WorldWideScience

Sample records for identify important properties

  1. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  2. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  3. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  4. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  5. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  6. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  7. Important physical properties of peat materials

    Science.gov (United States)

    D.H. Boelter

    1968-01-01

    Peat materials from 12 bogs in northern Minnesota, U.S.A., showed significant differences in physical properties. It is pointed out that 1) these properties can be related to the hydrology of organic soils only if the soils represent undisturbed field conditions, and 2) volumetric expressions of water content are necessary to correctly evaluate the amount of water in a...

  8. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  9. Properties Important To Mixing For WTP Large Scale Integrated Testing

    International Nuclear Information System (INIS)

    Koopman, D.; Martino, C.; Poirier, M.

    2012-01-01

    Large Scale Integrated Testing (LSIT) is being planned by Bechtel National, Inc. to address uncertainties in the full scale mixing performance of the Hanford Waste Treatment and Immobilization Plant (WTP). Testing will use simulated waste rather than actual Hanford waste. Therefore, the use of suitable simulants is critical to achieving the goals of the test program. External review boards have raised questions regarding the overall representativeness of simulants used in previous mixing tests. Accordingly, WTP requested the Savannah River National Laboratory (SRNL) to assist with development of simulants for use in LSIT. Among the first tasks assigned to SRNL was to develop a list of waste properties that matter to pulse-jet mixer (PJM) mixing of WTP tanks. This report satisfies Commitment 5.2.3.1 of the Department of Energy Implementation Plan for Defense Nuclear Facilities Safety Board Recommendation 2010-2: physical properties important to mixing and scaling. In support of waste simulant development, the following two objectives are the focus of this report: (1) Assess physical and chemical properties important to the testing and development of mixing scaling relationships; (2) Identify the governing properties and associated ranges for LSIT to achieve the Newtonian and non-Newtonian test objectives. This includes the properties to support testing of sampling and heel management systems. The test objectives for LSIT relate to transfer and pump out of solid particles, prototypic integrated operations, sparger operation, PJM controllability, vessel level/density measurement accuracy, sampling, heel management, PJM restart, design and safety margin, Computational Fluid Dynamics (CFD) Verification and Validation (V and V) and comparison, performance testing and scaling, and high temperature operation. The slurry properties that are most important to Performance Testing and Scaling depend on the test objective and rheological classification of the slurry (i

  10. PROPERTIES IMPORTANT TO MIXING FOR WTP LARGE SCALE INTEGRATED TESTING

    Energy Technology Data Exchange (ETDEWEB)

    Koopman, D.; Martino, C.; Poirier, M.

    2012-04-26

    Large Scale Integrated Testing (LSIT) is being planned by Bechtel National, Inc. to address uncertainties in the full scale mixing performance of the Hanford Waste Treatment and Immobilization Plant (WTP). Testing will use simulated waste rather than actual Hanford waste. Therefore, the use of suitable simulants is critical to achieving the goals of the test program. External review boards have raised questions regarding the overall representativeness of simulants used in previous mixing tests. Accordingly, WTP requested the Savannah River National Laboratory (SRNL) to assist with development of simulants for use in LSIT. Among the first tasks assigned to SRNL was to develop a list of waste properties that matter to pulse-jet mixer (PJM) mixing of WTP tanks. This report satisfies Commitment 5.2.3.1 of the Department of Energy Implementation Plan for Defense Nuclear Facilities Safety Board Recommendation 2010-2: physical properties important to mixing and scaling. In support of waste simulant development, the following two objectives are the focus of this report: (1) Assess physical and chemical properties important to the testing and development of mixing scaling relationships; (2) Identify the governing properties and associated ranges for LSIT to achieve the Newtonian and non-Newtonian test objectives. This includes the properties to support testing of sampling and heel management systems. The test objectives for LSIT relate to transfer and pump out of solid particles, prototypic integrated operations, sparger operation, PJM controllability, vessel level/density measurement accuracy, sampling, heel management, PJM restart, design and safety margin, Computational Fluid Dynamics (CFD) Verification and Validation (V and V) and comparison, performance testing and scaling, and high temperature operation. The slurry properties that are most important to Performance Testing and Scaling depend on the test objective and rheological classification of the slurry (i

  11. Synthesis, Properties and Mineralogy of Important Inorganic Materials

    CERN Document Server

    Warner, Terence E

    2010-01-01

    Intended as a textbook for courses involving preparative solid-state chemistry, this book offers clear and detailed descriptions on how to prepare a selection of inorganic materials that exhibit important optical, magnetic and electrical properties, on a laboratory scale. The text covers a wide range of preparative methods and can be read as separate, independent chapters or as a unified coherent body of work. Discussions of various chemical systems reveal how the properties of a material can often be influenced by modifications to the preparative procedure, and vice versa. References to miner

  12. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  13. Environmental importance, composition and properties of pervious concrete

    Directory of Open Access Journals (Sweden)

    Topličić-Ćurčić Gordana

    2016-01-01

    Full Text Available Porous or pervious concrete was in use since the 60's of the previous century. It was first used in the USA and afterwards in Europe. The environmental importance of pervious concrete can be seen through fast collection of stormwater from the pavements, parking lots and other impervious surfaces. . Special purification systems remove the detrimental matter from the collected strormwater. As such, it can be used for other purposes. The pervious concrete has little or almost no fine aggregates. Its porosity is high, and ranges between 15 and 30 % in comparison to the concrete volume. Prior to massive usage of pervious concrete, it was necessary to prove, i.e. to examine its properties in service conditions. The paper elucidates the environmental character of pervious concrete, provides its usual composition and its properties.

  14. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  15. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  16. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  17. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  18. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  19. Neighborhood properties are important determinants of temperature sensitive mutations.

    Directory of Open Access Journals (Sweden)

    Svetlana Lockwood

    Full Text Available Temperature-sensitive (TS mutants are powerful tools to study gene function in vivo. These mutants exhibit wild-type activity at permissive temperatures and reduced activity at restrictive temperatures. Although random mutagenesis can be used to generate TS mutants, the procedure is laborious and unfeasible in multicellular organisms. Further, the underlying molecular mechanisms of the TS phenotype are poorly understood. To elucidate TS mechanisms, we used a machine learning method-logistic regression-to investigate a large number of sequence and structure features. We developed and tested 133 features, describing properties of either the mutation site or the mutation site neighborhood. We defined three types of neighborhood using sequence distance, Euclidean distance, and topological distance. We discovered that neighborhood features outperformed mutation site features in predicting TS mutations. The most predictive features suggest that TS mutations tend to occur at buried and rigid residues, and are located at conserved protein domains. The environment of a buried residue often determines the overall structural stability of a protein, thus may lead to reversible activity change upon temperature switch. We developed TS prediction models based on logistic regression and the Lasso regularized procedure. Through a ten-fold cross-validation, we obtained the area under the curve of 0.91 for the model using both sequence and structure features. Testing on independent datasets suggested that the model predicted TS mutations with a 50% precision. In summary, our study elucidated the molecular basis of TS mutants and suggested the importance of neighborhood properties in determining TS mutations. We further developed models to predict TS mutations derived from single amino acid substitutions. In this way, TS mutants can be efficiently obtained through experimentally introducing the predicted mutations.

  20. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  1. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Sensory properties of Californian and imported extra virgin olive oils.

    Science.gov (United States)

    Delgado, Claudia; Guinard, Jean-Xavier

    2011-04-01

    Production and consumption of extra-virgin olive has been increasing in the United States, particularly in California. The objective of this study was to compare the sensory characteristics of 22 extra virgin olive oils (EVOO) from California, Italy, Spain, Chile, and Australia using a generic descriptive analysis. A total of 22 sensory attributes were identified and defined by the descriptive panel. With the exception of thick and citrus, all sensory attributes were significantly different among the oils. Canonical Variate Analysis (CVA) showed that California oils differed from some imported EVOOs, mainly by their absence of defects. A second analysis, of only those attributes included in the International Olive Council (IOC) official scorecard, provided a less detailed description of the samples and did not allow for a full characterization of the oils. While the IOC attributes allowed for faster classification in terms of clean versus defective EVOOs, the more comprehensive descriptive analysis provided both more information and a more refined classification of the samples. Variety and region of origin were important factors in the classification of both Californian and imported EVOOs.   Measuring olive oil sensory quality using the IOC method-positive attributes of fruitiness, bitterness, and pungency, and defects including fusty, musty, winey, and rancid-allows for the certification of oils as extra virgin but it provides limited information on the sensory characteristics of the oils. A full descriptive profile, on the other hand, provides information that can be used by producers in the processing and marketing of their oils, and is a useful tool in the education of consumers about the wide range of (positive) sensory attributes in EVOO and the various sensory styles of EVOO.

  3. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  4. Genomic Regions Affecting Cheese Making Properties Identified in Danish Holsteins

    DEFF Research Database (Denmark)

    Gregersen, Vivi Raundahl; Bertelsen, Henriette Pasgaard; Poulsen, Nina Aagaard

    The cheese renneting process is affected by a number of factors associated to milk composition and a number of Danish Holsteins has previously been identified to have poor milk coagulation ability. Therefore, the aim of this study was to identify genomic regions affecting the technological...

  5. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  6. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  7. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  8. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  9. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Identifying the Critical Links in Road Transportation Networks: Centrality-based approach utilizing structural properties

    Energy Technology Data Exchange (ETDEWEB)

    Chinthavali, Supriya [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-04-01

    Surface transportation road networks share structural properties similar to other complex networks (e.g., social networks, information networks, biological networks, and so on). This research investigates the structural properties of road networks for any possible correlation with the traffic characteristics such as link flows those determined independently. Additionally, we define a criticality index for the links of the road network that identifies the relative importance in the network. We tested our hypotheses with two sample road networks. Results show that, correlation exists between the link flows and centrality measures of a link of the road (dual graph approach is followed) and the criticality index is found to be effective for one test network to identify the vulnerable nodes.

  11. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  12. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  13. Reconsidering the importance of interfacial properties in foam stability

    NARCIS (Netherlands)

    Wierenga, P.A.; Norel, van L.; Basheva, E.S.

    2009-01-01

    In food industry, protein isolates are often used to help in the formation and stabilisation of food foams. Subsequently there is great interest in (1) understanding the effect of processing parameters on the functional properties of the isolate, and (2) methods and techniques that can help to

  14. The important parameters of polyurethane's properties and preparation

    International Nuclear Information System (INIS)

    Rad, A.S.

    2009-01-01

    Polyurethane (PU) is a type of plastic rind is formed by reacting a polyol (a polymeric alcohol with more than. two reactive hydroxyl groups per molecule) with diisocyanates or polymeric isocyanate in the presence of suitable catalysts and additives. Variations in the number of substitutions and the spacing between and within branch chains produce PUs ranging from linear to branched and flexible to rigid. Linear PUs are used for the manufacture of fibers and molding. The structure of polyurethane can be medley containing 'hard' and 'soft' sect, which contribute to the harmony between rigid and elastomeric properties. The chemical composition and molecular weight distribution (MWD)- of the incorporated soft block influence the macroscopic properties of the resulting coating. In modifying the backbone structure of PU coatings it is necessary to consider the end use for the coating and the cost of modification: The properties of the modified PU coating, The resistance of the coating towards mechanical and The compatibility of the coating and the substrate over the temperature range of expected application and The between the benefits to be gained and the additional cost are the parameters that must be A surface functionalization of a synthetic polyurethane was carried out by using biofunctional moieties to obtain a material with the appropriate mechanical properties and processing conditions. (author)

  15. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  16. Synthesis, Properties and Mineralogy of Important Inorganic Materials

    DEFF Research Database (Denmark)

    Warner, Terence Edwin

    chosen so as to illustrate the large variety of physico-chemical properties encountered in inorganic materials, and to provide practical experience covering a wide range of preparative methods, with an emphasis on high-temperature techniques. The majority of the materials described in the book relate...... in extending their repertoire of teaching material into the realms of high-temperature synthesis. It is also of interest to professional chemists, physicists, materials scientists and technologists, ceramicists, mineralogists, geologists, geochemists, archaeologists, metallurgists, engineers, and non......-specialists, who are interested in learning more about how technological ceramic materials and artificial minerals are made. Finally, the author assumes that the reader is familiar with the basic principles and concepts of materials chemistry (or at least has access to such knowledge), such as; thermodynamic...

  17. Intellectual Property Rights, Parallel Imports and Strategic Behavior

    OpenAIRE

    Maskus, Keith E.; Ganslandt, Mattias

    2007-01-01

    The existence of parallel imports (PI) raises a number of interesting policy and strategic questions, which are the subject of this survey article. For example, parallel trade is essentially arbitrage within policy-integrated markets of IPR-protected goods, which may have different prices across countries. Thus, we analyze fully two types of price differences that give rise to such arbitrage. First is simple retail-level trade in horizontal markets because consumer prices may differ. Second i...

  18. Commercially important properties of plants of the genus Plantago

    Directory of Open Access Journals (Sweden)

    Elżbieta Weryszko-Chmielewska

    2012-12-01

    Full Text Available The centuries-old experience of folk medicine, nutritional traditions, and the results of numerous research studies show that plants of the genus Plantago can be used for medicinal, cosmetic, dietetic, and ritual purposes. In the phytochemical composition of Plantago, there is an abundance of biologically active substances (among others, glycosides, flavonoids, polysaccharides, and vitamins exhibiting beneficial effects and, simultaneously, there is a low content of compounds that may exert a toxic effect. Scientific research has confirmed that Plantago plants have antioxidative, apoptosis-inhibiting, protective, healing-enhancing, spasmolytic, anthelmintic, and antimicrobial properties; they inhibit the development of some tumours, reduce the level of lipids in blood and inhibit tissue glycation. In phytotherapy, leaves, stems, and/or seeds of different plantain species are used. Plantago leaves and seeds are also used to manufacture creams, lotions, and face masks. Different parts of these plants (fresh plant material, extracts, or isolated substances are also used in human and animal nutrition. Plantain leaves can be eaten like lettuce or added to salads, fried in pastry, used to prepare a tea, juice, or wine. Its seeds are added to cakes, bread, breakfast cereals, ice cream, and drinks, or they are cooked like groats. Animals fed with plantain can live longer and are healthier, while meat derived from such animals is tastier and healthier to humans. Plantago seeds are readily eaten by cage birds. Plantain pollen, produced in large amounts (up to 20,000 pollen grains per 1 stamen of P. lancolata, can cause allergies in sensitive people. Due to a long flowering period of plants of the genus Plantago, the effect of the allergenic factor persists for many weeks. In Poland days with the maximum concentration of airborne plantain pollen most often occur in July.

  19. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  20. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  1. 7 CFR 767.201 - Real estate inventory property with important resources.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Real estate inventory property with important... SERVICE AGENCY, DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS INVENTORY PROPERTY MANAGEMENT Real Estate Property With Important Resources or Located in Special Hazard Areas § 767.201 Real estate inventory...

  2. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  3. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  4. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  5. Integration of experimental and computational methods for identifying geometric, thermal and diffusive properties of biomaterials

    Science.gov (United States)

    Weres, Jerzy; Kujawa, Sebastian; Olek, Wiesław; Czajkowski, Łukasz

    2016-04-01

    Knowledge of physical properties of biomaterials is important in understanding and designing agri-food and wood processing industries. In the study presented in this paper computational methods were developed and combined with experiments to enhance identification of agri-food and forest product properties, and to predict heat and water transport in such products. They were based on the finite element model of heat and water transport and supplemented with experimental data. Algorithms were proposed for image processing, geometry meshing, and inverse/direct finite element modelling. The resulting software system was composed of integrated subsystems for 3D geometry data acquisition and mesh generation, for 3D geometry modelling and visualization, and for inverse/direct problem computations for the heat and water transport processes. Auxiliary packages were developed to assess performance, accuracy and unification of data access. The software was validated by identifying selected properties and using the estimated values to predict the examined processes, and then comparing predictions to experimental data. The geometry, thermal conductivity, specific heat, coefficient of water diffusion, equilibrium water content and convective heat and water transfer coefficients in the boundary layer were analysed. The estimated values, used as an input for simulation of the examined processes, enabled reduction in the uncertainty associated with predictions.

  6. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  7. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  9. Identifying the molecular functions of electron transport proteins using radial basis function networks and biochemical properties.

    Science.gov (United States)

    Le, Nguyen-Quoc-Khanh; Nguyen, Trinh-Trung-Duong; Ou, Yu-Yen

    2017-05-01

    The electron transport proteins have an important role in storing and transferring electrons in cellular respiration, which is the most proficient process through which cells gather energy from consumed food. According to the molecular functions, the electron transport chain components could be formed with five complexes with several different electron carriers and functions. Therefore, identifying the molecular functions in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. This work includes two phases for discriminating electron transport proteins from transport proteins and classifying categories of five complexes in electron transport proteins. In the first phase, the performances from PSSM with AAIndex feature set were successful in identifying electron transport proteins in transport proteins with achieved sensitivity of 73.2%, specificity of 94.1%, and accuracy of 91.3%, with MCC of 0.64 for independent data set. With the second phase, our method can approach a precise model for identifying of five complexes with different molecular functions in electron transport proteins. The PSSM with AAIndex properties in five complexes achieved MCC of 0.51, 0.47, 0.42, 0.74, and 1.00 for independent data set, respectively. We suggest that our study could be a power model for determining new proteins that belongs into which molecular function of electron transport proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. ContextD: an algorithm to identify contextual properties of medical terms in a Dutch clinical corpus.

