other systems, which either directly target the mPFC–amygdala circuit, or produce behavioural effects that are coincident with functional changes in the circuit. We conclude that there are good grounds to be optimistic that the progress in defining the molecular substrates of mPFC–amygdala circuit function can be effectively leveraged to identify plausible candidates for extinction-promoting therapies for anxiety disorders. Linked Articles This article is part of a themed section on Animal Models in Psychiatry Research. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2014

  10. Mechanisms to medicines: elucidating neural and molecular substrates of fear extinction to identify novel treatments for anxiety disorders.

    Science.gov (United States)

    Bukalo, Olena; Pinard, Courtney R; Holmes, Andrew

    2014-10-01

    The burden of anxiety disorders is growing, but the efficacy of available anxiolytic treatments remains inadequate. Cognitive behavioural therapy for anxiety disorders focuses on identifying and modifying maladaptive patterns of thinking and behaving, and has a testable analogue in rodents in the form of fear extinction. A large preclinical literature has amassed in recent years describing the neural and molecular basis of fear extinction in rodents. In this review, we discuss how this work is being harnessed to foster translational research on anxiety disorders and facilitate the search for new anxiolytic treatments. We begin by summarizing the anatomical and functional connectivity of a medial prefrontal cortex (mPFC)-amygdala circuit that subserves fear extinction, including new insights from optogenetics. We then cover some of the approaches that have been taken to model impaired fear extinction and associated impairments with mPFC-amygdala dysfunction. The principal goal of the review is to evaluate evidence that various neurotransmitter and neuromodulator systems mediate fear extinction by modulating the mPFC-amygdala circuitry. To that end, we describe studies that have tested how fear extinction is impaired or facilitated by pharmacological manipulations of dopamine, noradrenaline, 5-HT, GABA, glutamate, neuropeptides, endocannabinoids and various other systems, which either directly target the mPFC-amygdala circuit, or produce behavioural effects that are coincident with functional changes in the circuit. We conclude that there are good grounds to be optimistic that the progress in defining the molecular substrates of mPFC-amygdala circuit function can be effectively leveraged to identify plausible candidates for extinction-promoting therapies for anxiety disorders. © 2014 The British Pharmacological Society.

  11. Statistical study of defects caused by primary knock-on atoms in fcc Cu and bcc W using molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Warrier, M., E-mail: Manoj.Warrier@gmail.com [Computational Analysis Division, BARC, Visakhapatnam, Andhra Pradesh, 530012 (India); Bhardwaj, U.; Hemani, H. [Computational Analysis Division, BARC, Visakhapatnam, Andhra Pradesh, 530012 (India); Schneider, R. [Computational Science, Ernst-Moritz-Arndt University, D-17489 Greifswald (Germany); Mutzke, A. [Max-Planck-Institut für Plasmaphysik, D-17491 Greifswald (Germany); Valsakumar, M.C. [School for Engineering Sciences and Technology, University of Hyderabad, Gachibowli, Hyderabad, Telangana State, 500046 (India)

    2015-12-15

    We report on molecular Dynamics (MD) simulations carried out in fcc Cu and bcc W using the Large-scale Atomic/Molecular Massively Parallel Simulator (LAMMPS) code to study (i) the statistical variations in the number of interstitials and vacancies produced by energetic primary knock-on atoms (PKA) (0.1–5 keV) directed in random directions and (ii) the in-cascade cluster size distributions. It is seen that around 60–80 random directions have to be explored for the average number of displaced atoms to become steady in the case of fcc Cu, whereas for bcc W around 50–60 random directions need to be explored. The number of Frenkel pairs produced in the MD simulations are compared with that from the Binary Collision Approximation Monte Carlo (BCA-MC) code SDTRIM-SP and the results from the NRT model. It is seen that a proper choice of the damage energy, i.e. the energy required to create a stable interstitial, is essential for the BCA-MC results to match the MD results. On the computational front it is seen that in-situ processing saves the need to input/output (I/O) atomic position data of several tera-bytes when exploring a large number of random directions and there is no difference in run-time because the extra run-time in processing data is offset by the time saved in I/O. - Highlights: • MD simulations of collision cascades in 200 random directions explored in the energy range of 1–5 keV for fcc Cu and bcc W. • 60–80 random directions must be sampled for the number of displacements produced in a collision cascade to stabilize. • In-cascade clustering of interstitials and vacancies occur. • Direction averaged distribution of interstitials and vacancies around the origin of a PKA is presented. • Comparisons with MD indicate that the recoils produced in BCA-MC simulations be checked for recombination against all vacancies created.

  12. Defect modelling

    International Nuclear Information System (INIS)

    Norgett, M.J.

    1980-01-01

    Calculations, drawing principally on developments at AERE Harwell, of the relaxation about lattice defects are reviewed with emphasis on the techniques required for such calculations. The principles of defect modelling are outlined and various programs developed for defect simulations are discussed. Particular calculations for metals, ionic crystals and oxides, are considered. (UK)

  13. Advanced computational biology methods identify molecular switches for malignancy in an EGF mouse model of liver cancer.

    Directory of Open Access Journals (Sweden)

    Philip Stegmaier

    Full Text Available The molecular causes by which the epidermal growth factor receptor tyrosine kinase induces malignant transformation are largely unknown. To better understand EGFs' transforming capacity whole genome scans were applied to a transgenic mouse model of liver cancer and subjected to advanced methods of computational analysis to construct de novo gene regulatory networks based on a combination of sequence analysis and entrained graph-topological algorithms. Here we identified transcription factors, processes, key nodes and molecules to connect as yet unknown interacting partners at the level of protein-DNA interaction. Many of those could be confirmed by electromobility band shift assay at recognition sites of gene specific promoters and by western blotting of nuclear proteins. A novel cellular regulatory circuitry could therefore be proposed that connects cell cycle regulated genes with components of the EGF signaling pathway. Promoter analysis of differentially expressed genes suggested the majority of regulated transcription factors to display specificity to either the pre-tumor or the tumor state. Subsequent search for signal transduction key nodes upstream of the identified transcription factors and their targets suggested the insulin-like growth factor pathway to render the tumor cells independent of EGF receptor activity. Notably, expression of IGF2 in addition to many components of this pathway was highly upregulated in tumors. Together, we propose a switch in autocrine signaling to foster tumor growth that was initially triggered by EGF and demonstrate the knowledge gain form promoter analysis combined with upstream key node identification.

  14. Integrated Bioinformatics, Environmental Epidemiologic and Genomic Approaches to Identify Environmental and Molecular Links between Endometriosis and Breast Cancer

    Directory of Open Access Journals (Sweden)

    Deodutta Roy

    2015-10-01

    Full Text Available We present a combined environmental epidemiologic, genomic, and bioinformatics approach to identify: exposure of environmental chemicals with estrogenic activity; epidemiologic association between endocrine disrupting chemical (EDC and health effects, such as, breast cancer or endometriosis; and gene-EDC interactions and disease associations. Human exposure measurement and modeling confirmed estrogenic activity of three selected class of environmental chemicals, polychlorinated biphenyls (PCBs, bisphenols (BPs, and phthalates. Meta-analysis showed that PCBs exposure, not Bisphenol A (BPA and phthalates, increased the summary odds ratio for breast cancer and endometriosis. Bioinformatics analysis of gene-EDC interactions and disease associations identified several hundred genes that were altered by exposure to PCBs, phthalate or BPA. EDCs-modified genes in breast neoplasms and endometriosis are part of steroid hormone signaling and inflammation pathways. All three EDCs–PCB 153, phthalates, and BPA influenced five common genes—CYP19A1, EGFR, ESR2, FOS, and IGF1—in breast cancer as well as in endometriosis. These genes are environmentally and estrogen responsive, altered in human breast and uterine tumors and endometriosis lesions, and part of Mitogen Activated Protein Kinase (MAPK signaling pathways in cancer. Our findings suggest that breast cancer and endometriosis share some common environmental and molecular risk factors.

  15. Expression Profiling of Differentiating Emerin-Null Myogenic Progenitor Identifies Molecular Pathways Implicated in Their Impaired Differentiation

    Directory of Open Access Journals (Sweden)

    Ashvin Iyer

    2017-10-01

    Full Text Available Mutations in the gene encoding emerin cause Emery-Dreifuss muscular dystrophy (EDMD, a disorder causing progressive skeletal muscle wasting, irregular heart rhythms and contractures of major tendons. RNA sequencing was performed on differentiating wildtype and emerin-null myogenic progenitors to identify molecular pathways implicated in EDMD, 340 genes were uniquely differentially expressed during the transition from day 0 to day 1 in wildtype cells. 1605 genes were uniquely expressed in emerin-null cells; 1706 genes were shared among both wildtype and emerin-null cells. One thousand and forty-seven transcripts showed differential expression during the transition from day 1 to day 2. Four hundred and thirty-one transcripts showed altered expression in both wildtype and emerin-null cells. Two hundred and ninety-five transcripts were differentially expressed only in emerin-null cells and 321 transcripts were differentially expressed only in wildtype cells. DAVID, STRING and Ingenuity Pathway Analysis identified pathways implicated in impaired emerin-null differentiation, including cell signaling, cell cycle checkpoints, integrin signaling, YAP/TAZ signaling, stem cell differentiation, and multiple muscle development and myogenic differentiation pathways. Functional enrichment analysis showed biological functions associated with the growth of muscle tissue and myogenesis of skeletal muscle were inhibited. The large number of differentially expressed transcripts upon differentiation induction suggests emerin functions during transcriptional reprograming of progenitors to committed myoblasts.

  16. Molecular profiling of aged neural progenitors identifies Dbx2 as a candidate regulator of age-associated neurogenic decline.

    Science.gov (United States)

    Lupo, Giuseppe; Nisi, Paola S; Esteve, Pilar; Paul, Yu-Lee; Novo, Clara Lopes; Sidders, Ben; Khan, Muhammad A; Biagioni, Stefano; Liu, Hai-Kun; Bovolenta, Paola; Cacci, Emanuele; Rugg-Gunn, Peter J

    2018-06-01

    Adult neurogenesis declines with aging due to the depletion and functional impairment of neural stem/progenitor cells (NSPCs). An improved understanding of the underlying mechanisms that drive age-associated neurogenic deficiency could lead to the development of strategies to alleviate cognitive impairment and facilitate neuroregeneration. An essential step towards this aim is to investigate the molecular changes that occur in NSPC aging on a genomewide scale. In this study, we compare the transcriptional, histone methylation and DNA methylation signatures of NSPCs derived from the subventricular zone (SVZ) of young adult (3 months old) and aged (18 months old) mice. Surprisingly, the transcriptional and epigenomic profiles of SVZ-derived NSPCs are largely unchanged in aged cells. Despite the global similarities, we detect robust age-dependent changes at several hundred genes and regulatory elements, thereby identifying putative regulators of neurogenic decline. Within this list, the homeobox gene Dbx2 is upregulated in vitro and in vivo, and its promoter region has altered histone and DNA methylation levels, in aged NSPCs. Using functional in vitro assays, we show that elevated Dbx2 expression in young adult NSPCs promotes age-related phenotypes, including the reduced proliferation of NSPC cultures and the altered transcript levels of age-associated regulators of NSPC proliferation and differentiation. Depleting Dbx2 in aged NSPCs caused the reverse gene expression changes. Taken together, these results provide new insights into the molecular programmes that are affected during mouse NSPC aging, and uncover a new functional role for Dbx2 in promoting age-related neurogenic decline. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  17. Omics analysis of human bone to identify genes and molecular networks regulating skeletal remodeling in health and disease.

    Science.gov (United States)

    Reppe, Sjur; Datta, Harish K; Gautvik, Kaare M

    2017-08-01

    The skeleton is a metabolically active organ throughout life where specific bone cell activity and paracrine/endocrine factors regulate its morphogenesis and remodeling. In recent years, an increasing number of reports have used multi-omics technologies to characterize subsets of bone biological molecular networks. The skeleton is affected by primary and secondary disease, lifestyle and many drugs. Therefore, to obtain relevant and reliable data from well characterized patient and control cohorts are vital. Here we provide a brief overview of omics studies performed on human bone, of which our own studies performed on trans-iliacal bone biopsies from postmenopausal women with osteoporosis (OP) and healthy controls are among the first and largest. Most other studies have been performed on smaller groups of patients, undergoing hip replacement for osteoarthritis (OA) or fracture, and without healthy controls. The major findings emerging from the combined studies are: 1. Unstressed and stressed bone show profoundly different gene expression reflecting differences in bone turnover and remodeling and 2. Omics analyses comparing healthy/OP and control/OA cohorts reveal characteristic changes in transcriptomics, epigenomics (DNA methylation), proteomics and metabolomics. These studies, together with genome-wide association studies, in vitro observations and transgenic animal models have identified a number of genes and gene products that act via Wnt and other signaling systems and are highly associated to bone density and fracture. Future challenge is to understand the functional interactions between bone-related molecular networks and their significance in OP and OA pathogenesis, and also how the genomic architecture is affected in health and disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity

    Science.gov (United States)

    Xu, Ning; Cui, Jinrui; Mengesha, Emebet; Chen, Yii-Der I.; Taylor, Kent D.; Azziz, Ricardo; Goodarzi, Mark O.

    2015-01-01

    Genome wide association studies (GWAS) have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS), a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs) therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS. PMID:26305227

  19. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity.

    Directory of Open Access Journals (Sweden)

    Michelle R Jones

    2015-08-01

    Full Text Available Genome wide association studies (GWAS have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS, a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS.

  20. Systems Genetics Reveals the Functional Context of PCOS Loci and Identifies Genetic and Molecular Mechanisms of Disease Heterogeneity.

    Science.gov (United States)

    Jones, Michelle R; Brower, Meredith A; Xu, Ning; Cui, Jinrui; Mengesha, Emebet; Chen, Yii-Der I; Taylor, Kent D; Azziz, Ricardo; Goodarzi, Mark O

    2015-08-01

    Genome wide association studies (GWAS) have revealed 11 independent risk loci for polycystic ovary syndrome (PCOS), a common disorder in young women characterized by androgen excess and oligomenorrhea. To put these risk loci and the single nucleotide polymorphisms (SNPs) therein into functional context, we measured DNA methylation and gene expression in subcutaneous adipose tissue biopsies to identify PCOS-specific alterations. Two genes from the LHCGR region, STON1-GTF2A1L and LHCGR, were overexpressed in PCOS. In analysis stratified by obesity, LHCGR was overexpressed only in non-obese PCOS women. Although not differentially expressed in the entire PCOS group, INSR was underexpressed in obese PCOS subjects only. Alterations in gene expression in the LHCGR, RAB5B and INSR regions suggest that SNPs in these loci may be functional and could affect gene expression directly or indirectly via epigenetic alterations. We identified reduced methylation in the LHCGR locus and increased methylation in the INSR locus, changes that are concordant with the altered gene expression profiles. Complex patterns of meQTL and eQTL were identified in these loci, suggesting that local genetic variation plays an important role in gene regulation. We propose that non-obese PCOS women possess significant alterations in LH receptor expression, which drives excess androgen secretion from the ovary. Alternatively, obese women with PCOS possess alterations in insulin receptor expression, with underexpression in metabolic tissues and overexpression in the ovary, resulting in peripheral insulin resistance and excess ovarian androgen production. These studies provide a genetic and molecular basis for the reported clinical heterogeneity of PCOS.

  1. Defect chemistry of ''BaCuO2''. Pt. 1. Oxygen non-stoichiometry, cation molecularity and X-ray diffraction determinations

    International Nuclear Information System (INIS)

    Spinolo, G.; Consiglio Nazionale delle Ricerche, Pavia; Anselmi-Tamburini, U.; Consiglio Nazionale delle Ricerche, Pavia; Arimondi, M.; Consiglio Nazionale delle Ricerche, Pavia; Ghigna, P.; Consiglio Nazionale delle Ricerche, Pavia; Flor, G.; Consiglio Nazionale delle Ricerche, Pavia

    1995-01-01

    ''BaCuO 2 '' is the key intermediate in the synthesis of the Ba 2 YCu 3 O 7-δ superconductor. Its very complex crystal structure is able to accommodate a large change in oxygen content. Oxygen non-stoichiometry of ''BaCuO 2 '' materials with 1:1 and 88:90 (Ba:Cu) molecularity has been investigated by polythermal X-ray powder diffraction coupled with isobaric-isothermal gravimetry determinations under different temperature and oxygen partial pressure conditions [300 ≤ T ≤ 820 C, 1 ≥ P(O 2 ) ≥3 . 10 -3 atm]. The 1:1 composition does not give well reproducible results, thus suggesting its polyphasic nature, at least in part of the investigated range. The results for the 88:90 ≅ 0.98 (Ba:Cu) composition are well reproducible and show that the material is single phase. Ba 0.98 CuO 1.98 + δ is oxygen over-stoichiometric in the whole investigated [T, P(O 2 )] range, with a maximum value δ ∼ 0.21. A Rietveld X-ray profile fitting is in agreement with previous single-crystal data. The trend of δ vs. P(O 2 ) is consistent with the presence of oxygen interstitial defects on (possibly different) crystallographic sites. (orig.)

  2. Characterization of structural defects in SnSe2 thin films grown by molecular beam epitaxy on GaAs (111)B substrates

    Science.gov (United States)

    Tracy, Brian D.; Li, Xiang; Liu, Xinyu; Furdyna, Jacek; Dobrowolska, Margaret; Smith, David J.

    2016-11-01

    Tin selenide thin films have been grown by molecular beam epitaxy on GaAs (111)B substrates at a growth temperature of 150 °C, and a microstructural study has been carried out, primarily using the technique of transmission electron microscopy. The Se:Sn flux ratio during growth was systematically varied and found to have a strong impact on the resultant crystal structure and quality. Low flux ratios (Se:Sn=3:1) led to defective films consisting primarily of SnSe, whereas high flux ratios (Se:Sn>10:1) gave higher quality, single-phase SnSe2. The structure of the monoselenide films was found to be consistent with the Space Group Pnma with the epitaxial growth relationship of [011]SnSe// [ 1 1 bar 0 ] GaAs, while the diselenide films were consistent with the Space Group P 3 bar m1 , and had the epitaxial growth relationship [ 2 1 bar 1 bar 0 ]SnSe2// [ 1 1 bar 0 ] GaAs.

  3. Identifying cell and molecular stress after radiation in a three-dimensional (3-D) model of oral mucositis

    International Nuclear Information System (INIS)

    Lambros, Maria Polikandritou; Parsa, Cyrus; Mulamalla, HariChandana; Orlando, Robert; Lau, Bernard; Huang, Ying; Pon, Doreen; Chow, Moses

    2011-01-01

    Research highlights: → We irradiated a 3-D human oral cell culture of keratinocytes and fibroblasts with 12 and 2 Gy. → 6 h after irradiation the histopathology and apoptosis of the 3-D culture were evaluated. Microarrays were used to assess the gene expression in the irradiated 3-D tissue. → 12 Gy induced significant histopathologic changes and cellular apoptosis. → 12 Gy significantly affected genes of the NF-kB pathway, inflammatory cytokines and DAMPs. -- Abstract: Mucositis is a debilitating adverse effect of chemotherapy and radiation treatment. It is important to develop a simple and reliable in vitro model, which can routinely be used to screen new drugs for prevention and treatment of mucositis. Furthermore, identifying cell and molecular stresses especially in the initiation phase of mucositis in this model will help towards this end. We evaluated a three-dimensional (3-D) human oral cell culture that consisted of oral keratinocytes and fibroblasts as a model of oral mucositis. The 3-D cell culture model was irradiated with 12 or 2 Gy. Six hours after the irradiation we evaluated microscopic sections of the cell culture for evidence of morphologic changes including apoptosis. We used microarrays to compare the expression of several genes from the irradiated tissue with identical genes from tissue that was not irradiated. We found that irradiation with 12 Gy induced significant histopathologic effects including cellular apoptosis. Irradiation significantly affected the expression of several genes of the NF-kB pathway and several inflammatory cytokines, such as IL-1B, 1L-8, NF-kB1, and FOS compared to tissue that was not irradiated. We identified significant upregulation of several genes that belong to damage-associated molecular patterns (DAMPs) such as HMB1, S100A13, SA10014, and SA10016 in the 3-D tissues that received 12 Gy but not in tissues that received 2 Gy. In conclusion, this model quantifies radiation damage and this is an important first

  4. Nanocarbon: Defect Architectures and Properties

    Science.gov (United States)

    Vuong, Amanda

    The allotropes of carbon make its solid phases amongst the most diverse of any element. It can occur naturally as graphite and diamond, which have very different properties that make them suitable for a wide range of technological and commercial purposes. Recent developments in synthetic carbon include Highly Oriented Pyrolytic Graphite (HOPG) and nano-carbons, such as fullerenes, nanotubes and graphene. The main industrial application of bulk graphite is as an electrode material in steel production, but in purified nuclear graphite form, it is also used as a moderator in Advanced Gas-cooled Reactors across the United Kingdom. Both graphene and graphite are damaged over time when subjected to bombardment by electrons, neutrons or ions, and these have a wide range of effects on their physical and electrical properties, depending on the radiation flux and temperature. This research focuses on intrinsic defects in graphene and dimensional change in nuclear graphite. The method used here is computational chemistry, which complements physical experiments. Techniques used comprise of density functional theory (DFT) and molecular dynamics (MD), which are discussed in chapter 2 and chapter 3, respectively. The succeeding chapters describe the results of simulations performed to model defects in graphene and graphite. Chapter 4 presents the results of ab initio DFT calculations performed to investigate vacancy complexes that are formed in AA stacked bilayer graphene. In AB stacking, carbon atoms surrounding the lattice vacancies can form interlayer structures with sp2 bonding that are lower in energy compared to in-plane reconstructions. From the investigation of AA stacking, sp2 interlayer bonding of adjacent multivacancy defects in registry creates a type of stable sp2 bonded wormhole between the layers. Also, a new class of mezzanine structure characterised by sp3 interlayer bonding, resembling a prismatic vacancy loop has also been identified. The mezzanine, which is a

  5. Molecular Characterization and Functional Analysis of PR-1-Like Proteins Identified from the Wheat Head Blight Fungus Fusarium graminearum.

    Science.gov (United States)

    Lu, Shunwen; Edwards, Michael C

    2018-04-01

    The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologs are also found in other eukaryotic kingdoms. Studies on nonplant PR-1-like (PR-1L) proteins have been pursued widely in humans and animals but rarely in filamentous ascomycetes. Here, we report the characterization of four PR-1L proteins identified from the ascomycete fungus Fusarium graminearum, the primary cause of Fusarium head blight of wheat and barley (designated FgPR-1L). Molecular cloning revealed that the four FgPR-1L proteins are all encoded by small open reading frames (612 to 909 bp) that are often interrupted by introns, in contrast to plant PR-1 genes that lack introns. Sequence analysis indicated that all FgPR-1L proteins contain the PR-1-specific three-dimensional structure, and one of them features a C-terminal transmembrane (TM) domain that has not been reported for any stand-alone PR-1 proteins. Transcriptional analysis revealed that the four FgPR-1L genes are expressed in axenic cultures and in planta with different spatial or temporal expression patterns. Phylogenetic analysis indicated that fungal PR-1L proteins fall into three major groups, one of which harbors FgPR-1L-2-related TM-containing proteins from both phytopathogenic and human-pathogenic ascomycetes. Low-temperature sodium dodecyl sulfate polyacrylamide gel electrophoresis and proteolytic assays indicated that the recombinant FgPR-1L-4 protein exists as a monomer and is resistant to subtilisin of the serine protease family. Functional analysis confirmed that deletion of the FgPR-1L-4 gene from the fungal genome results in significantly reduced virulence on susceptible wheat. This study provides the first example that the F. graminearum-wheat interaction involves a pathogen-derived PR-1L protein that affects fungal virulence on the host.

  6. An innovative strategy for the molecular diagnosis of Usher syndrome identifies causal biallelic mutations in 93% of European patients.

    Science.gov (United States)

    Bonnet, Crystel; Riahi, Zied; Chantot-Bastaraud, Sandra; Smagghe, Luce; Letexier, Mélanie; Marcaillou, Charles; Lefèvre, Gaëlle M; Hardelin, Jean-Pierre; El-Amraoui, Aziz; Singh-Estivalet, Amrit; Mohand-Saïd, Saddek; Kohl, Susanne; Kurtenbach, Anne; Sliesoraityte, Ieva; Zobor, Ditta; Gherbi, Souad; Testa, Francesco; Simonelli, Francesca; Banfi, Sandro; Fakin, Ana; Glavač, Damjan; Jarc-Vidmar, Martina; Zupan, Andrej; Battelino, Saba; Martorell Sampol, Loreto; Claveria, Maria Antonia; Catala Mora, Jaume; Dad, Shzeena; Møller, Lisbeth B; Rodriguez Jorge, Jesus; Hawlina, Marko; Auricchio, Alberto; Sahel, José-Alain; Marlin, Sandrine; Zrenner, Eberhart; Audo, Isabelle; Petit, Christine

    2016-12-01

    Usher syndrome (USH), the most prevalent cause of hereditary deafness-blindness, is an autosomal recessive and genetically heterogeneous disorder. Three clinical subtypes (USH1-3) are distinguishable based on the severity of the sensorineural hearing impairment, the presence or absence of vestibular dysfunction, and the age of onset of the retinitis pigmentosa. A total of 10 causal genes, 6 for USH1, 3 for USH2, and 1 for USH3, and an USH2 modifier gene, have been identified. A robust molecular diagnosis is required not only to improve genetic counseling, but also to advance gene therapy in USH patients. Here, we present an improved diagnostic strategy that is both cost- and time-effective. It relies on the sequential use of three different techniques to analyze selected genomic regions: targeted exome sequencing, comparative genome hybridization, and quantitative exon amplification. We screened a large cohort of 427 patients (139 USH1, 282 USH2, and six of undefined clinical subtype) from various European medical centers for mutations in all USH genes and the modifier gene. We identified a total of 421 different sequence variants predicted to be pathogenic, about half of which had not been previously reported. Remarkably, we detected large genomic rearrangements, most of which were novel and unique, in 9% of the patients. Thus, our strategy led to the identification of biallelic and monoallelic mutations in 92.7% and 5.8% of the USH patients, respectively. With an overall 98.5% mutation characterization rate, the diagnosis efficiency was substantially improved compared with previously reported methods.

  7. Defects in dilute nitrides

    International Nuclear Information System (INIS)

    Chen, W.M.; Buyanova, I.A.; Tu, C.W.; Yonezu, H.

    2005-01-01

    We provide a brief review our recent results from optically detected magnetic resonance studies of grown-in non-radiative defects in dilute nitrides, i.e. Ga(In)NAs and Ga(Al,In)NP. Defect complexes involving intrinsic defects such as As Ga antisites and Ga i self interstitials were positively identified.Effects of growth conditions, chemical compositions and post-growth treatments on formation of the defects are closely examined. These grown-in defects are shown to play an important role in non-radiative carrier recombination and thus in degrading optical quality of the alloys, harmful to performance of potential optoelectronic and photonic devices based on these dilute nitrides. (author)

  8. Defect Characterization of Pyroelectric Materials

    National Research Council Canada - National Science Library

    Keeble, David

    2002-01-01

    Two methods for identify point defects applicable to the study of technologically relevant pyroelectric oxide materials have been investigated, namely Positron Annihilation Lifetime Spectroscopy (PALS...

  9. A Network Biology Approach Identifies Molecular Cross-Talk between Normal Prostate Epithelial and Prostate Carcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Victor Trevino

    2016-04-01

    Full Text Available The advent of functional genomics has enabled the genome-wide characterization of the molecular state of cells and tissues, virtually at every level of biological organization. The difficulty in organizing and mining this unprecedented amount of information has stimulated the development of computational methods designed to infer the underlying structure of regulatory networks from observational data. These important developments had a profound impact in biological sciences since they triggered the development of a novel data-driven investigative approach. In cancer research, this strategy has been particularly successful. It has contributed to the identification of novel biomarkers, to a better characterization of disease heterogeneity and to a more in depth understanding of cancer pathophysiology. However, so far these approaches have not explicitly addressed the challenge of identifying networks representing the interaction of different cell types in a complex tissue. Since these interactions represent an essential part of the biology of both diseased and healthy tissues, it is of paramount importance that this challenge is addressed. Here we report the definition of a network reverse engineering strategy designed to infer directional signals linking adjacent cell types within a complex tissue. The application of this inference strategy to prostate cancer genome-wide expression profiling data validated the approach and revealed that normal epithelial cells exert an anti-tumour activity on prostate carcinoma cells. Moreover, by using a Bayesian hierarchical model integrating genetics and gene expression data and combining this with survival analysis, we show that the expression of putative cell communication genes related to focal adhesion and secretion is affected by epistatic gene copy number variation and it is predictive of patient survival. Ultimately, this study represents a generalizable approach to the challenge of deciphering cell

  10. Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity.

    Directory of Open Access Journals (Sweden)

    Guan-Feng Wang

    2015-02-01

    Full Text Available Plant disease resistance is often mediated by nucleotide binding-leucine rich repeat (NLR proteins which remain auto-inhibited until recognition of specific pathogen-derived molecules causes their activation, triggering a rapid, localized cell death called a hypersensitive response (HR. Three domains are recognized in one of the major classes of NLR proteins: a coiled-coil (CC, a nucleotide binding (NB-ARC and a leucine rich repeat (LRR domains. The maize NLR gene Rp1-D21 derives from an intergenic recombination event between two NLR genes, Rp1-D and Rp1-dp2 and confers an autoactive HR. We report systematic structural and functional analyses of Rp1 proteins in maize and N. benthamiana to characterize the molecular mechanism of NLR activation/auto-inhibition. We derive a model comprising the following three main features: Rp1 proteins appear to self-associate to become competent for activity. The CC domain is signaling-competent and is sufficient to induce HR. This can be suppressed by the NB-ARC domain through direct interaction. In autoactive proteins, the interaction of the LRR domain with the NB-ARC domain causes de-repression and thus disrupts the inhibition of HR. Further, we identify specific amino acids and combinations thereof that are important for the auto-inhibition/activity of Rp1 proteins. We also provide evidence for the function of MHD2, a previously uncharacterized, though widely conserved NLR motif. This work reports several novel insights into the precise structural requirement for NLR function and informs efforts towards utilizing these proteins for engineering disease resistance.

  11. A Network Biology Approach Identifies Molecular Cross-Talk between Normal Prostate Epithelial and Prostate Carcinoma Cells.

    Science.gov (United States)

    Trevino, Victor; Cassese, Alberto; Nagy, Zsuzsanna; Zhuang, Xiaodong; Herbert, John; Antczak, Philipp; Clarke, Kim; Davies, Nicholas; Rahman, Ayesha; Campbell, Moray J; Guindani, Michele; Bicknell, Roy; Vannucci, Marina; Falciani, Francesco

    2016-04-01

    The advent of functional genomics has enabled the genome-wide characterization of the molecular state of cells and tissues, virtually at every level of biological organization. The difficulty in organizing and mining this unprecedented amount of information has stimulated the development of computational methods designed to infer the underlying structure of regulatory networks from observational data. These important developments had a profound impact in biological sciences since they triggered the development of a novel data-driven investigative approach. In cancer research, this strategy has been particularly successful. It has contributed to the identification of novel biomarkers, to a better characterization of disease heterogeneity and to a more in depth understanding of cancer pathophysiology. However, so far these approaches have not explicitly addressed the challenge of identifying networks representing the interaction of different cell types in a complex tissue. Since these interactions represent an essential part of the biology of both diseased and healthy tissues, it is of paramount importance that this challenge is addressed. Here we report the definition of a network reverse engineering strategy designed to infer directional signals linking adjacent cell types within a complex tissue. The application of this inference strategy to prostate cancer genome-wide expression profiling data validated the approach and revealed that normal epithelial cells exert an anti-tumour activity on prostate carcinoma cells. Moreover, by using a Bayesian hierarchical model integrating genetics and gene expression data and combining this with survival analysis, we show that the expression of putative cell communication genes related to focal adhesion and secretion is affected by epistatic gene copy number variation and it is predictive of patient survival. Ultimately, this study represents a generalizable approach to the challenge of deciphering cell communication networks

  12. Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity.

    Science.gov (United States)

    Wang, Guan-Feng; Ji, Jiabing; El-Kasmi, Farid; Dangl, Jeffery L; Johal, Guri; Balint-Kurti, Peter J

    2015-02-01

    Plant disease resistance is often mediated by nucleotide binding-leucine rich repeat (NLR) proteins which remain auto-inhibited until recognition of specific pathogen-derived molecules causes their activation, triggering a rapid, localized cell death called a hypersensitive response (HR). Three domains are recognized in one of the major classes of NLR proteins: a coiled-coil (CC), a nucleotide binding (NB-ARC) and a leucine rich repeat (LRR) domains. The maize NLR gene Rp1-D21 derives from an intergenic recombination event between two NLR genes, Rp1-D and Rp1-dp2 and confers an autoactive HR. We report systematic structural and functional analyses of Rp1 proteins in maize and N. benthamiana to characterize the molecular mechanism of NLR activation/auto-inhibition. We derive a model comprising the following three main features: Rp1 proteins appear to self-associate to become competent for activity. The CC domain is signaling-competent and is sufficient to induce HR. This can be suppressed by the NB-ARC domain through direct interaction. In autoactive proteins, the interaction of the LRR domain with the NB-ARC domain causes de-repression and thus disrupts the inhibition of HR. Further, we identify specific amino acids and combinations thereof that are important for the auto-inhibition/activity of Rp1 proteins. We also provide evidence for the function of MHD2, a previously uncharacterized, though widely conserved NLR motif. This work reports several novel insights into the precise structural requirement for NLR function and informs efforts towards utilizing these proteins for engineering disease resistance.

  13. A molecular key for building hyphae aggregates: the role of the newly identified Streptomyces protein HyaS.

    Science.gov (United States)

    Koebsch, Ilona; Overbeck, Jens; Piepmeyer, Sophie; Meschke, Holger; Schrempf, Hildgund

    2009-05-01

    Streptomycetes produce many metabolites with medical and biotechnological applications. During fermentations, their hyphae build aggregates, a process in which the newly identified protein HyaS plays an important role. The corresponding hyaS gene is present within all investigated Streptomyces species. Reporter fusions indicate that transcription of hyaS occurs within substrate hyphae of the Streptomyces lividans wild type (WT). The HyaS protein is dominantly associated with the substrate hyphae. The WT strain forms cylindrically shaped clumps of densely packed substrate hyphae, often fusing to higher aggregates (pellets), which remain stably associated during shaking. Investigations by electron microscopy suggest that HyaS induces tight fusion-like contacts among substrate hyphae. In contrast, the pellets of the designed hyaS disruption mutant ΔH are irregular in shape, contain frequently outgrowing bunches of hyphae, and fuse less frequently. ΔH complemented with a plasmid carrying hyaS resembles the WT phenotype. Biochemical studies indicate that the C-terminal region of HyaS has amine oxidase activity. Investigations of ΔH transformants, each carrying a specifically mutated gene, lead to the conclusion that the in situ oxidase activity correlates with the pellet-inducing role of HyaS, and depends on the presence of certain histidine residues. Furthermore, the level of undecylprodigiosin, a red pigment with antibiotic activity, is influenced by the engineered hyaS subtype within a strain. These data present the first molecular basis for future manipulation of pellets, and concomitant production of secondary metabolites during biotechnological processes. © 2009 The Authors. Journal compilation © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.

  14. The molecular signature of impaired diabetic wound healing identifies serpinB3 as a healing biomarker.

    Science.gov (United States)

    Fadini, Gian Paolo; Albiero, Mattia; Millioni, Renato; Poncina, Nicol; Rigato, Mauro; Scotton, Rachele; Boscari, Federico; Brocco, Enrico; Arrigoni, Giorgio; Villano, Gianmarco; Turato, Cristian; Biasiolo, Alessandra; Pontisso, Patrizia; Avogaro, Angelo

    2014-09-01

    Chronic foot ulceration is a severe complication of diabetes, driving morbidity and mortality. The mechanisms underlying delaying wound healing in diabetes are incompletely understood and tools to identify such pathways are eagerly awaited. Wound biopsies were obtained from 75 patients with diabetic foot ulcers. Matched subgroups of rapidly healing (RH, n = 17) and non-healing (NH, n = 11) patients were selected. Proteomic analysis was performed by labelling with isobaric tag for relative and absolute quantification and mass spectrometry. Differentially expressed proteins were analysed in NH vs RH for identification of pathogenic pathways. Individual sample gene/protein validation and in vivo validation of candidate pathways in mouse models were carried out. Pathway analyses were conducted on 92/286 proteins that were differentially expressed in NH vs RH. The following pathways were enriched in NH vs RH patients: apoptosis, protease inhibitors, epithelial differentiation, serine endopeptidase activity, coagulation and regulation of defence response. SerpinB3 was strongly upregulated in RH vs NH wounds, validated as protein and mRNA in individual samples. To test the relevance of serpinB3 in vivo, we used a transgenic mouse model with α1-antitrypsin promoter-driven overexpression of human SERPINB3. In this model, wound healing was unaffected by SERPINB3 overexpression in non-diabetic or diabetic mice with or without hindlimb ischaemia. In an independent validation cohort of 47 patients, high serpinB3 protein content was confirmed as a biomarker of healing improvement. We provide a benchmark for the unbiased discovery of novel molecular targets and biomarkers of impaired diabetic wound healing. High serpinB3 protein content was found to be a biomarker of successful healing in diabetic patients.

  15. Who named the quantum defect?

    International Nuclear Information System (INIS)

    Rau, A.R.P.; Inokuti, M.

