WorldWideScience

Sample records for identify important struggles

  1. The struggling reader: Identifying and addressing reading problems successfully at an early stage

    Directory of Open Access Journals (Sweden)

    Le Cordeur, Michael

    2010-12-01

    Full Text Available The standard of reading of learners in the intermediate phase is cause for considerable concern. In this article, the intermediate phase refers to grades 4, 5 and 6 (roughly ages 10 – 12. According to the 2008 Evaluation Assessment Tests for Reading, only 15% of learners in Grade 6 achieved the required literacy level. Clearly, reading achievement is a problem in South Africa. Although approximately 4% of any given population experience neurological reading problems, the focus of this article is on the significant number of learners in the intermediate phase who experience reading problems and the generic causes of reading problems for learners in general. The intent is to alert teachers and parents to the characteristics of a struggling reader so that the problem can be identified and addressed early. Firstly, ways in which learning problems are manifested are described. Secondly, a discussion of various types of reading problems, of which four, namely poor reading comprehension, inadequate reading fluency, a lack of vocabulary and a negative attitude towards reading, are discussed in depth. Strategies for struggling readers are presented and recommendations are made. The conclusion is that learners who experience reading problems can learn to read successfully when given the necessary support.

  2. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  3. School Foodservice Personnel's Struggle with Using Labels to Identify Whole-Grain Foods

    Science.gov (United States)

    Chu, Yen Li; Orsted, Mary; Marquart, Len; Reicks, Marla

    2012-01-01

    Objective: To describe how school foodservice personnel use current labeling methods to identify whole-grain products and the influence on purchasing for school meals. Methods: Focus groups explored labeling methods to identify whole-grain products and barriers to incorporating whole-grain foods in school meals. Qualitative analysis procedures and…

  4. Identifying Students Struggling in Courses by Analyzing Exam Grades, Self-reported Measures and Study Activities

    DEFF Research Database (Denmark)

    Christensen, Bianca Clavio; Bemman, Brian; Knoche, Hendrik

    2018-01-01

    . In this paper, we present a set of instrument`s designed to identify at-risk undergraduate students in a Problem-based Learning (PBL) university, using an introductory programming course between two campus locations as a case study. Collectively, these instruments form the basis of a proposed learning ecosystem...... in the prediction model. Results of a multiple linear regression model found several significant assessment predictors related to how often students attempted self-guided course assignments and their self-reported programming experience, among others.......Technical educations often experience poor student performance and consequently high rates of attrition. Providing students with early feedback on their learning progress can assist students in self-study activities or in their decision-making process regarding a change in educational direction...

  5. Social Struggles as Epistemic Struggles

    NARCIS (Netherlands)

    R.A. Icaza Garza (Rosalba); R. Vázquez (Rolando)

    2013-01-01

    markdownabstract__Abstract__ This contribution offers a view on social struggles as epistemic struggles to critically engage with the Activism 2010+ debate. Our core idea is that social struggles that stand up against depoliticization, economic exploitation and cultural alienation cannot be

  6. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  7. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  8. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  9. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  10. Why women of lower educational attainment struggle to make healthier food choices: the importance of psychological and social factors.

    Science.gov (United States)

    Lawrence, Wendy; Skinner, Chas; Haslam, Cheryl; Robinson, Sian; Inskip, Hazel; Barker, David; Cooper, Cyrus; Jackson, Alan; Barker, Mary

    2009-11-01

    Women of lower educational attainment are more likely to eat unhealthy diets than women of higher educational attainment. To identify influences on the food choices of women with lower educational attainment, 11 focus groups (eight with women of lower, and three with women of higher educational attainment) were held. Using a semi-structured discussion guide, environmental, social, historical and psychological factors known to be associated with food choice were explored. Audio recordings were transcribed verbatim and thematically analysed. Compared to women of higher educational attainment, women of lower educational attainment had less control over their families' food choices, less support for attempts to eat healthily, fewer opportunities to observe and learn good food-related practices, more negative affect, more perceived environmental constraints and more ambiguous beliefs about the consequences of eating a nutritious diet. These findings provide a starting point for taking forward the design of an intervention to improve the diets of young women.

  11. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  12. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  13. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  14. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  15. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  16. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  17. Struggles in (Elderly) Care

    DEFF Research Database (Denmark)

    Dahl, Hanne Marlene

    This book provides a critical engagement with the intensified struggles to be found within elderly care provision. Various social and political processes, including the forces of globalisation and the de-gendering of care, have changed how we might understand this national and global political...... of contestation. Dahl approaches these issues from a post-structuralist and radical feminist position, while drawing from feminist sociology, feminist political science, nursing philosophy and feminist history. In particular, Struggles In (Elderly) Care highlights how the predominantly feminist theorization...

  18. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  19. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  20. Generalizing: The descriptive struggle

    Directory of Open Access Journals (Sweden)

    Barney G. Glaser, Ph.D.; Hon Ph.D.

    2006-11-01

    Full Text Available The literature is not kind to the use of descriptive generalizations. Authors struggle and struggle to find and rationalize a way to use them and then fail in spite of trying a myriad of work-arounds. And then we have Lincoln and Guba’s famous statement: “The only generalization is: there is no generalization” in referring to qualitative research. (op cit, p. 110 They are referring to routine QDA yielding extensive descriptions, but which tacitly include conceptual generalizations without any real thought of knowledge about them. In this chapter I wish to explore this struggle for the purpose of explaining that the various contra arguments to using descriptive generalizations DO NOT apply to the ease of using conceptual generalizations yielded in SGT and especially FGT. I will not argue for the use of descriptive generalization. I agree with Lincoln and Guba with respect to QDA, “the only generalization is: there is no generalization.” It is up to the QDA methodologists, of whom there are many; to continue the struggle and I wish them well.

  1. No struggle, no strength

    DEFF Research Database (Denmark)

    Morgall, J M; Almarsdóttir, A B

    1999-01-01

    Research accounts of the struggle of professions to attain and maintain a monopoly, strategies of exclusion and usurpation, make for interesting and often exciting reading. The purpose of this article is to present a less frequently reported phenomenon--the study of a profession that had a monopo...

  2. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  3. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  5. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  6. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  7. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  8. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Struggle against climate change

    International Nuclear Information System (INIS)

    2009-01-01

    This document first proposes a presentation of the cross-cutting policy defined for the struggle against climate change. It notably presents its various programs. It describes the implemented strategy which aims at reducing on a short term greenhouse gas emissions with the available technologies, at making the climate challenge a driver for economic competitiveness, at developing the knowledge on climatic change and at preparing the necessary adaptation measures, and at stating on the international scene the French commitment and its dynamic role in front of the climate challenge

  10. Valuation Struggles over Pricing

    DEFF Research Database (Denmark)

    Pallesen, Trine

    2016-01-01

    of creating political markets, and political prices, here understood as market distortion. This paper studies the ‘politics’ of pricing by following the adoption of the first feed-in tariff in France. Pricing as a way of achieving non-economic ends, such as climate mitigation, brings the values of several...... public goods into play, all the while prompting a translation of these values into a single price. Following the struggles over the pricing of wind power in the early 2000s, the study illustrates that rather than a pollution of the market sphere by that of politics, a politics of pricing can be observed...

  11. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  12. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  13. New Ideological Struggle?

    Directory of Open Access Journals (Sweden)

    Sergey Aleksandrovich Karaganov

    2016-12-01

    Full Text Available Instead of predicted end of ideology and ideological competition due to presumed 15-20 years ago final victory of Western liberalism and democracy the world is sliding into the new ideological struggle. There are many reasons for it: appeal of the West is declining, the democratization and renationalization of international polities push to the fore new leaders and most of them profess traditional and nationalist values. New post-European values did not get hold in Russian society seeking old values it has been cut off during the 70 years of the Communist experiment and also due to the fact that the West pursued a neo-Weimar policy of geopolitical expansion, which provoked defensive reaction to everything coming from the West. The intensity of the new ideological struggle is exacerbated by the moral and ideological vacuum created by modernization, which pushes aside many traditional religious and moral values. Author concludes that mutual resentment between Russia and Europe is quite strong right now, but it’s better to build good-neighborly relations while understanding that we are different. And it’s needed to try hard to avoid a new systemic military-political confrontation that is desired by many forces.

  14. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  15. No struggle, no strength

    DEFF Research Database (Denmark)

    Morgall, Janine Marie; Almarsdóttir, Anna Birna

    1999-01-01

    Research accounts of the struggle of professions to attain and maintain a monopoly, strategies of exclusion and usurpation, make for interesting and often exciting reading. The purpose of this article is to present a less frequently reported phenomenon--the study of a profession that had a monopoly......, and then lost it. The authors attempt to answer the question: under what circumstances will a profession support the state in breaking their own monopoly? The study looked at the pharmacy profession in Iceland in the light of the recent change in drug legislation. Interviews with key actors in the pharmacy...... profession were conducted to gain an understanding of how they interpreted and experienced this change. Three factors contributed to the break in the professional monopoly: (1) political desire to take advantage of new competition and deregulation policy, (2) desire to cut the health budget and (3) internal...

  16. Struggling at work

    DEFF Research Database (Denmark)

    Hjarsbech, Pernille U; Nielsen, Maj Britt D.; Andersen, Malene Friis

    2015-01-01

    Purpose: Little is known on how employees at work with mental health problems experience their work environment. This study explores how a selected sample of Danish employees with depressive symptoms experience the interaction with their work environment and how they respond to and deal...... with problems at work. Methods: From a survey study on work and mental health in Denmark, we invited participants for in-depth interviews. Using grounded theory, we conducted 13 semi structured interviews with employees, at work, experiencing depressive symptoms. Findings: Work was pivotal for the informants...... is a key element for employees with depressive symptoms struggling at work. Practitioners and other health and rehabilitation practitioners working with people with depressive symptoms and other mental health problems could inquire about supervisor's behaviour and relation between supervisors and employees...

  17. Karl Ove Knausgaard's My Struggle

    DEFF Research Database (Denmark)

    Schmitt, Arnaud; Kjerkegaard, Stefan

    2016-01-01

    In this study of Karl Ove Knausgaard’s My Struggle, the authors theorize what paratextual information does to one’s reading, especially in autobiography informed literature. Although My Struggle can be read both as memoir and novel, and even as autofiction, Knausgaard is aiming at a higher truth...

  18. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  19. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  20. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  1. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  2. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  3. One Family's Struggles with Rotavirus

    Medline Plus

    Full Text Available ... getvaxed about GETVAXED print ads go to GETVAXED.ORG cme Immunizations Rotavirus One family's struggles with rotavirus ... free-of-charge. Branded videos contain the "PKIDs.ORG" end slate; unbranded videos are provided for organizations ...

  4. One Family's Struggle with Chickenpox

    Medline Plus

    Full Text Available ... getvaxed about GETVAXED print ads go to GETVAXED.ORG cme Immunizations Chickenpox (Varicella) One family's struggles with ... free-of-charge. Branded videos contain the "PKIDs.ORG" end slate; unbranded videos are provided for organizations ...

  5. One Family's Struggle with Chickenpox

    Medline Plus

    Full Text Available ... GETVAXED print ads go to GETVAXED.ORG cme Immunizations Chickenpox (Varicella) One family's struggles with chickenpox We ... not possible without a visit to your doctor. Immunizations stop disease from spreading. Check with your family ...

  6. One Family's Struggles with Rotavirus

    Medline Plus

    Full Text Available ... GETVAXED print ads go to GETVAXED.ORG cme Immunizations Rotavirus One family's struggles with rotavirus We provide ... not possible without a visit to your doctor. Immunizations stop disease from spreading. Check with your family ...

  7. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  8. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  10. Struggling with a depression diagnosis

    DEFF Research Database (Denmark)

    Rønberg, Mette

    2017-01-01

    In this article, I explore how an adult experiences and negotiates the process of being diagnosed with depression, and how she struggles to learn to live under this particular diagnostic descrip- tion. It is based on two interviews with one informant, Bridget, being part of a larger ethnograph- ic...... eldwork in Denmark among adults diagnosed with depression. Psychiatric diagnoses are the most common categories used when su ering and life problems are to be understood, interpret- ed, and acted upon in Denmark. Bridget’s story is a case in which resistance against, and ongoing negotiations...... and complicated struggles with, a psychiatric diagnosis stand out, as she continu- ously struggles to articulate an oppositional stance to the dominant diagnostic categories. The negotiations take place in a complex network where medical authorities, the workplace and the diagnostic cultures play a crucial part...

  11. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  12. Internet Pornography Use, Perceived Addiction, and Religious/Spiritual Struggles.

    Science.gov (United States)

    Grubbs, Joshua B; Exline, Julie J; Pargament, Kenneth I; Volk, Fred; Lindberg, Matthew J

    2017-08-01

    Prior work has demonstrated that religious beliefs and moral attitudes are often related to sexual functioning. The present work sought to examine another possibility: Do sexual attitudes and behaviors have a relationship with religious and spiritual functioning? More specifically, do pornography use and perceived addiction to Internet pornography predict the experience of religious and spiritual struggle? It was expected that feelings of perceived addiction to Internet pornography would indeed predict such struggles, both cross-sectionally and over time, but that actual pornography use would not. To test these ideas, two studies were conducted using a sample of undergraduate students (N = 1519) and a sample of adult Internet users in the U.S. (N = 713). Cross-sectional analyses in both samples found that elements of perceived addiction were related to the experience of religious and spiritual struggle. Additionally, longitudinal analyses over a 1-year time span with a subset of undergraduates (N = 156) and a subset of adult web users (N = 366) revealed that perceived addiction to Internet pornography predicted unique variance in struggle over time, even when baseline levels of struggle and other related variables were held constant. Collectively, these findings identify perceived addiction to Internet pornography as a reliable predictor of religious and spiritual struggle.

  13. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  14. Triage for Struggling Adolescent Readers

    Science.gov (United States)

    Diamond, Linda J.

    2006-01-01

    To improve achievement for struggling readers in particular, secondary schools must design programs and curricula to address students' lack of background knowledge, delayed English language development, and limited success in reading. In this article, the author presents a systems approach that offers intensive care for the most at-risk students…

  15. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  16. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  17. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  18. Challenging Tasks Lead to Productive Struggle!

    Science.gov (United States)

    Livy, Sharyn; Muir, Tracey; Sullivan, Peter

    2018-01-01

    Productive struggle leads to productive classrooms where students work on complex problems, are encouraged to take risks, can struggle and fail yet still feel good about working on hard problems (Boaler, 2016). Teachers can foster a classroom culture that values and promotes productive struggle by providing students with challenging tasks. These…

  19. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  20. Public trust: Struggle and regain

    International Nuclear Information System (INIS)

    Aoki, Tadao

    1999-01-01

    The after-effect of Monju and Tokai accidents has been much larger than expected. It struck PNC a fierce blow and the damage did not stop there but extended to the nuclear community at large. As a result, PNC was reformed into a new corporate, Japan Nuclear Cycle Development Institute (JNC). JNC has been given a new body but its mind must be cultivated so as to be able to regain public trust. This presentation summarizes the struggle to regain public trust in case of Monju. After five and a half years of construction work, Monju began pre-operation tests in May 1991, achieved initial criticality in April 1994 and the first connection to the grid in August 1995, and the accident occurs in December 1995. Until then, there was confidence, perhaps overconfidence, and it was taken for granted that the public was always in favour of 'nuclear'. The struggle to regain the public confidence involved: (1) Improvement of safety measures and emergency management; (2) Cultivation of a new corporate culture; (3) Open information; (4) Public communication (i.e. 'Door-to-door visit', 'Public meeting', 'Come-and-see', Weekly press conference. The struggle may continue for some time

  1. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  2. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  3. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  4. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  6. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  7. China struggles to reform giants

    International Nuclear Information System (INIS)

    McDonald, Paul

    1999-01-01

    This article examines the struggle to reform the Chinese oil industry. Topics discussed include the defending of state monopolies, the capital injections required by the three main national oil companies, the bidding of the China National Petroleum Corporation (CNPC) for oilfields in Kazakhstan resulting in the need for large investment, and CNPC's failure to meet its spending commitments in the Middle East. Expenditure on exploration, the funding of gas development, and the plans of the China Petroleum Corporation (Sinopec) to raise funds overseas are discussed, and competition problems are considered. (UK)

  8. Understanding women's struggles for justice, healing, and redress ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    A study of gender and reparation in ..... historical memory, and redress. ..... interpretation in the research process and in struggles for justice and reparations more .... importance of women's leadership in engaging change at the community level. ...... Such knowledge contrasts with both an epistemological framework of.

  9. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  10. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  11. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  12. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  13. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  14. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  15. Screening for Spiritual Struggle in an Adolescent Transgender Clinic: Feasibility and Acceptability.

    Science.gov (United States)

    Grossoehme, Daniel H; Teeters, Alexis; Jelinek, Sue; Dimitriou, Sophia M; Conard, Lee Ann E

    2016-01-01

    Spiritual struggles are associated with poorer health outcomes, including depression, which has higher prevalence among transgender individuals than the general population. This study's objective was to improve the quality of care in an outpatient transgender clinic by screening patients and caregivers for spiritual struggle and future intervention. The quality improvement questions addressed were whether screening for spiritual struggle was feasible and acceptable; and whether the sensitivity and specificity of the Rush Protocol were acceptable. Revision of the screening was based on cognitive interviews with the 115 adolescents and caregivers who were screened. Prevalence of spiritual struggle was 38-47%. Compared to the Negative R-COPE, the Rush Protocol screener had sensitivities of 44-80% and specificities of 60-74%. The Rush Protocol was acceptable to adolescents seen in a transgender clinic, caregivers, and clinic staff; was feasible to deliver during outpatient clinic visits, and offers a straightforward means of identifying transgender persons and caregivers experiencing spiritual struggle.

  16. Science and the struggle for relevance

    NARCIS (Netherlands)

    Hessels, L.K.|info:eu-repo/dai/nl/304832863

    2010-01-01

    This thesis deals with struggles for relevance of university researchers, their efforts to make their work correspond with ruling standards of relevance and to influence these standards. Its general research question is: How to understand changes in the struggle for relevance of Dutch academic

  17. Change Makers: The Struggle for Consumer Rights.

    Science.gov (United States)

    Nelson, Helen E.; And Others

    1995-01-01

    "Video Documentary Project: A Brief History" (Nelson, Clark) describes "Change Makers: The Struggle for Consumer Rights," a documentary that tells stories of ordinary people who participated in the struggle to obtain fairness in the marketplace. "An Appraisal" (Mayer) offers a review of the film. (JOW)

  18. Practicum Training for Teachers of Struggling Readers

    Science.gov (United States)

    Morris, Darrell

    2011-01-01

    Teachers who work with struggling beginning readers need a supervised training experience that leads them to understand both how reading ability develops and how to adapt instruction to meet the needs of individual children. The practicum, in which a teacher works with one struggling reader under the supervision of an experienced and expert…

  19. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  20. Religious and Spiritual Struggles as Concerns for Health and Well-Being

    Directory of Open Access Journals (Sweden)

    Nick Stauner

    2016-03-01

    Full Text Available People struggle with religion and spirituality in several ways, including challenges in trusting God, confronting supernatural evil, tolerating other perspectives on religion, maintaining moral propriety, finding existential meaning, and managing religious doubt. These religious and spiritual (R/S struggles relate to both physical and mental health independently of other religious and distress factors. Causality in this connection needs further study, but evidence supports many potential causes and moderators of the link between R/S struggle and health. These include personality, social, and environmental influences, including traumatic experiences and subcultural differences. Many theoretical questions remain unresolved, including how change in R/S struggle can predict or be predicted by change in health and other connected constructs, and how one might intervene to aid those who struggle with religious or spiritual challenges. Nonetheless, research momentum has grown, having already produced a wealth of information that underscores the need for greater attention to this domain. R/S struggle poses an important exception to generally positive overall associations between religion and well-being, though even R/S struggle may promote growth. This review offers a brief introduction to emerging psychological theory and research on R/S struggle with an emphasis on its relevance to wellness and illness.

  1. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  2. Toddlers at the Table: Avoiding Power Struggles

    Science.gov (United States)

    ... Search English Español Toddlers at the Table: Avoiding Power Struggles KidsHealth / For Parents / Toddlers at the Table: ... common concerns into opportunities to teach healthy eating habits. Most Toddlers Are Picky Eaters Many toddlers express ...

  3. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... sq how to do kids infect kids links & resources M.O.V.E. parents for prevention ... go to GETVAXED.ORG cme Immunizations HPV (Human Papillomavirus) One family's struggles with HPV We provide ...

  4. Mobbing and Methods of Struggle with Mobbing

    Directory of Open Access Journals (Sweden)

    Tevfik Erdem

    2014-12-01

    Full Text Available In the article, especially in the workplace increasing with an alias called psychological terror is given information about the mobbing. Detailed description of methods of struggle against mobbing is also done for employees.

  5. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... getvaxed about GETVAXED print ads go to GETVAXED.ORG cme Immunizations HPV (Human Papillomavirus) One family's struggles ... free-of-charge. Branded videos contain the "PKIDs.ORG" end slate; unbranded videos are provided for organizations ...

  6. One Family's Struggles with Hepatitis B

    Medline Plus

    Full Text Available ... getvaxed about GETVAXED print ads go to GETVAXED.ORG cme Immunizations Hepatitis B One family's struggles with ... free-of-charge. Branded videos contain the "PKIDs.ORG" end slate; unbranded videos are provided for organizations ...

  7. One Family's Struggles with Pertussis (Whooping Cough)

    Medline Plus

    Full Text Available ... getvaxed about GETVAXED print ads go to GETVAXED.ORG cme Immunizations Pertussis (Whooping Cough) One family's struggles ... free-of-charge. Branded videos contain the "PKIDs.ORG" end slate; unbranded videos are provided for organizations ...

  8. One Family's Struggles with Pertussis (Whooping Cough)

    Medline Plus

    Full Text Available ... GETVAXED print ads go to GETVAXED.ORG cme Immunizations Pertussis (Whooping Cough) One family's struggles with pertussis ... not possible without a visit to your doctor. Immunizations stop disease from spreading. Check with your family ...

  9. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... GETVAXED print ads go to GETVAXED.ORG cme Immunizations HPV (Human Papillomavirus) One family's struggles with HPV ... not possible without a visit to your doctor. Immunizations stop disease from spreading. Check with your family ...

  10. One Family's Struggles with Hepatitis B

    Medline Plus

    Full Text Available ... GETVAXED print ads go to GETVAXED.ORG cme Immunizations Hepatitis B One family's struggles with hepatitis B ... not possible without a visit to your doctor. Immunizations stop disease from spreading. Check with your family ...

  11. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  12. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  13. Auditing Nicaragua's anti-corruption struggle, 1998 to 2009.

    Science.gov (United States)

    Arosteguí, Jorge; Hernandez, Carlos; Suazo, Harold; Cárcamo, Alvaro; Reyes, Rosa Maria; Andersson, Neil; Ledogar, Robert J

    2011-12-21

    Four social audits in 1998, 2003, 2006 and 2009 identified actions that Nicaragua could take to reduce corruption and public perception in primary health care and other key services. In a 71-cluster sample, weighted according to the 1995 census and stratified by geographic region and settlement type, we audited the same five public services: health centres and health posts, public primary schools, municipal government, transit police and the courts. Some 6,000 households answered questions about perception and personal experience of unofficial and involuntary payments, payments without obtaining receipts or to the wrong person, and payments "to facilitate" services in municipal offices or courts. Additional questions covered complaints about corruption and confidence in the country's anti-corruption struggle. Logistic regression analyses helped clarify local variations and explanatory variables. Feedback to participants and the services at both national and local levels followed each social audit. Users' experience of corruption in health services, education and municipal government decreased. The wider population's perception of corruption in these sectors decreased also, but not as quickly. Progress among traffic police faltered between 2006 and 2009 and public perception of police corruption ticked upwards in parallel with drivers' experience. Users' experience of corruption in the courts worsened over the study period--with the possible exception of Managua between 2006 and 2009--but public perception of judicial corruption, after peaking in 2003, declined from then on. Confidence in the anti-corruption struggle grew from 50% to 60% between 2003 and 2009. Never more than 8% of respondents registered complaints about corruption.Factors associated with public perception of corruption were: personal experience of corruption, quality of the service itself, and the perception that municipal government takes community opinion into account and keeps people informed

  14. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  15. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  16. Vietnamese women in struggle for national independence.

    Science.gov (United States)

    1998-01-01

    The 30-year struggle for independence in Viet Nam took a huge toll on women, but even in the hardest times, Vietnamese women received support from the world-wide women's movement. As the world prepares to enter the new millennium, it is important to determine what policies can be created to prevent war and guarantee peace. These policies must grow out of international agreement on basic principles such as respect for independence and sovereignty and must not resort to the embargoes and sanctions that have placed a disproportionate burden on women and children. Another challenge of the new millennium is to encourage implementation of national programs, policies, and measures to help women realize their rights while preserving traditional family values. Despite the heightened visibility of the international women's movement, women still suffer from widespread inequalities. In accordance with the goals of the Communist Party of Viet Nam, the 8th Congress of Vietnamese Women in 1997 created a national plan for women that is a blueprint for the women's movement for the years 1997-2000. Among the goals are creating jobs for women, upgrading their standard of living, eliminating hunger, decreasing poverty, and ensuring that women have educational opportunities. Vietnamese women also seek to strengthen their relationship with other women in the international community, and the Vietnamese Women's Union has actively forwarded the objectives of the Federation of International Democratic Women.

  17. Race, Social Struggles, and ‘Human’ Rights

    DEFF Research Database (Denmark)

    Suárez-Krabbe, Julia

    2013-01-01

    Many contemporary social movements in Latin America base their political projects upon a critique of colonialism or coloniality, and point to the problem of racism that lies at the core of human rights thinking. This article further develops these critiques by discussing two important antecedents...... to contemporary human rights thinking. The first concerns the construction of the hierarchical category ‘human’ during the conquest and colonization of America. The second concerns the ways in which a particular construction of race crystallized and played a pivotal role in the social struggles of racialized...... subjects in Latin America during independence and republic building. These struggles ensured that an idea of racial equality was incorporated into the legal frameworks of the newly independent Latin American countries. However, the inclusion of this idea in the legal bases of these new republics was...

  18. Investigating the knowledge level of sellers of pesticides used in agricultural struggle in Adana province

    OpenAIRE

    Nazlıcan, Ersin; Ötegen, Volkan Recai; Akbaba, Muhsin; İlter, Hüseyin

    2018-01-01

    Objective:While significant increase in pesticide use in our country, most extensive usesare at Aegean and Mediterranean regions. Adjusting amount of pesticideconsumption is important for both human health and environmental contamination.Our aim is investigating the level of knowledge of sellers of pesticides usedin agricultural struggle about pesticides in Adana, in Mediterranean region.Method: In Adana, survey with 37 questions applied to sellers of pesticidesused in agricultural struggle, ...

  19. The Battle for Business Ethics: A Struggle Theory

    OpenAIRE

    Kaptein, Muel

    2015-01-01

    textabstractTo be and to remain ethical requires struggle from organizations. Struggling is necessary due to the pressures and temptations management and employees encounter in and around organizations. As the relevance of struggle for business ethics has not yet been analyzed systematically in the scientific literature, this paper develops a theory of struggle that elaborates on the meaning and dimensions of struggle in organizations, why and when it is needed, and what its antecedents and c...

  20. Using cognitive referents in making sense of teaching: A chemistry teacher's struggle to change assessment practices

    Science.gov (United States)

    Briscoe, Carol

    This qualitative case study focused on the role of cognitive referents in the sense-making process of one teacher as he attempted to change his classroom science assessment. The interpretations identify cultural myths, conceptual metonymys, as well as personally constructed beliefs as referents that constrained change. The teacher's cognitive struggle to make sense of assessment and his role as assessor are linked to conflicting referents he used in varying contexts including day-to-day assessment and summative assessment settings. The results of the study suggest that cognitive referents are important influences in driving how a teacher thinks about assessment and may constrain an individual teacher's implementation of innovative practices. Accordingly, identification of referents such as myths, their associated beliefs, and metonymic conceptual models that teachers use to make sense of their actions is an important first step in developing an understanding of constraints to educational change.

  1. Women and political struggles: achievements and limitations lived in the second half of twentieth century

    Directory of Open Access Journals (Sweden)

    Flávia Fernandes de Carvalhaes

    2016-06-01

    Full Text Available The second half of the twentieth century was a period marked by important achievements and setbacks in the struggle for women's rights field. This study mapped out and described part of speeches, images and movements undertaken in that historical period and its effects on people's lives. Adopting a perspective of historical and theoretical analysis, the description looked up, first, the struggles carried out in some countries of Europe and the United States, highlighting its main challenges and difficulties. Then, the struggles undertaken are mapped in Brazil, with the analysis axis facing women inequality. Finally, it is considered that the political struggles carried out in the analyzed period had as greatest merits the disruption and exploitation of gender boundaries.

  2. Struggling for Water and Pastures in Niger

    DEFF Research Database (Denmark)

    Cold-Ravnkilde, Signe Marie

    inform natural resource struggles on the ground and reveals that points of contest between universalism and cultural relativism in regard to property, public authority and justice are reflected in both national legislation and in international development practices. On the basis of a sensitive study...... of struggles over water and pastures in Diffa, Signe Marie Cold-Ravnkilde accounts for the outcome of conflict and cooperation and explains why herders, like people in other cultures, conceive of their rights in a contradictory manner: as requiring adoption to cultural specific conditions and yet applies...

  3. One Family's Struggle with Chickenpox

    Medline Plus

    Full Text Available ... vaccinate posters buttons and banners videos someone you love flu overview nasal spray flu caccine CDC surveillance ... pediatric hepatitis report infection protection bioterrorism five second rule germs handwashing why handwashing is important handwashing cartoon ...

  4. One Family's Struggles with Rotavirus

    Medline Plus

    Full Text Available ... vaccinate posters buttons and banners videos someone you love flu overview nasal spray flu caccine CDC surveillance ... pediatric hepatitis report infection protection bioterrorism five second rule germs handwashing why handwashing is important handwashing cartoon ...

  5. One Family's Struggle with Chickenpox

    Medline Plus

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  6. One Family's Struggles with Rotavirus

    Medline Plus

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  7. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  8. From struggles to resource gains in interprofessional service networks: Key findings from a multiple case study.

    Science.gov (United States)

    Toiviainen, Hanna; Kira, Mari

    2017-07-01

    In interprofessional service networks, employees cross professional boundaries to collaborate with colleagues and clients with expertise and values different from their own. It can be a struggle to adopt shared work practices and deal with "multivoicedness." At the same time, networks allow members to engage in meaningful service provision, gain a broader understanding of the service provided, and obtain social support. Intertwined network struggles and resource gains have received limited attention in the interprofessional care literature to date. The aim of the study was to investigate the learning potential of the co-existing struggles and resource gains. This article reports findings from two interprofessional networks. Interviews were conducted with 19 employees and thematically analysed. Three types of struggles and six types of resource gains of networking were identified. The struggles relate, first, to the assumptions of networking following similar practices to those in a home organisation; second, to the challenges of dealing with the multivoicedness of networking; and, third, to the experienced gap between the networking ideals and the reality of cooperation. At the same time, the network members experience gains in emotional resources (e.g., stronger sense of meaningfulness at work), cognitive resources (e.g., understanding the customer needs from alternative perspectives), and social resources (e.g., being able to rely on other professionals' competence). Learning potential emerged from the dynamics between coexisting struggles and resource gains.

  9. Meeting the Needs of Struggling Adolescent Readers

    Science.gov (United States)

    Stover, Katie; O'Rear, Allison; Morris, Carolyn

    2015-01-01

    Research suggests that additional reading instruction is necessary to support struggling adolescent readers. In addition to time allocated for reading and access to appropriately leveled texts, many students need teacher support in learning and implementing a range of reading strategies. As a high school English teacher and a middle school Social…

  10. Berlin: Emergency shelters and contemporary border struggles

    Directory of Open Access Journals (Sweden)

    Žiga Podgornik-Jakil

    2016-06-01

    Full Text Available Researching the developments of present political economy must necessarily include investigating the tools of contemporary border regime. These are used for surveillance and control of populations in order to create new divisions of labour and enable extraction of rent by using peoples’ bodies. The article focuses on emergency shelters in Berlin, that is, on their function and ways in which the asylum seekers accommodated there spontaneously struggle against them. The research was done as a militant and cooperative work of the network Lager Mobilisation Network in Berlin’s district Wedding, which builds connections with people housed in the sports halls in the mentioned district. The author underlines that exhausting the aslyum seekers psychically is one of the strategies for filtering the ‘unwanted’ from the ‘wanted’, that is the ones that are interesting for the labour market. At the same time, the restriction of movement and limited access to civil rights confine asylum seekers in emergency shelters run by private companies, which seek profits on their account. Far from claiming that non-profit companies have a ‘better’ shelter administration, since the boundaries between them and profit-oriented companies are often blurred, the author rather speaks of new forms of anticolonial struggles by the people living inside. He understands these struggles as the struggles against the contemporary border regime in Germany and the EU and as a potential for building an inclusive society.

  11. Improving reading achievements of struggling learners

    NARCIS (Netherlands)

    Houtveen, Thoni; van de Grift, Wim

    In The Netherlands, the percentage of struggling readers in the 1st year of formal reading instruction is about 25%. This problem inspired us to develop the Reading Acceleration Programme. To evaluate the effectiveness of this programme, a quasi-experiment is carried out. The teachers in the

  12. Psychology's struggle for existence: Second edition, 1913.

    Science.gov (United States)

    Wundt, Wilhelm; Lamiell, James T

    2013-08-01

    Presents an English translation of Wilhelm Wundt's Psychology's struggle for existence: Second edition, 1913, by James T. Lamiell in August, 2012. In his essay, Wundt advised against the impending divorce of psychology from philosophy. (PsycINFO Database Record (c) 2013 APA, all rights reserved).

  13. One Family's Struggles with Hepatitis B

    Medline Plus

    Full Text Available ... immunizations about immunizations current news Flu's Gonna Lose hepatitis a & b vaccines im/sq how to do kids ... cme Immunizations Hepatitis B One family's struggles with hepatitis B We provide this video in a variety of formats and lengths for use by ...

  14. Seven Billion People: Fostering Productive Struggle

    Science.gov (United States)

    Murawska, Jaclyn M.

    2018-01-01

    How can a cognitively demanding real-world task such as the Seven Billion People problem promote productive struggle "and" help shape students' mathematical dispositions? Driving home from school one evening, Jaclyn Murawska heard a commentator on the radio announce three statements: (1) experts had determined that the world population…

  15. Young women struggling for an identity.

    Science.gov (United States)

    Dickerson, Victoria C

    2004-09-01

    In this article, I propose that many young women in today's world are facing an intense internal struggle to find their identity, and that this struggle is an effect of what they experience as enormous pressure to achieve certain goals. My belief is that, in the contemporary atmosphere of postfeminism in which women seemingly have many more options, the young adult woman experiences these options as expectations. The effect of these demands is an enormous self-doubt where women feel worthless, unimportant, and often unable to go forward in their lives. This article focuses on the stories of 3 young women and their struggles: a 25-year-old White middle-class woman whose obsessive longing to find the "right" man leads to eating difficulties; a 23-year-old lesbian, also White, who is just graduating from college and believes that she is terminally depressed; and a 29-year-old Chinese American woman who has fought anxiety and chronic fatigue for most of her adult life. How they find their way clearly exemplifies both the struggle and the road to success--overcoming self-doubt and challenging the expectations that create the conditions for it.

  16. The Battle for Business Ethics: A Struggle Theory

    NARCIS (Netherlands)

    S.P. Kaptein (Muel)

    2015-01-01

    textabstractTo be and to remain ethical requires struggle from organizations. Struggling is necessary due to the pressures and temptations management and employees encounter in and around organizations. As the relevance of struggle for business ethics has not yet been analyzed systematically in the

  17. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  18. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  19. Adolescents' struggles with swallowing tablets: barriers, strategies and learning.

    Science.gov (United States)

    Hansen, Dana Lee; Tulinius, Ditte; Hansen, Ebba Holme

    2008-01-01

    To explore adolescents' struggles with taking oral medications. Copenhagen, Denmark. Semi-structured qualitative interviews were conducted with 89 adolescents (33 boys, 56 girls) between the ages of 11 and 20. Adolescents were recruited through four public schools. To identify struggles with taking oral medication, interview transcripts were systematically searched for statements including the terms swallow, chew, crush and eat. Thematic analysis of the identified statements was carried out to reveal dominant themes in the adolescents' accounts. Over one-third of the adolescents spontaneously provided accounts of the difficulties they experienced with taking oral medications, especially with swallowing tablets. Three themes were dominant in their narratives: barriers, strategies and learning. Barriers experienced by the adolescents involved the medications' properties, e.g. taste. Adolescents developed strategies to overcome these barriers, e.g. crushing tablets. Via a process of learning-by-doing and the acquisition of increased experience and autonomy, many adolescents mastered the skill of swallowing tablets. Many adolescents experienced barriers in their attempts to swallow tablets. They developed various strategies to overcome these barriers and gradually mastered taking medicines in a learning-by-doing process.

  20. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  1. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  2. Maritime insurance as a way to struggle piracy

    Directory of Open Access Journals (Sweden)

    Ekaterina S. Anyanova

    2016-09-01

    Full Text Available Objective to research the features of maritime insurance from the viewpoint of fighting piracy at international level and to define the ways to improve the legal norms in this sphere. Methods dialectic method of cognition and private scientific research methods formallegal systemicstructural sociallegal comparativelegal statistical. Results basing on the analysis of normative legal acts regulating the relations in the sphere of maritime insurance as one of the ways to struggle against piracy the insufficiency of unified insurance norms at internationallegal level is revealed features of modern piracy are identified as well as the dependence of the insurance cost on the piratesrsquo activity the state of legal protection of the shipownerrsquos interests in case of piratesrsquo attacks at international routes a conclusion is made that the difficulties with the ldquopiracyrdquo notion do not hinder its fullfledged research in international law the drawbacks of the piracy concept in international law are reflected the insurance legal norms are studied as well as the drawbacks in insufficient unification and stronger protection of shipowners in case of ransom payments especially in RF. Scientific novelty for the first time in the article the internationallegal features of maritime piracy are viewed as one of the measures of struggle against piracy. Practical significance the main provisions and conclusions of the article can be used in practical scientific and educational activity when dealing with the issues of maritime insurance of piracy risks.