    Science.gov (United States)

    Afzal, Zubair; Pons, Ewoud; Kang, Ning; Sturkenboom, Miriam C J M; Schuemie, Martijn J; Kors, Jan A

    2014-11-29

    In order to extract meaningful information from electronic medical records, such as signs and symptoms, diagnoses, and treatments, it is important to take into account the contextual properties of the identified information: negation, temporality, and experiencer. Most work on automatic identification of these contextual properties has been done on English clinical text. This study presents ContextD, an adaptation of the English ConText algorithm to the Dutch language, and a Dutch clinical corpus. We created a Dutch clinical corpus containing four types of anonymized clinical documents: entries from general practitioners, specialists' letters, radiology reports, and discharge letters. Using a Dutch list of medical terms extracted from the Unified Medical Language System, we identified medical terms in the corpus with exact matching. The identified terms were annotated for negation, temporality, and experiencer properties. To adapt the ConText algorithm, we translated English trigger terms to Dutch and added several general and document specific enhancements, such as negation rules for general practitioners' entries and a regular expression based temporality module. The ContextD algorithm utilized 41 unique triggers to identify the contextual properties in the clinical corpus. For the negation property, the algorithm obtained an F-score from 87% to 93% for the different document types. For the experiencer property, the F-score was 99% to 100%. For the historical and hypothetical values of the temporality property, F-scores ranged from 26% to 54% and from 13% to 44%, respectively. The ContextD showed good performance in identifying negation and experiencer property values across all Dutch clinical document types. Accurate identification of the temporality property proved to be difficult and requires further work. The anonymized and annotated Dutch clinical corpus can serve as a useful resource for further algorithm development.

  11. Examining the Psychometric Properties of the Identify as a Professional Social Worker Subscale

    Science.gov (United States)

    Farmer, Antoinette Y.

    2017-01-01

    The purpose of this study was to examine the psychometric properties of the Identify as a Professional Social Worker Subscale, which assessed the Council on Social Work Education--prescribed competency "identify as a professional social worker and conduct oneself accordingly." The results of confirmatory factory analysis indicated that…

  12. To Identify the Important Soil Properties Affecting Dinoseb Adsorption with Statistical Analysis

    Directory of Open Access Journals (Sweden)

    Yiqing Guan

    2013-01-01

    Full Text Available Investigating the influences of soil characteristic factors on dinoseb adsorption parameter with different statistical methods would be valuable to explicitly figure out the extent of these influences. The correlation coefficients and the direct, indirect effects of soil characteristic factors on dinoseb adsorption parameter were analyzed through bivariate correlation analysis, and path analysis. With stepwise regression analysis the factors which had little influence on the adsorption parameter were excluded. Results indicate that pH and CEC had moderate relationship and lower direct effect on dinoseb adsorption parameter due to the multicollinearity with other soil factors, and organic carbon and clay contents were found to be the most significant soil factors which affect the dinoseb adsorption process. A regression is thereby set up to explore the relationship between the dinoseb adsorption parameter and the two soil factors: the soil organic carbon and clay contents. A 92% of the variation of dinoseb sorption coefficient could be attributed to the variation of the soil organic carbon and clay contents.

  13. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  14. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  15. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  16. Investigations regarding the lowering of specific intellectual property risks identified in the production process

    Directory of Open Access Journals (Sweden)

    Pakocs Ramona

    2017-01-01

    Full Text Available The main purpose of this research is to decrease the emergence of specific intellectual property risks within the production process as well as increasing risk management performance of IP by preventing them. In order to achieve this, previous studies regarding the main specific intellectual property risks from industrial companies were analyzed together with their managerial methods as well as the possibility of reducing their emergence. As a result of the research conducted were identified five types of intellectual property risks that have a high potential of emergence in the production process, namely: the risk of production of goods in violation of IP rights; the know-how, production knowledge and trade secret disclosure risk; the technological risk of unprotected utility models; the technological risk of unprotected integrated circuits topographies and finally the risk of product counterfeit. In order to achieve the main purpose of our investigation, we have proposed new formulas for estimating the specific intellectual property risks identified in the production process. Their purpose was to minimalize the risk’s negative effects on industrial companies and to increase the managerial performance from the intellectual property domain through a new type of management appropriately named: intellectual property management. The research is finalized with a case study regarding the lapse of rights of a patented invention. Based on a case analysis, it was proved that the exploitation of an invention without a contract represents a counterfeit.

  17. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  18. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  19. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  20. Importance of intellectual property generated by biomedical research at universities and academic hospitals.

    Science.gov (United States)

    Heus, Joris J; de Pauw, Elmar S; Leloux, Mirjam; Morpurgo, Margherita; Hamblin, Michael R; Heger, Michal

    2017-01-01

    Biomedical research has many different facets. Researchers and clinicians study disease biology and biochemistry to discover novel therapeutic targets, unravel biochemical pathways and identify biomarkers to improve diagnosis, or devise new approaches to clinically manage diseases more effectively. In all instances, the overall goal of biomedical research is to ensure that results thereof (such as a therapy, a device, or a method which may be broadly referred to as "inventions") are clinically implemented. Most of the researchers' efforts are centered on the advance of technical and scientific aspects of an invention. The development and implementation of an invention can be arduous and very costly. Historically, it has proven to be crucial to protect intellectual property rights (IPR) to an invention (i.e., a patent) to ensure that companies can obtain a fair return on their investment that is needed to develop an academic invention into a product for the benefit of patients. However, the importance of IPR is not generally acknowledged among researchers at academic institutions active in biomedical research. Therefore this paper aims to (1) raise IP awareness amongst clinical and translational researchers; (2) provide a concise overview of what the patenting trajectory entails; and (3) highlight the importance of patenting for research and the researcher. Adequate patent protection of inventions generated through biomedical research at academic institutions increases the probability that patients will benefit from these inventions, and indirectly enables the financing of clinical studies, mainly by opening up funding opportunities (e.g. specific grants aimed at start-ups, pre-seed and seed capital) that otherwise would not be accessible. As a consequence, patented inventions are more likely to become clinically tested and reach the market, providing patients with more treatment options.

  1. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  2. Influence of biodiesel blending on physicochemical properties and importance of mathematical model for predicting the properties of biodiesel blend

    International Nuclear Information System (INIS)

    Wakil, M.A.; Kalam, M.A.; Masjuki, H.H.; Atabani, A.E.; Rizwanul Fattah, I.M.

    2015-01-01

    Highlights: • Short identification of selected biodiesel feedstock. • Review of physicochemical properties for blended biodiesel. • Mathematical model for predicting properties of various biodiesel blends. - Abstract: The growing demand for green world serves as one of the most significant challenges of modernization. Requirements like largest usage of energy for modern society as well as demand for friendly milieu create a deep concern in field of research. Biofuels are placed at the peak of the research arena for their underlying benefits as mentioned by multiple researches. Out of a number of vegetable oils, only a few are used commercially for biodiesel production. Due to various limitations of edible oil, non-edible oils are becoming a profitable choice. Till today, very little percentage of biodiesel is used successfully in engine. The research is still continuing for improving the biodiesel usage level. Recently, it is found that the blended biodiesel from more than one feedstock provides better performance in engine. This paper reviews the physicochemical properties of different biodiesel blends obtained from various feedstocks with a view to properly understand the fuel quality. Moreover, a short description of each feedstock is given along with graphical presentation of important properties for various blend percentages from B0 to B100. Finally, mathematical model is formed for predicting various properties of biodiesel blend with the help of different research data by using polynomial curve fitting method. The results obtained from a number of literature based on this work shows that the heating value of biodiesel is about 11% lower than diesel except coconut (14.5% lower) whereas kinematic viscosity is in the range of 4–5.4 mm 2 /s. Flash point of all biodiesels are more than 150 °C, except neem and coconut. Cold flow properties of calophyllum, palm, jatropha, moringa are inferior to others. This would help to determine important properties of

  3. Bacterial composition of activated sludge - importance for floc and sludge properties

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, Per H.; Thomsen, Trine R.; Nielsen, Jeppe L.

    2003-07-01

    Activated sludge flocs consist of numerous constituents which, together with other factors, are responsible for floc structure and floc properties. These properties largely determine the sludge properties such as flocculation, settling and dewaterability. In this paper we briefly review the present knowledge about the role of bacteria in relation to floc and sludge properties, and we present a new approach to investigate the identity and function of the bacteria in the activated sludge flocs. The approach includes identification of the important bacteria and a characterization of their physiological and functional properties. It is carried out by use of culture-independent molecular biological methods linked with other methods to study the physiology and function maintaining a single cell resolution. Using this approach it was found that floc-forming properties differed among the various bacterial groups, e.g. that different microcolony-forming bacteria had very different sensitivities to shear and that some of them deflocculated under anaerobic conditions. in our opinion, the approach to combine identity with functional analysis of the dominant bacteria in activated sludge by in situ methods is a very promising way to investigate correlations between presence of specific bacteria, and floc and sludge properties that are of interest. (author)

  4. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  5. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  7. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  8. Spectroscopic properties for identifying sapphire samples from Ban Bo Kaew, Phrae Province, Thailand

    Science.gov (United States)

    Mogmued, J.; Monarumit, N.; Won-in, K.; Satitkune, S.

    2017-09-01

    Gemstone commercial is a high revenue for Thailand especially ruby and sapphire. Moreover, Phrae is a potential gem field located in the northern part of Thailand. The studies of spectroscopic properties are mainly to identify gemstone using advanced techniques (e.g. UV-Vis-NIR spectrophotometry, FTIR spectrometry and Raman spectroscopy). Typically, UV-Vis-NIR spectrophotometry is a technique to study the cause of color in gemstones. FTIR spectrometry is a technique to study the functional groups in gem-materials. Raman pattern can be applied to identify the mineral inclusions in gemstones. In this study, the natural sapphires from Ban Bo Kaew were divided into two groups based on colors including blue and green. The samples were analyzed by UV-Vis-NIR spectrophotometer, FTIR spectrometer and Raman spectroscope for studying spectroscopic properties. According to UV-Vis-NIR spectra, the blue sapphires show higher Fe3+/Ti4+ and Fe2+/Fe3+ absorption peaks than those of green sapphires. Otherwise, green sapphires display higher Fe3+/Fe3+ absorption peaks than blue sapphires. The FTIR spectra of both blue and green sapphire samples show the absorption peaks of -OH,-CH and CO2. The mineral inclusions such as ferrocolumbite and rutile in sapphires from this area were observed by Raman spectroscope. The spectroscopic properties of sapphire samples from Ban Bo Kaew, Phrae Province, Thailand are applied to be the specific evidence for gemstone identification.

  9. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-01-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  10. Intellectual property enforcement at the EU border: the challenge of private imports

    DEFF Research Database (Denmark)

    Petersen, Clement Salung; Riis, Thomas; Schovsbo, Jens Hemmingsen

    2012-01-01

    commercial importers of counterfeit and pirated goods, a consumer who imports such goods for his or her private use does not infringe any intellectual property rights (IPR). This article discusses how and to what extent right holders may nonetheless use the Customs Regulation to enforce their IPR against...... private imports. After having dismissed the so-called “manufacturing fiction” following the decision of the ECJ in Philips/Nokia the article elaborates on an alternative method which is called the “infringing sale of goods-“approach and which may find support in the ECJ decision in L'Oréal and possibly...

  11. The Importance of Thermophysical Properties of Steels for the Numerical Simulation of a Concasting Process

    Directory of Open Access Journals (Sweden)

    Frantisek KAVICKA

    2010-12-01

    Full Text Available The thermophysical properties of steels have significant influence on the actual concasting process, and on the accuracy of its numerical simulation and optimization. The determination of these properties (heat conductivity, specific heat capacity and density in the solid and liquid states often requires more time than the actual numerical calculation of the temperature fields of a continuously cast steel billet, cylinder or slab (generally a concasting. The influence of individual properties should be neither under- nor over-estimated. Therefore, an analysis/parametric study of these thermophysical properties was conducted. The order of importance within the actual process and the accuracy of simulation and optimization were also determined. Individual properties, which, in some cases, were obtained from tables, and in others experimentally, were substituted by an approximation using orthogonal polynomials. The accuracy of each polynomial is dependent on the precision of individual values. The order of significance of individual thermophysical properties was determined with respect to the metallurgical length. The analysis was performed by means of a so-called calculation experiment, i.e. by means of the original and universal numerical concasting model developed by the authors of this paper. It is convenient to conduct such an analysis in order to facilitate the simulation of each individual case of concasting, thus enhancing the process of optimization.

  12. Applying network theory to animal movements to identify properties of landscape space use.

    Science.gov (United States)

    Bastille-Rousseau, Guillaume; Douglas-Hamilton, Iain; Blake, Stephen; Northrup, Joseph M; Wittemyer, George

    2018-04-01

    Network (graph) theory is a popular analytical framework to characterize the structure and dynamics among discrete objects and is particularly effective at identifying critical hubs and patterns of connectivity. The identification of such attributes is a fundamental objective of animal movement research, yet network theory has rarely been applied directly to animal relocation data. We develop an approach that allows the analysis of movement data using network theory by defining occupied pixels as nodes and connection among these pixels as edges. We first quantify node-level (local) metrics and graph-level (system) metrics on simulated movement trajectories to assess the ability of these metrics to pull out known properties in movement paths. We then apply our framework to empirical data from African elephants (Loxodonta africana), giant Galapagos tortoises (Chelonoidis spp.), and mule deer (Odocoileous hemionus). Our results indicate that certain node-level metrics, namely degree, weight, and betweenness, perform well in capturing local patterns of space use, such as the definition of core areas and paths used for inter-patch movement. These metrics were generally applicable across data sets, indicating their robustness to assumptions structuring analysis or strategies of movement. Other metrics capture local patterns effectively, but were sensitive to specified graph properties, indicating case specific applications. Our analysis indicates that graph-level metrics are unlikely to outperform other approaches for the categorization of general movement strategies (central place foraging, migration, nomadism). By identifying critical nodes, our approach provides a robust quantitative framework to identify local properties of space use that can be used to evaluate the effect of the loss of specific nodes on range wide connectivity. Our network approach is intuitive, and can be implemented across imperfectly sampled or large-scale data sets efficiently, providing a

  13. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  14. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  15. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  16. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  17. Antimicrobial properties of nest volatiles in red imported fire ants, Solenopsis invicta (hymenoptera: formicidae)

    Science.gov (United States)

    Wang, Lei; Elliott, Brad; Jin, Xixuan; Zeng, Ling; Chen, Jian

    2015-12-01

    The antimicrobial property of volatiles produced by red imported fire ants, Solenopsis invicta, against Beauveria bassiana, a common entomopathogenic fungus, was demonstrated. The germination rate of B. bassiana spores was significantly reduced after they were exposed to volatiles within an artificial ant nest. Since the air that contained the same level of O2 and CO2 as that in artificial fire ant nests did not suppress the germination rate of B. bassiana, the observed reduction of germination rate must be caused by the toxicity of nest volatiles. Nest fumigation may be an important component of the social immune system in S. invicta.

  18. Determining the Most Important Soil Properties Affecting the Yield of Saffron in the Ghayenat Area

    Directory of Open Access Journals (Sweden)

    amir ranjbar

    2016-02-01

    Full Text Available Introduction: Saffron is one of the most important economic plants in the Khorasan province. Awareness of soil quality in agricultural lands is essential for the best management of lands and for obtaining maximum economic benefit. In general, plant growth is a function of environmental factors especially chemical and physical properties of soil (20. It has been demonstrated that there was a positive and high correlation between soil organic matter and saffron yield. Increasing the yield of saffron due to organic matter is probably due to soil nutrient, especially phosphorous and nitrogen and also improvement of soil physical quality (6, 28, 29. The yield of saffron in soils with high nitrogen as a result of vegetative growth is high (8. Shahandeh (6 found that most of the variation of saffron yield depends on soil properties. Due to the economic importance of saffron and the role of soil properties on saffron yield, this research was conducted to find the relationship between saffron yield and some soil physical and chemical properties, and to determine the contribution of soil properties that have the greatest impact on saffron yield in the Ghayenat area. Materials and Methods: This research was performed in 30 saffron fields (30 soil samples of the Ghayenat area (longitude 59° 10΄ 10.37˝ - 59° 11΄ 38.41˝ and latitude 33° 43΄ 35.08˝ - 33΄ 44΄ 02.78˝, which is located in the Khrasan province of Iran. In this research, 21 soil properties were regarded as the total data set (TDS. Then the principal component analysis (PCA was used to determine the most important soil properties affecting saffron yield as a minimum data set (MDS and the stepwise regression to estimate saffron yield. To estimate the yield of saffron in stepwise regression method, saffron yield was considered as a dependent variable and soil physical and chemical properties were considered to be independent variables. Results and Discussion: According to the PCA method

  19. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  20. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  1. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  2. The contribution of nature to people: Applying concepts of values and properties to rate the management importance of natural elements.