    1997-01-01

    The notion of the quantum defect is important in atomic and molecular spectroscopy and also in unifying spectroscopy with collision theory. In the latter context, the quantum defect may be viewed as an ancestor of the phase shift. However, the origin of the term quantum defect does not seem to be explained in standard textbooks. It occurred in a 1921 paper by Schroedinger, preceding quantum mechanics, yet giving the correct meaning as an index of the short-range interactions with the core of an atom. The authors present the early history of the quantum-defect idea, and sketch its recent developments

  16. Computer simulation of defect cluster

    Energy Technology Data Exchange (ETDEWEB)

    Kuramoto, Eiichi [Kyushu Univ., Kasuga, Fukuoka (Japan). Research Inst. for Applied Mechanics

    1996-04-01

    In order to elucidate individual element process of various defects and defect clusters of used materials under irradiation environments, interatomic potential with reliability was investigated. And for comparison with experimental results, it is often required to adopt the temperature effect and to investigate in details mechanism of one dimensional motion of micro conversion loop and so forth using the molecular dynamic (MD) method. Furthermore, temperature effect is also supposed for stable structure of defects and defect clusters, and many problems relating to alloy element are also remained. And, simulation on photon life at the defects and defect clusters thought to be important under comparison with equipment can also be supposed an improvement of effectiveness due to relation to theses products. In this paper, some topics in such flow was extracted to explain them. In particular, future important problems will be potential preparation of alloy, structure, dynamic behavior and limited temperature of intralattice atomic cluster. (G.K.)

  17. Integrative genome-wide expression profiling identifies three distinct molecular subgroups of renal cell carcinoma with different patient outcome

    Directory of Open Access Journals (Sweden)

    Beleut Manfred

    2012-07-01

    Full Text Available Abstract Background Renal cell carcinoma (RCC is characterized by a number of diverse molecular aberrations that differ among individuals. Recent approaches to molecularly classify RCC were based on clinical, pathological as well as on single molecular parameters. As a consequence, gene expression patterns reflecting the sum of genetic aberrations in individual tumors may not have been recognized. In an attempt to uncover such molecular features in RCC, we used a novel, unbiased and integrative approach. Methods We integrated gene expression data from 97 primary RCC of different pathologic parameters, 15 RCC metastases as well as 34 cancer cell lines for two-way nonsupervised hierarchical clustering using gene groups suggested by the PANTHER Classification System. We depicted the genomic landscape of the resulted tumor groups by means of Single Nuclear Polymorphism (SNP technology. Finally, the achieved results were immunohistochemically analyzed using a tissue microarray (TMA composed of 254 RCC. Results We found robust, genome wide expression signatures, which split RCC into three distinct molecular subgroups. These groups remained stable even if randomly selected gene sets were clustered. Notably, the pattern obtained from RCC cell lines was clearly distinguishable from that of primary tumors. SNP array analysis demonstrated differing frequencies of chromosomal copy number alterations among RCC subgroups. TMA analysis with group-specific markers showed a prognostic significance of the different groups. Conclusion We propose the existence of characteristic and histologically independent genome-wide expression outputs in RCC with potential biological and clinical relevance.

  18. Photographic guide of selected external defect indicators and associated internal defects in sugar maple

    Science.gov (United States)

    Everette D. Rast; John A. Beaton; David L. Sonderman

    1991-01-01

    To properly classify or grade logs or trees, one must be able to correctly identify defect indicators and assess the effect of the underlying defect on possible end products. This guide assists the individual in identifying the surface defect indicator and shows the progressive stages of the defect throughout its development for sugar maple. Eleven types of external...

  19. Photographic guide of selected external defect indicators and associated internal defects in yellow-poplar

    Science.gov (United States)

    Everette D. Rast; John A. Beaton; David L. Sonderman

    1991-01-01

    To properly classify or grade logs or trees, one must be able to correctly identify defect indicators and assess the effect of the underlying defect on possible end products. This guide assists the individual in identifying the surface defect indicator and shows the progressive stages of the defect throughout its development for yellow-poplar. Twelve types of external...

  20. Photographic guide of selected external defect indicators and associated internal defects in yellow birch

    Science.gov (United States)

    Everette D. Rast; John A. Beaton; David L. Sonderman

    1991-01-01

    To properly classify or grade logs or trees, one must be able to correctly identify defect indicators and assess the effect of the underlying defect on possible end products. This guide assists the individual in identifying the surface defect indicator and shows the progressive stages of the defect throughout its development for yellow birch. Eleven types of external...

  1. Defects and defect processes in nonmetallic solids

    CERN Document Server

    Hayes, W

    2004-01-01

    This extensive survey covers defects in nonmetals, emphasizing point defects and point-defect processes. It encompasses electronic, vibrational, and optical properties of defective solids, plus dislocations and grain boundaries. 1985 edition.

  2. Value of transmission electron microscopy for primary ciliary dyskinesia diagnosis in the era of molecular medicine: Genetic defects with normal and non-diagnostic ciliary ultrastructure.

    Science.gov (United States)

    Shapiro, Adam J; Leigh, Margaret W

    2017-01-01

    Primary ciliary dyskinesia (PCD) is a genetic disorder causing chronic oto-sino-pulmonary disease. No single diagnostic test will detect all PCD cases. Transmission electron microscopy (TEM) of respiratory cilia was previously considered the gold standard diagnostic test for PCD, but 30% of all PCD cases have either normal ciliary ultrastructure or subtle changes which are non-diagnostic. These cases are identified through alternate diagnostic tests, including nasal nitric oxide measurement, high-speed videomicroscopy analysis, immunofluorescent staining of axonemal proteins, and/or mutation analysis of various PCD causing genes. Autosomal recessive mutations in DNAH11 and HYDIN produce normal TEM ciliary ultrastructure, while mutations in genes encoding for radial spoke head proteins result in some cross-sections with non-diagnostic alterations in the central apparatus interspersed with normal ciliary cross-sections. Mutations in nexin link and dynein regulatory complex genes lead to a collection of different ciliary ultrastructures; mutations in CCDC65, CCDC164, and GAS8 produce normal ciliary ultrastructure, while mutations in CCDC39 and CCDC40 cause absent inner dynein arms and microtubule disorganization in some ciliary cross-sections. Mutations in CCNO and MCIDAS cause near complete absence of respiratory cilia due to defects in generation of multiple cellular basal bodies; however, the scant cilia generated may have normal ultrastructure. Lastly, a syndromic form of PCD with retinal degeneration results in normal ciliary ultrastructure through mutations in the RPGR gene. Clinicians must be aware of these genetic causes of PCD resulting in non-diagnostic TEM ciliary ultrastructure and refrain from using TEM of respiratory cilia as a test to rule out PCD.

  3. Various Stone-Wales defects in phagraphene

    Science.gov (United States)

    Openov, L. A.; Podlivaev, A. I.

    2016-08-01

    Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.

  4. Molecular grading of tumors of the upper urothelial tract using FGFR3 mutation status identifies patients with favorable prognosis

    OpenAIRE

    Fernandez, Cecilia; Lyle,Stephen; Hsieh,; Shuber,Anthony

    2012-01-01

    Stephen R Lyle,1 Chung-Cheng Hsieh,1 Cecilia A Fernandez,2 Anthony P Shuber21University of Massachusetts, Worcester, MA, 2Predictive Biosciences Inc., Lexington, MA, USABackground: Mutations in FGFR3 have been shown to occur in tumors of the upper urothelial tract and may be indicative of a good prognosis. In bladder tumors, the combination of FGFR3 mutation status and Ki-67 level has been used to define a tumor's molecular grade and predict survival. Pathological evaluation of upper ...

  5. Molecular fingerprinting of the myxozoan community in common carp suffering Swim Bladder Inflammation (SBI) identifies multiple etiological agents

    Czech Academy of Sciences Publication Activity Database

    Holzer, Astrid S.; Hartigan, Ashlie; Patra, Sneha; Pecková, Hana; Eszterbauer, E.

    2014-01-01

    Roč. 7, AUG 28 2014 (2014), s. 398 ISSN 1756-3305 R&D Projects: GA AV ČR(CZ) M200961205; GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : Cyprinus carpio carpio * swim bladder inflammation * fish disease * Myxozoa * molecular diagnostic * rDNA * in situ hybridisation Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.430, year: 2014

  6. A Phylogenomic Census of Molecular Functions Identifies Modern Thermophilic Archaea as the Most Ancient Form of Cellular Life

    Directory of Open Access Journals (Sweden)

    Arshan Nasir

    2014-01-01

    Full Text Available The origins of diversified life remain mysterious despite considerable efforts devoted to untangling the roots of the universal tree of life. Here we reconstructed phylogenies that described the evolution of molecular functions and the evolution of species directly from a genomic census of gene ontology (GO definitions. We sampled 249 free-living genomes spanning organisms in the three superkingdoms of life, Archaea, Bacteria, and Eukarya, and used the abundance of GO terms as molecular characters to produce rooted phylogenetic trees. Results revealed an early thermophilic origin of Archaea that was followed by genome reduction events in microbial superkingdoms. Eukaryal genomes displayed extraordinary functional diversity and were enriched with hundreds of novel molecular activities not detected in the akaryotic microbial cells. Remarkably, the majority of these novel functions appeared quite late in evolution, synchronized with the diversification of the eukaryal superkingdom. The distribution of GO terms in superkingdoms confirms that Archaea appears to be the simplest and most ancient form of cellular life, while Eukarya is the most diverse and recent.

  7. A phylogenomic census of molecular functions identifies modern thermophilic archaea as the most ancient form of cellular life.

    Science.gov (United States)

    Nasir, Arshan; Kim, Kyung Mo; Caetano-Anollés, Gustavo

    2014-01-01

    The origins of diversified life remain mysterious despite considerable efforts devoted to untangling the roots of the universal tree of life. Here we reconstructed phylogenies that described the evolution of molecular functions and the evolution of species directly from a genomic census of gene ontology (GO) definitions. We sampled 249 free-living genomes spanning organisms in the three superkingdoms of life, Archaea, Bacteria, and Eukarya, and used the abundance of GO terms as molecular characters to produce rooted phylogenetic trees. Results revealed an early thermophilic origin of Archaea that was followed by genome reduction events in microbial superkingdoms. Eukaryal genomes displayed extraordinary functional diversity and were enriched with hundreds of novel molecular activities not detected in the akaryotic microbial cells. Remarkably, the majority of these novel functions appeared quite late in evolution, synchronized with the diversification of the eukaryal superkingdom. The distribution of GO terms in superkingdoms confirms that Archaea appears to be the simplest and most ancient form of cellular life, while Eukarya is the most diverse and recent.

  8. Defects in new protective aprons

    International Nuclear Information System (INIS)

    Glaze, S.; LeBlanc, A.D.; Bushong, S.C.

    1984-01-01

    Upon careful examination, several defects have been detected in new protective aprons. The nature of the defects is identified and described. Although the occurrence of such defects has not exceeded 5%, they are significant enough to warrant return of the lead apron to the supplier. It is recommended that the integrity of all new protective aprons be verified upon receipt as well as at yearly intervals

  9. Evaluation of serological and molecular tests used to identify Toxoplasma gondii infection in pregnant women attended in a public health service in São Paulo state, Brazil.

    Science.gov (United States)

    Murata, Fernando Henrique Antunes; Ferreira, Marina Neves; Pereira-Chioccola, Vera Lucia; Spegiorin, Lígia Cosentino Junqueira Franco; Meira-Strejevitch, Cristina da Silva; Gava, Ricardo; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

    2017-09-01

    Toxoplasmosis during pregnancy can have severe consequences. The use of sensitive and specific serological and molecular methods is extremely important for the correct diagnosis of the disease. We compared the ELISA and ELFA serological methods, conventional PCR (cPCR), Nested PCR and quantitative PCR (qPCR) in the diagnosis of Toxoplasma gondii infection in pregnant women without clinical suspicion of toxoplasmosis (G1=94) and with clinical suspicion of toxoplasmosis (G2=53). The results were compared using the Kappa index, and the sensitivity, specificity, positive predictive value and negative predictive value were calculated. The results of the serological methods showed concordance between the ELISA and ELFA methods even though ELFA identified more positive cases than ELISA. Molecular methods were discrepant with cPCR using B22/23 primers having greater sensitivity and lower specificity compared to the other molecular methods. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Integrative Bioinformatic Analysis of Transcriptomic Data Identifies Conserved Molecular Pathways Underlying Ionizing Radiation-Induced Bystander Effects (RIBE

    Directory of Open Access Journals (Sweden)

    Constantinos Yeles

    2017-11-01

    Full Text Available Ionizing radiation-induced bystander effects (RIBE encompass a number of effects with potential for a plethora of damages in adjacent non-irradiated tissue. The cascade of molecular events is initiated in response to the exposure to ionizing radiation (IR, something that may occur during diagnostic or therapeutic medical applications. In order to better investigate these complex response mechanisms, we employed a unified framework integrating statistical microarray analysis, signal normalization, and translational bioinformatics functional analysis techniques. This approach was applied to several microarray datasets from Gene Expression Omnibus (GEO related to RIBE. The analysis produced lists of differentially expressed genes, contrasting bystander and irradiated samples versus sham-irradiated controls. Furthermore, comparative molecular analysis through BioInfoMiner, which integrates advanced statistical enrichment and prioritization methodologies, revealed discrete biological processes, at the cellular level. For example, the negative regulation of growth, cellular response to Zn2+-Cd2+, and Wnt and NIK/NF-kappaB signaling, thus refining the description of the phenotypic landscape of RIBE. Our results provide a more solid understanding of RIBE cell-specific response patterns, especially in the case of high-LET radiations, like α-particles and carbon-ions.

  11. Subtype-Specific Genes that Characterize Subpopulations of Callosal Projection Neurons in Mouse Identify Molecularly Homologous Populations in Macaque Cortex.

    Science.gov (United States)

    Fame, Ryann M; Dehay, Colette; Kennedy, Henry; Macklis, Jeffrey D

    2017-03-01

    Callosal projection neurons (CPN) interconnect the neocortical hemispheres via the corpus callosum and are implicated in associative integration of multimodal information. CPN have undergone differential evolutionary elaboration, leading to increased diversity of cortical neurons-and more extensive and varied connections in neocortical gray and white matter-in primates compared with rodents. In mouse, distinct sets of genes are enriched in discrete subpopulations of CPN, indicating the molecular diversity of rodent CPN. Elements of rodent CPN functional and organizational diversity might thus be present in the further elaborated primate cortex. We address the hypothesis that genes controlling mouse CPN subtype diversity might reflect molecular patterns shared among mammals that arose prior to the divergence of rodents and primates. We find that, while early expression of the examined CPN-enriched genes, and postmigratory expression of these CPN-enriched genes in deep layers are highly conserved (e.g., Ptn, Nnmt, Cited2, Dkk3), in contrast, the examined genes expressed by superficial layer CPN show more variable levels of conservation (e.g., EphA3, Chn2). These results suggest that there has been evolutionarily differential retraction and elaboration of superficial layer CPN subpopulations between mouse and macaque, with independent derivation of novel populations in primates. Together, these data inform future studies regarding CPN subpopulations that are unique to primates and rodents, and indicate putative evolutionary relationships. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Atom Tunneling in the Hydroxylation Process of Taurine/α-Ketoglutarate Dioxygenase Identified by Quantum Mechanics/Molecular Mechanics Simulations.

    Science.gov (United States)

    Álvarez-Barcia, Sonia; Kästner, Johannes

    2017-06-01

    Taurine/α-ketoglutarate dioxygenase is one of the most studied α-ketoglutarate-dependent dioxygenases (αKGDs), involved in several biotechnological applications. We investigated the key step in the catalytic cycle of the αKGDs, the hydrogen transfer process, by a quantum mechanics/molecular mechanics approach (B3LYP/CHARMM22). Analysis of the charge and spin densities during the reaction demonstrates that a concerted mechanism takes place, where the H atom transfer happens simultaneously with the electron transfer from taurine to the Fe═O cofactor. We found the quantum tunneling of the hydrogen atom to increase the rate constant by a factor of 40 at 5 °C. As a consequence, a quite high kinetic isotope effect close to 60 is obtained, which is consistent with the experimental value.

  13. Potential bacterial core species associated with digital dermatitis in cattle herds identified by molecular profiling of interdigital skin samples

    DEFF Research Database (Denmark)

    Weiss Nielsen, Martin; Strube, Mikael Lenz; Isbrand, Anastasia

    2016-01-01

    of different molecular methods. Deep sequencing of the 16S rRNA gene variable regions V1–V2 showed that Treponema, Mycoplasma, Fusobacterium and Porphyromonas were the genera best differentiating the DD samples from the controls. Additional deep sequencing analysis of the most abundant genus, Treponema...... in the epidermal lesions and were present in only a subset of samples. RT-qPCR analysis showed that treponemes were also actively expressing a panel of virulence factors at the site of infection. Our results further support the hypothesis that species belonging to the genus Treponema are major pathogens of DD...... and also provide sufficient clues to motivate additional research into the role of M. fermentans, F. necrophorum and P. levii in the etiology of DD....

  14. What can we learn from Raman Spectroscopy on irradiation-induced defects in UO2?

    International Nuclear Information System (INIS)

    Desgranges, L.; Martin, Ph.; Simon, P.; Guimbretiere, G.; Baldinozzi, G.

    2014-01-01

    Recent results on irradiated UO 2 by Raman spectroscopy evidenced Raman lines that are characteristic of irradiation-induced defects. Three main mechanisms are identified to explain their origin: resonant Raman, formation of new molecular entities, or breakdown in symmetry. Arguments are given to consider breakdown in symmetry as the predominant mechanism. A tentative description of the defects at the origin of this symmetry breakdown is proposed in terms of coordination polyhedrons of uranium. This discussion led us to consider that the Raman defect modes could be related to area with different stoichiometry. (authors)

  15. Characterization of point defects in monolayer arsenene

    Science.gov (United States)

    Liang, Xiongyi; Ng, Siu-Pang; Ding, Ning; Wu, Chi-Man Lawrence

    2018-06-01

    Topological defects that are inevitably found in 2D materials can dramatically affect their properties. Using density functional theory (DFT) calculations and ab initio molecular dynamics (AIMD) method, the structural, thermodynamic, electronic and magnetic properties of six types of typical point defects in arsenene, i.e. the Stone-Wales defect, single and double vacancies and adatoms, were systemically studied. It was found that these defects were all more easily generated in arsenene with lower formation energies than those with graphene and silicene. Stone-Wales defects can be transformed from pristine arsenene by overcoming a barrier of 2.19 eV and single vacancy defects tend to coalesce into double vacancy defects by diffusion. However, a type of adatom defect does not exhibit kinetic stability at room temperature. In addition, SV defects and another type of adatom defect can remarkably affect the electronic and magnetic properties of arsenene, e.g. they can introduce localized states near the Fermi level, as well as a strongly local magnetic moment due to dangling bond and unpaired electron. Furthermore, the simulated scanning tunneling microscopy (STM) and Raman spectroscopy were computed and the types of point defects can be fully characterized by correlating the STM images and Raman spectra to the defective atomistic structures. The results provide significant insights to the effect of defects in arsenene for potential applications, as well as identifications of two helpful tools (STM and Raman spectroscopy) to distinguish the type of defects in arsenene for future experiments.

  16. The familial hyperchylomicronemia syndrome: New insights into underlying genetic defects

    Energy Technology Data Exchange (ETDEWEB)

    Santamarina-Fojo, S.; Brewer, H.B. (National Inst. of Health, Bethesda, MD (United States))

    1991-02-20

    This case history reports the diagnosis of familial hyperchylomicronemia, a rare genetic syndrome inherited as an autosomal recessive trait. It is characterized by severe fasting hypertriglyceridemia and massive accumulations of chylomicrons in plasma. The two major molecular defects in the disease are a deficiency of lipoprotein lipase or of apo C-II. The location of the mutations in the human apolipoprotein (apo) C-II gene are identified.

  17. Molecular characterization and functional analysis of PR-1-like proteins identified from the wheat head blight fungus Fusarium graminearum

    Science.gov (United States)

    The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologues are also found in other eukaryotic kingdoms. Studies on non-plant PR-1-like (PR-1L) proteins have been pursued widely in humans/animals but rarely in filamentous ascomycetes. Here we report the ch...

  18. Embedded defects

    International Nuclear Information System (INIS)

    Barriola, M.; Vachaspati, T.; Bucher, M.

    1994-01-01

    We give a prescription for embedding classical solutions and, in particular, topological defects in field theories which are invariant under symmetry groups that are not necessarily simple. After providing examples of embedded defects in field theories based on simple groups, we consider the electroweak model and show that it contains the Z string and a one-parameter family of strings called the W(α) string. It is argued that although the members of this family are gauge equivalent when considered in isolation, each member becomes physically distinct when multistring configurations are considered. We then turn to the issue of stability of embedded defects and demonstrate the instability of a large class of such solutions in the absence of bound states or condensates. The Z string is shown to be unstable for all values of the Higgs boson mass when θ W =π/4. W strings are also shown to be unstable for a large range of parameters. Embedded monopoles suffer from the Brandt-Neri-Coleman instability. Finally, we connect the electroweak string solutions to the sphaleron

  19. Effects of in-cascade defect clustering on near-term defect evolution

    Energy Technology Data Exchange (ETDEWEB)

    Heinisch, H.L. [Pacific Northwest National Lab., Richland, WA (United States)

    1997-08-01

    The effects of in-cascade defect clustering on the nature of the subsequent defect population are being studied using stochastic annealing simulations applied to cascades generated in molecular dynamics (MD) simulations. The results of the simulations illustrates the strong influence of the defect configuration existing in the primary damage state on subsequent defect evolution. The large differences in mobility and stability of vacancy and interstitial defects and the rapid one-dimensional diffusion of small, glissile interstitial loops produced directly in cascades have been shown to be significant factors affecting the evolution of the defect distribution. In recent work, the effects of initial cluster sizes appear to be extremely important.

  20. Quantum computing with defects

    Science.gov (United States)

    Varley, Joel

    2011-03-01

    The development of a quantum computer is contingent upon the identification and design of systems for use as qubits, the basic units of quantum information. One of the most promising candidates consists of a defect in diamond known as the nitrogen-vacancy (NV-1) center, since it is an individually-addressable quantum system that can be initialized, manipulated, and measured with high fidelity at room temperature. While the success of the NV-1 stems from its nature as a localized ``deep-center'' point defect, no systematic effort has been made to identify other defects that might behave in a similar way. We provide guidelines for identifying other defect centers with similar properties. We present a list of physical criteria that these centers and their hosts should meet and explain how these requirements can be used in conjunction with electronic structure theory to intelligently sort through candidate systems. To elucidate these points, we compare electronic structure calculations of the NV-1 center in diamond with those of several deep centers in 4H silicon carbide (SiC). Using hybrid functionals, we report formation energies, configuration-coordinate diagrams, and defect-level diagrams to compare and contrast the properties of these defects. We find that the NC VSi - 1 center in SiC, a structural analog of the NV-1 center in diamond, may be a suitable center with very different optical transition energies. We also discuss how the proposed criteria can be translated into guidelines to discover NV analogs in other tetrahedrally coordinated materials. This work was performed in collaboration with J. R. Weber, W. F. Koehl, B. B. Buckley, A. Janotti, C. G. Van de Walle, and D. D. Awschalom. This work was supported by ARO, AFOSR, and NSF.

  1. Molecular Defects in Cardiac Myofilament Ca2+-Regulation Due to Cardiomyopathy-Linked Mutations Can Be Reversed by Small Molecules Binding to Troponin.

    Science.gov (United States)

    Sheehan, Alice; Messer, Andrew E; Papadaki, Maria; Choudhry, Afnan; Kren, Vladimír; Biedermann, David; Blagg, Brian; Khandelwal, Anuj; Marston, Steven B

    2018-01-01

    . Many of these compounds were either pure re-couplers or pure desensitizers, indicating these properties are independent; moreover, re-coupling ability could be lost with small changes of compound structure, indicating the possibility of specificity. Small molecules that can re-couple may have therapeutic potential. HIGHLIGHTS - Inherited cardiomyopathies are common diseases that are currently untreatable at a fundamental level and therefore finding a small molecule treatment is highly desirable.- We have identified a molecular level dysfunction common to nearly all mutations: uncoupling of the relationship between troponin I phosphorylation and modulation of myofilament Ca 2+ -sensitivity, essential for normal responses to adrenaline.- We have identified a new class of drugs that are capable of both reducing Ca 2+ -sensitivity and/or recouping the relationship between troponin I phosphorylation and Ca 2+ -sensitivity.- The re-coupling phenomenon can be explained on the basis of a single mechanism that is testable.- Measurements with a wide range of small molecules of varying structures can indicate the critical molecular features required for recoupling and allows the prediction of other potential re-couplers.

  2. Molecular Defects in Cardiac Myofilament Ca2+-Regulation Due to Cardiomyopathy-Linked Mutations Can Be Reversed by Small Molecules Binding to Troponin

    Directory of Open Access Journals (Sweden)

    Alice Sheehan

    2018-03-01

    filaments. Many of these compounds were either pure re-couplers or pure desensitizers, indicating these properties are independent; moreover, re-coupling ability could be lost with small changes of compound structure, indicating the possibility of specificity. Small molecules that can re-couple may have therapeutic potential.HIGHLIGHTS- Inherited cardiomyopathies are common diseases that are currently untreatable at a fundamental level and therefore finding a small molecule treatment is highly desirable.- We have identified a molecular level dysfunction common to nearly all mutations: uncoupling of the relationship between troponin I phosphorylation and modulation of myofilament Ca2+-sensitivity, essential for normal responses to adrenaline.- We have identified a new class of drugs that are capable of both reducing Ca2+-sensitivity and/or recouping the relationship between troponin I phosphorylation and Ca2+-sensitivity.- The re-coupling phenomenon can be explained on the basis of a single mechanism that is testable.- Measurements with a wide range of small molecules of varying structures can indicate the critical molecular features required for recoupling and allows the prediction of other potential re-couplers.

  3. sxtA-Based Quantitative Molecular Assay To Identify Saxitoxin-Producing Harmful Algal Blooms in Marine Waters ▿ †

    Science.gov (United States)

    Murray, Shauna A.; Wiese, Maria; Stüken, Anke; Brett, Steve; Kellmann, Ralf; Hallegraeff, Gustaaf; Neilan, Brett A.

    2011-01-01

    The recent identification of genes involved in the production of the potent neurotoxin and keystone metabolite saxitoxin (STX) in marine eukaryotic phytoplankton has allowed us for the first time to develop molecular genetic methods to investigate the chemical ecology of harmful algal blooms in situ. We present a novel method for detecting and quantifying the potential for STX production in marine environmental samples. Our assay detects a domain of the gene sxtA that encodes a unique enzyme putatively involved in the sxt pathway in marine dinoflagellates, sxtA4. A product of the correct size was recovered from nine strains of four species of STX-producing Alexandrium and Gymnodinium catenatum and was not detected in the non-STX-producing Alexandrium species, other dinoflagellate cultures, or an environmental sample that did not contain known STX-producing species. However, sxtA4 was also detected in the non-STX-producing strain of Alexandrium tamarense, Tasmanian ribotype. We investigated the copy number of sxtA4 in three strains of Alexandrium catenella and found it to be relatively constant among strains. Using our novel method, we detected and quantified sxtA4 in three environmental blooms of Alexandrium catenella that led to STX uptake in oysters. We conclude that this method shows promise as an accurate, fast, and cost-effective means of quantifying the potential for STX production in marine samples and will be useful for biological oceanographic research and harmful algal bloom monitoring. PMID:21841034

  4. sxtA-based quantitative molecular assay to identify saxitoxin-producing harmful algal blooms in marine waters.

    Science.gov (United States)

    Murray, Shauna A; Wiese, Maria; Stüken, Anke; Brett, Steve; Kellmann, Ralf; Hallegraeff, Gustaaf; Neilan, Brett A

    2011-10-01

    The recent identification of genes involved in the production of the potent neurotoxin and keystone metabolite saxitoxin (STX) in marine eukaryotic phytoplankton has allowed us for the first time to develop molecular genetic methods to investigate the chemical ecology of harmful algal blooms in situ. We present a novel method for detecting and quantifying the potential for STX production in marine environmental samples. Our assay detects a domain of the gene sxtA that encodes a unique enzyme putatively involved in the sxt pathway in marine dinoflagellates, sxtA4. A product of the correct size was recovered from nine strains of four species of STX-producing Alexandrium and Gymnodinium catenatum and was not detected in the non-STX-producing Alexandrium species, other dinoflagellate cultures, or an environmental sample that did not contain known STX-producing species. However, sxtA4 was also detected in the non-STX-producing strain of Alexandrium tamarense, Tasmanian ribotype. We investigated the copy number of sxtA4 in three strains of Alexandrium catenella and found it to be relatively constant among strains. Using our novel method, we detected and quantified sxtA4 in three environmental blooms of Alexandrium catenella that led to STX uptake in oysters. We conclude that this method shows promise as an accurate, fast, and cost-effective means of quantifying the potential for STX production in marine samples and will be useful for biological oceanographic research and harmful algal bloom monitoring.

  5. P-N defect in GaNP studied by optically detected magnetic resonance

    International Nuclear Information System (INIS)

    Chen, W.M.; Thinh, N.Q.; Vorona, I.P.; Buyanova, I.A.; Xin, H.P.; Tu, C.W.

    2003-01-01

    We provide experimental evidence for an intrinsic defect in GaNP from optically detected magnetic resonance (ODMR). This defect is identified as a P-N complex, exhibiting hyperfine structure due to interactions with a nuclear spin I=((1)/(2)) of one P atom and also a nuclear spin I=1 due to one N atom. The introduction of the defect is assisted by the incorporation of N within the studied N composition range of up to 3.1%, under non-equilibrium growth conditions during gas-source molecular beam epitaxy. The corresponding ODMR spectrum was found to be isotropic, suggesting an A 1 symmetry of the defect state. The localization of the electron wave function at the P-N defect in GaNP is found to be even stronger than that for the isolated P Ga antisite in its parent binary compound GaP

  6. Molecular analysis of faecal samples from birds to identify potential crop pests and useful biocontrol agents in natural areas.

    Science.gov (United States)

    King, R A; Symondson, W O C; Thomas, R J

    2015-06-01

    Wild habitats adjoining farmland are potentially valuable sources of natural enemies, but also of pests. Here we tested the utility of birds as 'sampling devices', to identify the diversity of prey available to predators and particularly to screen for pests and natural enemies using natural ecosystems as refugia. Here we used PCR to amplify prey DNA from three sympatric songbirds foraging on small invertebrates in Phragmites reedbed ecosystems, namely the Reed Warbler (Acrocephalus scirpaceus), Sedge Warbler (Acrocephalus schoenobaenus) and Cetti's Warbler (Cettia cetti). A recently described general invertebrate primer pair was used for the first time to analyse diets. Amplicons were cloned and sequenced, then identified by reference to the Barcoding of Life Database and to our own sequences obtained from fresh invertebrates. Forty-five distinct prey DNA sequences were obtained from 11 faecal samples, of which 39 could be identified to species or genus. Targeting three warbler species ensured that species-specific differences in prey choice broadened the range of prey taken. Amongst the prey found in reedbeds were major pests (including the tomato moth Lacanobia oleracea) as well as many potentially valuable natural enemies including aphidophagous hoverflies and braconid wasps. Given the mobility of birds, this approach provides a practical way of sampling a whole habitat at once, providing growers with information on possible invasion by locally resident pests and the colonization potential of natural enemies from local natural habitats.

  7. Molecular typing and characterization of a new serotype of human enterovirus (EV-B111) identified in China.

    Science.gov (United States)

    Zhang, Yong; Hong, Mei; Sun, Qiang; Zhu, Shuangli; Tsewang; Li, Xiaolei; Yan, Dongmei; Wang, Dongyan; Xu, Wenbo

    2014-04-01

    Molecular methods, based on sequencing the region encoding the complete VP1 or P1 protein, have enabled the rapid identification of new enterovirus serotypes. In the present study, the complete genome of a newly discovered enterovirus serotype, strain Q0011/XZ/CHN/2000 (hereafter referred to as Q0011), was sequenced and analyzed. The virus, isolated from a stool sample from a patient with acute flaccid paralysis in the Tibet region of China in 2000, was characterized by amplicon sequencing and comparison to a GenBank database of enterovirus nucleotide sequences. The nucleotide sequence encoding the complete VP1 capsid protein is most closely related to the sequences of viruses within the species enterovirus B (EV-B), but is less than 72.1% identical to the homologous sequences of the recognized human enterovirus serotypes, with the greatest homology to EV-B101 and echovirus 32. Moreover, the deduced amino acid sequence of the complete VP1 region is less than 84.7% identical to those of the recognized serotypes, suggesting that the strain is a new serotype of enterovirus within EV-B. The virus was characterized as a new enterovirus type, named EV-B111, by the Picornaviridae Study Group of the International Committee on Taxonomy of Viruses. Low positive rate and titer of neutralizing antibody against EV-B111 were found in the Tibet region of China. Nearly 50% of children ≤5 years had no neutralizing antibody against EV-B111. So the extent of transmission and the exposure of the population to this new EV are very limited. This is the first identification of a new serotype of human enterovirus in China, and strain Q0011 was designated the prototype strain of EV-B111. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Genetic relationships in an international collection of Puccinia horiana isolates based on newly identified molecular markers and demonstration of recombination.

    Science.gov (United States)

    De Backer, M; Bonants, P; Pedley, K F; Maes, M; Roldan-Ruiz, I; Van Bockstaele, E; Heungens, K; van der Lee, T

    2013-11-01

    The obligate biotrophic pathogen Puccinia horiana is the causal agent of chrysanthemum white rust. Although P. horiana is a quarantine organism, it has been able to spread to most chrysanthemum-producing regions in the world since the 1960s; however, the transfer routes are largely obscure. An extremely low level of allelic diversity was observed in a geographically diverse set of eight isolates using complexity reduction of polymorphic sequences (CRoPS) technology. Only 184 of the 16,196 contigs (1.1%) showed one or more single-nucleotide polymorphisms (SNPs). Thirty-two SNPs and one simple-sequence repeat were translated into molecular markers and used to genotype 45 isolates originating from North and South America, Asia, and Europe. In most cases, phylogenetic clustering was related to geographic origin, indicating local establishment. The European isolates mostly grouped in two major populations that may relate to the two historic introductions previously reported. However, evidence of recent geographic transfer was also observed, including transfer events between Europe and South America and between Southeast Asia and Europe. In contrast with the presumed clonal propagation of this microcyclic rust, strong indications of marker recombination were observed, presumably as a result of anastomosis, karyogamy, and somatic meiosis. Recombination and transfer also explain the geographic dispersal of specific markers. A near-to-significant correlation between the genotypic data and previously obtained pathotype data was observed and one marker was associated with the most virulent pathotype group. In combination with a fast SNP detection method, the markers presented here will be helpful tools to further elucidate the transfer pathways and local survival of this pathogen.

  9. Development of a new marker system for identifying the complex members of the low-molecular-weight glutenin subunit gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Zhang, Xiaofei; Liu, Dongcheng; Yang, Wenlong; Liu, Kunfan; Sun, Jiazhu; Guo, Xiaoli; Li, Yiwen; Wang, Daowen; Ling, Hongqing; Zhang, Aimin

    2011-05-01

    Low-molecular-weight glutenin subunits (LMW-GSs) play an important role in determining the bread-making quality of bread wheat. However, LMW-GSs display high polymorphic protein complexes encoded by multiple genes, and elucidating the complex LMW-GS gene family in bread wheat remains challenging. In the present study, using conventional polymerase chain reaction (PCR) with conserved primers and high-resolution capillary electrophoresis, we developed a new molecular marker system for identifying LMW-GS gene family members. Based on sequence alignment of 13 LMW-GS genes previously identified in the Chinese bread wheat variety Xiaoyan 54 and other genes available in GenBank, PCR primers were developed and assigned to conserved sequences spanning the length polymorphism regions of LMW-GS genes. After PCR amplification, 17 DNA fragments in Xiaoyan 54 were detected using capillary electrophoresis. In total, 13 fragments were identical to previously identified LMW-GS genes, and the other 4 were derived from unique LMW-GS genes by sequencing. This marker system was also used to identify LMW-GS genes in Chinese Spring and its group 1 nulli-tetrasomic lines. Among the 17 detected DNA fragments, 4 were located on chromosome 1A, 5 on 1B, and 8 on 1D. The results suggest that this marker system is useful for large-scale identification of LMW-GS genes in bread wheat varieties, and for the selection of desirable LMW-GS genes to improve the bread-making quality in wheat molecular breeding programmes.

  10. Molecular profiling of short-term and long-term surviving patients identifies CD34 mRNA level as prognostic for glioblastoma survival

    DEFF Research Database (Denmark)

    Michaelsen, Signe Regner; Urup, Thomas; Olsen, Lars Rønn

    2018-01-01

    Despite extensive treatment, overall survival (OS) for glioblastoma (GBM) remains poor. A small proportion of patients present long survival over 3 years, but the underlying molecular background separating these long-term survivors (LTS) from short-term survivors (STS) are insufficiently understood....... Accordingly, study aim was to identify independent prognostic biomarkers for survival. Study cohort consisted of 93 primary GBM patients treated with radiation-, chemo- and bevacizumab therapy, among which 14 STS (OS ≤ 12 months) and 6 LTS (OS ≥ 36 months) were identified, all confirmed being IDH wild......-type. RNA expression levels in diagnostic tumor specimen for 792 genes were analyzed by NanoString technology. While no differences were found with regard to GBM subtype between LTS versus STS, comparative analysis of individual genes identified 14 significantly differently expressed candidate genes...