  3. The Struggle Between Liberties and Authorities in the Information Age.

    Science.gov (United States)

    Taddeo, Mariarosaria

    2015-10-01

    The "struggle between liberties and authorities", as described by Mill, refers to the tension between individual rights and the rules restricting them that are imposed by public authorities exerting their power over civil society. In this paper I argue that contemporary information societies are experiencing a new form of such a struggle, which now involves liberties and authorities in the cyber-sphere and, more specifically, refers to the tension between cyber-security measures and individual liberties. Ethicists, political philosophers and political scientists have long debated how to strike an ethically sound balance between security measures and individual rights. I argue that such a balance can only be reached once individual rights are clearly defined, and that such a definition cannot prescind from an analysis of individual well-being in the information age. Hence, I propose an analysis of individual well-being which rests on the capability approach, and I then identify a set of rights that individuals should claim for themselves. Finally, I consider a criterion for balancing the proposed set of individual rights with cyber-security measures in the information age.

  4. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  5. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  6. Wedding Pedagogy and Politics: Oral Histories of Black Women Teachers and the Struggle against Apartheid.

    Science.gov (United States)

    Wieder, Alan

    2002-01-01

    Presents the stories of three black, female, activist teachers who combined teaching and politics to help fight South Africa's apartheid regime. They promoted alternative curricula and worked against apartheid oppression. Each believed in the struggle and, although they believed in nonracialism, they identified as black, a political construction…

  7. Leprosy: ongoing medical and social struggle in Vietnam.

    Science.gov (United States)

    Nguyen, Nhiem; Tat Nguyen, Thang; Hong Phan, Hai; Tam Tran, Tinh

    2008-01-01

    Until recently, leprosy had been prominent in 33 countries worldwide, and Vietnam was ranked among the top 14 endemic countries. The leprosy situation in Vietnam was reviewed as a sample of the worldwide ongoing medical and social struggle to assess the need for continued support for leprosy control activities and for social programs of integration of leprosy victims into the community. A search was conducted of official Vietnamese publications, World Health Organization documents, major electronic databases, and popular leprosy Web sites; as well, notes from visits to local leprosy clinics and interviews with health workers were checked. Important achievements were realized through national determination and international collaboration. In contrast with the impressive performance statistics at the national level, and despite strong government efforts for leprosy control, the results obtained at the province-city and district-commune levels still exhibit deficiencies in case detection, treatment, and socioeconomic integration of leprosy victims. The struggle to eliminate such a complex and destructive infectious disease as leprosy does not end with the cure. Deep-seated medical and social problems remain. These problems are best solved through community-based approaches.

  8. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  9. Women neurologist: a worldwide and Brazilian struggle

    Directory of Open Access Journals (Sweden)

    Marleide da Mota Gomes

    2011-10-01

    Full Text Available The main aim of this paper was to present some pioneer women neurologist, their struggle to pursue their career and the barriers mainly encountered at the beginning of their professional lives. It was also presented the progressive increasing of the feminine participation in medicine and in the neurology with study based on data of the School of Medicine of the Federal University of Rio de Janeiro and Brazilian Academy of Neurology. Their composition were analyzed according to gender, class and academic rank. In spite of this feminization, there is lack of a women's parallel advancement into leadership positions despite no visible barriers ("glass ceiling".

  10. AN INNER STRUGGLE: UNDER WESTERN EYES

    Directory of Open Access Journals (Sweden)

    Hale Yağlıdere

    2013-06-01

    Full Text Available This study aims to shed light on the most significant aspect of the modern man’s inner struggle in Joseph Conrad’s Under Western Eyes. Joseph Conrad is one of the authors of the twentieth century who was influenced by the psychological philosophy and he makes use of this influence in his works deeply. He who synthesizes the inner nature of the modern man, having conflicts himself with the deeper analysis field of the psychology aims to point out the incomprehensible and unsettled inner nature of the modern man in Under Western Eyes.

  11. Women neurologist: a worldwide and Brazilian struggle.

    Science.gov (United States)

    Gomes, Marleide da Mota

    2011-10-01

    The main aim of this paper was to present some pioneer women neurologist, their struggle to pursue their career and the barriers mainly encountered at the beginning of their professional lives. It was also presented the progressive increasing of the feminine participation in medicine and in the neurology with study based on data of the School of Medicine of the Federal University of Rio de Janeiro and Brazilian Academy of Neurology. Their composition were analyzed according to gender, class and academic rank. In spite of this feminization, there is lack of a women's parallel advancement into leadership positions despite no visible barriers ("glass ceiling").

  12. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  13. Easy-going, rational, susceptible and struggling eaters: A segmentation study based on eating behaviour tendencies.

    Science.gov (United States)

    Pentikäinen, Saara; Arvola, Anne; Karhunen, Leila; Pennanen, Kyösti

    2018-01-01

    Eating behaviour tendencies, emotional eating (EE), uncontrolled eating (UE) and cognitive restraint (CR), are associated with various indicators of physical and mental health. Therefore, it is important to understand these tendencies in order to design interventions to improve health. Previous research has mostly examined eating behaviour tendencies individually, without considering typical combinations of these tendencies or their manifestation in well-being and food choices. This study aimed to understand the interactive occurrence of EE, UE and CR in two independent populations. Finnish (n = 1060) and German (n = 1070) samples were segmented on the basis of their responses to a modified Three-Factor Eating Questionnaire (TFEQ-R15). Well-being, coping strategies and food consumption habits of the segments were studied. Segmentation revealed four segments: "Susceptible", "Easy-going", "Rational" and "Struggling". These segments were similar in both countries with regard to well-being, coping strategies and food choices. EE and UE co-occurred, and these tendencies were mainly responsible for differentiating the segments. Members of the "Rational" and "Easy-going" segments, who had low scores for EE and UE, tended to experience vitality and positive emotions in life, and contentment with their eating. By contrast, the "Susceptible" and "Struggling" segments, with more pronounced tendencies towards EE and UE, experienced lower levels of vitality and less frequently positive emotions, applied less adaptive coping strategies and experienced more discontent with eating. The results of the current study suggest that it is possible to identify segments, with differing eating habits, coping strategies and well-being on the basis of the eating behaviour tendencies EE, UE and CR. We discuss possible viewpoints for the design of interventions and food products to help people towards psychologically and physiologically healthier eating styles. Copyright © 2017 Elsevier

  14. Black Lives Matter of Black Identity Extremist? : The FBI, Black Activists and the Struggle for Victimhood

    NARCIS (Netherlands)

    Mutsaers, Paul

    2017-01-01

    The question 'who is the victim?' is an important social directive that shapes the struggles for victimhood in which Black Lives Matters, U.S. police forces and their various (counter)publics are currently engaging. This column begins with a controversial FBI report on so-called Black Identity

  15. Business without the Math: Competing Discourses and the Struggle to Develop an Undergraduate Leadership Program

    Science.gov (United States)

    McLaren, Patricia Genoe; McGowan, Rosemary A.; Gerhardt, Kris; Diallo, Lamine; Saeed, Akbar

    2013-01-01

    Despite widespread acknowledgement of the importance of leadership education, undergraduate leadership degree programs in Canada are limited and, in some cases, struggling for survival. This case study examines the ways in which competing discourses of careerism, postsecondary corporatization, liberal arts education, and business education impact…

  16. The Struggle for Industrial Education in the "Lowell of the South," Columbus, Georgia, 1850-1930

    Science.gov (United States)

    Bradshaw, Lauren Yarnell; Bohan, Chara Haeussler

    2013-01-01

    The history of Columbus, Georgia, cannot be separated from that of the local textile mills; the mills were important in defining the economic success, the social struggles, and the enduring legacy of southern industrial tycoons. Evidence of this industrial past can be seen on almost every street, school, and business located in the city along the…

  17. Motivation to Read: How Does It Change for Struggling Readers with and without Disabilities?

    Science.gov (United States)

    Melekoglu, Macid A.; Wilkerson, Kimber L.

    2013-01-01

    Lack of reading motivation impedes upper elementary and secondary school students' willingness to improve critical reading skills and strategies to be successful in school. Struggling readers often show a negative attitude towards reading tasks and manifest low motivation to read. Although the importance of motivation is clear, there is limited…

  18. Maslow's Hierarchy of Needs and Navajo Students' Struggle for Self Esteem.

    Science.gov (United States)

    Walker, Kay

    1996-01-01

    Maslow's theory of a hierarchy of needs is used to analyze Navajo youths' struggles for identity, fulfillment, and self-esteem. Answers to the challenges of substance abuse, violence, and gang membership are offered based upon George Bearden's eight-step plan, which stresses the importance of understanding human needs to perceive and transform…

  19. Women's struggle against poverty: the SEWA story.

    Science.gov (United States)

    Chatterjee, M

    1998-01-01

    The Self-Employed Women's Association (SEWA) is an Ahmedabad-based union of women workers established in 1972. Backed by 212,000 association members organized to fight poverty through full employment and self-reliance, SEWA workers demand the right to work for food, income, and social security. Since its creation, SEWA has fought to gain the recognition of home-based and outside workers' legitimate rights. However, it was realized during the course of such struggle that struggle alone could not fulfill the demands, needs, and priorities of workers. There was also a need to create alternative economic organizations of workers. The joint action of union and cooperatives has therefore been SEWA's organizing strategy for more than 2 decades. An account of employment and income generated by SEWA members in 1997 is presented. Building alternative economic organizations is discussed in terms of access to capital, markets, raw materials, and knowledge and skills; building organizational and managerial capacities; upgrading skills through training; social security; and enabling policies.

  20. How to Reduce Customer Struggles in Online Shopping in China

    OpenAIRE

    Wang, Fan

    2012-01-01

    This paper attempts to provide efficient approaches on reducing customer struggles in online shopping. It appears that online retailing in China needs more improvements based on the customer-centred perspective. Customer struggles relate to physical and psychological flounders, such as unqualified products, unsatisfied services, loss of money and information leakage. Factors that affect customer struggles online include price, diversity of products, quality of items, quality of services, and ...

  1. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  3. The Self's Struggle for Recognition. August Strindberg and the Other

    DEFF Research Database (Denmark)

    Granild, Lars

    2007-01-01

    and his need for the recognition of others. Because of the demand for absolute freedom the self suffers from an anxiety of influence which constantly leads to interpersonal or metaphysical identity struggles and to a monologic approach toward the Other. This anxiety, however, is exactly a sign of lacking......In this article I focus on the Other's important role for the identity of the self in the writings of August Strindberg. I argue that the instability and dynamism that characterize the self and writing in Strindberg are due to a dialectic between the self's romantic demond for absolute freedom...... autonomy - of a dialogical self. Because of the hero's dialogic consciousness the discourse and dialogue are on a closer inspection filled with dialogically sideward glances and polemical strokes at the Other. I argue that it is the self's dialogical consciousness that prevent many of Strindberg's texts...

  4. Searchable Signatures: Context and the Struggle for Recognition

    Directory of Open Access Journals (Sweden)

    Gina Schlesselman-Tarango

    2013-09-01

    Full Text Available Social networking sites made possible through Web 2.0 allow for unique user-generated tags called “searchable signatures.”  These tags move beyond the descriptive and act as means for users to assert online individual and group identities.  A study of searchable signatures on the Instagram application demonstrates that these types of tags are valuable not only because they allow for both individuals and groups to engage in what social theorist Axel Honneth calls the struggle for recognition, but also because they provide contextual use data and sociohistorical information so important to the understanding of digital objects.  This article explores how searchable signatures might be used by both patrons and staff in library environments.

  5. Green conflicts as discursive struggles over the common good

    DEFF Research Database (Denmark)

    Horsbøl, Anders

    conflicts as discursive struggles over how to represent the common good when it comes to the environment, i.e. whether concerns about natural environments and landscapes are asso‑ ciated with common or just particular interests, and how these interests are articulated discursively. An important aspect....... the infamous Not In My Backyard attitude). The paper will analyze these 'scalations' of time and space and the ways in which they contribute to conflicting representations of the common good in green conflicts. Moreover, central topoi (Wodak et al. 2009, Wengeler 2013) which are employed to weigh the opposing...... is the scales of time and space (Lemke 2000, Chilton 2004) invoked in the debate. As for temporality, concerns about the local environment may for instance invoke the idea of a natural heritage of a place which extends far back in time and calls for common responsibility many years ahead, or they may be limited...

  6. Elite Struggle and Stability of the Political Regime in Uzbekistan

    Directory of Open Access Journals (Sweden)

    Сабрина Павловна Базылева

    2017-12-01

    Full Text Available The death of the President of Uzbekistan Islam Karimov, an official announcement which appeared in the second half of the day September 2 - involuntarily forced to wonder about his successor and most importantly, about the continuity of the course. Externally, in the country there is peace and order. Islam Karimov has built a stable system, authoritarian regime. This stability is due to the pragmatism of the Uzbek members of the junta. A special role in the economy and politics of Uzbekistan plays a clan system which has evolved over the last 100-120 years according to the territorial principle and immigrants, which today represent the political elite of the country. The article examines Elite struggle and the stability of the political regime in Uzbekistan available today.

  7. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  8. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  9. Humanitarian Struggle in Burma's Conflict Zones.

    Science.gov (United States)

    Gyo, Moe

    The Back Pack Health Worker Team (BPHWT), a community- based health organization, provides primary health care to ethnic people in conflict, remote, and internally displaced areas, in Burma (aka Myanmar), controlled by ethnic armed organizations fighting against the Burma government. Its services include both curative and preventative health care through a network of 1,425 health personnel including community health workers and village-embedded traditional birth attendants and village health workers. The BPHWT organizational and program model may prove useful to Special Operations medical actions in support of insurgent movements and conversely with a host nation's counterinsurgency strategies, which include the extension of its health services into areas that may be remote and/or inhabited by indigenous people and have insurgency potential. In the former respect, special attention is directed toward "humanitarian struggle" that uses health care as a weapon against the counterinsurgency strategies of a country's oppressive military. 2017.

  10. Mental Suffering as a Struggle with Words

    DEFF Research Database (Denmark)

    Rosfort, René

    2016-01-01

    of suffering. I unfold this argument in five steps. I will first look at the vexed question of what emotions are. Discussing biological and rational conceptions of emotions, I argue that human emotions are deeply ambiguous phenomena constituted by an opaque combination of biological factors and rational......Human emotional life is structured and to a certain extent constituted by language, and yet making sense of and communicating how we feel is often a challenge. In this article, I will argue that a person’s struggle to make sense of and articulate her suffering plays a major role in the experience...... factors. In the second section, I will argue that instead of trying to solve the ontological riddle of emotions we should investigate the actual experience of emotions. I examine the dialectics of the conceptual and the phenomenal aspects of our emotional experience, arguing that we need to adopt...

  11. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  12. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  13. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  14. Supporting Struggling Readers in Secondary School Science Classes

    Science.gov (United States)

    Roberts, Kelly D.; Takahashi, Kiriko; Park, Hye-Jin; Stodden, Robert A.

    2012-01-01

    Many secondary school students struggle to read complex expository text such as science textbooks. This article provides step-by-step guidance on how to foster expository reading for struggling readers in secondary school science classes. Two strategies are introduced: Text-to-Speech (TTS) Software as a reading compensatory strategy and the…

  15. Finding versus Fixing: Self-Monitoring for Readers Who Struggle

    Science.gov (United States)

    Anderson, Nancy L.; Kaye, Elizabeth L.

    2017-01-01

    This article explains how teachers can understand, notice, and supportively respond to readers who struggle with self-monitoring during text reading. The unique strategic processing demands for readers who struggle support the argument that teaching children to find and notice errors is different than fixing a word, or getting it right. Three…

  16. Struggling doctors in specialist training: a case control study

    DEFF Research Database (Denmark)

    O'Neill, Lotte; Norberg, Karen; Thomsen, Maria

    ), or transferred (i.e. had unplanned changes in place of training/ward due to failure to thrive or due to inadequate development of competences), or dropped out (i.e. were dismissed from, had resigned from, or changed their speciality). Controls were a random sample of doctors in the source population, who were......Abstract summary The aim of this cummulative incidence case-control study was to examine: if struggling trainees in medical specialist training (cases) tended to struggle already in medical school or not compared to non-struggling controls, and which performance indicators during medical school...... seemed to predict struggling in postgraduate education if any. The study design is rooted in epidemiological methodology. Struggling doctors in specialist training: a case-control study. It has been reported in the international literature, that around 3-10% of doctors in post-garduate specialist...

  17. Struggles, strengths, and strategies: an ethnographic study exploring the experiences of adolescents living with an ostomy

    Science.gov (United States)

    Nicholas, David B; Swan, Sylvia R; Gerstle, Ted J; Allan, Theresa; Griffiths, Anne Marie

    2008-01-01

    Background Adolescents with IBD requiring ostomy surgery experience perioperative needs that may exceed those of patients experiencing other major abdominal surgery [1]. This procedure requires ongoing and vigilant daily care and management. Gastrointestinal symptoms and complications impose psychological and social stresses on young patients [2], and the procedure results in body image changes and daily regimens of self-care. This study aimed to explore adolescents' experiences and quality of life following ostomy surgery. Methods Ethnographic interviews and a subsequent focus group were conducted with 20 adolescents with an ostomy or j-pouch being treated at the Hospital for Sick Children in Toronto, Canada. Interviews were transcribed verbatim and subjected to theme generation. Results Findings suggest that adolescents are profoundly affected by their ostomy. Adolescents convey strength as well as adjustment struggles. Identified impacts include body intrusion and body image changes, decreased independence, secrecy about the ostomy, adjustment over time, challenges for the family, and strategies for constructively moving forward. Conclusion Implications address the importance of ensuring meaningful opportunities to understand and reframe the stresses of illness. An ongoing clinical challenge involves the promotion of a healthy self-esteem and psychosocial adjustment for these adolescents and their families. Finding effective ways to minimize stress and embarrassment and reframe personal shame, constitute important clinical priorities. Opportunities for peer support and family dialogue may assist in clarifying worries and easing the burden carried by these young persons. Flexible and adequately funded resources are advocated in fostering quality of life. PMID:19091104

  18. Struggles, strengths, and strategies: an ethnographic study exploring the experiences of adolescents living with an ostomy

    Directory of Open Access Journals (Sweden)

    Allan Theresa

    2008-12-01

    Full Text Available Abstract Background Adolescents with IBD requiring ostomy surgery experience perioperative needs that may exceed those of patients experiencing other major abdominal surgery 1. This procedure requires ongoing and vigilant daily care and management. Gastrointestinal symptoms and complications impose psychological and social stresses on young patients 2, and the procedure results in body image changes and daily regimens of self-care. This study aimed to explore adolescents' experiences and quality of life following ostomy surgery. Methods Ethnographic interviews and a subsequent focus group were conducted with 20 adolescents with an ostomy or j-pouch being treated at the Hospital for Sick Children in Toronto, Canada. Interviews were transcribed verbatim and subjected to theme generation. Results Findings suggest that adolescents are profoundly affected by their ostomy. Adolescents convey strength as well as adjustment struggles. Identified impacts include body intrusion and body image changes, decreased independence, secrecy about the ostomy, adjustment over time, challenges for the family, and strategies for constructively moving forward. Conclusion Implications address the importance of ensuring meaningful opportunities to understand and reframe the stresses of illness. An ongoing clinical challenge involves the promotion of a healthy self-esteem and psychosocial adjustment for these adolescents and their families. Finding effective ways to minimize stress and embarrassment and reframe personal shame, constitute important clinical priorities. Opportunities for peer support and family dialogue may assist in clarifying worries and easing the burden carried by these young persons. Flexible and adequately funded resources are advocated in fostering quality of life.

  19. The validity of student tutors' judgments in early detection of struggling in medical school. A prospective cohort study.

    Science.gov (United States)

    O'Neill, Lotte Dyhrberg; Morcke, Anne Mette; Eika, Berit

    2016-12-01

    Early identification and support of strugglers in medical education is generally recommended in the research literature, though very little evidence of the diagnostic qualities of early teacher judgments in medical education currently exists. The aim of this study was to examine the validity of early diagnosis of struggling in medical school based on informal teacher judgements of in-class behavior. The study design was a prospective cohort study and the outcomes/truth criteria were anatomy failure and medical school drop out. Six weeks into an anatomy course, student tutors attempted to identify medical students, who they reckoned would fail the anatomy course or drop out, based on their everyday experiences with students in a large group educational setting. In addition, they were asked to describe the indicators of struggling they observed. Sixteen student tutors evaluated 429 medical students for signs of struggling. By week six, the student tutors were able to detect approximately 1/4-1/3 of the students who eventually failed or dropped out, and for ¾ of the strugglers they identified, they were correct in their judgments. Informal student tutor's judgements showed incremental validity for both outcomes when controlling for grades obtained in preceeding exams. Lack of participation, lack of commitment, poor academic performance, poor social interactions and general signs of distress were the main indicators of struggling identified. Teachers' informal judgements of in-class behavior may be an untapped source of information in the early identification of struggling medical students with added value above and beyond formal testing.

  20. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  1. Bifactor Models of Religious and Spiritual Struggles: Distinct from Religiousness and Distress

    Directory of Open Access Journals (Sweden)

    Nick Stauner

    2016-06-01

    Full Text Available The Religious and Spiritual Struggles Scale (RSS measures important psychological constructs in an underemphasized section of the overlap between religion and well-being. Are religious/spiritual struggles distinct from religiousness, distress, and each other? To test the RSS’ internal discriminant validity, we replicated the original six-factor measurement model across five large samples (N = 5705 and tested the fit of a restricted bifactor model, which supported the mutual viability of multidimensional and unidimensional scoring systems for the RSS. Additionally, we explored a bifactor model with correlated group factors that exhibited optimal fit statistics. This model maintained the correlations among the original factors while extracting a general factor from the RSS. This general factor’s strong correlations with religious participation and belief salience suggested that this factor resembles religiousness itself. Estimating this general factor seemed to improve Demonic and Moral struggles’ independence from religiousness, but did not change any factor’s correlations with neuroticism, depression, anxiety, and stress. These distress factors correlated with most of the independent group factors corresponding to the original dimensions of the RSS, especially Ultimate Meaning and Divine struggles. These analyses demonstrate the discriminant validity of religious/spiritual struggles and the complexity of their relationships with religiousness and distress.

  2. The importance of civilian nursing organizations: integrative literature review.

    Science.gov (United States)

    Santos, James Farley Estevam Dos; Santos, Regina Maria Dos; Costa, Laís de Miranda Crispim; Almeida, Lenira Maria Wanderley Santos de; Macêdo, Amanda Cavalcante de; Santos, Tânia Cristina Franco

    2016-06-01

    to identify and analyze evidence from studies about the importance of civilian nursing organizations. an integrative literature review, for which searches were conducted in the databases LILACS, PubMed/MEDLINE, SciELO, BDENF, and Scopus. sixteen articles published between the years 2004-2013 were selected, 68.75% of which were sourced from Brazilian journals and 31.25% from American journals. civilian nursing organizations are important and necessary, because they have collaborated decisively in nursing struggles in favor of the working class and society in general, and these contributions influence different axes of professional performance.

  3. Bioethics and corruption: a personal struggle.

    Science.gov (United States)

    Blasszauer, Bela

    2013-01-01

    The author attempts to give a general picture of corruption, especially in the area of healthcare. Corruption ranges from fraud, through deceit, bribery and dehumanisation, to immeasurable moral decay. As a bioethicist who has challenged corruption in various ways, the author approaches this worldwide plague mainly on the basis of his personal experience. He does not offer a recipe for successfully combating corruption, but tries to provide some ways and means to fight immorality without self-defeat. Bioethics is not a discipline whose task is to investigate, expose, or punish corrupt people. A number of agencies exist for this "noble" job. Nevertheless, an ethics teacher should not be completely indifferent to obvious and harmful immoral behaviour, regardless of his/her personal compulsions. It is not the "patient rights" that threaten the prestige of the medical profession; it is rather the bad apples that infiltrate the moral mission of this esteemed work. It seems that the hardest challenges in the struggle against corruption are bad laws-laws that provide loopholes and immunity to immoral dealings. In a stable, strong democracy, morally unfounded laws can, and will be changed. Where real democracy exists, they would not even have come into effect.

  4. Concepts of health: women's struggle for wholeness in the midst of poverty.

    Science.gov (United States)

    Polakoff, Elizabeth; Gregory, David

    2002-12-01

    This article describes the findings of a modest qualitative study that deals with the concept of health and involves the women-centered interviewing of six women who live in poverty. The themes uncovered in this study identify the struggle for wholeness in the midst of poverty. The findings validate many of the nursing theorists' definitions of health as wholeness, and challenge care providers to bring an appreciation of this view to their understanding of women's health.

  5. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  6. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  7. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  8. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  9. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  10. Review: Ways of teaching struggling reading students, and beginners

    African Journals Online (AJOL)

    Review: Ways of teaching struggling reading students, and beginners. ... International Journal of Pedagogy, Policy and ICT in Education. Journal Home · ABOUT THIS JOURNAL ... AJOL African Journals Online. HOW TO USE AJOL.

  11. Ten Years after Tiananmen: Some Unsung Heroes of the Struggle.

    Science.gov (United States)

    American Educator, 1999

    1999-01-01

    Tells the life stories of some of the people who have worked for human rights and democracy in contemporary China. Five profiles show the obstacles faced by Chinese teachers in the human-rights struggle. (SLD)

  12. Struggling to Hear? Tiny Devices Can Keep You Connected

    Science.gov (United States)

    ... Human Services Search form Search Site Menu Home Latest Issue Past Issues Special Issues Subscribe May 2018 Print this issue Struggling to Hear? Tiny Devices Can Keep You Connected En español Send us ...

  13. Observing writing processes of struggling adult writers with collaborative writing

    Directory of Open Access Journals (Sweden)

    Afra Sturm

    2016-10-01

    Full Text Available This study investigated how struggling adult writers solve a writing task and what they know about writing and themselves as writers. The writing process of the adult writers was examined by combining three elements: the observation of collaborative writing tasks, analyses of their written texts, and structured individual interviews that included both retrospective and prospective parts. This methodical approach provides productive tools to assess writing processes and writing knowledge of struggling adult writers. The triangulation of data from the different sources is visualized in a case study. Findings from the case study suggest both similarities and differences between struggling adult and younger writers. Concerning the writing process of both groups, planning and revision play a limited role. However, alongside these similar limitations in their writing process, struggling adult writers distinguish themselves from their young counterparts through their relatively extensive knowledge about themselves as writers.

  14. Taking the struggle elsewhere. Minority representation in the European Parliament

    DEFF Research Database (Denmark)

    Wilken, Lisanne

    This paper explored and discussed the struggle for recognition by representatives of linguistic minorities in the European Parliament from the early 1970s and up to the recognition of select minority languages as co-national languages in 2005......This paper explored and discussed the struggle for recognition by representatives of linguistic minorities in the European Parliament from the early 1970s and up to the recognition of select minority languages as co-national languages in 2005...

  15. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  16. Helping struggling students in introductory biology: a peer-tutoring approach that improves performance, perception, and retention.

    Science.gov (United States)

    Batz, Zachary; Olsen, Brian J; Dumont, Jonathan; Dastoor, Farahad; Smith, Michelle K

    2015-01-01

    The high attrition rate among science, technology, engineering, and mathematics (STEM) majors has long been an area of concern for institutions and educational researchers. The transition from introductory to advanced courses has been identified as a particularly "leaky" point along the STEM pipeline, and students who struggle early in an introductory STEM course are predominantly at risk. Peer-tutoring programs offered to all students in a course have been widely found to help STEM students during this critical transition, but hiring a sufficient number of tutors may not be an option for some institutions. As an alternative, this study examines the viability of an optional peer-tutoring program offered to students who are struggling in a large-enrollment, introductory biology course. Struggling students who regularly attended peer tutoring increased exam performance, expert-like perceptions of biology, and course persistence relative to their struggling peers who were not attending the peer-tutoring sessions. The results of this study provide information to instructors who want to design targeted academic assistance for students who are struggling in introductory courses. © 2015 Z. Batz et al. CBE—Life Sciences Education © 2015 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  17. Helping Struggling Students in Introductory Biology: A Peer-Tutoring Approach That Improves Performance, Perception, and Retention

    Science.gov (United States)

    Batz, Zachary; Olsen, Brian J.; Dumont, Jonathan; Dastoor, Farahad; Smith, Michelle K.

    2015-01-01

    The high attrition rate among science, technology, engineering, and mathematics (STEM) majors has long been an area of concern for institutions and educational researchers. The transition from introductory to advanced courses has been identified as a particularly “leaky” point along the STEM pipeline, and students who struggle early in an introductory STEM course are predominantly at risk. Peer-tutoring programs offered to all students in a course have been widely found to help STEM students during this critical transition, but hiring a sufficient number of tutors may not be an option for some institutions. As an alternative, this study examines the viability of an optional peer-tutoring program offered to students who are struggling in a large-enrollment, introductory biology course. Struggling students who regularly attended peer tutoring increased exam performance, expert-like perceptions of biology, and course persistence relative to their struggling peers who were not attending the peer-tutoring sessions. The results of this study provide information to instructors who want to design targeted academic assistance for students who are struggling in introductory courses. PMID:25976652

  18. Auditing Nicaragua’s anti-corruption struggle, 1998 to 2009

    Science.gov (United States)

    2011-01-01

    Background Four social audits in 1998, 2003, 2006 and 2009 identified actions that Nicaragua could take to reduce corruption and public perception in primary health care and other key services. Methods In a 71-cluster sample, weighted according to the 1995 census and stratified by geographic region and settlement type, we audited the same five public services: health centres and health posts, public primary schools, municipal government, transit police and the courts. Some 6,000 households answered questions about perception and personal experience of unofficial and involuntary payments, payments without obtaining receipts or to the wrong person, and payments "to facilitate" services in municipal offices or courts. Additional questions covered complaints about corruption and confidence in the country's anti-corruption struggle. Logistic regression analyses helped clarify local variations and explanatory variables. Feedback to participants and the services at both national and local levels followed each social audit. Results Users' experience of corruption in health services, education and municipal government decreased. The wider population's perception of corruption in these sectors decreased also, but not as quickly. Progress among traffic police faltered between 2006 and 2009 and public perception of police corruption ticked upwards in parallel with drivers' experience. Users' experience of corruption in the courts worsened over the study period -- with the possible exception of Managua between 2006 and 2009 -- but public perception of judicial corruption, after peaking in 2003, declined from then on. Confidence in the anti-corruption struggle grew from 50% to 60% between 2003 and 2009. Never more than 8% of respondents registered complaints about corruption. Factors associated with public perception of corruption were: personal experience of corruption, quality of the service itself, and the perception that municipal government takes community opinion into

  19. Auditing Nicaragua’s anti-corruption struggle, 1998 to 2009

    Directory of Open Access Journals (Sweden)

    Arosteguí Jorge

    2011-12-01

    Full Text Available Abstract Background Four social audits in 1998, 2003, 2006 and 2009 identified actions that Nicaragua could take to reduce corruption and public perception in primary health care and other key services. Methods In a 71-cluster sample, weighted according to the 1995 census and stratified by geographic region and settlement type, we audited the same five public services: health centres and health posts, public primary schools, municipal government, transit police and the courts. Some 6,000 households answered questions about perception and personal experience of unofficial and involuntary payments, payments without obtaining receipts or to the wrong person, and payments "to facilitate" services in municipal offices or courts. Additional questions covered complaints about corruption and confidence in the country's anti-corruption struggle. Logistic regression analyses helped clarify local variations and explanatory variables. Feedback to participants and the services at both national and local levels followed each social audit. Results Users' experience of corruption in health services, education and municipal government decreased. The wider population's perception of corruption in these sectors decreased also, but not as quickly. Progress among traffic police faltered between 2006 and 2009 and public perception of police corruption ticked upwards in parallel with drivers' experience. Users' experience of corruption in the courts worsened over the study period -- with the possible exception of Managua between 2006 and 2009 -- but public perception of judicial corruption, after peaking in 2003, declined from then on. Confidence in the anti-corruption struggle grew from 50% to 60% between 2003 and 2009. Never more than 8% of respondents registered complaints about corruption. Factors associated with public perception of corruption were: personal experience of corruption, quality of the service itself, and the perception that municipal government

  20. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  1. Struggle in the ethics of technology

    Directory of Open Access Journals (Sweden)

    E. Schuurman

    2006-07-01

    Full Text Available The advantages as well as the disadvantages of modern technology, especially in combination with the development of the natural sciences, call in general for philosophical reflection. There is a struggle going on between the various philosophical movements. What is the content of Christian-philosophical thinking about technology and its problems? And what are the consequences in relation to the ethics of technology? Such questions are very unusual among Christians. Nevertheless, the potentially disastrous effects of technology require an ethics of technology. Such an ethics must concern itself with man’s good and responsible conduct in and through technology. Generally speaking, since modern times there has been a technological control mentality. All questions relating to spiritual reflection and religious problems are ruled out. The world view has been transformed to a technological worldview. Motives, values and norms are derived from it. This implies a technological ethics which is the cause of many threats and problems. It is characterised by a cosmological deficit and an ethical deficit. It is only possible to overcome these deficits by a reorientation in culture and in ethics. The “Enlightenment” ought to be enlightened itself by the God-given revelation. The cosmology of the reality as God’s creation and the commandments of love give a possibility for the redirection of an ethics of technology. A responsible cultural and technological development evokes a representation of culture that depicts earth as a garden tended by humans. Technology must be developed within the perspective of the earth as one large garden-city. Technology ought to serve life and not to threaten it. Besides, in an ethics of responsibility attention is given to the central motive of love against the central motive of power of the technological worldview. For a justified, responsible technology the ethical challenge is finding not only true motives, but also

  2. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  3. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  4. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  5. Shorter lines facilitate reading in those who struggle.

    Directory of Open Access Journals (Sweden)

    Matthew H Schneps

    Full Text Available People with dyslexia, who ordinarily struggle to read, sometimes remark that reading is easier when e-readers are used. Here, we used eye tracking to observe high school students with dyslexia as they read using these devices. Among the factors investigated, we found that reading using a small device resulted in substantial benefits, improving reading speeds by 27%, reducing the number of fixations by 11%, and importantly, reducing the number of regressive saccades by more than a factor of 2, with no cost to comprehension. Given that an expected trade-off between horizontal and vertical regression was not observed when line lengths were altered, we speculate that these effects occur because sluggish attention spreads perception to the left as the gaze shifts during reading. Short lines eliminate crowded text to the left, reducing regression. The effects of attention modulation by the hand, and of increased letter spacing to reduce crowding, were also found to modulate the oculomotor dynamics in reading, but whether these factors resulted in benefits or costs depended on characteristics, such as visual attention span, that varied within our sample.

  6. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  7. Struggles for Equal Rights and Social Justice as Unrepresented and Represented in Psychological Research.

    Science.gov (United States)

    Turiel, Elliot; Chung, Eunkyung; Carr, Jessica A

    2016-01-01

    Issues of equality and social justice remain important concerns for contemporary societies. Struggles for equal rights and fair treatment continue in both organized movements and in acts of everyday life. We first consider trends in psychological research that fail to address such struggles and may even impede theoretical understanding of the complex processes of thought and action involved when individuals confront situations of welfare, justice, and rights. Then, we consider research, which attempts to address these issues. We review studies on the development of moral judgments and on understandings of equality and distributive justice. We also discuss research that accounts for the varying social contexts of individual lives and conceives of human behavior as engaged in moral judgments, which often produce resistance and opposition to injustice. In conclusion, we call for more attention in psychological research to issues of equity and social justice. © 2016 Elsevier Inc. All rights reserved.

  8. A legacy of struggle: the OSHA ergonomics standard and beyond, Part II.

    Science.gov (United States)

    Delp, Linda; Mojtahedi, Zahra; Sheikh, Hina; Lemus, Jackie

    2014-11-01

    The OSHA ergonomics standard issued in 2000 was repealed within four months through a Congressional resolution that limits future ergonomics rulemaking. This section continues the conversation initiated in Part I, documenting a legacy of struggle for an ergonomics standard through the voices of eight labor, academic, and government key informants. Part I summarized important components of the standard; described the convergence of labor activism, research, and government action that laid the foundation for a standard; and highlighted the debates that characterized the rulemaking process. Part II explores the anti-regulatory political landscape of the 1990s, as well as the key opponents, power dynamics, and legal maneuvers that led to repeal of the standard. This section also describes the impact of the ergonomics struggle beyond the standard itself and ends with a discussion of creative state-level policy initiatives and coalition approaches to prevent work-related musculoskeletal disorders (WMSDs) in today's sociopolitical context.

  9. Class Struggle in Contemporary Films: "Hunger Games" vs. "Arrow, The Ultimate Weapon"

    Directory of Open Access Journals (Sweden)

    Dal Yong Jin

    2016-05-01

    Full Text Available By critically engaging with Marxist notion of class struggle in contemporary films utilizing the bow and arrow as their signifier, this paper textually analyzes two films in order to find distinctive characteristics of Western movies and non-Western movies. Since the textual analysis becomes very important to understanding how media texts might be used in order to make sense of the world we live in—meaning it is significant to contextualize it within our life and/or society, this paper investigates the ways in which the major themes have developed and what their representations are. It therefore compares and contrasts these movies in terms of their major themes, in particular the ways in which these two films portray capitalism, either internally or externally. It especially examines how the bow and arrow symbolize class struggle either within a country or between countries in order to map out the major differences that the arrows represent.

  10. Gender, resistance and land: interlinked struggles over resources and meanings in South Asia.

    Science.gov (United States)

    Agarwal, B

    1994-10-01

    This article examines the nature of women's resistance to gender inequities in resource distribution and ideological representation. It argues that to understand how women perceive these inequities it is necessary to take into account not only their overt protests but also the many covert forms their resistance might take. At the same time, to significantly alter gendered structures of property and power it appears necessary to move beyond 'individual-covert' to 'group-overt' (organized collective) resistance. These issues are examined here especially in the context of women's struggles for land rights and gender equality in South Asia. Although historically South Asian women have been important participants in peasant movements, these movements have not been typified by women demanding independent land rights or contesting iniquitous gender relations within the movements and within their families. Some recent challenges in this direction indicate that attaining gender equality in the distribution of productive resources will require a simultaneous struggle against constraining ideological constructions of gender, including (in many regions) associated social practices such as purdah. And in both types of struggle (namely concerning resources and gender ideologies), group-overt resistance is likely to be of critical importance.

  11. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  12. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  13. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  14. Contested Cowboys: Ethnic Mexican Charros and the Struggle for Suburban Public Space in 1970s Los Angeles

    Science.gov (United States)

    Barraclough, Laura R.

    2012-01-01

    While most studies of Mexican American suburbanization since the 1970s focus on the transformation of residential (private) space, it is in suburban public space that some of the most important struggles over belonging and rights have occurred. This article builds a theoretical framework to analyze the relationships between public space,…

  15. Letting go of Managing? Struggles over Managerial Roles in Collaborative Governance

    Directory of Open Access Journals (Sweden)

    Mie Plotnikof

    2016-03-01

    Full Text Available This article discusses the role of the manager in collaborative governance studies. These studies identify a new managerial role as facilitator of stakeholder collaboration when pursuing public policy and service innovation. But the complications of role changes are underexplored; hence this article addresses the emerging challenges. Drawing on organizational discourse studies, it theorizes and analyzes managers’ positioning during collaborative governance practices in cases from the Danish daycare area. The findings demonstrate how public managers construct old and new roles related to various public management discourses, and their struggles to change accordingly. However, the findings also show how managers empower their new role and gain agency to steer collaborative outcomes. Thereby the article unpacks the challenges of becoming a facilitating manager alongside other roles: the struggles of identity and agency constitutive to particular ways of managing, as well as struggles over multiple roles. It suggests paying greater attention to constitutive aspects of changing roles to understand the managerial challenges and effects implied through emerging public management discourses.