    Science.gov (United States)

    Smith, Michael J; Wagner, Christian; Wallace, Ken J; Pourabdollah, Amir; Lewis, Loretta

    2016-06-15

    An important, and yet unresolved question in natural resource management is how best to manage natural elements and their associated values to ensure human wellbeing. Specifically, there is a lack of measurement tools to assess the contribution of nature to people. We present one approach to overcome this global issue and show that the preferred state of any system element, in terms of realising human values, is a function of element properties. Consequently, natural resource managers need to understand the nature of the relationships between element properties and values if they are to successfully manage for human wellbeing. In two case studies of applied planning, we demonstrate how to identify key element properties, quantify their relationships to priority human values, and combine this information to model the contribution of elements to human wellbeing. In one of the two case studies we also compared the modelling outputs with directly elicited stakeholder opinions regarding the importance of the elements for realising the given priority values. The two, largely congruent outputs provide additional support for the approach. The study shows that rating sets of elements on their relative overall value for human wellbeing, or utility, provides critical information for subsequent management decisions and a basis for productive new research. We consider that the described approach is broadly applicable within the domain of natural resource management. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Properties important for solid–liquid separations change during the enzymatic hydrolysis of pretreated wheat straw

    DEFF Research Database (Denmark)

    Weiss, Noah Daniel; Felby, Claus; Thygesen, Lisbeth Garbrecht

    2018-01-01

    Objectives The biochemical conversion of lignocellulosic biomass into renewable fuels and chemicals provides new challenges for industrial scale processes. One such process, which has received little attention, but is of great importance for efficient product recovery, is solid–liquid separations......, which may occur both after pretreatment and after the enzymatic hydrolysis steps. Due to the changing nature of the solid biomass during processing, the solid–liquid separation properties of the biomass can also change. The objective of this study was to show the effect of enzymatic hydrolysis...... of cellulose upon the water retention properties of pretreated biomass over the course of the hydrolysis reaction. Results Water retention value measurements, coupled with 1H NMR T2 relaxometry data, showed an increase in water retention and constraint of water by the biomass with increasing levels...

  4. Properties important to mixing and simulant recommendations for WTP full-scale vessel testing

    Energy Technology Data Exchange (ETDEWEB)

    Poirier, M. R. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Martino, C. J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-12-01

    Full Scale Vessel Testing (FSVT) is being planned by Bechtel National, Inc., to demonstrate the ability of the standard high solids vessel design (SHSVD) to meet mixing requirements over the range of fluid properties planned for processing in the Pretreatment Facility (PTF) of the Hanford Waste Treatment and Immobilization Plant (WTP). Testing will use simulated waste rather than actual Hanford waste. Therefore, the use of suitable simulants is critical to achieving the goals of the test program. WTP personnel requested the Savannah River National Laboratory (SRNL) to assist with development of simulants for use in FSVT. Among the tasks assigned to SRNL was to develop a list of waste properties that are important to pulse-jet mixer (PJM) performance in WTP vessels with elevated concentrations of solids.

  5. Importance of van der Waals interaction on structural, vibrational, and thermodynamic properties of NaCl

    Science.gov (United States)

    Marcondes, Michel L.; Wentzcovitch, Renata M.; Assali, Lucy V. C.

    2018-05-01

    Thermal equations of state (EOS) are essential in several scientific domains. However, experimental determination of EOS parameters may be limited at extreme conditions, therefore, ab initio calculations have become an important method to obtain them. Density functional theory (DFT) and its extensions with various degrees of approximations for the exchange and correlation (XC) energy is the method of choice, but large errors in the EOS parameters are still common. The alkali halides have been problematic from the onset of this field and the quest for appropriate DFT functionals for such ionic and relatively weakly bonded systems has remained an active topic of research. Here we use DFT + van der Waals functionals to calculate vibrational properties, thermal EOS, thermodynamic properties, and the B1 to B2 phase boundary of NaCl with high precision. Our results reveal a remarkable improvement over the performance of standard local density approximation and generalized gradient approximation functionals for all these properties and phase transition boundary, as well as great sensitivity of anharmonic effects on the choice of XC functional.

  6. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  7. Identifying potential heirs properties in the Southeastern United States: a new GIS methodology utilizing mass appraisal data

    Science.gov (United States)

    Scott Pippin; Shana Jones; Cassandra. Johnson Gaither

    2017-01-01

    This report presents a methodology for identifying land parcels that have an increased probability of being heirs property. Heirs property is inherited land passed to successive generations intestate, without clear title, typically to family members. This land ownership type is widespread among rural, African-American populations and is also thought to be pervasive in...

  8. Investigations on Important Properties of the 10 cm x 10 cm GEM Prototype

    CERN Document Server

    Saenboonruang, Kiadtisak; Kulasri, Kittipong; Ritthirong, Anawat

    2015-01-01

    The Gas Electron Multiplier (GEM) detector is one of promising particle and radiation detectors that has been improved greatly from previous gas detectors. The improvement includes better spatial resolutions, higher detection rate capabilities, and flexibilities in designs. In particular, the 10 cm x 10 cm GEM prototype is designed and provided by the Gas Detectors Development group (GDD) at CERN, Switzerland. With its simplicity in operations and designs, while still maintaining high qualities, the GEM prototype is suitable for both start-up and advanced researches. This article aims to report the investigations on some important properties of the 10 cm x 10 cm GEM detector using current measurement and signal counting. Results have shown that gains of the GEM prototype exponentially increase as voltage supplied to the detector increases, while the detector reaches full efficiency (plateau region) when the voltage is greater than 4100 V. In terms of signal sharing between X and Y strips of the readout, X str...

  9. Structure, stability, and properties of the trans peroxo nitrate radical: the importance of nondynamic correlation.

    Science.gov (United States)

    Dutta, Achintya Kumar; Dar, Manzoor; Vaval, Nayana; Pal, Sourav

    2014-02-27

    We report a comparative single-reference and multireference coupled-cluster investigation on the structure, potential energy surface, and IR spectroscopic properties of the trans peroxo nitrate radical, one of the key intermediates in stratospheric NOX chemistry. The previous single-reference ab initio studies predicted an unbound structure for the trans peroxo nitrate radical. However, our Fock space multireference coupled-cluster calculation confirms a bound structure for the trans peroxo nitrate radical, in accordance with the experimental results reported earlier. Further, the analysis of the potential energy surface in FSMRCC method indicates a well-behaved minima, contrary to the shallow minima predicted by the single-reference coupled-cluster method. The harmonic force field analysis, of various possible isomers of peroxo nitrate also reveals that only the trans structure leads to the experimentally observed IR peak at 1840 cm(-1). The present study highlights the critical importance of nondynamic correlation in predicting the structure and properties of high-energy stratospheric NOx radicals.

  10. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  11. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  12. Candidate nematicidal proteins in a new Pseudomonas veronii isolate identified by its antagonistic properties against Xiphinema index.

    Science.gov (United States)

    Canchignia, Hayron; Altimira, Fabiola; Montes, Christian; Sánchez, Evelyn; Tapia, Eduardo; Miccono, María; Espinoza, Daniel; Aguirre, Carlos; Seeger, Michael; Prieto, Humberto

    2017-03-17

    The nematode Xiphinema index affects grape vines and transmits important viruses associated with fanleaf degeneration. Pseudomonas spp. are an extensive bacterial group in which important biodegradation and/or biocontrol properties can occur for several strains in the group. The aim of this study was to identify new Pseudomonas isolates with antagonist activity against X. index. Forty bacterial isolates were obtained from soil and root samples from Chilean vineyards. Thirteen new fluorescent pseudomonads were found and assessed for their antagonistic capability. The nematicide Pseudomonas protegens CHA0 was used as a control. Challenges of nematode individuals in King's B semi-solid agar Petri dishes facilitated the identification of the Pseudomonas veronii isolate R4, as determined by a 16S rRNA sequence comparison. This isolate was as effective as CHA0 as an antagonist of X. index, although it had a different lethality kinetic. Milk-induced R4 cultures exhibited protease and lipase activities in cell supernatants using both gelatin/tributyrin Petri dish assays and zymograms. Three proteins with these activities were isolated and subjected to mass spectrometry. Amino acid partial sequences enabled the identification of a 49-kDa protease similar to metalloprotease AprA and two lipases of 50 kDa and 69 kDa similar to LipA and ExoU, respectively. Electron microscopy analyses of challenged nematodes revealed degraded cuticle after R4 supernatant treatment. These results represent a new and unexplored property in this species associated with the presence of secretable lipases and protease, similar to characterized enzymes present in biocontrol pseudomonads.

  13. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  14. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  15. Recognizing brain motor imagery activities by identifying chaos properties of oxy-hemoglobin dynamics time series

    International Nuclear Information System (INIS)

    Khoa, Truong Quang Dang; Yuichi, Nakamura; Masahiro, Nakagawa

    2009-01-01

    In recent years, functional near-infrared spectroscopy (NIRS) has been introduced as a new neuroimaging modality with which to conduct functional brain-imaging studies. With its advanced features, NIRS signal processing has become a very attractive field in computational science. This work explores nonlinear physical aspects of cerebral hemodynamic changes over the time series of NIRS. Detecting the presence of chaos in a dynamical system is an important problem in studying the irregular or chaotic motion that is generated by nonlinear systems whose dynamical laws uniquely determine the time of evolution of a state of the system. The strategy results directly from the definition of the largest Lyapunov exponent. The Lyapunov exponents quantify the exponential divergence of initially close state-space trajectories and estimate the amount of chaos in a system. The method is an application of the Rosenstein algorithm, an efficient method for calculating the largest Lyapunov exponent from an experimental time series. In the present paper, the authors focus mainly on the detection of chaos characteristics of the time series associated to hemoglobin dynamics. Furthermore, the chaos parameters obtained can be used to identify the active state period of the human brain.

  16. 76 FR 27377 - Additional Identifying Information Associated With Persons Whose Property and Interests in...

    Science.gov (United States)

    2011-05-11

    ... 13572 of April 29, 2011, ``Blocking Property of Certain Persons With Respect to Human Rights Abuses in... 29, 2011, ``Blocking Property of Certain Persons with Respect to Human Rights Abuses in Syria... Emergency Economic Powers Act (50 U.S.C. 1701-06). In the Order, the President expanded the scope of the...

  17. 75 FR 61246 - Additional Identifying Information Associated With Persons Whose Property and Interests in...

    Science.gov (United States)

    2010-10-04

    ... situation in North Korea. Section 1 of the Order blocks, with certain exceptions, all property and interests...), Sosong Street, Kyongrim-Dong, Pyongyang, Korea, North; Changgwang Street, Pyongyang, Korea, North [DPRK...

  18. Inulin and Oligofructosis: a review about functional properties, prebiotic effects and importance for food industry

    Directory of Open Access Journals (Sweden)

    Maria Celia de Oliveira Hauly

    2002-01-01

    Full Text Available Nowadays consumers are more conscious about the relation between food and health. Therefore food industry has been looking for food that has a lot of benefits besides good flavor and appearance. Inulin and oligofructose are fructose polimers, vastly found in plants as storage carbohydrates. They present important functional for the food industry. Both inulin and oligofructose have been used as fiber bulk in food products. Differently from other fibers, they do not add flavor, allowing the food to be improved without changing its viscosity. Inulin and oligofructose have similar nutritional properties. Inulin is more indicated for obtaining products with a low fat content such as ice cream, cake and soup, while oligofructose is indicated for yogurt with a low caloric value and in order to mask the residual flavor from high intensity sweeteners used in food preparation. Research has shown that inulin and oligofructose have prebiotic effects because they are not digestible and they can develop bifidogenic effects, improving the intestinal microflora. The simultaneous use of inulin and oligofructose with probiotic agents in food is recommended for symbiotic effects.

  19. Sea Cucumber Glycosides: Chemical Structures, Producing Species and Important Biological Properties.

    Science.gov (United States)

    Mondol, Muhammad Abdul Mojid; Shin, Hee Jae; Rahman, M Aminur; Islam, Mohamad Tofazzal

    2017-10-17

    Sea cucumbers belonging to echinoderm are traditionally used as tonic food in China and other Asian countries. They produce abundant biologically active triterpene glycosides. More than 300 triterpene glycosides have been isolated and characterized from various species of sea cucumbers, which are classified as holostane and nonholostane depending on the presence or absence of a specific structural unit γ(18,20)-lactone in the aglycone. Triterpene glycosides contain a carbohydrate chain up to six monosaccharide units mainly consisting of d-xylose, 3-O-methy-d-xylose, d-glucose, 3-O-methyl-d-glucose, and d-quinovose. Cytotoxicity is the common biological property of triterpene glycosides isolated from sea cucumbers. Besides cytotoxicity, triterpene glycosides also exhibit antifungal, antiviral and hemolytic activities. This review updates and summarizes our understanding on diverse chemical structures of triterpene glycosides from various species of sea cucumbers and their important biological activities. Mechanisms of action and structural-activity relationships (SARs) of sea cucumber glycosides are also discussed briefly.

  20. What makes astronomical heritage valuable? Identifying potential Outstanding Universal Value in cultural properties relating to astronomy

    Science.gov (United States)

    Cotte, Michel

    2016-10-01

    This communication presents the situation regarding astronomical and archaeoastronomical heritage related to the World Heritage Convention through recent years up until today. Some parallel events and works were promoted strongly within the IAU-UNESCO Initiative during the International Year of Astronomy (2009). This was followed by a joint program by the IAU and ICOMOS-an official advisory body assisting the World Heritage Committee in the evaluation of nomination dossiers. The result of that work is an important publication by around 40 authors from 20 different countries all around the world: Heritage Sites of Astronomy and Archaeoastronomy in the Context of the UNESCO World Heritage Convention (Ruggles & Cotte 2010). A second volume is under preparation (2015). It was also accompanied by some initiatives such as the ``Windows to the Universe" organisation and the parallel constitution of local ``Starlight Reserves''. Some regional meetings studying specific facets or regional heritage in the field giving significant knowledge progresses also accompanied the global trend for astronomical heritage. WH assessment is defined by a relatively strict format and methodology. A key phrase is ``demonstration of Outstanding Universal Value'' to justify the WH Listing by the Committee. This communication first examines the requirements and evaluation practices about of demonstrating OUV for a given place in the context of astronomical or archaeoastronomical heritage. That means the examination of the tangible attributes, an inventory of the property in terms of immoveable and moveable components and an inventory of intangible issues related to the history (history of the place in the context of the history of astronomy and cultural history). This is also related to the application to the site of the concept of integrity and authenticity, as regards the place itself and in comparison with other similar places (WH sites already listed, sites on national WH Tentative Lists

  1. Identifying the Physical Properties of Showers That Influence User Satisfaction to Aid in Developing Water-Saving Showers

    Directory of Open Access Journals (Sweden)

    Minami Okamoto

    2015-07-01

    Full Text Available This research was conducted with the goal of clarifying the required conditions of water-saving showerheads. In order to this, the research analyzes the mutual relationship between water usage flow, the level of satisfaction and the physical properties of spray of showerheads. The physical properties of spray were measured using physical properties test apparatus of standard or scheme for water-saving showerheads issued in several water-saving countries, and satisfaction evaluation data was acquired through bathing experiments. The evaluated showerheads were separated into three groups according to usage water flow and the level of satisfaction. The relationships between usage water flow, the level of satisfaction and physical properties were compared. The results identified that Spray Force and Spray Force-per-Hole were physical properties that influence usage water flow. Spray force-per-hole, water volume ratio in Spray Patterns within φ 100 and φ 150, Temperature Drop and Spray Angle were identified as physical properties that influenced the level of satisfaction. The level of satisfaction and usage water flow has a spurious correlation through the physical properties of Spray Force-per-Hole and Temperature Drop. It is possible to improve the level of satisfaction independent of amount of water usage through designs that set an appropriate value for water volume ratio and Spray Angle for Spray Patterns within φ 100 and φ 150.

  2. Importance of the Recurrent Tax on Immovable Property in the Tax Systems of EU Countries

    OpenAIRE

    Břetislav Andrlík; Lucie Formanová

    2014-01-01

    This paper deals with the issue of the recurrent tax on immovable property and its significance in the tax systems of the EU Member States. The recurrent tax on immovable property is classified as property taxes, also according to the international methodology of the classification of taxes. This tax is imposed on the owners (in some cases on the lessee or user) of the immovable property in the various tax jurisdictions and belong to the taxes that the taxpayer cannot avoid and from this pers...

  3. The importance of fuel properties in the formation of nitrogen oxides and in combustion

    International Nuclear Information System (INIS)

    Huotari, J.; Aho, M.; Haemaelaeinen, J.; Huotari, J.; Saastamoinen, J.; Rantanen, J.

    1995-01-01

    The goal of this work is to find new information about the effects of pressure, temperature and fuel properties (Fuel-O/Fuel-N) on the formation of nitrogen oxides through the most important intermediates (NH 3 and HCN). In addition, a single particle model for the simultaneous pyrolysis and char combustion will be improved to be used for calculating combustion under pressure. Experimental work is done with an electrically heated pressurized entrained flow reactor (PEFR) which is equipped with modern analytics (as FT-IR for the analysis of N 2 O, NO and NO 2 and FT-IR pyrometry for the measurement of particle temperatures). The experimental work is carried out in several stages: (a) Study of the formation of HCN and NH 3 during pressurized pyrolysis (b) Oxidation of HCN and NH 3 to nitrogen oxides in pressurized combustion (c) Reduction of NO by NH 3 under pressure (thermax denox) Task a is performed with fuels of various O/N ratio. Task b is performed with pure HCN and NH 3 and with more complicated gas mixtures including HCN and NH 3 . A large part of these results are utilized in kinetic modelling in Aabo Akademi University, Finland in project LIEKKI 2-201. Two kinds of modelling work is performed in VTT in this project (a) Simultaneous modelling of the composition of solid and gaseous phases in the pyrolysis and combustion of a small fuel particle (multiphase modelling) (b) Modelling of pyrolysis and combustion of a single fuel particle under pressurized conditions (single particle modelling). The results can be used in planning of pressurized combustors and in minimizing the emissions of nitrogen oxides. (author)

  4. 77 FR 31068 - Additional Identifying Information Associated With Persons Whose Property and Interests in...