  11. Biochemical and molecular characteristics of patients with organic acidaemias and urea cycle disorders identified through newborn screening.

    Science.gov (United States)

    Barends, M; Pitt, J; Morrissy, S; Tzanakos, N; Boneh, A

    2014-01-01

    In recent years it has become clear that newborn screening (NBS) programmes using tandem mass spectrometry identify "patients" with "classical" inborn errors of metabolism who are asymptomatic. This observation raises issues regarding medicalization of "non-diseases," potentially unnecessary treatment and unnecessary anxiety to parents. This study aims to identify possible markers that may assist in predicting the need for treatment of infants with "classical" organic acidaemias (OA) and urea cycle disorders (UCD) diagnosed through NBS. Medical records of all patients with classical OA and UCD detected through the Victorian NBS programme from February 2002 to January 2014, or diagnosed clinically between 1990 and January 2002 were retrospectively reviewed. Neonatal presentation did not always predict the need for on-going strict treatment. Blood concentrations of amino acids and acyl-carnitines and the changes thereof in follow-up samples correlated with severity in citrullinaemia-I, possibly isovaleric acidaemia but not in argininosuccinic aciduria or propionic acidaemia. Some specific mutations correlate with "attenuated" citrullinaemia-I. Gender may affect clinical outcome in propionic acidaemia. Changes in blood concentration of certain metabolites (amino acids, acyl-carnitines) in the first weeks of life may be predictive of the need for treatment in some disorders but not in others. Mutation analysis may be predictive in some disorders but whether or not this should be considered as second-tier testing in NBS should be discussed separately. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Quantum computing with defects.

    Science.gov (United States)

    Weber, J R; Koehl, W F; Varley, J B; Janotti, A; Buckley, B B; Van de Walle, C G; Awschalom, D D

    2010-05-11

    Identifying and designing physical systems for use as qubits, the basic units of quantum information, are critical steps in the development of a quantum computer. Among the possibilities in the solid state, a defect in diamond known as the nitrogen-vacancy (NV(-1)) center stands out for its robustness--its quantum state can be initialized, manipulated, and measured with high fidelity at room temperature. Here we describe how to systematically identify other deep center defects with similar quantum-mechanical properties. We present a list of physical criteria that these centers and their hosts should meet and explain how these requirements can be used in conjunction with electronic structure theory to intelligently sort through candidate defect systems. To illustrate these points in detail, we compare electronic structure calculations of the NV(-1) center in diamond with those of several deep centers in 4H silicon carbide (SiC). We then discuss the proposed criteria for similar defects in other tetrahedrally coordinated semiconductors.

  13. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  14. Surface Charge-Transfer Doping of Graphene Nanoflakes Containing Double-Vacancy (5-8-5) and Stone-Wales (55-77) Defects through Molecular Adsorption.

    Science.gov (United States)

    Shakourian-Fard, Mehdi; Jamshidi, Zahra; Kamath, Ganesh

    2016-10-18

    The adsorption of six electron donor-acceptor (D/A) organic molecules on various sizes of graphene nanoflakes (GNFs) containing two common defects, double-vacancy (5-8-5) and Stone-Wales (55-77), are investigated by means of ab initio DFT [M06-2X(-D3)/cc-pVDZ]. Different D/A molecules adsorb on a defect graphene (DG) surface with binding energies (ΔE b ) of about -12 to -28 kcal mol -1 . The ΔE b values for adsorption of molecules on the Stone-Wales GNF surface are higher than those on the double vacancy GNF surface. Moreover, binding energies increase by about 10 % with an increase in surface size. The nature of cooperative weak interactions is analyzed based on quantum theory of atoms in molecules, noncovalent interactions plot, and natural bond order analyses, and the dominant interaction is compared for different molecules. Electron density population analysis is used to explain the n- and p-type character of defect graphene nanoflakes (DGNFs) and also the change in electronic properties and reactivity parameters of DGNFs upon adsorption of different molecules and with increasing DGNF size. Results indicate that the HOMO-LUMO energy gap (E g ) of DGNFs decreases upon adsorption of molecules. However, by increasing the size of DGNFs, the E g and chemical hardness of all complexes decrease and the electrophilicity index increases. Furthermore, the values of the chemical potential of acceptor-DGNF complexes decrease with increasing size, whereas those of donor-DGNF complexes increase. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Study of reactive collisions between electrons and molecular cations using multichannel quantum defect theory: Application to HD{sup +} and BeH{sup +}

    Energy Technology Data Exchange (ETDEWEB)

    Pop, N., E-mail: nicolina.pop@upt.ro; Ilie, S. [Politehnica University of Timişoara, Department of Physical Foundation of Engineering, Vasile Pârvan Blvd., 300223 Timisoara (Romania); Motapon, O.; Epée, M. D. Epée [Physics Department, University of Douala, P. O. Box 24157, Douala (Cameroon); Niyonzima, S. [Laboratoire Ondes and Milieux Complexes CNRS- UMR-6294, Université du Havre, 76058, Le Havre, France and Département de Physique, Faculté des Sciences, Université du Burundi, B.P. 2700 Bujumbura (Burundi); Mezei, J. Zs. [Laboratoire Ondes and Milieux Complexes CNRS- UMR-6294, Université du Havre, 76058, Le Havre (France); Laboratoire Aimé-Cotton CNRS-UPR-3321, Université Paris-Sud, F-91405 Orsay (France); Institute of Nuclear Research of the Hung (Hungary); Chakrabarti, K. [Dept. of Mathematics, Scottish Church College, 1 and 3 Urquhart Sq., Kolkata 700 006 (India); Schneider, I. F. [Laboratoire Ondes and Milieux Complexes CNRS- UMR-6294, Université du Havre, 76058, Le Havre (France)

    2014-11-24

    The present work is aimed at performing the computation of cross sections and Maxwell rate coefficients in the framework of the stepwise version of the Multichannel Quantum Defect Theory (MQDT). Cross sections and rate coefficients suitable for the modelling of the kinetics of HD{sup +} and BeH{sup +} in fusion plasmas and in the stellar atmospheres are presented and discussed. A very good agreement is found between our results for rotational transitions for HD{sup +} and other computations, as well as with experiment.

  16. Molecular characterization of an unauthorized genetically modified Bacillus subtilis production strain identified in a vitamin B2 feed additive.

    Science.gov (United States)

    Paracchini, Valentina; Petrillo, Mauro; Reiting, Ralf; Angers-Loustau, Alexandre; Wahler, Daniela; Stolz, Andrea; Schönig, Birgit; Matthies, Anastasia; Bendiek, Joachim; Meinel, Dominik M; Pecoraro, Sven; Busch, Ulrich; Patak, Alex; Kreysa, Joachim; Grohmann, Lutz

    2017-09-01

    Many food and feed additives result from fermentation of genetically modified (GM) microorganisms. For vitamin B2 (riboflavin), GM Bacillus subtilis production strains have been developed and are often used. The presence of neither the GM strain nor its recombinant DNA is allowed for fermentation products placed on the EU market as food or feed additive. A vitamin B 2 product (80% feed grade) imported from China was analysed. Viable B. subtilis cells were identified and DNAs of two bacterial isolates (LHL and LGL) were subjected to three whole genome sequencing (WGS) runs with different devices (MiSeq, 454 or HiSeq system). WGS data revealed the integration of a chloramphenicol resistance gene, the deletion of the endogenous riboflavin (rib) operon and presence of four putative plasmids harbouring rib operons. Event- and construct-specific real-time PCR methods for detection of the GM strain and its putative plasmids in food and feed products have been developed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, Rikke L. V.; Oettinger, Thomas; Rosenkrands, Ida

    2000-01-01

    . The molecules were characterized, mapped in a two-dimensional electrophoresis reference map of short-term culture filtrate, and compared with another recently identified low-mass protein, CFP10 (F. X. Berthet, P, B. Rasmussen, I. Rosenkrands, P. Andersen, and B. Gicquel. Microbiology 144:3195-3203, 1998......), and the well-described ESAT-6 antigen. Genetic analyses demonstrated that TB10.4 as well as CFP10 belongs to the ESAT-6 family of low-mass proteins, whereas TB7.3 is a low-molecular-mass protein outside this family. The proteins were expressed in Escherichia coli, and their immunogenicity was tested...

  18. Diet of pumas (Puma concolor) in Sonora, Mexico, as determined by GPS kill sites and molecular identified scat, with comments on jaguar (Panthera onca) diet

    Science.gov (United States)

    Cassaigne, Ivonne; Medellin, Rodrigo A.; Thompson, Ron W.; Culver, Melanie; Ochoa, Alexander; Vargas, Karla; Childs, Jack L.; Sanderson, Jim; List, Rurik; Torres-Gomez, Armando

    2016-01-01

    We documented puma (Puma concolor) and jaguar (Panthera onca) prey consumption in northeastern Sonora, Mexico, by investigating global positioning system cluster sites (n = 220), and conducting molecular analyses of scat (n = 116) collected between 2011 and 2013. We used camera trap data (n = 8,976 camera days) to estimate relative abundances of pumas and jaguars. Deer (Odocoileus virginianus) was the most frequent prey for puma found at kill sites (67%) and identified from scat (74%), although based on relative numbers of prey consumed, deer represented 45% and lagomorphs 20% of the proportion of all individuals eaten. A variety of small prey (weighing Sonora.

  19. Virtual screening approach to identifying influenza virus neuraminidase inhibitors using molecular docking combined with machine-learning-based scoring function.

    Science.gov (United States)

    Zhang, Li; Ai, Hai-Xin; Li, Shi-Meng; Qi, Meng-Yuan; Zhao, Jian; Zhao, Qi; Liu, Hong-Sheng

    2017-10-10

    In recent years, an epidemic of the highly pathogenic avian influenza H7N9 virus has persisted in China, with a high mortality rate. To develop novel anti-influenza therapies, we have constructed a machine-learning-based scoring function (RF-NA-Score) for the effective virtual screening of lead compounds targeting the viral neuraminidase (NA) protein. RF-NA-Score is more accurate than RF-Score, with a root-mean-square error of 1.46, Pearson's correlation coefficient of 0.707, and Spearman's rank correlation coefficient of 0.707 in a 5-fold cross-validation study. The performance of RF-NA-Score in a docking-based virtual screening of NA inhibitors was evaluated with a dataset containing 281 NA inhibitors and 322 noninhibitors. Compared with other docking-rescoring virtual screening strategies, rescoring with RF-NA-Score significantly improved the efficiency of virtual screening, and a strategy that averaged the scores given by RF-NA-Score, based on the binding conformations predicted with AutoDock, AutoDock Vina, and LeDock, was shown to be the best strategy. This strategy was then applied to the virtual screening of NA inhibitors in the SPECS database. The 100 selected compounds were tested in an in vitro H7N9 NA inhibition assay, and two compounds with novel scaffolds showed moderate inhibitory activities. These results indicate that RF-NA-Score improves the efficiency of virtual screening for NA inhibitors, and can be used successfully to identify new NA inhibitor scaffolds. Scoring functions specific for other drug targets could also be established with the same method.

  20. T cell differentiation stages identified by molecular and immunologic analysis of the T cell receptor complex in childhood lymphoblastic leukemia.

    Science.gov (United States)

    Mirro, J; Kitchingman, G; Behm, F G; Murphy, S B; Goorha, R M

    1987-03-01

    T cell differentiation was investigated by determining the relationship of T cell receptor (Ti) gene rearrangement and transcription to the expression of surface and cytoplasmic T3 antigen using blast cells from five children with acute lymphoblastic leukemia of thymic origin. Patterns of monoclonal antibody (MoAb) reactivity indicated that these cases were representative of the three recognized stages (I, II, III) of human thymocyte development. The T3 antigen, which becomes linked to the Ti to form a functional T cell receptor complex on mature thymocytes, was expressed on the cell surface in two cases (stage III). However, in the remaining three cases that were surface T3 negative (stages I and II), large amounts of T3 were identified in the cytoplasm by immunoperoxidase staining and flow cytometry. Leukemic blasts from all five patients showed rearranged genes encoding the beta-chain portion of the Ti heterodimer. RNA transcripts of Ti beta-chain genes were also evident in lymphoblasts from all five cases, but transcripts coding for the alpha-chain portion of Ti were found only in cases that expressed T3 on the cell surface. Thus the absence of surface T3 (and presumably Ti) coincides with the absence of Ti alpha-chain RNA, suggesting that transcription of alpha-chain genes is a critical regulatory event in the surface expression of the Ti-T3 complex. Leukemic T cells that rearrange and express Ti beta-chain genes but lack Ti alpha-chain messenger RNA (mRNA) may represent a stage of differentiation analogous to pre-B cells, where heavy-chain immunoglobulin (Ig) genes are rearranged and expressed but light-chain Ig genes are not expressed.

  1. Serine biosynthesis and transport defects.

    Science.gov (United States)

    El-Hattab, Ayman W

    2016-07-01

    l-serine is a non-essential amino acid that is biosynthesized via the enzymes phosphoglycerate dehydrogenase (PGDH), phosphoserine aminotransferase (PSAT), and phosphoserine phosphatase (PSP). Besides its role in protein synthesis, l-serine is a potent neurotrophic factor and a precursor of a number of essential compounds including phosphatidylserine, sphingomyelin, glycine, and d-serine. Serine biosynthesis defects result from impairments of PGDH, PSAT, or PSP leading to systemic serine deficiency. Serine biosynthesis defects present in a broad phenotypic spectrum that includes, at the severe end, Neu-Laxova syndrome, a lethal multiple congenital anomaly disease, intermediately, infantile serine biosynthesis defects with severe neurological manifestations and growth deficiency, and at the mild end, the childhood disease with intellectual disability. A serine transport defect resulting from deficiency of the ASCT1, the main transporter for serine in the central nervous system, has been recently described in children with neurological manifestations that overlap with those observed in serine biosynthesis defects. l-serine therapy may be beneficial in preventing or ameliorating symptoms in serine biosynthesis and transport defects, if started before neurological damage occurs. Herein, we review serine metabolism and transport, the clinical, biochemical, and molecular aspects of serine biosynthesis and transport defects, the mechanisms of these diseases, and the potential role of serine therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Nuclear Pasta: Topology and Defects

    Science.gov (United States)

    da Silva Schneider, Andre; Horowitz, Charles; Berry, Don; Caplan, Matt; Briggs, Christian

    2015-04-01

    A layer of complex non-uniform phases of matter known as nuclear pasta is expected to exist at the base of the crust of neutron stars. Using large scale molecular dynamics we study the topology of some pasta shapes, the formation of defects and how these may affect properties of neutron star crusts.

  3. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, R L; Oettinger, T; Rosenkrands, I

    2000-01-01

    Culture filtrate from Mycobacterium tuberculosis contains protective antigens of relevance for the generation of a new antituberculosis vaccine. We have identified two previously uncharacterized M. tuberculosis proteins (TB7.3 and TB10.4) from the highly active low-mass fraction of culture filtrate....... The molecules were characterized, mapped in a two-dimensional electrophoresis reference map of short-term culture filtrate, and compared with another recently identified low-mass protein, CFP10 (F. X. Berthet, P. B. Rasmussen, I. Rosenkrands, P. Andersen, and B. Gicquel. Microbiology 144:3195-3203, 1998......), and the well-described ESAT-6 antigen. Genetic analyses demonstrated that TB10.4 as well as CFP10 belongs to the ESAT-6 family of low-mass proteins, whereas TB7.3 is a low-molecular-mass protein outside this family. The proteins were expressed in Escherichia coli, and their immunogenicity was tested...

  4. Transcriptomic profiling of diverse Aedes aegypti strains reveals increased basal-level immune activation in dengue virus-refractory populations and identifies novel virus-vector molecular interactions.

    Directory of Open Access Journals (Sweden)

    Shuzhen Sim

    Full Text Available Genetic variation among Aedes aegypti populations can greatly influence their vector competence for human pathogens such as the dengue virus (DENV. While intra-species transcriptome differences remain relatively unstudied when compared to coding sequence polymorphisms, they also affect numerous aspects of mosquito biology. Comparative molecular profiling of mosquito strain transcriptomes can therefore provide valuable insight into the regulation of vector competence. We established a panel of A. aegypti strains with varying levels of susceptibility to DENV, comprising both laboratory-maintained strains and field-derived colonies collected from geographically distinct dengue-endemic regions spanning South America, the Caribbean, and Southeast Asia. A comparative genome-wide gene expression microarray-based analysis revealed higher basal levels of numerous immunity-related gene transcripts in DENV-refractory mosquito strains than in susceptible strains, and RNA interference assays further showed different degrees of immune pathway contribution to refractoriness in different strains. By correlating transcript abundance patterns with DENV susceptibility across our panel, we also identified new candidate modulators of DENV infection in the mosquito, and we provide functional evidence for two potential DENV host factors and one potential restriction factor. Our comparative transcriptome dataset thus not only provides valuable information about immune gene regulation and usage in natural refractoriness of mosquito populations to dengue virus but also allows us to identify new molecular interactions between the virus and its mosquito vector.

  5. Genomic, Epigenomic, and Transcriptomic Profiling towards Identifying Omics Features and Specific Biomarkers That Distinguish Uterine Leiomyosarcoma and Leiomyoma at Molecular Levels

    Directory of Open Access Journals (Sweden)

    Tomoko Miyata

    2015-01-01

    Full Text Available Uterine leiomyosarcoma (LMS is the worst malignancy among the gynecologic cancers. Uterine leiomyoma (LM, a benign tumor of myometrial origin, is the most common among women of childbearing age. Because of their similar symptoms, it is difficult to preoperatively distinguish the two conditions only by ultrasound and pelvic MRI. While histopathological diagnosis is currently the main approach used to distinguish them postoperatively, unusual histologic variants of LM tend to be misdiagnosed as LMS. Therefore, development of molecular diagnosis as an alternative or confirmatory means will help to diagnose LMS more accurately. We adopted omics-based technologies to identify genome-wide features to distinguish LMS from LM and revealed that copy number, gene expression, and DNA methylation profiles successfully distinguished these tumors. LMS was found to possess features typically observed in malignant solid tumors, such as extensive chromosomal abnormalities, overexpression of cell cycle-related genes, hypomethylation spreading through large genomic regions, and frequent hypermethylation at the polycomb group target genes and protocadherin genes. We also identified candidate expression and DNA methylation markers, which will facilitate establishing postoperative molecular diagnostic tests based on conventional quantitative assays. Our results demonstrate the feasibility of establishing such tests and the possibility of developing preoperative and noninvasive methods.

  6. Advanced molecular and cytogenetic technologies in birth defect diagnosis and prevention%分子和细胞遗传学新技术在出生缺陷诊断及防治中的应用

    Institute of Scientific and Technical Information of China (English)

    Marilyn M. LI

    2005-01-01

    SUMMARY Fluorescence in situ hybridization (FISH) has become an important diagnostic tool as an adjunct to classical cytogenetics. FISH utilizes DNA probes comprised of specific nucleic acid sequences tagged with fluorescent molecules to identify the number and location of specific DNA sequences in human cells. These probes can be used to determine various numerical and structural chromosomal aberrations, in many cases, gene dosage and/or structure alterations. Chromosomal abnormalities are responsible for a considerable number of birth defects, and more than 50% of spontaneous abortions. These numbers have been significantly higher since the advent of FISH technology that allows the detection of submicroscopic chromosome alterations. The clinic application of FISH technology in postnatal, prenatal, and preimplantation diagnoses has been playing an important role in the diagnosis and prevention of birth defects. As new technologies evolve, more and more new FISH techniques - such as subtelomeric FISH, multicolor FISH (M-FISH), comparative genomic hybridization (CGH), and microarray - are used in clinical diagnoses, the role of FISH technology in both research and clinical aspects of birth defects will surely continue to expand.

  7. Two different molecular defects in the Tva receptor gene explain the resistance of two tvar lines of chickens to infection by subgroup A avian sarcoma and leukosis viruses

    Czech Academy of Sciences Publication Activity Database

    Elleder, Daniel; Melder, D. C.; Trejbalová, Kateřina; Svoboda, Jan; Federspiel, M.

    2004-01-01

    Roč. 78, č. 24 (2004), s. 13489-13500 ISSN 0022-538X R&D Projects: GA ČR GA523/04/0489; GA AV ČR KSK5011112 Institutional research plan: CEZ:AV0Z5052915 Keywords : ASLV * retrovirus receptor Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.398, year: 2004

  8. Association between the European GWAS-identified susceptibility locus at chromosome 4p16 and the risk of atrial septal defect: a case-control study in Southwest China and a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Li Zhao

    Full Text Available Atrial septal defect (ASD is the third most frequent type of congenital heart anomaly, featuring shunting of blood between the two atria. Gene-environment interaction remains to be an acknowledged cause for ASD occurrence. A recent European genome-wide association study (GWAS of congenital heart disease (CHD identified 3 susceptibility SNPs at chromosome 4p16 associated with ASD: rs870142, rs16835979 and rs6824295. A Chinese-GWAS of CHD conducted in the corresponding period did not reveal the 3 susceptibility SNPs, but reported 2 different risk SNPs: rs2474937 and rs1531070. Therefore, we aimed to investigate the associations between the 3 European GWAS-identified susceptibility SNPs and ASD risk in the Han population in southwest China. Additionally, to increase the robustness of our current analysis, we conducted a meta-analysis combining published studies and our current case-control study. We performed association, linkage disequilibrium, and haplotype analysis among the 3 SNPs in 190 ASD cases and 225 age-, sex-, and ethnicity-matched healthy controls. Genotype and allele frequencies among the 3 SNPs showed statistically significant differences between the cases and controls. Our study found that individuals carrying the allele T of rs870142, the allele A of rs16835979, and the allele T of rs6824295 had a respective 50.1% (odds ratio (OR = 1.501, 95% confidence interval (CI = 1.122-2.009, PFDR-BH = 0.018, 48.5% (OR = 1.485, 95%CI = 1.109-1.987, PFDR-BH = 0.012, and 38.6% (OR = 1.386, 95%CI = 1.042-1.844, PFDR-BH = 0.025 increased risk to develop ASD than wild-type allele carriers in our study cohort. In the haplotype analysis, we identified a disease-risk haplotype (TAT (OR = 1.540, 95%CI = 1.030-2.380, PFDR-BH = 0.016. Our meta-analysis also showed that the investigated SNP was associated with ASD risk (combined OR (95%CI = 1.35 (1.24-1.46, P < 0.00001. Our study provides compelling evidence to motivate better understanding of the etiology

  9. Reduced defect densities in the ZnO epilayer grown on Si substrates by laser-assisted molecular-beam epitaxy using a ZnS epitaxial buffer layer

    International Nuclear Information System (INIS)

    Onuma, T.; Chichibu, S.F.; Uedono, A.; Yoo, Y.-Z.; Chikyow, T.; Sota, T.; Kawasaki, M.; Koinuma, H.

    2004-01-01

    Nonradiative photoluminescence (PL) lifetime (τ nr ) and point defect density in the (0001) ZnO epilayer grown on (111) Si substrates by laser-assisted molecular-beam epitaxy (L-MBE) using a (0001) ZnS epitaxial buffer layer were compared with those in the ZnO films on (111) and (001) Si substrates prepared by direct transformation of ZnS epilayers on Si by thermal oxidation [Yoo et al., Appl. Phys. Lett. 78, 616 (2001)]. Both the ZnO films exhibited excitonic reflectance anomalies and corresponding PL peaks at low temperature, and the density or size of vacancy-type point defects (Zn vacancies), which were measured by the monoenergetic positron annihilation measurement, in the L-MBE epilayer was lower than that in the films prepared by the oxidation transformation. The ZnO epilayer grown on a (0001) ZnS epitaxial buffer on (111) Si exhibited longer τ nr of 105 ps at room temperature

  10. A study of defects in diamond

    International Nuclear Information System (INIS)

    Hunt, D.C.

    1999-01-01

    Defects, intrinsic and extrinsic, in natural and synthetic diamond, have been studied using Electron Paramagnetic Resonance (EPR) and optical absorption techniques. EPR measurements have been used in conjunction with infrared absorption to identify the defect-induced one-phonon infrared spectra produced by ionised single substitutional nitrogen, N s + . This N s + spectrum is characterised by a sharp peak at the Raman energy, 1332 cm -1 , accompanied by several broader resonances at 950(5), 1050(5), and 1095(5) cm -1 . Detailed concentration measurements show that a concentration of 5.5(5) ppm gives rise to an absorption of 1 cm -1 at 1332 cm -1 . The optical absorption band ND1, identified as the negative vacancy (V - ), is frequently used by diamond spectroscopists to measure the concentration of V - . Isoya has identified V - in the EPR spectra of irradiated diamond. The accuracy of EPR in determining concentrations, has been used to correlate the integrated absorption of the ND1 zero-phonon line to the concentration of V - centres. The parameter derived from this correlation is ∼16 times smaller than the previously accepted value obtained by indirect methods. A systematic study has been made - using EPR and optical absorption techniques - of synthetic type IIa diamonds, which have been irradiated with 2 MeV electrons in a specially developed dewar, allowing irradiation down to a measured sample temperature of 100K. Measurement of defect creation rates of the neutral vacancy and EPR defects, show a radical difference in the production rate of the EPR defect R2 between irradiation with the sample held at 100K and 350K. At 100K its production rate is 1.1(1) cm -1 , ∼10 times greater that at 350K. Observation of the di- -split interstitial (Ri) after irradiation at 100K proves the self-interstitial in diamond must be mobile at 100K, under the conditions of irradiation. Further study of the properties of the R2 defect (the most dominant EPR after electron

  11. Informing Antibiotic Treatment Decisions: Evaluating Rapid Molecular Diagnostics To Identify Susceptibility and Resistance to Carbapenems against Acinetobacter spp. in PRIMERS III.

    Science.gov (United States)

    Evans, Scott R; Hujer, Andrea M; Jiang, Hongyu; Hill, Carol B; Hujer, Kristine M; Mediavilla, Jose R; Manca, Claudia; Tran, Thuy Tien T; Domitrovic, T Nicholas; Higgins, Paul G; Seifert, Harald; Kreiswirth, Barry N; Patel, Robin; Jacobs, Michael R; Chen, Liang; Sampath, Rangarajan; Hall, Thomas; Marzan, Christine; Fowler, Vance G; Chambers, Henry F; Bonomo, Robert A

    2017-01-01

    The widespread dissemination of carbapenem-resistant Acinetobacter spp. has created significant therapeutic challenges. At present, rapid molecular diagnostics (RMDs) that can identify this phenotype are not commercially available. Two RMD platforms, PCR combined with electrospray ionization mass spectrometry (PCR/ESI-MS) and molecular beacons (MB), for detecting genes conferring resistance/susceptibility to carbapenems in Acinetobacter spp. were evaluated. An archived collection of 200 clinical Acinetobacter sp. isolates was tested. Predictive values for susceptibility and resistance were estimated as a function of susceptibility prevalence and were based on the absence or presence of beta-lactamase (bla) NDM, VIM, IMP, KPC, and OXA carbapenemase genes (e.g., bla OXA-23 , bla OXA-24/40 , and bla OXA-58 found in this study) against the reference standard of MIC determinations. According to the interpretation of MICs, 49% (n = 98) of the isolates were carbapenem resistant (as defined by either resistance or intermediate resistance to imipenem). The susceptibility sensitivities (95% confidence interval [CI]) for imipenem were 82% (74%, 89%) and 92% (85%, 97%) for PCR/ESI-MS and MB, respectively. Resistance sensitivities (95% CI) for imipenem were 95% (88%, 98%) and 88% (80%, 94%) for PCR/ESI-MS and MB, respectively. PRIMERS III establishes that RMDs can discriminate between carbapenem resistance and susceptibility in Acinetobacter spp. In the context of a known prevalence of resistance, SPVs and RPVs can inform clinicians regarding the best choice for empiric antimicrobial therapy against this multidrug-resistant pathogen. Copyright © 2016 American Society for Microbiology.

  12. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  13. Therapeutic molecules for multiple human diseases identified from pigeon pea (Cajanus cajan L. Millsp. through GC–MS and molecular docking

    Directory of Open Access Journals (Sweden)

    Deepu Mathew

    2017-12-01

    Full Text Available Molecular mechanism behind the therapeutic potential of pigeon pea over the human diseases such as rheumatoid arthritis, breast cancer, type II diabetes, malaria, measles and sickle cell disease were revealed through docking of GC–MS identified phyto-compound ligands with candidate disease proteins. Of the 242 ligands, three dimensional structures of 47 compounds had to be drawn using ChemSketch and the remaining structures were retrieved from PubChem and docked with the active sites of candidate proteins. The molecules identified through docking were further subjected to ADMET analysis and promising drug candidates were identified for each disease. This paper presents a precise account of the chemoprofile of pigeon pea leaves, stems and seeds, interaction of these molecules with target proteins and suggests 26 highly potential molecules which are drug candidates for multiple human diseases. Pigeon pea seeds are especially proven as invaluable source for therapeutic molecules. Keywords: Breast cancer, Drug discovery, Herbal medicine, In silico, Malaria, Measles, Phyto-compounds, Rheumatoid arthritis, Sickle cell disease, Type II diabetes

  14. Targeting N-Glycan Cryptic Sugar Moieties for Broad-Spectrum Virus Neutralization: Progress in Identifying Conserved Molecular Targets in Viruses of Distinct Phylogenetic Origins

    Directory of Open Access Journals (Sweden)

    Denong Wang

    2015-03-01

    Full Text Available Identifying molecular targets for eliciting broadly virus-neutralizing antibodies is one of the key steps toward development of vaccines against emerging viral pathogens. Owing to genomic and somatic diversities among viral species, identifying protein targets for broad-spectrum virus neutralization is highly challenging even for the same virus, such as HIV-1. However, viruses rely on host glycosylation machineries to synthesize and express glycans and, thereby, may display common carbohydrate moieties. Thus, exploring glycan-binding profiles of broad-spectrum virus-neutralizing agents may provide key information to uncover the carbohydrate-based virus-neutralizing epitopes. In this study, we characterized two broadly HIV-neutralizing agents, human monoclonal antibody 2G12 and Galanthus nivalis lectin (GNA, for their viral targeting activities. Although these agents were known to be specific for oligomannosyl antigens, they differ strikingly in virus-binding activities. The former is HIV-1 specific; the latter is broadly reactive and is able to neutralize viruses of distinct phylogenetic origins, such as HIV-1, severe acute respiratory syndrome coronavirus (SARS-CoV, and human cytomegalovirus (HCMV. In carbohydrate microarray analyses, we explored the molecular basis underlying the striking differences in the spectrum of anti-virus activities of the two probes. Unlike 2G12, which is strictly specific for the high-density Man9GlcNAc2Asn (Man9-clusters, GNA recognizes a number of N-glycan cryptic sugar moieties. These include not only the known oligomannosyl antigens but also previously unrecognized tri-antennary or multi-valent GlcNAc-terminating N-glycan epitopes (Tri/m-Gn. These findings highlight the potential of N-glycan cryptic sugar moieties as conserved targets for broad-spectrum virus neutralization and suggest the GNA-model of glycan-binding warrants focused investigation.

  15. Defect production in Ar irradiated graphene membranes under different initial applied strains

    Energy Technology Data Exchange (ETDEWEB)

    Martinez-Asencio, J., E-mail: jesusmartinez@ua.es [Dept. Física Aplicada, Facultad de Ciencias, Fase II, Universidad de Alicante, Alicante E-036090 (Spain); Ruestes, C.J.; Bringa, E. [CONICET and Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Cuyo, Mendoza 5500 (Argentina); Caturla, M.J. [Dept. Física Aplicada, Facultad de Ciencias, Fase II, Universidad de Alicante, Alicante E-036090 (Spain)

    2017-02-15

    Highlights: • Defects in graphene membranes are formed due to 140 eV Ar ions irradiation using MD. • Different initial strains are applied, which influence the type and number of defects. • Mono-vacancies, di-vacancies and tri-vacancies production behaves linearly with dose. • The total number of defects under compression is slightly higher than under tension. - Abstract: Irradiation with low energy Ar ions of graphene membranes gives rise to changes in the mechanical properties of this material. These changes have been associated to the production of defects, mostly isolated vacancies. However, the initial state of the graphene membrane can also affect its mechanical response. Using molecular dynamics simulations we have studied defect production in graphene membranes irradiated with 140 eV Ar ions up to a dose of 0.075 × 10{sup 14} ions/cm{sup 2} and different initial strains, from −0.25% (compressive strain) to 0.25% (tensile strain). For all strains, the number of defects increases linearly with dose with a defect production of about 80% (80 defects every 100 ions). Defects are mostly single vacancies and di-vacancies, although some higher order clusters are also observed. Two different types of di-vacancies have been identified, the most common one being two vacancies at first nearest neighbours distance. Differences in the total number of defects with the applied strain are observed which is related to the production of a higher number of di-vacancies under compressive strain compared to tensile strain. We attribute this effect to the larger out-of-plane deformations of compressed samples that could favor the production of defects in closer proximity to others.

  16. Facts about Birth Defects

    Science.gov (United States)

    ... label> Information For… Media Policy Makers Facts about Birth Defects Language: English (US) Español (Spanish) Recommend on ... having a baby born without a birth defect. Birth Defects Are Common Every 4 ½ minutes, a ...

  17. Neural Tube Defects

    Science.gov (United States)

    Neural tube defects are birth defects of the brain, spine, or spinal cord. They happen in the ... that she is pregnant. The two most common neural tube defects are spina bifida and anencephaly. In ...

  18. Molecular forensics in avian conservation: a DNA-based approach for identifying mammalian predators of ground-nesting birds and eggs.

    Science.gov (United States)

    Hopken, Matthew W; Orning, Elizabeth K; Young, Julie K; Piaggio, Antoinette J

    2016-01-07

    The greater sage-grouse (Centrocercus urophasianus) is a ground-nesting bird from the Northern Rocky Mountains and a species at risk of extinction in in multiple U.S. states and Canada. Herein we report results from a proof of concept that mitochondrial and nuclear DNAs from mammalian predator saliva could be non-invasively collected from depredated greater sage-grouse eggshells and carcasses and used for predator species identification. Molecular forensic approaches have been applied to identify predators from depredated remains as one strategy to better understand predator-prey dynamics and guide management strategies. This can aid conservation efforts by correctly identifying predators most likely to impact threatened and endangered species. DNA isolated from non-invasive samples around nesting sites (e.g. fecal or hair samples) is one method that can increase the success and accuracy of predator species identification when compared to relying on nest remains alone. Predator saliva DNA was collected from depredated eggshells and carcasses using swabs. We sequenced two partial fragments of two mitochondrial genes and obtained microsatellite genotypes using canid specific primers for species and individual identification, respectively. Using this multilocus approach we were able to identify predators, at least down to family, from 11 out of 14 nests (79%) and three out of seven carcasses (47%). Predators detected most frequently were canids (86%), while other taxa included rodents, a striped skunk, and cattle. We attempted to match the genotypes of individual coyotes obtained from eggshells and carcasses with those obtained from fecal samples and coyotes collected in the areas, but no genotype matches were found. Predation is a main cause of nest failure in ground-nesting birds and can impact reproduction and recruitment. To inform predator management for ground-nesting bird conservation, accurate identification of predator species is necessary. Considering

  19. Genetic analysis of the pedigrees and molecular defects of the GH-receptor gene in the Israeli cohort of patients with Laron syndrome.

    Science.gov (United States)

    Shevah, Orit; Laron, Zvi

    2006-08-01

    Out of the 63 patients with Laron Syndrome ( LS) followed in our clinic we were able to perform a genetic analysis on 43 patients belonging to 28 families. Twenty-seven patients were Jews, eight were Arabs, one was Druze, and six were Caucasians from countries other then Israel. Consanguinity was found in 11 families. Molecular analysis of the growth hormone receptor gene was performed in 32 patients and 32 family members. From the study of the pedigrees, as well as the GH receptor gene analysis, we confirmed an earlier report from our group that LS is a recessively inherited disease. One patient with a classical phenotype of LS had a non-classical pattern of inheritance: R43X heterozygosity together with a heterozygous polymorphism G168G; a condition which needs further exploration.

  20. Theory of Defects in Semiconductors

    CERN Document Server

    Drabold, David A

    2007-01-01

    Semiconductor science and technology is the art of defect engineering. The theoretical modeling of defects has improved dramatically over the past decade. These tools are now applied to a wide range of materials issues: quantum dots, buckyballs, spintronics, interfaces, amorphous systems, and many others. This volume presents a coherent and detailed description of the field, and brings together leaders in theoretical research. Today's state-of-the-art, as well as tomorrow’s tools, are discussed: the supercell-pseudopotential method, the GW formalism,Quantum Monte Carlo, learn-on-the-fly molecular dynamics, finite-temperature treatments, etc. A wealth of applications are included, from point defects to wafer bonding or the propagation of dislocation.