  16. Darwin's Difficulties and Students' Struggles with Trait Loss: Cognitive-Historical Parallelisms in Evolutionary Explanation

    Science.gov (United States)

    Ha, Minsu; Nehm, Ross H.

    2014-05-01

    Although historical changes in scientific ideas sometimes display striking similarities with students' conceptual progressions, some scholars have cautioned that such similarities lack meaningful commonalities. In the history of evolution, while Darwin and his contemporaries often used natural selection to explain evolutionary trait gain or increase, they struggled to use it to convincingly account for cases of trait loss or decrease. This study examines Darwin's evolutionary writings about trait gain and loss in the Origin of Species (On the origin of species by means of natural selection, or the preservation of favoured races in the struggle for life. D. Appleton, New York, 1859) and compares them to written evolutionary explanations for trait gain and loss in a large (n > 500), cross-cultural and cross-sectional sample (novices and experts from the USA and Korea). Findings indicate that significantly more students and experts applied natural selection to cases of trait gain, but like Darwin and his contemporaries, they more often applied `use and disuse' and `inheritance of acquired characteristics' to episodes of trait loss. Although the parallelism between Darwin's difficulties and students' struggles with trait loss are striking, significant differences also characterize explanatory model structure. Overall, however, students and scientists struggles to explain trait loss—which is a very common phenomenon in the history of life—appear to transcend time, place, and level of biological expertise. The significance of these findings for evolution education are discussed; in particular, the situated nature of biological reasoning, and the important role that the history of science can play in understanding cognitive constraints on science learning.

  17. One Family's Struggles with Pertussis (Whooping Cough)

    Medline Plus

    Full Text Available ... vaccinate posters buttons and banners videos someone you love flu overview nasal spray flu caccine CDC surveillance ... pediatric hepatitis report infection protection bioterrorism five second rule germs handwashing why handwashing is important handwashing cartoon ...

  18. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... vaccinate posters buttons and banners videos someone you love flu overview nasal spray flu caccine CDC surveillance ... pediatric hepatitis report infection protection bioterrorism five second rule germs handwashing why handwashing is important handwashing cartoon ...

  19. One Family's Struggles with Hepatitis B

    Medline Plus

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  20. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  1. One Family's Struggles with Pertussis (Whooping Cough)

    Medline Plus

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  2. Religion as problem, religion as solution: religious buffers of the links between religious/spiritual struggles and well-being/mental health.

    Science.gov (United States)

    Abu-Raiya, Hisham; Pargament, Kenneth I; Krause, Neal

    2016-05-01

    Previous studies have established robust links between religious/spiritual struggles (r/s struggles) and poorer well-being and psychological distress. A critical issue involves identifying the religious factors that buffer this relationship. This is the first study to empirically address this question. Specifically, it examines four religious factors (i.e., religious commitment, life sanctification, religious support, religious hope) as potential buffers of the links between r/s struggle and one indicator of subjective well-being (i.e., happiness) and one indicator of psychological distress (i.e., depressive symptoms). We utilized a cross-sectional design and a nationally representative sample of American adults (N = 2140) dealing with a wide range of major life stressors. We found that the interactions between r/s struggle and all potential moderators were significant in predicting happiness and/or depression. The linkage between r/s struggle and lower levels of happiness was moderated by higher levels of each of the four proposed religious buffers. Religious commitment and life sanctification moderated the ties between r/s struggles and depressive symptoms. The findings underscore the multifaceted character of religion: Paradoxically, religion may be a source of solutions to problems that may be an inherent part of religious life.

  3. Serpica Naro and the Others. The Media Sociali Experience in Italian Struggles Against Precarity

    Directory of Open Access Journals (Sweden)

    Alice Mattoni

    2008-11-01

    Full Text Available Social movements are also producers of symbolic resources, since they construct new collective identities and provide alternative system of meanings to societies. This was particularly significant with regard to recent struggles against work insecurity in Italy. There, in a discursive context dominated by the so-called ‘flexibility political mantra’, activists raised their voice in order to identify a novel social problem, precarity, and a novel social subject, precarious workers. The paper starts from these premises in order to investigate the so-called media sociali, a particular kind of media practice that had been developed by Italian activists involved in the long protest campaign against precarity, namely the Euro Mayday Parade (EMP. Probably, the media sociali are the most evident attempt to construct a fresh imagery based on precarious workers living and working conditions and to provide an alternative cultural grammar able to speak about precarity. The paper gives back the most important mechanism on which the media sociali rests through the living voices of activists involved in their elaboration: the mechanism of political socialization and social networking as well as the mechanism of diffusion and mutual recognition. Moreover, the paper proposes further reflections about the way in which those activists involved in the EMP perceived the media sociali. In doing so, the paper presents different ways of interpreting political conflict in contemporary Italian social movements and argues that the media sociali are an interesting attempt to overcome both mainstream and independent media in the construction of precarious workers’ imagery and political socialization. Interviews with activists and social movement generated documents are the main data source, investigated according to a qualitative analysis approach.

  4. The Struggle for Human Rights in Myanmar

    Science.gov (United States)

    Keefer, Natalie

    2012-01-01

    The non-violent participation of Nobel Peace Prize laureate Aung San Suu Kyi and Buddhist monks in resistance efforts to advocate for the welfare of Myanmar's people has played an important role in educating the world about human rights violations in the country. Faced with international condemnation, Myanmar's junta released Aung San Suu Kyi from…

  5. Women and the Struggle for Daytime Adult Education in Ireland.

    Science.gov (United States)

    Inglis, Tom

    1994-01-01

    Daytime adult education has emerged in Ireland in the form of voluntary, locally based groups of working class women providing education for themselves and others. A survey of 96 groups illuminated their struggles with finding suitable space, day care, and advertising. They thrive because of disenchantment with the content, scheduling, and form of…

  6. The 'Recalcitrant Other': The Rhetorical Identity and Struggle of ...

    African Journals Online (AJOL)

    This article explores the complexity of Mandela's rhetorical identity as the Recalcitrant Other and his rhetorical struggle as informed by contesting influences such as his ancestral birthright, cultural upbringing, British mission education, and exposure to a racially constructed hegemonic order. By subversively drawing on his ...

  7. The photograph collection of the Alan Paton Centre and Struggle ...

    African Journals Online (AJOL)

    To address the problem of easy access while adhering to archivally correct procedures, the Alan Paton Centre and Struggle Archives has devised a system of arranging and documenting their photograph collection which honours the principle of original order, but also considers the meanings and links between ...

  8. Ethiopia's Involvement in South Sudan's Struggle for Independence ...

    African Journals Online (AJOL)

    This article examines three successive Ethiopian governments' involvement in South Sudan's struggle for independence and its concomitant conflict and peace processes within the broad context of the north-east African security situation from the middle of the 1950s to the present. It argues that this framework is of value not ...

  9. The struggle for textual conventions in a language support programme

    African Journals Online (AJOL)

    In this article, the writer explores the experience of a group of South African learners with regard to a language support course that aims to facilitate their struggle to master English textual conventions in discipline specific contexts. The academic context of this study was that of a nursing science degree programme where ...

  10. "Rabbit Proof Fence": A Struggle for Cultural Existence

    Science.gov (United States)

    Al-Momani, Hassan Ali Abdullah

    2016-01-01

    The main goal of this paper is to depict the struggle for cultural existence in "Rabbit Proof Fence." It also reflects the cultural conflict represented in the three aboriginal girls' characters which is due to their rejection and resistance for the colonialists' culture. Besides, the paper presents the cognitive analysis of the cultural…

  11. Technology for the Struggling Reader: Free and Easily Accessible Resources

    Science.gov (United States)

    Berkeley, Sheri; Lindstrom, Jennifer H.

    2011-01-01

    A fundamental problem for many struggling readers, their parents, and their teachers is that there are few benchmarks to guide decision making about assistive technological supports when the nature of a disability is cognitive (e.g., specific learning disability, SLD) rather than physical. However, resources such as the National Center on…

  12. Resolving Struggling Readers' Homework Difficulties: A Social Cognitive Perspective

    Science.gov (United States)

    Margolis, Howard; Mccabe, Patrick

    2004-01-01

    Struggling readers often fail to complete homework or complete it in a slipshod, haphazard fashion. Often, this adversely affects grades, erodes motivation for academics, and causes conflict between readers, parents, and school personnel. To help teachers and educational consultants (e.g., reading specialists, school psychologists) help struggling…

  13. Organizing Instruction for Struggling Readers in Tutorial Settings

    Science.gov (United States)

    Mokhtari, Kouider; Hutchison, Amy C.; Edwards, Patricia A.

    2010-01-01

    In this article, the authors suggest that many of the problems struggling readers encounter while reading stem from distinct yet fundamental sources of difficulty related to the types of text read (print or online), the task or activity readers engage in, and the sociocultural context of reading. The authors further argue that although these…

  14. Struggling with solutions : a case study of using organisation concepts

    NARCIS (Netherlands)

    Benders, Jos; Slomp, Jannes

    2009-01-01

    Engineers contribute to the constant flow of new tools and organisation concepts. These tend to be presented as solutions to existing organisational problems. These solutions may become problems themselves, however. We present a longitudinal case of how a truck manufacturer struggled with various

  15. Struggling with scales: revisiting the boundaries of river basin management

    NARCIS (Netherlands)

    Warner, J.F.; Wester, P.; Hoogesteger van Dijk, J.D.

    2014-01-01

    This article reviews, illustrated by two case studies, how struggles around scales play out in three globally hegemonic trends in river governance: (1) stakeholder participation for (2) integrated water resources management (IWRM), conceived at (3) the watershed or river basin level. This ‘holy

  16. Disability Studies, Disabled People and the Struggle for Inclusion

    Science.gov (United States)

    Oliver, Mike; Barnes, Colin

    2010-01-01

    This paper traces the relationship between the emergence of disability studies and the struggle for meaningful inclusion for disabled people with particular reference to the work of a pivotal figure in these developments: Len Barton. It is argued that the links between disability activism and the academy were responsible for the emergence of…

  17. Economic struggle and the class culture of workers

    Directory of Open Access Journals (Sweden)

    Branko Bembič

    2013-08-01

    Full Text Available Economic struggles are usually linked to the spontaneous working class ideology of fighting for a mere improvement in wages and working conditions. However, they often transcend their meagre economic results as they are indispensable in the construction of the working class culture of solidarity. Far from being spontaneous, the process of transforming the trade union orientation from class unionism to business unionism in the USA and to social partnership in Europe had to be imposed through social struggles in which capital forced upon workers a pacified form of economic struggle that was required by post-war Keynesianism. The ruling perception of twentieth-century economic struggles was thus shaped by references to the Gramscian concept of hegemony, in which marginal concessions to labour are essential for its successful subordination to capital. However, the intensification of economic struggles in the 1960s and 1970s showed that the hope of integrating labour into capitalist society by marginal concessions underestimated the economic conditions of capitalist discipline. Thus, the neoliberal restoration was primarily concerned with the imposition of capitalist discipline in the “Factory,” which had severe cultural consequences in the sphere of “School and Family.” However, while American neoliberalism orchestrated a frontal attack on organised labour, in Europe the system of industrial relations was preserved, but with disastrous effects on the culture of labour. I grasp these cultural aspects of the neoliberal attack on European labour with the concept of community in resignation, which, unlike the concept of hegemony, explains labour’s subordination in terms of workers’ renouncement of certain rights in the process of forging competitive alliances with capital.

  18. AFRICAN-AMERICAN STRUGGLE FOR EQUALITY IN“I, TOO, SING AMERICA” AND “BALLAD OF THE LANDLORD” BY LANGSTON HUGHES

    Directory of Open Access Journals (Sweden)

    Anddy Steven

    2017-04-01

    The analysis revealed three important information: first, both poems delivered the theme and sub theme that reflect Hughes‘ protest upon inequality faced by the African-American and the reflection of the inequality itself; second, the theme and sub theme were delivered by using the abrogation and appropriation process; and last, the two post-colonial process reflected the idea of ‗marginal versus center‘ in the poems. It was concluded that both poems represent African-American struggle for equality from the theme and sub theme which are reflected by the usage of the appropriation and abrogation process of post-colonial writing, where the ‗marginal‘, can be identified as African-American, who wanted to oppose the basic outlook of ‗white supremacy‘ adopted by the ‗center‘, which refers to the majority white Americans and also the state and federal government of the United States of America.

  19. A struggle for recognition and meaning

    DEFF Research Database (Denmark)

    Damsgaard, Janne Brammer

    2016-01-01

    pain. Paper II aims to explore how patients undergoing SFS experience their illness trajectory and their interaction with the healthcare system. Paper III aims to explore how patients experience their situation from the point of making the decision to undergo SFS to living in everyday life after...... not to be a burden. This study emphasises that the recommendation and decision to undergo SFS can create feelings of being recognised and feelings of relief. However, it is important for the healthcare professionals to be aware of the fact that the patient role and the insecurity can be so pervasive that patients...

  20. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  1. Social Protectionism, Transfered Mothering, and the Struggle for Reproductive Health

    Directory of Open Access Journals (Sweden)

    Suely Gomes Costa

    2002-01-01

    Full Text Available This article analyses the nature of the tensions brought about by the entrance of women into public space and the rise of protectionist systems in Brazil. It places both experience and theory in the long-range context of women’s history, gender relations and feminist movements. Feminist struggles and domesticity patterns reaffirm the home as the place par excellence of protectionist practices, something that prevented or delayed the advent of public protectionist systems. The different relationships among those women who remained at home and those that managed to develop their activities outside the domestic environment will certainly establish inequalities as to the obtention of social rights. The article examines evidence of change in the historical trend in the struggle for universal reproductive rights during the 1980s.

  2. Is nuclear necessary to struggle against climate disruption?

    International Nuclear Information System (INIS)

    2015-01-01

    Nuclear energy is generally considered as non-carbonated, and is therefore considered as one of the options to struggle against climate disruption, and even sometimes as the only solution to massively produce electricity while limiting greenhouse gas emissions. Thus, this article examines whether the use of nuclear energy is so inescapable. It discusses the indirect CO 2 content and avoided emissions, and outlines that these avoided emissions represent a small part with respect to those generated by the world electric system. In other words, nuclear energy has a marginal impact on greenhouse gas emissions. Besides, nuclear energy is used to produce electricity and its development can therefore impact emissions related to the electric sector only, i.e. one third of emissions related to energy. Thus nuclear energy is generally assigned a minor role in scenarios of struggle against climate change. The article then outlines that a dynamics exists in favour of other options

  3. Subaltern Classes, Class Struggles and Hegemony : a Gramscian Approach

    Directory of Open Access Journals (Sweden)

    Ivete Simionatto

    2009-01-01

    Full Text Available This article sought to revive the concept of subaltern classes and their relation with other categories, particularly the State, civil society and hegemony in the thinking of Antonio Gramsci, as a support for contemporary class struggles. It also analyzes the relations between subaltern classes, common sense and ideology, as well as the forms of “overcoming” conceptualized by Gramsci, through the culture and philosophy of praxis. The paper revives the discussion of the subaltern classes, based on the original Gramscian formulation in the realm of Marxism, through the dialectic interaction between structure and superstructure, economy and politics. In addition to the conceptual revival, it indicates some elements that can support the discussion of the forms of subalternity found in contemporary reality and the possibilities for strengthening the struggles of these class layers, above all in moments of strong demobilization of popular participation.

  4. HISTORICAL-CRITICAL PEDAGOGY, CLASS STRUGGLE AND SCHOOL EDUCATION

    Directory of Open Access Journals (Sweden)

    Dermeval Saviani

    2013-12-01

    Full Text Available After introducing the approach of the relationship between education and class struggle in today's society, this article deals with the meaning of the concept of violence pointing out the current condition of a world ruled by violence that finds justification in the fascism, defined as the metaphysics of the violence. Next it approaches the problem of the eradication of the violence in the social praxis in the perspectives of the Christian Personalism (metaphysics of the non-violence, Existentialism (subjective conception of the violence and of the Marxism (objective conception of the violence and of the nonviolence. Based on those analyses it makes evident, in the conclusion, the relationship between class struggle and school education in the historical—critical perspective.

  5. The struggle against climate change in the United Kingdom

    International Nuclear Information System (INIS)

    2009-01-01

    As the United Kingdom has been the first country in the world to adopt a law to struggle against climate change, The Climate Change Act 2008, which specifies a 80% reduction of greenhouse gas emissions by 2050 (vs 1990), this report propose an overview of the actions implemented by this country in the political, economical, and technological fields to struggle against climate change. The various organisations and political institutions concerned by this struggle are presented (governmental organisations and institutions, non governmental institutions). The content of the Climate Change Act is described: definitions of constraints and requirements, carbon reduction commitment (CRC), carbon budgets, systems and programmes dealing with energy production (Renewable Obligation, household energy supplier obligations), with firms (Climate Change Levy, Climate Change Agreements, Enhanced Capital Allowances), with transports (Renewable Transport Fuel Obligation, Low Carbon Vehicle Procurement Programme), with buildings (Low Carbon Building Programme, Home Energy Saving Programme), with research and communication. Then, discussing the economy of climate change, this report comments the content of the Stern report, the reactions about it, and the economical consequences of struggle against climate change. These consequences can be drawbacks (increase of energy costs, inequalities of abilities to face transition costs, loss of international competitiveness) or benefits. The consequences of the economical crisis are also briefly discussed, as well as the consequences of the solutions to this crisis. The third part of this report gives an overview of the low carbon engineering and technology in the United Kingdom in the energy sector (renewable energy, wind energy, hydroelectric energy, biomass, nuclear energy, carbon capture and storage) and in the transport sector. The last part comments the objectives of the 2009 Copenhagen conference

  6. Synthesis of the 2011 'struggle against climate change' DPT

    International Nuclear Information System (INIS)

    2011-01-01

    A DPT is a document of transverse policy in France. This paper presents the DPT which addresses the struggle against climate change. It briefly presents the French budget effort on this topic, indicates some programs addressing this issue and contained in the DPT, comments the expenses of these programs which are taken into account in the DPT, evokes incentive mechanisms based on tax expenses. It finally evokes the indicators aimed at assessing the success or failure of these programs

  7. INDIGENOUS STRUGGLES AND THE DISCREET CHARM OF THE BOURGEOISIE

    OpenAIRE

    Jonathan Friedman

    2015-01-01

    Since the mid-Seventies there has been a massive increase in the activities of indigenous minorities in the world. Their struggles have become global news, and they have entered numerous global organizations so that they have become an international presence. This, I shall argue, does not mean that they have been globalized and that they are just like everyone else in today's globalizing world. They have been part of many a national scene for many decades. They have been marginalized in their...

  8. INDIGENOUS STRUGGLES AND THE DISCREET CHARM OF THE BOURGEOISIE

    Directory of Open Access Journals (Sweden)

    Jonathan Friedman

    2015-08-01

    Full Text Available Since the mid-Seventies there has been a massive increase in the activities of indigenous minorities in the world. Their struggles have become global news, and they have entered numerous global organizations so that they have become an international presence. This, I shall argue, does not mean that they have been globalized and that they are just like everyone else in today's globalizing world. They have been part of many a national scene for many decades. They have been marginalized in their own territories, boxed, packaged and oppressed, sometimes even unto death. But this has changed in many parts of the world, because the indigenous is now part of a larger inversion of Western cosmology in which the traditional other, a modern category, is no longer the starting point of a long and positive evolu-tion of civilization, but a voice of Wisdom, a way of life in tune with nature,a culture in harmony, a gemeinschaft, that we have all but lost. Evolution has become devolution, the fall of civilized man. But there is a social reality to this change as well since the voices of the Other are the voices of real people struggling for control over their conditions of existence. This struggle is not about culture as such, but about social identity of a particular kind, indigenous identity, which is constituted around cultural and experiential continuities that are only poorly mirrored in Western categories, not least in anthropological categories. Fourth world struggles have been partially, and in some cases very successful, but they do not operate in a simple structure where the only larger context is the national state. They are also part of a dynamic global system, one that is multiplex and contains a number of related processes.

  9. Struggling between resources-based and sustainable development schemes-An analysis of Egypt's recent energy policy

    International Nuclear Information System (INIS)

    Suding, Paul H.

    2011-01-01

    This paper discusses Egypt's recent energy sector and policy developments against objectives and issues of the energy policy strategy adopted in 2007. It reviews energy supply and demand, pricing and subsidies as well as institutional arrangements and respective reform projects from the perspective of assessing achievements. It identifies the consequences of the policy and the long-term outlook and reports on the internal policy struggle. The policy strategy of 2007 is directed at energy security, social and industrial development. Environmental or climate objectives play no role. Energy efficiency is at best considered an instrument. The implementation of the strategy has been successful on the supply side, but not on the demand side. Price reform, refocusing subsidies and sector reform were not achieved. This has negatively affected energy efficiency and diversification, energy availability and supply security, the State budget and the sector's financial capacity. It causes rising energy import requirements and increasing risks to the current account balance. In spite of that, 'old guard' and industrial establishment favour the resource-based development based on cheap energy and protract price reform, whereas another group of businessmen wants a sustainable development concept and monetize the oil and gas production to invest in Egypt's competitiveness. - Research Highlights: → Egyptian energy policy has not delivered demand side results and institutional reform. → The consequences are disparities in supply, external balance, financing and subsidies. →The prevailing interest groups succeed in protracting the implementation of the policy.

  10. Defining the new initiatives of struggle against the proliferation of arms of massive destruction

    International Nuclear Information System (INIS)

    Hautecouverture, Benjamin

    2007-01-01

    The author discusses the various terms of the concept of 'new initiatives of struggle against arms of massive destruction' by discussing how these initiatives are new, how they address new threats (State-based proliferation of AMD, terrorism of massive destruction). He comments the background of these initiatives which may be launched to respond to a specific threat or to implement specific means of struggle. He identifies the main characteristics of these political or institutional initiatives: they are pragmatic, functional, instrumental, have different scopes, are based on an institutional flexibility, and on cooperation and partnership. For different of these initiatives (Proliferation Security Initiative, Container Security Initiative, Global Initiative to Combat Nuclear Terrorism, and so on), the author indicates whether they are unilateral, bilateral, supported by regional organisations, by the UN, by operational international organisations, or inter-governmental groups. He finally outlines questions raised by these initiatives: how to assess their impact? Must they be more integrated? Can they or must they have a better defined role in the global regime of non proliferation and disarmament?

  11. A qualitative study of medical educators' perspectives on remediation: Adopting a holistic approach to struggling residents.

    Science.gov (United States)

    Krzyzaniak, Sara M; Wolf, Stephen J; Byyny, Richard; Barker, Lisa; Kaplan, Bonnie; Wall, Stephen; Guerrasio, Jeannette

    2017-09-01

    During residency, some trainees require the identification and remediation of deficiencies to achieve the knowledge, skills and attitudes necessary for independent practice. Given the limited published frameworks for remediation, we characterize remediation from the perspective of educators and propose a holistic framework to guide the approach to remediation. We conducted semistructured focus groups to: explore methods for identifying struggling residents; categorize common domains of struggle; describe personal factors that contribute to difficulties; define remediation interventions and understand what constitutes successful completion. Data were analyzed through conventional content analysis. Nineteen physicians across multiple specialties and institutions participated in seven focus groups. Thirteen categories emerged around remediation. Some themes addressed practical components of remediation, while others reflected barriers to the process and the impact of remediation on the resident and program. The themes were used to inform development of a novel holistic framework for remediation. The approach to remediation requires comprehensive identification of individual factors impacting performance. The intervention should not only include a tailored learning plan but also address confounders that impact likelihood of remediation success. Our holistic framework intends to guide educators creating remediation plans to ensure all domains are addressed.

  12. The validity of student tutors’ judgments in early detection of struggling in medical school. A prospective cohort study

    DEFF Research Database (Denmark)

    O'Neill, Lotte; Mørcke, Anne Mette; Eika, Berit

    2016-01-01

    Early identification and support of strugglers in medical education is generally recommended in the research literature, though very little evidence of the diagnostic qualities of early teacher judgments in medical education currently exists. The aim of this study was to examine the validity...... of early diagnosis of struggling in medical school based on informal teacher judgements of in-class behavior. The study design was a prospective cohort study and the outcomes/truth criteria were anatomy failure and medical school drop out. Six weeks into an anatomy course, student tutors attempted...... to identify medical students, who they reckoned would fail the anatomy course or drop out, based on their everyday experiences with students in a large group educational setting. In addition, they were asked to describe the indicators of struggling they observed. Sixteen student tutors evaluated 429 medical...

  13. A meta-ethnography of patients' experiences of chronic pelvic pain: struggling to construct chronic pelvic pain as 'real'.

    Science.gov (United States)

    Toye, Francine; Seers, Kate; Barker, Karen

    2014-12-01

    To review systematically and integrate the findings of qualitative research to increase our understanding of patients' experiences of chronic pelvic pain. Chronic pelvic pain is a prevalent pain condition with a high disease burden for men and women. Its multifactorial nature makes it challenging for clinicians and patients. Synthesis of qualitative research using meta-ethnography. Five electronic bibliographic databases from inception until March 2014 supplemented by citation tracking. Of 488 papers retrieved, 32 met the review aim. Central to meta-ethnography is identifying 'concepts' and developing a conceptual model through constant comparison. Concepts are the primary data of meta-ethnography. Two team members read each paper to identify and collaboratively describe the concepts. We next compared concepts across studies and organized them into categories with shared meaning. Finally, we developed a conceptual model, or line of argument, to explain the conceptual categories. Our findings incorporate the following categories into a conceptual model: relentless and overwhelming pain; threat to self; unpredictability, struggle to construct pain as normal or pathological; a culture of secrecy; validation by diagnosis; ambiguous experience of health care; elevation of experiential knowledge and embodiment of knowledge through a community. The innovation of our model is to demonstrate, for the first time, the central struggle to construct 'pathological' vs. 'normal' chronic pelvic pain, a struggle that is exacerbated by a culture of secrecy. More research is needed to explore men's experience and to compare this with women's experience. © 2014 John Wiley & Sons Ltd.

  14. An Analysis of Differential Response Patterns on the Peabody Picture Vocabulary Test-IIIB in Struggling Adult Readers and Third-Grade Children

    Science.gov (United States)

    Pae, Hye K.; Greenberg, Daphne; Williams, Rihana S.

    2012-01-01

    This study examines the Peabody Picture Vocabulary Test-IIIB (PPVT-IIIB) performance of 130 adults identified as struggling readers, in comparison to 175 third-grade children. Response patterns to the items on the PPVT-IIIB by these two groups were investigated, focusing on items, semantic categories, and lexical features, including word length,…

  15. The struggle for market power: industrial relations in the British coal industry, 1800-1840

    Energy Technology Data Exchange (ETDEWEB)

    James Alan Jaffe

    2003-07-01

    During the Industrial Revolution, class relations were defined largely through the struggle to control the terms of exchange in the market. Integrating aspects of economic and social history as well as industrial sociology, this book examines the sources of the perception of the market on the part of both capital and labour and the elaboration of their alternative market ideologies. Of particular import is the argument that working-class culture expressed a fundamental acceptance of the utility of the market, a point that is supported by a detailed analysis of the labour process, workplace bargaining, and early-nineteenth-century trade unionism. Nonetheless, the working class's definition of 'proper' market relations differed substantially from that of capitalists. Contents: Introduction; 1. Capital and credit; 2. The perception of the market and industrial policy; 3. Managerial capitalism; 4. Family, community, and the labor market; 5. Work and the ideology of the market; 6. Religion, ideology, and trade unions; 7. The transformation of market relations: Tommy Hepburn's union, 1831; 8. Epilogue: class struggle and market power; Conclusion: the labor process and the market; Appendix; Select bibliography; Index.

  16. History of Reading Struggles Linked to Enhanced Learning in Low Spatial Frequency Scenes

    Science.gov (United States)

    Schneps, Matthew H.; Brockmole, James R.; Sonnert, Gerhard; Pomplun, Marc

    2012-01-01

    People with dyslexia, who face lifelong struggles with reading, exhibit numerous associated low-level sensory deficits including deficits in focal attention. Countering this, studies have shown that struggling readers outperform typical readers in some visual tasks that integrate distributed information across an expanse. Though such abilities would be expected to facilitate scene memory, prior investigations using the contextual cueing paradigm failed to find corresponding advantages in dyslexia. We suggest that these studies were confounded by task-dependent effects exaggerating known focal attention deficits in dyslexia, and that, if natural scenes were used as the context, advantages would emerge. Here, we investigate this hypothesis by comparing college students with histories of severe lifelong reading difficulties (SR) and typical readers (TR) in contexts that vary attention load. We find no differences in contextual-cueing when spatial contexts are letter-like objects, or when contexts are natural scenes. However, the SR group significantly outperforms the TR group when contexts are low-pass filtered natural scenes [F(3, 39) = 3.15, p<.05]. These findings suggest that perception or memory for low spatial frequency components in scenes is enhanced in dyslexia. These findings are important because they suggest strengths for spatial learning in a population otherwise impaired, carrying implications for the education and support of students who face challenges in school. PMID:22558210

  17. History of reading struggles linked to enhanced learning in low spatial frequency scenes.

    Directory of Open Access Journals (Sweden)

    Matthew H Schneps

    Full Text Available People with dyslexia, who face lifelong struggles with reading, exhibit numerous associated low-level sensory deficits including deficits in focal attention. Countering this, studies have shown that struggling readers outperform typical readers in some visual tasks that integrate distributed information across an expanse. Though such abilities would be expected to facilitate scene memory, prior investigations using the contextual cueing paradigm failed to find corresponding advantages in dyslexia. We suggest that these studies were confounded by task-dependent effects exaggerating known focal attention deficits in dyslexia, and that, if natural scenes were used as the context, advantages would emerge. Here, we investigate this hypothesis by comparing college students with histories of severe lifelong reading difficulties (SR and typical readers (TR in contexts that vary attention load. We find no differences in contextual-cueing when spatial contexts are letter-like objects, or when contexts are natural scenes. However, the SR group significantly outperforms the TR group when contexts are low-pass filtered natural scenes [F(3, 39 = 3.15, p<.05]. These findings suggest that perception or memory for low spatial frequency components in scenes is enhanced in dyslexia. These findings are important because they suggest strengths for spatial learning in a population otherwise impaired, carrying implications for the education and support of students who face challenges in school.

  18. Do Supplemental Remedial Reading Programs Address the Motivational Issues of Struggling Readers? An Analysis of Five Popular Programs.

    Science.gov (United States)

    Quirk, Matthew P; Schwanenflugel, Paula J

    2004-04-01

    Five popular, but distinctly different, remedial reading programs were reviewed regarding the potential to motivate children to read. It is argued that current remedial reading program designs and research on program effectiveness ignore the impact that motivation has on struggling readers. In addition, we develop a theory of reading motivation specific to struggling readers that highlights motivational constructs we feel are important to the improvement of reading skill for this population of students. The three aspects of reading motivation most relevant to the instruction of remedial readers include: (a) improving reading self-efficacy; (b) making internal and controllable outcome attributions for successes and failures associated with reading; and (c) establishing personally relevant value in becoming a better reader. We conclude that, while most programs address some motivational issues and other issues not at all, most programs could make minor modifications that would greatly enhance their motivational impact.

  19. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  20. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  1. Active drug users - struggling for rights and recognition in Denmark

    DEFF Research Database (Denmark)

    Anker, Jørgen

    This paper examines the strategic dilemmas and the self-representation of the Drug Users’ Union in Denmark. The paper explores how a group of drug users on the one hand seeks to struggle for the rights of drug users and one the other hand seeks to gain legitimacy and access to public funding...... and support. It reveals how the organisation attempts to advance a more balanced image of drug users as persons who are able to run an effective organisation while they also claim the right to use drugs....

  2. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  3. Living with advanced Parkinson's disease: a constant struggle with unpredictability.

    Science.gov (United States)

    Haahr, Anita; Kirkevold, Marit; Hall, Elisabeth O C; Ostergaard, Karen

    2011-02-01

    This paper is a report of an exploration of patients' lifeworld and way of managing life with advanced Parkinson's disease prior to Deep Brain Stimulation and what they expect from life following this treatment. Parkinson's disease is a progressive neurodegenerative disease, which is initially well-treated with L-dopa. Living with Parkinson's disease means living with the experience of continuous loss of independence and self-esteem and unpredictable ON/OFF phenomena. Thus, in the advanced stage of the disease, treatment with Deep Brain Stimulation may become relevant. Eleven patients eligible for Deep Brain Stimulation were interviewed prior to treatment. Data were collected in 2007 and analysed according to the hermeneutic phenomenological methodology of van Manen, using the four existentials as analytic tools. Living with advanced Parkinson's disease can be described as the experience of living with and managing unpredictability. The disease gradually took over, and participants had to struggle with unpredictability on a daily basis. Themes in relation to this were: The body - setting the agenda, Always a struggle to be on time, Living in dependence and compromise - being a burden, and Living with restrained space and changes in social life. Parkinson's disease leads to profound bodily restrictions. Living with an unpredictable body affects all aspects of life, and nurses need to be aware of the impact the disease has on the entire lifeworld, and how this may affect the way treatment is perceived. © 2010 Blackwell Publishing Ltd.

  4. Verhulst-Lotka-Volterra (VLV) model of ideological struggle

    Science.gov (United States)

    Vitanov, Nikolay K.; Dimitrova, Zlatinka I.; Ausloos, Marcel

    2010-11-01

    A model for ideological struggles is formulated. The underlying set is a closed one, like a country but in which the population size is variable in time. The dynamics of the struggle is described by model equations of Verhulst-Lotka-Volterra kind. Several “ideologies” compete to increase their number of adepts. Such followers can be either converted from one ideology to another or become followers of an ideology though being previously ideologically-free. A reverse process is also allowed. Two kinds of conversions are considered: unitary conversion, e.g. by means of mass communication tools, or binary conversion, e.g. by means of interactions between people. It is found that the steady state, when it exists, depends on the number of ideologies. Moreover when the number of ideologies increases some tension arises between them. This tension can change in the course of time. We propose to measure the ideology tensions through an appropriately defined scale index. Finally it is shown that a slight change in the conditions of the environment can prevent the extinction of some ideology; after almost collapsing the ideology can spread again and can affect a significant part of the country’s population. Two kinds of such resurrection effects are described as phoenix effects.

  5. Struggles Against Bilateral FTAs: Challenges for Transnational Global Justice Activism

    Directory of Open Access Journals (Sweden)

    Aziz Choudry

    2012-11-01

    Full Text Available The past decade has seen major movements and mobilizations against the new crop of bilateral free trade and investment agreements being pursued by governments in the wake of the failure of global (World Trade Organization and regional (e.g. Free Trade Area of the Americas negotiations, and the defeat of an attempted Multilateral Agreement on Investment in the 1990s.  However, in spite of much scholarly, non-governmental organization (NGO and activist focus on transnational global justice activism, many of these movements, such as the major multi-sectoral popular struggle over the recently-concluded US-Korea Free Trade Agreement, are hardly acknowledged in North America and Europe.  With a shift in emphasis pushing liberalization and deregulation of trade and investment increasingly favouring lower-profile bilateral agreements, this article maps the resistance movements to these latest shifts in global free market capitalist relations and discusses the disconnect between these (mainly Southern struggles and dominant scholarly and NGO conceptions of global justice and the global justice movement as well as questions of knowledge production arising from these movements.

  6. First-Year Students’ Research Challenges: Does Watching Videos on Common Struggles affect Students’ Research Self-Efficacy?

    Directory of Open Access Journals (Sweden)

    Savannah L. Kelly

    2017-12-01

    Full Text Available Abstract Objective – The purpose of this quantitative study was to measure the impact of providing research struggle videos on first-year students’ research self-efficacy. The three-part video series explicated and briefly addressed common first-year roadblocks related to searching, evaluating, and caring about sources. The null hypothesis tested was that students would have similar research self-efficacy scores, regardless of exposure to the video series. Methods – The study was a quasi-experimental, nonequivalent control group design. The population included all 22 sections (N = 359 of First-Year Writing affiliated with the FASTrack Learning Community at the University of Mississippi. Of 22 sections, 12 (N = 212 served as the intervention group exposed to the videos, while the other 10 (N = 147 served as the control group. A research self-efficacy pretest – posttest measure was administered to all students. In addition, all 22 sections, regardless of control or intervention status, received a face-to-face one-shot library instruction session. Results – As a whole, this study failed to reject the null hypothesis. Students exposed to the research struggle videos reported similar research self-efficacy scores as students who were not exposed to the videos. A significant difference, however, did exist between all students’ pretest and posttest scores, suggesting that something else, possibly the in-person library session, did have an impact on students’ research self-efficacy. Conclusion – Although students’ research self-efficacy may have increased due to the presence of an in-person library session, this current research was most interested in evaluating the effect of providing supplemental instruction via struggle videos for first-year students. As this was not substantiated, it is recommended that researchers review the findings and limitations of this current study in order to identify more effective approaches in providing

  7. Identifying Opportunities for Vertical Integration of Biochemistry and Clinical Medicine.

    Science.gov (United States)

    Wendelberger, Karen J.; Burke, Rebecca; Haas, Arthur L.; Harenwattananon, Marisa; Simpson, Deborah

    1998-01-01

    Objectives: Retention of basic science knowledge, as judged by National Board of Medical Examiners' (NBME) data, suffers due to lack of apparent relevance and isolation of instruction from clinical application, especially in biochemistry. However, the literature reveals no systematic process for identifying key biochemical concepts and associated clinical conditions. This study systematically identified difficult biochemical concepts and their common clinical conditions as a critical step towards enhancing relevance and retention of biochemistry.Methods: A multi-step/ multiple stakeholder process was used to: (1) identify important biochemistry concepts; (2) determine students' perceptions of concept difficulty; (3) assess biochemistry faculty, student, and clinical teaching scholars' perceived relevance of identified concepts; and (4) identify associated common clinical conditions for relevant and difficult concepts. Surveys and a modified Delphi process were used to gather data, subsequently analyzed using SPSS for Windows.Results: Sixteen key biochemical concepts were identified. Second year medical students rated 14/16 concepts as extremely difficult while fourth year students rated nine concepts as moderately to extremely difficult. On average, each teaching scholar generated common clinical conditions for 6.2 of the 16 concepts, yielding a set of seven critical concepts and associated clinical conditions.Conclusions: Key stakeholders in the instructional process struggle to identify biochemistry concepts that are critical, difficult to learn and associated with common clinical conditions. However, through a systematic process beginning with identification of concepts and associated clinical conditions, relevance of basic science instruction can be enhanced.