    Science.gov (United States)

    2012-05-24

    ... With Respect to Grave Human Rights Abuses by Governments of Iran and Syria via Information Technology... Human Rights Abuses by the Governments of Iran and Syria via Information Technology,'' whose property... Respect to Grave Human Rights Abuses by the Governments of Iran and Syria via Information Technology...

  5. 77 FR 39573 - Additional Identifying Information Associated With Persons Whose Property and Interests in...

    Science.gov (United States)

    2012-07-03

    ... of State, and the Secretary of Homeland Security may designate and block the property and interests... in, or providing financial or technological support for or to, or providing goods or services in..., DOB 24 Mar 1967; POB Sinaloa, Mexico; citizen Mexico; nationality Mexico; Passport TJT000291379...

  6. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  7. Study of material properties important for an optical property modulation-based radiation detection method for positron emission tomography

    OpenAIRE

    Tao, Li; Daghighian, Henry M.; Levin, Craig S.

    2017-01-01

    We compare the performance of two detector materials, cadmium telluride (CdTe) and bismuth silicon oxide (BSO), for optical property modulation-based radiation detection method for positron emission tomography (PET), which is a potential new direction to dramatically improve the annihilation photon pair coincidence time resolution. We have shown that the induced current flow in the detector crystal resulting from ionizing radiation determines the strength of optical modulation signal. A large...

  8. Use of genetic algorithm to identify thermophysical properties of deposited fouling in heat exchanger tubes

    International Nuclear Information System (INIS)

    Adili, Ali; Ben Salah, Mohieddine; Kerkeni, Chekib; Ben Nasrallah, Sassi

    2009-01-01

    At high temperature, the circulation of fluid in heat exchangers provides a tendency for fouling accumulation to take place on the internal surface of tubes. This paper shows an experimental process of thermophysical properties estimation of the fouling deposited on internal surface of a heat exchanger tube using genetic algorithms (GAs). The genetic algorithm is used to minimize an objective function containing calculated and measured temperatures. The experimental bench using a photothermal method with a finite width pulse heat excitation is used and the estimated parameters are obtained with high accuracy

  9. Importance of the Recurrent Tax on Immovable Property in the Tax Systems of EU Countries

    Directory of Open Access Journals (Sweden)

    Břetislav Andrlík

    2014-01-01

    Full Text Available This paper deals with the issue of the recurrent tax on immovable property and its significance in the tax systems of the EU Member States. The recurrent tax on immovable property is classified as property taxes, also according to the international methodology of the classification of taxes. This tax is imposed on the owners (in some cases on the lessee or user of the immovable property in the various tax jurisdictions and belong to the taxes that the taxpayer cannot avoid and from this perspective it represents a stable source of income for the public budgets of the modern market economies. This paper discusses the current state of the application of this tax in the tax systems of the Member States with an emphasis on numerical characteristics on the defined timeline. In frame of the analysis of the numerical characteristics there are use the primary sources, which are followed by the interpretation of the calculated results. The theoretical introduction is defining the theoretical basis for the application of this tax in modern tax systems and its conflict with the issue of double taxation.

  10. Identifying the changes of geo-engineering properties of dunites due to weathering utilizing electrical resistivity tomography (ERT)

    International Nuclear Information System (INIS)

    Ündül, Ömer; Tuğrul, Atiye; Zarif, İ Halil; Özyalın, Şenol

    2015-01-01

    Weathering phenomena have an important role in many construction facilities with varying depths and grades. Due to the anisotropic and heterogeneous nature of weathering profiles of some rocks, uncertainities exist in determining the geo-engineering properties. Geo-electrical studies have been utilized to overcome such uncertainities for various subsurface conditions including the determination of boundaries between weathered and unweathered parts of different rock types.In this study, the electrical resistivity tomography (ERT) results were correlated with conventional methods in determining the effects of weathering on the geo-engineering properties of dunites. During the research, weathering grades were determined by field studies including discontinuity spacings, aperture and properties of fill materials. The detailed petrographical studies, determination of petrophysical properties (e.g. water absorption and effective porosity) and mechanical properties (e.g. unconfined compressive strength (UCS)) constitute the laboratory studies. ERT studies were carried out in a row of sixty electrodes with electrode spacings of 0.5 m utilizing a Wenner–Schlumberger configuration. According to the comparison of the inversion model sections with the weathering profiles obtained by field and laboratory studies it is concluded that the use of ERT with a Wenner–Schlumberger configuration supplies comparable data for wider subsurface areas from the view of weathering and its effect on geo-engineering properties of dunites. In addition, ERT techniques are very useful where conventional techniques are inadequate in determining the full weathering profile. (paper)

  11. Importance of the textural characteristics of inert additives in the reduction of coal thermoplastic properties

    Energy Technology Data Exchange (ETDEWEB)

    A.M. Fernandez; C. Barriocanal; M.A. Diez; R. Alvarez [Instituto Nacional del Carbon, Oviedo (Spain)

    2010-11-15

    Seven carbonaceous materials of different origin were chosen in order to study the influence of their porous structure on the modification of the thermoplastic properties of a bituminous coal. The materials included were: two non-coking coals, a petroleum coke, coke fines, two residues from tyre recycling and a bituminous residue. The materials were heat-treated to 900{sup o}C to prevent any chemical interaction between the volatiles evolved during co-carbonization. The thermoplastic properties of blends that contained 10 wt.% of additive were measured by means of the Gieseler test. Microporosity was measured by CO{sub 2} adsorption at 273 K, whereas meso and macroporosity were determined by means of mercury porosimetry. The results of the porous structure assessment are discussed in relation to the modification of coal plasticity. 32 refs., 5 figs., 5 tabs.

  12. Identifying Mechanical Properties of Viscoelastic Materials in Time Domain Using the Fractional Zener Model

    Directory of Open Access Journals (Sweden)

    Ana Paula Delowski Ciniello

    Full Text Available Abstract The present paper aims at presenting a methodology for characterizing viscoelastic materials in time domain, taking into account the fractional Zener constitutive model and the influence of temperature through Williams, Landel, and Ferry’s model. To that effect, a set of points obtained experimentally through uniaxial tensile tests with different constant strain rates is considered. The approach is based on the minimization of the quadratic relative distance between the experimental stress-strain curves and the corresponding ones given by the theoretical model. In order to avoid the local minima in the process of optimization, a hybrid technique based on genetic algorithms and non-linear programming techniques is used. The methodology is applied in the characterization of two different commercial viscoelastic materials. The results indicate that the proposed methodology is effective in identifying thermorheologically simple viscoelastic materials.

  13. TECHNOLOGICAL AND FUNCTIONAL PROPERTIES OF LACTIC ACID BACTERIA: THE IMPORTANCE OF THESE MICROORGANISMS FOR FOOD

    Directory of Open Access Journals (Sweden)

    Amanda de Souza Motta

    2015-12-01

    Full Text Available Eacters of coccus or rods Gram-positive, catalase negative, non-sporulating, which produce lactic acid as the major end product during the fermentation of carbohydrates. When applied on food, provides beneficial effects to consumers through its functional and technological properties. With this the present review article, explore the potential application of lactic acid bacteria in food. The following genera are considered the principal lactic acid bacteria: Aerococcus, Carnobacterium, Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus and Weissella. These cultures have been used as starter or adjunct cultures for the fermentation of foods and beverages due to their contributions to the sensorial characteristics of these products and by microbiological stability. Their probiotic properties have also been investigated. More recent studies by indigenous cultures have received increased attention in light of the search for isolated cultures of a given raw material and a certain region. These microorganisms are being investigated for its functional and technological potential that may be applied in product development with its own characteristics and designation of origin. Those properties will be discussed in the present review in order to highlight the performance of these bacteria and the high degree of control over the fermentation process and standardization of the final product. The use of autochthonous cultures will be considered due the increase of studies of new cultures of lactic acid bacteria isolated of milk and meat of distinct products.

  14. Study of material properties important for an optical property modulation-based radiation detection method for positron emission tomography.

    Science.gov (United States)

    Tao, Li; Daghighian, Henry M; Levin, Craig S

    2017-01-01

    We compare the performance of two detector materials, cadmium telluride (CdTe) and bismuth silicon oxide (BSO), for optical property modulation-based radiation detection method for positron emission tomography (PET), which is a potential new direction to dramatically improve the annihilation photon pair coincidence time resolution. We have shown that the induced current flow in the detector crystal resulting from ionizing radiation determines the strength of optical modulation signal. A larger resistivity is favorable for reducing the dark current (noise) in the detector crystal, and thus the higher resistivity BSO crystal has a lower (50% lower on average) noise level than CdTe. The CdTe and BSO crystals can achieve the same sensitivity under laser diode illumination at the same crystal bias voltage condition while the BSO crystal is not as sensitive to 511-keV photons as the CdTe crystal under the same crystal bias voltage. The amplitude of the modulation signal induced by 511-keV photons in BSO crystal is around 30% of that induced in CdTe crystal under the same bias condition. In addition, we have found that the optical modulation strength increases linearly with crystal bias voltage before saturation. The modulation signal with CdTe tends to saturate at bias voltages higher than 1500 V due to its lower resistivity (thus larger dark current) while the modulation signal strength with BSO still increases after 3500 V. Further increasing the bias voltage for BSO could potentially further enhance the modulation strength and thus, the sensitivity.

  15. Investigation of soil properties for identifying recharge characteristics in the Lake Chad Basin

    Science.gov (United States)

    Banks, M. L.; Ndunguru, G. G.; Adisa, S. J.; Lee, J.; Adegoke, J. O.; Goni, I. B.; Grindley, J.; Mulugeta, V.

    2009-12-01

    Lake Chad was once labeled as one of the largest fresh water lakes in the world, providing water and livelihood to over 20 million people. The lake is shared by six different countries; Chad Nigeria, Niger, Cameroon, Central African Republic, and Sudan. Since the 1970 to date, a significant decrease in the size of the lake has been observed with the use of satellite imagery. This shrinking of the lake has been blamed on global warming, population increase and poor water management by the agriculture industry for farming purpose for both plants and animals. While these can be all valid reasons for the decrease of Lake Chad, we see the need to examine environmental and hydrological evidence around the Lake Chad basin. This study was carried out from upper stream to lower stream leading from Kano to the Damatru region which is one of several water bodies that supply Lake Chad. Over seventy six sites were sampled for soil texture, bulk density and other physical properties to investigate recharge capacity of the basin especially along the stream. Soils were collected using a soil core and properly stored at 4 degrees Celsius. Soils were weighed and put to dry at 105 degrees for twenty four hours. Dry weight was recorded and bulk density was calculated. The wet sieve method was used to determine the particle size analysis. Soils were weighed to 10 grams and hydrogen peroxide added to separate particles. Samples were washed with water and put to dry overnight. Soils were reweighed and sieved to separate as course sand, fine sand and silt and clay. The data revealed that in the upstream, coarse sand continuously decreased while silt and clay continuously increased down toward the lake. At mid stream silt and clay had significantly higher values when compared to coarse sand and fine sand. In the lower stream, bulk density clearly decreased compared to the upper and mid streams. Correlations will be carried out to investigate the particle size analysis and bulk density with

  16. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  17. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  18. Antimicrobial properties of nest volatiles in red imported fire ants, Solenopsis invicta (Hymenoptera: Formicidae)

    Science.gov (United States)

    In social insects, antimicrobial secretions are often used collectively for the benefit of the whole colony, which is an important component in social immunity. Many ant species build nests in which air circulation can be controlled. Volatile antimicrobial agents would be ideal in implementing socia...

  19. Capturing optically important constituents and properties in a marine biogeochemical and ecosystem model

    Science.gov (United States)

    Dutkiewicz, S.; Hickman, A. E.; Jahn, O.; Gregg, W. W.; Mouw, C. B.; Follows, M. J.

    2015-07-01

    We present a numerical model of the ocean that couples a three-stream radiative transfer component with a marine biogeochemical-ecosystem component in a dynamic three-dimensional physical framework. The radiative transfer component resolves the penetration of spectral irradiance as it is absorbed and scattered within the water column. We explicitly include the effect of several optically important water constituents (different phytoplankton functional types; detrital particles; and coloured dissolved organic matter, CDOM). The model is evaluated against in situ-observed and satellite-derived products. In particular we compare to concurrently measured biogeochemical, ecosystem, and optical data along a meridional transect of the Atlantic Ocean. The simulation captures the patterns and magnitudes of these data, and estimates surface upwelling irradiance analogous to that observed by ocean colour satellite instruments. We find that incorporating the different optically important constituents explicitly and including spectral irradiance was crucial to capture the variability in the depth of the subsurface chlorophyll a (Chl a) maximum. We conduct a series of sensitivity experiments to demonstrate, globally, the relative importance of each of the water constituents, as well as the crucial feedbacks between the light field, the relative fitness of phytoplankton types, and the biogeochemistry of the ocean. CDOM has proportionally more importance at attenuating light at short wavelengths and in more productive waters, phytoplankton absorption is relatively more important at the subsurface Chl a maximum, and water molecules have the greatest contribution when concentrations of other constituents are low, such as in the oligotrophic gyres. Scattering had less effect on attenuation, but since it is important for the amount and type of upwelling irradiance, it is crucial for setting sea surface reflectance. Strikingly, sensitivity experiments in which absorption by any of the

  20. Importance of intrinsic properties of dense caseinate dispersions for structure formation.

    Science.gov (United States)

    Manski, Julita M; van Riemsdijk, Lieke E; van der Goot, Atze J; Boom, Remko M

    2007-11-01

    Rheological measurements of dense calcium caseinate and sodium caseinate dispersions (> or =15%) provided insight into the factors determining shear-induced structure formation in caseinates. Calcium caseinate at a sufficiently high concentration (30%) was shown to form highly anisotropic structures during shearing and concurrent enzymatic cross-linking. In contrast, sodium caseinate formed isotropic structures using similar processing conditions. The main difference between the two types of caseinates is the counterion present, and as a consequence, the size of structural elements and their interactions. The rheological behavior of calcium caseinate and sodium caseinate reflected these differences, yielding non-monotonic and shear thinning flow behavior for calcium caseinate whereas sodium caseinate behaved only slightly shear thinning. It appears that the intrinsic properties of the dense caseinate dispersions, which are reflected in their rheological behavior, affect the structure formation that was found after applying shear. Therefore, rheological measurements are useful to obtain an indication of the structure formation potential of caseinate dispersions.

  1. Importance of non-parabolic band effects in the thermoelectric properties of semiconductors

    Science.gov (United States)

    Chen, Xin; Parker, David; Singh, David J.

    2013-01-01

    We present an analysis of the thermoelectric properties of of n-type GeTe and SnTe in relation to the lead chalcogenides PbTe and PbSe. We find that the singly degenerate conduction bands of semiconducting GeTe and SnTe are highly non-ellipsoidal, even very close to the band edges. This leads to isoenergy surfaces with a strongly corrugated shape that is clearly evident at carrier concentrations well below 0.005 e per formula unit (7–9 × 1019 cm−3 depending on material). Analysis within Boltzmann theory suggests that this corrugation may be favorable for the thermoelectric transport. Our calculations also indicate that values of the power factor for these two materials may well exceed those of PbTe and PbSe. As a result these materials may exhibit n-type performance exceeding that of the lead chalcogenides. PMID:24196778

  2. Thermal and physicochemical properties important for the long term behavior of nuclear waste glasses

    International Nuclear Information System (INIS)

    Vernaz, E.; Matzke, H.J.

    1992-01-01

    High level nuclear waste from reprocessing of spent nuclear fuel has to be solidified in a stable matrix for safe long-time storage. Vitrification in borosilicate glasses is the technique accepted worldwide. A number of different glasses was developed in different national programs. The criteria and the reasons for selecting the final compositions are briefly described. Emphasis is placed on the French product R7T7 and on thermal and physicochemical properties though glasses developed in other national projects (e.g. the German product GP 98/12 etc.) are also treated. The basic physical and mechanical properties and the chemical durability of the glass in contact with water or other aqueous solutions are described. The basic mechanisms of aqueous corrosion are discussed and the evolving modelling of the leaching process is dealt with, as well as effects of container material, backfill, etc. The thermal behavior has also been studied and extensive data exist on diffusion of glass constituents (Na) and of interesting elements of the waste such as the alkalis Rb and Cs or the actinides U and Pu, as well as on crystallization processes in the glass during storage at elevated temperatures. Emphasis is placed on the radiation stability of the glasses, based on extensive studies using short-lived actinides (e.g. Cm-244) or ion-implantation to produce the damage expected during long storage at an accelerated rate. The radiation stability is shown to be very good, if realistic damage conditions are used. The knowledge accumulated in the past years is used to evaluate and predict the long-term evolution of the glass under storage conditions

  3. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  4. Sensory properties of chile pepper heat - and its importance to food quality and cultural preference.

    Science.gov (United States)

    Guzmán, Ivette; Bosland, Paul W

    2017-10-01

    Chile peppers are one of the most important vegetable and spice crops in the world. They contain capsaicinoids that are responsible for the characteristic burning (pungency) sensation. Currently, there are 22 known naturally occurring capsaicinoids that can cause the heat sensation when consumed. Each produces a different heat sensation effect in the mouth. A need exists for a standard and new terminology to describe the complex heat sensation one feels when eating a chile pepper. A comprehensive set of descriptors to describe the sensory characteristics of chile pepper heat was developed. It was validated with trained panelists tasting samples representing the five domesticated species and 14 pod-types within these species. Five key attributes that define and reference a lexicon for describing the heat sensation of chile peppers were determined to describe the heat sensation in any product, and importantly, can be used in the food industry worldwide. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Properties of Two Novel Esterases Identified from Culture Supernatant of Penicillium purpurogenum Grown on Sugar Beet Pulp.