  1. Automatic classification of blank substrate defects

    Science.gov (United States)

    Boettiger, Tom; Buck, Peter; Paninjath, Sankaranarayanan; Pereira, Mark; Ronald, Rob; Rost, Dan; Samir, Bhamidipati

    2014-10-01

    Mask preparation stages are crucial in mask manufacturing, since this mask is to later act as a template for considerable number of dies on wafer. Defects on the initial blank substrate, and subsequent cleaned and coated substrates, can have a profound impact on the usability of the finished mask. This emphasizes the need for early and accurate identification of blank substrate defects and the risk they pose to the patterned reticle. While Automatic Defect Classification (ADC) is a well-developed technology for inspection and analysis of defects on patterned wafers and masks in the semiconductors industry, ADC for mask blanks is still in the early stages of adoption and development. Calibre ADC is a powerful analysis tool for fast, accurate, consistent and automatic classification of defects on mask blanks. Accurate, automated classification of mask blanks leads to better usability of blanks by enabling defect avoidance technologies during mask writing. Detailed information on blank defects can help to select appropriate job-decks to be written on the mask by defect avoidance tools [1][4][5]. Smart algorithms separate critical defects from the potentially large number of non-critical defects or false defects detected at various stages during mask blank preparation. Mechanisms used by Calibre ADC to identify and characterize defects include defect location and size, signal polarity (dark, bright) in both transmitted and reflected review images, distinguishing defect signals from background noise in defect images. The Calibre ADC engine then uses a decision tree to translate this information into a defect classification code. Using this automated process improves classification accuracy, repeatability and speed, while avoiding the subjectivity of human judgment compared to the alternative of manual defect classification by trained personnel [2]. This paper focuses on the results from the evaluation of Automatic Defect Classification (ADC) product at MP Mask

  2. Impact of substrate temperature on the incorporation of carbon-related defects and mechanism for semi-insulating behavior in GaN grown by molecular beam epitaxy

    International Nuclear Information System (INIS)

    Armstrong, A.; Poblenz, C.; Green, D.S.; Mishra, U.K.; Speck, J.S.; Ringel, S.A.

    2006-01-01

    The electrical conductivity and deep level spectrum of GaN grown by molecular beam epitaxy and codoped with carbon and silicon were investigated for substrate temperatures T s of 650 and 720 deg. C as a function relative carbon and silicon doping levels. With sufficiently high carbon doping, semi-insulating behavior was observed for films grown at both temperatures, and growth at T s =720 deg. C enhanced the carbon compensation ratio. Similar carbon-related band gap states were observed via deep level optical spectroscopy for films grown at both substrate temperatures. Due to the semi-insulating nature of the films, a lighted capacitance-voltage technique was required to determine individual deep level concentrations. Carbon-related band gap states underwent substantial redistribution between deep level and shallow acceptor configurations with change in T s . In light of a T s dependence for the preferential site of carbon incorporation, a model of semi-insulating behavior in terms of carbon impurity state incorporation mediated by substrate temperature is proposed

  3. Basal gene expression by lung CD4+ T cells in chronic obstructive pulmonary disease identifies independent molecular correlates of airflow obstruction and emphysema extent.

    Directory of Open Access Journals (Sweden)

    Christine M Freeman

    Full Text Available Lung CD4+ T cells accumulate as chronic obstructive pulmonary disease (COPD progresses, but their role in pathogenesis remains controversial. To address this controversy, we studied lung tissue from 53 subjects undergoing clinically-indicated resections, lung volume reduction, or transplant. Viable single-cell suspensions were analyzed by flow cytometry or underwent CD4+ T cell isolation, followed either by stimulation with anti-CD3 and cytokine/chemokine measurement, or by real-time PCR analysis. In lung CD4+ T cells of most COPD subjects, relative to lung CD4+ T cells in smokers with normal spirometry: (a stimulation induced minimal IFN-γ or other inflammatory mediators, but many subjects produced more CCL2; (b the T effector memory subset was less uniformly predominant, without correlation with decreased IFN-γ production. Analysis of unstimulated lung CD4+ T cells of all subjects identified a molecular phenotype, mainly in COPD, characterized by markedly reduced mRNA transcripts for the transcription factors controlling TH1, TH2, TH17 and FOXP3+ T regulatory subsets and their signature cytokines. This mRNA-defined CD4+ T cell phenotype did not result from global inability to elaborate mRNA; increased transcripts for inhibitory CD28 family members or markers of anergy; or reduced telomerase length. As a group, these subjects had significantly worse spirometry, but not DLCO, relative to subjects whose lung CD4+ T cells expressed a variety of transcripts. Analysis of mRNA transcripts of unstimulated lung CD4+ T cell among all subjects identified two distinct molecular correlates of classical COPD clinical phenotypes: basal IL-10 transcripts correlated independently and inversely with emphysema extent (but not spirometry; by contrast, unstimulated IFN-γ transcripts correlated independently and inversely with reduced spirometry (but not reduced DLCO or emphysema extent. Aberrant lung CD4+ T cells polarization appears to be common in advanced

  4. Molecular and Conventional Analysis of Acute Diarrheal Isolates Identifies Epidemiological Trends, Antibiotic Resistance and Virulence Profiles of Common Enteropathogens in Shanghai

    Directory of Open Access Journals (Sweden)

    Feng Yang

    2018-02-01

    Full Text Available Objective: To investigate prevalence of acute diarrhea in Shanghai and analyze virulence associated-genes and antibiotic resistance of major enteropathogens using combination of conventional and molecular epidemiology methods.Method: The 412 stool specimens were obtained by systematic sampling from diarrhea patients throughout entire year 2016. Bacterial and viral pathogens were identified and bacterial isolates were cultured and screened for antibiotic resistance profiles. Two most prevalent bacteria, Vibrio parahaemolyticus and Salmonella were further typed by multi-locus sequence typing (MLST and analyzed for presence of virulence-associated genes. The association between virulence genes, resistance phenotypes and genetic diversities was analyzed.Results: Among stool specimens testing positive for pathogens (23.1%, 59 bacterial and 36 viral pathogens were identified. V. parahaemolyticus (27/412, 6.6%, Salmonella (23/412, 5.6% and norovirus GII (21/412, 5.1% were three most-commonly found. Most bacterial isolates exhibited high levels of antibiotic resistance with high percentage of MDR. The drug resistance rates of V. parahaemolyticus and Salmonella isolates to cephalosporins were high, such as 100.0 and 34.8% to CFX, 55.6 and 43.4% to CTX, 92.6 and 95.7% to CXM, respectively. The most common resistance combination of V. parahaemolyticus and Salmonella was cephalosporins and quinolone. The dominant sequence types (STs of V. parahaemolyticus and Salmonella were ST3 (70.4% and ST11 (43.5%, respectively. The detection rates of virulence genes in V. parahaemolyticus were tlh (100% and tdh (92.6%, without trh and ureR. Most of the Salmonella isolates were positive for the Salmonella pathogenicity islands (SPIs genes (87–100%, and some for Salmonella plasmid virulence (SPV genes (34.8% for spvA and spvB, 43.5% for spvC. In addition, just like the drug resistance, virulence genes exhibited wide-spread distribution among the different STs albeit

  5. Applying Unique Molecular Identifiers in Next Generation Sequencing Reveals a Constrained Viral Quasispecies Evolution under Cross-Reactive Antibody Pressure Targeting Long Alpha Helix of Hemagglutinin

    Science.gov (United States)

    Hauck, Nastasja C.; Kirpach, Josiane; Kiefer, Christina; Farinelle, Sophie; Morris, Stephen A.; Muller, Claude P.; Lu, I-Na

    2018-01-01

    To overcome yearly efforts and costs for the production of seasonal influenza vaccines, new approaches for the induction of broadly protective and long-lasting immune responses have been developed in the past decade. To warrant safety and efficacy of the emerging crossreactive vaccine candidates, it is critical to understand the evolution of influenza viruses in response to these new immune pressures. Here we applied unique molecular identifiers in next generation sequencing to analyze the evolution of influenza quasispecies under in vivo antibody pressure targeting the hemagglutinin (HA) long alpha helix (LAH). Our vaccine targeting LAH of hemagglutinin elicited significant seroconversion and protection against homologous and heterologous influenza virus strains in mice. The vaccine not only significantly reduced lung viral titers, but also induced a well-known bottleneck effect by decreasing virus diversity. In contrast to the classical bottleneck effect, here we showed a significant increase in the frequency of viruses with amino acid sequences identical to that of vaccine targeting LAH domain. No escape mutant emerged after vaccination. These results not only support the potential of a universal influenza vaccine targeting the conserved LAH domains, but also clearly demonstrate that the well-established bottleneck effect on viral quasispecies evolution does not necessarily generate escape mutants. PMID:29587397

  6. Proteomics Analysis to Identify and Characterize the Molecular Signatures of Hepatic Steatosis in Ovariectomized Rats as a Model of Postmenopausal Status

    Directory of Open Access Journals (Sweden)

    Chen-Chung Liao

    2015-10-01

    Full Text Available Postmenopausal women are particularly at increased risk of developing non-alcoholic fatty liver disease (NAFLD. Here we aimed to determine the impact of postmenopausal-induced NAFLD (PM-NAFLD in an ovariectomized rat model. Sixteen six-week-old Sprague-Dawley female rats were randomly divided into two groups (eight per group, for sham-operation (Sham or bilateral ovariectomy (Ovx. Four months after surgery, indices of liver damage and liver histomorphometry were measured. Both serum aspartate aminotransferase (AST and alanine aminotranferease (ALT levels were significantly higher in the Ovx than Sham group. We performed quantitative LC-MS/MS-based proteomic profiling of livers from rats with PM-NAFLD to provide baseline knowledge of the PM-NAFLD proteome and to investigate proteins involved in PM-NAFLD by ingenuity pathways analysis (IPA to provide corroborative evidence for differential regulation of molecular and cellular functions affecting metabolic processes. Of the 586 identified proteins, the levels of 59 (10.0% and 48 (8.2% were significantly higher and lower, respectively, in the Ovx group compared to the Sham group. In conclusion, the changes in regulation of proteins implicated in PM-NAFLD may affect other vital biological processes in the body apart from causing postmenopause-mediated liver dysfunction. Our quantitative proteomics analysis may also suggest potential biomarkers and further clinical applications for PM-NAFLD.

  7. Integrated molecular analysis of Tamoxifen-resistant invasive lobular breast cancer cells identifies MAPK and GRM/mGluR signaling as therapeutic vulnerabilities.

    Science.gov (United States)

    Stires, Hillary; Heckler, Mary M; Fu, Xiaoyong; Li, Zhao; Grasso, Catherine S; Quist, Michael J; Lewis, Joseph A; Klimach, Uwe; Zwart, Alan; Mahajan, Akanksha; Győrffy, Balázs; Cavalli, Luciane R; Riggins, Rebecca B

    2018-08-15

    Invasive lobular breast cancer (ILC) is an understudied malignancy with distinct clinical, pathological, and molecular features that distinguish it from the more common invasive ductal carcinoma (IDC). Mounting evidence suggests that estrogen receptor-alpha positive (ER+) ILC has a poor response to Tamoxifen (TAM), but the mechanistic drivers of this are undefined. In the current work, we comprehensively characterize the SUM44/LCCTam ILC cell model system through integrated analysis of gene expression, copy number, and mutation, with the goal of identifying actionable alterations relevant to clinical ILC that can be co-targeted along with ER to improve treatment outcomes. We show that TAM has several distinct effects on the transcriptome of LCCTam cells, that this resistant cell model has acquired copy number alterations and mutations that impinge on MAPK and metabotropic glutamate receptor (GRM/mGluR) signaling networks, and that pharmacological inhibition of either improves or restores the growth-inhibitory actions of endocrine therapy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Applying Unique Molecular Identifiers in Next Generation Sequencing Reveals a Constrained Viral Quasispecies Evolution under Cross-Reactive Antibody Pressure Targeting Long Alpha Helix of Hemagglutinin

    Directory of Open Access Journals (Sweden)

    Nastasja C. Hauck

    2018-03-01

    Full Text Available To overcome yearly efforts and costs for the production of seasonal influenza vaccines, new approaches for the induction of broadly protective and long-lasting immune responses have been developed in the past decade. To warrant safety and efficacy of the emerging crossreactive vaccine candidates, it is critical to understand the evolution of influenza viruses in response to these new immune pressures. Here we applied unique molecular identifiers in next generation sequencing to analyze the evolution of influenza quasispecies under in vivo antibody pressure targeting the hemagglutinin (HA long alpha helix (LAH. Our vaccine targeting LAH of hemagglutinin elicited significant seroconversion and protection against homologous and heterologous influenza virus strains in mice. The vaccine not only significantly reduced lung viral titers, but also induced a well-known bottleneck effect by decreasing virus diversity. In contrast to the classical bottleneck effect, here we showed a significant increase in the frequency of viruses with amino acid sequences identical to that of vaccine targeting LAH domain. No escape mutant emerged after vaccination. These results not only support the potential of a universal influenza vaccine targeting the conserved LAH domains, but also clearly demonstrate that the well-established bottleneck effect on viral quasispecies evolution does not necessarily generate escape mutants.

  9. Molecular Cytogenetic Characterization Identified the Murine B-Cell Lymphoma Cell Line A-20 as a Model for Sporadic Burkitt's Lymphoma.

    Science.gov (United States)

    Guja, Karolina; Liehr, Thomas; Rincic, Martina; Kosyakova, Nadezda; Hussein Azawi, Shaymaa S

    2017-11-01

    Here, we report the first molecular cytogenetic characterization of the BALB/cAnN mouse derived B-cell non-Hodgkin lymphoma (B-cell NHL) cell lines A-20. Even though previously used as a model for testing of, for example, dexametason, up to present, no data in the genetic properties of A-20 were available. The present study closed this gap and provides evidence that A-20 is a model for B-cell NHL subgroup sporadic Burkitt's lymphoma. C-myc oncogene is involved in a translocation and copy number alterations as gain of murine 14q material could be observed. Interestingly, the cell line showed the karyotype 39,X,-X or -Y,t(2;15)(qE5;qD2),del(6)(qB3qC3),del(9)(qA3qA4),dup(14)(qE1qE4) in ~95% of the cells, being exceptionally stable for cell lines being established 38 years ago. Still, ~5% of the cells showed polyploidization followed by chromothripsis. It remains to be determined if this can be observed also in other cell lines, just has not been reported yet, and/or if it is a unique feature of A-20. Overall, finally here, the necessary genetic data to identify A-20 as a model for human sporadic Burkitt's lymphoma are provided.

  10. Electrical fingerprint of pipeline defects

    International Nuclear Information System (INIS)

    Mica, Isabella; Polignano, Maria Luisa; Marco, Cinzia De

    2004-01-01

    Pipeline defects are dislocations that connect the source region of the transistor with the drain region. They were widely reported to occur in CMOS, BiCMOS devices and recently in SOI technologies. They can reduce device yield either by affecting the devices functionality or by increasing the current consumption under stand-by conditions. In this work the electrical fingerprint of these dislocations is studied, its purpose is to enable us to identify these defects as the ones responsible for device failure. It is shown that the pipeline defects are responsible for a leakage current from source to drain in the transistors. This leakage has a resistive characteristic and it is lightly modulated by the body bias. It is not sensitive to temperature; vice versa the off-current of a good transistor exhibits the well-known exponential dependence on 1/T. The emission spectrum of these defects was studied and compared with the spectrum of a good transistor. The paper aims to show that the spectrum of a defective transistor is quite peculiar; it shows well defined peaks, whereas the spectrum of a good transistor under saturation conditions is characterized by a broad spectral light emission distribution. Finally the deep-level transient spectroscopy (DLTS) is tried on defective diodes

  11. The effects of defects on copper melting under hydrostatic and shock loading

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Shengnian [Los Alamos National Laboratory; An, Qi [Los Alamos National Laboratory; Germann, Timothy C [Los Alamos National Laboratory; Han, Li - Bo [USTC

    2009-07-24

    With molecular dynamics (MD) simulations, we investigate the effects of defects on Cu melting under hydrostatic and shock wave loading. We explore preexistent defects including vacancies, stacking faults and grain boundaries, as well as shock-induced defects. Depending on defect characteristics (energy and concentration), defects may have negligible or considerable effects on melting at MD scales However, it is expected that defects have more pronounced effects at heating rates lower than the MD rates.

  12. Fanconi anemia: a disorder defective in the DNA damage response.

    Science.gov (United States)

    Kitao, Hiroyuki; Takata, Minoru

    2011-04-01

    Fanconi anemia (FA) is a cancer predisposition disorder characterized by progressive bone marrow failure, congenital developmental defects, chromosomal abnormalities, and cellular hypersensitivity to DNA interstrand crosslink (ICL) agents. So far mutations in 14 FANC genes were identified in FA or FA-like patients. These gene products constitute a common ubiquitin-phosphorylation network called the "FA pathway" and cooperate with other proteins involved in DNA repair and cell cycle control to repair ICL lesions and to maintain genome stability. In this review, we summarize recent exciting discoveries that have expanded our view of the molecular mechanisms operating in DNA repair and DNA damage signaling.

  13. Experimentally-derived fibroblast gene signatures identify molecular pathways associated with distinct subsets of systemic sclerosis patients in three independent cohorts.

    Directory of Open Access Journals (Sweden)

    Michael E Johnson

    Full Text Available Genome-wide expression profiling in systemic sclerosis (SSc has identified four 'intrinsic' subsets of disease (fibroproliferative, inflammatory, limited, and normal-like, each of which shows deregulation of distinct signaling pathways; however, the full set of pathways contributing to this differential gene expression has not been fully elucidated. Here we examine experimentally derived gene expression signatures in dermal fibroblasts for thirteen different signaling pathways implicated in SSc pathogenesis. These data show distinct and overlapping sets of genes induced by each pathway, allowing for a better understanding of the molecular relationship between profibrotic and immune signaling networks. Pathway-specific gene signatures were analyzed across a compendium of microarray datasets consisting of skin biopsies from three independent cohorts representing 80 SSc patients, 4 morphea, and 26 controls. IFNα signaling showed a strong association with early disease, while TGFβ signaling spanned the fibroproliferative and inflammatory subsets, was associated with worse MRSS, and was higher in lesional than non-lesional skin. The fibroproliferative subset was most strongly associated with PDGF signaling, while the inflammatory subset demonstrated strong activation of innate immune pathways including TLR signaling upstream of NF-κB. The limited and normal-like subsets did not show associations with fibrotic and inflammatory mediators such as TGFβ and TNFα. The normal-like subset showed high expression of genes associated with lipid signaling, which was absent in the inflammatory and limited subsets. Together, these data suggest a model by which IFNα is involved in early disease pathology, and disease severity is associated with active TGFβ signaling.

  14. Indicators for Building Process without Final Defects -

    DEFF Research Database (Denmark)

    Jørgensen, Kirsten; Rasmussen, Grane Mikael Gregaard; Thuesen, Christian Langhoff

    2011-01-01

    This article introduces the preliminary data analysis, as well as the underlying theories and methods for identifying the indicators for building process without final defects. Since 2004, the Benchmark Centre for the Danish Construction Sector (BEC) has collected information about legal defects...

  15. Craniotomy Frontal Bone Defect

    African Journals Online (AJOL)

    2018-03-01

    Mar 1, 2018 ... Defect reconstruction and fixation of the graft: The defect of ... where all loose fragments of fractured frontal bone was removed via the ... Mandible. • Ilium. • Allograft ... pediatric patients owing to skull growth. Thus, autologous ...

  16. Congenital platelet function defects

    Science.gov (United States)

    ... pool disorder; Glanzmann's thrombasthenia; Bernard-Soulier syndrome; Platelet function defects - congenital ... Congenital platelet function defects are bleeding disorders that cause reduced platelet function. Most of the time, people with these disorders have ...

  17. Primordial inhomogeneities from massive defects during inflation

    Energy Technology Data Exchange (ETDEWEB)

    Firouzjahi, Hassan; Karami, Asieh; Rostami, Tahereh, E-mail: firouz@ipm.ir, E-mail: karami@ipm.ir, E-mail: t.rostami@ipm.ir [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of)

    2016-10-01

    We consider the imprints of local massive defects, such as a black hole or a massive monopole, during inflation. The massive defect breaks the background homogeneity. We consider the limit that the physical Schwarzschild radius of the defect is much smaller than the inflationary Hubble radius so a perturbative analysis is allowed. The inhomogeneities induced in scalar and gravitational wave power spectrum are calculated. We obtain the amplitudes of dipole, quadrupole and octupole anisotropies in curvature perturbation power spectrum and identify the relative configuration of the defect to CMB sphere in which large observable dipole asymmetry can be generated. We observe a curious reflection symmetry in which the configuration where the defect is inside the CMB comoving sphere has the same inhomogeneous variance as its mirror configuration where the defect is outside the CMB sphere.

  18. Dual approaches for defects condensation

    Energy Technology Data Exchange (ETDEWEB)

    Rougemont, Romulo; Grigorio, Leonardo de Souza; Wotzasek, Clovis [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil); Guimaraes, Marcelo Santos [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil)

    2009-07-01

    Full text. Due to the fact that the QCD running coupling constant becomes larger as we go into the low energy (or large distance) limit of the theory, a perturbative treatment of its infrared (IR) region is impossible. In particular, a formal mathematical demonstration of color confinement and a complete physical understanding of the exact mechanism that confines quarks and gluons are two missing points in our current knowledge of the IR-QCD. It was known that due to the Meissner effect of expulsion of magnetic fields in a electric condensate that usual superconductors should confine magnetic monopoles. That point led to the conjecture that the QCD vacuum could be a condensate of chromomagnetic monopoles, a dual superconductor (DSC). Such a chromomagnetic condensate should be responsible for the dual Meissner effect which is expected to lead to the confinement of color charges immersed in this medium. In dual superconductor models of color confinement, magnetic monopoles appear as topological defects in points of the space where the abelian projection becomes singular. Also, condensation of other kinds of defects such as vortices in superfluids and line-like defects in solids are responsible for a great variety of phase transitions, which once more proves the relevance of the subject. In the present work we review two methods that allow us to approach the condensation of defects: the Kleinert Mechanism (KM) and the Julia-Toulouse Mechanism (JTM). We show that in the limit where the vortex gauge field goes to zero, which we identify as the signature of the condensation of defects in the dual picture, these are two equivalent dual prescriptions for obtaining an effective theory for a phase where defects are condensed, starting from the fundamental theory defined in the normal phase where defects are diluted. (author)

  19. Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

    Science.gov (United States)

    Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

    2010-01-01

    Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

  20. Defect of the Eyelids.

    Science.gov (United States)

    Lu, Guanning Nina; Pelton, Ron W; Humphrey, Clinton D; Kriet, John David

    2017-08-01

    Eyelid defects disrupt the complex natural form and function of the eyelids and present a surgical challenge. Detailed knowledge of eyelid anatomy is essential in evaluating a defect and composing a reconstructive plan. Numerous reconstructive techniques have been described, including primary closure, grafting, and a variety of local flaps. This article describes an updated reconstructive ladder for eyelid defects that can be used in various permutations to solve most eyelid defects. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Fibrous metaphyseal defects

    International Nuclear Information System (INIS)

    Ritschl, P.; Hajek, P.C.; Pechmann, U.

    1989-01-01

    Sixteen patients with fibrous metaphyseal defects were examined with both plain radiography and magnetic resonance (MR) imaging. Depending on the age of the fibrous metaphyseal defects, characteristic radiomorphologic changes were found which correlated well with MR images. Following intravenous Gadolinium-DTPA injection, fibrous metaphyseal defects invariably exhibited a hyperintense border and signal enhancement. (orig./GDG)

  2. Birth Defects (For Parents)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Birth Defects KidsHealth / For Parents / Birth Defects What's in ... Prevented? Print en español Anomalías congénitas What Are Birth Defects? While still in the womb, some babies ...

  3. Defects in conformal field theory

    International Nuclear Information System (INIS)

    Billò, Marco; Gonçalves, Vasco; Lauria, Edoardo; Meineri, Marco

    2016-01-01

    We discuss consequences of the breaking of conformal symmetry by a flat or spherical extended operator. We adapt the embedding formalism to the study of correlation functions of symmetric traceless tensors in the presence of the defect. Two-point functions of a bulk and a defect primary are fixed by conformal invariance up to a set of OPE coefficients, and we identify the allowed tensor structures. A correlator of two bulk primaries depends on two cross-ratios, and we study its conformal block decomposition in the case of external scalars. The Casimir equation in the defect channel reduces to a hypergeometric equation, while the bulk channel blocks are recursively determined in the light-cone limit. In the special case of a defect of codimension two, we map the Casimir equation in the bulk channel to the one of a four-point function without defect. Finally, we analyze the contact terms of the stress-tensor with the extended operator, and we deduce constraints on the CFT data. In two dimensions, we relate the displacement operator, which appears among the contact terms, to the reflection coefficient of a conformal interface, and we find unitarity bounds for the latter.

  4. Defects in conformal field theory

    Energy Technology Data Exchange (ETDEWEB)

    Billò, Marco [Dipartimento di Fisica, Università di Torino, and Istituto Nazionale di Fisica Nucleare - sezione di Torino,Via P. Giuria 1 I-10125 Torino (Italy); Gonçalves, Vasco [Centro de Física do Porto,Departamento de Física e Astronomia Faculdade de Ciências da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); ICTP South American Institute for Fundamental Research Instituto de Física Teórica,UNESP - University Estadual Paulista,Rua Dr. Bento T. Ferraz 271, 01140-070, São Paulo, SP (Brazil); Lauria, Edoardo [Institute for Theoretical Physics, KU Leuven, Celestijnenlaan 200D, B-3001 Leuven (Belgium); Meineri, Marco [Perimeter Institute for Theoretical Physics,Waterloo, Ontario, N2L 2Y5 (Canada); Scuola Normale Superiore, and Istituto Nazionale di Fisica Nucleare - sezione di Pisa,Piazza dei Cavalieri 7 I-56126 Pisa (Italy)

    2016-04-15

    We discuss consequences of the breaking of conformal symmetry by a flat or spherical extended operator. We adapt the embedding formalism to the study of correlation functions of symmetric traceless tensors in the presence of the defect. Two-point functions of a bulk and a defect primary are fixed by conformal invariance up to a set of OPE coefficients, and we identify the allowed tensor structures. A correlator of two bulk primaries depends on two cross-ratios, and we study its conformal block decomposition in the case of external scalars. The Casimir equation in the defect channel reduces to a hypergeometric equation, while the bulk channel blocks are recursively determined in the light-cone limit. In the special case of a defect of codimension two, we map the Casimir equation in the bulk channel to the one of a four-point function without defect. Finally, we analyze the contact terms of the stress-tensor with the extended operator, and we deduce constraints on the CFT data. In two dimensions, we relate the displacement operator, which appears among the contact terms, to the reflection coefficient of a conformal interface, and we find unitarity bounds for the latter.

  5. Molecular Basis of Human Enamel Defects

    Directory of Open Access Journals (Sweden)

    Chatzopoulos Georgios

    2014-03-01

    Full Text Available During eruption of teeth in the oral cavity, the effect of gene variations and environmental factors can result in morphological and structural changes in teeth. Amelogenesis imperfecta is a failure which is detected on the enamel of the teeth and clinical picture varies by the severity and type of the disease. Classification of the types of amelogenesis imperfecta is determined by histological, genetic, clinical and radiographic criteria. Specifically, there are 4 types of amelogenesis imperfecta (according to Witkop: hypoplastic form, hypo-maturation form, hypo-calcified form, and hypo-maturation/hypoplasia form with taurodontism and 14 subcategories. The diagnosis and classification of amelogenesis imperfecta has traditionally been based on clinical presentation or phenotype and the inheritance pattern. Several genes can be mutated and cause the disease. Millions of genes, possibly more than 10,000 genes produce proteins that regulate synthesis of enamel. Some of the genes and gene products that are likely associated with amelogenesis imperfecta are: amelogenin (AMELX, AMELY genes, ameloblastin (AMBN gene, enamelin (ENAM gene, enamelysin (MMP20 gene, kalikryn 4 (KLK 4 gene, tuftelins (Tuftelin gene, FAM83H (FAM83H gene and WDR72 (WDR72 gene. Particular attention should be given by the dentist in recognition and correlation of phenotypes with genotypes, in order to diagnose quickly and accurately such a possible disease and to prevent or treat it easily and quickly. Modern dentistry should restore these lesions in order to guarantee aesthetics and functionality, usually in collaboration with a group of dentists.

  6. Integrated RNA-Seq and sRNA-Seq Analysis Identifies Chilling and Freezing Responsive Key Molecular Players and Pathways in Tea Plant (Camellia sinensis)

    Science.gov (United States)

    Zheng, Chao; Zhao, Lei; Wang, Yu; Shen, Jiazhi; Zhang, Yinfei; Jia, Sisi; Li, Yusheng; Ding, Zhaotang

    2015-01-01

    Tea [Camellia sinensis (L) O. Kuntze, Theaceae] is one of the most popular non-alcoholic beverages worldwide. Cold stress is one of the most severe abiotic stresses that limit tea plants’ growth, survival and geographical distribution. However, the genetic regulatory network and signaling pathways involved in cold stress responses in tea plants remain unearthed. Using RNA-Seq, DGE and sRNA-Seq technologies, we performed an integrative analysis of miRNA and mRNA expression profiling and their regulatory network of tea plants under chilling (4℃) and freezing (-5℃) stress. Differentially expressed (DE) miRNA and mRNA profiles were obtained based on fold change analysis, miRNAs and target mRNAs were found to show both coherent and incoherent relationships in the regulatory network. Furthermore, we compared several key pathways (e.g., ‘Photosynthesis’), GO terms (e.g., ‘response to karrikin’) and transcriptional factors (TFs, e.g., DREB1b/CBF1) which were identified as involved in the early chilling and/or freezing response of tea plants. Intriguingly, we found that karrikins, a new group of plant growth regulators, and β-primeverosidase (BPR), a key enzyme functionally relevant with the formation of tea aroma might play an important role in both early chilling and freezing response of tea plants. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-Seq and sRNA-Seq analysis. This is the first study to simultaneously profile the expression patterns of both miRNAs and mRNAs on a genome-wide scale to elucidate the molecular mechanisms of early responses of tea plants to cold stress. In addition to gaining a deeper insight into the cold resistant characteristics of tea plants, we provide a good case study to analyse mRNA/miRNA expression and profiling of non-model plant species using next-generation sequencing technology. PMID:25901577

  7. Dirichlet topological defects

    International Nuclear Information System (INIS)

    Carroll, S.M.; Trodden, M.

    1998-01-01

    We propose a class of field theories featuring solitonic solutions in which topological defects can end when they intersect other defects of equal or higher dimensionality. Such configurations may be termed open-quotes Dirichlet topological defects,close quotes in analogy with the D-branes of string theory. Our discussion focuses on defects in scalar field theories with either gauge or global symmetries, in 3+1 dimensions; the types of defects considered include walls ending on walls, strings on walls, and strings on strings. copyright 1998 The American Physical Society

  8. Synthetic Defects for Vibrothermography

    Science.gov (United States)

    Renshaw, Jeremy; Holland, Stephen D.; Thompson, R. Bruce; Eisenmann, David J.

    2010-02-01

    Synthetic defects are an important tool used for characterizing the performance of nondestructive evaluation techniques. Viscous material-filled synthetic defects were developed for use in vibrothermography (also known as sonic IR) as a tool to improve inspection accuracy and reliability. This paper describes how the heat-generation response of these VMF synthetic defects is similar to the response of real defects. It also shows how VMF defects can be applied to improve inspection accuracy for complex industrial parts and presents a study of their application in an aircraft engine stator vane.

  9. Defect production in ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Zinkle, S.J. [Oak Ridge National Lab., TN (United States); Kinoshita, C. [Kyushu Univ. (Japan)

    1997-08-01

    A review is given of several important defect production and accumulation parameters for irradiated ceramics. Materials covered in this review include alumina, magnesia, spinel silicon carbide, silicon nitride, aluminum nitride and diamond. Whereas threshold displacement energies for many ceramics are known within a reasonable level of uncertainty (with notable exceptions being AIN and Si{sub 3}N{sub 4}), relatively little information exists on the equally important parameters of surviving defect fraction (defect production efficiency) and point defect migration energies for most ceramics. Very little fundamental displacement damage information is available for nitride ceramics. The role of subthreshold irradiation on defect migration and microstructural evolution is also briefly discussed.

  10. Identifying the Interaction of Vancomycin With Novel pH-Responsive Lipids as Antibacterial Biomaterials Via Accelerated Molecular Dynamics and Binding Free Energy Calculations.

    Science.gov (United States)

    Ahmed, Shaimaa; Vepuri, Suresh B; Jadhav, Mahantesh; Kalhapure, Rahul S; Govender, Thirumala

    2018-06-01

    Nano-drug delivery systems have proven to be an efficient formulation tool to overcome the challenges with current antibiotics therapy and resistance. A series of pH-responsive lipid molecules were designed and synthesized for future liposomal formulation as a nano-drug delivery system for vancomycin at the infection site. The structures of these lipids differ from each other in respect of hydrocarbon tails: Lipid1, 2, 3 and 4 have stearic, oleic, linoleic, and linolenic acid hydrocarbon chains, respectively. The impact of variation in the hydrocarbon chain in the lipid structure on drug encapsulation and release profile, as well as mode of drug interaction, was investigated using molecular modeling analyses. A wide range of computational tools, including accelerated molecular dynamics, normal molecular dynamics, binding free energy calculations and principle component analysis, were applied to provide comprehensive insight into the interaction landscape between vancomycin and the designed lipid molecules. Interestingly, both MM-GBSA and MM-PBSA binding affinity calculations using normal molecular dynamics and accelerated molecular dynamics trajectories showed a very consistent trend, where the order of binding affinity towards vancomycin was lipid4 > lipid1 > lipid2 > lipid3. From both normal molecular dynamics and accelerated molecular dynamics, the interaction of lipid3 with vancomycin is demonstrated to be the weakest (∆G binding  = -2.17 and -11.57, for normal molecular dynamics and accelerated molecular dynamics, respectively) when compared to other complexes. We believe that the degree of unsaturation of the hydrocarbon chain in the lipid molecules may impact on the overall conformational behavior, interaction mode and encapsulation (wrapping) of the lipid molecules around the vancomycin molecule. This thorough computational analysis prior to the experimental investigation is a valuable approach to guide for predicting the encapsulation

  11. On holographic defect entropy

    International Nuclear Information System (INIS)

    Estes, John; Jensen, Kristan; O’Bannon, Andy; Tsatis, Efstratios; Wrase, Timm

    2014-01-01

    We study a number of (3+1)- and (2+1)-dimensional defect and boundary conformal field theories holographically dual to supergravity theories. In all cases the defects or boundaries are planar, and the defects are codimension-one. Using holography, we compute the entanglement entropy of a (hemi-)spherical region centered on the defect (boundary). We define defect and boundary entropies from the entanglement entropy by an appropriate background subtraction. For some (3+1)-dimensional theories we find evidence that the defect/boundary entropy changes monotonically under certain renormalization group flows triggered by operators localized at the defect or boundary. This provides evidence that the g-theorem of (1+1)-dimensional field theories generalizes to higher dimensions

  12. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  13. Genital and Urinary Tract Defects

    Science.gov (United States)

    ... conditions > Genital and urinary tract defects Genital and urinary tract defects E-mail to a friend Please fill ... and extra fluids. What problems can genital and urinary tract defects cause? Genital and urinary tract defects affect ...

  14. Multiscale crystal defect dynamics: A coarse-grained lattice defect model based on crystal microstructure

    Science.gov (United States)

    Lyu, Dandan; Li, Shaofan

    2017-10-01

    Crystal defects have microstructure, and this microstructure should be related to the microstructure of the original crystal. Hence each type of crystals may have similar defects due to the same failure mechanism originated from the same microstructure, if they are under the same loading conditions. In this work, we propose a multiscale crystal defect dynamics (MCDD) model that models defects by considering its intrinsic microstructure derived from the microstructure or material genome of the original perfect crystal. The main novelties of present work are: (1) the discrete exterior calculus and algebraic topology theory are used to construct a scale-up (coarse-grained) dual lattice model for crystal defects, which may represent all possible defect modes inside a crystal; (2) a higher order Cauchy-Born rule (up to the fourth order) is adopted to construct atomistic-informed constitutive relations for various defect process zones, and (3) an hierarchical strain gradient theory based finite element formulation is developed to support an hierarchical multiscale cohesive (process) zone model for various defects in a unified formulation. The efficiency of MCDD computational algorithm allows us to simulate dynamic defect evolution at large scale while taking into account atomistic interaction. The MCDD model has been validated by comparing of the results of MCDD simulations with that of molecular dynamics (MD) in the cases of nanoindentation and uniaxial tension. Numerical simulations have shown that MCDD model can predict dislocation nucleation induced instability and inelastic deformation, and thus it may provide an alternative solution to study crystal plasticity.

  15. The role of defects in laser damage of multilayer coatings

    International Nuclear Information System (INIS)

    Kozlowski, M.R.; Chow, R.

    1993-01-01

    Laser induced damage to optical coatings is generally a localized phenomenon associated with coating defects. The most common of the defect types are the well-known nodule defect. This paper reviews the use of experiments and modeling to understand the formation of these defects and their interaction with laser light. Of particular interest are efforts to identify which defects are most susceptible to laser damage. Also discussed are possible methods for stabilizing these defects (laser conditioning) or preventing their initiation (source stabilization, spatter particle trapping)

  16. Ectopic expression of Ptf1a induces spinal defects, urogenital defects, and anorectal malformations in Danforth's short tail mice.

    Directory of Open Access Journals (Sweden)

    Kei Semba

    Full Text Available Danforth's short tail (Sd is a semidominant mutation on mouse chromosome 2, characterized by spinal defects, urogenital defects, and anorectal malformations. However, the gene responsible for the Sd phenotype was unknown. In this study, we identified the molecular basis of the Sd mutation. By positional cloning, we identified the insertion of an early transposon in the Sd candidate locus approximately 12-kb upstream of Ptf1a. We found that insertion of the transposon caused overexpression of three neighboring genes, Gm13344, Gm13336, and Ptf1a, in Sd mutant embryos and that the Sd phenotype was not caused by disruption of an as-yet-unknown gene in the candidate locus. Using multiple knockout and knock-in mouse models, we demonstrated that misexpression of Ptf1a, but not of Gm13344 or Gm13336, in the notochord, hindgut, cloaca, and mesonephros was sufficient to replicate the Sd phenotype. The ectopic expression of Ptf1a in the caudal embryo resulted in attenuated expression of Cdx2 and its downstream target genes T, Wnt3a, and Cyp26a1; we conclude that this is the molecular basis of the Sd phenotype. Analysis of Sd mutant mice will provide insight into the development of the spinal column, anus, and kidney.