  8. The Struggles of Solidarity: Chicana/o-Mexican Networks, 1960s–1970s

    Directory of Open Access Journals (Sweden)

    Nydia A. Martinez

    2015-07-01

    Full Text Available Throughout the 1960s and 1970s, members of the Chicana/o Movement reached across class, borders, and ideologies to proclaim a political solidarity with the Mexican Left. Both, Chicana/os and Mexican activists expressed a narrative of political solidarity that encompassed a perceived shared experience of oppression and struggles for liberation. I contend, however, that both groups saw the source of their oppression and forms of resistance through different lenses. Chicana/o activists identified racism, discrimination, and cultural erasure with oppression, and they retrofit Mexican nationalism with political radicalism. In contrast, Mexican activists celebrated Marxist ideologies as radical political resistance against an increasing authoritarian government and associated Mexican nationalism with state repression and political manipulation.

  9. Novices’ Struggles with Conceptual and Theoretical Framing in Writing Dissertations and Papers for Publication

    Directory of Open Access Journals (Sweden)

    Christine Pearson Casanave

    2015-04-01

    Full Text Available In this conceptual paper, we address the problem that novice scholars in social sciences sometimes have in constructing conceptual or theoretical frameworks for their dissertations and papers for publication. In the first part of the paper, we discuss why the topic is important in the high pressure environment that novice scholars face, in which finishing a doctoral degree and getting published can make a difference in career success or failure, and explain our understanding of theoretical/conceptual framing, including provisionally defining some key terms. We then elucidate ten problems that novice scholars have with theoretical/conceptual framing, using our own experiences as manuscript reviewers and writers as examples. The paper concludes with ways that novice scholars can address the task of framing their scholarly work conceptually and theoretically, on the understanding that the struggles continue over the lifetime of a scholarly career.

  10. Case of ex-Yugoslavia and struggle for its interpretation: Case of NGO's in Serbia

    Directory of Open Access Journals (Sweden)

    Radojičić Mirjana

    2008-01-01

    Full Text Available In this article author considers the case of disintegration/decomposition of Yugoslavia from the angle of struggle for interpretation that several NGO's have fought on Serbian public scene. Clue of whole matter is in a kind of politic of interpretation engaged by these NGO's as for the near Yugoslav past. After the brief summary of this kind of interpretation author asks for key tenets of alleged "new politicity" that have been formed as a model of civil activity in Serbia during the last decade. In concluding part of the article geopolitical dimension of that phenomena is pointed out as well as importance of its precise legislation needed to restrict this kind of practice considerably.

  11. Masculinities and Religion in Kaduna, Nigeria: A Struggle for Continuity at a Time of Change

    Directory of Open Access Journals (Sweden)

    Colette Harris

    2012-04-01

    Full Text Available This paper addresses coping strategies used by men in Kaduna to ward off chaos resulting from economic instability, situating them within the global context and national policies on gender and religion. They include upholding a set of gender norms in which adult masculinity’s most crucial traits are control over women and children, and breadwinning. These norms were introduced into Nigeria under colonialism and through Islam and Christianity, yet today they are considered to represent local traditions. Religion is also important for coping strategies, especially the newer Pentecostal churches and reformist mosques, characterized by emphasis on literalist interpretations of the scriptures and notions of male superiority. Poor men have particularly welcomed the levels of certainty, moral and material support they provide as well as the legitimization of their gender power positions, especially those struggling to perform appropriate masculinity, while at the same time these establishments have facilitated sectarian violence.

  12. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  13. Major depressive disorder with religious struggle and completed suicide after hair transplantation

    Directory of Open Access Journals (Sweden)

    Mehmet Emin Ceylan

    2017-03-01

    Full Text Available Objectives: Psychological outcomes of aesthetic surgical procedures like hair transplantation are mostly positive including decreased anxiety, depression and social phobia and increased general well-being, self-efficacy and self-esteem. However, some patients may suffer from post-surgical depression and post-surgical increased suicide rates have been reported for breast augmentation patients. Difficulty adapting to the new image, unfulfilled psychological needs expected to be met by the surgery, side effects of the surgery like tissue swelling or bruising, uncontrolled pain, presence of body dysmorphic disorder and previous history of mood disorder may be some of the risk factors for post-surgical depression. Methods: Here, we present a case without prior psychiatric history who developed major depressive disorder after hair transplantation and died of suicide. Results: He started experiencing religious struggle related to his decision about the hair transplant which he interpreted as acting against God’s will. While religious involvement has been reported to be a protective factor against depression, spiritual struggle, which includes religious guilt, has been described as an important risk factor for depression, hopelessness and suicidality which might explain the severity of depression in our patient. Conclusions: This case highlights the importance of a detailed psychiatric evaluation and exploration of religious concerns of any patient before any type of aesthetic surgery. Major depressive disorder is a treatable condition; however, mild depression can go unnoticed. Religious belief and related religious practices affect an individual’s personal health attitudes; therefore, we think that every physician is needed to explore the religious concerns of any patient during any medical examination or surgical procedure. Relevant religious authorities should be consulted when necessary.

  14. Struggles with learning about scientific models in a middle school science classroom

    Science.gov (United States)

    Loper, Suzanna Jane

    Two important goals in science education are teaching students about the nature of science and teaching students to do scientific inquiry. Learning about scientific models is central to both of these endeavors, but studies have shown that students have very flawed and limited understandings of the nature and purposes of scientific models (Carey & Smith, 1993; Grosslight, Unger, & Jay, 1991; Lederman, 1992). In this dissertation I investigate the processes of teaching and learning about scientific models in an 8th grade classroom in an urban middle school. In order to do so, I examine recordings of student and teacher talk about models across a period of two months in which students completed two independent inquiry projects, using the Inquiry Island software and curriculum (Eslinger, 2004; Shimoda, White, & Frederiksen, 2002; White, Shimoda, & Frederiksen, 2000). My analysis draws on video records of small-group work and whole-class interactions, as well as on students' written work. I find that in this classroom, students struggled to understand the nature and purpose of scientific models. I analyze episodes in the classroom talk in which models appeared to be a source of trouble or confusion, and describe the ways in which the teacher attempted to respond to these troubles. I find that in many cases students appeared to be able to produce scientific models of the proper form, yet still struggled with displaying an understanding of what a model was, or of the functions of models in scientific research. I propose directions for further research and curriculum development in order to build on these findings. In particular, I argue, we need to design ways to help students engage in scientific modeling as a social and communicative practice, and to find ways to build from their everyday reasoning and argumentation practices. My research also reinforces the importance of looking at classroom talk, not just pre- and post-assessments, in order to understand teaching and

  15. Major depressive disorder with religious struggle and completed suicide after hair transplantation.

    Science.gov (United States)

    Ceylan, Mehmet Emin; Önen Ünsalver, Barış; Evrensel, Alper

    2017-01-01

    Psychological outcomes of aesthetic surgical procedures like hair transplantation are mostly positive including decreased anxiety, depression and social phobia and increased general well-being, self-efficacy and self-esteem. However, some patients may suffer from post-surgical depression and post-surgical increased suicide rates have been reported for breast augmentation patients. Difficulty adapting to the new image, unfulfilled psychological needs expected to be met by the surgery, side effects of the surgery like tissue swelling or bruising, uncontrolled pain, presence of body dysmorphic disorder and previous history of mood disorder may be some of the risk factors for post-surgical depression. Here, we present a case without prior psychiatric history who developed major depressive disorder after hair transplantation and died of suicide. He started experiencing religious struggle related to his decision about the hair transplant which he interpreted as acting against God's will. While religious involvement has been reported to be a protective factor against depression, spiritual struggle, which includes religious guilt, has been described as an important risk factor for depression, hopelessness and suicidality which might explain the severity of depression in our patient. This case highlights the importance of a detailed psychiatric evaluation and exploration of religious concerns of any patient before any type of aesthetic surgery. Major depressive disorder is a treatable condition; however, mild depression can go unnoticed. Religious belief and related religious practices affect an individual's personal health attitudes; therefore, we think that every physician is needed to explore the religious concerns of any patient during any medical examination or surgical procedure. Relevant religious authorities should be consulted when necessary.

  16. Cultural Work as a Site of Struggle: Freelancers and Exploitation

    Directory of Open Access Journals (Sweden)

    Nicole S. Cohen

    2012-05-01

    Full Text Available This paper argues that Marxist political economy is a useful framework for understanding contemporary conditions of cultural work. Drawing on Karl Marx’s foundational concepts, labour process theory, and a case study of freelance writers, I argue that the debate over autonomy and control in cultural work ignores exploitation in labour-capital relationships, which is a crucial process shaping cultural work. To demonstrate the benefits of this approach, I discuss two methods media firms use to extract surplus value from freelance writers: exploitation of unpaid labour time and exploitation of intellectual property through aggressive copyright regimes. I argue that a Marxist perspective can uncover the dynamics that are transforming cultural industries and workers’ experiences. From this perspective, cultural work is understood as a site of struggle.

  17. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  18. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  19. International Struggles for Critical Democratic Education. Counterpoints: Studies in the Postmodern Theory of Education. Volume 427

    Science.gov (United States)

    Knoester, Matthew, Ed.

    2012-01-01

    Drawing from rich data, "International Struggles for Critical Democratic Education" profiles teachers, students, and schools struggling to interrupt the reproduction of social inequalities from one generation to the next. International in its nature, the work collected here illustrates how forces of globalization create greater inequalities, and…

  20. An argument for the struggles to de-racialise South African sport ...

    African Journals Online (AJOL)

    This historical review examines the background to the struggles against inequality, discrimination and the fight to deracialise South African sport. South Africa has a long history of racial discrimination. The struggles for political freedom and for all-race-inclusive or non-racial sport were generally intertwined. The sports ...

  1. Tug-of-War: Why and when teams get embroiled in power struggles

    NARCIS (Netherlands)

    L. van Bunderen (Lisanne)

    2018-01-01

    markdownabstractIntra-team power struggles, or competitions over resource control between members, are pervasive in organizations. Research has shown that power struggles impair team outcomes, yet why and when they arise remains unknown. In this dissertation, I unravel which factors elicit

  2. The Social Construction of "Struggle": Influences of School Literacy Contexts, Curriculum, and Relationships

    Science.gov (United States)

    Triplett, Cheri F.

    2007-01-01

    In this study, social constructionism provided a theoretical framework for investigating how students' struggles with reading are socially constructed in school literacy contexts, curriculum, and relationships. The study also sought to discover how "struggling reader" is a socially constructed subjectivity or identity that begins in the early…

  3. Homophobic Slurs and Public Apologies: The Discursive Struggle over "Fag/Maricon" in Public Discourse

    Science.gov (United States)

    Cashman, Holly R.

    2012-01-01

    A handful of recent incidents hints at an ideological struggle over the use of the English word "fag(got)" and the Spanish word "maricon" in public discourse. This article examines the discursive and ideological struggle over the terms through the comparison of two cases in which Spanish/English bilingual Latinos in the U. S. use what might be…

  4. Review: Martha Akawa, The Gender Politics of the Namibian Liberation Struggle (2014)

    OpenAIRE

    Henning Melber; Dag Hammarskjöld Foundation

    2014-01-01

    Review of the monograph:Martha Akawa, The Gender Politics of the Namibian Liberation Struggle, Basel: Basler Afrika Bibliographien, 2014, ISBN 978-3-905 758-26-9, 230 pp. Besprechung der Monographie:Martha Akawa, The Gender Politics of the Namibian Liberation Struggle, Basel: Basler Afrika Bibliographien, 2014, ISBN 978-3-905 758-26-9, 230 Seiten

  5. Cognitive Strategy Instruction for Teaching Word Problems to Primary-Level Struggling Students

    Science.gov (United States)

    Pfannenstiel, Kathleen Hughes; Bryant, Diane Pedrotty; Bryant, Brian R.; Porterfield, Jennifer A.

    2015-01-01

    Students with mathematics difficulties and learning disabilities (LD) typically struggle with solving word problems. These students often lack knowledge about efficient, cognitive strategies to utilize when solving word problems. Cognitive strategy instruction has been shown to be effective in teaching struggling students how to solve word…

  6. Predictors of Reading Comprehension among Struggling Readers Who Exhibit Differing Levels of Inattention and Hyperactivity

    Science.gov (United States)

    Swanson, Elizabeth; Barnes, Marcia; Fall, Anna-Mari; Roberts, Greg

    2018-01-01

    The purpose of this study was to investigate the impact of inference making, decoding, memory, and vocabulary on reading comprehension among 7th- through 12th-grade struggling readers with varying levels of inattention and hyperactivity. We categorized a group of 414 struggling readers into 3 groups based on results from factor mixture modeling:…

  7. Literature Discussion: Encouraging Reading Interest and Comprehension in Struggling Middle School Readers

    Science.gov (United States)

    Pittman, Pamela; Honchell, Barbara

    2014-01-01

    The purpose of this qualitative study was to explore how literature discussion affects middle school struggling readers. The focus was on 16 middle school struggling readers in a rural Title I school in the southeastern United States. Findings indicated that (a) literature discussion increased student enjoyment of reading, and (b) students…

  8. Making Connections: Linking Cognitive Psychology and Intervention Research to Improve Comprehension of Struggling Readers

    Science.gov (United States)

    McMaster, Kristen L.; Espin, Christine A.; van den Broek, Paul

    2014-01-01

    Many studies have demonstrated the efficacy of reading comprehension interventions for struggling readers, including students with learning disabilities. Yet, some readers continue to struggle with comprehension despite receiving these interventions. In this article, we argue that an explicit link between cognitive psychology and intervention…

  9. Comprehensive Assessment of Struggling Learners Referred to a Graduate Medical Education Remediation Program.

    Science.gov (United States)

    Warburton, Karen M; Goren, Eric; Dine, C Jessica

    2017-12-01

    Implementation of the Next Accreditation System has provided a standardized framework for identifying learners not meeting milestones, but there is as yet no corresponding framework for remediation. We developed a comprehensive assessment process that allows correct diagnosis of a struggling learner's deficit(s) to promote successful remediation. At the University of Pennsylvania, resident learners within the Department of Medicine who are not meeting milestones are referred to the Early Intervention Remediation Committee (EIRC). The EIRC, composed of 14 faculty members with expertise in remediation, uses a standardized process to assess learners' deficits. These faculty members categorize primary deficits as follows: medical knowledge, clinical reasoning, organization and efficiency, professionalism, and communication skills. The standardized process of assessment includes an analysis of the learner's file, direct communication with evaluators, an interview focused on learner perception of the problem, screening for underlying medical or psychosocial issues, and a review of systems for deficits in the 6 core competencies. Participants were surveyed after participating in this process. Over a 2-year period, the EIRC assessed and developed remediation plans for 4% of learners (14 of a total 342). Following remediation and reassessment, the identified problems were satisfactorily resolved in all cases with no disciplinary action. While the process was time intensive, an average of 45 hours per learner, the majority of faculty and residents rated it as positive and beneficial. This structured assessment process identifies targeted areas for remediation and adds to the tools available to Clinical Competency Committees.

  10. Canadian energy policy and the struggle for sustainable development

    International Nuclear Information System (INIS)

    Doern, G.B.

    2005-01-01

    This book examined selected energy policy issues and challenges confronting Canadians over the last two decades. The aim of the book was to provide an analysis of how energy policy has evolved. The book presents an overview of energy policy and its relationship to sustainable development. Politico-economic contexts were reviewed, including the changing nature of national and continental energy markets, energy policy and sustainable development. The difficulties in evaluating the environment in energy policy were discussed. Issues concerning electricity restructuring in Canada were reviewed, with reference to Canada-US electricity trade and the climate change agenda. Alberta's oil and gas industry and the Kyoto Protocol were also examined, with reference to voluntary measures to address climate change. Issues concerning stewardship, indigenous peoples and petroleum-based economic development in the north were reviewed, as well as northern gas pipeline policy and sustainable development. Conclusions and recommendations were made concerning the following 6 analytical and practical energy policy and governance challenges facing the current government: Kyoto Protocol implementation challenges; energy security; northern pipelines and concerns with Aboriginal peoples and sustainable northern development; electricity restructuring and the limits of regulatory-market design; energy science and technology and innovation policy links; and prospects for turning the struggle for sustainable development in the energy policy field into something closer to an actual achievement. 37 refs

  11. For a consistent policy in the struggle against proliferation networks

    International Nuclear Information System (INIS)

    Schlumberger, Guillaume; Gruselle, Bruno

    2007-01-01

    Proliferation networks operate like companies. They must be capable of coordinating a series of elementary logistics, financial and technical functions. Due to the increase in worldwide exchanges, the reinforcement of existing export control tools alone will not be sufficient to face the increase in proliferation flows. Despite widespread reporting in the media, interdiction operations also can only have limited effect on networks, due to their occasional nature, if they are undertaken independently of an approach targeting other functions. It also seems hardly realistic to wish to neutralize a proliferation network only by freezing part of its credits in the framework of a repressive approach. Setting up an overall policy provides a means of coordinating intelligence actions, repression tools and interdiction means both nationally and internationally, and therefore appears as the only viable solution in the struggle against proliferation networks. This is a complex task for it requires the organization of inter-ministerial (or interagency) responsibilities, and in particular it requires an equilibrium between long term and short term actions. Finally, it depends on the reinforcement of links between the administrations involved and private participants including service companies, financial institutions and enterprises. (authors)

  12. Sanctions and the struggle for health in South Africa.

    Science.gov (United States)

    Coovadia, H M

    1999-10-01

    This commentary describes the role of a major antiapartheid health organization, the National Medical and Dental Association (NAMDA), in reinforcing and maintaining international pressure on the racist South African government. NAMDA was a constituent of the Mass Democratic Movement (MDM), which was at the forefront in the struggle for freedom in South Africa. NAMDA endorsed the programs of the banned African National Congress (ANC), which included a range of sanctions. Debates within NAMDA on enlarging sanctions into an academic boycott are summarized. The development of a policy of selective academic support, which approved academic exchanges in accord with the aims of the MDM, is explained. Indirect evidence shows that international pressures created by specific types of economic sanctions and the forms of academic boycott decided on by NAMDA achieved their objectives. I have highlighted the tension between these strategies, which resulted in the isolation of the apartheid regime, as well as the responsibility to protect the most vulnerable from the burdens that resulted from these policies.

  13. Are preservice teachers prepared to teach struggling readers?

    Science.gov (United States)

    Washburn, Erin K; Joshi, R Malatesha; Binks Cantrell, Emily

    2011-06-01

    Reading disabilities such as dyslexia, a specific learning disability that affects an individual's ability to process written language, are estimated to affect 15-20% of the general population. Consequently, elementary school teachers encounter students who struggle with inaccurate or slow reading, poor spelling, poor writing, and other language processing difficulties. However, recent evidence may suggest that teacher preparation programs are not providing preservice teachers with information about basic language constructs and other components related to scientifically based reading instruction. As a consequence preservice teachers have not exhibited explicit knowledge of such concepts in previous studies. Few studies have sought to assess preservice teachers' knowledge about dyslexia in conjunction with knowledge of basic language concepts. The purpose of the present study was to examine elementary school preservice teachers' knowledge of basic language constructs and their perceptions and knowledge about dyslexia. Findings from the present study suggest that preservice teachers, on average, are able to display implicit skills related to certain basic language constructs (i.e., syllable counting), but fail to demonstrate explicit knowledge of others (i.e., phonics principles). Also, preservice teachers seem to hold the common misconception that dyslexia is a visual perception deficit rather than a problem with phonological processing. Implications for future research as well as teacher preparation are discussed.

  14. Fostering Students' Competence in Identifying Business Opportunities in Entrepreneurship Education

    Science.gov (United States)

    Karimi, Saeid; Biemans, Harm J. A.; Lans, Thomas; Aazami, Mousa; Mulder, Martin

    2016-01-01

    Opportunity identification and, in particular, the generation of new business ideas is becoming an important element of entrepreneurship education. Researchers and educators, however, struggle with how opportunity identification competence can be enhanced. The purpose of this study was, therefore, to test the ability of students to generate new…

  15. Community empowerment needs in the struggle for environmental justice

    Energy Technology Data Exchange (ETDEWEB)

    Smith, D.

    1995-12-01

    The paper addresses the specific empowerment needs of communities and workers fighting for environmental justice. Thousands of people of color and poor communities throughout the United States are victimized by policies and practices of environmental racism which resulted in the disproportionate burden of exposure to environmental contamination where they live, work and play. Powerful interests who own and operate polluting industries and waste disposal facilities prey on poor, low income and non-white communities because they view them as areas of least resistance and {open_quotes}sacrifice zones.{close_quotes} Leaders and members of organizations from communities threatened or already devastated by contamination are waging determined, courageous and heroic struggles against giant corporate polluters. In many instances, the leaders and members of these grassroots environmental groups are literally sick and dying from contamination as they seek to organize for clean, safe and healthy communities. A key issue for communities and workers fighting for environmental justice is realizing true empowerment. Communities and workers must develop empowerment and capacity building skills in the areas of community and labor organizing; media relations and public education; legal advocacy; legislative and regulatory tracking; lobbying; health monitoring and health services; research; scientific technical needs (eg. air, water and soil testing); fundraising and economic sustainable development; institutional and organizational development; voter education and electoral politics; and youth and adult leadership training. When these empowerment skills are combined with a clear vision of justice for the future, communities will be able to fight cooporations armed with high-powered lawyers, lobbyists, public relations firms and bought-off politicians.

  16. Real-Life Stories About Addiction Struggles | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... on. Feature: Preventing Drug Abuse and Addiction Real-Life Stories About Addiction Struggles Past Issues / Fall 2011 ... TO PLAY THE VIDEO NIHSeniorHealth Videos Offer Real-Life Stories About Addiction Struggles—and Much More Many ...

  17. the effect of the War Measures Acts on Political Struggles within

    African Journals Online (AJOL)

    Setup

    Political Struggles within the South African Mine Workers' Union, 1939-1947 .... by white workers was prohibited, and compulsory arbitration of industrial disputes was ..... blamed the UP government's refusal to mediate in the strike as being ...

  18. The Lady Film: Gender at The Roots of Struggle for Democracy

    OpenAIRE

    Ichsani, Nurul

    2017-01-01

    - the lady film presented as a film advertising the women's struggle for bitmese independence and democracy. As a medium of communication, The lady Film indeed compresis variety of language lement both verbal and non verbal

  19. Risk, science and policy: definitional struggles, information management, the media and BSE.

    Science.gov (United States)

    Miller, D

    1999-11-01

    This article examines the role of definitional struggles in the science policy interface using the example of the cattle disease bovine spongiform encephalopathy (BSE) or mad cow disease in the UK. A central contention is that an explicit focus on definition illuminates the processes by which scientific judgements are made, promoted, communicated, assessed and judged and gives an improved picture of policy making. Neglected areas such as the role of secrecy, public relations and the mass media in the science-policy interface are brought into sharper focus as an intrinsic part of the wider operation of definitional struggles. The focus on definitional struggles also sheds light on some current work on risk in social theory. It is argued that the neglect of questions of agency which are central to definitional struggles has led to some theorists presenting risks as inevitable concomitants of technological and cultural developments leaving them in the grip of political quietism.

  20. The Struggling Adolescent: A Social-Phenomenological Study of Adolescent Substance Abuse.

    Science.gov (United States)

    Wolf, Barry M.

    1981-01-01

    A phenomenological investigation was conducted to examine the causal factors of adolescent substance abuse. Results indicated the adolescent substance abuser sees life as a struggle, sees self as an outsider, feels powerless and uses drugs to cope with anxiety. (RC)

  1. Is there a way for clinical teachers to assist struggling learners? A synthetic review of the literature

    Directory of Open Access Journals (Sweden)

    Boileau E

    2017-01-01

    Full Text Available Elisabeth Boileau,1 Christina St-Onge,2 Marie-Claude Audétat3 1Department of Family and Emergency Medicine, 2Department of Medicine, Université de Sherbrooke, Sherbrooke, QC, Canada; 3Unité des Internistes Généralistes et Pédiatres, Université de Genève, Geneva, Switzerland Abstract: Struggling medical trainees pose a challenge to clinical teachers, since these learners warrant closer supervision that is time-consuming and competes with time spent on patient care. Clinical teachers’ perception that they are ill equipped to address learners’ difficulties efficiently may lead to delays or even lack of remediation for these learners. Because of the paucity of evidence to guide best practices in remediation, the best approach to guide clinical teachers in the field remains to be established. We aimed to present a synthetic review of the empirical evidence and theory that may guide clinical teachers in their daily task of supervising struggling learners, reviewing current knowledge on the challenges and solutions that have been identified and explored. A computerized literature search was performed using Medline, Embase, Education Resources Information Center, and Education Source, after which final articles were selected based on relevance. The literature reviewed provided best evidence for clinical teachers to address learners’ difficulties, which is presented in the order of the four steps inherent to the clinical approach: 1 detecting a problem based on a subjective impression, 2 gathering and documenting objective data, 3 assessing data to make a diagnosis, and 4 planning remediation. A synthesized classification of pedagogical diagnoses is also presented. This review provides an outline of practical recommendations regarding the supervision and management of struggling learners up to the remediation phase. Our findings suggest that future research and faculty development endeavors should aim to operationalize remediation

  2. Spiritual Growth or Decline and Meaning-Making as Mediators of Anxiety and Satisfaction with Life During Religious Struggle.

    Science.gov (United States)

    Zarzycka, Beata; Zietek, Pawel

    2018-03-14

    A number of studies have demonstrated links between spiritual struggles and health problems. As yet, however, only a few studies have investigated what makes religious struggle a source of mental problems or a source of well-being. We determined whether spiritual growth, spiritual decline, and meaning-making mediated the relationship between religious struggle and anxiety and satisfaction with life. Of the 180 respondents, 92 were women, and mean (SD) age was 24 (8.2) years. Each respondent completed the Religious and Spiritual Struggles Scale, the Meaning-Making Scale, the Spiritual Transformation Scale, the State-Trait Anxiety Inventory, and the Satisfaction with Life Scale. Religious struggle correlated positively with anxiety and negatively with satisfaction with life. Spiritual growth mediated the relationship between moral and demonic struggle with satisfaction with life, and spiritual decline mediated the relationship between demonic, moral, and interpersonal struggle with anxiety. Finally, meaning-making mediated the relationship between religious doubt and satisfaction with life.

  3. Balancing struggles with desired results in everyday activities: strategies for elderly persons with physical disabilities.

    Science.gov (United States)

    Bontje, Peter; Asaba, Eric; Josephsson, Staffan

    2016-03-01

    The number of elderly persons with disabilities needing support with everyday activities increasing in Japan and around the world. Yet, engagement in everyday activities can support the quality of their daily life. Despite research focusing on reported meanings of people's actions, there is still limited knowledge on how engagement in everyday activity is enacted along with the meanings of persons' actions. The aim of the present study was to identify meanings of persons' actions within everyday activities of elderly Japanese with physical disabilities. Five elderly persons with physical disabilities living in the community participated in this study. Data were gathered by 10 participant observations of everyday activities supplemented with 13 unstructured interviews. Narrative analysis was used to identify meanings of persons' actions. The analysis identified an overall plot termed 'balancing struggles with desired results'. This plot illustrated that participants' and other involved individuals balanced problematic situations with finding situations that accommodated their needs. Meanings of these actions were further identified as three complementary strategies. Two of three strategies aimed to mitigate given problems, one by 'acting on a plan to achieve one's goals', the other by 'taking a step in a preferred direction by capitalising on emerging opportunities'. The third strategy focused on avoiding undesirable experiences by 'modifying problematic situations'. In conclusion, these findings call for care and rehabilitation providers' sensitivity to shifting foci of what matters in daily life's situations as well as aligning with persons' skills, resources and perspectives. Accordingly, the judicious and flexible use of these complementary strategies can enhance elderly persons' quality of daily living through everyday activities. © 2015 Nordic College of Caring Science.

  4. Deep entanglements: history, space and (energy) struggle in the German Energiewende

    OpenAIRE

    Paul, Franziska Christina

    2018-01-01

    This paper contributes to recent debates in energy geography, especially to energy transition research and literature, by developing a critical and empirically grounded understanding of energy transitions as expressions of contentious socio-spatial politics, past and present. The paper argues that historical struggles and contentious political practices around energy, so called energy struggles, continue to inform the ongoing and dynamic socio-spatial politics of energy transitions today and ...

  5. Introduction: the struggle for Shakespeare's text: twentieth-century editorial theory and practice

    OpenAIRE

    Egan, Gabriel

    2010-01-01

    This book chapter was published in the book, The Struggle for Shakespeare's Text Twentieth-Century Editorial Theory and Practice [© Cambridge University Press]. The publisher's website is at: http://www.cambridge.org/ We know Shakespeare's writings only from imperfectly-made early editions, from which editors struggle to remove errors. The New Bibliography of the early twentieth century, refined with technological enhancements in the 1950s and 1960s, taught generations of editors how to...

  6. Struggling and Seeking for Identity-The Plight of the Protagonists in Fences

    Institute of Scientific and Technical Information of China (English)

    张晨虹; 刘翀

    2013-01-01

    The characters in August Wilson’s play Fences all suffer from great pain as African American in 50s society in U. S.. Father, mother and son exert their efforts struggling in both family life and social racism. The source of their survival plight, to great extent, lies in the confusion of identity. This paper explores the struggling and seeking of the characters from both interior and exterior world.

  7. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  8. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  9. The struggle for Via Bologna street market: crisis, racial denial and speaking back to power in Naples Italy.

    Science.gov (United States)

    Dawes, Antonia

    2018-01-10

    This paper is based on ethnographic research conducted with migrant and Italian street vendors in Naples, southern Italy, in 2012. It tells the story of Via Bologna market which was nearly closed down by the City Hall at the time. Naples is a city where issues of poverty and unemployment pre-date and have been exacerbated by manifold narratives of crisis now unfolding across Europe regarding the economy, political legitimacy, security and migration. Street markets have always been an important and visible economic survival strategy for both Neapolitans and migrants there. This article shows how the Via Bologna street vendors appropriated and adapted discourses about crisis to form their own cosmopolitan social movement that halted the closure of the market. It argues that, in the age of globalized migration, the multilingual nature of such collective action is central to understanding social struggles that must be organized between marginalized groups of people divided by race, religion, politics and legal status. This, frequently ambiguous, transcultural solidarity speaks back against a mainstream post-racial discourse - often articulated by the Neapolitan street vendors at the market - that would reduce the complexity of such collective action to questions of poverty and class struggle. © London School of Economics and Political Science 2018.

  10. LEVELING THE UNLEVELED? Syariah Advocates’ Struggle for Equality in Indonesian Legal Pluralism

    Directory of Open Access Journals (Sweden)

    Ratno Lukito

    2011-02-01

    Full Text Available One of the ongoing problems faced by many Syariah advocates in Indonesia is how they can maintain their important role in the practice of law in the midst of the domination of common advocates. They are always trapped in double burden in concern of their position. On one side, they are challenged with the long historical inequality of educational access between religious (Islamic groups and secular groups, while on the other, they have to deal with the problem of being part of Muslim society with a legal culture where Islamic  law is commonly viewed as irreconcilable with secular legal traditions. This paper specifically discusses the role played by the Association of Indonesian Syariah Advocates (Asosiasi Pengacara Syariah Indonesia, APSI in their struggle to assert equality between Syariah advocates and common advocates. It shows that although APSI has successfully attracted attention from the state and public in general, the interest shown by Syariah faculties remains even relatively low. Embedded traditional culture of studying Islamic law in many Syariah faculties seems to have influenced their attention towards APSI. Yet, with inclusive approaches in expanding the institution, APSI can attract many advocates, not only from Muslim law graduates but from those of non-Muslims as well. Keywords: Syariah Lawyers, APSI, Legal Pluralism

  11. Struggle over energy transition in Berlin: How do grassroots initiatives affect local energy policy-making?

    International Nuclear Information System (INIS)

    Blanchet, Thomas

    2015-01-01

    This paper examines the growing role of grassroots initiatives in the governance of urban energy systems. In recent years, research has increasingly underlined the potential for sustainable innovation of community-led bottom-up actions but has at the same time underestimated their potential impact on the governance of energy systems. Based on a strategic action field framework (SAF), this paper analyses the conflicts over the remunicipalisation of Berlin's electricity grid and investigates the creation and strategic development of two grassroots initiatives as well as their interaction with the local government and the established grid operator. We argue that grassroots initiatives have an important impact on the local energy system, not just through their influence on the implementation of local energy policy but above all by their framing of a specific vision of a local energy transition. The paper discusses the scope and limits of such initiatives in an urban context. - Highlights: • Grassroots initiatives as actors with countervailing power in local energy policy. • They increase citizens' awareness and impact the action of the local government. • Grids as objects of struggle between competing visions of energy transition. • Urban context is both a resource and a constraint for grassroots initiatives action

  12. Fuel poverty as injustice: Integrating distribution, recognition and procedure in the struggle for affordable warmth

    International Nuclear Information System (INIS)

    Walker, Gordon; Day, Rosie

    2012-01-01

    Bringing attention to fuel poverty as a distinct manifestation of social inequality has asserted the place of affordable warmth in the profile of contemporary rights and entitlements. As such, fuel poverty can be understood as an expression of injustice, involving the compromised ability to access energy services and thereby to secure a healthful living environment. In this paper, we consider how fuel poverty may be aligned to various alternative concepts of social and environmental justice. Whilst recognising that fuel poverty is fundamentally a complex problem of distributive injustice, we argue that other understandings of injustice are also implicated and play important roles in producing and sustaining inequalities in access to affordable warmth. Addressing fuel poverty has to involve seeking justice in terms of the cultural and political recognition of vulnerable and marginalised social groups and pursuing procedural justice through opening up involvement and influence in decision-making processes. We make this argument both in theoretical terms, and through considering the experience of fuel poverty advocacy and policy development in the UK. Opportunities for future action may be illuminated through such interconnected justice framings as wider awareness of energy, climate and poverty issues emerge. - Highlights: ► We examine fuel poverty through different concepts of social and environmental justice. ► UK experience is used to inform and exemplify our analysis. ► Distributional justice is central but insufficient on its own. ► Procedural justice and justice as recognition are key necessary goals in the struggle for affordable warmth.

  13. Treatment Effects for Older Struggling Readers: An Application of Moderated Mediation.

    Science.gov (United States)

    Roberts, Greg; Fletcher, Jack M; Stuebing, Karla K; Barth, Amy E; Vaughn, Sharon

    2013-02-01

    This study used multigroup structural equations to evaluate the possibility that a theory-driven, evidence-based, yearlong reading program for sixth-grade struggling readers moderates the interrelationships among elements of the simple model of reading (i.e., listening comprehension, word reading, and reading comprehension; Hoover & Gough, 1990). Our specific interest was in the relation of theory, program, and evaluation. Our motivating assumptions were that 1) a well-designed, theory-based program affects performance in predictable ways and that 2) treatment effects may be present even when group differences in posttest means are not robust. The analysis sample comprised 327 students, 113 in the business-as-usual condition and 214 in treatment. We pretested students in the fall of sixth grade and collected posttest data in the fall of seventh grade. There were 217 cases in the posttest sample, 47 comparison students and 170 treatment students at posttest. The findings support the possibility that treated sixth-grade students improved in response to an intensive, yearlong intervention, when conceptualizing change in terms of predictable interrelationships of important underlying skills, rather than in terms of group mean differences at posttest. Specifically, the results suggest that verbal knowledge is less proximal to the reading comprehension of students who have become proficient in the use of text processing and reading comprehension strategies.

  14. The spiritual struggle of anger toward God: a study with family members of hospice patients.

    Science.gov (United States)

    Exline, Julie J; Prince-Paul, Maryjo; Root, Briana L; Peereboom, Karen S

    2013-04-01

    Anger toward God is a common form of spiritual struggle, one that people often experience when they see God as responsible for severe harm or suffering. The aim of this study was to assess the prevalence, correlates, and preferred coping strategies associated with anger toward God among family members of hospice patients. Teams from a large hospice in the midwestern United States distributed surveys, one per household, to family members of home-care patients. The survey assessed feelings toward God (anger/disappointment and positive feelings), depressive symptoms, religiosity, and perceived meaning. Participants also rated their interest in various strategies for coping with conflicts with God. Surveys (n=134) indicated that 43% of participants reported anger/disappointment toward God, albeit usually at low levels of intensity. Anger toward God was associated with more depressive symptoms, lower religiosity, more difficulty finding meaning, and belief that the patient was experiencing greater pain. Prayer was the most highly endorsed strategy for managing conflicts with God. Other commonly endorsed strategies included reading sacred texts; handling the feelings on one's own; and conversations with friends, family, clergy, or hospice staff. Self-help resources and therapy were less popular options. Anger toward God is an important spiritual issue among family members of hospice patients, one that is commonly experienced and linked with depressive symptoms. It is valuable for hospice staff to be informed about the issue of anger toward God, especially because many family members reported interest in talking with hospice team members about such conflicts.

  15. Proceedings about pachamamismo, Extractivism and development in social and environmental struggles

    Directory of Open Access Journals (Sweden)

    Patricia Agosto

    2016-05-01

    Full Text Available The deepening of the exporting extractive industry in Latin America in recent decades has opened important debates involving intellectuals, governments and peoples who resist in the areas of slaughter delivered extractivism. Thus, concepts like Pachamamismo, development, economic growth, modernity, Good Living, rights of nature, are the key to these discussions that seem essential to collectively build an alternative way to recreate the world in which we live. In this article we approach some of these discussions, with the conviction that the development associated with modernity, capitalism, the colonial organization of the world and its system of Eurocentric knowledge, is not seeking our people, not comply with the excuse of economic growth and perceived more and more clearly that the “most advanced” of economic, social and cultural organization of industrialized countries to imitate, forms are what caused this civilizational crisis in which we find . So are routed through their struggles, to build the Good Life, with human dignity and rights nature, it becomes an alternative way of living and being in the world.

  16. Struggling to find meaning in life among spouses of people with ALS.

    Science.gov (United States)

    Ozanne, Anneli O; Graneheim, Ulla H; Strang, Susann

    2015-08-01

    The aim of this study was to illuminate experiences of finding meaning in life among spouses of people with amyotrophic lateral sclerosis. Thirteen interviews were analyzed with qualitative content analysis. The spouses were struggling for meaning at the end of a dark tunnel. They felt limited and isolated in their proximity to death. They lived imprisoned lives, felt lonely, considered life to be unfair and incomplete, and mourned the loss of their future. However, they found meaning despite the proximity of death through cherishing their own lives, fellowship, accepting the present, and believing in meaning after the partner's death. Meaning in life strengthened spouses' well-being and ability to find pleasure in a difficult situation. It also strengthened their will to live after the partner's death. Limitations and isolations were strong predictors of what could impair their well-being and the possibility of finding meaning after the partner's death. Spouses need individual support throughout the disease process and after the partner's death, to give them the strength to find meaning in life and prioritize what is important for them. Paying attention to what might prevent them from finding meaning could make it easier to help them in their situation. Providing joint support to the patient and spouse might also help them to see each other's situation, come together, and help each other.