    Science.gov (United States)

    Oleas, Gabriela; Callegari, Eduardo; Sepulveda, Romina; Eyzaguirre, Jaime

    2016-01-01

    The filamentous fungus Penicillium purpurogenum grows on a variety of natural carbon sources, such as sugar beet pulp, and secretes to the medium a large number of enzymes that degrade the carbohydrate components of lignocellulose. Sugar beet pulp is rich in pectin, and the purpose of this work is to identify novel esterases produced by the fungus, which may participate in pectin degradation. Partially purified culture supernatants of the fungus grown on sugar beet pulp were subjected to mass spectrometry analysis. Peptides thus identified, which may be part of potential esterases were probed against the proteins deduced from the fungal genome sequence. The cDNAs of two putative esterases identified were expressed in Pichia pastoris and their properties studied. One of these enzymes, named FAET, is a feruloyl esterase, while the other, PE, is classified as a pectin methyl esterase. These findings add to our knowledge of the enzymology of pectin degradation by Penicillium purpurogenum, and define properties of two novel esterases acting on de-esterification of pectin. Their availability may be useful as tools for the study of pectin structure and degradation.

  6. How important are scaffolds and their surface properties in regenerative medicine

    Energy Technology Data Exchange (ETDEWEB)

    Idaszek, J.; Kijeńska, E.; Łojkowski, M.; Swieszkowski, W., E-mail: wojciech.swieszkowski@inmat.pw.edu.pl

    2016-12-01

    Highlights: • Cell performance on AM scaffolds can be controlled by modification of surface chemistry as well as their architecture. • Introduction of chemical groups/particles increasing surface wettability and surface energy has a positive effect on cell retention and adhesion. • The properties of nanofiber scaffold like fibers orientation, wettability, roughness and chemical composition direct spreading, proliferation, maturation and differentiation of the cells promoting tissue re-growth. - Abstract: The ability of cells to sense various cues present within their natural habitat gives a tremendous opportunity to steer their fate in vitro within artificial matrices (scaffolds). However, the variety of signals and their chemical and physical origin makes engineering of the scaffolds quite challenging and requires careful design in order to obtained the desired outcome. Herein, we discuss the effect of architecture and surface of scaffolds fabricated by means of additive manufacturing and electrospinning on cell retention, spreading, proliferation and differentiation. Additionally, we present some of the reported surface and bulk modifications of the scaffolds, which positively affected cell performance. Finally, in the last part we discuss application of multicellular spheroids as a useful tool to study cell performance within three-dimensional and porous structures.

  7. Phytochemical and Pharmacological Properties of Gymnema sylvestre: An Important Medicinal Plant

    Directory of Open Access Journals (Sweden)

    Pragya Tiwari

    2014-01-01

    Full Text Available Gymnema sylvestre (Asclepiadaceae, popularly known as “gurmar” for its distinct property as sugar destroyer, is a reputed herb in the Ayurvedic system of medicine. The phytoconstituents responsible for sweet suppression activity includes triterpene saponins known as gymnemic acids, gymnemasaponins, and a polypeptide, gurmarin. The herb exhibits a broad range of therapeutic effects as an effective natural remedy for diabetes, besides being used for arthritis, diuretic, anemia, osteoporosis, hypercholesterolemia, cardiopathy, asthma, constipation, microbial infections, indigestion, and anti-inflammatory. G. sylvestre has good prospects in the treatment of diabetes as it shows positive effects on blood sugar homeostasis, controls sugar cravings, and promotes regeneration of pancreas. The herbal extract is used in dietary supplements since it reduces body weight, blood cholesterol, and triglyceride levels and holds great prospects in dietary as well as pharmacological applications. This review explores the transition of a traditional therapeutic to a modern contemporary medication with an overview of phytochemistry and pharmacological activities of the herb and its phytoconstituents.

  8. How important are scaffolds and their surface properties in regenerative medicine

    International Nuclear Information System (INIS)

    Idaszek, J.; Kijeńska, E.; Łojkowski, M.; Swieszkowski, W.

    2016-01-01

    Highlights: • Cell performance on AM scaffolds can be controlled by modification of surface chemistry as well as their architecture. • Introduction of chemical groups/particles increasing surface wettability and surface energy has a positive effect on cell retention and adhesion. • The properties of nanofiber scaffold like fibers orientation, wettability, roughness and chemical composition direct spreading, proliferation, maturation and differentiation of the cells promoting tissue re-growth. - Abstract: The ability of cells to sense various cues present within their natural habitat gives a tremendous opportunity to steer their fate in vitro within artificial matrices (scaffolds). However, the variety of signals and their chemical and physical origin makes engineering of the scaffolds quite challenging and requires careful design in order to obtained the desired outcome. Herein, we discuss the effect of architecture and surface of scaffolds fabricated by means of additive manufacturing and electrospinning on cell retention, spreading, proliferation and differentiation. Additionally, we present some of the reported surface and bulk modifications of the scaffolds, which positively affected cell performance. Finally, in the last part we discuss application of multicellular spheroids as a useful tool to study cell performance within three-dimensional and porous structures.

  9. Antimicrobial Activity – The Most Important Property of Probiotic and Starter Lactic Acid Bacteria

    Directory of Open Access Journals (Sweden)

    Blaženka Kos

    2010-01-01

    Full Text Available The antimicrobial activity of industrially important lactic acid bacteria as starter cultures and probiotic bacteria is the main subject of this review. This activity has been attributed to the production of metabolites such as organic acids (lactic and acetic acid, hydrogen peroxide, ethanol, diacetyl, acetaldehyde, acetoine, carbon dioxide, reuterin, reutericyclin and bacteriocins. The potential of using bacteriocins of lactic acid bacteria, primarily used as biopreservatives, represents a perspective, alternative antimicrobial strategy for continuously increasing problem with antibiotic resistance. Another strategy in resolving this problem is an application of probiotics for different gastrointestinal and urogenital infection therapies.

  10. Importance of gradients in membrane properties and electrical coupling in sinoatrial node pacing.

    Directory of Open Access Journals (Sweden)

    Shin Inada

    Full Text Available The sinoatrial node (SAN is heterogeneous in terms of cell size, ion channels, current densities, connexins and electrical coupling. For example, Nav1.5 (responsible for INa and Cx43 (responsible for electrical coupling are absent from the centre of the SAN (normally the leading pacemaker site, but present in the periphery (at SAN-atrial muscle junction. To test whether the heterogeneity is important for the functioning of the SAN, one- and two-dimensional models of the SAN and surrounding atrial muscle were created. Normal functioning of the SAN (in terms of cycle length, position of leading pacemaker site, conduction times, activation and repolarization sequences and space constants was observed when, from the centre to the periphery, (i cell characteristics (cell size and ionic current densities were changed in a gradient fashion from a central-type (lacking INa to a peripheral-type (possessing INa and (ii coupling conductance was increased in a gradient fashion. We conclude that the heterogeneous nature of the node is important for its normal functioning. The presence of Nav1.5 and Cx43 in the periphery may be essential for the node to be able to drive the atrial muscle: Nav1.5 provides the necessary depolarizing current and Cx43 delivers it to the atrial muscle.

  11. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  12. Therapy against organophosphate poisoning: The importance of anticholinergic drugs with antiglutamatergic properties

    International Nuclear Information System (INIS)

    Weissman, Ben Avi; Raveh, Lily

    2008-01-01

    Potent cholinesterase inhibitors (e.g., soman, sarin), induce a wide range of deleterious effects including convulsions, behavioral impairments and ultimately, death. Due to the likelihood of various scenarios of military or terrorist attacks by these and other chemical weapons, research has to be aimed at finding optimal therapies. Early accumulation of acetylcholine in synaptic clefts was suggested to trigger an array of toxic events including an excessive release of glutamate, culminating in the activation of its receptors. Stimulation of the N-Methyl-D-Aspartate (NMDA) subtype of these receptors was associated with the neuronal injury that initiates organophosphate-induced brain damage. The notion of a stepwise mechanism yielded treatments based on a combination of an immediate administration of enzyme reactivators and anticholinergic drugs. This strategy dramatically increased survival rates but did not abolish convulsions and failed to prevent the ensuing cognitive dysfunction. Efforts to improve this paradigm by adding anticonvulsants or antiglutamatergic drugs with anti-epileptic characteristics produced dubious results. Under these conditions, benactyzine and caramiphen, agents with anticholinergic and antiglutamatergic properties, provided improved protection when introduced as adjunct agents to oximes, reversible cholinesterase inhibitors and/or specific antimuscarinic drugs such as atropine. In contrast, the specific antimuscarinic drug scopolamine failed to block soman-induced changes in glutamatergic and behavioral parameters even when given prophylactically. These findings along with a large number of additional reports led towards the conclusion that the therapeutic advantage of drugs such as benactyzine and caramiphen could derive from their ability to modulate central cholinergic and glutamate neurotransmission

  13. The Importance of Hurricane Research to Life, Property, the Economy, and National Security.

    Science.gov (United States)

    Busalacchi, A. J.

    2017-12-01

    The devastating 2017 Atlantic hurricane season has brought into stark relief how much hurricane forecasts have improved - and how important it is to make them even better. Whereas the error in 48-hour track forecasts has been reduced by more than half, according to the National Hurricane Center, intensity forecasts remain challenging, especially with storms such as Harvey that strengthened from a tropical depression to a Category 4 hurricane in less than three days. The unusually active season, with Hurricane Irma sustaining 185-mph winds for a record 36 hours and two Atlantic hurricanes reaching 150-mph winds simultaneously for the first time, also highlighted what we do, and do not, know about how tropical cyclones will change as the climate warms. The extraordinary toll of Hurricanes Harvey, Irma, and Maria - which may ultimately be responsible for hundreds of deaths and an estimated $200 billion or more in damages - underscores why investments into improved forecasting must be a national priority. At NCAR and UCAR, scientists are working with their colleagues at federal agencies, the private sector, and the university community to advance our understanding of these deadly storms. Among their many projects, NCAR researchers are making experimental tropical cyclone forecasts using an innovative Earth system model that allows for variable resolution. We are working with NOAA to issue flooding, inundation, and streamflow forecasts for areas hit by hurricanes, and we have used extremely high-resolution regional models to simulate successfully the rapid hurricane intensification that has proved so difficult to predict. We are assessing ways to better predict the damage potential of tropical cyclones by looking beyond wind speed to consider such important factors as the size and forward motion of the storm. On the important question of climate change, scientists have experimented with running coupled climate models at a high enough resolution to spin up a hurricane

  14. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  15. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  16. Effect of important operating parameters on product properties and operation of HDPE slurry reactor

    International Nuclear Information System (INIS)

    Soltanieh, M.; Remezani Saadat Abadi, A.; Dashti, A.; Mokhtari, J.

    2007-01-01

    In this article, a complete model for the mixed flow slurry reactor for polymerization of ethylene to high density polyethylene in the presence of Ziegler-Natta catalyst is presented. In addition to the effects of the multiple active sites, the effect of other important parameters such as the catalyst concentration, co-catalyst, hydrogen, monomer, impurities and pressure on the mass-average and number-average polymer product chain length, the average product distribution index and the required residence time for the reactor were investigated. The simulation results show that as the catalyst, hydrogen and solvent concentrations increase, the mass and number-average polymer chain length decrease, whereas with increasing monomer concentration and pressure, the average molecular weight increases. The effects of these parameters on the polydispersity index and residence time do not follow the same trend and their relationship changes in some of these variables

  17. Stability of operational taxonomic units: an important but neglected property for analyzing microbial diversity.

    Science.gov (United States)

    He, Yan; Caporaso, J Gregory; Jiang, Xiao-Tao; Sheng, Hua-Fang; Huse, Susan M; Rideout, Jai Ram; Edgar, Robert C; Kopylova, Evguenia; Walters, William A; Knight, Rob; Zhou, Hong-Wei

    2015-01-01

    The operational taxonomic unit (OTU) is widely used in microbial ecology. Reproducibility in microbial ecology research depends on the reliability of OTU-based 16S ribosomal subunit RNA (rRNA) analyses. Here, we report that many hierarchical and greedy clustering methods produce unstable OTUs, with membership that depends on the number of sequences clustered. If OTUs are regenerated with additional sequences or samples, sequences originally assigned to a given OTU can be split into different OTUs. Alternatively, sequences assigned to different OTUs can be merged into a single OTU. This OTU instability affects alpha-diversity analyses such as rarefaction curves, beta-diversity analyses such as distance-based ordination (for example, Principal Coordinate Analysis (PCoA)), and the identification of differentially represented OTUs. Our results show that the proportion of unstable OTUs varies for different clustering methods. We found that the closed-reference method is the only one that produces completely stable OTUs, with the caveat that sequences that do not match a pre-existing reference sequence collection are discarded. As a compromise to the factors listed above, we propose using an open-reference method to enhance OTU stability. This type of method clusters sequences against a database and includes unmatched sequences by clustering them via a relatively stable de novo clustering method. OTU stability is an important consideration when analyzing microbial diversity and is a feature that should be taken into account during the development of novel OTU clustering methods.

  18. Modelling explicit tides in the Indonesian seas: An important process for surface sea water properties.

    Science.gov (United States)

    Nugroho, Dwiyoga; Koch-Larrouy, Ariane; Gaspar, Philippe; Lyard, Florent; Reffray, Guillaume; Tranchant, Benoit

    2017-06-16

    Very intense internal tides take place in Indonesian seas. They dissipate and affect the vertical distribution of temperature and currents, which in turn influence the survival rates and transports of most planktonic organisms at the base of the whole marine ecosystem. This study uses the INDESO physical model to characterize the internal tides spatio-temporal patterns in the Indonesian Seas. The model reproduced internal tide dissipation in agreement with previous fine structure and microstructure observed in-situ in the sites of generation. The model also produced similar water mass transformation as the previous parameterization of Koch-Larrouy et al. (2007), and show good agreement with observations. The resulting cooling at the surface is 0.3°C, with maxima of 0.8°C at the location of internal tides energy, with stronger cooling in austral winter. The cycle of spring tides and neap tides modulates this impact by 0.1°C to 0.3°C. These results suggest that mixing due to internal tides might also upwell nutrients at the surface at a frequency similar to the tidal frequencies. Implications for biogeochemical modelling are important. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  20. 41 CFR 102-75.75 - What is the most important consideration in evaluating a proposed transfer of excess real property?

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What is the most... Guidelines § 102-75.75 What is the most important consideration in evaluating a proposed transfer of excess real property? In every case of a proposed transfer of excess real property, the most important...

  1. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  2. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  4. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  5. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  6. Content Validity and Psychometric Properties of the Nomination Scale for Identifying Football Talent (NSIFT: Application to Coaches, Parents and Players

    Directory of Open Access Journals (Sweden)

    Alejandro Prieto-Ayuso

    2017-01-01

    Full Text Available The identification of football talent is a critical issue both for clubs and the families of players. However, despite its importance in a sporting, economic and social sense, there appears to be a lack of instruments that can reliably measure talent performance. The aim of this study was to design and validate the Nomination Scale for Identifying Football Talent (NSIFT, with the aim of optimising the processes for identifying said talent. The scale was first validated through expert judgment, and then statistically, by means of an exploratory factor analysis (EFA, confirmatory factor analysis (CFA, internal reliability and convergent validity. The results reveal the presence of three factors in the scale’s factor matrix, with these results being confirmed by the CFA. The scale revealed suitable internal reliability and homogeneity indices. Convergent validity showed that it is teammates who are best able to identify football talent, followed by coaches and parents. It can be concluded that the NSIFT is suitable for use in the football world. Future studies should seek to confirm these results in different contexts by means of further CFAs.

  7. The relative importance of climate and vegetation properties on patterns of North American breeding bird species richness

    International Nuclear Information System (INIS)

    Goetz, Scott J; Sun, Mindy; Zolkos, Scott; Hansen, Andy; Dubayah, Ralph

    2014-01-01

    Recent advances in remote sensing and ecological modeling warrant a timely and robust investigation of the ecological variables that underlie large-scale patterns of breeding bird species richness, particularly in the context of intensifying land use and climate change. Our objective was to address this need using an array of bioclimatic and remotely sensed data sets representing vegetation properties and structure, and other aspects of the physical environment. We first build models of bird species richness across breeding bird survey (BBS) routes, and then spatially predict richness across the coterminous US at moderately high spatial resolution (1 km). Predictor variables were derived from various sources and maps of species richness were generated for four groups (guilds) of birds with different breeding habitat affiliation (forest, grassland, open woodland, scrub/shrub), as well as all guilds combined. Predictions of forest bird distributions were strong (R 2 = 0.85), followed by grassland (0.76), scrub/shrub (0.63) and open woodland (0.60) species. Vegetation properties were generally the strongest determinants of species richness, whereas bioclimatic and lidar-derived vertical structure metrics were of variable importance and dependent upon the guild type. Environmental variables (climate and the physical environment) were also frequently selected predictors, but canopy structure variables were not as important as expected based on more local to regional scale studies. Relatively sparse sampling of canopy structure metrics from the satellite lidar sensor may have reduced their importance relative to other predictor variables across the study domain. We discuss these results in the context of the ecological drivers of species richness patterns, the spatial scale of bird diversity analyses, and the potential of next generation space-borne lidar systems relevant to vegetation and ecosystem studies. This study strengthens current understanding of bird species

  8. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  9. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  10. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  11. A Statistical Test for Identifying the Number of Creep Regimes When Using the Wilshire Equations for Creep Property Predictions

    Science.gov (United States)

    Evans, Mark

    2016-12-01

    A new parametric approach, termed the Wilshire equations, offers the realistic potential of being able to accurately lift materials operating at in-service conditions from accelerated test results lasting no more than 5000 hours. The success of this approach can be attributed to a well-defined linear relationship that appears to exist between various creep properties and a log transformation of the normalized stress. However, these linear trends are subject to discontinuities, the number of which appears to differ from material to material. These discontinuities have until now been (1) treated as abrupt in nature and (2) identified by eye from an inspection of simple graphical plots of the data. This article puts forward a statistical test for determining the correct number of discontinuities present within a creep data set and a method for allowing these discontinuities to occur more gradually, so that the methodology is more in line with the accepted view as to how creep mechanisms evolve with changing test conditions. These two developments are fully illustrated using creep data sets on two steel alloys. When these new procedures are applied to these steel alloys, not only do they produce more accurate and realistic looking long-term predictions of the minimum creep rate, but they also lead to different conclusions about the mechanisms determining the rates of creep from those originally put forward by Wilshire.