  17. Positron lifetime calculation for defects and defect clusters in graphite

    International Nuclear Information System (INIS)

    Onitsuka, T.; Ohkubo, H.; Takenaka, M.; Tsukuda, N.; Kuramoto, E.

    2000-01-01

    Calculations of positron lifetime have been made for vacancy type defects in graphite and compared with experimental results. Defect structures were obtained in a model graphite lattice after including relaxation of whole lattice as determined by the molecular dynamics method, where the interatomic potential given by Pablo Andribet, Dominguez-Vazguez, Mari Carmen Perez-Martin, Alonso, Jimenez-Rodriguez [Nucl. Instrum. and Meth. 115 (1996) 501] was used. For the defect structures obtained via lattice relaxation positron lifetime was calculated under the so-called atomic superposition method. Positron lifetimes 204 and 222 ps were obtained for the graphite matrix and a single vacancy, respectively, which can be compared with the experimental results 208 and 233 ps. For planar vacancy clusters, e.g., vacancy loops, lifetime calculation was also made and indicated that lifetime increases with the number of vacancies in a cluster. This is consistent with the experimental result in the region of higher annealing temperature (above 1200 deg. C), where the increase of positron lifetime is seen, probably corresponding to the clustering of mobile vacancies

  18. Defects in semiconductors

    CERN Document Server

    Romano, Lucia; Jagadish, Chennupati

    2015-01-01

    This volume, number 91 in the Semiconductor and Semimetals series, focuses on defects in semiconductors. Defects in semiconductors help to explain several phenomena, from diffusion to getter, and to draw theories on materials' behavior in response to electrical or mechanical fields. The volume includes chapters focusing specifically on electron and proton irradiation of silicon, point defects in zinc oxide and gallium nitride, ion implantation defects and shallow junctions in silicon and germanium, and much more. It will help support students and scientists in their experimental and theoret

  19. Proceedings of the European Meeting on Positron Studies of Defects

    International Nuclear Information System (INIS)

    1987-01-01

    The meeting dealt with both theoretical and experimental aspects of positron studies of defects using conventional and novel positron techniques. The subjects are indicated in the following headings: (1) theory of positrons in imperfect solids, (2) vacancies in metals and alloys, (3) dislocation and deformation effects, (4) amorphous alloys and fine-grained materials, (5) phase transitions, (6) precipitation phenomena, (7) gas impurity-defect interaction and irradiation effects, (8) defects in elemental semiconductors, (9) defects in compound semiconductors, (10) slow positron studies of defects, (11) defects in oxides and halides, (12) defects in molecular solids, and (13) advances in experimental techniques and data treatment. Althogether 141 contributions (invited plenary lectures, short lectures, and posters) are presented as titles with abstracts. Most of them are in INIS scope and are processed individually for the database

  20. Size Effect of Defects on the Mechanical Properties of Graphene

    Science.gov (United States)

    Park, Youngho; Hyun, Sangil

    2018-03-01

    Graphene, a two-dimensional material, has been studied and utilized for its excellent material properties. In reality, achieving a pure single-crystalline structure in graphene is difficult, so usually graphene may have various types of defects in it. Vacancies, Stone-Wales defects, and grain boundaries can drastically change the material properties of graphene. Graphene with vacancy defects has been of interest because it is a two-dimensional analogy of three-dimensional porous materials. It has efficient material properties, and can function as a part of modern devices. The mechanical properties have been studied by using molecular dynamics for either a single vacancy defect with various sizes or multiple vacancy defects with same defect ratios. However, it is not clear which one has more influence on the mechanical properties between the size of the defects and the defect ratio. Therefore, we investigated the hole-size effect on the mechanical properties of single-crystalline graphene at various defect ratios. A void defect with large size can have a rather high tensile modulus with a low fracture strain compared to a void defect with small size. We numerically found that the tensile properties of scattered single vacancies is similar to that of amorphous graphene. We suspect that this is due to the local orbital change of the carbon atoms near the boundary of the void defects, so-called the interfacial phase.

  1. Expanding the clinical spectrum associated with defects in CNTNAP2 and NRXN1

    Directory of Open Access Journals (Sweden)

    Ullmann Reinhard

    2011-08-01

    Full Text Available Abstract Background Heterozygous copy-number and missense variants in CNTNAP2 and NRXN1 have repeatedly been associated with a wide spectrum of neuropsychiatric disorders such as developmental language and autism spectrum disorders, epilepsy and schizophrenia. Recently, homozygous or compound heterozygous defects in either gene were reported as causative for severe intellectual disability. Methods 99 patients with severe intellectual disability and resemblance to Pitt-Hopkins syndrome and/or suspected recessive inheritance were screened for mutations in CNTNAP2 and NRXN1. Molecular karyotyping was performed in 45 patients. In 8 further patients with variable intellectual disability and heterozygous deletions in either CNTNAP2 or NRXN1, the remaining allele was sequenced. Results By molecular karyotyping and mutational screening of CNTNAP2 and NRXN1 in a group of severely intellectually disabled patients we identified a heterozygous deletion in NRXN1 in one patient and heterozygous splice-site, frameshift and stop mutations in CNTNAP2 in four patients, respectively. Neither in these patients nor in eight further patients with heterozygous deletions within NRXN1 or CNTNAP2 we could identify a defect on the second allele. One deletion in NRXN1 and one deletion in CNTNAP2 occurred de novo, in another family the deletion was also identified in the mother who had learning difficulties, and in all other tested families one parent was shown to be healthy carrier of the respective deletion or mutation. Conclusions We report on patients with heterozygous defects in CNTNAP2 or NRXN1 associated with severe intellectual disability, which has only been reported for recessive defects before. These results expand the spectrum of phenotypic severity in patients with heterozygous defects in either gene. The large variability between severely affected patients and mildly affected or asymptomatic carrier parents might suggest the presence of a second hit, not

  2. Electrically Rotatable Polarizer Using One-Dimensional Photonic Crystal with a Nematic Liquid Crystal Defect Layer

    Directory of Open Access Journals (Sweden)

    Ryotaro Ozaki

    2015-09-01

    Full Text Available Polarization characteristics of defect mode peaks in a one-dimensional (1D photonic crystal (PC with a nematic liquid crystal (NLC defect layer have been investigated. Two different polarized defect modes are observed in a stop band. One group of defect modes is polarized along the long molecular axis of the NLC, whereas another group is polarized along its short axis. Polarizations of the defect modes can be tuned by field-induced in-plane reorientation of the NLC in the defect layer. The polarization properties of the 1D PC with the NLC defect layer is also investigated by the finite difference time domain (FDTD simulation.

  3. Metallography of defects

    International Nuclear Information System (INIS)

    Borisova, E.A.; Bochvar, G.A.; Brun, M.Ya.

    1980-01-01

    Different types of defects of metallurgical, technological and exploitation origin in intermediate and final products of titanium alloys, are considered. The examples of metallic and nonmetallic inclusions, chemical homogeneity, different grains, bands, cracks, places of searing, porosity are given; methods of detecting the above defects are described. The methods of metallography, X-ray spectral analysis, measuring microhardness are used

  4. Beating Birth Defects

    Centers for Disease Control (CDC) Podcasts

    Each year in the U.S., one in 33 babies is affected by a major birth defect. Women can greatly improve their chances of giving birth to a healthy baby by avoiding some of the risk factors for birth defects before and during pregnancy. In this podcast, Dr. Stuart Shapira discusses ways to improve the chances of giving birth to a healthy baby.

  5. Defects at oxide surfaces

    CERN Document Server

    Thornton, Geoff

    2015-01-01

    This book presents the basics and characterization of defects at oxide surfaces. It provides a state-of-the-art review of the field, containing information to the various types of surface defects, describes analytical methods to study defects, their chemical activity and the catalytic reactivity of oxides. Numerical simulations of defective structures complete the picture developed. Defects on planar surfaces form the focus of much of the book, although the investigation of powder samples also form an important part. The experimental study of planar surfaces opens the possibility of applying the large armoury of techniques that have been developed over the last half-century to study surfaces in ultra-high vacuum. This enables the acquisition of atomic level data under well-controlled conditions, providing a stringent test of theoretical methods. The latter can then be more reliably applied to systems such as nanoparticles for which accurate methods of characterization of structure and electronic properties ha...

  6. Direct Observation of Radiation Defects: Experiment and Interpretation

    International Nuclear Information System (INIS)

    Dudarev, S.L.

    2012-01-01

    at low cost in comparison with the mock-up tests, offer scientific insight and make it possible to perform, in combination with experimental information derived from fission and ion-beam irradiation experiments, the preliminary assessment of power plant operating scenarios. Defining the limits of visibility of small defect clusters and dislocation loops, and optimal diffraction conditions for electron microscope imaging, remains one of the central problems of electron microscopy of irradiated materials. Using computer image simulations based on the propagation- interpolation algorithm for solving the Howie-Basinski equations, it is possible to investigate the relation between the actual and the 'observed' size of small loops, the part played by many-beam dynamical diffraction effects, and limitations of electron microscope imaging in identifying the structure of small defects. A particularly impressive and useful application of electron microscopy is given by recent in situ electron microscope observations, providing real-time visualization of dynamics of defects produced by ultra-high-energy electron irradiation, or showing microstructural evolution occurring under ion beam irradiation. Such observations have revolutionized our understanding of how properties of metals and alloys change in the extreme radiation and thermal environments of a fission or a fusion power plant. The key feature of in situ electron microscopy is its ability to exhibit the time-dependent dynamics of migration, interaction, and transformation of radiation defects, and to visualize the entire complexity of evolving defect and dislocation networks. For example, in situ electron microscope observations provided evidence of violation of the Burgers vector conservation law for dislocations on the nanoscale. This gave a vital clue needed for modeling microscopic processes responsible for the formation of unusual high temperature dislocation structures in iron, and for explaining the origin of the

  7. Energetics of the rearrangement of neutral and ionized perfluorocyclopropane to perfluoropropylene. Use of infrared multiphoton dissociation spectra to identify structural isomers of molecular ions

    International Nuclear Information System (INIS)

    Bomse, D.S.; Berman, D.W.; Beauchamp, J.L.

    1981-01-01

    Infrared photodissociation spectroscopy is used to compare the structure of gas-phase C 3 F 6 + ions obtained by electron-impact ionization of two isomeric precursors: perfluoropropylene and perfluorocyclopropane. Photodissociation spectra are obtained by observing the extent of multiphoton dissociation as the CO 2 laser is tuned across the 925 to 1080 cm -1 wavelength range. Ions are formed, stored, and detected with the use of techniques of ion cyclotron resonance spectroscopy. Infrared multiphoton excitation is effected by using low-power, continuous-wave laser radiation. The fingerprint spectrum of the molecular ion of perfluorocyclopropane is identical with that obtained from perfluoropropylene, indicating rearrangement of the former to the latter. Photodissociation kinetics indicate that the entire perfluorocyclopropane molecular ion population isomerizes to the more stable perfluoropropylene structure. Thermochemistry of C 3 F 6 and C 3 F 6 + isomers is discussed. Comparisons are made with the analogous C 3 H 6 system. Photoionization mass spectroscopy results yield ΔH/sub f/(c-C 3 F 6 ) = -233.8 kcal/mol. 4 figures

  8. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots.

    Science.gov (United States)

    Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang

    2017-02-06

    Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. 'MAPK cascade'), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway'), reactive oxygen species (ROS) metabolic process (e.g. 'hydrogen peroxide catabolic process') and transcription factors (e.g., 'MYB, ZFP and bZIP') were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment.

  9. Study of irradiation induced defects in silicon

    International Nuclear Information System (INIS)

    Pal, Gayatri; Sebastian, K.C.; Somayajulu, D.R.S.; Chintalapudi, S.N.

    2000-01-01

    Pure high resistivity (6000 ohm-cm) silicon wafers were recoil implanted with 1.8 MeV 111 In ions. As-irradiated wafers showed a 13 MHz quadrupole interaction frequency, which was not observed earlier. The annealing behaviour of these defects in the implanted wafers was studied between room temperature and 1073 K. At different annealing temperatures two more interaction frequencies corresponding to defect complexes D2 and D3 are observed. Even though the experimental conditions were different, these are identical to the earlier reported ones. Based on an empirical point charge model calculation, an attempt is made to identify the configuration of these defect complexes. (author)

  10. What’s new in genetics of congenital heart defects

    Directory of Open Access Journals (Sweden)

    Maria Cristina Digilio

    2016-12-01

    Full Text Available Epidemiological studies, clinical observations and advances in molecular genetics are contributing to the understanding of the etiology of congenital heart defects (CHDs. Several phenotype-genotype correlation studies have suggested that specific morphogenetic mechanisms put in motion by genes can result in a specific cardiac phenotype. The use of new technologies has increased the possibility of identification of new genes and chromosomal loci in syndromic and non-syndromic CHDs. There are a number of methods available for genetic research studies of CHDs, including cytogenetic analysis, linkage and association studies, copy number variation (CNV and DNA micro-array analysis, and whole exome sequencing. The altered dosage of contigous genes included inside CNVs can produce new syndromic CHDs, so that several different new genomic conditions have been identified. These include duplication 22q11.2 syndrome, distal 22q11.2 deletion syndrome, deletion and duplication 1q21.1, deletion 1p36 syndrome. Molecular techniques as whole exome sequancing has lead to the identification of new genes for monogenic syndromes with CHD, as for example in Adams-Oliver, Noonan and Kabuki syndrome. The variable expressivity and reduced penetrance of CHDs in genetic syndromes is likely influenced by genetic factors, and several studies have been performed showing the involvement of modifier genes. It is not easy to define precisely the genetic defects underlying non-syndromic CHDs, due to the genetic and clinical heterogeneity of these malformations. Recent experimental studies have identified multiple CNVs contributing to non-syndromic CHD. The number of identified genes for non-syndromic CHDs is at this time limited and each of the identified gene has been shown to be implicated only in a small proportion of CHD. The application of new technologies to specific cases of CHD and pedigrees with familial recurrence and filtering genes mapping in CNV regions can probably

  11. Graphene defects induced by ion beam

    Science.gov (United States)

    Gawlik, Grzegorz; Ciepielewski, Paweł; Baranowski, Jacek; Jagielski, Jacek

    2017-10-01

    The CVD graphene deposited on the glass substrate was bombarded by molecular carbon ions C3+ C6+ hydrocarbon ions C3H4+ and atomic ions He+, C+, N+, Ar+, Kr+ Yb+. Size and density of ion induced defects were estimated from evolution of relative intensities of Raman lines D (∼1350 1/cm), G (∼1600 1/cm), and D‧ (∼1620 1/cm) with ion fluence. The efficiency of defect generation by atomic ions depend on ion mass and energy similarly as vacancy generation directly by ion predicted by SRIM simulations. However, efficiency of defect generation in graphene by molecular carbon ions is essentially higher than summarized efficiency of similar group of separate atomic carbon ions of the same energy that each carbon ion in a cluster. The evolution of the D/D‧ ratio of Raman lines intensities with ion fluence was observed. This effect may indicate evolution of defect nature from sp3-like at low fluence to a vacancy-like at high fluence. Observed ion graphene interactions suggest that the molecular ion interacts with graphene as single integrated object and should not be considered as a group of atomic ions with partial energy.

  12. Defect assessment benchmark studies

    International Nuclear Information System (INIS)

    Hooton, D.G.; Sharples, J.K.

    1995-01-01

    Assessments of the resistance to fast fracture of the beltline region of a PWR vessel subjected to a pressurized thermal shock (PTS) transient have been carried out using the procedures of French (RCC-M) and German (KTA) design codes, and comparisons made with results obtained using the R6 procedure as applied for Sizewell B. The example chosen for these comparisons is of a generic nature, and is taken as the PTS identified by the Hirsch addendum to the Second Marshall report (1987) as the most severe transient with regard to vessel integrity. All assessment methods show the beltline region of the vessel to be safe from the risk of fast fracture, but by varying factors of safety. These factors are discussed in terms of margins between limiting and reference defect sizes, fracture toughness and stress intensity factor, and material temperature and temperature at the onset of upper-shelf materials behaviour. Based on these studies, consideration is given to issues involved in the harmonization of those sections of the design codes which are concerned with methods for the demonstration of the avoidance of the risk of failure by fast fracture. (author)

  13. Time and temperature dependence of cascade induced defect production in in situ experiments and computer simulation

    International Nuclear Information System (INIS)

    Ishino, Shiori

    1993-01-01

    Understanding of the defect production and annihilation processes in a cascade is important in modelling of radiation damage for establishing irradiation correlation. In situ observation of heavy ion radiation damage has a great prospect in this respect. Time and temperature dependence of formation and annihilation of vacancy clusters in a cascade with a time resolution of 30 ms has been studied with a facility which comprises a heavy ion accelerator and an electron microscope. Formation and annihilation rates of defect clusters have been separately measured by this technique. The observed processes have been analysed by simple kinetic equations, taking into account the sink effect of surface and the defect clusters themselves together with the annihilation process due to thermal emission of vacancies from the defect clusters. Another tool to study time and temperature dependence of defect production in a cascade is computer simulation. Recent results of molecular dynamics calculations on the temperature dependence of cascade evolution are presented, including directional and temperature dependence of the lengths of replacement collision sequences, temperature dependence of the process to reach thermal equilibrium and so on. These results are discussed under general time frame of radiation damage evolution covering from 10 -15 to 10 9 s, and several important issues for the general understanding have been identified. (orig.)

  14. Secondary defects in non-metallic solids

    International Nuclear Information System (INIS)

    Ashbee, K.H.G.; Hobbs, L.W.

    1977-01-01

    This paper points out features of secondary defect formation which are peculiar to non-metallic solids (excluding elemental semiconductors). Most of the materials of interest are compounds of two or more (usually more or less ionic) atomic species, and immediate consequence of which is a need to maintain both stoichiometry (or accommodate non-stoichiometry) and order. Primary defects in these solids, whether produced thermally, chemically or by irradiation, seldom are present or aggregate in exactly stoichiometric proportions, and the resulting extending defect structures can be quite distinct from those found in metallic solids. Where stoichiometry is maintained, it is often convenient to describe extended defects in terms of alterations in the arrangement of 'molecular' units. The adoption of this procedure enables several novel features of extended defect structures in non-metals to be explained. There are several ways in which a range of non-stoichiometry can be accommodated, which include structural elimination of point defects, nucleation of new coherent phases of altered stoichiometry, and decomposition. (author)

  15. Point defect balance in epitaxial GaSb

    International Nuclear Information System (INIS)

    Segercrantz, N.; Slotte, J.; Makkonen, I.; Kujala, J.; Tuomisto, F.; Song, Y.; Wang, S.

    2014-01-01

    Positron annihilation spectroscopy in both conventional and coincidence Doppler broadening mode is used for studying the effect of growth conditions on the point defect balance in GaSb:Bi epitaxial layers grown by molecular beam epitaxy. Positron annihilation characteristics in GaSb are also calculated using density functional theory and compared to experimental results. We conclude that while the main positron trapping defect in bulk samples is the Ga antisite, the Ga vacancy is the most prominent trap in the samples grown by molecular beam epitaxy. The results suggest that the p–type conductivity is caused by different defects in GaSb grown with different methods.

  16. Gauge theory and defects in solids

    CERN Document Server

    Edelen, DGB

    2012-01-01

    This new series Mechanics and Physics of Discrete Systems aims to provide a coherent picture of the modern development of discrete physical systems. Each volume will offer an orderly perspective of disciplines such as molecular dynamics, crystal mechanics and/or physics, dislocation, etc. Emphasized in particular are the fundamentals of mechanics and physics that play an essential role in engineering applications.Volume 1, Gauge Theory and Defects in Solids, presents a detailed development of a rational theory of the dynamics of defects and damage in solids. Solutions to field e

  17. Structure of Human B12 Trafficking Protein CblD Reveals Molecular Mimicry and Identifies a New Subfamily of Nitro-FMN Reductases.

    Science.gov (United States)

    Yamada, Kazuhiro; Gherasim, Carmen; Banerjee, Ruma; Koutmos, Markos

    2015-12-04

    In mammals, B12 (or cobalamin) is an essential cofactor required by methionine synthase and methylmalonyl-CoA mutase. A complex intracellular pathway supports the assimilation of cobalamin into its active cofactor forms and delivery to its target enzymes. MMADHC (the methylmalonic aciduria and homocystinuria type D protein), commonly referred to as CblD, is a key chaperone involved in intracellular cobalamin trafficking, and mutations in CblD cause methylmalonic aciduria and/or homocystinuria. Herein, we report the first crystal structure of the globular C-terminal domain of human CblD, which is sufficient for its interaction with MMADHC (the methylmalonic aciduria and homocystinuria type C protein), or CblC, and for supporting the cytoplasmic cobalamin trafficking pathway. CblD contains an α+β fold that is structurally reminiscent of the nitro-FMN reductase superfamily. Two of the closest structural relatives of CblD are CblC, a multifunctional enzyme important for cobalamin trafficking, and the activation domain of methionine synthase. CblD, CblC, and the activation domain of methionine synthase share several distinguishing features and, together with two recently described corrinoid-dependent reductive dehalogenases, constitute a new subclass within the nitro-FMN reductase superfamily. We demonstrate that CblD enhances oxidation of cob(II)alamin bound to CblC and that disease-causing mutations in CblD impair the kinetics of this reaction. The striking structural similarity of CblD to CblC, believed to be contiguous in the cobalamin trafficking pathway, suggests the co-option of molecular mimicry as a strategy for achieving its function. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Molecular dynamics simulations of site point mutations in the TPR domain of cyclophilin 40 identify conformational states with distinct dynamic and enzymatic properties

    Science.gov (United States)

    Gur, Mert; Blackburn, Elizabeth A.; Ning, Jia; Narayan, Vikram; Ball, Kathryn L.; Walkinshaw, Malcolm D.; Erman, Burak

    2018-04-01

    Cyclophilin 40 (Cyp40) is a member of the immunophilin family that acts as a peptidyl-prolyl-isomerase enzyme and binds to the heat shock protein 90 (Hsp90). Its structure comprises an N-terminal cyclophilin domain and a C-terminal tetratricopeptide (TPR) domain. Cyp40 is overexpressed in prostate cancer and certain T-cell lymphomas. The groove for Hsp90 binding on the TPR domain includes residues Lys227 and Lys308, referred to as the carboxylate clamp, and is essential for Cyp40-Hsp90 binding. In this study, the effect of two mutations, K227A and K308A, and their combinative mutant was investigated by performing a total of 5.76 μs of all-atom molecular dynamics (MD) simulations in explicit solvent. All simulations, except the K308A mutant, were found to adopt two distinct (extended or compact) conformers defined by different cyclophilin-TPR interdomain distances. The K308A mutant was only observed in the extended form which is observed in the Cyp40 X-ray structure. The wild-type, K227A, and combined mutant also showed bimodal distributions. The experimental melting temperature, Tm, values of the mutants correlate with the degree of compactness with the K308A extended mutant having a marginally lower melting temperature. Another novel measure of compactness determined from the MD data, the "coordination shell volume," also shows a direct correlation with Tm. In addition, the MD simulations show an allosteric effect with the mutations in the remote TPR domain having a pronounced effect on the molecular motions of the enzymatic cyclophilin domain which helps rationalise the experimentally observed increase in enzyme activity measured for all three mutations.

  19. Formation of topological defects

    International Nuclear Information System (INIS)

    Vachaspati, T.

    1991-01-01

    We consider the formation of point and line topological defects (monopoles and strings) from a general point of view by allowing the probability of formation of a defect to vary. To investigate the statistical properties of the defects at formation we give qualitative arguments that are independent of any particular model in which such defects occur. These arguments are substantiated by numerical results in the case of strings and for monopoles in two dimensions. We find that the network of strings at formation undergoes a transition at a certain critical density below which there are no infinite strings and the closed-string (loop) distribution is exponentially suppressed at large lengths. The results are contrasted with the results of statistical arguments applied to a box of strings in dynamical equilibrium. We argue that if point defects were to form with smaller probability, the distance between monopoles and antimonopoles would decrease while the monopole-to-monopole distance would increase. We find that monopoles are always paired with antimonopoles but the pairing becomes clean only when the number density of defects is small. A similar reasoning would also apply to other defects

  20. Defective glycinergic synaptic transmission in zebrafish motility mutants

    Directory of Open Access Journals (Sweden)

    Hiromi Hirata

    2010-01-01

    Full Text Available Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR β subunit genes. These mutants exhibit a loss of glycinergic synaptic transmission due to a lack of synaptic aggregation of GlyRs. Due to the consequent loss of reciprocal inhibition of motor circuits between the two sides of the spinal cord, motor neurons activate simultaneously on both sides resulting in bilateral contraction of axial muscles of beo mutants, eliciting the so-called ‘accordion’ phenotype. Similar defects in GlyR subunit genes have been observed in several mammals and are the basis for human hyperekplexia/startle disease. By contrast, zebrafish shocked (sho mutants have a defect in slc6a9, encoding GlyT1, a glycine transporter that is expressed by astroglial cells surrounding the glycinergic synapse in the hindbrain and spinal cord. GlyT1 mediates rapid uptake of glycine from the synaptic cleft, terminating synaptic transmission. In zebrafish sho mutants, there appears to be elevated extracellular glycine resulting in persistent inhibition of postsynaptic neurons and subsequent reduced motility, causing the ‘twitch once’ phenotype. We review current knowledge regarding zebrafish ‘accordion’ and ‘twitch once’ mutants, including beo and sho, and report the identification of a new α2 subunit that revises the phylogeny of zebrafish GlyRs.

  1. Defective Glycinergic Synaptic Transmission in Zebrafish Motility Mutants

    Science.gov (United States)

    Hirata, Hiromi; Carta, Eloisa; Yamanaka, Iori; Harvey, Robert J.; Kuwada, John Y.

    2009-01-01

    Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo) mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR) β subunit genes. These mutants exhibit a loss of glycinergic synaptic transmission due to a lack of synaptic aggregation of GlyRs. Due to the consequent loss of reciprocal inhibition of motor circuits between the two sides of the spinal cord, motor neurons activate simultaneously on both sides resulting in bilateral contraction of axial muscles of beo mutants, eliciting the so-called ‘accordion’ phenotype. Similar defects in GlyR subunit genes have been observed in several mammals and are the basis for human hyperekplexia/startle disease. By contrast, zebrafish shocked (sho) mutants have a defect in slc6a9, encoding GlyT1, a glycine transporter that is expressed by astroglial cells surrounding the glycinergic synapse in the hindbrain and spinal cord. GlyT1 mediates rapid uptake of glycine from the synaptic cleft, terminating synaptic transmission. In zebrafish sho mutants, there appears to be elevated extracellular glycine resulting in persistent inhibition of postsynaptic neurons and subsequent reduced motility, causing the ‘twitch-once’ phenotype. We review current knowledge regarding zebrafish ‘accordion’ and ‘twitch-once’ mutants, including beo and sho, and report the identification of a new α2 subunit that revises the phylogeny of zebrafish GlyRs. PMID:20161699

  2. Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

    Science.gov (United States)

    Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

    2009-04-01

    Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

  3. ILT based defect simulation of inspection images accurately predicts mask defect printability on wafer

    Science.gov (United States)

    Deep, Prakash; Paninjath, Sankaranarayanan; Pereira, Mark; Buck, Peter

    2016-05-01

    printability of defects at wafer level and automates the process of defect dispositioning from images captured using high resolution inspection machine. It first eliminates false defects due to registration, focus errors, image capture errors and random noise caused during inspection. For the remaining real defects, actual mask-like contours are generated using the Calibre® ILT solution [1][2], which is enhanced to predict the actual mask contours from high resolution defect images. It enables accurate prediction of defect contours, which is not possible from images captured using inspection machine because some information is already lost due to optical effects. Calibre's simulation engine is used to generate images at wafer level using scanner optical conditions and mask-like contours as input. The tool then analyses simulated images and predicts defect printability. It automatically calculates maximum CD variation and decides which defects are severe to affect patterns on wafer. In this paper, we assess the printability of defects for the mask of advanced technology nodes. In particular, we will compare the recovered mask contours with contours extracted from SEM image of the mask and compare simulation results with AIMSTM for a variety of defects and patterns. The results of printability assessment and the accuracy of comparison are presented in this paper. We also suggest how this method can be extended to predict printability of defects identified on EUV photomasks.

  4. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  5. Comparative evaluation of low-molecular-mass proteins from Mycobacterium tuberculosis identifies members of the ESAT-6 family as immunodominant T-cell antigens

    DEFF Research Database (Denmark)

    Skjøt, R L; Oettinger, T; Rosenkrands, I

    2000-01-01

    Culture filtrate from Mycobacterium tuberculosis contains protective antigens of relevance for the generation of a new antituberculosis vaccine. We have identified two previously uncharacterized M. tuberculosis proteins (TB7.3 and TB10.4) from the highly active low-mass fraction of culture filtra...

  6. Use of quantitative molecular diagnostic methods to identify causes of diarrhoea in children: a reanalysis of the GEMS case-control study.

    Science.gov (United States)

    Liu, Jie; Platts-Mills, James A; Juma, Jane; Kabir, Furqan; Nkeze, Joseph; Okoi, Catherine; Operario, Darwin J; Uddin, Jashim; Ahmed, Shahnawaz; Alonso, Pedro L; Antonio, Martin; Becker, Stephen M; Blackwelder, William C; Breiman, Robert F; Faruque, Abu S G; Fields, Barry; Gratz, Jean; Haque, Rashidul; Hossain, Anowar; Hossain, M Jahangir; Jarju, Sheikh; Qamar, Farah; Iqbal, Najeeha Talat; Kwambana, Brenda; Mandomando, Inacio; McMurry, Timothy L; Ochieng, Caroline; Ochieng, John B; Ochieng, Melvin; Onyango, Clayton; Panchalingam, Sandra; Kalam, Adil; Aziz, Fatima; Qureshi, Shahida; Ramamurthy, Thandavarayan; Roberts, James H; Saha, Debasish; Sow, Samba O; Stroup, Suzanne E; Sur, Dipika; Tamboura, Boubou; Taniuchi, Mami; Tennant, Sharon M; Toema, Deanna; Wu, Yukun; Zaidi, Anita; Nataro, James P; Kotloff, Karen L; Levine, Myron M; Houpt, Eric R

    2016-09-24

    Diarrhoea is the second leading cause of mortality in children worldwide, but establishing the cause can be complicated by diverse diagnostic approaches and varying test characteristics. We used quantitative molecular diagnostic methods to reassess causes of diarrhoea in the Global Enteric Multicenter Study (GEMS). GEMS was a study of moderate to severe diarrhoea in children younger than 5 years in Africa and Asia. We used quantitative real-time PCR (qPCR) to test for 32 enteropathogens in stool samples from cases and matched asymptomatic controls from GEMS, and compared pathogen-specific attributable incidences with those found with the original GEMS microbiological methods, including culture, EIA, and reverse-transcriptase PCR. We calculated revised pathogen-specific burdens of disease and assessed causes in individual children. We analysed 5304 sample pairs. For most pathogens, incidence was greater with qPCR than with the original methods, particularly for adenovirus 40/41 (around five times), Shigella spp or enteroinvasive Escherichia coli (EIEC) and Campylobactor jejuni o C coli (around two times), and heat-stable enterotoxin-producing E coli ([ST-ETEC] around 1·5 times). The six most attributable pathogens became, in descending order, Shigella spp, rotavirus, adenovirus 40/41, ST-ETEC, Cryptosporidium spp, and Campylobacter spp. Pathogen-attributable diarrhoeal burden was 89·3% (95% CI 83·2-96·0) at the population level, compared with 51·5% (48·0-55·0) in the original GEMS analysis. The top six pathogens accounted for 77·8% (74·6-80·9) of all attributable diarrhoea. With use of model-derived quantitative cutoffs to assess individual diarrhoeal cases, 2254 (42·5%) of 5304 cases had one diarrhoea-associated pathogen detected and 2063 (38·9%) had two or more, with Shigella spp and rotavirus being the pathogens most strongly associated with diarrhoea in children with mixed infections. A quantitative molecular diagnostic approach improved population

  7. Reduction in Defect Content in ODS Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Ritherdon, J.; Jones, A.R.

    2000-02-01

    The work detailed within this report is a continuation of earlier work that was carried out under contract number IDX-SY382V. The earlier work comprised a literature review of the sources and types of defects found principally in Fe-based ODS alloys together with a series of experiments designed to identify defects in ODS Fe{sub 3}Al material and recommend methods of defect reduction. Defects found in the Mechanically Alloyed (MA) ODS Fe{sub 3}Al included regions of incomplete MA, porosity, intrusions and fine-grained stringers. Some defects tended to be found in association with one another e.g. intrusions and fine-grained stringers. Preliminary powder separation experiments were also performed. The scope and objectives of the present work were laid out in the technical proposal ``Reduction in Defect Content in ODS Alloys--II'' which formed the basis of amendment 3 of the current contract. The current studies were devised in the context of the preceding work with a view to extending and concluding certain experiments while exploring new avenues of investigation of defect control and reduction where appropriate. All work proposed was within the context of achieving an ODS Fe{sub 3}Al alloy of improved overall quality and potential creep performance (particularly) in the consolidated, release condition. The interim outturn of the experimental work performed is also reported.

  8. Exploring atomic defects in molybdenum disulphide monolayers

    KAUST Repository

    Hong, Jinhua; Hu, Zhixin; Probert, Matt; Li, Kun; Lv, Danhui; Yang, Xinan; Gu, Lin; Mao, Nannan; Feng, Qingliang; Xie, Liming; Zhang, Jin; Wu, Dianzhong; Zhang, Zhiyong; Jin, Chuanhong; Ji, Wei; Zhang, Xixiang; Yuan, Jun; Zhang, Ze

    2015-01-01

    Defects usually play an important role in tailoring various properties of two-dimensional materials. Defects in two-dimensional monolayer molybdenum disulphide may be responsible for large variation of electric and optical properties. Here we present a comprehensive joint experiment-theory investigation of point defects in monolayer molybdenum disulphide prepared by mechanical exfoliation, physical and chemical vapour deposition. Defect species are systematically identified and their concentrations determined by aberration-corrected scanning transmission electron microscopy, and also studied by ab-initio calculation. Defect density up to 3.5 × 10 13 cm '2 is found and the dominant category of defects changes from sulphur vacancy in mechanical exfoliation and chemical vapour deposition samples to molybdenum antisite in physical vapour deposition samples. Influence of defects on electronic structure and charge-carrier mobility are predicted by calculation and observed by electric transport measurement. In light of these results, the growth of ultra-high-quality monolayer molybdenum disulphide appears a primary task for the community pursuing high-performance electronic devices.

  9. Exploring atomic defects in molybdenum disulphide monolayers

    KAUST Repository

    Hong, Jinhua

    2015-02-19

    Defects usually play an important role in tailoring various properties of two-dimensional materials. Defects in two-dimensional monolayer molybdenum disulphide may be responsible for large variation of electric and optical properties. Here we present a comprehensive joint experiment-theory investigation of point defects in monolayer molybdenum disulphide prepared by mechanical exfoliation, physical and chemical vapour deposition. Defect species are systematically identified and their concentrations determined by aberration-corrected scanning transmission electron microscopy, and also studied by ab-initio calculation. Defect density up to 3.5 × 10 13 cm \\'2 is found and the dominant category of defects changes from sulphur vacancy in mechanical exfoliation and chemical vapour deposition samples to molybdenum antisite in physical vapour deposition samples. Influence of defects on electronic structure and charge-carrier mobility are predicted by calculation and observed by electric transport measurement. In light of these results, the growth of ultra-high-quality monolayer molybdenum disulphide appears a primary task for the community pursuing high-performance electronic devices.

  10. Isolated 2-methylbutyrylglycinuria caused by short/branched-chain acyl-CoA dehydrogenase deficiency: identification of a new enzyme defect, resolution of its molecular basis, and evidence for distinct acyl-CoA dehydrogenases in isoleucine and valine metabolism

    NARCIS (Netherlands)

    Andresen, B. S.; Christensen, E.; Corydon, T. J.; Bross, P.; Pilgaard, B.; Wanders, R. J.; Ruiter, J. P.; Simonsen, H.; Winter, V.; Knudsen, I.; Schroeder, L. D.; Gregersen, N.; Skovby, F.

    2000-01-01

    Acyl-CoA dehydrogenase (ACAD) defects in isoleucine and valine catabolism have been proposed in clinically diverse patients with an abnormal pattern of metabolites in their urine, but they have not been proved enzymatically or genetically, and it is unknown whether one or two ACADs are involved. We

  11. Ventricular Septal Defect (VSD)

    Science.gov (United States)

    ... Call your doctor if your baby or child: Tires easily when eating or playing Is not gaining ... heart procedures. Risk factors Ventricular septal defects may run in families and sometimes may occur with other ...

  12. Birth Defects: Cerebral Palsy

    Science.gov (United States)

    ... Loss > Birth defects & other health conditions > Cerebral palsy Cerebral palsy E-mail to a friend Please fill in ... this page It's been added to your dashboard . Cerebral palsy (also called CP) is a group of conditions ...