  17. Policy for the struggle against climate change in the United Kingdom

    International Nuclear Information System (INIS)

    Rahmani, S.

    2008-01-01

    This article briefly presents the content of the 'Climate Change Bill' which was to be voted by the British Parliament by the end of 2008. This bill created an independent institution, the 'Climate Change Committee', which will counsel the government on the optimal path for emission reductions on the basis of economical, technological, social, and environmental criteria, and will also give its opinion on the aimed emission reduction level. Besides this governance institution, the struggle against climate change is based on two other bills, the 'Energy Bill' and the 'Planning Bill'. The first one deals with the development of technologies in renewable energies, in offshore gas storage, and in carbon capture, and also with the financing of nuclear waste processing and nuclear installation dismantling. The second one aims at simplifying urban planning rules, and proposes the creation of and independent planning commission. The author gives data on the particularly important expected emission reductions obtained through the European Union Emission Trading Scheme (EU-ETS)

  18. Alternative Text Types to Improve Reading Fluency for Competent to Struggling Readers

    Directory of Open Access Journals (Sweden)

    Timothy V. Rasinski

    2016-01-01

    Full Text Available This article offers instructional suggestions and strategies based on research and theoretical literature for developing reading fluency through the use of rhyming poetry and other texts beyond the narrative and informational texts that have been traditionally used for reading instruction. Readers’ lack of fluency in reading can be a monumental impediment to proficiency in good comprehension and overall reading competency. For all readers it is well established that as they progress in reading competence their reading ability grows (Stanovich, 1993/1994. This continued reading success begets continued reading growth; however, many struggling readers have difficulty in moving to a level of automaticity and fluency in their reading that enables them to engage in a successful practice. Lack of practice inhibits their reading comprehension. Readers’ abilities to effectively comprehend texts are significantly affected by their proficiency in accurate and automatic word recognition and prosody (May, 1998; Stanovich, 1993/1994; LaBerge & Samuels, 1974; Schreiber, 1991. Repeated reading practice has been shown to be a powerful way to improve these important fluency competencies. Certain texts are particularly well suited for repeated reading that improves both aspects of fluency

  19. International migration, "domestic struggles" and status aspiration among nurses in South Africa.

    Science.gov (United States)

    Hull, Elizabeth

    2010-01-01

    The achievement of upward mobility through participation in international labour markets has become possible for nurses in the context of a 'new' democratic South Africa, but this contrasts sharply with the predicament of many in the post-apartheid context, for whom economic vulnerability and unemployment are the prevailing norm. Such a stark contrast has tended to complicate the domestic relations experienced by nurses who, as working professionals, often have significantly greater financial resources and career flexibility than their husbands. Looking at the possibilities and constraints that are created for nurses in their social relationships particularly with their husbands, I draw on Belinda Bozzoli's concept of 'domestic struggles' in order to emphasise the multiplicity and changeability of gendered relations, instead of assuming a single patriarchal status quo.1 Fixed representations of gender roles nonetheless play an important part in nurses' own commentary on migration. While many nurses speak enthusiastically of the possibilities of seeking work overseas, others draw upon familiar representations of female domestic duty to condemn migrants for neglecting their family in pursuit of financial gain. I argue that this criticism is rooted in a fear of the threat that migration presents to existing nursing hierarchies, as a new and powerful tool for status acquisition in the post-apartheid context.

  20. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  1. Chlamydia trachomatis’ struggle to keep its host alive

    Directory of Open Access Journals (Sweden)

    Barbara S. Sixt

    2017-03-01

    Full Text Available Bacteria of the phylum Chlamydiae infect a diverse range of eukaryotic host species, including vertebrate animals, invertebrates, and even protozoa. Characteristics shared by all Chlamydiae include their obligate intracellular lifestyle and a biphasic developmental cycle. The infectious form, the elementary body (EB, invades a host cell and differentiates into the replicative form, the reticulate body (RB, which proliferates within a membrane-bound compartment, the inclusion. After several rounds of division, RBs retro-differentiate into EBs that are then released to infect neighboring cells. The consequence of this obligatory transition between replicative and infectious forms inside cells is that Chlamydiae absolutely depend on the viability and functionality of their host cell throughout the entire infection cycle. We recently conducted a forward genetic screen in Chlamydia trachomatis, a common sexually transmitted human pathogen, and identified a mutant that caused premature death in the majority of infected host cells. We employed emerging genetic tools in Chlamydia to link this cytotoxicity to the loss of the protein CpoS (Chlamydia promoter of survival that normally localizes to the membrane of the pathogen-containing vacuole. CpoS-deficient bacteria also induced an exaggerated type-1 interferon response in infected cells, produced reduced numbers of infectious EBs in cell culture, and were cleared faster from the mouse genital tract in a transcervical infection model in vivo. The analysis of this CpoS-deficient mutant yielded unique insights into the nature of cell-autonomous defense responses against Chlamydia and highlighted the importance of Chlamydia-mediated control of host cell fate for the success of the pathogen.

  2. Looking beyond installation: Why households struggle to make the most of solar hot water systems

    International Nuclear Information System (INIS)

    Gill, Nicholas; Osman, Peter; Head, Lesley; Voyer, Michelle; Harada, Theresa; Waitt, Gordon; Gibson, Chris

    2015-01-01

    This paper examines household responses to sustainability issues and adoption of energy saving technologies. Our example of solar hot water systems highlights the complexity and variability of responses to low-carbon technologies. While SHW systems have the potential to provide the majority of household hot water and to lower carbon emissions, little research has been done to investigate how SHW systems are integrated into everyday life. We draw on cultural understandings of the household to identify passive and active users of SHW systems and utilize a model that illustrates how technology use is dependent on inter-relations between cultural norms, systems of provision, the material elements of homes, and practice. A key finding is that households can be ill-prepared to make the most of their SHW systems and lack post-installation support to do so. Thus, informed and efficient use of SHW systems is hit and miss. Current policy is largely aimed at subsidizing purchase and installation on the assumption that this is sufficient for emission reduction goals. Our analysis provides evidence to the contrary. Areas we highlight for policy and practice improvement are independent pre-purchase advice, installation quality, and practical guidance on system operation and interaction with patterns of hot water use. - Highlights: • We interview Australian households about their experience with SHW systems. • We identify active and passive users of SHW. Active users tend to be dissatisfied with their system. • Passive users tend to be satisfied but have relatively inefficient systems. • Householders struggle to integrate hot water use and system operation, compromising efficiency. • Policy should encompass pre and post-installation support as much as incentives to install.

  3. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  4. An ideal of philosophy as a struggle for man's sense of existence

    Directory of Open Access Journals (Sweden)

    Popović Brankica V.

    2011-01-01

    Full Text Available The paper aims at researching the phenomenon of contemporary man struggling for 'self-understanding'. The starting point of the research is Husserl's notion of universal, transformed science and its calling in terms of beginning a new epoch, with its belief in its idea of being true science and method. Nevertheless, its own fate (vocation, on the way to self-understanding, is contained in the necessity of discovering final idea of philosophy along with its true method. In such a situation, we, as humans of the modern age, find ourselves in danger of descending into general scepticism, thereby losing our own sense of existence and truth, as Husserl would warn. Instead of it, in fact, he proposes self-understanding and spiritual awakening, inner understanding of the flow of philosophy, which is, in spite of its contradictions, still unique and facilitates understanding of our present conditions of life. The only true and significant struggles of our time, according to Husserl, are those very struggles between a crushed humanity, and the present humanity that has to fight for a new stronghold. In other words, real spiritual struggles of European man are essentially struggles of philosophies: between sceptical (nonphilosophies and actual, vital philosophies. Their vitality consists of the fact that they fight for their genuine sense, and along with it, for the sense of genuine humanity.

  5. Hypothetical learning trajectory design on the history of Indonesian independence struggle in Mathematics logic instruction

    Directory of Open Access Journals (Sweden)

    Dra Nurjanah

    2017-12-01

    Full Text Available The research was aimed at developing learning resources for mathematics logic using the hypothetical learning trajectory designed through reflection on the history of Indonesian independence struggle. The study was carried out at the Department of Mathematics Education of the Faculty of Teacher Training and Educational Sciences Nusantara Islamic University (Uninus. The study used design research consisted of three stages: preparing the experiments, design the experiments, and retrospective analysis. Preparing the experiments stage has been completed and design the experiments stage is currently under preparation. The main activities accomplished in preparing the experiments stage consisted of: studies of Indonesian independence struggle, curriculum analysis, literature review, and early prototype design. Design the experiments phase has enabled the development of the research instruments. The learning trajectory which has been designed in the first stage involved: reflections on the history of Indonesian independence struggle; implication and bi-implication; implication, bi-implication and their truth in the context of the history of the Indonesian independence struggle; and implication, bi-implication and their truth in the context of mathematics. Based on the results of discussions with colleagues, the students’ ability in mathematical thinking can be developed by using the history of Indonesian independence struggle as the context of learning in a mathematics logics course.

  6. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  7. ERNEST J. GAINES’S MISS JANE PITTMAN: A SYMBOL OF THE BLACK FEMALE ABOLITIONIST STRUGGLE / « MADEMOISELLE JANE PITTMAN » D'ERNEST J. GAINES: UN SYMBOLE DE LA LUTTE ABOLITIONNISTE MENÉE PAR LES FEMMES DE COULEUR / "DOMNIŞOARA JANE PITTMAN” DE ERNEST J. GAINES: SIMBOL AL LUPTEI ABOLIŢIONISTE DUSE DE FEMEILE DE CULOARE

    Directory of Open Access Journals (Sweden)

    Ettien Yapo

    2014-11-01

    Full Text Available The Autobiography of Miss Jane Pittman by Ernest J. Gaines is a testimony of the black female abolitionist struggle. Its protagonist, Miss Jane Pittman, whose life covers the Civil War period (1861-1865 and the 1960s, embodies the African American women’s experience through her own story. As Ernest J. Gaines gives her the voice to relate her life experience, she reflects on her being and at the same time, she constructs her identity which reveals her heroism. Her struggle for freedom turns around her participation in the Civil War and the Civil Rights Movement. But her attempt to reach the North after the Civil War remains an important fact of her struggle. As a symbol of the black female abolitionist struggle, her “autobiography” is the voiceless African American women’s point of view.

  8. The struggle against proliferation in the USA in the QDR 2006: the age of maturity?

    International Nuclear Information System (INIS)

    Gruselle, Bruno; Payre, Guillaume

    2006-01-01

    The authors comment the content of the US Quadrennial Defence Review of 2006 (QDR 2006), and more particularly how this document addresses the struggle against proliferation. This struggle appears as a transverse issue within the main conventional pillars of the DoD's action (to defend homeland in depth, to prevent the acquisition and use of weapons of mass destruction by hostile actors, and to shape choices of countries at strategic crossroads). They recall that a previous release (QDR 2005) already set the principles and an age of maturity for the struggle against proliferation, and that an older release (QDR 2001) outlined the necessity for the USA to defend their homeland and allies against ballistic and cruise weapons (this meant the assignment of new means and weapons to conventional deterrence). Thus, the QDR 2006 defines means to be implemented and their operational structure, and therefore an almost definitive architecture for a new triad

  9. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  10. Helping struggling learners of English as an additional language succeed with interactive multisensory structured strategies

    Directory of Open Access Journals (Sweden)

    Schneider, Elke

    2016-01-01

    Full Text Available Based on cross-linguistic and interdisciplinary research of several decades that bridges learning an additional language with the field of learning differences/disabilities, this article shares research-evidenced practices to effectively address the needs of struggling foreign and second language learners of English in Brazil. These multisensory structured strategies enhance pronunciation, listening, reading and writing skills and strengthen grammar and vocabulary competencies of struggling learners. The selected multisensory structured metacognitive strategies can easily be infused into existing English as a foreign/second language curricula

  11. Nuclear energy is part of the solution to struggle against climate change

    International Nuclear Information System (INIS)

    2015-05-01

    This document is a contribution to the preparation of the Paris COP21 conference. It recalls the main objectives of the Kyoto Protocol, and then states and discusses three main issues to reach these objectives: the world will need all low-carbon energies including nuclear energy (80 per cent of electricity must be low-carbon within 35 years; CO 2 emissions must be reduced while meeting humanity basic needs; the IPCC has identified three types of low-carbon electricity: renewable, nuclear, and based on carbon capture and sequestration; the electrification of uses is an efficient vector of de-carbonation), it is urgent to use available low-carbon energies right now (70 per cent of the carbon budget has already been consumed; nuclear energy is an available industrial low-carbon solution; nuclear energy is the first source of low-carbon electricity in OECD countries and this is an asset to be preserved to meet climate objectives; nuclear energy is a solution to support a low-carbon growth in emerging countries; nuclear energy will remain a stake to reduce CO 2 emissions), and each country should have access to the larger as possible portfolio of low-carbon technologies (very few scenarios succeed in remaining under the 2 degree C limit without nuclear; all national objectives and peculiarities must be integrated for each country joining the struggle against climate change; nuclear energy allows the reduction of CO 2 emissions while strengthening supply safety and economic safety; within 35 years, the technology portfolio will be larger due to the development of energy storage systems, renewable energies and fourth-generation reactors)

  12. Struggles for recognition: a content analysis of messages posted on the Internet

    Directory of Open Access Journals (Sweden)

    Andersen AJ

    2012-07-01

    Full Text Available Anders Johan W Andersen,1,2 Tommy Svensson31Department of Psychosocial Health, University of Agder, Norway; 2Nordic School of Public Health, Gothenburg, Sweden; 3Department of Behavioral Sciences and Learning, Linköping University, Linköping, SwedenBackground: The Internet has enlarged the possibilities of human communication and opened new ways of exploring perceptions of mental health. This study is part of a research project aiming to explore, describe, and analyze different discourses of mental health in Norway and Sweden, using material from Internet-based services.Aim: To examine messages posed by users of publicly available question-and-answer services and to describe their content.Methods: A Web search was used to identify Norwegian and Swedish Websites offering mental health services by email or posted messages. A total of 601 messages from 20 services, 10 Norwegian and 10 Swedish, were analyzed by means of qualitative content analysis and further interpreted in light of the social theory of recognition by Honneth.Results: Eight categories emerged from the analysis: family life, couples, others, violence, the ungovernable, self-image, negotiating normality, and life struggles. These categories were then grouped into three themes: (1 relationship to significant others, (2 relationship to self, and (3 relationship to the social community. The themes promoted an understanding of mental health as closely connected to political and social factors.Conclusions: The results showed a variety of concerns from various parts of life and empowered the view that mental health should be understood broadly, at a conceptual level. Mental health emerged as a deeply relational concept that emphasized the equal distribution of chances in life. It strengthened the moral grammar of social inclusion and the acceptance of plurality in social life.Keywords: Internet-based services, mental health, public health, social theory

  13. The struggle towards 'the New Normal': a qualitative insight into psychosexual adjustment to prostate cancer.

    Science.gov (United States)

    Hanly, Narelle; Mireskandari, Shab; Juraskova, Ilona

    2014-07-30

    Despite the growing body of literature which highlights the potential for significant and enduring side-effects of prostate cancer treatment, there is limited research exploring the experience of living with the treatment-induced side-effects such as sexual dysfunction, and their repercussions for men and their partners. The aim of this qualitative study was to explore factors influencing psychosexual adjustment, self-perception, and unmet information and support needs of prostate cancer patients and their partners. Twenty-one men, recruited via a prostate cancer support group newsletter, participated in face-to-face semi-structured interviews, which were subjected to thematic analysis. The qualitative analysis revealed three inter-connected main themes which contributed to men's psychosexual adjustment: i) Psychosexual impact, ii) Communication and support, and iii) Integration process. Men reported distressing sexual and urinary difficulties, tainted self-perception and altered intimate relationships. Receiving adequate information and support, and having good communication with their doctors and partners facilitated better adjustment to prostate cancer treatment. Coming to terms with the significant impact of treatment had involved making lifestyle changes, coping with emotional struggles and striving to accept and integrate their post-treatment "new normal" self and sexual life. The importance of adequate communication with health professionals and partners, especially regarding treatment effects on sexual function and rehabilitation options, was highlighted as a key factor facilitating the adjustment process. Prostate cancer patients would benefit from improved access to timely and tailored information and decision-making resources, ongoing multidisciplinary care, and support groups, as well as appropriate referrals for sexual and psychological counselling.

  14. Gossip-Free Zones: Problem Solving to Prevent Power Struggles

    Science.gov (United States)

    Bruno, Holly

    2007-01-01

    Gossiping staff in early childhood programs models destructive behavior and harms families' trust in the professionalism of the program. Bruno identifies some of the causes and motives for gossip and examines its occurrence in early care and education settings. She offers step-by-step strategies to help supervisors set and enact policies that…

  15. Obnoxious Labels as Language of Class Struggle in Nigeria: The ...

    African Journals Online (AJOL)

    Obnoxious Labels as derogatory language have some truths Nigerians especially the Igbo have not set free. The essay identifies some discriminatory practices and postures of intolerance, occasioned by linguistic, religious, gender, and ethnic related sentiments as being reinforced by revivals of primordial differentiations ...

  16. "A constant struggle to receive mental health care": health care professionals' acquired experience of barriers to mental health care services in Rwanda.

    Science.gov (United States)

    Rugema, Lawrence; Krantz, Gunilla; Mogren, Ingrid; Ntaganira, Joseph; Persson, Margareta

    2015-12-16

    In Rwanda, many people are still mentally affected by the consequences of the genocide and yet mental health care facilities are scarce. While available literature explains the prevalence and consequences of mental disorders, there is lack of knowledge from low-income countries on health care seeking behavior due to common mental disorders. Therefore, this study sought to explore health care professionals' acquired experiences of barriers and facilitators that people with common mental disorders face when seeking mental health care services in Rwanda. A qualitative approach was applied and data was collected from six focus group discussions (FGDs) conducted in October 2012, including a total of 43 health care professionals, men and women in different health professions. The FGDs were performed at health facilities at different care levels. Data was analyzed using manifest and latent content analysis. The emerging theme "A constant struggle to receive mental health care for mental disorders" embraced a number of barriers and few facilitators at individual, family, community and structural levels that people faced when seeking mental health care services. Identified barriers people needed to overcome were: Poverty and lack of family support, Fear of stigmatization, Poor community awareness of mental disorders, Societal beliefs in traditional healers and prayers, Scarce resources in mental health care and Gender imbalance in care seeking behavior. The few facilitators to receive mental health care were: Collaboration between authorities and organizations in mental health and having a Family with awareness of mental disorders and health insurance. From a public health perspective, this study revealed important findings of the numerous barriers and the few facilitating factors available to people seeking health for mental disorders. Having a supportive family with awareness of mental disorders who also were equipped with a health insurance was perceived as vital for

  17. Resistance in Action Learning: Struggling with Self-Efficacy and the Social Self--and What about the Set Advisor?

    Science.gov (United States)

    Burger, Ulrike

    2013-01-01

    This account of practice explores the concept of resistance in action learning. Resistance is conceptualized as an attempt of self-protection that is manifested in action learners' struggles with their sense of self-efficacy and their social Self. These struggles are an inherent part of the action learning process and may elicit defensive…

  18. Bill project related to the struggle against the proliferation of arms of massive destruction and their vectors

    International Nuclear Information System (INIS)

    2011-01-01

    This bill project addresses several issues: the struggle against proliferation of arms of massive destruction (nuclear weapons, nuclear materials, biological weapons, and chemical weapons), the struggle against proliferation of vectors of arms of massive destruction, double-use goods, the use of these weapons and vectors in acts of terrorism

  19. The legacy of social conflicts over property rights in rural Brazil and Mexico : Current land struggles in historical perspective

    NARCIS (Netherlands)

    Vergara-Camus, Leandro

    2012-01-01

    This article proposes an approach to the agrarian question that focuses on the establishment of absolute private property rights over land in Brazil and Mexico. The author argues that current land struggles are conditioned by the property regimes inherited from past struggles. The author examines

  20. Evaluating the Struggles with International Students and Local Community Participation

    Science.gov (United States)

    Kusek, Weronika A.

    2015-01-01

    International students are not only important for universities, but even more so to the host communities, towns and regions where higher education institutions are located. This pilot study looked at a public university located in a small college town in Ohio. The study explored the relationship between international students and the local…

  1. One Struggle through Individualism: Toward an Antiracist White Racial Identity.

    Science.gov (United States)

    Croteau, James M.

    1999-01-01

    Understanding the collective versus individualistic viewpoint is important to understanding racism in America. The author applies lessons learned in dealing with homophobia to the matter of racism. Forming for oneself a white version of racial identity is the key to white's active personal involvement and identification with being anti-racist.…

  2. Understanding the Academic Struggles of Community College Student Athletes

    Science.gov (United States)

    Demas, Jason

    2017-01-01

    When students begin their education at community colleges, they may face more obstacles to obtaining their college education than students starting in four-year institutions. Research has shown the importance of academic and student services in the support of student athletes, that community college student athletes are often at academic risk, and…

  3. Struggling to decide : Competition in group decision-making

    NARCIS (Netherlands)

    de Wilde, T.R.W.

    2017-01-01

    In this dissertation, it is examined how cooperation and competition affect the way groups exchange and process information, and how this – in turn – affects groups’ decision-making quality. Answering this question is important because competition is ubiquitous in group interactions and such

  4. Learning to get along despite struggling to get by

    Science.gov (United States)

    Ostrowski, Elizabeth A; Shaulsky, Gad

    2009-01-01

    How cooperation can evolve by natural selection is important for understanding the evolutionary transition from unicellular to multicellular life. Here we review the evolutionary theories for cooperation, with emphasis on the mechanisms that can favor cooperation and reduce conflict in multicellular organisms. PMID:19519929

  5. Complex Intervention: A Family's Story of Loss, Struggle, and Perseverance

    Science.gov (United States)

    Njoroge, Wanjiku F. M.

    2015-01-01

    This article reveals the complicated relationships among culture, family, trauma, and service delivery for immigrant families. The author describes a family who first came into contact with the service delivery system referred by the pediatrician, whose practice was an important point of entry for the early childhood work that followed. The family…

  6. Students' Food Acquisition Struggles in the Context of South Africa: The Fundamentals of Student Development

    Science.gov (United States)

    Dominguez-Whitehead, Yasmine

    2015-01-01

    This article situates food at the heart of the fundamentals of student development, based on qualitative case study research. Food acquisition and food-related struggles in the context of the South African university are examined. Three overarching themes emerged from the analysis of the data, and are discussed in detail: depletion of food funds,…

  7. Emergence of inter-identity alliances in struggles for transformation of the Kenyan constitution

    Directory of Open Access Journals (Sweden)

    Jacob Mwathi Mati

    2017-03-01

    Full Text Available Struggles for transformation of the Kenyan constitution brought into alliances disparate movements from below, sections of middleclass, and factions of political, economic and religious elites, in challenging the government. The emergence of these alliances presents useful cases for examining the dynamic relationship and politics between these movements, and also for probing social movement theory. Specifically, given the centrality of identity consciousness in movements, how were intrinsic class, religious, gender, generational and ethnic identity interests, contestations and cleavages overcome to enable inter-identity alliances in these struggles? More critically, how relevant are the dominant social movement theories in explaining this phenomenon? Is theoretical straightjacketing useful for analysing movements with such diversity? Drawing from in-depth interviews and existing literature on Kenyan constitutional reform struggles, this paper illustrates how alliances between the different identities and movements were forged to allow for a common struggle. The paper further illustrates that while political opportunity structures explain certain aspects of this phenomenon, framing, civic education and community organising strategies were critical enablers for collective identity formation

  8. Benefits of Structured After-School Literacy Tutoring by University Students for Struggling Elementary Readers

    Science.gov (United States)

    Lindo, Endia J.; Weiser, Beverly; Cheatham, Jennifer P.; Allor, Jill H.

    2018-01-01

    This study examines the effectiveness of minimally trained tutors providing a highly structured tutoring intervention for struggling readers. We screened students in Grades K-6 for participation in an after-school tutoring program. We randomly assigned those students not meeting the benchmark on a reading screening measure to either a tutoring…

  9. The Effect of Electronic Storybooks on Struggling Fourth-Graders' Reading Comprehension

    Science.gov (United States)

    Ertem, Ihsan Seyit

    2010-01-01

    This quantitative research examined the differences in struggling readers' comprehension of storybooks according to the medium of presentation. Each student was randomly assigned with one of three conditions: (1) computer presentation of storybooks with animation; (2) computer presentation of storybooks without animation; and (3) traditional print…

  10. Reliability and Validity of the CTOPP Elision and Blending Words Subtests for Struggling Adult Readers

    Science.gov (United States)

    Nanda, Alice O.; Greenberg, Daphne; Morris, Robin D.

    2014-01-01

    Almost half of American adults struggle with reading but there is a dearth of reading-related assessments for these adults. In turn, researchers and practitioners use assessments designed for children with these adults. This study examined the psychometric and descriptive attributes of the Comprehensive Test of Phonological Processing (CTOPP)…

  11. The Effect of Technology-Based Altered Readability Levels on Struggling Readers' Science Comprehension

    Science.gov (United States)

    Marino, Matthew T.; Coyne, Michael; Dunn, Michael

    2010-01-01

    This article reports findings from a study examining how altered readability levels affected struggling readers' (N = 288) comprehension of scientific concepts and vocabulary. Specifically, the researchers were interested in learning what effect altered readability levels have when low ability readers participate in a technology-based science…

  12. Using Peer Collaboration to Support Online Reading, Writing, and Communication: An Empowerment Model for Struggling Readers

    Science.gov (United States)

    Henry, Laurie A.; Castek, Jill; O'Byrne, W. Ian; Zawilinski, Lisa

    2012-01-01

    This comparative case study investigated the implementation of an empowerment model for struggling readers that utilized the Internet as a context for reading, writing, and communicating in 3 different classroom contexts. Through student-centered techniques, such as flexible grouping and peer teaching, we designed Internet Reciprocal Teaching to…

  13. Democratizing Rural Economy: Institutional Friction, Sustainable Struggle and the Cooperative Movement

    Science.gov (United States)

    Mooney, Patrick H.

    2004-01-01

    Sustainable development demands institutions manage the conflicts and struggles that inevitably arise over material and ideal interests. While current cooperative theory privileges the economic element, a political economy of cooperation emphasizes cooperatives' tentative bridging of economic and political spheres with a democratic ethos. The…

  14. Evidence That International Undergraduates Can Succeed Academically Despite Struggling with English

    Science.gov (United States)

    Fass-Holmes, Barry; Vaughn, Allison A.

    2015-01-01

    Many American universities require international applicants whose native language is not English to submit English proficiency exam scores presumably because of proficiency's potential to predict future academic success. The present study provides evidence, however, that such applicants can succeed academically despite struggling with English.…

  15. Using Game-Based Learning to Support Struggling Readers at Home

    Science.gov (United States)

    Holmes, Wayne

    2011-01-01

    Significant numbers of children (6% of 11-year-olds) have difficulties learning to read. Meanwhile, children who receive appropriate support from their parents do better in literacy than those who do not. This study uses a case study approach to investigate how digital games designed to support struggling readers in school were used at home, by…

  16. Engaging Struggling Early Readers to Promote Reading Success: A Pilot Study of Reading by Design

    Science.gov (United States)

    Mendez, Linda M. Raffaele; Pelzmann, Catherine A.; Frank, Michael J.

    2016-01-01

    In this study, we piloted a Tier 2 intervention designed to improve reading skills among struggling early readers using an intervention that included SRA Reading Mastery, listening-while-reading activities, strategies to increase motivation and engagement in reading, and parent involvement in reading homework. The study included 6 students in…

  17. Lift-Off for Early Literacy: Directed Reading Opportunities for Struggling Students

    Science.gov (United States)

    Iannone-Campbell, Charlene; Lattimore, Susan Lloyd

    2011-01-01

    As early as preschool, children who struggle with emergent literacy skills can benefit from effective response to intervention. Don't wait until later grades when they've already fallen behind--improve their literacy skills now with this evidence-based Tier 2 RTI curriculum, ready for any pre-K educator to pick up and use right away. Created by…

  18. The New Peasantries, struggles for autonomy and sustainability in an era of empire and globalization

    NARCIS (Netherlands)

    Ploeg, van der J.D.

    2008-01-01

    This book explores the position, role and significance of the peasantry in an era of globalization, particularly of the agrarian markets and food industries. It argues that the peasant condition is characterized by a struggle for autonomy that finds expression in the creation and development of a

  19. The Effectiveness of Graphic Organizers to Support Executive Function for Ninth Grade Struggling Readers

    Science.gov (United States)

    Barry, Elaine

    2016-01-01

    Struggling readers, or students who read below grade level but have strong phonological awareness, may benefit from using instructional tools like graphic organizers (GOs) while reading. The purpose of this study was to investigate the relationship between reading comprehension and teacher-generated graphic organizers (GOs) as they support…

  20. Struggling Readers: Assessment and Instruction in Grades K-6. Solving Problems in the Teaching of Literacy.

    Science.gov (United States)

    Balajthy, Ernest; Lipa-Wade, Sally

    This book focuses on three distinct types of struggling readers that teachers will instantly recognize from their own classrooms--the "Catch-On Reader," the "Catch-Up Reader," and the "Stalled Reader." The book provides detailed case studies which bring to life the specific problems these students are likely to face…

  1. How Parental Support during Homework Contributes to Helpless Behaviors among Struggling Readers

    Science.gov (United States)

    Orkin, Melissa; May, Sidney; Wolf, Maryanne

    2017-01-01

    This research investigated the influence of parental practices on helpless behaviors of struggling readers during homework tasks. Parents (N = 36) of elementary students reported on their children's helpless behaviors, such as task avoidance and negative affect, during homework assignments, and on the nature and frequency of their support.…

  2. Treatment Effects for Adolescent Struggling Readers: An Application of Moderated Mediation

    Science.gov (United States)

    Roberts, Greg; Fletcher, Jack M.; Stuebing, Karla K.; Barth, Amy E.; Vaughn, Sharon

    2013-01-01

    This study used multigroup structural equations to evaluate the possibility that a theory-driven, evidence-based, yearlong reading program for sixth-grade struggling readers moderates the interrelationships among elements of the simple model of reading (i.e., listening comprehension, word reading, and reading comprehension; Hoover & Gough,…

  3. Enhancing Writing Achievement through a Digital Learning Environment: Case Studies of Three Struggling Adolescent Male Writers

    Science.gov (United States)

    Pruden, Manning; Kerkhoff, Shea N.; Spires, Hiller A.; Lester, James

    2017-01-01

    The aim of this study was to explore how "Narrative Theatre," a narrative-centered digital learning environment, supported the writing processes of 3 struggling adolescent male writers. We utilized a multicase study approach to capture 3 sixth-grade participants' experiences with the digital learning environment before, during, and after…

  4. Responses to Struggling, K-2 Readers and Writers: Early Literacy Intervention in Three Urban Schools

    Science.gov (United States)

    Mooney, Kathleen C.

    2009-01-01

    An abundance of research on early literacy intervention indicates that struggling, K-2 readers and writers can be effectively supported through the receipt of intervention services in school; however, research in the area has not yet addressed study of the unique, contextualized design and implementation of early literacy intervention in different…

  5. Struggles and Successes Implementing Classroom Communication Technology in a College Pre-Calculus Course

    Science.gov (United States)

    Case, Erin; Pape, Stephen

    2013-01-01

    This case study documents the struggles and successes encountered by a pre-calculus teacher while using Classroom Connectivity Technology (CCT) daily in her community college mathematics course. CCT refers to a wireless communication system that connects a teacher's computer with an individual student's handheld calculator and has been associated…

  6. Emotion and Cognition in Students Who Struggle to Read: New Insights and Ideas

    Science.gov (United States)

    Zambo, Debby; Brem, Sarah

    2004-01-01

    As educators, we need to change the way we think about cognition and emotion, especially for children who struggle to read. Emotion and cognition work in parallel in subtle and powerful ways. In this article, we explore the relationship between emotion and cognition in a group of children with reading disabilities in grades five through nine. We…

  7. Reflections on Structural Inequality, Struggle and the Meanings of Citizenship: A "zainichi" Korean Teacher Narrative

    Science.gov (United States)

    Osler, Audrey

    2018-01-01

    Teachers across the globe engage in day-to-day struggles for justice, often with support from unions and community-led groups. Teacher narratives reveal opportunities for building an inclusive theory and practice of education for social justice. I profile one teacher, a third generation "zainichi" Korean permanent resident in Japan,…

  8. Reproducing Vulnerability: A Bourdieuian Analysis of Readers Who Struggle in Neoliberal Times

    Science.gov (United States)

    Jaeger, Elizabeth L.

    2017-01-01

    The neoliberal agenda promotes education as a route toward success in university and career. However, a neoliberal economy requires large numbers of workers willing to accept low-paying, dead-end jobs. The students most likely to take these jobs are those who have struggled with literacy and so schools must, in Bourdieu's terms, re/produce,…

  9. The Struggles of Women Industrial Workers To Improve Work Conditions in the Progressive Era.

    Science.gov (United States)

    Barrett, Nancy J.

    1999-01-01

    Offers a lesson plan that addresses the working conditions endured by women in the Progressive Era and their struggles for womens rights in the workplace. Strives to demonstrate the similarities between the plights of the Progressive Era women to those of women workers in the 1990s. (CMK)

  10. Data literacy: what do educators learn and struggle with during a data use intervention?

    NARCIS (Netherlands)

    Kippers, Wilma Berdien; Poortman, Cindy Louise; Visscher, Arend J.; Schildkamp, Kim

    Data literacy is a prerequisite for making data-based decisions. This paper focuses on the extent to which educators develop components of data literacy during a 1-year data use intervention, as well as what they learn and struggle with concerning these data literacy components. In the data use

  11. Multidisciplinary Collaboration to Support Struggling Readers: Centering Culture in Concerns about Process and Outcomes

    Science.gov (United States)

    King Thorius, Kathleen A.; Simon, Marsha

    2014-01-01

    Our commentary responds to the five articles of the special issue on multidisciplinary collaboration to support struggling readers. From our perspectives informed by experiences working with diverse student and family populations in urban settings, preparing pre- and in-service educators and specialists to do the same, and working in federally…

  12. Land restitution during apartheid\\'s dying days: The struggle for ...

    African Journals Online (AJOL)

    Roosboom is just a speck on the map, but its people\\'s struggle for their land provides insight into the complex South African history of land dispossession, highlighting the suffering endured by black freehold communities during apartheid - and sometimes beyond. Africa Insight Vol.34(2/3) 2004: 48-57 ...

  13. The Role of African Intellectuals of South Africa in the Struggle for ...

    African Journals Online (AJOL)

    In this study, post-apartheid South Africa as a product of the incomplete process of the liberation struggle which trails many other African countries in terms of economic liberation and socioeconomic achievements, is the starting point. South Africa is still defined by the white factor, particularly on the economic front, and the ...

  14. BOOK REVIEW OF "CHESAPEAKE BAY BLUES: SCIENCE, POLITICS, AND THE STRUGGLE TO SAVE THE BAY"

    Science.gov (United States)

    This is a book review of "Chesapeake Bay Blues: Science, Politics, and the Struggle to Save the Bay". This book is very well written and provides an easily understandable description of the political challenges faced by those proposing new or more stringent environmental regulat...

  15. Early struggles and the creation of a self-sustaining entity

    African Journals Online (AJOL)

    Twenty environmental entrepreneurs answered the research question: What is their retrospective assessment of the early struggles and lived experiences leading to firm establishment as they engaged in the new venture creation process? This study determined that the experience of starting a new venture is distinct from ...

  16. Morpho-Phonemic Analysis Boosts Word Reading for Adult Struggling Readers

    Science.gov (United States)

    Gray, Susan H.; Ehri, Linnea C.; Locke, John L.

    2018-01-01

    A randomized control trial compared the effects of two kinds of vocabulary instruction on component reading skills of adult struggling readers. Participants seeking alternative high school diplomas received 8 h of scripted tutoring to learn forty academic vocabulary words embedded within a civics curriculum. They were matched for language…

  17. White Teachers/White Schools: Oral Histories from the Struggle against Apartheid.

    Science.gov (United States)

    Wieder, Alan

    2003-01-01

    Presents the oral histories of two white teachers who taught in white South African schools during apartheid. Both combined pedagogy and politics in their lives as teachers and joined other teachers in the struggle against apartheid. Describes the oral history project, apartheid and education, and oral history methodology. Both teachers spent…

  18. Grassroots scalar politics: Insights from peasant water struggles in the Ecuadorian and Peruvian Andes

    NARCIS (Netherlands)

    Hoogesteger van Dijk, J.D.; Verzijl, A.

    2015-01-01

    Based on insights from peasant and indigenous communities’ struggles for water in Andean Peru and Ecuador, in this article we argue that the defense of grassroots interests -and with it the advancement of more equitable governance- greatly hinges on the capacity of these groups to engage in

  19. The Internal Suicide Debate Hypothesis: Exploring the Life versus Death Struggle

    Science.gov (United States)

    Harris, Keith M.; McLean, John P.; Sheffield, Jeanie; Jobes, David

    2010-01-01

    Researchers and theorists (e.g., Shneidman, Stengel, Kovacs, and Beck) hypothesized that suicidal people engage in an internal debate, or struggle, over whether to live or die, but few studies have tested its tenability. This study introduces direct assessment of a suicidal debate, revealing new aspects of suicidal ideation. Results, from an…

  20. Mastering the struggle : gender, actors and agrarian change in a Mexican ejido

    NARCIS (Netherlands)

    Brunt, D.

    1992-01-01


    Actors and the Socio-Political and Symbolic Order

    In this thesis I have shown how women and men, all part of a small ejido in Western Mexico, are actively engaged in struggling to manage the social constraints and conditions they encounter. We have

  1. A Struggling School Receives an "F" That: Connecting Moral Luck and Educational Technology Will Build Hope

    Science.gov (United States)

    Thomas, Joy; Brevetti, Melissa

    2017-01-01

    With the recent publication of "Our Kids: The American Dream in Crisis," Robert Putnam, renowned social scientist, exposed the new class divide as an urgent issue, based upon new quantitative and qualitative data (2015). Research shows that students from struggling backgrounds have little likelihood of graduating from colleges and…

  2. Forty Years of Struggle and Still No Right to Inuit Education in Nunavut

    Science.gov (United States)

    Rasmussen, Derek

    2011-01-01

    In this article issues related to policy and education in the Canadian Arctic are critically put to question. The focus is on the struggle for Inuit education, language issues, and supporting minority rights, with pragmatic solutions proposed to the problems confronting Nunavut.