  12. Use of the Plant Defense Protein Osmotin To Identify Fusarium oxysporum Genes That Control Cell Wall Properties

    KAUST Repository

    Lee, H.

    2010-02-26

    Fusarium oxysporum is the causative agent of fungal wilt disease in a variety of crops. The capacity of a fungal pathogen such as F. oxysporum f. sp. nicotianae to establish infection on its tobacco (Nicotiana tabacum) host depends in part on its capacity to evade the toxicity of tobacco defense proteins, such as osmotin. Fusarium genes that control resistance to osmotin would therefore reflect coevolutionary pressures and include genes that control mutual recognition, avoidance, and detoxification. We identified FOR (Fusarium Osmotin Resistance) genes on the basis of their ability to confer osmotin resistance to an osmotin-sensitive strain of Saccharomyces cerevisiae. FOR1 encodes a putative cell wall glycoprotein. FOR2 encodes the structural gene for glutamine:fructose-6-phosphate amidotransferase, the first and rate-limiting step in the biosynthesis of hexosamine and cell wall chitin. FOR3 encodes a homolog of SSD1, which controls cell wall composition, longevity, and virulence in S. cerevisiae. A for3 null mutation increased osmotin sensitivity of conidia and hyphae of F. oxysporum f. sp. nicotianae and also reduced cell wall β-1,3-glucan content. Together our findings show that conserved fungal genes that determine cell wall properties play a crucial role in regulating fungal susceptibility to the plant defense protein osmotin.

  13. Use of the Plant Defense Protein Osmotin To Identify Fusarium oxysporum Genes That Control Cell Wall Properties

    KAUST Repository

    Lee, H.; Damsz, B.; Woloshuk, C. P.; Bressan, R. A.; Narasimhan, Meena L.

    2010-01-01

    Fusarium oxysporum is the causative agent of fungal wilt disease in a variety of crops. The capacity of a fungal pathogen such as F. oxysporum f. sp. nicotianae to establish infection on its tobacco (Nicotiana tabacum) host depends in part on its capacity to evade the toxicity of tobacco defense proteins, such as osmotin. Fusarium genes that control resistance to osmotin would therefore reflect coevolutionary pressures and include genes that control mutual recognition, avoidance, and detoxification. We identified FOR (Fusarium Osmotin Resistance) genes on the basis of their ability to confer osmotin resistance to an osmotin-sensitive strain of Saccharomyces cerevisiae. FOR1 encodes a putative cell wall glycoprotein. FOR2 encodes the structural gene for glutamine:fructose-6-phosphate amidotransferase, the first and rate-limiting step in the biosynthesis of hexosamine and cell wall chitin. FOR3 encodes a homolog of SSD1, which controls cell wall composition, longevity, and virulence in S. cerevisiae. A for3 null mutation increased osmotin sensitivity of conidia and hyphae of F. oxysporum f. sp. nicotianae and also reduced cell wall β-1,3-glucan content. Together our findings show that conserved fungal genes that determine cell wall properties play a crucial role in regulating fungal susceptibility to the plant defense protein osmotin.

  14. Willingness to Use Microbicides Is Affected by the Importance of Product Characteristics, Use Parameters, and Protective Properties

    Science.gov (United States)

    Morrow, Kathleen M.; Fava, Joseph L.; Rosen, Rochelle K.; Vargas, Sara; Barroso, Candelaria; Christensen, Anna L.; Woodsong, Cynthia; Severy, Lawrence

    2008-01-01

    Background Along with efficacy, a microbicide’s acceptability will be integral to its impact on the pandemic. Understanding Product Characteristics that users find most acceptable and determining who will use which type of product are key to optimizing use effectiveness. Objectives To evaluate psychometrically the Important Microbicide Characteristics (IMC) instrument and examine its relationship to willingness to use microbicides. Results Exploratory and confirmatory factor analyses revealed 2 IMC subscales (Cronbach’s coefficient α: Product Characteristics subscale (α = 0.84) and Protective Properties subscale (α = 0.89)). Significant differences on Product Characteristics subscale scores were found for history of douching (P = 0.002) and employment status (P = 0.001). Whether a woman used a method to prevent pregnancy or sexually transmitted disease (STD) in the last 3 months (P IMC instrument serves as a template for future studies of candidate microbicides. PMID:17325607

  15. Identifying sources of soil inorganic pollutants on a regional scale using a multivariate statistical approach: Role of pollutant migration and soil physicochemical properties

    International Nuclear Information System (INIS)

    Zhang Changbo; Wu Longhua; Luo Yongming; Zhang Haibo; Christie, Peter

    2008-01-01

    Principal components analysis (PCA) and correlation analysis were used to estimate the contribution of four components related to pollutant sources on the total variation in concentrations of Cu, Zn, Pb, Cd, As, Se, Hg, Fe and Mn in surface soil samples from a valley in east China with numerous copper and zinc smelters. Results indicate that when carrying out source identification of inorganic pollutants their tendency to migrate in soils may result in differences between the pollutant composition of the source and the receptor soil, potentially leading to errors in the characterization of pollutants using multivariate statistics. The stability and potential migration or movement of pollutants in soils must therefore be taken into account. Soil physicochemical properties may offer additional useful information. Two different mechanisms have been hypothesized for correlations between soil heavy metal concentrations and soil organic matter content and these may be helpful in interpreting the statistical analysis. - Principal components analysis with Varimax rotation can help identify sources of soil inorganic pollutants but pollutant migration and soil properties can exert important effects

  16. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  17. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  18. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  19. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  20. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  1. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  2. The importance of nuclear quantum effects in spectral line broadening of optical spectra and electrostatic properties in aromatic chromophores

    Science.gov (United States)

    Law, Y. K.; Hassanali, A. A.

    2018-03-01

    In this work, we examine the importance of nuclear quantum effects on capturing the line broadening and vibronic structure of optical spectra. We determine the absorption spectra of three aromatic molecules indole, pyridine, and benzene using time dependent density functional theory with several molecular dynamics sampling protocols: force-field based empirical potentials, ab initio simulations, and finally path-integrals for the inclusion of nuclear quantum effects. We show that the absorption spectrum for all these chromophores are similarly broadened in the presence of nuclear quantum effects regardless of the presence of hydrogen bond donor or acceptor groups. We also show that simulations incorporating nuclear quantum effects are able to reproduce the heterogeneous broadening of the absorption spectra even with empirical force fields. The spectral broadening associated with nuclear quantum effects can be accounted for by the broadened distribution of chromophore size as revealed by a particle in the box model. We also highlight the role that nuclear quantum effects have on the underlying electronic structure of aromatic molecules as probed by various electrostatic properties.

  3. Importance of soil-water relation in assessment endpoint in bioremediated soils: Plant growth and soil physical properties

    International Nuclear Information System (INIS)

    Li, X.; Sawatsky, N.

    1995-01-01

    Much effort has been focused on defining the end-point of bioremediated soils by chemical analysis (Alberta Tier 1 or CCME Guideline for Contaminated Soils) or toxicity tests. However, these tests do not completely assess the soil quality, or the capability of soil to support plant growth after bioremediation. This study compared barley (Hordeum vulgare) growth on: (i) non-contaminated, agricultural topsoil, (2) oil-contaminated soil (4% total extractable hydrocarbons, or TEH), and (3) oil-contaminated soil treated by bioremediation (< 2% TEH). Soil physical properties including water retention, water uptake, and water repellence were measured. The results indicated that the growth of barley was significantly reduced by oil-contamination of agricultural topsoil. Furthermore, bioremediation did not improve the barley yield. The lack of effects from bioremediation was attributed to development of water repellence in hydrocarbon contaminated soils. There seemed to be a critical water content around 18% to 20% in contaminated soils. Above this value the water uptake by contaminated soil was near that of the agricultural topsoil. For lower water contents, there was a strong divergence in sorptivity between contaminated and agricultural topsoil. For these soils, water availability was likely the single most important parameter controlling plant growth. This parameter should be considered in assessing endpoint of bioremediation for hydrocarbon contaminated soils

  4. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  5. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  6. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  7. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  8. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  9. 41 CFR 102-75.340 - Where hazardous substance activity has been identified on property proposed for disposal, what...

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Where hazardous... Provisions Relating to Hazardous Substance Activity § 102-75.340 Where hazardous substance activity has been... offer to purchase and the conveyance document? Where the existence of hazardous substance activity has...

  10. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  11. The importance of the biomimetic composites components for recreating the optical properties and molecular composition of intact dental tissues.

    Science.gov (United States)

    Seredin, P. V.; Goloshchapov, D. L.; Gushchin, M. S.; Ippolitov, Y. A.; Prutskij, T.

    2017-11-01

    The objective of this paper was to investigate whether it is possible to obtain biomimetic materials recreating the luminescent properties and molecular composition of intact dental tissues. Biomimetic materials were produced and their properties compared with native dental tissues. In addition, the overall contribution of the organic and non-organic components in the photoluminescence band was investigated. The results showed that it is possible to develop biomimetic materials with similar molecular composition and optical properties to native dental tissues for the early identification of dental caries.

  12. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  13. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  14. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  15. A New Approach to Identify Optimal Properties of Shunting Elements for Maximum Damping of Structural Vibration Using Piezoelectric Patches

    Science.gov (United States)

    Park, Junhong; Palumbo, Daniel L.

    2004-01-01

    The use of shunted piezoelectric patches in reducing vibration and sound radiation of structures has several advantages over passive viscoelastic elements, e.g., lower weight with increased controllability. The performance of the piezoelectric patches depends on the shunting electronics that are designed to dissipate vibration energy through a resistive element. In past efforts most of the proposed tuning methods were based on modal properties of the structure. In these cases, the tuning applies only to one mode of interest and maximum tuning is limited to invariant points when based on den Hartog's invariant points concept. In this study, a design method based on the wave propagation approach is proposed. Optimal tuning is investigated depending on the dynamic and geometric properties that include effects from boundary conditions and position of the shunted piezoelectric patch relative to the structure. Active filters are proposed as shunting electronics to implement the tuning criteria. The developed tuning methods resulted in superior capabilities in minimizing structural vibration and noise radiation compared to other tuning methods. The tuned circuits are relatively insensitive to changes in modal properties and boundary conditions, and can applied to frequency ranges in which multiple modes have effects.

  16. Predicting and analyzing DNA-binding domains using a systematic approach to identifying a set of informative physicochemical and biochemical properties

    Science.gov (United States)

    2011-01-01

    Background Existing methods of predicting DNA-binding proteins used valuable features of physicochemical properties to design support vector machine (SVM) based classifiers. Generally, selection of physicochemical properties and determination of their corresponding feature vectors rely mainly on known properties of binding mechanism and experience of designers. However, there exists a troublesome problem for designers that some different physicochemical properties have similar vectors of representing 20 amino acids and some closely related physicochemical properties have dissimilar vectors. Results This study proposes a systematic approach (named Auto-IDPCPs) to automatically identify a set of physicochemical and biochemical properties in the AAindex database to design SVM-based classifiers for predicting and analyzing DNA-binding domains/proteins. Auto-IDPCPs consists of 1) clustering 531 amino acid indices in AAindex into 20 clusters using a fuzzy c-means algorithm, 2) utilizing an efficient genetic algorithm based optimization method IBCGA to select an informative feature set of size m to represent sequences, and 3) analyzing the selected features to identify related physicochemical properties which may affect the binding mechanism of DNA-binding domains/proteins. The proposed Auto-IDPCPs identified m=22 features of properties belonging to five clusters for predicting DNA-binding domains with a five-fold cross-validation accuracy of 87.12%, which is promising compared with the accuracy of 86.62% of the existing method PSSM-400. For predicting DNA-binding sequences, the accuracy of 75.50% was obtained using m=28 features, where PSSM-400 has an accuracy of 74.22%. Auto-IDPCPs and PSSM-400 have accuracies of 80.73% and 82.81%, respectively, applied to an independent test data set of DNA-binding domains. Some typical physicochemical properties discovered are hydrophobicity, secondary structure, charge, solvent accessibility, polarity, flexibility, normalized Van Der

  17. Sign and magnitude scaling properties of heart rate variability in patients with end-stage renal failure: Are these properties useful to identify pathophysiological adaptations?

    Science.gov (United States)

    Lerma, Claudia; Echeverría, Juan C.; Infante, Oscar; Pérez-Grovas, Héctor; González-Gómez, Hortensia

    2017-09-01

    The scaling properties of heart rate variability data are reliable dynamical features to predict mortality and for the assessment of cardiovascular risk. The aim of this manuscript was to determine if the scaling properties, as provided by the sign and magnitude analysis, can be used to differentiate between pathological changes and those adaptations basically introduced by modifications of the mean heart rate in distinct manoeuvres (active standing or hemodialysis treatment, HD), as well as clinical conditions (end stage renal disease, ESRD). We found that in response to active standing, the short-term scaling index (α1) increased in healthy subjects and in ESRD patients only after HD. The sign short-term scaling exponent (α1sign) increased in healthy subjects and ESRD patients, showing a less anticorrelated behavior in active standing. Both α1 and α1sign did show covariance with the mean heart rate in healthy subjects, while in ESRD patients, this covariance was observed only after HD. A reliable estimation of the magnitude short-term scaling exponent (α1magn) required the analysis of time series with a large number of samples (>3000 data points). This exponent was similar for both groups and conditions and did not show covariance with the mean heart rate. A surrogate analysis confirmed the presence of multifractal properties (α1magn > 0.5) in the time series of healthy subjects and ESDR patients. In conclusion, α1 and α1sign provided insights into the physiological adaptations during active standing, which revealed a transitory impairment before HD in ESRD patients. The presence of multifractal properties indicated that a reduced short-term variability does not necessarily imply a declined regulatory complexity in these patients.

  18. The importance of the protection of industrial property, how and to defend it; La importancia de la tutela de la propiedad industrial como y por que defenderla

    Energy Technology Data Exchange (ETDEWEB)

    Ferrandis, S.; Miazzetto, F.; Gracia, J. L.; Rodriguez, F.; Ortiz, A.; Bosh, A.

    2011-07-01

    The global economy has strengthened the importance that Intellectual Property rights have in our society, converting the investments done in intangible assets and their following enforcement in key factors of the entrepreneurial success and of the economy as a whole. The article offers a comprehensive vision of the reasons pushing the entrepreneurs to enforce their intellectual property and, at the same time, it tries to describe the means and corresponding proceedings that the Spanish system offers them with this aim. (Author)

  19. Influence of the Training Set Value on the Quality of the Neural Network to Identify Selected Moulding Sand Properties

    Directory of Open Access Journals (Sweden)

    Jakubski J.

    2013-06-01

    Full Text Available Artificial neural networks are one of the modern methods of the production optimisation. An attempt to apply neural networks for controlling the quality of bentonite moulding sands is presented in this paper. This is the assessment method of sands suitability by means of detecting correlations between their individual parameters. This paper presents the next part of the study on usefulness of artificial neural networks to support rebonding of green moulding sand, using chosen properties of moulding sands, which can be determined fast. The effect of changes in the training set quantity on the quality of the network is presented in this article. It has been shown that a small change in the data set would change the quality of the network, and may also make it necessary to change the type of network in order to obtain good results.

  20. On The Importance of Connecting Laboratory Measurements of Ice Crystal Growth with Model Parameterizations: Predicting Ice Particle Properties

    Science.gov (United States)

    Harrington, J. Y.

    2017-12-01

    Parameterizing the growth of ice particles in numerical models is at an interesting cross-roads. Most parameterizations developed in the past, including some that I have developed, parse model ice into numerous categories based primarily on the growth mode of the particle. Models routinely possess smaller ice, snow crystals, aggregates, graupel, and hail. The snow and ice categories in some models are further split into subcategories to account for the various shapes of ice. There has been a relatively recent shift towards a new class of microphysical models that predict the properties of ice particles instead of using multiple categories and subcategories. Particle property models predict the physical characteristics of ice, such as aspect ratio, maximum dimension, effective density, rime density, effective area, and so forth. These models are attractive in the sense that particle characteristics evolve naturally in time and space without the need for numerous (and somewhat artificial) transitions among pre-defined classes. However, particle property models often require fundamental parameters that are typically derived from laboratory measurements. For instance, the evolution of particle shape during vapor depositional growth requires knowledge of the growth efficiencies for the various axis of the crystals, which in turn depends on surface parameters that can only be determined in the laboratory. The evolution of particle shapes and density during riming, aggregation, and melting require data on the redistribution of mass across a crystals axis as that crystal collects water drops, ice crystals, or melts. Predicting the evolution of particle properties based on laboratory-determined parameters has a substantial influence on the evolution of some cloud systems. Radiatively-driven cirrus clouds show a broader range of competition between heterogeneous nucleation and homogeneous freezing when ice crystal properties are predicted. Even strongly convective squall

  1. The importance of charge-transfer interactions in determining chromophoric dissolved organic matter (CDOM) optical and photochemical properties.