  13. Endocardial cushion defect

    Science.gov (United States)

    ... Philadelphia, PA: Elsevier; 2016:chap 426. Kouchoukos NT, Blackstone EH, Hanley FL, Kirklin JK. Atrioventricular septal defect. In: Kouchoukos NT, Blackstone EH, Hanley FL, Kirklin JK, eds. Kirklin/Barratt- ...

  14. Repairing Nanoparticle Surface Defects

    NARCIS (Netherlands)

    Marino, Emanuele; Kodger, Thomas E.; Crisp, R.W.; Timmerman, Dolf; MacArthur, Katherine E.; Heggen, Marc; Schall, Peter

    2017-01-01

    Solar devices based on semiconductor nanoparticles require the use of conductive ligands; however, replacing the native, insulating ligands with conductive metal chalcogenide complexes introduces structural defects within the crystalline nanostructure that act as traps for charge carriers. We

  15. Point defects in platinum

    International Nuclear Information System (INIS)

    Piercy, G.R.

    1960-01-01

    An investigation was made of the mobility and types of point defect introduced in platinum by deformation in liquid nitrogen, quenching into water from 1600 o C, or reactor irradiation at 50 o C. In all cases the activation energy for motion of the defect was determined from measurements of electrical resistivity. Measurements of density, hardness, and x-ray line broadening were also made there applicable. These experiments indicated that the principal defects remaining in platinum after irradiation were single vacant lattice sites and after quenching were pairs of vacant lattice sites. Those present after deformation In liquid nitrogen were single vacant lattice sites and another type of defect, perhaps interstitial atoms. (author)

  16. Molecular characterization of the VP4, VP6, VP7, and NSP4 genes of lapine rotaviruses identified in italy: emergence of a novel VP4 genotype

    International Nuclear Information System (INIS)

    Martella, Vito; Ciarlet, Max; Camarda, Antonio; Pratelli, Annamaria; Tempesta, Maria; Greco, Grazia; Cavalli, Alessandra; Elia, Gabriella; Decaro, Nicola; Terio, Valentina; Bozzo, Giancarlo; Camero, Michele; Buonavoglia, Canio

    2003-01-01

    The genes encoding the glycoprotein VP7, the VP8* trypsin-cleavage product of the protein VP4, a fragment of the protein VP6 associated with subgroup (SG) specificity, and the enterotoxin NSP4 of rotavirus strains identified in diarrheic fecal samples of rabbits in Italy were sequenced. The Italian lapine rotavirus (LRV) strains possessed a G3 VP7, SG I VP6, and KUN-like NSP4, a gene constellation typical of LRVs. One LRV strain (30/96), isolated in 1996, shared the closest amino acid (aa) identity (87-96%) with the P[14] genotype, composed of human and LRV strains. Conversely, three LRV strains (160/01, 229/01, and 308/01), identified in 2001, were highly identical (90-95%) among each other, but showed low aa identity (34-77%) to the VP8* genotype-specific sequences of representative rotavirus strains of all remaining P genotypes. This report confirms the worldwide genetic constellations of LRVs and identifies a novel VP4 genotype in rabbits, tentatively proposed as genotype P[22

  17. Giant Galápagos tortoises; molecular genetic analyses identify a trans-island hybrid in a repatriation program of an endangered taxon

    Directory of Open Access Journals (Sweden)

    Caccone Adalgisa

    2007-02-01

    Full Text Available Abstract Background Giant Galápagos tortoises on the island of Española have been the focus of an intensive captive breeding-repatriation programme for over 35 years that saved the taxon from extinction. However, analysis of 118 samples from released individuals indicated that the bias sex ratio and large variance in reproductive success among the 15 breeders has severely reduced the effective population size (Ne. Results We report here that an analysis of an additional 473 captive-bred tortoises released back to the island reveals an individual (E1465 that exhibits nuclear microsatellite alleles not found in any of the 15 breeders. Statistical analyses incorporating genotypes of 304 field-sampled individuals from all populations on the major islands indicate that E1465 is most probably a hybrid between an Española female tortoise and a male from the island of Pinzón, likely present on Española due to human transport. Conclusion Removal of E1465 as well as its father and possible (half-siblings is warranted to prevent further contamination within this taxon of particular conservation significance. Despite this detected single contamination, it is highly noteworthy to emphasize the success of this repatriation program conducted over nearly 40 years and involving release of over 2000 captive-bred tortoises that now reproduce in situ. The incorporation of molecular genetic analysis of the program is providing guidance that will aid in monitoring the genetic integrity of this ambitious effort to restore a unique linage of a spectacular animal.

  18. What does it take to resolve relationships and to identify species with molecular markers? An example from the epiphytic Rhipsalideae (Cactaceae).

    Science.gov (United States)

    Korotkova, Nadja; Borsch, Thomas; Quandt, Dietmar; Taylor, Nigel P; Müller, Kai F; Barthlott, Wilhelm

    2011-09-01

    The Cactaceae are a major New World plant family and popular in horticulture. Still, taxonomic units and species limits have been difficult to define, and molecular phylogenetic studies so far have yielded largely unresolved trees, so relationships within Cactaceae remain insufficiently understood. This study focuses on the predominantly epiphytic tribe Rhipsalideae and evaluates the utility of a spectrum of plastid genomic regions. • We present a phylogenetic study including 52 of the 53 Rhipsalideae species and all the infraspecific taxa. Seven regions (trnK intron, matK, rbcL, rps3-rpl16, rpl16 intron, psbA-trnH, trnQ-rps16), ca. 5600 nucleotides (nt) were sequenced per sample. The regions used were evaluated for their phylogenetic performance and performance in DNA-based species recognition based on operational taxonomic units (OTUs) defined beforehand. • The Rhipsalideae are monophyletic and contain five clades that correspond to the genera Rhipsalis, Lepismium, Schlumbergera, Hatiora, and Rhipsalidopsis. The species-level tree was well resolved and supported; the rpl16 and trnK introns yielded the best phylogenetic signal. Although the psbA-trnH and trnQ-rps16 spacers were the most successful individual regions for OTU identification, their success rate did not significantly exceed 70%. The highest OTU identification rate of 97% was found using the combination of psbA-trnH, rps3-rpl16, trnK intron, and trnQ-rps16 as a minimum possible marker length (ca. 1660 nt). • The phylogenetic performance of a marker is not determined by the level of sequence variability, and species discrimination power does not necessarily correlate with phylogenetic utility.

  19. Reduction in Defect Content of ODS Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Ritherdon, J

    2001-05-15

    The work detailed within this report is a continuation of earlier work carried out under contract number 1DX-SY382V. The earlier work comprises a literature review of the sources and types of defects found principally in Fe-based ODS alloys as well as experimental work designed to identify defects in the prototype ODS-Fe{sub 3}Al alloy, deduce their origins and to recommend methods of defect reduction. The present work is an extension of the experimental work already reported and concentrates on means of reduction of defects already identified rather than the search for new defect types. This report also includes results gathered during powder separation trials, conducted by the University of Groningen, Netherlands and coordinated by the University of Liverpool, involving the separation of different metallic powders in terms of their differing densities. The scope and objectives of the present work were laid out in the technical proposal ''Reduction in Defect Content in ODS Alloys-III''. All the work proposed in the ''Statement of Work'' section of the technical proposal has been carried out and all work extra to the ''Statement of Work'' falls within the context of an ODS-Fe{sub 3}Al alloy of improved overall quality and potential creep performance in the consolidated form. The outturn of the experimental work performed is reported in the following sections.

  20. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  1. Urinary Metabolomics Identifies a Molecular Correlate of Interstitial Cystitis/Bladder Pain Syndrome in a Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP Research Network Cohort

    Directory of Open Access Journals (Sweden)

    Kaveri S. Parker

    2016-05-01

    Full Text Available Interstitial cystitis/bladder pain syndrome (IC/BPS is a poorly understood syndrome affecting up to 6.5% of adult women in the U.S. The lack of broadly accepted objective laboratory markers for this condition hampers efforts to diagnose and treat this condition. To identify biochemical markers for IC/BPS, we applied mass spectrometry-based global metabolite profiling to urine specimens from a cohort of female IC/BPS subjects from the Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP Research Network. These analyses identified multiple metabolites capable of discriminating IC/BPS and control subjects. Of these candidate markers, etiocholan-3α-ol-17-one sulfate (Etio-S, a sulfoconjugated 5-β reduced isomer of testosterone, distinguished female IC/BPS and control subjects with a sensitivity and specificity >90%. Among IC/BPS subjects, urinary Etio-S levels are correlated with elevated symptom scores (symptoms, pelvic pain, and number of painful body sites and could resolve high- from low-symptom IC/BPS subgroups. Etio-S-associated biochemical changes persisted through 3–6 months of longitudinal follow up. These results raise the possibility that an underlying biochemical abnormality contributes to symptoms in patients with severe IC/BPS.

  2. Electronic Rydberg wavepacket effects on molecular vibration

    International Nuclear Information System (INIS)

    Hughes, I.G.; Meacher, D.R.

    1994-01-01

    Electronic wavepacket states of molecular hydrogen are considered which represent the situation of a spectator electron orbiting a molecular core. A quantum defect theory approach is used to determine the energy level structure, wavefunctions and molecular potentials, which is valid in regions where the quantum defects approach zero. In such a region the orbital motion of the wavepacket leads to a periodic variation in the molecular vibration frequency of the order of 100 cm -1 . Possible detection schemes are discussed. (author)

  3. Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

    Science.gov (United States)

    Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

    2012-07-01

    Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and

  4. Defect sizing using automated ultrasonic inspection techniques at RNL

    International Nuclear Information System (INIS)

    Rogerson, A.; Highmore, P.J.; Poulter, L.N.J.

    1983-10-01

    RNL has developed and applied automated wide-beam pulse-echo and time-of-flight techniques with synthetic aperture processing for sizing defects in clad thick-section weldments and nozzle corner regions. These techniques were amongst those used in the four test plate inspections making up the UKAEA Defect Detection Trials. In this report a critical appraisal is given of the sizing procedures adopted by RNL in these inspections. Several factors influencing sizing accuracy are discussed and results from particular defects highlighted. The time-of-flight technique with colour graphics data display is shown to be highly effective in imaging near-vertical buried defects and underclad defects of height greater than 5 mm. Early characterisation of any identified defect from its ultrasonic response under pulse-echo inspection is seen as a desirable aid to the selection of an appropriate advanced sizing technique for buried defects. (author)

  5. Observation of point defects in impurity-doped zinc selenide films using a monoenergetic positron beam

    International Nuclear Information System (INIS)

    Miyajima, T.; Okuyama, H.; Akimoto, K.; Mori, Y.; Wei, L.; Tanigawa, S.

    1992-01-01

    We studied point defects in ZnSe films grown by molecular beam epitaxy using the positron annihilation method. We found that doping with Ga atoms induces vacancy-type defects such as Zn vacancies, and that heavy doping with oxygen atoms induces interstitial type defects. We think that these defects are one of the causes of active carrier saturation in doped ZnSe films. (author)

  6. Norwegian Pitched Roof Defects

    Directory of Open Access Journals (Sweden)

    Lars Gullbrekken

    2016-06-01

    Full Text Available The building constructions investigated in this work are pitched wooden roofs with exterior vertical drainpipes and wooden load-bearing system. The aim of this research is to further investigate the building defects of pitched wooden roofs and obtain an overview of typical roof defects. The work involves an analysis of the building defect archive from the research institute SINTEF Building and Infrastructure. The findings from the SINTEF archive show that moisture is a dominant exposure factor, especially in roof constructions. In pitched wooden roofs, more than half of the defects are caused by deficiencies in design, materials, or workmanship, where these deficiencies allow moisture from precipitation or indoor moisture into the structure. Hence, it is important to increase the focus on robust and durable solutions to avoid defects both from exterior and interior moisture sources in pitched wooden roofs. Proper design of interior ventilation and vapour retarders seem to be the main ways to control entry from interior moisture sources into attic and roof spaces.

  7. Investigation of Shrinkage Defect in Castings by Quantitative Ishikawa Diagram

    Directory of Open Access Journals (Sweden)

    Chokkalingam B.

    2017-03-01

    Full Text Available Metal casting process involves processes such as pattern making, moulding and melting etc. Casting defects occur due to combination of various processes even though efforts are taken to control them. The first step in the defect analysis is to identify the major casting defect among the many casting defects. Then the analysis is to be made to find the root cause of the particular defect. Moreover, it is especially difficult to identify the root causes of the defect. Therefore, a systematic method is required to identify the root cause of the defect among possible causes, consequently specific remedial measures have to be implemented to control them. This paper presents a systematic procedure to identify the root cause of shrinkage defect in an automobile body casting (SG 500/7 and control it by the application of Pareto chart and Ishikawa diagram. with quantitative Weightage. It was found that the root causes were larger volume section in the cope, insufficient feeding of riser and insufficient poured metal in the riser. The necessary remedial measures were taken and castings were reproduced. The shrinkage defect in the castings was completely eliminated.

  8. Epidemiological links between tuberculosis cases identified twice as efficiently by whole genome sequencing than conventional molecular typing: A population-based study.

    Science.gov (United States)

    Jajou, Rana; de Neeling, Albert; van Hunen, Rianne; de Vries, Gerard; Schimmel, Henrieke; Mulder, Arnout; Anthony, Richard; van der Hoek, Wim; van Soolingen, Dick

    2018-01-01

    Patients with Mycobacterium tuberculosis isolates sharing identical DNA fingerprint patterns can be epidemiologically linked. However, municipal health services in the Netherlands are able to confirm an epidemiological link in only around 23% of the patients with isolates clustered by the conventional variable number of tandem repeat (VNTR) genotyping. This research aims to investigate whether whole genome sequencing (WGS) is a more reliable predictor of epidemiological links between tuberculosis patients than VNTR genotyping. VNTR genotyping and WGS were performed in parallel on all Mycobacterium tuberculosis complex isolates received at the Netherlands National Institute for Public Health and the Environment in 2016. Isolates were clustered by VNTR when they shared identical 24-loci VNTR patterns; isolates were assigned to a WGS cluster when the pair-wise genetic distance was ≤ 12 single nucleotide polymorphisms (SNPs). Cluster investigation was performed by municipal health services on all isolates clustered by VNTR in 2016. The proportion of epidemiological links identified among patients clustered by either method was calculated. In total, 535 isolates were genotyped, of which 25% (134/535) were clustered by VNTR and 14% (76/535) by WGS; the concordance between both typing methods was 86%. The proportion of epidemiological links among WGS clustered cases (57%) was twice as common than among VNTR clustered cases (31%). When WGS was applied, the number of clustered isolates was halved, while all epidemiologically linked cases remained clustered. WGS is therefore a more reliable tool to predict epidemiological links between tuberculosis cases than VNTR genotyping and will allow more efficient transmission tracing, as epidemiological investigations based on false clustering can be avoided.

  9. Molecular biology of human muscle disease

    Energy Technology Data Exchange (ETDEWEB)

    Dunne, P.W.; Epstein, H.F. (Baylor Coll. of Medicine, Houston, TX (United States))

    1991-01-01

    The molecular revolution that is transforming the entire biomedical field has had far-reaching impact in its application to inherited human muscle disease. The gene for Duchenne muscular dystrophy was one of the first cloned without knowledge of the defective protein product. This success was based upon the availability of key chromosomal aberrations that provided molecular landmarks for the disease locus. Subsequent discoveries regarding the mode of expression for this gene, the structure and localization of its protein product dystrophin, and molecular diagnosis of affected and carrier individuals constitute a paradigm for investigation of human genetics. Finding the gene for myotonic muscular dystrophy is requiring the brute force approach of cloning several million bases of DNA, identifying expressed sequences, and characterizing candidate genes. The gene that causes hypertrophic cardiomyopathy has been found serendipitously to be one of the genetic markers on chromosome 14, the {beta} myosin heavy chain.

  10. Exploring the influence of EGCG on the β-sheet-rich oligomers of human islet amyloid polypeptide (hIAPP1-37 and identifying its possible binding sites from molecular dynamics simulation.

    Directory of Open Access Journals (Sweden)

    Qianqian Wang

    Full Text Available EGCG possesses the ability of disaggregating the existing amyloid fibrils which were associated with many age-related degenerative diseases. However, the molecular mechanism of EGCG to disaggregate these fibrils is poorly known. In this work, to study the influence of EGCG on the full-length human islet amyloid polypeptide 1-37 (hIAPP1-37 oligomers, molecular dynamics simulations of hIAPP1-37 pentamer and decamer with EGCG were performed, respectively. The obtained results indicate that EGCG indeed destabilized the hIAPP1-37 oligomers. The nematic order parameter and secondary structure calculations coupled with the free-energy landscape indicate that EGCG broke the initial ordered pattern of two polymers, greatly reduced their β-sheet content and enlarged their conformational space. On this basis, three possible target sites were identified with the binding capacity order of S1>S2>S3. After a deeper analysis of each site, we found that S1 was the most possible site on which residues B-Ile26/Ala25, A-Phe23, B/C-Leu27 and E-Tyr37 played an important role for their binding. The proposal of this molecular mechanism can not only provide a prospective interaction figure between EGCG and β-sheet-rich fibrils of hIAPP1-37, but also is useful for further discovering other potential inhibitors.

  11. Repairing Nanoparticle Surface Defects.

    Science.gov (United States)

    Marino, Emanuele; Kodger, Thomas E; Crisp, Ryan W; Timmerman, Dolf; MacArthur, Katherine E; Heggen, Marc; Schall, Peter

    2017-10-23

    Solar devices based on semiconductor nanoparticles require the use of conductive ligands; however, replacing the native, insulating ligands with conductive metal chalcogenide complexes introduces structural defects within the crystalline nanostructure that act as traps for charge carriers. We utilized atomically thin semiconductor nanoplatelets as a convenient platform for studying, both microscopically and spectroscopically, the development of defects during ligand exchange with the conductive ligands Na 4 SnS 4 and (NH 4 ) 4 Sn 2 S 6 . These defects can be repaired via mild chemical or thermal routes, through the addition of L-type ligands or wet annealing, respectively. This results in a higher-quality, conductive, colloidally stable nanomaterial that may be used as the active film in optoelectronic devices. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  12. Defect identification using positrons

    International Nuclear Information System (INIS)

    Beling, C.D.; Fung, S.

    2001-01-01

    The current use of the lifetime and Doppler broadening techniques in defect identification is demonstrated with two studies, the first being the identification of carbon vacancy in n-6H SiC through lifetime spectroscopy, and the second the production of de-hydrogenated voids in α-Si:H through light soaking. Some less conventional ideas are presented for more specific defect identification, namely (i) the amalgamation of lifetime and Doppler techniques with conventional deep level transient spectroscopy in what may be called ''positron-deep level transient spectroscopy'', and (ii) the extraction of more spatial information on vacancy defects by means of what may be called ''Fourier transform Doppler broadening of annihilation radiation spectroscopy'' (orig.)

  13. Key Questions in Building Defect Prediction Models in Practice

    Science.gov (United States)

    Ramler, Rudolf; Wolfmaier, Klaus; Stauder, Erwin; Kossak, Felix; Natschläger, Thomas

    The information about which modules of a future version of a software system are defect-prone is a valuable planning aid for quality managers and testers. Defect prediction promises to indicate these defect-prone modules. However, constructing effective defect prediction models in an industrial setting involves a number of key questions. In this paper we discuss ten key questions identified in context of establishing defect prediction in a large software development project. Seven consecutive versions of the software system have been used to construct and validate defect prediction models for system test planning. Furthermore, the paper presents initial empirical results from the studied project and, by this means, contributes answers to the identified questions.

  14. Defects in semiconductors

    International Nuclear Information System (INIS)

    Pimentel, C.A.F.

    1983-01-01

    Some problems openned in the study of defects in semiconductors are presented. In particular, a review is made of the more important problems in Si monocrystals of basic and technological interest: microdefects and the presence of oxigen and carbon. The techniques usually utilized in the semiconductor material characterization are emphatized according its potentialities. Some applications of x-ray techniques in the epitaxial shell characterization in heterostructures, importants in electronic optics, are shown. The increase in the efficiency of these defect analysis methods in semiconductor materials with the use of synchrotron x-ray sources is shown. (L.C.) [pt

  15. A novel inspection system for cosmetic defects

    Science.gov (United States)

    Hazra, S.; Roy, R.; Williams, D.; Aylmore, R.; Hollingdale, D.

    2013-12-01

    The appearance of automotive skin panels creates desirability for a product and differentiates it from the competition. Because of the importance of skin panels, considerable care is taken in minimizing defects such as the 'hollow' defect that occur around door-handle depressions. However, the inspection process is manual, subjective and time-consuming. This paper describes the development of an objective and inspection scheme for the 'hollow' defect. In this inspection process, the geometry of a panel is captured using a structured lighting system. The geometry data is subsequently analyzed by a purpose-built wavelet-based algorithm to identify the location of any defects that may be present and to estimate the perceived severity of the defects without user intervention. This paper describes and critically evaluates the behavior of this physically-based algorithm on an ideal and real geometry and compares its result to an actual audit. The results show that the algorithm is capable of objectively locating and classifying 'hollow' defects in actual panels.

  16. Power spectrum analysis for defect screening in integrated circuit devices

    Science.gov (United States)

    Tangyunyong, Paiboon; Cole Jr., Edward I.; Stein, David J.

    2011-12-01

    A device sample is screened for defects using its power spectrum in response to a dynamic stimulus. The device sample receives a time-varying electrical signal. The power spectrum of the device sample is measured at one of the pins of the device sample. A defect in the device sample can be identified based on results of comparing the power spectrum with one or more power spectra of the device that have a known defect status.

  17. Slow Replication Fork Velocity of Homologous Recombination-Defective Cells Results from Endogenous Oxidative Stress

    Science.gov (United States)

    Magdalou, Indiana; Machon, Christelle; Dardillac, Elodie; Técher, Hervé; Guitton, Jérôme; Debatisse, Michelle; Lopez, Bernard S.

    2016-01-01

    Replications forks are routinely hindered by different endogenous stresses. Because homologous recombination plays a pivotal role in the reactivation of arrested replication forks, defects in homologous recombination reveal the initial endogenous stress(es). Homologous recombination-defective cells consistently exhibit a spontaneously reduced replication speed, leading to mitotic extra centrosomes. Here, we identify oxidative stress as a major endogenous source of replication speed deceleration in homologous recombination-defective cells. The treatment of homologous recombination-defective cells with the antioxidant N-acetyl-cysteine or the maintenance of the cells at low O2 levels (3%) rescues both the replication fork speed, as monitored by single-molecule analysis (molecular combing), and the associated mitotic extra centrosome frequency. Reciprocally, the exposure of wild-type cells to H2O2 reduces the replication fork speed and generates mitotic extra centrosomes. Supplying deoxynucleotide precursors to H2O2-exposed cells rescued the replication speed. Remarkably, treatment with N-acetyl-cysteine strongly expanded the nucleotide pool, accounting for the replication speed rescue. Remarkably, homologous recombination-defective cells exhibit a high level of endogenous reactive oxygen species. Consistently, homologous recombination-defective cells accumulate spontaneous γH2AX or XRCC1 foci that are abolished by treatment with N-acetyl-cysteine or maintenance at 3% O2. Finally, oxidative stress stimulated homologous recombination, which is suppressed by supplying deoxynucleotide precursors. Therefore, the cellular redox status strongly impacts genome duplication and transmission. Oxidative stress should generate replication stress through different mechanisms, including DNA damage and nucleotide pool imbalance. These data highlight the intricacy of endogenous replication and oxidative stresses, which are both evoked during tumorigenesis and senescence initiation

  18. Slow Replication Fork Velocity of Homologous Recombination-Defective Cells Results from Endogenous Oxidative Stress.

    Directory of Open Access Journals (Sweden)

    Therese Wilhelm

    2016-05-01

    Full Text Available Replications forks are routinely hindered by different endogenous stresses. Because homologous recombination plays a pivotal role in the reactivation of arrested replication forks, defects in homologous recombination reveal the initial endogenous stress(es. Homologous recombination-defective cells consistently exhibit a spontaneously reduced replication speed, leading to mitotic extra centrosomes. Here, we identify oxidative stress as a major endogenous source of replication speed deceleration in homologous recombination-defective cells. The treatment of homologous recombination-defective cells with the antioxidant N-acetyl-cysteine or the maintenance of the cells at low O2 levels (3% rescues both the replication fork speed, as monitored by single-molecule analysis (molecular combing, and the associated mitotic extra centrosome frequency. Reciprocally, the exposure of wild-type cells to H2O2 reduces the replication fork speed and generates mitotic extra centrosomes. Supplying deoxynucleotide precursors to H2O2-exposed cells rescued the replication speed. Remarkably, treatment with N-acetyl-cysteine strongly expanded the nucleotide pool, accounting for the replication speed rescue. Remarkably, homologous recombination-defective cells exhibit a high level of endogenous reactive oxygen species. Consistently, homologous recombination-defective cells accumulate spontaneous γH2AX or XRCC1 foci that are abolished by treatment with N-acetyl-cysteine or maintenance at 3% O2. Finally, oxidative stress stimulated homologous recombination, which is suppressed by supplying deoxynucleotide precursors. Therefore, the cellular redox status strongly impacts genome duplication and transmission. Oxidative stress should generate replication stress through different mechanisms, including DNA damage and nucleotide pool imbalance. These data highlight the intricacy of endogenous replication and oxidative stresses, which are both evoked during tumorigenesis and

  19. Slow Replication Fork Velocity of Homologous Recombination-Defective Cells Results from Endogenous Oxidative Stress.

    Science.gov (United States)

    Wilhelm, Therese; Ragu, Sandrine; Magdalou, Indiana; Machon, Christelle; Dardillac, Elodie; Técher, Hervé; Guitton, Jérôme; Debatisse, Michelle; Lopez, Bernard S

    2016-05-01

    Replications forks are routinely hindered by different endogenous stresses. Because homologous recombination plays a pivotal role in the reactivation of arrested replication forks, defects in homologous recombination reveal the initial endogenous stress(es). Homologous recombination-defective cells consistently exhibit a spontaneously reduced replication speed, leading to mitotic extra centrosomes. Here, we identify oxidative stress as a major endogenous source of replication speed deceleration in homologous recombination-defective cells. The treatment of homologous recombination-defective cells with the antioxidant N-acetyl-cysteine or the maintenance of the cells at low O2 levels (3%) rescues both the replication fork speed, as monitored by single-molecule analysis (molecular combing), and the associated mitotic extra centrosome frequency. Reciprocally, the exposure of wild-type cells to H2O2 reduces the replication fork speed and generates mitotic extra centrosomes. Supplying deoxynucleotide precursors to H2O2-exposed cells rescued the replication speed. Remarkably, treatment with N-acetyl-cysteine strongly expanded the nucleotide pool, accounting for the replication speed rescue. Remarkably, homologous recombination-defective cells exhibit a high level of endogenous reactive oxygen species. Consistently, homologous recombination-defective cells accumulate spontaneous γH2AX or XRCC1 foci that are abolished by treatment with N-acetyl-cysteine or maintenance at 3% O2. Finally, oxidative stress stimulated homologous recombination, which is suppressed by supplying deoxynucleotide precursors. Therefore, the cellular redox status strongly impacts genome duplication and transmission. Oxidative stress should generate replication stress through different mechanisms, including DNA damage and nucleotide pool imbalance. These data highlight the intricacy of endogenous replication and oxidative stresses, which are both evoked during tumorigenesis and senescence initiation

  20. Molecular dynamics simulations of Hsp40 J-domain mutants identifies disruption of the critical HPD-motif as the key factor for impaired curing in vivo of the yeast prion [URE3].

    Science.gov (United States)

    Xue, You-Lin; Wang, Hao; Riedy, Michael; Roberts, Brittany-Lee; Sun, Yuna; Song, Yong-Bo; Jones, Gary W; Masison, Daniel C; Song, Youtao

    2018-05-01

    Genetic screens using Saccharomyces cerevisiae have identified an array of Hsp40 (Ydj1p) J-domain mutants that are impaired in the ability to cure the yeast [URE3] prion through disrupting functional interactions with Hsp70. However, biochemical analysis of some of these Hsp40 J-domain mutants has so far failed to provide major insight into the specific functional changes in Hsp40-Hsp70 interactions. To explore the detailed structural and dynamic properties of the Hsp40 J-domain, 20 ns molecular dynamic simulations of 4 mutants (D9A, D36A, A30T, and F45S) and wild-type J-domain were performed, followed by Hsp70 docking simulations. Results demonstrated that although the Hsp70 interaction mechanism of the mutants may vary, the major structural change was targeted to the critical HPD motif of the J-domain. Our computational analysis fits well with previous yeast genetics studies regarding highlighting the importance of J-domain function in prion propagation. During the molecular dynamics simulations several important residues were identified and predicted to play an essential role in J-domain structure. Among these residues, Y26 and F45 were confirmed, using both in silico and in vivo methods, as being critical for Ydj1p function.

  1. Defects introduced by Ar plasma exposure in GaAs probed by monoenergetic positron beam

    Energy Technology Data Exchange (ETDEWEB)

    Uedono, Akira; Tanigawa, Shoichiro [Tsukuba Univ., Ibaraki (Japan). Inst. of Materials Science; Kawano, Takao; Wada, Kazumi; Nakanishi, Hideo

    1994-10-01

    Ar-plasma-induced defects in n-type GaAs were probed by a monoenergetic positron beam. The depth distribution of the defects was obtained from measurements of Doppler broadening profiles of the annihilation radiation as a function of incident positron energy. The damaged layer induced by the exposure was found to extend far beyond the stopping range of Ar ions, and the dominant defects were identified as interstitial-type defects. After 100degC annealing, such defects were annealed. Instead, vacancy-type defects were found to be the dominant defects in the subsurface region. (author).

  2. Kinetics of interstitial defects in α-Fe: The effect from uniaxial stress

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Changwoo [Department of Nuclear Engineering, Texas A& M University, College Station, TX 77843 (United States); Wang, Qingyu [College of Nuclear Science and Technology, Harbin Engineering University, Harbin 150001 (China); Shao, Lin, E-mail: lshao@tamu.edu [Department of Nuclear Engineering, Texas A& M University, College Station, TX 77843 (United States)

    2017-03-15

    Understanding defect kinetics in a stress field is important for multiscale modeling of materials degradation of nuclear materials. By means of molecular dynamics and molecular statics simulations, we calculate formation and migration energies of self-interstitial atoms (SIA) and SIA clusters (up to size of 5 interstitials) in alpha Fe and identify their stable configurations under uniaxial tensile strains. By applying uniaxial stress along [111], <111> oriented single SIA defects become more stable than <110> oriented SIA, which is opposite to stress-free condition. Diffusion of single SIA defects under [111] tensile stress is facilitated along [111] direction and the diffusion becomes one dimensional (1D). For SIA clusters, their diffusion under zero stress has gradual transition from three dimensional (3D) for small clusters to one dimensional (1D) for large clusters. Under the tensile stress along [111], the 3D to 1D transition is accelerated. For large SIA clusters, the stress effect is quickly saturated with less diffusivity enhancement in comparison with small SIA clusters.

  3. Defect detection module

    International Nuclear Information System (INIS)

    Ernwein, R.; Westermann, G.

    1986-01-01

    The ''defect detector'' module is aimed at exceptional event or state recording. Foreseen for voltage presence monitoring on high supply voltage module of drift chambers, its characteristics can also show up the vanishing of supply voltage and take in account transitory fast signals [fr

  4. Interaction between dangling bonds in vacancy-defects in silicon

    International Nuclear Information System (INIS)

    Caldas, M.J.; Fazzio, A.

    1983-01-01

    The 'defect-molecule' model in the simplest scheme (without configuration interaction) is reviewed and the concept of 'delocalized dangling-bonds' is explorated in the study of the interaction between the unsaturated hybrids of the mono and divacancy in silicon. The 'defect-molecule' hamiltonian is written in parametric form, and the parameters are extracted from full self-consistent calculations for both systems carried out through the MS-Xα molecular cluster model. (Author) [pt

  5. Amino acids interacting with defected carbon nanotubes: ab initio calculations

    Directory of Open Access Journals (Sweden)

    M. Darvish Ganji

    2016-09-01

    Full Text Available The adsorption of a number of amino acids on a defected single-walled carbon nanotube (SWCNT is investigated by using the density-functional theory (DFT calculations. The adsorption energies and equilibrium distances are calculated for various configurations such as amino acid attaching to defect sites heptagon, pentagon and hexagon in defective tube and also for several molecular orientations with respect to the nanotube surface. The results showed that amino acids prefer to be physisorbed on the outer surface of the defected nanotube with different interaction strength following the hierarchy histidine > glycine > phenylalanine > cysteine. Comparing these findings with those obtained for perfect SWCNTs reveals that the adsorption energy of the amino acids increase for adsorption onto defected CNTs. The adsorption nature has also been evaluated by means of electronics structures analysis within the Mulliken population and DOS spectra for the interacting entities.

  6. The quantum defect: Early history and recent developments

    International Nuclear Information System (INIS)

    Rau, A.R.; Inokuti, M.

    1997-01-01

    The notion of the quantum defect is important in atomic and molecular spectroscopy and also in unifying spectroscopy with collision theory. In the latter context, the quantum defect may be viewed as an ancestor of the phase shift. However, the origin of the term open-quotes quantum defectclose quotes does not seem to be explained in standard textbooks. It occurred in a 1921 paper by Schroedinger, preceding quantum mechanics, yet giving the correct meaning as an index of the short-range interactions with the core of an atom. We present the early history of the quantum-defect idea, and sketch its recent developments. copyright 1997 American Association of Physics Teachers

  7. In Situ Observation of Antisite Defect Formation during Crystal Growth

    International Nuclear Information System (INIS)

    Kramer, M. J.; Napolitano, R. E.; Mendelev, M. I.

    2010-01-01

    In situ x-ray diffraction (XRD) coupled with molecular dynamics (MD) simulations have been used to quantify antisite defect trapping during crystallization. Rietveld refinement of the XRD data revealed a marked lattice distortion which involves an a axis expansion and a c axis contraction of the stable C11b phase. The observed lattice response is proportional in magnitude to the growth rate, suggesting that the behavior is associated with the kinetic trapping of lattice defects. MD simulations demonstrate that this lattice response is due to incorporation of 1% to 2% antisite defects during growth.

  8. Identifying the Molecular Origin of Global Warming

    Science.gov (United States)

    Bera, Partha P.; Francisco, Joseph S.; Lee, Timothy J.

    2009-01-01

    We have investigated the physical characteristics of greenhouse gases (GHGs) to assess which properties are most important in determining the efficiency of a GHG. Chlorofluorcarbons (CFCs), hydrofluorocarbons (HFCs), perfluorocarbons (PFCs), nitrogen fluorides, and various other known atmospheric trace molecules have been included in this study. Compounds containing the halogens F or Cl have in common very polar X-F or X-Cl bonds, particularly the X-F bonds. It is shown that as more F atoms bond to the same central atom, the bond dipoles become larger as a result of the central atom becoming more positive. This leads to a linear increase in the total or integrated XF bond dipole derivatives for the molecule, which leads to a non-linear (quadratic) increase in infrared (IR) intensity. Moreover, virtually all of the X-F bond stretches occur in the atmospheric IR window as opposed to X-H stretches, which do not occur in the atmospheric window. It is concluded that molecules possessing several F atoms will always have a large radiative forcing parameter in the calculation of their global warming potential. Some of the implications for global warming and climate change are discussed.

  9. CT Image Sequence Processing For Wood Defect Recognition

    Science.gov (United States)

    Dongping Zhu; R.W. Conners; Philip A. Araman

    1991-01-01

    The research reported in this paper explores a non-destructive testing application of x-ray computed tomography (CT) in the forest products industry. This application involves a computer vision system that uses CT to locate and identify internal defects in hardwood logs. The knowledge of log defects is critical in deciding whether to veneer or to saw up a log, and how...

  10. Investigation of naphthofuran moiety as potential dual inhibitor against BACE-1 and GSK-3β: molecular dynamics simulations, binding energy, and network analysis to identify first-in-class dual inhibitors against Alzheimer's disease.

    Science.gov (United States)

    Kumar, Akhil; Srivastava, Gaurava; Srivastava, Swati; Verma, Seema; Negi, Arvind S; Sharma, Ashok

    2017-08-01

    BACE-1 and GSK-3β are potential therapeutic drug targets for Alzheimer's disease. Recently, both the targets received attention for designing dual inhibitors for Alzheimer's disease. Until now, only two-scaffold triazinone and curcumin have been reported as BACE-1 and GSK-3β dual inhibitors. Docking, molecular dynamics, clustering, binding energy, and network analysis of triazinone derivatives with BACE-1 and GSK-3β was performed to get molecular insight into the first reported dual inhibitor. Further, we designed and evaluated a naphthofuran series for its ability to inhibit BACE-1 and GSK-3β with the computational approaches. Docking study of naphthofuran series showed a good binding affinity towards both the targets. Molecular dynamics, binding energy, and network analysis were performed to compare their binding with the targets and amino acids responsible for binding. Naphthofuran series derivatives showed good interaction within the active site residues of both of the targets. Hydrogen bond occupancy and binding energy suggested strong binding with the targets. Dual-inhibitor binding was mostly governed by the hydrophobic interactions for both of the targets. Per residue energy decomposition and network analysis identified the key residues involved in the binding and inhibiting BACE-1 and GSK-3β. The results indicated that naphthofuran series derivative 11 may be a promising first-in-class dual inhibitor against BACE-1 and GSK-3β. This naphthofuran series may be further explored to design better dual inhibitors. Graphical abstract Naphthofuran derivative as a dual inhibitor for BACE-1 and GSK-3β.