  3. The Paradigmatic Struggle for Legitimacy of the Danish Welfare State regarding the Provision of Welfare Services

    DEFF Research Database (Denmark)

    Pedersen, John Storm; Nielsen, Anna Lyneborg; Rendtorff, Jacob Dahl

    2014-01-01

    The Danish welfare state constitutes a paradigmatic case of the welfare struggle of modern welfare states. Taking care of vulnerable children and youths is used as a case study here, to illustrate the efforts of the welfare state to acquire legitimacy as a body of public administration. That is, ...

  4. Self-Determined Learning to Motivate Struggling Learners in Reading and Writing

    Science.gov (United States)

    Wehmeyer, Michael L.; Shogren, Karrie A.; Toste, Jessica R.; Mahal, Stephanie

    2017-01-01

    Promoting self-determined learning through student-directed learning strategies has been documented to promote more positive school-related outcomes for upper elementary grade learners with disabilities and other students who are struggling. These strategies are typically introduced in multicomponent interventions combining several…

  5. Teachers' Experiences Providing One-on-One Instruction to Struggling Readers

    Science.gov (United States)

    Liebfreund, Meghan D.; Amendum, Steven J.

    2017-01-01

    This study examined the experiences of 12 kindergarten, first-, and second-grade classroom teachers who provided one-on-one intervention instruction for struggling readers within the general classroom context. Teachers were interviewed at the end of the project. Interview statements clustered into four themes: Managing One-on-One Intervention,…

  6. Voluntary participation, state involvement: Indonesian propaganda in the struggle for maintaining independence, 1945-1949

    NARCIS (Netherlands)

    Zara, M.Y.

    2016-01-01

    After the Japanese occupation (1942-1945), the Indonesian archipelago experienced an unprecedented struggle: the Dutch-Indonesian conflict of 1945-1949, also known as the Indonesian Revolution, or the Indonesian War of Independence. This study examines how the leadership of the Republic of Indonesia

  7. Searching for ski-lift injury: an uphill struggle?

    Science.gov (United States)

    Smartt, Pam; Chalmers, David

    2010-03-01

    Injuries arising from ski-lift malfunction are rare. Most arise from skier error when embarking or disembarking, or from improper lift operation. A search of the literature failed to uncover any studies focusing specifically on ski-lift injuries. The purpose of this study was to identify and characterise ski-lift injury resulting in hospitalisation and comment on barriers to reporting and reporting omissions. New Zealand hospitalised injury discharges 2000-2005 formed the primary dataset. To aid case identification these data were linked to ACC compensated claims for the same period and the data searched for all hospitalised cases of injury arising from ski-lifts. 44 cases were identified representing 2% of snow-skiing/snowboarding cases. 28 cases (64%) were male and 16 (36%) female, the average age was 32 yrs (range 5-73 yrs). The majority of cases were snow-skiers (35 cases, 80%). Most of the injuries were serious, or potentially so, with 1 case of traumatic pneumothorax, one of pulmonary embolism (after jumping from a ski-lift) and 28 cases sustaining fractures (six to the neck-of-femur, one to the lumbar spine and one to the pubis). ICISS scores for all cases ranged from 1.00 to 0.8182 (probability of dying in hospital 0-18.18%). Only 14 (32%) cases could be easily identified from ICD-10-AM e-codes and activity codes in the discharge summary. The ICD-10-AM external cause code for ski-lift injury V98 ("other specified transport accidents") was only assigned to 39% of cases. The type of ski-lift could only be determined in 24 cases (55%). Copyright 2009 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  8. Complexities of coalition building: leaders' successes, strategies, struggles, and solutions.

    Science.gov (United States)

    Mizrahi, T; Rosenthal, B B

    2001-01-01

    Government and private funding initiatives are promoting coalitions, collaborations, and other interorganizational approaches to address complex community, social services, and health issues. Social work organizers and administrators are increasingly leading coalitions themselves or representing their organizations in collaborative planning and problem solving, often without understanding how to manage the complexities involved in interorganizational relationships. This article reports on aspects of a larger quantitative and qualitative research project that studied coalition dynamics, operations, and outcomes. Coalition leaders interviewed defined success in multiple ways. Competent leadership was the factor most often identified with coalition success.

  9. Moral Legitimacy: The Struggle Of Homeopathy in the NHS.

    Science.gov (United States)

    Crawford, Louise

    2016-02-01

    This article deploys a well-established theoretical model from the accountability literature to the domain of bioethics. Specifically, homeopathy is identified as a controversial industry and the strategic action of advocates to secure moral legitimacy and attract public funding is explored. The Glasgow Homeopathic Hospital (GHH) is used as the location to examine legitimizing strategies, from gaining legitimacy as a National Health Service (NHS) hospital in 1948, followed by maintaining and repairing legitimacy in response to government enquires in 2000 and 2010. An analysis of legitimizing strategies leads to the conclusion that advocates have been unsuccessful in maintaining and repairing moral legitimacy for homeopathy, thus threatening continued public funding for this unscientific medical modality. This is an encouraging development towards open and transparent NHS accountability for targeting limited public resources in pursuit of maximizing society's health and well-being. Policy implications and areas for future research are suggested. © 2016 John Wiley & Sons Ltd.

  10. The Struggle for the Soul of Public Health.

    Science.gov (United States)

    Wiley, Lindsay F

    2016-12-01

    Prevention has become a central focus for health care payers, providers, policy makers, and the general public. Given the centrality of prevention to public health science, practice, and law, it would seem that conditions are ripe for the public health law renaissance to expand beyond legal and scientific circles to permeate the general consciousness. Yet, public health law and policy interventions continue to face considerable political and legal opposition. The population perspective-which emphasizes the social determinants of health, collective action to create healthier communities, and communitarian rationales for prioritizing health-is as important to public health problem-solving as the prevention orientation. But it conflicts with the individualistic orientation that dominates American legal, cultural, and social discourse. This article suggests that public health law and policy debates offer important opportunities for public health advocates to reach across silos to promote the population perspective that unites the field. The article explores contrasting explanations for disease, injury, premature death, and health disparities offered by the population perspective and the individualistic orientation; political and cultural barriers that stand in the way of innovative law and policy interventions; and normative tensions between the communitarian population perspective and self-interested rationales for investment in prevention. Copyright © 2016 by Duke University Press.

  11. Governing climate : the struggle for a global framework beyond Kyoto

    International Nuclear Information System (INIS)

    Sugiyama, T.; Hasselknippe, H.; Tangen, K.; Michaelowa, A.; Pan, J.; Sinton, J.

    2005-01-01

    This book presented the results of a 2 year research project which developed post-2012 climate regime scenarios. The aim of the project was to contribute to decision-making and dialogue between policy-makers and stakeholders. A range of scenarios for a post-2012 framework were developed which illustrated the many possible futures under which the global climate regime may evolve. Scenarios include the strengthening of a binding-cap approach; a bottom-up evolution of emission markets on a global scale; a regime consisting of multiple treaties among like-minded countries and a binding-cap regime with an emphasis on equity. Papers in this book explored key building blocks of a future climate regime, and presented ideas on how to broaden the current cap-and-trade regime. The roles and importance of technology were explored. Lessons from past successes were reviewed with the aim of developing options for their most effective use in the near future. The issue of financial flows to developing countries was addressed, including the issue of mainstreaming assistance for climate-change response. It was suggested that European countries will be key players in initial negotiations in the post-2012 regime, and that the current framework favours Europe while making it difficult for the United States, Japan and Canada to make ambitious commitments. It was concluded that a careful analysis of all the alternative paths available for international climate policies is needed. refs., tabs., figs

  12. The struggle for safe nuclear expansion in China

    International Nuclear Information System (INIS)

    Xu, Y.C.

    2014-01-01

    After a temporary halt following the Fukushima nuclear disaster in March 2011, China resumed its fast, yet cautious, expansion of nuclear energy programme. Nuclear energy is considered as part of the general strategy to deal with the challenges of energy security and climate change and to advance with ‘state of the art’ technology in its development. This article briefly discusses recent development in and driving forces behind nuclear industry in China, and several challenges it has been facing: how to adopt, adapt, standardise and indigenise whose technologies, and how to address the shortage of qualified nuclear engineers, scientists, skilled labour force and qualified regulators. More importantly, it argues that safe and secure nuclear development requires consistent policies and effective regulations. Therefore, it is crucial to build policy and regulatory capacities based on coordination, planning and management of government agencies and the industry. - Highlights: • Nuclear energy development in China. • Nuclear technology selection. • Human capital. • Regulatory regime. • Safe and secure development

  13. Augmented Reality Reading Support in Higher Education: Exploring Effects on Perceived Motivation and Confidence in Comprehension for Struggling Readers in Higher Education

    Science.gov (United States)

    Huisinga, Laura Anne

    2017-01-01

    Technology has shown promise to aid struggling readers in higher education, particularly through new and emerging technologies. Augmented reality (AR) has been used successfully in the classroom to motivate and engage struggling learners, yet little research exists on how augmented print might help struggling readers. This study explores this gap,…

  14. Slowing the Titanic: China's Epic Struggle with Tobacco.

    Science.gov (United States)

    Stone, Emily C A; Zhou, Caicun

    2016-12-01

    China is home to a third of the world's smokers and, correspondingly, to a third of the world's cases of lung cancer. Beginning in the mid-1990s, a generation or so later than in many Western countries, the Chinese government commenced measures to control tobacco, limiting advertising, banning smoking in many public venues, and increasing taxation. At the time of this review, there are signs that these policies are having some effect, but hundreds of millions of Chinese continue to smoke and rates of diagnosis of lung cancer continue to rise. There is much work to be done and much premature death to be suffered before the epidemic is slowed to the levels reached in Australia or the United States. This article aims to provide, particularly for practicing lung cancer clinicians, a description of patterns of smoking in China, the lung cancer epidemic there, and the stimuli for and barriers to tobacco control imposed by the highly complex and unique regulatory setting of the Chinese tobacco industry. A particular challenge in developing this description has come from the variability of studies published about a huge nation that has enormous diversity in wealth, education, urbanization, and tradition. The studies vary because the data vary. Much information on lung cancer and smoking rates in China comes, for example, from studies of cohorts that may number in the millions yet represent only a small percentage of the population and sometimes only a tiny geographic area of such a vast nation. National registry data on lung cancer in China do not yet cover even a fifth of the national population. Even so, we argue that several major trends can be identified: (1) more than 50% of men smoke regularly; (2) there are more than 300 million smokers in China; (3) almost half a million new cases of lung cancer are diagnosed in China each year; (4) secondhand smoking is a significant problem in China (as elsewhere), accounting for a high proportion of lung cancer cases among

  15. A legacy of struggle: the OSHA ergonomics standard and beyond, Part I.

    Science.gov (United States)

    Delp, Linda; Mojtahedi, Zahra; Sheikh, Hina; Lemus, Jackie

    2014-11-01

    In November 2000, the Occupational Safety and Health Administration (OSHA) issued an ergonomics standard to prevent debilitating work-related musculoskeletal disorders (WMSDs). It was rescinded by Congress within four months. We explore how this story unfolded over two decades of collaboration and conflict. Part I provides an overview of the historical context of the struggle for a standard, followed by interviews with key players from labor, academia and government. They provide a snapshot of the standard; discuss the prevalence of WMSDs in the context of changing work organization; give insight into the role of unions and of scientific debate within the context of rulemaking; and uncover the basis for the groundbreaking OSHA citations that laid the foundation for a standard. Part II interviews further explore the anti-regulatory political landscape of the 1990s that led to repeal of the standard, discuss the impact of the struggle beyond the standard, and describe creative approaches for the future.

  16. Struggling Authorial Identity of Second Language University Academic Writers in Mexico

    Directory of Open Access Journals (Sweden)

    Troy Crawford

    2016-01-01

    Full Text Available This paper explores the different factors that appear to affect the on-going construction of second language authorial identity in a professional academic environment in Mexico. Through narrative research methodology from a qualitative paradigm, the everyday struggles of two university professors to maintain their professional status in second language writing are explored. The areas of study for these two are chemistry and penal law. With data the learning processes of entering into a community of second language writers are studied as well as the problems they faced and how they resolved them. Finally, the process of negotiating an authorial identity in a second language seems to be a constant underlying struggle composed of a variety of psychological factors.

  17. URBAN STRUGGLES IN CURITIBA METROPOLIS: POPULAR HOUSING, LAND OCCUPATIONS AND RESISTANCE

    Directory of Open Access Journals (Sweden)

    Danilo Volochko

    2016-07-01

    Full Text Available The forms of exploitation and expropriation in the city imply the emergence of land and buildings occupations in peripheral and central areas. In Curitiba, slums, neighborhoods without infrastructure, popular housing, vacant land sites and buildings make part of multiple processes and temporalities that emerge of the city which is mythically taken as urban planning model. The research seeks to analyze organized land occupations in order to understand its links with the reproduction of the metropolis, revealing the scale of the place, of everyday life, of sociability in these occupations, their socio-political organization strategies and resistance, revealing urban struggles as an amalgam between local particularities and global processes, placing the debate in the realization of the right to the city. Key-words: urban struggles, production of space, land occupations, spatial justice.

  18. Mastering the struggle : gender, actors and agrarian change in a Mexican ejido

    OpenAIRE

    Brunt, D.

    1992-01-01


    Actors and the Socio-Political and Symbolic Order

    In this thesis I have shown how women and men, all part of a small ejido in Western Mexico, are actively engaged in struggling to manage the social constraints and conditions they encounter. We have seen that coping with the process of agricultural change and the incorporation of the village and farm enterprise into the wider economic, political and institutional environment requires new skills a...

  19. Apple, Foxconn, and Chinese workers' struggles from a global labor perspective

    OpenAIRE

    Pun, Ngai; Shen, Yuan; Guo, Yuhua; Lu, Huilin; Chan, Jenny; Selden, Mark

    2016-01-01

    To enrich the discussion of global labor, between 2010 and 2016, we studied Apple's value chain, Foxconn's mode of labor control, and Chinese workers' struggles. Through our fieldwork in China we also examined Apple's and Foxconn's responses to the spate of worker suicides, workers' resistance, the activism of scholar and student groups, and transnational justice campaigns. We conclude with reflection on global labor studies in light of the debates between Karl Polanyi's counter movement and ...

  20. Democracy and the Struggle for Political Empowerment of Women in Nigeria

    OpenAIRE

    Nelson, E. E.

    2012-01-01

    This paper discusses women's participation in politics and governance in Nigeria, in order to unravel the dynamics and factors that limit their visibility in the political system. Women's participation in politics in Nigeria has remained a contentious issue, despite many decades of struggle to improve their lot politically. Following an analysis of the ways in which gender relations shapes the lives of Nigerian women, and an extensive review of the trajectories of women's political participat...

  1. Morpho-phonemic analysis boosts word reading for adult struggling readers

    OpenAIRE

    Gray, Susan H.; Ehri, Linnea C.; Locke, John L.

    2017-01-01

    A randomized control trial compared the effects of two kinds of vocabulary instruction on component reading skills of adult struggling readers. Participants seeking alternative high school diplomas received 8 h of scripted tutoring to learn forty academic vocabulary words embedded within a civics curriculum. They were matched for language background and reading levels, then randomly assigned to either morpho-phonemic analysis teaching word origins, morpheme and syllable structures, or traditi...

  2. Developing Mathematical Knowledge Through Class Discussion: One Teacher's Struggles in Implementing Reform

    OpenAIRE

    Nelson, Rebecca S.

    1997-01-01

    The purpose of this case study was to examine the experience of one secondary mathematics teacher during his efforts to facilitate mathematical discussions in a secondary algebra class. Class discussions and interviews were documented and analyzed to investigate the patterns of discussion, the teacher's role in facilitating discussion, and the struggles encountered by the teacher through his attempts to enact reform-oriented strategies. The investigation focused on the teacher's vision for ...

  3. The roots of violence: converging psychoanalytic explanatory models for power struggles and violence in schools.

    Science.gov (United States)

    Twemlow, S W

    2000-10-01

    This paper demonstrates that several psychoanalytic models taken together converge to collectively explain school violence and power struggles better than each does alone. Using my own experience in doing psychoanalytically informed community intervention, I approach the problem of school violence from a combination of Adlerian, Stollerian, dialectical social systems, and Klein-Bion perspectives. This integrated model is then applied to the Columbine High School massacre in Littleton, Colorado.

  4. Make me authentic, but not here: Reflexive struggles with academic identity and authentic leadership

    OpenAIRE

    Tomkins, Leah; Nicholds, Alyson

    2017-01-01

    This article presents a reflexive auto-ethnography of the experience of teaching authentic leadership to MBA students. It traces parallels between the challenges of authentic leadership and the challenges of academic identity work, grounded specifically in the experience of having to teach something one does not fully endorse. Both authentic leadership and academic identity work emerge as struggle – riddled with false starts, best intentions and self-deception, and entwined in the politics of...

  5. Anti-urbanism in Flanders: the political and social consequences of a spatial class struggle strategy

    OpenAIRE

    Kesteloot, Christian; De Maesschalck, Filip

    2016-01-01

    Class struggle resulted in a anti-urban feeling in Flanders. The industrial revolution first developed in Wallonia and industrialisation came much later in Flanders. The bourgeoisie and the Church could anticipate rising secularisation and socialism in Flanders by keeping the workers away from the cities through specific housing and mobility policies. This explains the traditional Christian political hegemony in Flanders, with socialist and liberal cracks mainly in the cities. In the second p...

  6. Policy in Conflict: The Struggle Between Environmental Policy and Homeland Security Goals

    Science.gov (United States)

    2013-09-01

    environmental and energy 34 policy (Murkowski, 2010). However, a good set of literature on the broader, macro level question central to this investigation...terms of increasing efficiency of the automotive fleet (demand side), certain environmental policies have the unintended consequence of restricting the...Middle East  Broader aspects of the struggle between environmental policy and energy policy  A broad analysis of ways to diminish animus toward the

  7. Engaging in the Struggle for Economic Justice in the Streets of the City of Tshwane

    Directory of Open Access Journals (Sweden)

    Methula, Dumisane W.

    2014-12-01

    Full Text Available The Meal of Peace Project is a transformative encounter that represents a theoretical break with neo-liberal missiological discourses and seeks to liberate the Bible from ivory tower hegemonic paradigms. This is done through Bible studies with the homeless from the City of Tshwane, engaging in the struggle for economic justice in the hills and valleys of Tshwane. In the past 20 years the major characteristic of the democratic dispensation in South Africa, since the inauguration of majority rule in 1994, has been the intensification of the countrys socio-economic problems of poverty, unemployment and inequality. The struggle for economic justice is the new struggle for the prophetic church and liberation theologies in the current constitutional democratic juncture in post-apartheid South Africa. The need arises for exploring ethical alternatives to achieve economic injustice. This articles critical reflection on the socio-economic situation will be carried out through the Bible study session at TLF, where we looked at the message of Amos 5:22-24.

  8. POSITIONINGS AND IDENTITY NARRATIVES IN THE STRUGGLE FOR “EMEK MOVIE THEATER”

    Directory of Open Access Journals (Sweden)

    Idil ATABINEN

    2015-06-01

    Full Text Available Places hold a crucial role in constructing one’s identity. Just like interacting with other humans, individuals also interact with places and that interaction happens to be mutual. Positioning others and oneself based on the place is just as possible as relating identities to a place. Defenses of places shine a light on the political aspect of place attachment; discursive analysis of place defense is thus very substantial. In this study, the narratives of actors who are part of the resistance against the renewal project of Emek Movie Theater are analyzed based on representations of struggle, different positioning of individuals and identities attached to the cinema. After conducting a narrative analysis through the lens of critical discursive psychology, it is realized that the speaker positions herself, others and the place based on the desired representation of struggle. It is observed that representations of the struggle range from personal narratives to narratives that are inclusive of the collective and an ideological rhetoric. In conclusion, among all the legitimization tactics for resistance, narratives that are inclusive of ideological rhetoric are the ones that are most caring for representation.

  9. Tamgha and the Struggle against It: On the History of Medieval Turkic-mongol Taxation System

    Directory of Open Access Journals (Sweden)

    R.Yu. Pochekaev

    2014-12-01

    Full Text Available The paper deals with the Turkic-Mongol taxation institute of tamgha widely used in the Mongol Empire since the first half of the 13th century. Author characterizes the etymology of this term, its meanings, legal regulation of levy and rates, evolution of the tax in different states – successors of the Mongol Empire (the Golden Horde, Ilkhanate, etc. as well as in these states even after fall of Chinggisid dynasties (such as Iran under Safavids, Central Asia under Timurids. As the author supposes, the long-term use of tamgha allows us to talk about the vitality and effectiveness of Chinggisid legal tradition, which survived after the end of “Chinggisid age”. Even the rulers and dynasties, which positioned themselves as rivals of Chinggisids, used tamgha in their taxation system. This tax was also borrowed by the Russians and was used for a long time becoming a base for custom system in Russia. Other subjects of the research are the struggle of Islamic theologians and jurists against tamgha in different countries of Inner Asia and reasons for this struggle. The author attempts to clarify reasons of this struggle, strict position of clergy against tamgha and measures of rulers who did not want to be in trouble with clergy, but at the same time tried to save tamgha as effective and profitable tax.

  10. A STRUGGLE FOR LOVE OF BELLA SWAN REFLECTED IN NEW MOON MOVIE: AN INDIVIDUAL PSYCHOLOGICAL APPROACH

    Directory of Open Access Journals (Sweden)

    Ayu Riska Lestari

    2012-12-01

    Full Text Available This paper described the struggle for love of Bella Swan reflected in New Moon movie by using Alfred Adler’s individual psychology and analyzed the plot of the movie. It used qualitative research method and the object of this study was a major character named Bella Swan. Primary data sources were the New Moon movie directed by Christopher Weitz and the script of the movie, while secondary data sources were collected from many sources such as dictionary, articles from internet, and books related to this study. Methods of data collecting were observation and library research. The method of data analysis was descriptive analysis. Based on the analysis, It reflected the condition of a person who had a goal and struggle to get it. It concluded that Bella had high struggles to reach her goals. The plot of New Moon movie is complicated and stimulating, therefore it made the story was not flat and boring. By analyzing the plot, the viewers could easily understand the story and the message of the movie and catch up the moral lesson of it.

  11. Karl Ove Knausgård’s My Struggle and the Serial Self

    Directory of Open Access Journals (Sweden)

    Inge van de Ven

    2016-06-01

    Full Text Available This article analyzes Karl Ove Knausgård’s six-volume autobiography My Struggle in the frame of an emerging cross-medial aesthetics of the ‘serial self’. This aesthetics is informed by the technological potentialities of digital media, and by social media practices like taking a selfie or posting a blog every single day and accumulating these self-representations, without selection. The serial self is marked by continuity, real-time effects, open-endedness, rhythm, repetition, and a thematic attention to the mundane. It can be discerned in the daily comic strip, the daily selfie, and time-lapse cinema. The article embeds My Struggle in this larger, intermedial framework. Moreover, it refers to the work of psychologist Galen Strawson to argue that the self-representations in Knausgård’s work should be understood as episodic rather than diachronic in nature. This results in a sequential and paratactic, rather than causal and hierarchical, presentation of memorial material. It is claimed that serial self-representations of this type are increasingly central to our current media ecology. They offer a valuable medium for investigating, materializing, and mapping on the page the traces left by the passage of time, as serialization lends itself to performative and cumulative representations of a ‘self’ in flux, that dramatize and perform the struggles of the episodic personality in search for continuity.

  12. Social Movement of Mandar People as a Struggle in Processof Forming West Sulawesi Province

    Directory of Open Access Journals (Sweden)

    Gustiana A.Kambo

    2014-02-01

    Full Text Available This paper examines the dynamics of ethnicity in South Sulawesi. Mandar is a tribe (ethnic that lives in the area. This region consists of three regencies (before expansion which challenged from Mandar kingdoms, ethnic try again confirmed its glory by extending political rights to form an autonomous region through the establishment of a new province in South Sulawesi. This paper focuses on problem, how is the struggle order of forming new province in the former Mandar section and why does formation movement appear in the former Mandar section. By using descriptive qualitative approach which determines informant chosen focus on what is suggested by Patton (1994 where determining informant by using purposive way. The conceptual framework used from Fakih (2000; Nordliger (1994; Suzane Keller (1984; and Ryass Rasyid (2000.the finding of the research describes that struggle movement of forming new province in the former Mandar section is a form of social movement to the positive phenomenon as a constructive means to social struggle where this movement is coordinated by an institution as a historical flame product refers to a number of activities to ease the movement pioneered by intellectual and traditional elite.

  13. Social outcomes due to the interplay between language competition and ideology struggle

    Science.gov (United States)

    Barreira da Silva Rocha, André

    2018-02-01

    I study the interplay between language competition and ideology struggle in a country where there are two competing languages. Language transition is governed by a three-state model similar to Minett-Wang (2008) and Heinsalu et al. (2014). In this class of models, I further assume that among monolinguals of one of the competing languages there is an ideology struggle between assimilationist individuals who accept to deal with foreign language speakers and nationalist individuals who oppose any form of foreign culture. Ideology transition follows a two-state model as in Abrams-Strogatz (2003). Depending on both ideology and language status, the possible equilibria show that when nationalism is introduced in the language competition model, complete assimilation might take place and one language disappears with the entire population becoming monolingual. On the other hand, when bilingualism emerges, it is associated with a segregated society with a bilingual group surviving in the long run together with an isolated monolingual group entirely composed of nationalist individuals. Another kind of segregation might also emerge in the equilibrium, in which two monolingual groups survive in the long run, one of them entirely composed of nationalists. In the latter case, both linguistic segregation and isolation are the negative social outcomes of ideology struggle.

  14. Identifying Students with Mental Health Issues: A Guide for Classroom Teachers

    Science.gov (United States)

    Marsh, Robbie J.

    2016-01-01

    Child and adolescent mental health is a growing concern in schools. Students suffering from mental health conditions struggle in the school environment if their needs are not being met. Teachers play an important role in the identification of these students. This article highlights the distinctions between externalizing and internalizing behaviors…

  15. Successful importation of cytarabine into the United States during a critical national drug shortage.

    Science.gov (United States)

    Hunnisett-Dritz, Dee

    2012-08-15

    The importation of cytarabine into the United States during a critical national drug shortage is described. In March 2011, the hospital pharmacy team at an acute care hospital was struggling to supply cytarabine for four specific patients, all of whom needed critical maintenance therapy after induction. Cytarabine was not available from any source in the United States, and the team had no realistic projected release dates for back orders. Idis UK, a pharmaceutical distributor, was asked to identify available drug and eventually found an unrestricted source of cytarabine in Switzerland. Once available drug was identified, a price quote for the supply amount was written for our consideration. This was inspected carefully to ensure that the drug, strength, dosage form, and any other ingredients listed were indeed what were expected. The pharmacy department worked with the hospital's department of finance and accounting to submit the necessary financial paperwork. Payment was electronically sent to the distributor before the drug was shipped. Before the order for cytarabine was placed, the associated risks and benefits were assessed. The patients provided consent to treatment with the unapproved product. Acceptance of the price quote and instructions to order the drug were e-mailed to the distributor. The necessary documentation was completed and included with the shipment. The importation process, from initial inquiries to delivery, took 21 days. The importation of cytarabine amid a drug shortage required a complex process that involved the efforts of an overseas distributor, the cooperation of multiple health professionals, and meticulous attention to detail.

  16. Hospital-physician relations: the relative importance of economic, relational and professional attributes to organizational attractiveness

    OpenAIRE

    Trybou, Jeroen; Gemmel, Paul; Van Vaerenbergh, Yves; Annemans, Lieven

    2014-01-01

    Background: Belgian hospitals face a growing shortage of physicians and increasingly competitive market conditions. In this challenging environment hospitals are struggling to build effective hospital-physician relationships which are considered to be a critical determinant of organizational success. Methods: Employed physicians of a University hospital were surveyed. Organizational attributes were identified through the literature and two focus groups. Variables were measured using valida...

  17. The Struggle of Annisa Against Patriarchal Culture in Nover “Perempuan Berkalung Sorban” by Abidah Khalieqy

    OpenAIRE

    Astuti, Aryanti Dwi

    2015-01-01

    As seen in title, this thesis discusses about the struggle of the woman in patriarchal culture. This novel was published in 2001. The main character of this novel struggle her rights because she think that patriarchal culture seizes her right and freedom. The main character of this novel adopts the ideas of feminism. The method which is used in this in this analysis is libarary research with documentary technique and descriptive method. The theories which are used in this analysis are the ...

  18. Silent Struggles

    DEFF Research Database (Denmark)

    Girschik, Verena; Boxenbaum, Eva

    when overt contestation is not a viable option – for example when they must dampen conflict to foster collaboration. This paper presents a case study of a Danish pharmaceutical company that overcame framing contexts, gained local stakeholders’ support and became the orchestrator of collaborative...... arrangements aimed at improving diabetes care in Indonesia. Inductively following the framing process in real-time, the paper presents a model that explicates three moves through which frame alignment was constructed: interactively reconstructing the field, manufacturing a common understanding of actions...

  19. Power struggle

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    The state of the electricity supply industry in Romania is described. In early 1990, domestic lighting is restricted and street lights are dim. However, Romania has a deal with Canada for the supply of a CANDU plant with five reactors which will supply 25000 MW by the next decade. Under the Ceausescu regime, Romanian engineers were forced to accept a dangerously tight official construction of the reactors. However the Canadians were able to maintain proper standards despite the dictator's interference. Now, reorganisation is possible, people are putting more effort into their work and incentives can be used to get the skilled workers needed on the construction site. (UK)

  20. Between the Managerial and the Democratic University: Governance Structure and Academic Freedom as Sites of Political Struggle

    Directory of Open Access Journals (Sweden)

    Dalie Giroux

    2016-03-01

    Full Text Available In this article we argue that the university cannot fully contribute to democratic life without being both an institution whose governance is collegial and based on principles of equality, equity, inclusion, transparency, and accountability, and a vector of critical thinking closely linked to academic freedom. Based on this understanding of the ‘democratic university,’ we seek to highlight some of the key tensions between the ‘managerial university’ and the democratic university, as reflected in institutional structures, regulations, legal frameworks, and principles. In order to achieve this objective, we identify two sites of political struggles from which it is possible to examine the interaction between a managerial and a democratic conception and practice of the university. The first of these sites is the bicameral governing structure, membership, rules, and regulations of the University of Ottawa. The second site is academic freedom in Canada, which we will discuss by comparing the Canadian Association of University Teachers’ (CAUT Statement on Academic Freedom (CAUT, 2011 with the Association of Universities and Colleges of Canada’s (AUCC Statement on Academic Freedom (AUCC, 2011. By stressing the necessary link and positive relationship between democratic governance and academic freedom, the article offers a normative evaluation of the impact the managerial reengineering of Canadian universities has had on the possibility and practice of a more democratic university.

  1. [Struggling for normal in an instable situation - informal caregivers self-management in palliative home care. A meta-synthesis].

    Science.gov (United States)

    Kreyer, Christiane; Pleschberger, Sabine

    2014-10-01

    Family caregivers play a key role in palliative home care for persons with advanced cancer. Although research has shown numerous burdens and strains of family caregiving, there is a lack of family-oriented support strategies in palliative home care. Little is known about family caregivers' self-management in this context so far. Qualitative research provides insight into families' perspectives of the transition to and management of palliative care at home and can be used as a starting point. The aim of the study was to increase knowledge of family caregivers' self-management in palliative home care by synthesizing evidence from qualitative research. Based on a systematic review of literature a meta-synthesis was conducted following the approach of Noblit and Hare (1988). A total of 13 qualitative studies from six countries, published from 2002 onward, formed the basis for an interpretative synthesis. Caring for a person with advanced cancer at the end of life at home is characterized by an instable transition process in which families are 'struggling for normal'. Six different family self-management strategies to deal with this were identified: acknowledging the transition, restructuring everyday life, maintaining balance in family relationships, taking responsibility for care, using social support, and acquiring caring-skills. Self-management strategies may provide a key for supporting family caregivers in palliative home care by focusing on resources and problem solving skills of families.

  2. Struggling readers learning with graphic-rich digital science text: Effects of a Highlight & Animate Feature and Manipulable Graphics

    Science.gov (United States)

    Defrance, Nancy L.

    Technology offers promise of 'leveling the playing field' for struggling readers. That is, instructional support features within digital texts may enable all readers to learn. This quasi-experimental study examined the effects on learning of two support features, which offered unique opportunities to interact with text. The Highlight & Animate Feature highlighted an important idea in prose, while simultaneously animating its representation in an adjacent graphic. It invited readers to integrate ideas depicted in graphics and prose, using each one to interpret the other. The Manipulable Graphics had parts that the reader could operate to discover relationships among phenomena. It invited readers to test or refine the ideas that they brought to, or gleaned from, the text. Use of these support features was compulsory. Twenty fifth grade struggling readers read a graphic-rich digital science text in a clinical interview setting, under one of two conditions: using either the Highlight & Animate Feature or the Manipulable Graphics. Participants in both conditions made statistically significant gains on a multiple choice measure of knowledge of the topic of the text. While there were no significant differences by condition in the amount of knowledge gained; there were significant differences in the quality of knowledge expressed. Transcripts revealed that understandings about light and vision, expressed by those who used the Highlight & Animate Feature, were more often conceptually and linguistically 'complete.' That is, their understandings included both a description of phenomena as well as an explanation of underlying scientific principles, which participants articulated using the vocabulary of the text. This finding may be attributed to the multiple opportunities to integrate graphics (depicting the behavior of phenomena) and prose (providing the scientific explanation of that phenomena), which characterized the Highlight & Animate Condition. Those who used the

  3. The struggle for women's rights is an unfinished business. Ms. Patricia M. Sarenas, M.P. Men's support for women's empowerment essential. -- Ms. Rechin Narangerel, M.P.

    Science.gov (United States)

    1999-01-01

    Ms. Patricia M. Sarenas and Ms. Rechin Narangerel, representative from the Philippines and Mongolia respectively, addressed the issue of women's right during the 6th General Assembly of Asian Forum of Parliamentarians on Population and development. According to Ms. Sarenas, the struggle for women's rights and gender equity, peace and development was an unfinished business. She stressed that women parliamentarians had a bigger role to play in defying condescension, criticize patronizing attitudes, assert women's issues and voice women's concerns, and insist on more meaningful participation of women at all levels. They must also stand unafraid to denounce loud and clear, violations of human rights, especially in Asia. Ms. Sarenas's greatest hope was that parliamentarians would continue to explore the different experiences and perspectives within the solidarity of their shared struggles in Asia as a group of people who were in a position to do something for women and men everywhere. On the other hand, Ms. Narangerel noted that Mongolia had always had a tradition of respect for women's status and conditions as manifested by the relatively high rates of literacy, access to health services and employment opportunities. Women's NGO were very active in sensitizing high-level government officials on the need to establish mechanisms to accelerate women's equal participation and equitable representation at all levels of the political process and public life. On her last note, she made mention of the importance of men's support for women's empowerment.

  4. Struggling for sense of control: everyday life with chronic pain for women of the Iraqi diaspora in Sweden.

    Science.gov (United States)

    Zander, Viktoria; Müllersdorf, Maria; Christensson, Kyllike; Eriksson, Henrik

    2013-12-01

    As dispersed ethnic populations in Swedish society expand, the healthcare system need to adapt rehabilitation services according to their needs. The experiences of trauma and forced resettlement have a continuing impact on health and musculoskeletal pain, as well as the intersecting structures that prerequisite the possibilities in the new country. To understand the specific needs of women from the Iraqi diaspora in Sweden, there is a need to elucidate the effects of pain on their everyday life. To elucidate everyday life with chronic pain from the perspective of women from the Iraqi diaspora in Sweden. Qualitative interview study according to Glaser's grounded theory. The results from 11 interviews suggest that pain was associated with dependency on society as well as on family. It resulted in a struggle for sense of control, framed by faith in God, influenced by the healthcare system, and with support from family. The women's testimony of lack of continuity of care, resulting in recollection of lived traumas in every visit, is a vital sign of the unconscious power relations within health care and how representatives from health care, instead of being the ones who help the women forward, become the ones who hold them back. The results show the importance of challenging the normative assumptions embedded in health care and treatment for patients with chronic pain and of including the voice of "others".

  5. From vulnerability to the 'weak power'. The political and diplomatic action of Bangladesh in the struggle against climate change

    International Nuclear Information System (INIS)

    Baillat, Alice

    2017-07-01

    As Bangladesh has been awarded by the UNEP (United Nations Environment Programme) for its leadership in the struggle against climate change, the author, while discussing the actions undertaken by this country, presents the concept of 'weak power' which is the ability of a weak actor to transform his vulnerability into a lever for public action, and into a comparative asset to influence the process and international negotiations. The author proposes an overview of the climate policy implemented since 2000 by Bangladesh, and of its commitments in international actions and bodies. She outlines how, as one of the main victims of climate change, Bangladesh appears as a moral leader on the international scene. She also described how this country has become a place of experimentation and of production of new 'Southern' knowledge, and is considered as a precursor in 'community-based adaptation'. This example shows that a mutualization of resources can make countries stronger, and that coalitions (notably between developing countries) can be very important in international negotiations. However, the author outlines that this 'weak power' is more or less efficient, depending on the context

  6. Private Governance, Hegemonic Struggles, and Institutional Outcomes in the Transnational Cotton Commodity Chain

    Directory of Open Access Journals (Sweden)

    Amy Quark

    2015-08-01

    Full Text Available Transnational firms have rolled out new forms of private governance at the same time as the rise of new economic powerhouses like China has fomented growing inter-state tensions. This points to critical questions: how does inter-state competition shape private governance of transnational commodity chains and how does private governance shape inter-state rivalries? I explore these questions by tracing the construction and dissolution of sectoral hegemonic coalitions that govern commodity chains. Drawing on the case of cotton quality governance from 2000-2012, I argue that a coalition of the U.S. state and transnational merchants has reconstituted its sectoral hegemony to allow expanded accumulation and accommodate their main rival~China. The U.S. state created standards with Chinese characteristics, while transnational merchants made the authority structure of their institutions more inclusive. However, this reconstituted hegemony remains unstable. Facing continued regulatory competition from China, the U.S. state has constructed new forms of meta-governance that could facilitate a shift to Chinese-led sectoral hegemony but under U.S. oversight. Moreover, these sectoral hegemonic struggles compelled Western transnational merchants to fracture their long-standing relationship with the U.S. state in the hegemonic coalition in order to position their private institutions as geopolitically neutral and thus compatible with the hegemonic leadership of either the U.S. or Chinese states in the sector. By tracing struggles among coalitions of leading firms and states for hegemony over the institutions governing particular commodity chain sectors, we can shed light on possible trajectories within broader world-system level hegemonic struggles that at once constitute and are constituted by these sectoral dynamics.