    Science.gov (United States)

    Sharpless, Charles M; Blough, Neil V

    2014-04-01

    Absorption of sunlight by chromophoric dissolved natural organic matter (CDOM) is environmentally significant because it controls photic zone depth and causes photochemistry that affects elemental cycling and contaminant fate. Both the optics (absorbance and fluorescence) and photochemistry of CDOM display unusual properties that cannot easily be ascribed to a superposition of individual chromophores. These include (i) broad, unstructured absorbance that decreases monotonically well into the visible and near IR, (ii) fluorescence emission spectra that all fall into a single envelope regardless of the excitation wavelength, and (iii) photobleaching and photochemical quantum yields that decrease monotonically with increasing wavelength. In contrast to a simple superposition model, these phenomena and others can be reasonably well explained by a physical model in which charge-transfer interactions between electron donating and accepting chromophores within the CDOM control the optical and photophysical properties. This review summarizes current understanding of the processes underlying CDOM photophysics and photochemistry as well as their physical basis.

  2. Transparent conductors from layer-by-layer assembled SWNT films: importance of mechanical properties and a new figure of merit.

    Science.gov (United States)

    Shim, Bong Sup; Zhu, Jian; Jan, Edward; Critchley, Kevin; Kotov, Nicholas A

    2010-07-27

    New transparent conductors (TCs) capable of replacing traditional indium tin oxide (ITO) are much needed for displays, sensors, solar cells, smart energy-saving windows, and flexible electronics. Technical requirements of TCs include not only high electrical conductivity and transparency but also environmental stability and mechanical property which are often overlooked in the research environment. Single-walled carbon nanotube (SWNT) coatings have been suggested as alternative TC materials but typically lack sufficient wear resistance compared to ITO. Balancing conductance, transparency, durability, and flexibility is a formidable challenge, which leads us to the introduction of a new TC figure of merit, PiTC, incorporating all these qualities. Maximization of PiTC to that of ITO or better can be suggested as an initial research goal. Fine tuning of SWNT layer-by-layer (LBL) polymeric nanocomposite structures makes possible integration of all the necessary properties. The produced TC demonstrated resistivity of 86 Omega/sq with 80.2% optical transmittance combined with tensile modulus, strength, and toughness of the film of 12.3+/-3.4 GPa, 218+/-13 MPa, and 8+/-1.7 J/g, respectively. A new transparent capping layer to conserve these properties in the hostile environment with matching or better strength, toughness, and transparency parameters was also demonstrated. Due to application demands, bending performance of TC made by LBL was of special interest and exceeded that of ITO by at least 100 times. Cumulative figure of merit PiTC for the produced coatings was 0.15 Omega(-1), whereas the conventional ITO showed PiTCOmega(-1). With overall electrical and optical performance comparable to ITO and exceptional mechanical properties, the described coatings can provide an excellent alternative to ITO or other nanowire- and nanotube-based TC specifically in flexible electronics, displays, and sensors.

  3. Physiological properties of anatomically identified basket and bistratified cells in the CA1 area of the rat hippocampus in vitro.

    Science.gov (United States)

    Buhl, E H; Szilágyi, T; Halasy, K; Somogyi, P

    1996-01-01

    Basket and bistratified cells form two anatomically distinct classes of GABAergic local-circuit neurons in the CA1 region of the rat hippocampus. A physiological comparison was made of intracellularly recorded basket (n = 13) and bistratified neurons (n = 6), all of which had been anatomically defined by their efferent target profile (Halasy et al., 1996). Basket cells had an average resting membrane potential of -64.2 +/- 7.2 vs. -69.2 +/- 4.6 mV in bistratified cells. The latter had considerably higher mean input resistances (60.2 +/- 42.1 vs. 31.3 +/- 10.9 M Ohms) and longer membrane time constants (18.6 +/- 8.1 vs. 9.8 +/- 4.5 ms) than basket cells. Differences were also apparent in the duration of action potentials, those of basket cells being 364 +/- 77 and those of bistratified cells being 527 +/- 138 microseconds at half-amplitude. Action potentials were generally followed by prominent, fast after-hyperpolarizing potentials which in basket cells were 13.5 +/- 6.7 mV in amplitude vs. 10.5 +/- 5.1 in bistratified cells. The differences in membrane time constant, resting membrane potential, and action potential duration reached statistical significance (P D-aspartate (NMDA) receptors, whereas the remaining slow-rise EPSP could be abolished by an NMDA receptor antagonist. Increasing stimulation intensity elicited biphasic inhibitory postsynaptic potentials (IPSPs) in both basket and bistratified cells. In conclusion, basket and bistratified cells in the CA1 area show prominent differences in several of their membrane and firing properties. Both cell classes are activated by Schaffer collateral/commissural axons in a feedforward manner and receive inhibitory input from other, as yet unidentified, local-circuit neurons.

  4. Identifying important spatial and temporal scales and patterns of soil properties in a tidal saltmarsh situated in a mixed red alder and Douglas fir watershed

    Science.gov (United States)

    Sea level rise is expected to drive a loss in salt marsh area and a change in marsh habitat composition, potentially leading to changes in the nitrogen source/sink dynamics of these systems. Estuaries in the Pacific Northwest might be particularly vulnerable to the effect of sal...

  5. Characterization of site-specific biomechanical properties of human meniscus-Importance of collagen and fluid on mechanical nonlinearities.

    Science.gov (United States)

    Danso, E K; Mäkelä, J T A; Tanska, P; Mononen, M E; Honkanen, J T J; Jurvelin, J S; Töyräs, J; Julkunen, P; Korhonen, R K

    2015-06-01

    Meniscus adapts to joint loads by depth- and site-specific variations in its composition and structure. However, site-specific mechanical characteristics of intact meniscus under compression are poorly known. In particular, mechanical nonlinearities caused by different meniscal constituents (collagen and fluid) are not known. In the current study, in situ indentation testing was conducted to determine site-specific elastic, viscoelastic and poroelastic properties of intact human menisci. Lateral and medial menisci (n=26) were harvested from the left knee joint of 13 human cadavers. Indentation tests, using stress-relaxation and dynamic (sinusoidal) loading protocols, were conducted for menisci at different sites (anterior, middle, posterior, n=78). Sample- and site-specific axisymmetric finite element models with fibril-reinforced poroelastic properties were fitted to the corresponding stress-relaxation curves to determine the mechanical parameters. Elastic moduli, especially the instantaneous and dynamic moduli, showed site-specific variation only in the medial meniscus (pmeniscus. The phase angle showed no statistically significant variation between the sites (p>0.05). The values for the strain-dependent fibril network modulus (nonlinear behaviour of collagen) were significantly different (pmeniscus only between the middle and posterior sites. For the strain-dependent permeability coefficient, only anterior and middle sites showed a significant difference (pmeniscus. This parameter demonstrated a significant difference (pmeniscus shows more site-dependent variation in the mechanical properties as compared to lateral meniscus. In particular, anterior horn of medial meniscus was the stiffest and showed the most nonlinear mechanical behaviour. The nonlinearity was related to both collagen fibrils and fluid. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. A protocol for a systematic review to identify allergenic tree nuts and the molecules responsible for their allergenic properties.

    Science.gov (United States)

    Javed, Bushra; Padfield, Philip; Sperrin, Matthew; Simpson, Angela; Mills, E N Clare

    2017-08-01

    Food regulations require that tree nuts and derived ingredients are included on food labels in order to help individuals with IgE-mediated allergies to avoid them. However, there is no consensus regarding which tree nut species should be included in this definition and specified on food labels. Allergen detection methods used for monitoring foods target allergen molecules, but it not clear which are the most relevant molecules to choose. A modified population-exposure-comparators-outcome (PECO) approach has been developed to systematically review the evidence regarding (1) which allergenic tree nuts should be included in food allergen labelling lists and (2) which are the clinically relevant allergens which should be used as analytical targets. A search strategy and criteria against which the evidence will be evaluated have been developed. The resulting evidence will be used to rank tree nuts with regards their ability to cause IgE-mediated allergies, and allergen molecules regarding their capacity to elicit an allergic reaction. The results of the systematic review will enable risk assessors and managers to identify tree nut species that should be included in food allergen labelling lists and ensure analytical methods for determination of allergens in foods are targeting appropriate molecules. Copyright © 2017. Published by Elsevier Ltd.

  7. Importance of thiol-functionalized molecules for the structure and properties of compression-molded glassy wheat gluten bioplastics.

    Science.gov (United States)

    Jansens, Koen J A; Lagrain, Bert; Brijs, Kristof; Goderis, Bart; Smet, Mario; Delcour, Jan A

    2013-11-06

    High-temperature compression molding of wheat gluten at low water levels yields a rigid plastic-like material. We performed a systematic study to determine the effect of additives with multiple thiol (SH) groups on gluten network formation during processing and investigate the impact of the resulting gluten network on the mechanical properties of the glassy end product. To this end, a fraction of the hydroxyl groups of different polyols was converted into SH functionalities by esterifying with 3-mercaptopropionic acid (MPA). The monofunctional additive MPA was evaluated as well. During low-temperature mixing SH-containing additives decreased the gluten molecular weight, whereas protein cross-linking occurred during high-temperature compression molding. The extent of both processes depended on the molecular architecture of the additives and their concentration. After molding, the material strength and failure strain increased without affecting the modulus, provided the additive concentration was low. The strength decreased again at too high concentrations for polyols with low SH functionalization. Attributing these effects solely to the interplay of plasticization and the SH-facilitated introduction of cross-links is inadequate, since an improvement in both strength and failure strain was also observed in the presence of high levels of MPA. It is hypothesized that, regardless of the molecular structure of the additive, the presence of SH-containing groups induces conformational changes which contribute to the mechanical properties of glassy gluten materials.

  8. PHYSICAL PROPERTIES AND MORPHOLOGY OF A NEWLY IDENTIFIED COMPACT z = 4.04 LENSED SUBMILLIMETER GALAXY IN ABELL 2218

    International Nuclear Information System (INIS)

    Knudsen, Kirsten K.; Kneib, Jean-Paul; Richard, Johan; Petitpas, Glen; Egami, Eiichi

    2010-01-01

    We present the identification of a bright submillimeter (submm) source, SMM J163555.5+661300, detected in the lensing cluster Abell 2218, for which we have accurately determined the position using observations from the Submillimeter Array (SMA). The identified optical counterpart has a spectroscopic redshift of z = 4.044 ± 0.001 if we attribute the single emission line detected at λ = 6140 A to Lyα. This redshift identification is in good agreement with the optical/near-infrared photometric redshift as well as the submm flux ratio S 450 /S 850 ∼ 1.6, the radio-submm flux ratio S 1.4 /S 850 24 /S 850 12 L sun , which implies a star formation rate (SFR) of 230 M sun yr -1 . This makes it the lowest-luminosity submillimeter galaxy (SMG) known at z>4 to date. Previous CO(4-3) emission line observations yielded a non-detection, for which we derived an upper limit of the CO line luminosity of L CO ' = 0.3x10 10 K km s -1 pc -2 , which is not inconsistent with the L ' CO -L FIR relation for starburst galaxies. The best-fit model to the optical and near-infrared photometry give a stellar population with an age of 1.4 Gyr and a stellar mass of 1.6 x 10 10 M sun . The optical morphology is compact and in the source plane the galaxy has an extent of ∼6 x 3 kpc with individual star-forming knots of sun yr -1 kpc 2 . The redshift of J163556 extends the redshift distribution of faint, lensed SMGs, and we find no evidence that these have a different redshift distribution than bright SMGs.

  9. Deconstructing Quinoline-Class Antimalarials to Identify Fundamental Physicochemical Properties of Beta-Hematin Crystal Growth Inhibitors.

    Science.gov (United States)

    Olafson, Katy N; Nguyen, Tam Q; Vekilov, Peter G; Rimer, Jeffrey D

    2017-10-04

    A versatile approach to control crystallization involves the use of modifiers, which are additives that interact with crystal surfaces and alter their growth rates. Elucidating a modifier's binding specificity to anisotropic crystal surfaces is a ubiquitous challenge that is critical to their design. In this study, we select hematin, a byproduct of malaria parasites, as a model system to examine the complementarity of modifiers (i.e., antimalarial drugs) to β-hematin crystal surfaces. We divide two antimalarials, chloroquine and amodiaquine, into segments consisting of a quinoline base, common to both drugs, and side chains that differentiate their modes of action. Using a combination of scanning probe microscopy, bulk crystallization, and analytical techniques, we show that the base and side chain work synergistically to reduce the rate of hematin crystallization. In contrast to general observations that modifiers retain their function upon segmentation, we show that the constituents do not act as modifiers. A systematic study of quinoline isomers and analogues shows how subtle rearrangement and removal of functional moieties can create effective constituents from previously ineffective modifiers, along with tuning their inhibitory modes of action. These findings highlight the importance of specific functional moieties in drug compounds, leading to an improved understanding of modifier-crystal interactions that could prove to be applicable to the design of new antimalarials. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Ceruleotoxin: identification in the venom of Bungarus fasciatus, molecular properties and importance of phospholipase A2 activity for neurotoxicity.

    Science.gov (United States)

    Bon, C; Saliou, B

    1983-01-01

    Ceruleotoxin is a potent neurotoxin which was originally purified from a batch of venom labelled Bungarus caeruleus, from the Pasteur Institute. Since NOBLE et al. have shown that this batch differs in its protein composition from that of B. caeruleus provided by Miami Serpentarium, we decided to clarify this point by comparing the composition of venoms from various Bungarus species of several origins. Although individual variations exist between samples of the same species, the venom from B. multicinctus, B. caeruleus and B. fasciatus possess characteristic protein compositions which allowed us to identify the batch used to purify ceruleotoxin as a B. fasciatus venom. We identified and purified ceruleotoxin from each of the five samples of B. fasciatus venoms tested. We failed to find this neurotoxin in either B. multicinctus or B. caeruleus venoms. Purified ceruleotoxin is a slightly basic protein with an isoelectric point of 7.4 which possesses a significant phospholipase A2 activity (200 mumoles lecithin hydrolyzed per min per mg) and a high lethal potency (i.v. LD50 in mice 0.03-0.07 mg/kg). It is composed of two identical subunits of 13,000 mol. wt. which resemble pancreas and snake venom phospholipases in their amino acid composition. Like crotoxin, ceruleotoxin irreversibly blocks the postsynaptic response of Torpedo and Electrophorus electroplaques to cholinergic agonists without preventing the binding of acetylcholine to its receptor. By hydrolyzing critical lipids of the postsynaptic membrane, it stabilizes the acetylcholine receptor - ionophore assembly in a desensitized state.

  11. Passive mechanical properties of rat abdominal wall muscles suggest an important role of the extracellular connective tissue matrix.

    Science.gov (United States)

    Brown, Stephen H M; Carr, John Austin; Ward, Samuel R; Lieber, Richard L

    2012-08-01

    Abdominal wall muscles have a unique morphology suggesting a complex role in generating and transferring force to the spinal column. Studying passive mechanical properties of these muscles may provide insights into their ability to transfer force among structures. Biopsies from rectus abdominis (RA), external oblique (EO), internal oblique (IO), and transverse abdominis (TrA) were harvested from male Sprague-Dawley rats, and single muscle fibers and fiber bundles (4-8 fibers ensheathed in their connective tissue matrix) were isolated and mechanically stretched in a passive state. Slack sarcomere lengths were measured and elastic moduli were calculated from stress-strain data. Titin molecular mass was also measured from single muscle fibers. No significant differences were found among the four abdominal wall muscles in terms of slack sarcomere length or elastic modulus. Interestingly, across all four muscles, slack sarcomere lengths were quite long in individual muscle fibers (>2.4 µm), and demonstrated a significantly longer slack length in comparison to fiber bundles (p resistance to lengthening at long muscle lengths. Titin molecular mass was significantly less in TrA compared to each of the other three muscles (p < 0.0009), but this difference did not correspond to hypothesized differences in stiffness. Copyright © 2012 Orthopaedic Research Society.