  11. Congenital Heart Defects (For Parents)

    Science.gov (United States)

    ... to be associated with genetic disorders, such as Down syndrome . But the cause of most congenital heart defects isn't known. While they can't be prevented, many treatments are available for the defects and related health ...

  12. Antigravity from a spacetime defect

    OpenAIRE

    Klinkhamer, F. R.; Queiruga, J. M.

    2018-01-01

    We argue that there may exist spacetime defects embedded in Minkowski spacetime, which have negative active gravitational mass. One such spacetime defect then repels a test particle, corresponding to what may be called "antigravity."

  13. Defect engineering of ZnO

    Energy Technology Data Exchange (ETDEWEB)

    Weber, M.H. [Center for Materials Research and Department of Physics and Astronomy, Washington State University, Pullman, WA 99164-2711 (United States)], E-mail: m_weber@wsu.edu; Selim, F.A.; Solodovnikov, D.; Lynn, K.G. [Center for Materials Research and Department of Physics and Astronomy, Washington State University, Pullman, WA 99164-2711 (United States)

    2008-10-31

    The defect responsible for the transparent to red color change of nominally undoped ZnO bulk single crystals is investigated. Upon annealing in the presence of metallic Zn as reported by Halliburton et al. and also Ti and Zr a native defect forms with an energy level about 0.7 eV below the conduction band. This change is reversible upon annealing in oxygen. Optical transmission data along with positron depth profiles and annealing studies are combined to identify the defect as oxygen vacancies. Vacancy clustering occurs at about 500 deg. C if isolated zinc and oxygen vacancies. In the absence of zinc vacancies, clusters form at about 800 deg. C.

  14. Defect engineering of ZnO

    International Nuclear Information System (INIS)

    Weber, M.H.; Selim, F.A.; Solodovnikov, D.; Lynn, K.G.

    2008-01-01

    The defect responsible for the transparent to red color change of nominally undoped ZnO bulk single crystals is investigated. Upon annealing in the presence of metallic Zn as reported by Halliburton et al. and also Ti and Zr a native defect forms with an energy level about 0.7 eV below the conduction band. This change is reversible upon annealing in oxygen. Optical transmission data along with positron depth profiles and annealing studies are combined to identify the defect as oxygen vacancies. Vacancy clustering occurs at about 500 deg. C if isolated zinc and oxygen vacancies. In the absence of zinc vacancies, clusters form at about 800 deg. C

  15. Studies of defects and defect agglomerates by positron annihilation spectroscopy

    DEFF Research Database (Denmark)

    Eldrup, Morten Mostgaard; Singh, B.N.

    1997-01-01

    A brief introduction to positron annihilation spectroscopy (PAS), and in particular lo its use for defect studies in metals is given. Positrons injected into a metal may become trapped in defects such as vacancies, vacancy clusters, voids, bubbles and dislocations and subsequently annihilate from...... the trapped state iri the defect. The annihilation characteristics (e.g., the lifetime of the positron) can be measured and provide information about the nature of the defect (e.g., size, density, morphology). The technique is sensitive to both defect size (in the range from monovacancies up to cavities...

  16. Congenital Heart Defects and CCHD

    Science.gov (United States)

    ... and more. Stony Point, NY 10980 Close X Home > Complications & Loss > Birth defects & other health conditions > Congenital heart defects and ... in congenital heart defects. You have a family history of congenital heart ... syndrome or VCF. After birth Your baby may be tested for CCHD as ...

  17. Defect kinetics in novel detector materials

    CERN Document Server

    MacEvoy, B C

    2000-01-01

    Silicon particle detectors will be used extensively in experiments at the CERN Large Hadron Collider, where unprecedented particle fluences will cause significant atomic displacement damage. We present a model of the evolution of defect concentrations and consequent electrical behaviour in "novel" detector materials with various oxygen and carbon impurity concentrations. The divacancy-oxygen (V/sub 2/O) defect is identified as the cause of changes in device characteristics during /sup 60/Co gamma irradiation. In the case of hadron irradiation changes in detector doping concentration (N/sub eff/) are dominated by cluster defects, in particular the divacancy (V/sub 2/), which exchange charge directly via a non-Shockley-Read- Hall mechanism. The V/sub 2/O defect also contributes to Ne/sub eff/. This defect is more copiously produced during 24 GeV/c proton irradiation than during 1 MeV neutron irradiation on account of the higher vacancy introduction rate, hence the radiation hardness of materials is more sensiti...

  18. Immobile defects in ferroelastic walls: Wall nucleation at defect sites

    Science.gov (United States)

    He, X.; Salje, E. K. H.; Ding, X.; Sun, J.

    2018-02-01

    Randomly distributed, static defects are enriched in ferroelastic domain walls. The relative concentration of defects in walls, Nd, follows a power law distribution as a function of the total defect concentration C: N d ˜ C α with α = 0.4 . The enrichment Nd/C ranges from ˜50 times when C = 10 ppm to ˜3 times when C = 1000 ppm. The resulting enrichment is due to nucleation at defect sites as observed in large scale MD simulations. The dynamics of domain nucleation and switching is dependent on the defect concentration. Their energy distribution follows the power law with exponents during yield between ɛ ˜ 1.82 and 2.0 when the defect concentration increases. The power law exponent is ɛ ≈ 2.7 in the plastic regime, independent of the defect concentration.

  19. Effect of sp3-hybridized defects on the oscillatory behavior of carbon nanotube oscillators

    International Nuclear Information System (INIS)

    Guo, Taiyu; Ding, Tony Weixi; Pei, Qing-Xiang; Zhang, Yong-Wei

    2011-01-01

    Using molecular dynamics simulations, we investigate the oscillatory behaviors of carbon nanotube oscillators containing sp 3 -hybridized defects formed by hydrogen chemisorption. It is found that the presence of these defects significantly affects the kinetic and potential energies of the nanotube systems, which in turn affects their oscillation periods and frequencies. We have also studied the oscillatory characteristics of the oscillators containing sp 3 -hybridized Stone-Wales defects. Our results show that it is possible to control the motion of the inner nanotube by introducing sp 3 -hybridized defects on the outer nanotube, which provides a potential way to tune the oscillatory behavior of nanotube oscillators. -- Highlights: → sp 3 -hybridized defects increase energy dissipation. → sp 3 -hybridized defects arranged in a row have stronger effect than that in a ring. → sp 3 -hybridized defects reduces the effect of SW defects.

  20. Effects of various defects on the mechanical properties of black phosphorene

    Science.gov (United States)

    Nguyen, Danh-Truong; Le, Minh-Quy; Nguyen, Van-Trang; Bui, Thanh-Lam

    2017-12-01

    The present work investigates the effects of seven types of defects on the mechanical properties of black phosphorene. Molecular dynamics finite element method with Stillinger-Weber potential is used to simulate the uniaxial tensile tests of the pristine and defective black phosphorene sheets. Young's modulus, fracture stress, and fracture strain of the pristine and defective black phosphorene sheets are estimated. Comparison of the influence of different types of defects on the mechanical response of black phosphorene is considered. Fracture mechanism of various defective black phosphorene sheets is also analyzed. It is found that effect of the defects on Young's modulus of black phosphorene is insignificant. In contrast, due to defects fracture stress and fracture strain can reduce up to 53% and 69%, respectively. Results provide a landscape on the mechanical properties of defective black phosphorene and are useful for the design of nanodevices with black phosphorene in future applications.

  1. Benign gastric filling defect

    International Nuclear Information System (INIS)

    Oh, K. K.; Lee, Y. H.; Cho, O. K.; Park, C. Y.

    1979-01-01

    The gastric lesion is a common source of complaints to Orientals, however, evaluation of gastric symptoms and laboratory examination offer little specific aid in the diagnosis of gastric diseases. Thus roentgenography of gastrointestinal tract is one of the most reliable method for detail diagnosis. On double contract study of stomach, gastric filling defect is mostly caused by malignant gastric cancer, however, other benign lesions can cause similar pictures which can be successfully treated by surgery. 66 cases of benign causes of gastric filling defect were analyzed at this point of view, which was verified pathologically by endoscope or surgery during recent 7 years in Yensei University College of Medicine, Severance Hospital. The characteristic radiological picture of each disease was discussed for precise radiologic diagnosis. 1. Of total 66 cases, there were 52 cases of benign gastric tumor 10 cases of gastric varices, 5 cases of gastric bezoar, 5 cases of corrosive gastritis, 3 cases of granulomatous disease and one case of gastric hematoma. 2. The most frequent causes of benign tumors were adenomatous polyp (35/42) and the next was leiomyoma (4/42). Others were one of case of carcinoid, neurofibroma and cyst. 3. Characteristic of benign adenomatous polyp were relatively small in size, smooth surface and were observed that large size, benign polyp was frequently type IV lesion with a stalk. 4. Submucosal tumors such as leiomyoma needed differential diagnosis with polypoid malignant cancer. However, the characteristic points of differentiation was well circumscribed smooth margined filling defect without definite mucosal destruction on surface. 5. Gastric varices showed multiple lobulated filling defected especially on gastric fundus that changed its size and shape by respiration and posture of patients. Same varices lesions on esophagus and history of liver disease were helpful for easier diagnosis. 6. Gastric bezoar showed well defined movable mass

  2. Benign gastric filling defect

    Energy Technology Data Exchange (ETDEWEB)

    Oh, K. K.; Lee, Y. H.; Cho, O. K.; Park, C. Y. [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1979-06-15

    The gastric lesion is a common source of complaints to Orientals, however, evaluation of gastric symptoms and laboratory examination offer little specific aid in the diagnosis of gastric diseases. Thus roentgenography of gastrointestinal tract is one of the most reliable method for detail diagnosis. On double contract study of stomach, gastric filling defect is mostly caused by malignant gastric cancer, however, other benign lesions can cause similar pictures which can be successfully treated by surgery. 66 cases of benign causes of gastric filling defect were analyzed at this point of view, which was verified pathologically by endoscope or surgery during recent 7 years in Yensei University College of Medicine, Severance Hospital. The characteristic radiological picture of each disease was discussed for precise radiologic diagnosis. 1. Of total 66 cases, there were 52 cases of benign gastric tumor 10 cases of gastric varices, 5 cases of gastric bezoar, 5 cases of corrosive gastritis, 3 cases of granulomatous disease and one case of gastric hematoma. 2. The most frequent causes of benign tumors were adenomatous polyp (35/42) and the next was leiomyoma (4/42). Others were one of case of carcinoid, neurofibroma and cyst. 3. Characteristic of benign adenomatous polyp were relatively small in size, smooth surface and were observed that large size, benign polyp was frequently type IV lesion with a stalk. 4. Submucosal tumors such as leiomyoma needed differential diagnosis with polypoid malignant cancer. However, the characteristic points of differentiation was well circumscribed smooth margined filling defect without definite mucosal destruction on surface. 5. Gastric varices showed multiple lobulated filling defected especially on gastric fundus that changed its size and shape by respiration and posture of patients. Same varices lesions on esophagus and history of liver disease were helpful for easier diagnosis. 6. Gastric bezoar showed well defined movable mass

  3. Benign gastric filling defect

    Energy Technology Data Exchange (ETDEWEB)

    Oh, K K; Lee, Y H; Cho, O K; Park, C Y [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1979-06-15

    The gastric lesion is a common source of complaints to Orientals, however, evaluation of gastric symptoms and laboratory examination offer little specific aid in the diagnosis of gastric diseases. Thus roentgenography of gastrointestinal tract is one of the most reliable method for detail diagnosis. On double contract study of stomach, gastric filling defect is mostly caused by malignant gastric cancer, however, other benign lesions can cause similar pictures which can be successfully treated by surgery. 66 cases of benign causes of gastric filling defect were analyzed at this point of view, which was verified pathologically by endoscope or surgery during recent 7 years in Yensei University College of Medicine, Severance Hospital. The characteristic radiological picture of each disease was discussed for precise radiologic diagnosis. 1. Of total 66 cases, there were 52 cases of benign gastric tumor 10 cases of gastric varices, 5 cases of gastric bezoar, 5 cases of corrosive gastritis, 3 cases of granulomatous disease and one case of gastric hematoma. 2. The most frequent causes of benign tumors were adenomatous polyp (35/42) and the next was leiomyoma (4/42). Others were one of case of carcinoid, neurofibroma and cyst. 3. Characteristic of benign adenomatous polyp were relatively small in size, smooth surface and were observed that large size, benign polyp was frequently type IV lesion with a stalk. 4. Submucosal tumors such as leiomyoma needed differential diagnosis with polypoid malignant cancer. However, the characteristic points of differentiation was well circumscribed smooth margined filling defect without definite mucosal destruction on surface. 5. Gastric varices showed multiple lobulated filling defected especially on gastric fundus that changed its size and shape by respiration and posture of patients. Same varices lesions on esophagus and history of liver disease were helpful for easier diagnosis. 6. Gastric bezoar showed well defined movable mass

  4. The 1.1 Å resolution structure of a periplasmic phosphate-binding protein from Stenotrophomonas maltophilia: a crystallization contaminant identified by molecular replacement using the entire Protein Data Bank.

    Science.gov (United States)

    Keegan, Ronan; Waterman, David G; Hopper, David J; Coates, Leighton; Taylor, Graham; Guo, Jingxu; Coker, Alun R; Erskine, Peter T; Wood, Steve P; Cooper, Jonathan B

    2016-08-01

    During efforts to crystallize the enzyme 2,4-dihydroxyacetophenone dioxygenase (DAD) from Alcaligenes sp. 4HAP, a small number of strongly diffracting protein crystals were obtained after two years of crystal growth in one condition. The crystals diffracted synchrotron radiation to almost 1.0 Å resolution and were, until recently, assumed to be formed by the DAD protein. However, when another crystal form of this enzyme was eventually solved at lower resolution, molecular replacement using this new structure as the search model did not give a convincing solution with the original atomic resolution data set. Hence, it was considered that these crystals might have arisen from a protein impurity, although molecular replacement using the structures of common crystallization contaminants as search models again failed. A script to perform molecular replacement using MOLREP in which the first chain of every structure in the PDB was used as a search model was run on a multi-core cluster. This identified a number of prokaryotic phosphate-binding proteins as scoring highly in the MOLREP peak lists. Calculation of an electron-density map at 1.1 Å resolution based on the solution obtained with PDB entry 2q9t allowed most of the amino acids to be identified visually and built into the model. A BLAST search then indicated that the molecule was most probably a phosphate-binding protein from Stenotrophomonas maltophilia (UniProt ID B4SL31; gene ID Smal_2208), and fitting of the corresponding sequence to the atomic resolution map fully corroborated this. Proteins in this family have been linked to the virulence of antibiotic-resistant strains of pathogenic bacteria and with biofilm formation. The structure of the S. maltophilia protein has been refined to an R factor of 10.15% and an Rfree of 12.46% at 1.1 Å resolution. The molecule adopts the type II periplasmic binding protein (PBP) fold with a number of extensively elaborated loop regions. A fully dehydrated phosphate

  5. Renyi entropy and conformal defects

    Energy Technology Data Exchange (ETDEWEB)

    Bianchi, Lorenzo [Humboldt-Univ. Berlin (Germany). Inst. fuer Physik; Hamburg Univ. (Germany). II. Inst. fuer Theoretische Physik; Meineri, Marco [Scuola Normale Superiore, Pisa (Italy); Perimeter Institute for Theoretical Physics, Waterloo, ON (Canada); Istituto Nazionale di Fisica Nucleare, Pisa (Italy); Myers, Robert C. [Perimeter Institute for Theoretical Physics, Waterloo, ON (Canada); Smolkin, Michael [California Univ., Berkely, CA (United States). Center for Theoretical Physics and Department of Physics

    2016-04-18

    We propose a field theoretic framework for calculating the dependence of Renyi entropies on the shape of the entangling surface in a conformal field theory. Our approach rests on regarding the corresponding twist operator as a conformal defect and in particular, we define the displacement operator which implements small local deformations of the entangling surface. We identify a simple constraint between the coefficient defining the two-point function of the displacement operator and the conformal weight of the twist operator, which consolidates a number of distinct conjectures on the shape dependence of the Renyi entropy. As an example, using this approach, we examine a conjecture regarding the universal coefficient associated with a conical singularity in the entangling surface for CFTs in any number of spacetime dimensions. We also provide a general formula for the second order variation of the Renyi entropy arising from small deformations of a spherical entangling surface, extending Mezei's results for the entanglement entropy.

  6. Renyi entropy and conformal defects

    International Nuclear Information System (INIS)

    Bianchi, Lorenzo; Myers, Robert C.; Smolkin, Michael

    2016-01-01

    We propose a field theoretic framework for calculating the dependence of Renyi entropies on the shape of the entangling surface in a conformal field theory. Our approach rests on regarding the corresponding twist operator as a conformal defect and in particular, we define the displacement operator which implements small local deformations of the entangling surface. We identify a simple constraint between the coefficient defining the two-point function of the displacement operator and the conformal weight of the twist operator, which consolidates a number of distinct conjectures on the shape dependence of the Renyi entropy. As an example, using this approach, we examine a conjecture regarding the universal coefficient associated with a conical singularity in the entangling surface for CFTs in any number of spacetime dimensions. We also provide a general formula for the second order variation of the Renyi entropy arising from small deformations of a spherical entangling surface, extending Mezei's results for the entanglement entropy.

  7. Combined computational and experimental study of Ar beam induced defect formation in graphite

    International Nuclear Information System (INIS)

    Pregler, Sharon K.; Hayakawa, Tetsuichiro; Yasumatsu, Hisato; Kondow, Tamotsu; Sinnott, Susan B.

    2007-01-01

    Irradiation of graphite, commonly used in nuclear power plants, is known to produce structural damage. Here, experimental and computational methods are used to study defect formation in graphite during Ar irradiation at incident energies of 50 eV. The experimental samples are analyzed with scanning tunneling microscopy to quantify the size distribution of the defects that form. The computational approach is classical molecular dynamic simulations that illustrate the mechanisms by which the defects are produced. The results indicate that defects in graphite grow in concentrated areas and are nucleated by the presence of existing defects

  8. Molecular dissection of Norrie disease.

    Science.gov (United States)

    Berger, W

    1998-01-01

    Norrie disease (ND) is a severe form of congenital blindness accompanied by mental retardation and/or deafness in at least one third of the patients. This article summarizes advances in the molecular genetic analysis of this disease during the last 13 years, including mapping and cloning of the human gene and the generation and characterization of a mouse model. Genetic linkage studies and physical mapping strategies have assigned the ND locus to the proximal short arm of the human X chromosome. The identification of chromosomal rearrangements in several patients, such as microdeletions, enabled the isolation of the ND gene by a positional cloning approach. Numerous point mutations in this gene have been identified in three distinct clinical entities: (1) ND, (2) familial and sporadic exudative vitreoretinopathy, and (3) retinopathy of prematurity. The gene encodes a relatively small protein, consisting of 133 amino acids. The function of the gene product is yet unknown, although homologies with known proteins and molecular modelling data suggest a role in the regulation of cell interaction or differentiation processes. A mouse model has been generated to shed more light on early pathogenic events involved in ND and allelic disorders. The mouse homologous protein is highly identical (94%) to the human polypeptide. The gene is expressed in the neuronal layers of the mouse retina, the cerebellum and olfactory epithelium. Mutant mice show snowflake-like opacities within the vitreous, dysgenesis of the ganglion cell layer and occasionally degeneration of photoreceptor cells. The mouse phenotype does not include phthisis bulbi and, overall, resembles a mild form of ND. Electrophysiological studies revealed a severely altered electroretinogram b-wave. These results suggest a primary defect in the inner neuronal layers of the retina. Defects in the vitreous and photoreceptor cell layer are most likely secondary effects. Further histological, functional and molecular

  9. Surface defects and chiral algebras

    Energy Technology Data Exchange (ETDEWEB)

    Córdova, Clay [School of Natural Sciences, Institute for Advanced Study,1 Einstein Dr, Princeton, NJ 08540 (United States); Gaiotto, Davide [Perimeter Institute for Theoretical Physics,31 Caroline St N, Waterloo, ON N2L 2Y5 (Canada); Shao, Shu-Heng [School of Natural Sciences, Institute for Advanced Study,1 Einstein Dr, Princeton, NJ 08540 (United States)

    2017-05-26

    We investigate superconformal surface defects in four-dimensional N=2 superconformal theories. Each such defect gives rise to a module of the associated chiral algebra and the surface defect Schur index is the character of this module. Various natural chiral algebra operations such as Drinfeld-Sokolov reduction and spectral flow can be interpreted as constructions involving four-dimensional surface defects. We compute the index of these defects in the free hypermultiplet theory and Argyres-Douglas theories, using both infrared techniques involving BPS states, as well as renormalization group flows onto Higgs branches. In each case we find perfect agreement with the predicted characters.

  10. Electron damage and defects in organic crystals

    International Nuclear Information System (INIS)

    Howitt, D.G.

    1976-06-01

    The nature of the defects discernable from and the radiation damage that is induced by high resolution electron microscopy is reported. The structural aspects of the radiation damage process can be correlated to the expected radiochemical decomposition of these materials and these effects identified. The types of local defect formed by radiation damage are often clearly distinguishable, in high resolution images, from those inherent in the microstructure. Techniques used in this type of electron microscopy and the limitations imposed by radiation damage are described as are the relevant radiochemical characteristics of these processes. In copper pthalocyanine, microstructural features distinct from those induced by radiation damage were identified which are consistent with those predicted and described by other workers in similar materials. The high resolution studies indicate that some of the microstructures observed are caused by structural rearrangements that can account, to some extent, for additional crystallographic forms that have been identified in this material and the photochemical behaviour of related structures

  11. [Molecular basis of Fanconi's anemia].

    Science.gov (United States)

    Digweed, M

    1999-01-01

    Fanconi anaemia (FA) is an autosomal recessive genetic disorder characterised clinically by progressive bone marrow failure, skeletal deformities and a predisposition to neoplasia. Patient cells manifest an extreme chromosomal instability and hypersensitivity to polyfunctional alkylating agents. It is assumed that the basic defect is related to the repair of DNA damage, in particular that of so-called DNA crosslinks. Currently there are eight complementation groups in FA (FA-A-FA-H) which indicates that at least eight independent genes can lead to FA. Three of these genes have been identified: FANCA, FANCC and FANCG. In this review, the molecular biology and genetics of FA are presented and possible functions of the FANC proteins are discussed.

  12. Point defects in nickel

    International Nuclear Information System (INIS)

    Peretto, P.

    1969-01-01

    The defects in electron irradiated nickel (20 deg. K) or neutron irradiated nickel (28 deg. K) are studied by simultaneous analysis using the magnetic after-effect, electron microscopy and electrical resistivity recovery. We use zone refined nickel (99.999 per cent) which, for some experiments, is alloyed with a small amount of iron (for example 0.1 per cent Fe). The temperature dependant electrical recovery may be divided in four stages. The sub-stages I B (31 deg. K), I C (42 deg. K), I D (from to 57 deg. K) and I E (62 deg. K) of stage I are due to the disappearance of single interstitials into vacancies. The interstitial defect has a split configuration with a migration energy of about 0.15 eV. In the close pair which disappears in stage I B the interstitial is found to be in a 3. neighbour position whilst in stage I D it is near the direction from the vacancy. In stage I E there is no longer any interaction between the interstitial and the vacancy. The stage II is due to more complicated interstitial defects: di-interstitials for stage II B (84 deg. K) and larger and larger interstitial loops for the following sub-stages. The loops may be seen by electron microscopy. Impurities can play the role of nucleation centers for the loops. Stages III A (370 deg. K) and III B (376 deg. K) are due to two types of di-vacancies. During stage IV (410 deg. K) the single vacancies migrate. Vacancy type loops and interstitial type loops grow concurrently and disappear at about 800 deg. K as observed by electron microscopy. (author) [fr

  13. Molecular Foundry

    Science.gov (United States)

    . New Study Indicates Greater Capacity for Carbon Storage in the Earth's Subsurface A team of Foundry minerals which make up the dominant clays in the Earth's deep subsurface. Doubling Down on Energy Storage identify molecular components within small volumes of biological samples, such as blood or urine. Industry

  14. Mechanical properties of highly defective graphene: from brittle rupture to ductile fracture

    International Nuclear Information System (INIS)

    Xu, Lanqing; Wei, Ning; Zheng, Yongping

    2013-01-01

    Defects are generally believed to deteriorate the superlative performance of graphene-based devices but may also be useful when carefully engineered to tailor the local properties and achieve new functionalities. Central to most defect-associated applications is the defect coverage and arrangement. In this work, we investigate, by molecular dynamics simulations, the mechanical properties and fracture dynamics of graphene sheets with randomly distributed vacancies or Stone–Wales defects under tensile deformations over a wide defect coverage range. With defects presented, an sp–sp 2 bonding network and an sp–sp 2 –sp 3 bonding network are observed in vacancy-defected and Stone–Wales-defected graphene, respectively. The ultimate strength degrades gradually with increasing defect coverage and saturates in the high-ratio regime, whereas the fracture strain presents an unusual descending–saturating–improving trend. In the dense vacancy defect situation, the fracture becomes more plastic and super-ductility is observed. Further fracture dynamics analysis reveals that the crack trapping by sp–sp 2 and sp–sp 2 –sp 3 rings and the crack-tip blunting account for the ductile fracture, whereas geometric rearrangement on the entire sheet for vacancy defects and geometric rearrangement on the specific defect sites for Stone–Wales defects account for their distinctive rules of the evolution of the fracture strain. (paper)

  15. Mechanical properties of highly defective graphene: from brittle rupture to ductile fracture.

    Science.gov (United States)

    Xu, Lanqing; Wei, Ning; Zheng, Yongping

    2013-12-20

    Defects are generally believed to deteriorate the superlative performance of graphene-based devices but may also be useful when carefully engineered to tailor the local properties and achieve new functionalities. Central to most defect-associated applications is the defect coverage and arrangement. In this work, we investigate, by molecular dynamics simulations, the mechanical properties and fracture dynamics of graphene sheets with randomly distributed vacancies or Stone-Wales defects under tensile deformations over a wide defect coverage range. With defects presented, an sp-sp(2) bonding network and an sp-sp(2)-sp(3) bonding network are observed in vacancy-defected and Stone-Wales-defected graphene, respectively. The ultimate strength degrades gradually with increasing defect coverage and saturates in the high-ratio regime, whereas the fracture strain presents an unusual descending-saturating-improving trend. In the dense vacancy defect situation, the fracture becomes more plastic and super-ductility is observed. Further fracture dynamics analysis reveals that the crack trapping by sp-sp(2) and sp-sp(2)-sp(3) rings and the crack-tip blunting account for the ductile fracture, whereas geometric rearrangement on the entire sheet for vacancy defects and geometric rearrangement on the specific defect sites for Stone-Wales defects account for their distinctive rules of the evolution of the fracture strain.

  16. Single ventricle cardiac defect

    International Nuclear Information System (INIS)

    Eren, B.; Turkmen, N.; Fedakar, R.; Cetin, V.

    2010-01-01

    Single ventricle heart is defined as a rare cardiac abnormality with a single ventricle chamber involving diverse functional and physiological defects. Our case is of a ten month-old baby boy who died shortly after admission to the hospital due to vomiting and diarrhoea. Autopsy findings revealed cyanosis of finger nails and ears. Internal examination revealed; large heart, weighing 60 grams, single ventricle, without a septum and upper membranous part. Single ventricle is a rare pathology, hence, this paper aims to discuss this case from a medico-legal point of view. (author)

  17. Simulating the production of free defects in irradiated metals

    International Nuclear Information System (INIS)

    Heinisch, H.L.

    1995-01-01

    Under cascade-producing irradiation by high energy neutrons or charged particles, only a small fraction of the initially displaced atoms contribute to the population of free defects that are available to migrate throughout the metal and cause microstructural changes. Although, in principle, computer simulations of free defect production could best be done using molecular dynamics, in practice, the wide ranges of time and distance scales involved can be done only by a combination of atomistic models that employ various levels of approximation. An atomic-scale, multi-model approach has been developed that combines molecular dynamics, binary collision models and stochastic annealing simulation. The annealing simulation is utilized in calibrating binary collision simulations to the results of molecular dynamics calculations, as well as to model the subsequent migration of the defects on more macroscopic time and size scales. The annealing simulation and the method of calibrating the multi-model approach are discussed, and the results of simulations of cascades in copper are presented. The temperature dependence of free defect production following simulated annealing of isolated cascades in copper shows a differential in the fractions of free vacancies and interstitial defects escaping from the cascade above stage V. This differential, a consequence of the direct formation of interstitial clusters in cascades and the relative thermal stability of vacancy and interstitial clusters during subsequent annealing, is the basis for the production bias mechanism of void swelling. (orig.)

  18. Defect detection using transient thermography

    International Nuclear Information System (INIS)

    Mohd Zaki Umar; Ibrahim Ahmad; Ab Razak Hamzah; Wan Saffiey Wan Abdullah

    2008-08-01

    An experimental research had been carried out to study the potential of transient thermography in detecting sub-surface defect of non-metal material. In this research, eight pieces of bakelite material were used as samples. Each samples had a sub-surface defect in the circular shape with different diameters and depths. Experiment was conducted using one-sided Pulsed Thermal technique. Heating of samples were done using 30 kWatt adjustable quartz lamp while infra red (IR) images of samples were recorded using THV 550 IR camera. These IR images were then analysed with ThermofitTMPro software to obtain the Maximum Absolute Differential Temperature Signal value, ΔΤ m ax and the time of its appearance, τ m ax (ΔΤ). Result showed that all defects were able to be detected even for the smallest and deepest defect (diameter = 5 mm and depth = 4 mm). However the highest value of Differential Temperature Signal (ΔΤ m ax), were obtained at defect with the largest diameter, 20 mm and at the shallowest depth, 1 mm. As a conclusion, the sensitivity of the pulsed thermography technique to detect sub-surface defects of bakelite material is proportionately related with the size of defect diameter if the defects are at the same depth. On the contrary, the sensitivity of the pulsed thermography technique inversely related with the depth of defect if the defects have similar diameter size. (Author)

  19. Dipole defects in beryl

    International Nuclear Information System (INIS)

    Holanda, B A; Cordeiro, R C; Blak, A R

    2010-01-01

    Dipole defects in gamma irradiated and thermally treated beryl (Be 3 Al 2 Si 6 O 18 ) samples have been studied using the Thermally Stimulated Depolarization Currents (TSDC) technique. TSDC experiments were performed in pink (morganite), green (emerald), blue (aquamarine) and colourless (goshenite) natural beryl. TSDC spectra present dipole peaks at 190K, 220K, 280K and 310K that change after gamma irradiation and thermal treatments. In morganite samples, for thermal treatments between 700K and 1100K, the 280K peak increase in intensity and the band at 220K disappears. An increase of the 280K peak and a decrease of the 190K peak were observed in the TSDC spectra of morganite after a gamma irradiation of 25kGy performed after the thermal treatments. In the case of emerald samples, thermal treatments enhanced the 280K peak and gamma irradiation partially destroyed this band. The goshenite TSDC spectra present only one band at 280K that is not affected either by thermal treatments or by gamma irradiation. All the observed peaks are of dipolar origin because the intensity of the bands is linearly dependent on the polarization field, behaviour of dipole defects. The systematic study, by means of TSDC measurements, of ionizing irradiation effects and thermal treatments in these crystals makes possible a better understanding of the role played by the impurities in beryl crystals.

  20. Radial collapse and physical mechanism of carbon nanotube with divacancy and 5-8-5 defects

    International Nuclear Information System (INIS)

    Zhang Ya-Ping; Ling Cui-Cui; Li Gui-Xia; Zhu Hai-Feng; Zhang Meng-Yu

    2015-01-01

    By employing molecular mechanics and molecular dynamics simulations, we investigate the radial collapses and elasticities of different chiral single-walled carbon nanotubes (SWCNTs) with divacancy, and 5-8-5 defects. It is found that divacancy and 5-8-5 defect can reduce the collapse pressure (P c ) of SWCNT (10, 10) while 5-8-5 defect can greatly increase P c of SWCNT (17, 0). For example, 5-8-5 defect can make P c of SWCNT (17, 0) increase by 500%. A model is established to understand the effects of chirality, divacancy, and 5-8-5 defect on radial collapse of SWCNTs. The results are particularly of value for understanding the mechanical behavior of SWCNT with divacancy, and the 5-8-5 defect that may be considered as a filler of high loading composites. (paper)

  1. Transforming graphene nanoribbons into nanotubes by use of point defects.

    Science.gov (United States)

    Sgouros, A; Sigalas, M M; Papagelis, K; Kalosakas, G

    2014-03-26

    Using molecular dynamics simulations with semi-empirical potentials, we demonstrate a method to fabricate carbon nanotubes (CNTs) from graphene nanoribbons (GNRs), by periodically inserting appropriate structural defects into the GNR crystal structure. We have found that various defect types initiate the bending of GNRs and eventually lead to the formation of CNTs. All kinds of carbon nanotubes (armchair, zigzag, chiral) can be produced with this method. The structural characteristics of the resulting CNTs, and the dependence on the different type and distribution of the defects, were examined. The smallest (largest) CNT obtained had a diameter of ∼ 5 Å (∼ 39 Å). Proper manipulation of ribbon edges controls the chirality of the CNTs formed. Finally, the effect of randomly distributed defects on the ability of GNRs to transform into CNTs is considered.

  2. Mobility of a 5|7 defect in carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Youngmin; Han, Jihoon; Im, Seyoung [Department of Mechanical Engineering, Korea Advanced Institute of Science and Technology (KAIST), Science Town, Daejeon, 305-701 (Korea, Republic of); Lee, In-Ho, E-mail: sim@kaist.ac.kr [Korea Research Institute of Standards and Science (KRISS), Daejeon, 305-600 (Korea, Republic of)

    2011-03-11

    The movement of a 5|7 defect in the plastic deformations of a carbon nanotube (CNT) plays the role of dislocation glide in the plastic deformations of metals. This work is concerned with the atomic shift mechanism of the 5|7 defect and the energy barrier when the CNT is subjected to tensile loading. Action-derived molecular dynamics (ADMD) is applied to find the minimum energy path and the energy barrier. It is found that the tensile loads make it easy for the 5|7 defect to glide, and lower the energy barrier. The minimum load level that makes a 5|7 defect glide freely with no energy barrier in the presence of an adatom is obtained.

  3. Mobility of a 5|7 defect in carbon nanotubes

    International Nuclear Information System (INIS)

    Lee, Youngmin; Han, Jihoon; Im, Seyoung; Lee, In-Ho

    2011-01-01

    The movement of a 5|7 defect in the plastic deformations of a carbon nanotube (CNT) plays the role of dislocation glide in the plastic deformations of metals. This work is concerned with the atomic shift mechanism of the 5|7 defect and the energy barrier when the CNT is subjected to tensile loading. Action-derived molecular dynamics (ADMD) is applied to find the minimum energy path and the energy barrier. It is found that the tensile loads make it easy for the 5|7 defect to glide, and lower the energy barrier. The minimum load level that makes a 5|7 defect glide freely with no energy barrier in the presence of an adatom is obtained.

  4. Ion-irradiation-induced defects in bundles of carbon nanotubes

    International Nuclear Information System (INIS)

    Salonen, E.; Krasheninnikov, A.V.; Nordlund, K.

    2002-01-01

    We study the structure and formation yields of atomic-scale defects produced by low-dose Ar ion irradiation in bundles of single-wall carbon nanotubes. For this, we employ empirical potential molecular dynamics and simulate ion impact events over an energy range of 100-1000 eV. We show that the most common defects produced at all energies are vacancies on nanotube walls, which at low temperatures are metastable but long-lived defects. We further calculate the spatial distribution of the defects, which proved to be highly non-uniform. We also show that ion irradiation gives rise to the formations of inter-tube covalent bonds mediated by carbon recoils and nanotube lattice distortions due to dangling bond saturation. The number of inter-tube links, as well as the overall damage, linearly grows with the energy of incident ions

  5. Cytoskeletal defects in Bmpr2-associated pulmonary arterial hypertension.

    Science.gov (United States)

    Johnson, Jennifer A; Hemnes, Anna R; Perrien, Daniel S; Schuster, Manfred; Robinson, Linda J; Gladson, Santhi; Loibner, Hans; Bai, Susan; Blackwell, Tom R; Tada, Yuji; Harral, Julie W; Talati, Megha; Lane, Kirk B; Fagan, Karen A; West, James

    2012-03-01

    The heritable form of pulmonary arterial hypertension (PAH) is typically caused by a mutation in bone morphogenic protein receptor type 2 (BMPR2), and mice expressing Bmpr2 mutations develop PAH with features similar to human disease. BMPR2 is known to interact with the cytoskeleton, and human array studies in PAH patients confirm alterations in cytoskeletal pathways. The goal of this study was to evaluate cytoskeletal defects in BMPR2-associated PAH. Expression arrays on our Bmpr2 mutant mouse lungs revealed cytoskeletal defects as a prominent molecular consequence of universal expression of a Bmpr2 mutation (Rosa26-Bmpr2(R899X)). Pulmonary microvascular endothelial cells cultured from these mice have histological and functional cytoskeletal defects. Stable transfection of different BMPR2 mutations into pulmonary microvascular endothelial cells revealed that cytoskeletal defects are common to multiple BMPR2 mutations and are associated with activation of the Rho GTPase, Rac1. Rac1 defects are corrected in cell culture and in vivo through administration of exogenous recombinant human angiotensin-converting enzyme 2 (rhACE2). rhACE2 reverses 77% of gene expression changes in Rosa26-Bmpr2(R899X) transgenic mice, in particular, correcting defects in cytoskeletal function. Administration of rhACE2 to Rosa26-Bmpr2(R899X) mice with established PAH normalizes pulmonary pressures. Together, these findings suggest that cytoskeletal function is central to the development of BMPR2-associated PAH and that intervention against cytoskeletal defects may reverse established disease.