  7. The role of civil society in health care reforms: an arena for hegemonic struggles.

    Science.gov (United States)

    Filc, Dani

    2014-12-01

    The present paper argues that current mainstream understandings of civil society as ontologically different from the state and essentially positive (either normative or functionally) are problematic in order to understand the development of health care reforms. The paper proposes to ground an explanation of the role of civil society in health care reforms in a Gramscian understanding of civil society as analytically different from the state, and as an arena for hegemonic struggles. The study of health care reform in Israel serves as a case study for this claim. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Struggling or Central Bank: Mexico's Negotia­tions with International Bankers, 1920-1925

    Directory of Open Access Journals (Sweden)

    Abdiel Oñate

    2000-04-01

    Full Text Available In order to give firm foundations to the process of accumulating national capital, the group led by Álvaro Obregón sought to recreate certain State institutions. This article explores their strategy, focusing on the conflict between representatives of the Mexican government and both national and foreign bankers over the control of money production, credit, public debt, and the  government's international financing. The background for this drama, where the new Mexican political class struggles to es­tablish its control over the Nation's resources and financing, are the deep changes brought about by the First World War in the intemational economic system.

  9. Rearguard Theory and Freedom of Movements: The Liberation Struggle of Refugees in Denmark

    DEFF Research Database (Denmark)

    Suárez-Krabbe, Julia

    2017-01-01

    and exploitation of group-differentiated vulnerabilities to premature death, in distinct yet densely interconnected political geographies” (Gilmore 2007: 28), the paper claims that the policies and legal frameworks that allow to put this system in practice—the death project—materializes in Europe in relation...... to its immigrant populations. The paper concludes that, in face of the problems with prisons and camps and the close relationship between law and exclusion, rights and death, struggles that aim to abolish prisons and camps offer strong alternatives as practices of freedom....

  10. Bill related to the struggle against proliferation of mass destruction weapons and their vectors

    International Nuclear Information System (INIS)

    2010-01-01

    This bill indicates the modifications brought to different French laws and codes (penal code, defence code, custom code) and defines provisions and penalties within the frame of struggle against the proliferation of weapons of mass destruction (nuclear weapons, biological weapons and toxin-based weapons, chemical weapons), and against the proliferation of their vectors. These modifications, provisions and penalties also concern double-use products. The bill also defines the modifications brought to the French penal procedure code. It finally addresses offenses related to these proliferations which can be considered as an act of terrorism

  11. 'A potential fifth column': conflicts and struggles for control in the context of local NHS privatization.

    Science.gov (United States)

    Aldred, Rachel

    2009-09-01

    This article uses case study data to discuss how a new procurement policy (Local Improvement Finance Trust, or LIFT) in English primary care may affect general practitioners' control over their work. LIFT, a series of 51 public-private partnerships, will enable over the medium term a shift towards the corporate ownership of surgeries and the creation of polyclinics or 'onestop-shops'. In this article, I explore the struggles over work autonomy and control within these new LIFT structures, as expressed by clinicians and managers in meetings and in research interviews. More generally, I consider how the findings inform debates over the changing position of professionals within increasingly financialized 'local health economies'.

  12. The struggle for inter-professional teamwork and collaboration in maternity care: Austrian health professionals' perspectives on the implementation of the Baby-Friendly Hospital Initiative.

    Science.gov (United States)

    Wieczorek, Christina C; Marent, Benjamin; Dorner, Thomas E; Dür, Wolfgang

    2016-03-14

    The health benefits of breastfeeding for mothers and babies are well documented in the scientific literature. Research suggests that support of breastfeeding during pre- and postnatal maternity care is an important determinant of breastfeeding initiation and duration. To support and promote breastfeeding on maternity units, the Baby-Friendly Hospital Initiative (BFHI) was launched in 1991. In Austria, however, less than one fifth of hospitals with a maternity unit are currently BFHI-certified. Implementation of BFHI and adjunct changes in work practices seem to represent a major challenge to maternity units. This article builds upon previous research that has identified a number of facilitators of and barriers to BFHI implementation in Austria. A major barrier has been the lack of intra- and inter-professional collaboration. Therefore, this article investigates the ways in which different healthcare professionals struggle to work together to successfully integrate the BFHI into practice. In this study, a qualitative research approach was used. Thirty-six semi-structured interviews with 11 midwives, 11 nurses, 13 physicians, and one quality manager, working across three maternity units, were interviewed on-site. Data analysis followed thematic analysis. Midwives, nurses, and physicians had diverse approaches to childbirth and breastfeeding (medicalization vs. naturalness) and worked along different jurisdictions that became manifest in strict spatial divisions of maternity units. In their engagement within the BFHI, midwives, nurses, and physicians pursued different strategies (safeguarding vs. circumvention strategies). These differences hindered inter-professional teamwork and collaboration and, therefore, the integration of BFHI into practice. Differing approaches to childbirth and breastfeeding, deep seated professional jurisdictions, as well as spatial constraints, challenge inter-professional teamwork and collaboration on maternity units. Inter

  13. The Facilities of British Intelligence Service in Trabzon at the Beginning of National Struggle

    Directory of Open Access Journals (Sweden)

    Resul YAVUZ

    2017-12-01

    Full Text Available Trabzon and its surrounding has always been one of the places where the states want to expand to inner parts through North want to control in almost every period of the history. The closest attempts to realize this aim were undoubtly to be carried out by Russians in the First World War and by the British in the Turkish Independence War which began after the war. The strategic position of it was in the interest of foreign intelligence services, especially in the national struggle years, due to its sophisticated socio-economic structure compared to the region and its geographical closeness to Bolshevik Russia. During these years, the British intelligence service reported to the centers about the connection and hidden points of the city and the sketches of possible landing and pathways in order to send troops to eastern Anatolia in the event of a possible occupation. Besides, the British attempted to control all activities of the city, especially the control of arm delivery under the name of implementing the conditions of the armistice by increasing the pressure on Trabzon during the years of national struggle that started in Anatolia.

  14. The cool, the bad, the ugly, and the powerful: identity struggles in schoolboy peer culture.

    Science.gov (United States)

    Govender, Kaymarlin

    2011-09-01

    Drawing upon a one-year-long ethnography of boys' constructions of their gender and sexual identities in one South African high school, this paper seeks to empirically explore and theorise how 58 grade 10 and grade 11 working-class boys create and seek out spaces among their male peers from which to cultivate their masculinities through heterosexual discourses, including being 'at risk' of getting AIDS. In this study, boys' daily struggles of trying to straddle the divide between hypersexual versus homosexual/effeminate versions of masculinity both subverted and reinforced hegemonic gender/sexual relations in the school context. Being caught up in this restrictive grip of heteronormativity meant that there were few spaces in male peer culture to resist hegemonic masculinity. The 'responsible male/controlled' position is indicative of one such space in which boys attempted to resist forms of hyper-sexuality. While this position cannot really be viewed as progressive, it nevertheless allowed boys to re-position themselves as moral agents through an assertion of control over their sexuality. Given the presence of these identity struggles, this paper, in general, suggests that interventions with boys need to cautiously explore these tensions/contradictions in identity making as opportunities to cultivate more gender sensitive and less violent discourses on masculinity.

  15. Lifestyle changes - a continuous, inner struggle for women with type 2 diabetes: a qualitative study.

    Science.gov (United States)

    Ahlin, Kristina; Billhult, Annika

    2012-03-01

    The objective of this study was to describe how women handle necessary lifestyle changes due to a chronic disease using diabetes as a model. Interview study. Ten women living in western Sweden were interviewed. In-depth interviews and analysis were performed using the phenomenological ideas of Giorgi. Ten women diagnosed with type 2 diabetes, mean age 65. All were either on disability pension or retired with varying complications ranging from none to stroke. The findings revealed five themes: the ambiguous feeling of others' involvement, becoming a victim of pressurizing demands, experiencing knowledge deficits, experiencing an urge, and finding reasons to justify not changing. The invariant meaning of a continuous inner struggle illuminates the experience of making lifestyle changes for women with type 2 diabetes. The findings of the present study show that it is vital for health care professionals to treat women diagnosed with type 2 diabetes with great respect and understanding regarding the struggle that they are going through. By being aware of the everyday burden for these women, acknowledging the fact that they want their lives to go on as before, may serve as a "key" to assist women in changing attitudes towards living in accordance with the disease and appreciating the lifestyle changes as a challenge as they become healthier and improve their quality of life.

  16. Struggling to adapt: caring for older persons while under threat of organizational change and termination notice.

    Science.gov (United States)

    Fläckman, Birgitta; Hansebo, Görel; Kihlgren, Annica

    2009-03-01

    Organizational changes are common in elder care today. Such changes affect caregivers, who are essential to providing good quality care. The aim of the present study was to illuminate caregivers' experiences of working in elder care while under threat of organizational change and termination notice. Qualitative content analysis was used to examine interview data from 11 caregivers. Interviews were conducted at three occasions during a two-year period. The findings show a transition in their experiences from 'having a professional identity and self-confidence', to 'being a professional in a threatening situation caused by someone else' and to 'struggling to adapt to a changed working environment as a person and a professional'. The caregivers experienced a loss of pride and satisfaction. Previous literature indicates that this may have consequences for the quality of care and that employees may be at risk of negative health effects. However, the caregivers continued to struggle, doing their best to complete their duties. The study has implications for high-level decision-makers, managers and caregivers in similar work-life situations in that it deals with factors that facilitate or impede similar transitions.

  17. Struggles against the pillars of agribusiness in Argentina: GMOs, agrotoxics and CONABIA

    Directory of Open Access Journals (Sweden)

    Cecilia Carrizo

    2014-10-01

    Full Text Available Provided with the contributions of the linguistic turn, our perspective conceives political theorizing as an intervention of the researcher in an intersubjective context in which a public issue is debated. We focus on those contexts in which the exercise and claim for rights against the consequences of agribusiness is thematized: diseases and deaths, siteclearances and evictions of indigenous and peasant communities, omission or complicit actions of the state institutions among other issues. We consider these diverse and sustained over time practices as struggles for recognition that put in tension the complacent “consensus of the commodities”, its concepts, practices, institutions and effects. We present the struggles against the pillars of agribusiness in Argentina: GMOs, pesticides and the National Commission on Agricultural Biotechnology (CONABIA. As a result of our research there are contributions that uncover the web of relationships impacted by agribusiness, the public problems generated and currently generates the technological innovation in this field, and the limits and possibilities for resolution. Also we offer glimpse into the structure, criteria and operation, also made invisible: the body of the official political system with responsibilities in this case in our country, the National Commission for Agricultural Technology (CONABIA.

  18. A Review of 'Organic Struggle: The Movement for Sustainable Agriculture in the United States'

    Directory of Open Access Journals (Sweden)

    Charles Francis

    2016-04-01

    Full Text Available Organic Struggle chronicles the challenges encountered by innovators in a growing segment of the U.S. food pro- duction and marketing system. Practiced for millenia by farmers before the introduction of chemical fertilizers and pesticides, and first developed more formally in Europe, organic farming practices began to gain prominence in the U.S. only in the 1950s. Far more than a system for pro- ducing food, this strategy has become a focus for those supporting healthy and pesticide-free products, for some who embrace the organic system as a food movement, and by many who disagree with the current domination of the country’s food industry by large farms and a small num- ber of multinational corporations. Within the organic sector there is debate between those who favor a system primar- ily run by local farmers who sell through small markets and CSAs, and others who insist that the ‘Big-Organic’ seg- ment that now sells more than half of all organic food is doing more to help the environment in the large picture. Author Brian Obach describes this ongoing struggle.

  19. Hospital-physician relations: the relative importance of economic, relational and professional attributes to organizational attractiveness

    Science.gov (United States)

    2014-01-01

    Background Belgian hospitals face a growing shortage of physicians and increasingly competitive market conditions. In this challenging environment hospitals are struggling to build effective hospital-physician relationships which are considered to be a critical determinant of organizational success. Methods Employed physicians of a University hospital were surveyed. Organizational attributes were identified through the literature and two focus groups. Variables were measured using validated questionnaires. Descriptive analyses and linear regression were used to test the model and relative importance analyses were performed. Results The selected attributes predict hospital attractiveness significantly (79.3%). The relative importance analysis revealed that hospital attractiveness is most strongly predicted by professional attributes (35.3%) and relational attributes (29.7%). In particular, professional development opportunities (18.8%), hospital prestige (16.5%), organizational support (17.2%) and leader support (9.3%) were found to be most important. Besides these non-economic aspects, the employed physicians indicated pay and financial benefits (7.4%) as a significant predictor of hospital attractiveness. Work-life balance and job security were not significantly related to hospital attractiveness. Conclusions This study shows that initiatives aimed at strengthening physicians’ positive perceptions of professional and relational aspects of practicing medicine in hospitals, while assuring satisfactory financial conditions, may offer useful avenues for increasing the level of perceived hospital attractiveness. Overall, hospitals are advised to use a differentiated approach to increase their attractiveness to physicians. PMID:24884491

  20. Hospital-physician relations: the relative importance of economic, relational and professional attributes to organizational attractiveness.

    Science.gov (United States)

    Trybou, Jeroen; Gemmel, Paul; Van Vaerenbergh, Yves; Annemans, Lieven

    2014-05-21

    Belgian hospitals face a growing shortage of physicians and increasingly competitive market conditions. In this challenging environment hospitals are struggling to build effective hospital-physician relationships which are considered to be a critical determinant of organizational success. Employed physicians of a University hospital were surveyed. Organizational attributes were identified through the literature and two focus groups. Variables were measured using validated questionnaires. Descriptive analyses and linear regression were used to test the model and relative importance analyses were performed. The selected attributes predict hospital attractiveness significantly (79.3%). The relative importance analysis revealed that hospital attractiveness is most strongly predicted by professional attributes (35.3%) and relational attributes (29.7%). In particular, professional development opportunities (18.8%), hospital prestige (16.5%), organizational support (17.2%) and leader support (9.3%) were found to be most important. Besides these non-economic aspects, the employed physicians indicated pay and financial benefits (7.4%) as a significant predictor of hospital attractiveness. Work-life balance and job security were not significantly related to hospital attractiveness. This study shows that initiatives aimed at strengthening physicians' positive perceptions of professional and relational aspects of practicing medicine in hospitals, while assuring satisfactory financial conditions, may offer useful avenues for increasing the level of perceived hospital attractiveness. Overall, hospitals are advised to use a differentiated approach to increase their attractiveness to physicians.

  1. Magic Moments of Struggle: Women's Memory of the Naxalbari Movement in West Bengal, India (1967-75)

    DEFF Research Database (Denmark)

    Roy, Mallarika Sinha

    2009-01-01

    This paper focuses on women's memories of participation in the Naxalbari movement in West Bengal. These memories, sourced from women's oral histories and published memoirs, capture not only women's visions of emancipation and camaraderie but their everyday struggles, experiences of fear...... and violence and patriarchal domination within the movement as well. As these memories are refracted by the women's diverse socio-economic and cultural locations, the paper makes an effort to distinguish the multiple meanings of the ‘magic moments of struggle' in the lives of peasant/working-class women, from...... those of middle-class women from smaller towns and upper middle-class metropolitan women....

  2. Struggling with motherhood and coping with fatherhood - A grounded theory study among Thai teenagers.

    Science.gov (United States)

    Sriyasak, Atcharawadee; Almqvist, Anna-Lena; Sridawruang, Chaweewan; Neamsakul, Wanwadee; Häggström-Nordin, Elisabet

    2016-11-01

    to gain a deeper understanding of Thai teenage parents' perspectives, experiences and reasoning about becoming and being a teenage parent from a gender perspective. an exploratory design using grounded theory methodology. Semi-structured interviews were used to collect data. An interview guide was developed, a pilot study was undertaken, and interviews were performed on two different occasions: once during the second trimester of pregnancy and again when the infant was 5-6 months old. a province in the western part of Thailand. the selection of a heterogeneous group of teenage parents-to-be continued until saturation was reached, as describe by Glaser and Strauss (1967), in all n=50. Inclusion criteria for participants were that they were heterosexual couples, under 20 years of age, cohabiting, and expecting their first child. the core category 'struggling with motherhood and coping with fatherhood' comprises descriptions of the process from when the teenagers first learned about the pregnancy until the child was six months old. The teenagers had failed to use contraceptives which led to an unintended parenthood. Their parenthood became a turning point as the teenagers started to change their behaviours and lifestyle during pregnancy, and adapted their relationships to partner and family. Family commitments was a facilitator, through support given by their families. Finally, becoming a parent describes ways of dealing with the parental role, by engaging in parental activities and reestablishing goals in life. Most of the teenage parents reproduced traditional gender roles by being a caring mother or a breadwinning father respectively. 'struggling with motherhood and coping with fatherhood' referred to the parents' stories about how they struggled and coped with life changes and their parental role when they became unintentionally pregnant, accepted their parenting, and finally became parents. After becoming parents, the main concerns of most of the teenage parents

  3. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  4. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  5. "In pursuit of the Nazi mind?" The deployment of psychoanalysis in the Allied struggle against Germany.

    Science.gov (United States)

    Pick, Daniel

    2009-01-01

    This paper discusses how psychoanalytic ideas were brought to bear in the Allied struggle against the Third Reich and explores some of the claims that were made about this endeavour. It shows how a variety of studies of Fascist psychopathology, centered on the concept of superego, were mobilized in military intelligence, postwar planning and policy recommendations for "denazification." Freud's ideas were sometimes championed by particular army doctors and government planners; at other times they were combined with, or displaced by, competing, psychiatric and psychological forms of treatment and diverse studies of the Fascist "personality." This is illustrated through a discussion of the treatment and interpretation of the deputy leader of the Nazi Party, Rudolf Hess, after his arrival in Britain in 1941.

  6. The fourth dimension in immunological space: how the struggle for nutrients selects high-affinity lymphocytes.

    Science.gov (United States)

    Wensveen, Felix M; van Gisbergen, Klaas P J M; Eldering, Eric

    2012-09-01

    Lymphocyte activation via the antigen receptor is associated with radical shifts in metabolism and changes in requirements for nutrients and cytokines. Concomitantly, drastic changes occur in the expression of pro-and anti-apoptotic proteins that alter the sensitivity of lymphocytes to limiting concentrations of key survival factors. Antigen affinity is a primary determinant for the capacity of activated lymphocytes to access these vital resources. The shift in metabolic needs and the variable access to key survival factors is used by the immune system to eliminate activated low-affinity cells and to generate an optimal high-affinity response. In this review, we focus on the control of apoptosis regulators in activated lymphocytes by nutrients, cytokines, and costimulation. We propose that the struggle among individual clones that leads to the formation of high-affinity effector cell populations is in effect an 'invisible' fourth signal required for effective immune responses. © 2012 John Wiley & Sons A/S.

  7. Restauration and revolution. Essay on the dialectics of the struggle for homosexual rights

    Directory of Open Access Journals (Sweden)

    Ivan Vuković

    2016-03-01

    Full Text Available The author analyses opinions expressed by the French philosopher Alain Badieu concerning the course and the outcome of ideological struggles led in the 20th century. Unlike Badieu who claims that the century ended with complete defeat of communist ideas, the author claims that the left had some success in the field of culture, in spite of all the loses in economy and politics. This thesis is illustrated by the example of the movement for homosexual rights. According to Badieu, this movement entered history with a revolutionary claim for a general liberation of human sexuality, and ended with the egoistic, petit-bourgeois request for the right to marriage. The author, on the other hand, thinks that the recognition of this second request augments sexual liberties and dynamics in the entire society, which means that the movement has fulfilled its general revolutionary function according Badieu’s own criteria.

  8. From the Backstage of War: the Struggle of Mothers in the Favelas of Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Vinícius Santiago

    Full Text Available Abstract This article analyses the political status of mothers whose children have been killed by members of the Brazilian military police and armed forces in the favelas of Rio de Janeiro in the course of the ‘war against drugs’. These mothers bear witness to the reality of state interference in the lives of their families. The loss of a child interrupts their intimate affective bonds and temporal linkages between the past, present and future, thereby requiring a resignification of the meaning and temporality of their lives. The war waged by the state and the mothers’ struggle for justice gives rise to a social dynamic that positions these mothers in a reordering of space and a redefinition of time, creating a spatio-temporal existence of pain, despair and hope.

  9. Morpho-phonemic analysis boosts word reading for adult struggling readers.

    Science.gov (United States)

    Gray, Susan H; Ehri, Linnea C; Locke, John L

    2018-01-01

    A randomized control trial compared the effects of two kinds of vocabulary instruction on component reading skills of adult struggling readers. Participants seeking alternative high school diplomas received 8 h of scripted tutoring to learn forty academic vocabulary words embedded within a civics curriculum. They were matched for language background and reading levels, then randomly assigned to either morpho-phonemic analysis teaching word origins, morpheme and syllable structures, or traditional whole word study teaching multiple sentence contexts, meaningful connections, and spellings. Both groups made comparable gains in learning the target words, but the morpho-phonemic group showed greater gains in reading unfamiliar words on standardized tests of word reading, including word attack and word recognition. Findings support theories of word learning and literacy that promote explicit instruction in word analysis to increase poor readers' linguistic awareness by revealing connections between morphological, phonological, and orthographic structures within words.

  10. Our struggle for climate - a low carbon world with growth is possible

    International Nuclear Information System (INIS)

    Chalendar, Pierre-Andre de

    2015-01-01

    In order to avoid an irreversible climate catastrophe, and as the will and commitments of States are not enough, the mobilisation of companies and enterprises is essential. This book aims to show that enterprises, which have been for long considered as responsible of greenhouse gas emissions, are now at the forefront of the struggle against climate change. The author describes the various challenges faced by French companies regarding climate and the environment. He thinks that the world will always need more energy, more steel, more aluminium, more building materials, more cars, more chemistry, more machines, more tubes and cables. The solution is then a technological one to transform industrial activities for a low carbon or zero carbon and growing economy

  11. Darwinism and cultural struggles in rural Askov and metropolitan Copenhagen in nineteenth-century Denmark

    DEFF Research Database (Denmark)

    Hjermitslev, Hans Henrik

    In the 1870s, when Charles Darwin's On the Origin of Species and Descent of Man were translated into Danish by the botanist-turned-poet J. P. Jacobsen, evolutionary thought played a seminal role in the modern breakthrough advocated by the freethinker and literary critic Georg Brandes. A group...... of students and artists assembled around Brandes in the capital of Copenhagen - the only Danish city hosting a university in the late nineteenth century - and used Darwinism in their cultural struggle against what they regarded as reactionary Christian and conservative values which dominated in the country....... At the same time in the village of Askov in rural Jutland, a liberal fraction of the Evangelical-Lutheran State Church, the Grundtvigians, had a stronghold at their high-profile folk high school. Here materialism and Darwinism associated with the Brandes circle were tabooed and later condemned. However...

  12. We Need not a New But an Indecent Materialism: Transmigrant, Transfeminist and Transgender Struggles

    Directory of Open Access Journals (Sweden)

    Marina Gržinić

    2015-10-01

    Full Text Available In the 1990s after the fall of the Berlin Wall we witnessed a blossoming of identity politics that in the form of multiculturalism was seen as a purely cultural phenomenon, but maybe we missed calling it a process of racialization that functions as matrix that sustains a monopoly on violent classifications, which decide who lives and who has to die. Therefore transmigrant, transfeminist and transgender struggles have to putthe relations of capital, power and labour at the center of investigation and contestation, as well as the expropriated surplus value that created superfluous populations, intensified capital’s militarization and rampant deprivation and, last but not least, the Western, Occidental, White Matrix of Power, which is the matrix of pure colonial violence.

  13. Challenged by the state and the Internet: Struggles for professionalism in Southeast Asian journalism

    Directory of Open Access Journals (Sweden)

    Emilie Lehmann-Jacobsen

    2017-06-01

    Full Text Available As in other regions, journalism in Southeast Asia is under pressure. Journalists in many of the region’s emerging markets have to develop their profession while struggling with changing market conditions, increasingly more demanding audiences, different degrees of authoritative states and growing competition from the Internet. Based on qualitative interviews and drawing on a combination of role theory and Pierre Bourdieu’s field theory, this article compares the role performances of journalists in Singapore and Vietnam by looking into the different expectations journalists in the two countries meet. The article illustrates how journalists continue to feel most conflicted about conforming with the states’ expectations to their profession. However, online actors imposing on the journalistic field are beginning to have a progressively bigger impact. Though they push the boundaries and set the media agenda, journalists fear they are changing the journalistic habitus, devaluing the journalistic capital and eroding years’ worth of professionalization progress.

  14. Nuclear energy, a solution in the struggle against global warming in quest of recognition

    International Nuclear Information System (INIS)

    Faudon, Valerie

    2014-01-01

    In this article, the author first comments assessments of the continuous increase of greenhouse gas emissions as they appear in the IPCC report of September 2013 and in the results published by the Global Carbon Project. She also evokes the commitments in emission reductions in compliance with the Kyoto Protocol and some dramatic consequences global warming may have according to the IPCC scenarios. Then, she addresses the share of nuclear energy in energy production and outlines its stakes and benefits in terms of greenhouse gas emissions. She notices that international bodies (European Commission, World Bank) do not mention nuclear energy in their plan for energy production development, but mainly rely on the development of renewable energies. The author then outlines the reasons why the development of renewable energies does not necessarily goes with the reduction of greenhouse gas emissions. She also notices that a new generation of ecologists considers nuclear energy as a tool to struggle against climate warming

  15. The internal suicide debate hypothesis: exploring the life versus death struggle.

    Science.gov (United States)

    Harris, Keith M; McLean, John P; Sheffield, Jeanie; Jobes, David

    2010-04-01

    Researchers and theorists (e.g., Shneidman, Stengel, Kovacs, and Beck) hyothesized that suicidal people engage in an internal debate, or struggle, over whether to live or die, but few studies have tested its tenability. This study introduces direct assessment of a suicidal debate, revealing new aspects of suicidal ideation. Results, from an online survey (N = 1,016), showed nearly all suicide-risk respondents engaged in the debate. In addition, debate frequency accounted for 54% of the variance in suicidality scores, and showed significant associations with other indicators of suicide risk. Likely factors of the debate, reasons for living and dying, showed significant differences by suicidality, and most suicide-risk participants reported going online for such purposes, demonstrating a behavioral component of the debate.

  16. Homeless Blogs as Travelogues. Travel as a Struggle for Recognition and Emplacement

    Directory of Open Access Journals (Sweden)

    Halina Gąsiorowska

    2017-07-01

    Full Text Available Applying Clifford’s broad concept of travel, I discuss American homeless blogs as autobiographical travel writing serving the struggle for recognition of the street people. The analysed travelogues are hitchhiker Ruth Rader’s Ruthie in the Sky blog and self-made woman Brianna Karp’s Girl’s Guide to Homelessness – a memoir published on the basis of the blog bearing the same title. In the travelogues I analyse the characteristic features of a personal travel writing: travel of the self, advice for future travelers, geographic information and portrayal of society in which the travel is undertaken. I claim that homeless bloggers recounting their stories of otherness and displacement in the US contribute to (reconstructing American cultural identity their personal Self, just like many other American travelers before. Additionally, homeless blogging about homelessness is shown as the process of emplacement (Casey – the bloggers’ attempt of making themselves at home in the world.

  17. Images of protest in social media: Struggle over visibility and visual narratives

    DEFF Research Database (Denmark)

    Neumayer, Christina; Rossi, Luca

    2018-01-01

    in the Blockupy protests against the opening of the European Central Bank headquarters in Frankfurt am Main on 18 March 2015. It does so through a novel combination of quantitative analysis, content analysis of images, and identification of narratives. The article concludes by arguing that the visual in political......While political protest is essentially a visual expression of dissent, both social movement research and media studies have thus far been hesitant to focus on visual social media data from protest events. This research explores the visual dimension (photos and videos) of Twitter communication...... protest in social media reproduces existing visualities and hierarchies rather than challenges them. This research enhances our conceptual understanding of how activists’ struggles play out in the visual and contributes to developing methods for empirical inquiry into visual social media content....

  18. Value-based pricing: A success factor in the competitive struggle

    Directory of Open Access Journals (Sweden)

    Netseva-Porcheva Tatyana

    2011-01-01

    Full Text Available Over the past decade, the view that the main purpose of market oriented organizations is not to satisfy the consumer, but to create values has dominated. Exactly the values, their creation, retention and increase, are the main sources of competitive advantage of the company. The purpose of the present report is to present the price formation, based on product value, as a source of competitive advantage. In connection with the so-defined objective, the value and the product price for the customer are derived as key factors for success of the company in the competitive struggle; the role of the value of the product in the marketing and pricing is revealed; and theory clarifies the two basic approaches for determining the price of the product on the basis of value - customer value modeling (CVM and economic value modeling (EVM, their nature, scope of application, advantages and disadvantages.

  19. STRUGGLING WITH THE PAST: REDEFINING AFRICAN-AMERICAN PHYSICAL APPEARANCES THROUGH ALICE RANDALL‟S THE WIND DONE GONE

    Directory of Open Access Journals (Sweden)

    Rasiah Rasiah

    2017-04-01

    Full Text Available This paperanalyzed the visual representations of African-Americans‘physical appearance on Alice Randall‘s The Wind Done Gone (2001. The Wind Done Gone is one of the slavery novels which appeared in early 21st century in America as a respond to the most parennial and hegemonic novel Gone with the wind(1938 authored by Margaret Mitchell. In many proslavery discourse,African-Americans found on popular culture artifacts or documents frequently employ the visual metaphor of others-as-beast. Tomap the discursive features ofthis form of racist ideology, attention is paid to the iconographic and linguistic strategies employed to depict African-Americans as physically, intellectually, and temperamentally distinct and inferior. Slavery was initially justified on the basis of the need for cheap labor, a racist ideology developed to support the subjugation of people of African descent. Included in this process was a denigration of African physical features and attributes.To respond this fact, Alice Randall tried to redefine the African- Americans‘physical appearances in her slavery novel as a resistence to colonial stereotype on African-American beauty. As the novel appeared in 21st century, Randall conviced thatAfrican-Americando no need to bleach his Negro soul in a flood of white American ideal of beauty, but the most important thing is that the change of perception on African-Americanidentity(blackness. It had to become part of an organised practice of struggles requiring the building up of black resistances as well as the development of new forms of black consciousness in new millenium.

  20. Health for smokers with schizophrenia - a struggle to maintain a dignified life.

    Science.gov (United States)

    Sundgren, Elisabet; Hallqvist, Johan; Fredriksson, Lennart

    2016-01-01

    To investigate the health and lifestyle habits of smokers with schizophrenia and describe their experience of smoking in relation to health. Semi-structured interviews with 10 smokers with schizophrenia were conducted in Sweden from May to October 2013. A hermeneutic phenomenological approach was used to describe and interpret respondents' experiences. Good health for a person with schizophrenia was defined as accepting their mental illness, having strategies to gain control over psychotic symptoms, and engaging in activities and good relationships. Lifestyle habits were described as structures in the respondents' daily life: arising in the morning, taking a cigarette, reading the newspaper, eating breakfast and doing the things planned for the day. The meaning of health for smokers with schizophrenia is not the same as being well or ill. Rather, health is an experience of a struggle to maintain a dignified life, including self-acceptance of the mental illness and control over the psychotic symptoms. People with schizophrenia have high willingness but low motivation to stop smoking because they fear that cigarette withdrawal will increase their psychotic symptoms. Therefore, they find it difficult to stop smoking. To succeed with health care intervention, health care providers must understand the life style habits and experiences specific to smokers with schizophrenia and the unique experience of health and life style habits that people with schizophrenia experience. Smokers with schizophrenia experience health as a struggle to maintain a dignified life and to maintain control over their psychotic symptoms. In smoking cessation programmes, health care providers must pay attention to the fear that people with schizophrenia have of losing control over their psychotic symptoms, if they stop smoking, and support them to find activities to replace smoking. This study suggests that to provide good support in health prevention for people with schizophrenia, it is vital

  1. Longitudinal Pediatric Palliative Care: Quality of Life & Spiritual Struggle (FACE): design and methods.

    Science.gov (United States)

    Dallas, Ronald H; Wilkins, Megan L; Wang, Jichuan; Garcia, Ana; Lyon, Maureen E

    2012-09-01

    As life expectancy increases for adolescents ever diagnosed with AIDS due to treatment advances, the optimum timing of advance care planning is unclear. Left unprepared for end-of-life (EOL) decisions, families may encounter miscommunication and disagreements, resulting in families being charged with neglect, court battles and even legislative intervention. Advanced care planning (ACP) is a valuable tool rarely used with adolescents. The Longitudinal Pediatric Palliative Care: Quality of Life & Spiritual Struggle study is a two-arm, randomized controlled trial assessing the effectiveness of a disease specific FAmily CEntered (FACE) advanced care planning intervention model among adolescents diagnosed with AIDS, aimed at relieving psychological, spiritual, and physical suffering, while maximizing quality of life through facilitated conversations about ACP. Participants will include 130 eligible dyads (adolescent and family decision-maker) from four urban cities in the United States, randomized to either the FACE intervention or a Healthy Living Control. Three 60-minute sessions will be conducted at weekly intervals. The dyads will be assessed at baseline as well as 3-, 6-, 12-, and 18-month post-intervention. The primary outcome measures will be in congruence with EOL treatment preferences, decisional conflict, and quality of communication. The mediating and moderating effects of threat appraisal, HAART adherence, and spiritual struggle on the relationships among FACE and quality of life and hospitalization/dialysis use will also be assessed. This study will be the first longitudinal study of an AIDS-specific model of ACP with adolescents. If successful, this intervention could quickly translate into clinical practice. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. 'Struggling to be an insider': a phenomenological design of new nurses' transition.

    Science.gov (United States)

    Lee, Huei Ying; Hsu, Min-Tao; Li, Pei-Ling; Sloan, Rebecca S

    2013-03-01

    To obtain a comprehensive understanding of the transition process of new nurses in Taiwan. Background.  The transition period for new nurses can be a daunting and traumatic experience. The large number of newly graduated Taiwanese nurses who resign from their jobs within three months indicates that this process can be complicated. However, the problems associated with the experiences of new nurses have not yet been recognised. We adopted a phenomenological design using focus group interviews. Sixteen new nurses (less than one year working experience) participated in eight weekly group interviews lasting two hours each to grasp their experience of 'being new'. Interview data were analysed according to Sloan's (2002) three moments, and the whole process of analysis followed the suggestions of Agar (1986), which was performed in a close collaboration between researchers until the consensus about the findings could be reached. The overarching pattern of the transition process of new nurses becoming experienced members of the clinical nursing team was revealed as a journey of 'struggling to be an insider'. This phenomenon was characterised by four themes, including (1) 'being new as being weak', (2) 'masking myself', (3) 'internalising the unreasonable' and (4) 'transforming myself to get a position'. While Western culture view abusive indoctrination of new nurses as toxic behaviour, under the Chinese traditions of yield, tolerance and self-oppression, following the power hierarchy and seeking harmony, the transition of new nurses is interpreted differently. Recognition of the journey of 'struggling to be an insider' helps nurse administrators to (1) gain a better understanding of what new nurses encounter in their transition process, (2) help new nurses without harm, (3) improve in-service training programmes and (4) retain future nurses. © 2012 Blackwell Publishing Ltd.

  3. Power in Practice: Adult Education and the Struggle for Knowledge and Power in Society. The Jossey-Bass Higher and Adult Education Series.

    Science.gov (United States)

    Cervero, Ronald M.; Wilson, Arthur L.

    This book contains 14 papers on adult education and the struggle for knowledge and power in society. The following papers are included: "At the Heart of Practice: The Struggle for Knowledge and Power" (Ronald M. Cervero, Arthur L. Wilson); "The Power of Economic Globalization: Deskilling Immigrant Women through Training"…

  4. The great controversy : the individual's struggle between good and evil in the Testaments of the Twelve Patriarchs and in their Jewish and Christian contexts

    NARCIS (Netherlands)

    Bruin, Tom de

    2013-01-01

    The Testaments of the Twelve Patriarchs are an early Christian work. The argumentation in this work finds its foundation in the struggle between good and evil. In the Testaments this struggle is applied individually, which is a theme found only in Christian works.

  5. Effect of Solution Focused Group Counseling for High School Students in Order to Struggle with School Burnout

    Science.gov (United States)

    Ates, Bünyamin

    2016-01-01

    In this research, the effect of solution focused group counseling upon high school students struggling with school burnout was analyzed. The research was an experimental study in which a pre-test post-test control group random design was used, depending upon the real experimental model. The study group included 30 students that volunteered from…

  6. [Review of the book What about me? : The struggle for identity in a market-based society, Paul Verhaeghe, 2014

    NARCIS (Netherlands)

    Nienass, Benjamin; Trautmann, Stefan

    In his book What about me? The struggle for identity in a market-based society, clinical psychologist and psychotherapist Paul Verhaeghe tries to elucidate the link between neo-liberal society, identity, and mental health. Verhaeghe starts from the observation that our identity is shaped by the

  7. Shared-Book Experience Using Science-Themed Books to Develop Scientific Literacy: An Interactive Approach with Struggling Readers

    Science.gov (United States)

    Chung, Mi-Hyun; Keckler, Barbara

    2016-01-01

    This paper will explain what a reading teacher learned from working with a group of first-grade struggling readers in a series of shared-book experience classes. The shared-book experience approach used a variety of science-themed books that were aligned with the first-grade curriculum and appropriate for beginning readers. Considering the…

  8. The Effectiveness of Synthetic Phonics in the Development of Early Reading Skills among Struggling Young ESL Readers

    Science.gov (United States)

    Jamaludin, Khairul Azhar; Alias, Norlidah; Mohd Khir, Roselina Johari; DeWitt, Dorothy; Kenayathula, Husaina Banu

    2016-01-01

    A quasi-experimental research design was used to investigate the effectiveness of synthetic phonics in the development of early reading skills among struggling young English as a second language (ESL) readers in a rural school. The pretest and posttest, adapted from the Phonological Awareness Literacy Screening (PALS) for Preschool Students and…

  9. Witnessing Kitchenuhmaykoosib Inninuwug's Strength and Struggle: The Affective Education of Reconciliation in Environmental Education

    Science.gov (United States)

    Korteweg, Lisa; Root, Emily

    2016-01-01

    Escalating environmental controversies are placing Indigenous peoples and First Nation communities at the front lines of protests, opposing unjust government policies and corporate actions. Yet, many environmental educators are not actively engaged or affectively learning about Indigenous Land struggles against Canada's colonial oppressions.…

  10. MATRIX MANAGEMENT OF PROJECTS AND POWER STRUGGLES - A CASE-STUDY OF AN RESEARCH-AND-DEVELOPMENT LABORATORY

    NARCIS (Netherlands)

    DELAAT, PB

    Matrix management of projects, it is argued, may generate normative conflict, prompting project and functional managers to engage in nonconformist conflict behavior which challenges the division of authority in matrix. An analysis of such struggles has been lacking yet. The present study fills this

  11. Why Johnny Struggles When Familiar Concepts Are Taken to a New Mathematical Domain: Towards a Polysemous Approach

    Science.gov (United States)

    Kontorovich, Igor'

    2018-01-01

    This article is concerned with cognitive aspects of students' struggles in situations in which familiar concepts are reconsidered in a new mathematical domain. Examples of such cross-curricular concepts are divisibility in the domain of integers and in the domain of polynomials, multiplication in the domain of numbers and in the domain of vectors,…

  12. Enhanced Recognition of Written Words and Enjoyment of Reading in Struggling Beginner Readers through Whole-Word Multimedia Software

    Science.gov (United States)

    Karemaker, Arjette; Pitchford, Nicola J.; O'Malley, Claire

    2010-01-01

    The effectiveness of a reading intervention using the whole-word multimedia software "Oxford Reading Tree (ORT) for Clicker" was compared to a reading intervention using traditional ORT Big Books. Developing literacy skills and attitudes towards learning to read were assessed in a group of 17 struggling beginner readers aged 5-6 years. Each child…

  13. Resilience and Struggle: Exploring the Experiences of Undocumented College Students through Chicana Feminist Theory and Dialogical Performance

    Science.gov (United States)

    Juarez, Sergio F.

    2017-01-01

    In an increasingly hostile political and social climate undocumented students in the United States continue to struggle to find space for themselves within universities. This research project undertakes a goal of illuminating how undocumented students make sense of their experiences on university campuses despite facing difficult climates at their…

  14. Decision-making as performative struggle: Strategic political-executive practices influencing the actualization of an infrastructural development

    NARCIS (Netherlands)

    Merkus, S.; de Heer, J.M.; Veenswijk, M.B.

    2014-01-01

    Purpose – The purpose of this paper is to introduce the concept of performative struggle through the use of an interpretative case story focussed on a strategic decision-making process concerning infrastructural development. Performativity is about “world-making” (Carter et al., 2010), based on the

  15. Dependent convergence: the importation of technological hazards by semiperipheral countries.

    Science.gov (United States)

    Siqueira, C E; Levenstein, C

    2000-01-01

    This article complements the substantial body of literature produced over the last three decades on the export of hazards from developed countries to developing countries. After reviewing the central arguments proposed by this literature, the authors add to the debate by focusing on the role of national actors in the importation of these hazards, based on the experience of late 1970s' developments in the petrochemical industry in Brazil. The Brazilian case indicates that social struggles and/or interactions among actors in developing and developed nations determine to what extent hazardous technologies are imported without environmental controls and to what extent their hazardous effects are controlled by these nations. This study suggests that the future development of a more inclusive theory of export-import of hazardous technologies and products should take into account the dialectical relationship established between social actors internal to the exporting and importing countries.

  16. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  17. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  18. Struggles for medical legitimacy among women experiencing sexual pain: A qualitative study.

    Science.gov (United States)

    Braksmajer, Amy

    2018-04-01

    Given the prominent role of medical institutions in defining what is "healthy" and "normal," many women turn to medicine when experiencing pain during intercourse (dyspareunia). The medical encounter can become a contest between patients and providers when physicians do not grant legitimacy to patients' claims of illness. Drawing on interviews conducted from 2007 to 2008 and 2011 to 2012 with 32 women experiencing dyspareunia (ages 18-60 years) and living in New York City and its surrounding areas, this study examined women's and their physicians' claims regarding bodily expertise, particularly women's perceptions of physician invalidation, their understanding of this invalidation as gendered, and the consequences for women's pursuit of medicalization. Women overwhelmingly sought a medical diagnosis for their dyspareunia, in which they believed that providers would relieve uncertainty about its origin, give treatment alternatives, and permit them to avoid sexual activity. When providers did not give diagnoses, women reported feeling that their bodily self-knowledge was dismissed and their symptoms were attributed to psychosomatic causes. Furthermore, some women linked their perceptions of invalidation to both historical and contemporary forms of gender bias. Exploration of women's struggles for medical legitimacy may lead to a better understanding of the processes by which medicalization of female sexuality takes place.

  19. Theoretical underpinnings of state institutionalisation of inclusion and struggles in collective health in Latin America.

    Science.gov (United States)

    Mahmood, Qamar; Muntaner, Carles

    2018-03-28

    Community participation as a strategy in health aims to increase the role of citizens in health decision-making which are contextualised within the institutions of democracy. Electoral representation as the dominant model of democracy globally is based on the elite theory of democracy that sees political decision-making a prerogative of political elites. Such political elitism is counter to the idea of democratic participation. Neoliberalism together with elitism in political sphere have worsened social inequities by undermining working class interests. Latin America has seen adverse consequences of these social inequities. In response, social movements representing collective struggles of organised citizens arose in the region. This paper explores the theoretical underpinnings of democratic participation in contemporary Latin American context at the nexus of emerging social movement activism and policy responses. The paper will use empirical examples to highlight how such democratic practices at the societal level evolved while demanding political inclusion. These societal democratic practices in Latin America are redefining democracy, which continues to be seen in the political sphere only. Health reforms promoting participatory democracy in several Latin American countries have demonstrated that establishing institutions and mechanisms of democratic participation facilitate collective participation by the organised citizenry in state affairs.

  20. RESEÑAS - 1. CONSENT OF THE NETWORKED. The Worldwide Struggle for Internet Freedom

    Directory of Open Access Journals (Sweden)

    Ruth Ainhoa de Frutos García

    2012-12-01

    Full Text Available La periodista e investigadora del Berkman Center for Internet and Society de la Universidad de Harvard Rebecca MacKinnon plantea en el libro Consent of the Networked. The Worldwide Struggle for Internet Freedom la necesidad que tienen los usuarios de internet de tomar conciencia y reaccionar sobre las violaciones de derechos humanos ligados a nuestro uso de internet que utilizan gobiernos y empresas.La gobernanza de internet, entendida como el derecho de los llamados ciudadanos digitales de influir en las decisiones políticas y corporativas a través de un consentimiento expreso, se describe a través de catorce capítulos divididos en cinco grandes capítulos: interrupciones, control 2.0, desafíos de la democracia, soberanos del ciberespacio y ¿qué se debe hacer?Tras exponer su análisis crítico sobre la situación mundial actual de las prácticas empresariales y los controles gubernamentales, MacKinnon detalla posibles soluciones para empoderar a los usuarios de internet a través de 294 páginas.La creadora de la iniciativa ciudadana Global Voices anima a los jóvenes a tomar el testigo de esta importante lucha y asumir el liderazgo frente a los poderes empresariales y gubernamentales.

  1. Turkey's Struggle with Internet in its 3rd year: Don Quixote, Ostrich, Harakiri

    Directory of Open Access Journals (Sweden)

    Mustafa Akgül

    2010-06-01

    Full Text Available The Code 5651 which sets Internet censhorship in Turkey has been active for 3 years. With this lawr, our country twanted to be a leader among democratic countries, , and challenged giant companies like Youtube and Google and fined them with tax penalty. Our country t is trying to set International Law on Internet via code 5651 and decisions of its courts. But it doesn't do this by defending or negotiating the issue on international forums or United Nations. It considers Internet as media and it punishes and bans similar to printing press.. A serious number of people, including the Prime Minister, break the ban. The President of the Republic, State Minister for EU, Minister of Transportation and chairman of Information and Communication Technologies Authority give statements against these bans. In the meantime, rule of law, separation of powers, fair trial, and basic human rights such as freedom of expression are ignored. In other words, a Legal Tradegy occurs in front of lawyers and intellectuals. And our country commits hara-kiri by not understanding Internet, just like the situation in printing machine. In this article, various dimensions of the 3-year struggle of Turkey with Internet are discussed.

  2. Philippine Mining Capitalism: The Changing Terrains of Struggle in the Neoliberal Mining Regime

    Directory of Open Access Journals (Sweden)

    Alvin A. Camba

    2016-06-01

    Full Text Available This article analyzes how the mining sector and anti-mining groups compete for mining outcomes in the Philippines. I argue that the transition to a neoliberal mineral regime has empowered the mining sector and weakened the mining groups by shifting the terrains of struggle onto the domains of state agencies and scientific networks. Since the neoliberal era, the mining sector has come up with two strategies. First, technologies of subjection elevate various public institutions to elect and select the processes aimed at making mining accountable and sensitive to the demands of local communities. However, they often refuse or lack the capacity to intervene effectively. Second, technologies of subjectivities allow a selective group of industry experts to single-handedly determine the environmental viability of mining projects. Mining consultants, specialists, and scientists chosen by mining companies determine the potential environmental damage on water bodies, air pollution, and soil erosion. Because of the mining capital’s access to economic and legal resources, anti-mining communities across the Philippines have been forced to compete on an unequal terrain for a meaningful social dialogue and mining outcomes.

  3. Therapeutic Theodicy? Suffering, Struggle, and the Shift from the God’s-Eye View

    Directory of Open Access Journals (Sweden)

    Amber L. Griffioen

    2018-03-01

    Full Text Available From a theoretical standpoint, the problem of human suffering can be understood as one formulation of the classical problem of evil, which calls into question the compatibility of the existence of a perfect God with the extent to which human beings suffer. Philosophical responses to this problem have traditionally been posed in the form of theodicies, or justifications of the divine. In this article, I argue that the theodical approach in analytic philosophy of religion exhibits both morally and epistemically harmful tendencies and that philosophers would do better to shift their perspective from the hypothetical “God’s-eye view” to the standpoint of those who actually suffer. By focusing less on defending the epistemic rationality of religious belief and more on the therapeutic effectiveness of particular imaginings of God with respect to suffering, we can recover, (reconstruct, and/or (reappropriate more virtuous approaches to the individual and collective struggle with the life of faith in the face of suffering.

  4. Existential struggle and self-reported needs of patients in rehabilitation.

    Science.gov (United States)

    Sigurgeirsdottir, Jonina; Halldorsdottir, Sigridur

    2008-02-01

    This paper is a report of a study to increase understanding of patients' experience of rehabilitation and their self-reported needs in that context. Nurses need to be able to recognize patient needs to plan effective and individualized care. Needs-led nursing care is emphasized in the nursing literature, but few studies in rehabilitation have explored needs from the patient's perspective. The sample of this phenomenological study was purposively selected and the data consisted of 16 in-depth interviews with 12 people aged between 26 and 85 years. The data were collected in 2005. The findings showed that being a patient in rehabilitation involves existential struggling, as the reason behind patients' rehabilitation, accident or illness usually leads to trying to cope with existential changes while needing to adapt to new characteristics of life and self. This makes patients vulnerable and their self-reported needs include individualized caring and emotional support from family, peers and staff. Participants also reported a need for a sense of security in a stable and homelike environment, with assistance, help and presence. Finally, they reported needing goal-oriented and progressive care in which realistic and achievable goals were established. Individualized patient education enhanced their independence and empowered them towards a new and progressive lifestyle. A new emphasis is needed in rehabilitation nursing, involving assessment of existential well-being of patients by means of skilful interpersonal relationship based on individualized caring and emotional support and recognition of each patient's own hierarchy of needs.

  5. Spiritual Struggle in Parents of Children with Cystic Fibrosis Increases Odds of Depression

    Directory of Open Access Journals (Sweden)

    Rhonda D. Szczesniak

    2017-01-01

    Full Text Available Objective. Spiritual struggle (SS is associated with poorer health outcomes including depression. The study’s main objectives were to characterize change in depression over time, examine longitudinal associations between SS and depression, and determine the extent to which experiencing SS at baseline was predictive of developing depression at follow-up. Methods. A two-site study collected questionnaire responses of parents (N=112; 72% female of children with cystic fibrosis followed longitudinally. Generalized linear mixed effects modeling examined the association between depression and SS over time and assessed potential mediators, moderators, and confounders. Results. Prevalence of depression increased from baseline to follow-up (OR: 3.6, P<0.0001, regardless of degree of SS. Parents with Moderate/Severe SS were more likely to have depressive symptoms, compared to parents without SS (OR: 15.2, P=0.0003 and parents who had Mild SS (OR: 10.2, P=0.0001. Being female and feeling less “at peace” also significantly predicted increased depression (OR: 2.5, P=0.0397, and OR: 1.15, P=0.0419, resp.. Experiencing SS at baseline was not predictive of having depression subsequently at follow-up. Conclusions. Parents experiencing SS were significantly more likely to report depressive symptoms. Interventions to reduce SS have shown efficacy and may be considered.

  6. Indigenous ExtrACTIVISM in Boreal Canada: Colonial Legacies, Contemporary Struggles and Sovereign Futures

    Directory of Open Access Journals (Sweden)

    Anna J. Willow

    2016-07-01

    Full Text Available This article approaches contemporary extractivism as an environmentally and socially destructive extension of an enduring colonial societal structure. Manifested in massive hydroelectric developments, clearcut logging, mining, and unconventional oil and gas production, extractivism removes natural resources from their points of origin and dislocates the emplaced benefits they provide. Because externally imposed resource extraction threatens Indigenous peoples’ land-based self-determination, industrial sites often become contested, politicized landscapes. Consequently, I also illuminate the struggles of those who strive to turn dreams for sovereign futures into reality through extrACTIVIST resistance to extractivist schemes. Presenting four case synopses—from across Canada’s boreal forest and spanning a broad range of extractive undertakings—that highlight both sides of the extractivism/ACTIVISM formulation, this article exposes the political roots of resource-related conflicts and contributes to an emerging comparative political ecology of settler colonialism. While extractivism’s environmental effects are immediate and arresting, these physical transformations have significant cultural consequences that are underlain by profound political inequities. I ultimately suggest that because extractivism is colonial in its causal logic, effective opposition cannot emerge from environmentalism alone, but will instead arise from movements that pose systemic challenges to conjoined processes of social, economic, and environmental injustice.

  7. Determinants of health disparities: The perennial struggle against polio in Nigeria

    Directory of Open Access Journals (Sweden)

    Nosayaba Osazuwa-Peters

    2011-01-01

    Full Text Available Polio remains a global public health issue, and even though it has been eradicated from most countries of the world, countries like Nigeria, the largest black nation on earth, threatens the dream of total eradication of polio from the surface of the earth. Transmission of wild polio virus has never been eliminated in Nigeria, but even worse is the number of countries, both in Sub-Saharan Africa and all over the world that has become re-infected by polio virus strains from Northern Nigeria in recent past. Although a lot has been documented about the Nigerian polio struggle, one aspect that has received little attention on this issue is ethnic and geographic disparities between the Southern and the Northern parts of Nigeria. Understanding these disparities involved in polio virus transmission in Nigeria, as well as the social determinants of health prevalent in Northern Nigeria will help government and other stakeholders and policy makers to synergize their efforts in the fight against this perennial scourge.

  8. Jumping for recognition: Women's ski jumping viewed as a struggle for rights.

    Science.gov (United States)

    Andersen, W; Loland, S

    2017-03-01

    With the campaign for women's participation in international and Olympic ski jumping as a practical case, sport's potential for recognition of individual rights is explored. In line with Honneth's influential ethical theory, recognition of rights refers to a mutual recognition between persons of each other as rational and responsible agents with an equal right to take part in the public formation and development of their community or practice. The argument is that women ski jumpers were entitled to compete as they had actual and/or potential capabilities and skills to contribute in the public formation and development of their sport. Their exclusion was a violation of individual rights. At a more general level, sport is discussed as a sphere for recognition of rights. It is argued that the basic principles of equal opportunity to take part and to perform make sport a particularly clear and potent sphere for such recognition, and also for the identification of rights violations. In sport, rights, or the violation of rights, are demonstrated in concrete and embodied ways. It is concluded that struggles for recognition and individual rights are a continuous process in sport as in most other human institutions and practices. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. A glimpse into 30 years of struggle against prostitution by the women's liberation movement in Norway.

    Science.gov (United States)

    Strøm, Agnete

    2009-11-01

    The Women's Front of Norway has worked against prostitution for 30 years. In 2008 a law criminalizing the purchase of a sexual act was passed in Norway. This article describes the struggle and the main actors in lobbying for the law. In the 1980s, we raised awareness of prostitution and trafficking in women in a study of the pornography industry, and targeted sex tourist agencies organizing trips to the Philippines and Thailand. In the 1990s, our members in trade unions got their unions to take a stand against prostitution and against legalizing prostitution as "work". In 2006, the Norwegian Confederation of Trade Unions Congress supported a law criminalizing the buyer of a sexual act; this had a strong impact on the centre-left coalition Government. We invited leaders of the Coalition Against Trafficking in Women to Norway to meet parliamentarians and trade unionists, and kept up the pressure. From the start, the focus was on ensuring that the situation for women in prostitution was ameliorated. Our demands have been for better social services and job training. Street prostitution, especially in Oslo, has been curbed, and a growth in the indoor market has not been reported. Our next task is participating in the awareness campaign "Buying Sex is not a Sport" in connection with the Soccer World Cup, South Africa, 2010.

  10. The Role of the Uighur Diaspora in the Struggle for Independence of Xinjiang

    Directory of Open Access Journals (Sweden)

    A S Mavlonova

    2015-12-01

    Full Text Available The article contains analysis of the activities of the Uighur diaspora abroad and its role in struggle for independence of Xinjiang. The author comes into conclusion that the role of the Uighur organizations located and incorporated in the western countries in activization of separatist in Xinjiang is huge. Such organizations are financed by the governments of the western countries, mainly by the United States. The most popular organization among them is “The World Uyghur Congress”, headed by Rebiya Kadeer. Despite the various internal disagreements, Uigur organizations located on the territory of western countries, pay special attention to the issue of self-determination and respecting of the rights of Uigurs in China. As a result of stabilization and improving of relations between Central Asian countries and China and formation of joint security system of countries within The Shanghai Cooperation Organization, the governments of the countries follow the policy based on the principle of sovereignty, independence and territorial integrity. Additionally, according to the author the fact that China has obtained support from the Central Asian countries in avoiding of separatism helps to keep Uighur organizations under strict control of the officials. Currently the Uigur diaspora is divided into many organizations established during the last several decades. The attempts to establish the single powerful organization that would support interests of the Uighur people and would be able to influence the world community were not successful.

  11. Why do we need a lump of money? Reflections on Crisis and Struggles around Reproductive Labour.

    Directory of Open Access Journals (Sweden)

    Gośka Maciejewska

    2014-01-01

    Full Text Available The paper discusses basic income in the context of feminist political ecology using the concepts of reproductive labor, both performed by people and by nature. In the first part we elaborate on Wages for Housework campaign as a forerunner of the idea of basic income. The campaign inscribed the concept of income into intersectional relation between patriarchy and capitalism what was a key element of its revolutionary dimension. In the second part we analyze three different social struggles in order to create a ground for further reflections over the legitimacy such tools (and resolutions as basic income. On the one hand the paper highlights some elements of the crisis of social reproduction, brought and further deepen by neoliberal reforms in Poland over the 25 years. On the other hand, it speaks to the issues of ecological crisis which needs to be taken into account in every anti-capitalist theory or strategy. Thus, the article aims to investigate if the wage demands for both reproductive and productive labor are still relevant in the era of neoliberal capitalism.

  12. The National Liberation Struggle of the Balkan Peoples and the Crimean War

    Directory of Open Access Journals (Sweden)

    Elena V. Belova

    2016-12-01

    Full Text Available The article examines the stages of the national liberation struggle of the peoples of South- Eastern Europe against the Ottoman Empire. The Russian Empire supported the Christian population and helped the southern Slavs and the Greeks to get free from the Ottoman dependency. But Emperor Nicholas I opposed the revolution. The 1850s were marked by the strained political and economic relations between Russia, Turkey, Britain, France and other European States. The Bulgarian and the Greek bourgeoisie had moved from enlightment activity to the political one. Bulgarians, Serbs, Moldovans, Greeks joined the volunteers and defended national interests with the weapon in hands. During the Crimean war the Russian command created military units on the territory of the Danubian principalities. Volunteers fought on the Danube, in Moldavia and Wallachia, and the Crimea. They protected the borders, defended the bastions of Sevastopol. The subject of the research is the organization of volunteer groups, national and social composition of the groups. The role of volunteers was of an exclusive political significance. The number of volunteers in the ranks of Russian troops was insignificant. But the volunteers were guides of Russian policy in the Turkish lands. They represented the fighting core.

  13. Diabetes distress: understanding the hidden struggles of living with diabetes and exploring intervention strategies.

    Science.gov (United States)

    Berry, Emma; Lockhart, Sam; Davies, Mark; Lindsay, John R; Dempster, Martin

    2015-05-01

    Diabetes distress is a rational emotional response to the threat of a life-changing illness. Distinct from depression, it is conceptually rooted in the demands of diabetes management and is a product of emotional adjustment. Diabetes distress has been found to be significantly associated with glycated haemoglobin (HbA1c) level and the likelihood of an individual adopting self-care behaviours. The lack of perceived support from family, friends and healthcare professionals significantly contributes to elevated diabetes distress, and this issue tends to be overlooked when designing interventions. Pioneering large-scale research, DAWN2, gives voices to the families of those with diabetes and reaffirms the need to consider psychosocial factors in routine diabetes care. Structured diabetes education programmes are the most widely used in helping individuals cope with diabetes, but they tend not to include the psychological or interpersonal aspects of diabetes management in their curricula. The need for health practitioners, irrespective of background, to demonstrate an understanding of diabetes distress and to actively engage in discussion with individuals struggling to cope with diabetes is emphasised. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  14. Struggle against Corruption in New Spain, in the View of the Neo-Stoics

    Directory of Open Access Journals (Sweden)

    Salvador Cárdenas Gutiérrez

    2006-01-01

    Full Text Available Along with the increasing presence of judicial and administrative officials in New Spain came the development of a courtly culture that entailed corrupt practices such as bribery  and fraud to the public treasury.  Spanish and viceragal authorities  attempted to  deter these  practices through local lawsuits and penal codes. At the same time, many lawyers, moralists and poets censured corruption from the perspective of neo-Stoic philosophy. Topics such as the “deception” produced by vanity and adulation, as opposed  to the “truth” revealed by virtue, were frequent in baroque  sermons,  panegyrics and festive and ceremonial  emblems inspired in this philosophical viewpoint. However, this same viewpoint attempted to unite  ethics and the  struggle  for power by taking advantage of the ludic dimension of virtue, just as Seneca had proposed and the authors  of courtly New-Spanish literature had repeated.

  15. Sakharov Prize Talk: Creativity of Physicists in the Struggle for Human Rights

    Science.gov (United States)

    Altshuler, Boris

    2014-03-01

    USSR was a totalitarian State with an almighty secret service - KGB. To save the repressed victim of regime, let it be dissident or scientists - Jewish refuzenik, was seemingly an absolutely impossible task. ``For success of our hopeless adventure!'', - as Andrei Sakharov used to say. There were no natural checks and balances in the Former USSR and there none in modern Russia - that is why the task to save the child in Russia is not less `hopeless' today. But the key word in Sakharov's motto is `success' - and we managed to reach it earlier in cooperation with the world scientific community, and we manage to reach it now in our work of protecting of rights of children. The Know How is creativity. To achieve something absolutely impossible needs unexpected `crazy' ideas (`it's not crazy enough to be true', - Niels Bohr). The same in science, in physics in particular, the Step to Unknown always demands `crazy' creative ideas. The Talk traces the parallels between creativity in physics and in human rights struggle. I acknowledge the support from the Committee of Concerned Scientists.

  16. A Struggle for Leadership Recognition: The AIIB, Reactive Chinese Assertiveness, and Regional Order

    Directory of Open Access Journals (Sweden)

    John H.S. Åberg

    2016-12-01

    Full Text Available The aim of this paper is to contribute to the ongoing debate about “Chinese assertiveness”. The paper dissects the central articles on the topic and evaluates their conceptual and theoretical insights. It ascertains that the concept of assertiveness is poorly substantiated; that proponents of “Chinese assertiveness” largely claim that it derives from structural factors that produced effects in Chinese foreign policy behavior prior to the US pivot to Asia; and ultimately, that critical accounts, since they reject the very concept, lack theories that can explain Chinese assertiveness. This article attempts to address these shortcomings. First, the article reconceptualizes assertiveness and connects it to grand strategy change. Second, this change is reactive and occurs after, not prior to the US pivot. Third, in order to provide greater theoretical adequacy, this article combines material factors with institutional factors and show how they dialectically interact with status aspiration, as part of the struggle for the positional good of leadership. To show the conceptual and theoretical plausibility of the argument, the paper outlines the dialectical interplay between positional barriers in the ADB and the US pivot to Asia, on the one hand, and reactive Chinese assertiveness and the AIIB, on the other.

  17. Struggle against privatization: a case history in the use of comparative performance evaluation of public hospitals.

    Science.gov (United States)

    Oh, Juhwan; Lee, Jin-Seok; Choi, Yong-Jun; Park, Hyeung-Keun; Do, Young Kyung; Eun, Sang-Jun

    2011-01-01

    After the 1997 economic crisis, the South Korean government implemented neoliberal policies in many sectors. In health care, the government attempted to privatize nine public hospitals, framing the initiative as "better management." In this discourse, public hospital workers were stereotyped as lazy and incompetent, while public hospitals were portrayed as poorly managed and of low quality. However, the government did not present any relevant evidence of improvement in already privatized hospitals, even though three hospitals had been semi-privatized at that time. In this study, the authors evaluated the effects of the semi-privatization, comparing the performance of the semi-privatized hospitals with that of the nine other hospitals targeted for privatization. The study found adverse effects on performance, unlike the claims made by the government. Semi-privatization intensified the workloads of hospital workers and the instability of employment, froze or decreased real wages, and drastically increased hospital revenue per patient stay. The changes may have resulted from redefining profit as the goal of the hospitals, as opposed to the previous focus on decision-making on public health. These research findings played a decisive role in the struggle to keep the targeted public hospitals free of privatization, especially in two of the nine hospitals targeted for privatization in 2001.

  18. The High-Throughput Analyses Era: Are We Ready for the Data Struggle?

    Science.gov (United States)

    D'Argenio, Valeria

    2018-03-02

    Recent and rapid technological advances in molecular sciences have dramatically increased the ability to carry out high-throughput studies characterized by big data production. This, in turn, led to the consequent negative effect of highlighting the presence of a gap between data yield and their analysis. Indeed, big data management is becoming an increasingly important aspect of many fields of molecular research including the study of human diseases. Now, the challenge is to identify, within the huge amount of data obtained, that which is of clinical relevance. In this context, issues related to data interpretation, sharing and storage need to be assessed and standardized. Once this is achieved, the integration of data from different -omic approaches will improve the diagnosis, monitoring and therapy of diseases by allowing the identification of novel, potentially actionably biomarkers in view of personalized medicine.

  19. Bounded Rational Managers Struggle with Talent Management - An Agent-based Modelling Approach

    DEFF Research Database (Denmark)

    Adamsen, Billy; Thomsen, Svend Erik

    This study applies an agent-based modeling approach to explore some aspects of an important managerial task: finding and cultivating talented individuals capable of creating value for their organization at some future state. Given that the term talent in talent management is an empty signifier...... and its denotative meaning floating, we propose that bounded rational managers base their decisions on a simple heuristic, i.e. selecting and cultivating individuals so that their capabilities resemble their own capabilities the most (Adamsen 2015). We model the consequences of this talent management...... heuristic by varying the capabilities of today’s managers, which in turn impact which individuals will be selected as talent. We model the average level of capabilities and the distribution thereof in the sample where managers identify and select individuals from. We consider varying degrees of path...

  20. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  1. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  2. “The History of all Hitherto Existing Society:” Class Struggle and the Current Wave of Resistance

    Directory of Open Access Journals (Sweden)

    Todd Wolfson

    2018-05-01

    Full Text Available Across the last decade we have witnessed a growing wave of resistance across the globe. In this article we argue that it is critical to utilise class analysis to understand contemporary social movements. We maintain that class analysis begins with understanding class as a series of relations and/or processes that condition both the objective and subjective dimensions of class. Following this, we illustrate how sectors of the contemporary working class are in struggle, yet struggle differently, based on their structural location as well as differing nature of their resistance. In taking this approach to class and social movements, we argue that scholars can begin to unmask the central role of capitalism and the attending regimes of accumulation in the current wave of resistance even when they appear disconnected.

  3. [The strategies of the symbolic struggle for the training of the visiting nurse in the early twentieth century].

    Science.gov (United States)

    Ayres, Lílian Fernandes Arial; Amorim, Wellington Mendonça de; Piva, Teresa Cristina de Carvalho; Porto, Fernando Rocha

    2012-09-01

    Based on the historical and social perspective, the scope of this documentary study were the strategies of the symbolic struggle for the training of agents in home visitation in the Courses for Visiting Nurses of the Brazilian Red Cross and the National Department of Public Health in Rio de Janeiro (Federal District), with repercussions in the Department of Health and Welfare of the State of Pernambuco between 1920 and 1926. We adopted the thinking of sociologist Pierre Bourdieu as a theoretical benchmark, showing the symbolic struggle in the field of public health between sanitarians Amaury de Medeiros and José P. Fontenelle and public health nurse Ethel Parsons, to analyze who was responsible for the scientific authority and competence of the training of visiting nurses.

  4. Unthinkable Rebellion and the Praxis of the Possible: Ch'orti' Campesin@ Struggles in Guatemala's Eastern Highlands

    OpenAIRE

    Casolo, Jennifer Jean

    2011-01-01

    This dissertation examines the production of rural struggle in Guatemala' indigenous eastern highlands, a place where after decades of silence, 36 years of civil war and two centuries of marginalization, the seemingly unthinkable--organized resistance and alternative proposals--became palpable. In the face of crisis, attempts to turn rural producers, into neoliberal subjects of credit resurrected the historical specter of dispossession and catalyzed an unlikely alliance to oppose unjust agrar...

  5. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  6. Action Research of a Color-Coded, Onset-Rime Decoding Intervention: Examining the Effects with First Grade Students Identified as at Risk

    Science.gov (United States)

    Wall, Candace A.; Rafferty, Lisa A.; Camizzi, Mariya A.; Max, Caroline A.; Van Blargan, David M.

    2016-01-01

    Many students who struggle to obtain the alphabetic principle are at risk for being identified as having a reading disability and would benefit from additional explicit phonics instruction as a remedial measure. In this action research case study, the research team conducted two experiments to investigate the effects of a color-coded, onset-rime,…

  7. Animal-Assisted Literacy Instruction for Students with Identified Learning Disabilities: Examining the Effects of Incorporating a Therapy Dog into Guided Oral Reading Sessions

    Science.gov (United States)

    Treat, Wendy Abigail

    2013-01-01

    Literacy acquisition is imperative to successful academic progress and to successful participation in our society. Students with identified learning disabilities are often among those who struggle to acquire literacy skills. The following dissertation shares the results of a reading intervention study in which nine students with identified…

  8. HEDIS Research Identifiable Files

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Healthcare Effectiveness Data and Information Set (HEDIS) is a tool used by more than 90 percent of Americas health plans to measure performance on important...

  9. Importance and functions of European grasslands.

    Science.gov (United States)

    Carlier, L; De Vliegher, A; Van Cleemput, O; Boeckx, P

    2005-01-01

    The European agricultural policy is not simple and needs to accommodate also social and environmental requirements. Grassland will continue to be an important form of land use in Europe, but with increased diversity in management objectives and systems used. Besides its role as basic nutrient for herbivores and ruminants grasslands have opportunities for adding value by exploiting positive health characteristics in animal products from grassland and through the delivery of environmental benefits. In fact grasslands contribute to a high degree to the struggle against erosion and to the regularizing of water regimes, to the purification of fertilizers and pesticides and to biodiversity. Finally they have aesthetic role and recreational function as far as they provide public access that other agricultural uses do not allow. But even for grassland it is very difficult to create a good frame for its different tasks (1) the provision of forage for livestock, (2) protection and conservation of soil and water resources, (3) furnishing a habitat for wildlife, both flora and fauna and (4) contribution to the attractiveness of the landscape. Nevertheless it is the only crop, able to fulfil so many tasks and to fit so many requirements.

  10. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  11. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  12. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  13. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  14. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  15. Struggling with one's own parenting after an upbringing with substance abusing parents.

    Science.gov (United States)

    Tedgård, Eva; Råstam, Maria; Wirtberg, Ingegerd

    2018-12-01

    To add to our knowledge concerning the key elements involved in the individual's experience of growing up with substance abusing parents and the resulting challenges this involved for their own parenthood. In-depth interviews were conducted with 19 parents who had participated in a mental health intervention programme. All had experienced substance abusing parents in their family of origin. Qualitative content analysis was used to analyse the data. They also completed a self-report questionnaire assessing their attachment style. Participants reported a high incidence of emotional abuse and neglect coupled with inadequate support from the community. Their own parental role was influenced by high parental stress and a majority had an insecure attachment style. All participants had experienced a very difficult childhood which was reinforced by the fact that they received little support from society. Their childhood experience and the resulting challenges that this created in their own parenting role could negatively influence their own children's ability to form a secure psychosocial development. It is therefore important to develop instruments that can help to identify children who were raised in misuse families in order to accommodate the transgenerational effects of growing up with substance abusing parents.

  16. Nonwestern Periphery and its Paradoxes: Reflections for Struggles in the 21st Century

    Directory of Open Access Journals (Sweden)

    Ana Saggioro Garcia

    2017-08-01

    Full Text Available What has historically been the role of the nonwestern semiperiphery (what was it expected to do and what did it really do and how has this role changed in recent years? In their article “Moving toward Theory for the 21st Century: The Centrality of Nonwestern Semiperiphery to World Ethnic/Racial Inequality”, Wilma Dunaway and Donald Clelland provide important contributions to the efforts to rethink global inequalities and the potential to transform the capitalist world-system. Presenting a wealth of data compiled in graphs and tables, the article aims to decenter analysis of global ethnic/racial inequality by bringing the nonwestern semiperiphery to the foreground. In their examination of the rise of the nonwestern semiperiphery, the authors question the popular “global apartheid model”, which identifies “white supremacy” as the sole cause of global ethnic/racial inequality. Their goal is to demonstrate that the nonwestern semiperiphery intensifies and exacerbates ethnic and racial inequalities in the world further by adopting political and economic mechanisms to exploit territories and workers both within and beyond their borders.

  17. Online health information search: what struggles and empowers the users? Results of an online survey.

    Science.gov (United States)

    Pletneva, Natalia; Vargas, Alejandro; Kalogianni, Konstantina; Boyer, Célia

    2012-01-01

    The most popular mean of searching for online health content is a general search engine for all domains of interest. Being general implies on one hand that the search engine is not tailored to the needs which are particular to the medical and on another hand that health domain and health-specific queries may not always return adequate and adapted results. The aim of our study was to identify difficulties and preferences in online health information search encountered by members of the general public. The survey in four languages was online from the 9th of March until the 27th of April, 2011. 385 answers were collected, representing mostly the opinions of highly educated users, mostly from France and Spain. The most important characteristics of a search engine are relevance and trustworthiness of results. The results currently retrieved do not fulfil these requirements. The ideal representation of the information will be a categorization of the results into different groups. Medical dictionaries/thesauruses, suggested relevant topics, image searches and spelling corrections are regarded as helpful tools. There is a need to work towards better customized solutions which provide users with the trustworthy information of high quality specific to his/her case in a user-friendly environment which would eventually lead to making appropriate health decisions.

  18. Struggling with one’s own parenting after an upbringing with substance abusing parents

    Science.gov (United States)

    Tedgård, Eva; Råstam, Maria; Wirtberg, Ingegerd

    2018-01-01

    ABSTRACT Aim: To add to our knowledge concerning the key elements involved in the individual’s experience of growing up with substance abusing parents and the resulting challenges this involved for their own parenthood. Methods: In-depth interviews were conducted with 19 parents who had participated in a mental health intervention programme. All had experienced substance abusing parents in their family of origin. Qualitative content analysis was used to analyse the data. They also completed a self-report questionnaire assessing their attachment style. Result: Participants reported a high incidence of emotional abuse and neglect coupled with inadequate support from the community. Their own parental role was influenced by high parental stress and a majority had an insecure attachment style. Conclusions: All participants had experienced a very difficult childhood which was reinforced by the fact that they received little support from society. Their childhood experience and the resulting challenges that this created in their own parenting role could negatively influence their own children’s ability to form a secure psychosocial development. It is therefore important to develop instruments that can help to identify children who were raised in misuse families in order to accommodate the transgenerational effects of growing up with substance abusing parents. PMID:29482480

  19. Social mixing through densification? The struggle over the Little Mountain public housing complex in Vancouver

    Directory of Open Access Journals (Sweden)

    Rosol, Marit

    2015-09-01

    Full Text Available In times of peak-oil and the on-going ‘urban renaissance’ (Porter and Shaw 2009, urban densification becomes increasingly more important. Densification is promoted not only for environmental reasons – in the sense of developing more compact and thus more sustainable cities – but also, as is the case in Vancouver, in the name of ‘social mixing’. Taking the conflict over “Little Mountain” – the oldest public housing complex in the province of British Columbia, Canada – as example, the article shows the conflicts that can arise in the process of densification. Despite the protests of residents and their supporters and without any concrete plans for redevelopment, almost all of the once 224 social housing units were demolished in 2009 to make room for at least 1,400 market condos (besides the 1-for-1 replacement of the social units. The example shows that densification processes that lack social measures for securing tenure for long-time residents lead to the displacement of poorer people, and to increased socio-spatial disparities. Furthermore, densification will not alleviate the affordability crisis but intensify it, if all the additionally created housing units will be market-housing only. Based on this example, the article shows that a purported social-mix policy is mainly motivated by recapturing prime real-estate, and identifies the rhetoric of ‘social mixing’ as ‘gentrification by stealth’ (Bridge et al. 2012.

  20. Struggling for independence”: The meaning of being an oldest old man in a rural area. Interpretation of oldest old men's narrations

    Directory of Open Access Journals (Sweden)

    Tove M. Ness

    2014-02-01

    Full Text Available The amount of older people receiving home nursing care is increasing; in rural areas, they are at additional risk because of the distance between people and health care facilities. No specific studies have been found about oldest old men living alone and receiving home nursing care and the meaning of living alone in one's own home. The aim of this study was therefore to illuminate the meaning of being an oldest old man living alone in a rural area and receiving home nursing care. A sample of 12 oldest old men living in rural areas in the middle of Norway was chosen for this study. Narrative interviews were conducted, and data were analyzed using the phenomenological hermeneutical method. After a naïve reading and a structural analysis of the text, we identified three themes: feelings of insufficiency in everyday life, finding hope in life, and feeling reconciliation with life. The comprehensive understanding suggested that being an oldest old man living alone in a rural area means a struggle between a dependent existence and a desire to be independent. Living in the tension between independence and dependency is a complex emotional situation where one is trying to accept the consequences of life and loss—reconciling the wish to live with the fact that life will come to an end.