  6. Topological defects in extended inflation

    International Nuclear Information System (INIS)

    Copeland, E.J.; Kolb, E.W.; Chicago Univ., IL; Liddle, A.R.

    1990-04-01

    We consider the production of topological defects, especially cosmic strings, in extended inflation models. In extended inflation, the Universe passes through a first-order phase transition via bubble percolation, which naturally allows defects to form at the end of inflation. The correlation length, which determines the number density of the defects, is related to the mean size of bubbles when they collide. This mechanism allows a natural combination of inflation and large-scale structure via cosmic strings. 18 refs

  7. Topological defects in extended inflation

    International Nuclear Information System (INIS)

    Copeland, E.J.; Kolb, E.W.; Liddle, A.R.

    1990-01-01

    We consider the production of topological defects, especially cosmic strings, in extended-inflation models. In extended inflation, the Universe passes through a first-order phase transition via bubble percolation, which naturally allows defects to form at the end of inflation. The correlation length, which determines the number density of the defects, is related to the mean size of the bubbles when they collide. This mechanism allows a natural combination of inflation and large-scale structure via cosmic strings

  8. Defining the molecular pathologies in cloaca malformation: similarities between mouse and human

    Directory of Open Access Journals (Sweden)

    Laura A. Runck

    2014-04-01

    Full Text Available Anorectal malformations are congenital anomalies that form a spectrum of disorders, from the most benign type with excellent functional prognosis, to very complex, such as cloaca malformation in females in which the rectum, vagina and urethra fail to develop separately and instead drain via a single common channel into the perineum. The severity of this phenotype suggests that the defect occurs in the early stages of embryonic development of the organs derived from the cloaca. Owing to the inability to directly investigate human embryonic cloaca development, current research has relied on the use of mouse models of anorectal malformations. However, even studies of mouse embryos lack analysis of the earliest stages of cloaca patterning and morphogenesis. Here we compared human and mouse cloaca development and retrospectively identified that early mis-patterning of the embryonic cloaca might underlie the most severe forms of anorectal malformation in humans. In mouse, we identified that defective sonic hedgehog (Shh signaling results in early dorsal-ventral epithelial abnormalities prior to the reported defects in septation. This is manifested by the absence of Sox2 and aberrant expression of keratins in the embryonic cloaca of Shh knockout mice. Shh knockout embryos additionally develop a hypervascular stroma, which is defective in BMP signaling. These epithelial and stromal defects persist later, creating an indeterminate epithelium with molecular alterations in the common channel. We then used these animals to perform a broad comparison with patients with mild-to-severe forms of anorectal malformations including cloaca malformation. We found striking parallels with the Shh mouse model, including nearly identical defective molecular identity of the epithelium and surrounding stroma. Our work strongly suggests that early embryonic cloacal epithelial differentiation defects might be the underlying cause of severe forms of anorectal malformations

  9. Metastable gravity on classical defects

    International Nuclear Information System (INIS)

    Ringeval, Christophe; Rombouts, Jan-Willem

    2005-01-01

    We discuss the realization of metastable gravity on classical defects in infinite-volume extra dimensions. In dilatonic Einstein gravity, it is found that the existence of metastable gravity on the defect core requires violation of the dominant energy condition for codimension N c =2 defects. This is illustrated with a detailed analysis of a six-dimensional hyperstring minimally coupled to dilaton gravity. We present the general conditions under which a codimension N c >2 defect admits metastable modes, and find that they differ from lower codimensional models in that, under certain conditions, they do not require violation of energy conditions to support quasilocalized gravity

  10. Fibrous metaphyseal defects

    International Nuclear Information System (INIS)

    Hajek, P.C.; Ritschi, P.; Kramer, J.; Imhof, H.; Karnel, F.

    1988-01-01

    Eighty-two patients (107 fibrous metaphyseal defects [FMDs]) were investigated with standard radiography and MR imaging (N = 15). Twenty-two of these were followed up sequentially up to 10 years (mean, 7.3 years). Histologic studies proved that FMDs originate at the site of insertion of a tendon in the perichondrium of the epiphyseal cartilage. After normal bone growth is regained, all FMDs were found to move diaphysically, following a straight line parallel to the long axis of the FMDs. This line pointed to the insertion of the tendon originally involved, a fact that was proved with MR imaging. Four characteristic stages were found to define a typical radiomorphologic course of an FMD

  11. Patterning and gastrulation defects caused by the tw18 lethal are due to loss of Ppp2r1a

    Directory of Open Access Journals (Sweden)

    Lisette Lange

    2017-06-01

    Full Text Available The mouse t haplotype, a variant 20 cM genomic region on Chromosome 17, harbors 16 embryonic control genes identified by recessive lethal mutations isolated from wild mouse populations. Due to technical constraints so far only one of these, the tw5 lethal, has been cloned and molecularly characterized. Here we report the molecular isolation of the tw18 lethal. Embryos carrying the tw18 lethal die from major gastrulation defects commencing with primitive streak formation at E6.5. We have used transcriptome and marker gene analyses to describe the molecular etiology of the tw18 phenotype. We show that both WNT and Nodal signal transduction are impaired in the mutant epiblast, causing embryonic patterning defects and failure of primitive streak and mesoderm formation. By using a candidate gene approach, gene knockout by homologous recombination and genetic rescue, we have identified the gene causing the tw18 phenotype as Ppp2r1a, encoding the PP2A scaffolding subunit PR65alpha. Our work highlights the importance of phosphatase 2A in embryonic patterning, primitive streak formation, gastrulation, and mesoderm formation downstream of WNT and Nodal signaling.

  12. Effect of triangular vacancy defect on thermal conductivity and thermal rectification in graphene nanoribbons

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ping, E-mail: yangpingdm@ujs.edu.cn [Laboratory of Advanced Manufacturing and Reliability for MEMS/NEMS/OEDS, Jiangsu University, Zhenjiang 212013 (China); Li, Xialong; Zhao, Yanfan [Laboratory of Advanced Manufacturing and Reliability for MEMS/NEMS/OEDS, Jiangsu University, Zhenjiang 212013 (China); Yang, Haiying [School of Materials Science and Engineering, Jiangsu University, Zhenjiang 212013 (China); Wang, Shuting, E-mail: wangst@mail.hust.edu.cn [School of Mechanical Science and Engineering, Huazhong University of Science and Technology, Wuhan, Hubei 430074 (China)

    2013-11-01

    We investigate the thermal transport properties of armchair graphene nanoribbons (AGNRs) possessing various sizes of triangular vacancy defect within a temperature range of 200–600 K by using classical molecular dynamics simulation. The results show that the thermal conductivities of the graphene nanoribbons decrease with increasing sizes of triangular vacancy defects in both directions across the whole temperature range tested, and the presence of the defect can decrease the thermal conductivity by more than 40% as the number of removed cluster atoms is increased to 25 (1.56% for vacancy concentration) owing to the effect of phonon–defect scattering. In the meantime, we find the thermal conductivity of defective graphene nanoribbons is insensitive to the temperature change at higher vacancy concentrations. Furthermore, the dependence of temperatures and various sizes of triangular vacancy defect for the thermal rectification ration are also detected. This work implies a possible route to achieve thermal rectifier for 2D materials by defect engineering.

  13. Defects and Disorder in the Drosophila Eye

    Science.gov (United States)

    Kim, Sangwoo; Carthew, Richard; Hilgenfeldt, Sascha

    Cell division and differentiation tightly control the regular pattern in the normal eye of the Drosophila fruit fly while certain genetic mutations introduce disorder in the form of topological defects. Analyzing data from pupal retinas, we develop a model based on Voronoi construction that explains the defect statistics as a consequence of area variation of individual facets (ommatidia). The analysis reveals a previously unknown systematic long-range area variation that spans the entire eye, with distinct effects on topological disorder compared to local fluctuations. The internal structure of the ommatidia and the stiffness of their interior cells also plays a crucial role in the defect generation. Accurate predictions of the correlation between the area variation and the defect density in both normal and mutant animals are obtained without free parameters. This approach can potentially be applied to cellular systems in many other contexts to identify size-topology correlations near the onset of symmetry breaking. This work has been supported by the NIH (GM098077) and the NSF (Grant No. 1504301).

  14. Dislocation defect interaction in irradiated Cu

    International Nuclear Information System (INIS)

    Schaeublin, R.; Yao, Z.; Spaetig, P.; Victoria, M.

    2005-01-01

    Pure Cu single crystals irradiated at room temperature to low doses with 590 MeV protons have been deformed in situ in a transmission electron microscope in order to identify the basic mechanisms at the origin of hardening. Cu irradiated to 10 -4 dpa shows at room temperature a yield shear stress of 13.7 MPa to be compared to the 8.8 MPa of the unirradiated Cu. Irradiation induced damage consists at 90% of 2 nm stacking fault tetrahedra, the remaining being dislocation loops and unidentified defects. In-situ deformation reveals that dislocation-defect interaction can take several forms. Usually, dislocations pinned by defects bow out under the applied stress and escape without leaving any visible defect. From the escape angles obtained at 183 K, an average critical stress of 100 MPa is deduced. In some cases, the pinning of dislocations leads to debris that are about 20 nm long, which formation could be recorded during the in situ experiment

  15. Deficiency of RITA results in multiple mitotic defects by affecting microtubule dynamics.

    Science.gov (United States)

    Steinhäuser, K; Klöble, P; Kreis, N-N; Ritter, A; Friemel, A; Roth, S; Reichel, J M; Michaelis, J; Rieger, M A; Louwen, F; Oswald, F; Yuan, J

    2017-04-01

    Deregulation of mitotic microtubule (MT) dynamics results in defective spindle assembly and chromosome missegregation, leading further to chromosome instability, a hallmark of tumor cells. RBP-J interacting and tubulin-associated protein (RITA) has been identified as a negative regulator of the Notch signaling pathway. Intriguingly, deregulated RITA is involved in primary hepatocellular carcinoma and other malignant entities. We were interested in the potential molecular mechanisms behind its involvement. We show here that RITA binds to tubulin and localizes to various mitotic MT structures. RITA coats MTs and affects their structures in vitro as well as in vivo. Tumor cell lines deficient of RITA display increased acetylated α-tubulin, enhanced MT stability and reduced MT dynamics, accompanied by multiple mitotic defects, including chromosome misalignment and segregation errors. Re-expression of wild-type RITA, but not RITA Δtub ineffectively binding to tubulin, restores the phenotypes, suggesting that the role of RITA in MT modulation is mediated via its interaction with tubulin. Mechanistically, RITA interacts with tubulin/histone deacetylase 6 (HDAC6) and its suppression decreases the binding of the deacetylase HDAC6 to tubulin/MTs. Furthermore, the mitotic defects and increased MT stability are also observed in RITA -/- mouse embryonic fibroblasts. RITA has thus a novel role in modulating MT dynamics and its deregulation results in erroneous chromosome segregation, one of the major reasons for chromosome instability in tumor cells.

  16. Actinic inspection of multilayer defects on EUV masks

    International Nuclear Information System (INIS)

    Barty, A; Liu, Y; Gullikson, E; Taylor, J S; Wood, O

    2005-01-01

    The production of defect-free mask blanks, and the development of techniques for inspecting and qualifying EUV mask blanks, remains a key challenge for EUV lithography. In order to ensure a reliable supply of defect-free mask blanks, it is necessary to develop techniques to reliably and accurately detect defects on un-patterned mask blanks. These inspection tools must be able to accurately detect all critical defects whilst simultaneously having the minimum possible false-positive detection rate. There continues to be improvement in high-speed non-actinic mask blank inspection tools, and it is anticipated that these tools can and will be used by industry to qualify EUV mask blanks. However, the outstanding question remains one of validating that non-actinic inspection techniques are capable of detecting all printable EUV defects. To qualify the performance of non-actinic inspection tools, a unique dual-mode EUV mask inspection system has been installed at the Advanced Light Source (ALS) synchrotron at Lawrence Berkeley National Laboratory. In high-speed inspection mode, whole mask blanks are scanned for defects using 13.5-nm wavelength light to identify and map all locations on the mask that scatter a significant amount of EUV light. In imaging, or defect review mode, a zone plate is placed in the reflected beam path to image a region of interest onto a CCD detector with an effective resolution on the mask of 100-nm or better. Combining the capabilities of the two inspection tools into one system provides the unique capability to determine the coordinates of native defects that can be used to compare actinic defect inspection with visible light defect inspection tools under commercial development, and to provide data for comparing scattering models for EUV mask defects

  17. Defect formation in fluoropolymer films at their condensation from a gas phase

    Science.gov (United States)

    Luchnikov, P. A.

    2018-01-01

    The questions of radiation defects, factors of influence of electronic high-frequency discharge plasma components on the molecular structure and properties of the fluoropolymer vacuum films synthesized on a substrate from a gas phase are considered. It is established that at sedimentation of fluoropolymer coverings from a gas phase in high-frequency discharge plasma in films there are radiation defects in molecular and supramolecular structure because of the influence of active plasma components which significantly influence their main properties.

  18. Identification of biochemical features of defective Coffea arabica L. beans.

    Science.gov (United States)

    Casas, María I; Vaughan, Michael J; Bonello, Pierluigi; McSpadden Gardener, Brian; Grotewold, Erich; Alonso, Ana P

    2017-05-01

    Coffee organoleptic properties are based in part on the quality and chemical composition of coffee beans. The presence of defective beans during processing and roasting contribute to off flavors and reduce overall cup quality. A multipronged approach was undertaken to identify specific biochemical markers for defective beans. To this end, beans were split into defective and non-defective fractions and biochemically profiled in both green and roasted states. A set of 17 compounds in green beans, including organic acids, amino acids and reducing sugars; and 35 compounds in roasted beans, dominated by volatile compounds, organic acids, sugars and sugar alcohols, were sufficient to separate the defective and non-defective fractions. Unsorted coffee was examined for the presence of the biochemical markers to test their utility in detecting defective beans. Although the green coffee marker compounds were found in all fractions, three of the roasted coffee marker compounds (1-methylpyrrole, 5-methyl- 2-furfurylfuran, and 2-methylfuran) were uniquely present in defective fractions. Published by Elsevier Ltd.

  19. Defect structure in proton-irradiated copper and nickel

    International Nuclear Information System (INIS)

    Tsukuda, Noboru; Ehrhart, P.; Jaeger, W.; Schilling, W.; Dworschak, F.; Gadalla, A.A.

    1987-01-01

    This single crystals of copper or nickel with a thickness of about 10 μm are irradiated with 3 MeV protons at room temperature and the structures of resultant defects are investigated based on measurements of the effects of irradiation on the electrical resistivity, length, lattice constants, x-ray diffraction line profile and electron microscopic observations. The measurements show that the electrical resistivity increases with irradiation dose, while leveling off at high dose due to overlapping of irradiation cascades. The lattice constants decreases, indicating that many vacancies still remain while most of the interstitial stoms are eliminated, absorbed or consumed for dislocation loop formation. The x-ray line profile undergoes broadening, which is the result of dislocation loops, dislocation networks and SFT's introduced by the proton irradiation. Various defects have different effects though they cannot be identified separately from the profile alone. A satellite peak appears at a low angle, which seems to arise from periodic defect structures that are found in electron microscopic observations. In both copper and nickel, such periodic defect structures are seen over a wide range from high to low dose. Defect-free and defect-rich domains (defect walls), 0.5 to several μm in size, are alingned parallel to the {001} plane at intervals of 60 nm. The defect walls, which consist of dislocations, dislocation loops and SFT's, is 20 - 40 nm thick. (Nogami, K.)

  20. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    Directory of Open Access Journals (Sweden)

    Abadie Jerome

    2011-05-01

    Full Text Available Abstract Background Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Methods Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Results Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. Conclusions The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model

  1. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    International Nuclear Information System (INIS)

    Hedan, Benoit; Thomas, Rachael; Motsinger-Reif, Alison; Abadie, Jerome; Andre, Catherine; Cullen, John; Breen, Matthew

    2011-01-01

    Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS) is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs) that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model for the human counterpart, providing additional evidence towards

  2. Lumber defect detection by ultrasonics

    Science.gov (United States)

    K. A. McDonald

    1978-01-01

    Ultrasonics, the technology of high-frequency sound, has been developed as a viable means for locating most defects In lumber for use in digital form in decision-making computers. Ultrasonics has the potential for locating surface and internal defects in lumber of all species, green or dry, and rough sawn or surfaced.

  3. Neutron diffraction and lattice defects

    International Nuclear Information System (INIS)

    Hamaguchi, Yoshikazu

    1974-01-01

    Study on lattice defects by neutron diffraction technique is described. Wave length of neutron wave is longer than that of X-ray, and absorption cross-section is small. Number of defects observed by ESR is up to several defects, and the number studied with electron microscopes is more than 100. Information obtained by neutron diffraction concerns the number of defects between these two ranges. For practical analysis, several probable models are selected from the data of ESR or electron microscopes, and most probable one is determined by calculation. Then, defect concentration is obtained from scattering cross section. It is possible to measure elastic scattering exclusively by neutron diffraction. Minimum detectable concentration estimated is about 0.5% and 10 20 - 10 21 defects per unit volume. A chopper and a time of flight system are used as a measuring system. Cold neutrons are obtained from the neutron sources inserted into reactors. Examples of measurements by using similar equipments to PTNS-I system of Japan Atomic Energy Research Institute are presented. Interstitial concentration in the graphite irradiated by fast neutrons is shown. Defects in irradiated MgO were also investigated by measuring scattering cross section. Study of defects in Ge was made by measuring total cross section, and model analysis was performed in comparison with various models. (Kato, T.)

  4. Lectures on cosmic topological defects

    Energy Technology Data Exchange (ETDEWEB)

    Vachaspati, T [Department of Astronomy and Astrophysics, Colaba, Mumbai (India) and Physics Department, Case Western Reserve University, Cleveland (United States)

    2001-11-15

    These lectures review certain topological defects and aspects of their cosmology. Unconventional material includes brief descriptions of electroweak defects, the structure of domain walls in non-Abelian theories, and the spectrum of magnetic monopoles in SU(5) Grand Unified theory. (author)

  5. Toward Intelligent Software Defect Detection

    Science.gov (United States)

    Benson, Markland J.

    2011-01-01

    Source code level software defect detection has gone from state of the art to a software engineering best practice. Automated code analysis tools streamline many of the aspects of formal code inspections but have the drawback of being difficult to construct and either prone to false positives or severely limited in the set of defects that can be detected. Machine learning technology provides the promise of learning software defects by example, easing construction of detectors and broadening the range of defects that can be found. Pinpointing software defects with the same level of granularity as prominent source code analysis tools distinguishes this research from past efforts, which focused on analyzing software engineering metrics data with granularity limited to that of a particular function rather than a line of code.

  6. Holographic Chern-Simons defects

    International Nuclear Information System (INIS)

    Fujita, Mitsutoshi; Melby-Thompson, Charles M.; Meyer, René; Sugimoto, Shigeki

    2016-01-01

    We study SU(N) Yang-Mills-Chern-Simons theory in the presence of defects that shift the Chern-Simons level from a holographic point of view by embedding the system in string theory. The model is a D3-D7 system in Type IIB string theory, whose gravity dual is given by the AdS soliton background with probe D7 branes attaching to the AdS boundary along the defects. We holographically renormalize the free energy of the defect system with sources, from which we obtain the correlation functions for certain operators naturally associated to these defects. We find interesting phase transitions when the separation of the defects as well as the temperature are varied. We also discuss some implications for the Fractional Quantum Hall Effect and for 2-dimensional QCD.

  7. THE BUILDER?S LIABILITY BEYOND THE DEFECTS LIABILITY

    Directory of Open Access Journals (Sweden)

    Johnson I IKPO

    2005-01-01

    Full Text Available This paper reviews the obligations of a builder after the expiration of the contracted defects liability period using relevant decided cases. The common areas identified as forming the bedrock of litigation pertain to structural and dimensional stability, freedom from damp, durability, adequate drainage, good waste disposal works, and effective service installations. Particular reference is made to walls, roofs, and services, which from the pilot study account for about 46%, 23%, and 17% respectively of the total defects attributable to the builder. It is concluded that the builder is responsible for defects arising from his product till the effluxion of reasonable time, except he establishes an element of contributory negligence.

  8. Defect forces, defect couples and path integrals in fracture mechanics

    International Nuclear Information System (INIS)

    Roche, R.L.

    1979-07-01

    In this work, it is shown that the path integrals can be introduced without any reference to the material behavior. The method is based on the definition in a continuous medium of a set of vectors and couples having the dimension of a force or a moment. More precisely, definitions are given of volume defect forces, surface defect forces, volume defect couples, and surface defect couples. This is done with the help of the stress working variation of a particule moving through the solid. The most important result is: the resultant of all the defect forces included in a volume V is the J integral on the surface surrounding V and the moment resultant is the L integral. So these integrals are defined without any assumption on the material constitutive equation. Another result is the material form of the virtual work principle - defect forces are acting like conventional forces in the conventional principles of virtual work. This lead to the introduction of the energy momentum tensor and of the associated couple stress. Application of this method is made to fracture mechanics in studying the defect forces distribution around a crack [fr

  9. Genetic and molecular risk factors within the newly identified primate-specific exon of the SAP97/DLG1 gene in the 3q29 schizophrenia-associated locus.

    Science.gov (United States)

    Uezato, Akihito; Yamamoto, Naoki; Jitoku, Daisuke; Haramo, Emiko; Hiraaki, Eri; Iwayama, Yoshimi; Toyota, Tomoko; Umino, Masakazu; Umino, Asami; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Hashimoto, Tasuku; Kanahara, Nobuhisa; Kurumaji, Akeo; Yoshikawa, Takeo; Nishikawa, Toru

    2017-12-01

    The synapse-associated protein 97/discs, large homolog 1 of Drosophila (DLG1) gene encodes synaptic scaffold PDZ proteins interacting with ionotropic glutamate receptors including the N-methyl-D-aspartate type glutamate receptor (NMDAR) that is presumed to be hypoactive in brains of patients with schizophrenia. The DLG1 gene resides in the chromosomal position 3q29, the microdeletion of which confers a 40-fold increase in the risk for schizophrenia. In the present study, we performed genetic association analyses for DLG1 gene using a Japanese cohort with 1808 schizophrenia patients and 2170 controls. We detected an association which remained significant after multiple comparison testing between schizophrenia and the single nucleotide polymorphism (SNP) rs3915512 that is located within the newly identified primate-specific exon (exon 3b) of the DLG1 gene and constitutes the exonic splicing enhancer sequence. When stratified by onset age, although it did not survive multiple comparisons, the association was observed in non-early onset schizophrenia, whose onset-age selectivity is consistent with our recent postmortem study demonstrating a decrease in the expression of the DLG1 variant in early-onset schizophrenia. Although the present study did not demonstrate the previously reported association of the SNP rs9843659 by itself, a meta-analysis revealed a significant association between DLG1 gene and schizophrenia. These findings provide a valuable clue for molecular mechanisms on how genetic variations in the primate-specific exon of the gene in the schizophrenia-associated 3q29 locus affect its regulation in the glutamate system and lead to the disease onset around a specific stage of brain development. © 2017 Wiley Periodicals, Inc.

  10. Chemotaxis-defective mutants of the nematode Caenorhabditis elegans.

    Science.gov (United States)

    Dusenbery, D B; Sheridan, R E; Russell, R L

    1975-06-01

    The technique of countercurrent separation has been used to isolate 17 independent chemotaxis-defective mutants of the nematode Caenorhabditis elegans. The mutants, selected to be relatively insensitive to the normally attractive salt NaCl, show varying degrees of residual sensitivity; some are actually weakly repelled by NaCl. The mutants are due to single gene defects, are autosomal and recessive, and identify at least five complementation groups.

  11. Defect Characterization in Semiconductors with Positron Annihilation Spectroscopy

    Science.gov (United States)

    Tuomisto, Filip

    Positron annihilation spectroscopy is an experimental technique that allows the selective detection of vacancy defects in semiconductors, providing a means to both identify and quantify them. This chapter gives an introduction to the principles of the positron annihilation techniques and then discusses the physics of some interesting observations on vacancy defects related to growth and doping of semiconductors. Illustrative examples are selected from studies performed in silicon, III-nitrides, and ZnO.

  12. Assessment of defects in ferromagnetic metals with eddy currents

    OpenAIRE

    Oaten, Susan Rosemary

    1989-01-01

    This thesis was submitted for the degree of Doctor of Philosophy and awarded by Brunel University. A study was made to identify and size surface breaking defects in ferromagnetic materials with eddy currents, whilst eliminating unwanted signals due to changes in magnetic permeability and probe lift-off. The former was overcome by the use of high frequencies and the latter by utilising the lift-off to characterise the defects. The lift- off or "touch" method was shown to be advantageous in ...

  13. Transcriptional profiling reveals molecular signatures associated with HIV permissiveness in Th1Th17 cells and identifies Peroxisome Proliferator-Activated Receptor Gamma as an intrinsic negative regulator of viral replication

    Science.gov (United States)

    2013-01-01

    Background We previously demonstrated that primary Th1Th17 cells are highly permissive to HIV-1, whereas Th1 cells are relatively resistant. Molecular mechanisms underlying these differences remain unknown. Results Exposure to replication competent and single-round VSV-G pseudotyped HIV strains provide evidence that superior HIV replication in Th1Th17 vs. Th1 cells was regulated by mechanisms located at entry and post-entry levels. Genome-wide transcriptional profiling identified transcripts upregulated (n = 264) and downregulated (n = 235) in Th1Th17 vs. Th1 cells (p-value Th17 (nuclear receptors, trafficking, p38/MAPK, NF-κB, p53/Ras, IL-23) vs. Th1 cells (proteasome, interferon α/β). Differentially expressed genes were classified into biological categories using Gene Ontology. Th1Th17 cells expressed typical Th17 markers (IL-17A/F, IL-22, CCL20, RORC, IL-26, IL-23R, CCR6) and transcripts functionally linked to regulating cell trafficking (CEACAM1, MCAM), activation (CD28, CD40LG, TNFSF13B, TNFSF25, PTPN13, MAP3K4, LTB, CTSH), transcription (PPARγ, RUNX1, ATF5, ARNTL), apoptosis (FASLG), and HIV infection (CXCR6, FURIN). Differential expression of CXCR6, PPARγ, ARNTL, PTPN13, MAP3K4, CTSH, SERPINB6, PTK2, and ISG20 was validated by RT-PCR, flow cytometry and/or confocal microscopy. The nuclear receptor PPARγ was preferentially expressed by Th1Th17 cells. PPARγ RNA interference significantly increased HIV replication at levels post-entry and prior HIV-DNA integration. Finally, the activation of PPARγ pathway via the agonist Rosiglitazone induced the nuclear translocation of PPARγ and a robust inhibition of viral replication. Conclusions Thus, transcriptional profiling in Th1Th17 vs. Th1 cells demonstrated that HIV permissiveness is associated with a superior state of cellular activation and limited antiviral properties and identified PPARγ as an intrinsic negative regulator of viral replication. Therefore, triggering PPARγ pathway via non

  14. Defect phase diagram for doping of Ga2O3

    Science.gov (United States)

    Lany, Stephan

    2018-04-01

    For the case of n-type doping of β-Ga2O3 by group 14 dopants (C, Si, Ge, Sn), a defect phase diagram is constructed from defect equilibria calculated over a range of temperatures (T), O partial pressures (pO2), and dopant concentrations. The underlying defect levels and formation energies are determined from first-principles supercell calculations with GW bandgap corrections. Only Si is found to be a truly shallow donor, C is a deep DX-like (lattice relaxed donor) center, and Ge and Sn have defect levels close to the conduction band minimum. The thermodynamic modeling includes the effect of association of dopant-defect pairs and complexes, which causes the net doping to decline when exceeding a certain optimal dopant concentration. The optimal doping levels are surprisingly low, between about 0.01% and 1% of cation substitution, depending on the (T, pO2) conditions. Considering further the stability constraints due to sublimation of molecular Ga2O, specific predictions of optimized pO2 and Si dopant concentrations are given. The incomplete passivation of dopant-defect complexes in β-Ga2O3 suggests a design rule for metastable doping above the solubility limit.

  15. Defect phase diagram for doping of Ga2O3

    Directory of Open Access Journals (Sweden)

    Stephan Lany

    2018-04-01

    Full Text Available For the case of n-type doping of β-Ga2O3 by group 14 dopants (C, Si, Ge, Sn, a defect phase diagram is constructed from defect equilibria calculated over a range of temperatures (T, O partial pressures (pO2, and dopant concentrations. The underlying defect levels and formation energies are determined from first-principles supercell calculations with GW bandgap corrections. Only Si is found to be a truly shallow donor, C is a deep DX-like (lattice relaxed donor center, and Ge and Sn have defect levels close to the conduction band minimum. The thermodynamic modeling includes the effect of association of dopant-defect pairs and complexes, which causes the net doping to decline when exceeding a certain optimal dopant concentration. The optimal doping levels are surprisingly low, between about 0.01% and 1% of cation substitution, depending on the (T, pO2 conditions. Considering further the stability constraints due to sublimation of molecular Ga2O, specific predictions of optimized pO2 and Si dopant concentrations are given. The incomplete passivation of dopant-defect complexes in β-Ga2O3 suggests a design rule for metastable doping above the solubility limit.

  16. Defect detection based on extreme edge of defective region histogram

    Directory of Open Access Journals (Sweden)

    Zouhir Wakaf

    2018-01-01

    Full Text Available Automatic thresholding has been used by many applications in image processing and pattern recognition systems. Specific attention was given during inspection for quality control purposes in various industries like steel processing and textile manufacturing. Automatic thresholding problem has been addressed well by the commonly used Otsu method, which provides suitable results for thresholding images based on a histogram of bimodal distribution. However, the Otsu method fails when the histogram is unimodal or close to unimodal. Defects have different shapes and sizes, ranging from very small to large. The gray-level distributions of the image histogram can vary between unimodal and multimodal. Furthermore, Otsu-revised methods, like the valley-emphasis method and the background histogram mode extents, which overcome the drawbacks of the Otsu method, require preprocessing steps and fail to use the general threshold for multimodal defects. This study proposes a new automatic thresholding algorithm based on the acquisition of the defective region histogram and the selection of its extreme edge as the threshold value to segment all defective objects in the foreground from the image background. To evaluate the proposed defect-detection method, common standard images for experimentation were used. Experimental results of the proposed method show that the proposed method outperforms the current methods in terms of defect detection.

  17. An Mcm10 Mutant Defective in ssDNA Binding Shows Defects in DNA Replication Initiation.

    Science.gov (United States)

    Perez-Arnaiz, Patricia; Kaplan, Daniel L

    2016-11-20

    Mcm10 is an essential protein that functions to initiate DNA replication after the formation of the replication fork helicase. In this manuscript, we identified a budding yeast Mcm10 mutant (Mcm10-m2,3,4) that is defective in DNA binding in vitro. Moreover, this Mcm10-m2,3,4 mutant does not stimulate the phosphorylation of Mcm2 by Dbf4-dependent kinase (DDK) in vitro. When we expressed wild-type levels of mcm10-m2,3,4 in budding yeast cells, we observed a severe growth defect and a substantially decreased DNA replication. We also observed a substantially reduced replication protein A- chromatin immunoprecipitation signal at origins of replication, reduced levels of DDK-phosphorylated Mcm2, and diminished Go, Ichi, Ni, and San (GINS) association with Mcm2-7 in vivo. mcm5-bob1 bypasses the growth defect conferred by DDK-phosphodead Mcm2 in budding yeast. However, the growth defect observed by expressing mcm10-m2,3,4 is not bypassed by the mcm5-bob1 mutation. Furthermore, origin melting and GINS association with Mcm2-7 are substantially decreased for cells expressing mcm10-m2,3,4 in the mcm5-bob1 background. Thus, the origin melting and GINS-Mcm2-7 interaction defects we observed for mcm10-m2,3,4 are not explained by decreased Mcm2 phosphorylation by DDK, since the defects persist in an mcm5-bob1 background. These data suggest that DNA binding by Mcm10 is essential for the initiation of DNA replication. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Strong Coupling between Nanofluidic Transport and Interfacial Chemistry: How Defect Reactivity Controls Liquid-Solid Friction through Hydrogen Bonding.

    Science.gov (United States)

    Joly, Laurent; Tocci, Gabriele; Merabia, Samy; Michaelides, Angelos

    2016-04-07

    Defects are inevitably present in nanofluidic systems, yet the role they play in nanofluidic transport remains poorly understood. Here, we report ab initio molecular dynamics (AIMD) simulations of the friction of liquid water on defective graphene and boron nitride sheets. We show that water dissociates at certain defects and that these "reactive" defects lead to much larger friction than the "nonreactive" defects at which water molecules remain intact. Furthermore, we find that friction is extremely sensitive to the chemical structure of reactive defects and to the number of hydrogen bonds they can partake in with the liquid. Finally, we discuss how the insight obtained from AIMD can be used to quantify the influence of defects on friction in nanofluidic devices for water treatment and sustainable energy harvesting. Overall, we provide new insight into the role of interfacial chemistry on nanofluidic transport in real, defective systems.

  19. Congenital Heart Defects and Receipt of Special Education Services.

    Science.gov (United States)

    Riehle-Colarusso, Tiffany; Autry, Andrew; Razzaghi, Hilda; Boyle, Coleen A; Mahle, William T; Van Naarden Braun, Kim; Correa, Adolfo

    2015-09-01

    We investigated the prevalence of receipt of special education services among children with congenital heart defects (CHDs) compared with children without birth defects. Children born from 1982 to 2004 in metropolitan Atlanta with CHDs (n = 3744) were identified from a population-based birth defect surveillance program; children without birth defects (n = 860 715) were identified from birth certificates. Cohorts were linked to special education files for the 1992-2012 school years to identify special education services. Children with noncardiac defects or genetic syndromes were excluded; children with CHDs were classified by presence or absence of critical CHDs (ie, CHDs requiring intervention by age one year). We evaluated the prevalence of receipt of special education services and prevalence rate ratios using children without birth defects as a reference. Compared with children without birth defects, children with CHDs were 50% more likely to receive special education services overall (adjusted prevalence rate ratio [aPRR] = 1.5; 95% confidence interval [CI]: 1.4-1.7). Specifically, they had higher prevalence of several special education categories including: intellectual disability (aPRR = 3.8; 95% CI: 2.8-5.1), sensory impairment (aPRR = 3.0; 95% CI: 1.8-5.0), other health impairment (aPRR = 2.8; 95% CI: 2.2-3.5), significant developmental delay (aPRR = 1.9; 95% CI: 1.3-2.8), and specific learning disability (aPRR = 1.4; 95% CI: 1.1-1.7). For most special education services, the excess prevalence did not vary by presence of critical CHDs. Children with CHDs received special education services more often than children without birth defects. These findings highlight the need for special education services and the importance of developmental screening for all children with CHDs. Copyright © 2015 by the American Academy of Pediatrics.

  20. Defect identification for the AsGa family

    International Nuclear Information System (INIS)

    Overhof, H.; Spaeth, J.-M.

    2003-01-01

    The As Ga family consists of at least four distinctly different point defects including the technologically important EL2 defect. While the different members are easily distinguished from their MCDA spectra, the differences of the hf and shf interactions as derived from ODEPR and ODENDOR are rather small. We present ab initio calculations using the LMTO-ASA Green's function method for a variety of defect models that might be relevant for the identification of As Ga -related defects. We confirm the identification of the isolated As Ga and show that the {As Ga -X 2 } defect must be identified with the nearest-neighbor antistructure pair rather than with the {As Ga -V As } pair. For the {As Ga -X 1 } defect a distant antistructure pair is a likely candidate. For the EL2, the most important member of the As Ga family, we have not found a conclusive defect model. The recent ODENDOR data are similar to those of the distant orthorhombic {As Ga -V Ga } pair, which, however is a triple acceptor and not a donor

  1. Optical coherence tomography use in the diagnosis of enamel defects

    Science.gov (United States)

    Al-Azri, Khalifa; Melita, Lucia N.; Strange, Adam P.; Festy, Frederic; Al-Jawad, Maisoon; Cook, Richard; Parekh, Susan; Bozec, Laurent

    2016-03-01

    Molar incisor hypomineralization (MIH) affects the permanent incisors and molars, whose undermineralized matrix is evidenced by lesions ranging from white to yellow/brown opacities to crumbling enamel lesions incapable of withstanding normal occlusal forces and function. Diagnosing the condition involves clinical and radiographic examination of these teeth, with known limitations in determining the depth extent of the enamel defects in particular. Optical coherence tomography (OCT) is an emerging hard and soft tissue imaging technique, which was investigated as a new potential diagnostic method in dentistry. A comparison between the diagnostic potential of the conventional methods and OCT was conducted. Compared to conventional imaging methods, OCT gave more information on the structure of the enamel defects as well as the depth extent of the defects into the enamel structure. Different types of enamel defects were compared, each type presenting a unique identifiable pattern when imaged using OCT. Additionally, advanced methods of OCT image analysis including backscattered light intensity profile analysis and enface reconstruction were performed. Both methods confirmed the potential of OCT in enamel defects diagnosis. In conclusion, OCT imaging enabled the identification of the type of enamel defect and the determination of the extent of the enamel defects in MIH with the advantage of being a radiation free diagnostic technique.

  2. Facts about Congenital Heart Defects