  12. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  13. Relationship between concentration of health important groups of fatty acids and components and technological properties in cow milk

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2010-01-01

    Full Text Available Groups of fatty acids (FAs in milk fat can have positive and negative impact on consumer health. Profile of FAs could be influenced by dairy cow nutrition, breed, milk yield level et cetera. The question is what relationships the FAs could have to quality of milk products? Relationships between FAs and their groups to selected milk indicators were studied in Czech Fleckvieh and Holstein cows (64 bulk milk samples. There were 8 herds in 2-year investigation during winter and summer season. The relationship of saturated FAs (SAFA; 66.22% was significant only to lactose (L content (0.290; P < 0.05. The relationships of monounsaturated FAs (MUFA; 29.21% to milk indicators (MIs were in­si­gni­fi­cant (P > 0.05. The relationships of polyunsaturated FAs (PUFA, beneficial for consumer health; 4.53% to MIs were narrower: fat (T, 0.321; P < 0.05; lactose (L, 0.458; P < 0.01; milk alcohol stability (AL, 0.447; P < 0.01; titration acidity (SH, 0.342; P < 0.01; cheese curd quality (KV, 0.427; P < 0.01; milk fermentationability (JSH, 0.529; P < 0.001, streptococci count in yoghurt (Strepto, 0.316; P < 0.05; total count of noble bacteria in yoghurt (CPMUK, 0.314; P < 0.05; streptococci/lactobacilly ratio (StreptoLacto, 0.356; P < 0.01. The relationships of conjugated linoleic acid (CLA; markedly beneficial for health; 0.68% to MIs were: T (0.379; P < 0.01; L (–0.542; P < 0.001; AL (0.266; P < 0.05; KV (0.411; P < 0.01; Strepto (0.260; P < 0.05; StreptoLacto (0.270; P < 0.05. The higher CLA levels were connected in this way with: higher fat content; lower lactose content; lower alcohol stability; lower streptococci count in yoghurt; lower streptococci/lactobacilly ratio in yoghurt. The PUFA and CLA representation decreased with L increase. Simultaneously some technological milk properties such as alcohol sta­bi­li­ty and fermentationability were slightly improved.

  14. The effect of simulated inflammatory conditions on the surface properties of titanium and stainless steel and their importance as biomaterials

    International Nuclear Information System (INIS)

    Fonseca-García, Abril; Pérez-Alvarez, J.; Barrera, C.C.; Medina, J.C.; Almaguer-Flores, A.; Sánchez, R. Basurto

    2016-01-01

    suffered from a dissolution/oxidation process that allows its integration with the surrounding media, while the SS remained completely passive and this different response might be related to their distinguished clinical outcome. - Highlights: • Comparison of the surface properties of titanium and stainless steel was done. • Titanium was more affected in the inflammatory conditions than stainless steel. • The H_2O_2 induced the growth of the oxide layer in both metals. • The polar component had an opposite change among both metals. • The immersion in H_2O_2 induced dissolution–oxidation of Ti.

  15. The Budding Yeast “Saccharomyces cerevisiae” as a Drug Discovery Tool to Identify Plant-Derived Natural Products with Anti-Proliferative Properties

    Directory of Open Access Journals (Sweden)

    Bouchra Qaddouri

    2011-01-01

    Full Text Available The budding yeast Saccharomyces cerevisiae is a valuable system to study cell-cycle regulation, which is defective in cancer cells. Due to the highly conserved nature of the cell-cycle machinery between yeast and humans, yeast studies are directly relevant to anticancer-drug discovery. The budding yeast is also an excellent model system for identifying and studying antifungal compounds because of the functional conservation of fungal genes. Moreover, yeast studies have also contributed greatly to our understanding of the biological targets and modes of action of bioactive compounds. Understanding the mechanism of action of clinically relevant compounds is essential for the design of improved second-generation molecules. Here we describe our methodology for screening a library of plant-derived natural products in yeast in order to identify and characterize new compounds with anti-proliferative properties.

  16. Effects of excipients on the tensile strength, surface properties and free volume of Klucel{sup ®} free films of pharmaceutical importance

    Energy Technology Data Exchange (ETDEWEB)

    Gottnek, Mihály [Department of Pharmaceutical Technology, University of Szeged, Eötvös utca 6, H-6720 Szeged (Hungary); Süvegh, Károly [Laboratory of Nuclear Chemistry, Eötvös Loránd University, P.O. Box 32, H-1518 Budapest 112 (Hungary); Pintye-Hódi, Klára [Department of Pharmaceutical Technology, University of Szeged, Eötvös utca 6, H-6720 Szeged (Hungary); Regdon, Géza [Department of Pharmaceutical Technology, University of Szeged, Eötvös utca 6, H-6720 Szeged (Hungary)

    2013-08-15

    The physicochemical properties of polymers planned to be applied as mucoadhesive films were studied. Two types of Klucel{sup ®} hydroxypropylcellulose (LF and MF) were used as film-forming polymers. Hydroxypropylcellulose was incorporated in 2 w/w% with glycerol and xylitol as excipients and lidocaine base as an active ingredient at 5, 10 or 15 w/w% of the mass of the film-forming polymer. The free volume changes of the films were investigated by positron annihilation lifetime spectroscopy, the mechanical properties of the samples were measured with a tensile strength tester and contact angles were determined to assess the surface properties of the films. It was found that the Klucel{sup ®} MF films had better physicochemical properties than those of the LF films. Klucel{sup ®} MF as a film-forming polymer with lidocaine base and both excipients at 5 w/w% exhibited physicochemical properties and good workability. The excipients proved to exert strong effects on the physicochemical properties of the tested systems and it is very important to study them intensively in preformulation studies in the pharmaceutical technology in order to utilise their benefits and to avoid any disadvantageous effects. - Highlights: • Glycerol increases, whereas xylitol decreases the free volume of both LF and MF HPC. • Both xylitol and glycerol increase the tensile strength of MF films. • The tensile strength of the MF product makes it suitable for pharmaceutical use. • The surface properties reveal a macroscopically stable film structure. • All measurements indicate a macroscopically homogeneous film structure.

  17. Effects of excipients on the tensile strength, surface properties and free volume of Klucel® free films of pharmaceutical importance

    International Nuclear Information System (INIS)

    Gottnek, Mihály; Süvegh, Károly; Pintye-Hódi, Klára; Regdon, Géza

    2013-01-01

    The physicochemical properties of polymers planned to be applied as mucoadhesive films were studied. Two types of Klucel ® hydroxypropylcellulose (LF and MF) were used as film-forming polymers. Hydroxypropylcellulose was incorporated in 2 w/w% with glycerol and xylitol as excipients and lidocaine base as an active ingredient at 5, 10 or 15 w/w% of the mass of the film-forming polymer. The free volume changes of the films were investigated by positron annihilation lifetime spectroscopy, the mechanical properties of the samples were measured with a tensile strength tester and contact angles were determined to assess the surface properties of the films. It was found that the Klucel ® MF films had better physicochemical properties than those of the LF films. Klucel ® MF as a film-forming polymer with lidocaine base and both excipients at 5 w/w% exhibited physicochemical properties and good workability. The excipients proved to exert strong effects on the physicochemical properties of the tested systems and it is very important to study them intensively in preformulation studies in the pharmaceutical technology in order to utilise their benefits and to avoid any disadvantageous effects. - Highlights: • Glycerol increases, whereas xylitol decreases the free volume of both LF and MF HPC. • Both xylitol and glycerol increase the tensile strength of MF films. • The tensile strength of the MF product makes it suitable for pharmaceutical use. • The surface properties reveal a macroscopically stable film structure. • All measurements indicate a macroscopically homogeneous film structure

  18. In vitro antimicrobial properties of plant essential oils thymus vulgaris, cymbopogon citratus and laurus nobilis against five important foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Alessandra Farias Millezi

    2012-03-01

    Full Text Available Several essential oils of condiment and medicinal plants possess proven antimicrobial activity and are of important interest for the food industry. Therefore, the Minimum Inhibitory Concentrations (MIC of those oils should be determined for various bacteria. MIC varies according to the oil used, the major compounds, and the physiology of the bacterium under study. In the present study, the essential oils of the plants Thymus vulgaris (time, Cymbopogon citratus (lemongrass and Laurus nobilis (bay were chemically quantified, and the MIC was determined on the bacteria Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 25922, Listeria monocytogenes ATCC 19117, Salmonella enterica Enteritidis S64, and Pseudomonas aeruginosa ATCC 27853. The essential oil of C. citratus demonstrated bacterial activity at all concentrations tested and against all of the bacteria tested. The majority of essential oil compounds were geranial and neral. The major constituent of T. vulgaris was 1.8-cineol and of L. nobilis was linalool, which presented lower antibacterial activity, followed by 1.8-cineol. The Gram-negative bacteria demonstrated higher resistance to the use of the essential oils tested in this study. E. coli was the least sensitive and was inhibited only by the oils of C. citratus and L. nobilis.

  19. The effect of simulated inflammatory conditions on the surface properties of titanium and stainless steel and their importance as biomaterials

    Energy Technology Data Exchange (ETDEWEB)

    Fonseca-García, Abril [Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México, México (Mexico); Posgrado en Ciencia e Ingeniería de Materiales, Universidad Nacional Autónoma de México, México (Mexico); Pérez-Alvarez, J. [Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México, México (Mexico); Barrera, C.C. [Posgrado en Ciencias Médicas, Odontológicas y de la Salud, Universidad Nacional Autónoma de México, México (Mexico); Medina, J.C. [Instituto de Investigaciones en Materiales, Universidad Nacional Autónoma de México, México (Mexico); Posgrado en Ciencia e Ingeniería de Materiales, Universidad Nacional Autónoma de México, México (Mexico); Almaguer-Flores, A. [Facultad de Odontología, Universidad Nacional Autónoma de México, México (Mexico); Sánchez, R. Basurto [Instituto Nacional de Investigaciones Nucleares, México (Mexico); and others

    2016-09-01

    observed on the SS. The cpTi surface suffered from a dissolution/oxidation process that allows its integration with the surrounding media, while the SS remained completely passive and this different response might be related to their distinguished clinical outcome. - Highlights: • Comparison of the surface properties of titanium and stainless steel was done. • Titanium was more affected in the inflammatory conditions than stainless steel. • The H{sub 2}O{sub 2} induced the growth of the oxide layer in both metals. • The polar component had an opposite change among both metals. • The immersion in H{sub 2}O{sub 2} induced dissolution–oxidation of Ti.

  20. Importance of biogeomorphic and spatial properties in assessing a tidal salt marsh vulnerability to sea-level rise

    Science.gov (United States)

    Thorne, Karen M.; Elliott-Fisk, Deborah L.; Wylie, Glenn D.; Perry, William M.; Takekawa, John Y.

    2014-01-01

    We evaluated the biogeomorphic processes of a large (309 ha) tidal salt marsh and examined factors that influence its ability to keep pace with relative sea-level rise (SLR). Detailed elevation data from 1995 and 2008 were compared with digital elevation models (DEMs) to assess marsh surface elevation change during this time. Overall, 37 % (113 ha) of the marsh increased in elevation at a rate that exceeded SLR, whereas 63 % (196 ha) of the area did not keep pace with SLR. Of the total area, 55 % (169 ha) subsided during the study period, but subsidence varied spatially across the marsh surface. To determine which biogeomorphic and spatial factors contributed to measured elevation change, we collected soil cores and determined percent and origin of organic matter (OM), particle size, bulk density (BD), and distance to nearest bay edge, levee, and channel. We then used Akaike Information Criterion (AICc) model selection to assess those variables most important to determine measured elevation change. Soil stable isotope compositions were evaluated to assess the source of the OM. The samples had limited percent OM by weight (-3, indicating that the soils had high mineral content with a relatively low proportion of pore space. The most parsimonious model with the highest AICc weight (0.53) included distance from bay's edge (i.e., lower intertidal) and distance from levee (i.e., upper intertidal). Close proximity to sediment source was the greatest factor in determining whether an area increased in elevation, whereas areas near landward levees experienced subsidence. Our study indicated that the ability of a marsh to keep pace with SLR varied across the surface, and assessing changes in elevation over time provides an alternative method to long-term accretion monitoring. SLR models that do not consider spatial variability of biogeomorphic and accretion processes may not correctly forecast marsh drowning rates, which may be especially true in modified and urbanized

  1. Exploring the spatial variation in quality-adjusted rental prices and identifying hot spots in Berlin’s residential property market

    DEFF Research Database (Denmark)

    Meulen, Philipp an de; Mitze, Timo Friedel

    2014-01-01

    In this work, we use residual values obtained from an estimated hedonic pricing model to assess the role of district-level neighbourhood effects for the spatial variation in quality-adjusted rental prices in Berlin between 2008 and 2013. By doing so, we also aim at identifying hot and cold spots ...... analysis (ESDA) toolbox, we finally pinpoint particular hot spots of the city’s residential property market associated with a significant spatial clustering of similar rental price values around individual observations....... proximity to the city centre compared to similar properties in Berlin’s periphery once we control for the properties’ physical characteristics. The observed temporal evolution of the rental price distribution between 2008 and 2013 thereby hints at an ongoing gentrification process in Germany’s capital...... associated with the current housing market boom. This visual impression is also confirmed by the application of quantile regressions for a correlation analysis between quality-adjusted rental price values and Berlin district-level characteristics obtained from the last census in 2011. Among other factors, we...

  2. The behavioural characteristics of sediment properties and their implications for sediment fingerprinting as an approach for identifying sediment sources in river basins

    Science.gov (United States)

    Koiter, A. J.; Owens, P. N.; Petticrew, E. L.; Lobb, D. A.

    2013-10-01

    Sediment fingerprinting is a technique that is increasingly being used to improve the understanding of sediment dynamics within river basins. At present, one of the main limitations of the technique is the ability to link sediment back to their sources due to the non-conservative nature of many of the sediment properties. The processes that occur between the sediment source locations and the point of collection downstream are not well understood or quantified and currently represent a black-box in the sediment fingerprinting approach. The literature on sediment fingerprinting tends to assume that there is a direct connection between sources and sinks, while much of the broader environmental sedimentology literature identifies that numerous chemical, biological and physical transformations and alterations can occur as sediment moves through the landscape. The focus of this paper is on the processes that drive particle size and organic matter selectivity and biological, geochemical and physical transformations and how understanding these processes can be used to guide sampling protocols, fingerprint selection and data interpretation. The application of statistical approaches without consideration of how unique sediment fingerprints have developed and how robust they are within the environment is a major limitation of many recent studies. This review summarises the current information, identifies areas that need further investigation and provides recommendations for sediment fingerprinting that should be considered for adoption in future studies if the full potential and utility of the approach are to be realised.

  3. Psychometric properties and reliability of the Assessment Screen to Identify Survivors Toolkit for Gender Based Violence (ASIST-GBV): results from humanitarian settings in Ethiopia and Colombia.

    Science.gov (United States)

    Vu, Alexander; Wirtz, Andrea; Pham, Kiemanh; Singh, Sonal; Rubenstein, Leonard; Glass, Nancy; Perrin, Nancy

    2016-01-01

    Refugees and internally displaced persons who are affected by armed-conflict are at increased vulnerability to some forms of sexual violence or other types of gender-based violence. A validated, brief and easy-to-administer screening tool will help service providers identify GBV survivors and refer them to appropriate GBV services. To date, no such GBV screening tool exists. We developed the 7-item ASIST-GBV screening tool from qualitative research that included individual interviews and focus groups with GBV refugee and IDP survivors. This study presents the psychometric properties of the ASIST-GBV with female refugees living in Ethiopia and IDPs in Colombia. Several strategies were used to validate ASIST-GBV, including a 3 month implementation to validate the brief screening tool with women/girls seeking health services, aged ≥15 years in Ethiopia (N = 487) and female IDPs aged ≥ 18 years in Colombia (N = 511). High proportions of women screened positive for past-year GBV according to the ASIST-GBV: 50.6 % in Ethiopia and 63.4 % in Colombia. The factor analysis identified a single dimension, meaning that all items loaded on the single factor. Cronbach's α = 0.77. A 2-parameter logistic IRT model was used for estimating the precision and discriminating power of each item. Item difficulty varied across the continuum of GBV experiences in the following order (lowest to highest): threats of violence (0.690), physical violence (1.28), forced sex (2.49), coercive sex for survival (2.25), forced marriage (3.51), and forced pregnancy (6.33). Discrimination results showed that forced pregnancy was the item with the strongest ability to discriminate between different levels of GBV. Physical violence and forced sex also have higher levels of discrimination with threats of violence discriminating among women at the low end of the GBV continuum and coercive sex for survival among women at the mid-range of the continuum. The findings demonstrate that

  4. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  5. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  7. Towards novel efficient and stable nuclear import signals: synthesis and properties of trimethylguanosine cap analogs modified within the 5',5'-triphosphate bridge.

    Science.gov (United States)

    Zytek, Malgorzata; Kowalska, Joanna; Lukaszewicz, Maciej; Wojtczak, Blazej A; Zuberek, Joanna; Ferenc-Mrozek, Aleksandra; Darzynkiewicz, Edward; Niedzwiecka, Anna; Jemielity, Jacek

    2014-12-07

    A trimethylguanosine (TMG) cap is present at the 5' end of several small nuclear and nucleolar RNAs. Recently, it has been reported that the TMG cap is a potential nuclear import signal for nucleus-targeting therapeutic nucleic acids and proteins. The import is mediated by recognition of the TMG cap by the snRNA transporting protein, snurportin1. This work describes the synthesis and properties of a series of dinucleotide TMG cap (m3(2,2,7)GpppG) analogs modified in the 5',5'-triphosphate bridge as tools to study TMG cap-dependent biological processes. The bridge was altered at different positions by introducing either bridging (imidodiphosphate, O to NH and methylenebisphosphonate, O to CH2) or non-bridging (phosphorothioate, O to S and boranophosphate, O to BH3) modifications, or by elongation to tetraphosphate. The stability of novel analogs in blood serum was studied to reveal that the α,β-bridging O to NH substitution (m3(2,2,7)GppNHpG) confers the highest resistance. Short RNAs capped with analogs containing α,β-bridging (m3(2,2,7)GppNHpG) or β-non-bridging (m3(2,2,7)GppSpG D2) modifications were resistant to decapping pyrophosphatase, hNudt16. Preliminary studies on binding by human snurportin1 revealed that both O to NH and O to S substitutions support this binding. Due to favorable properties in all three assays, m3(2,2,7)GppNHpG was selected as a promising candidate for further studies on the efficiency of the TMG cap as a nuclear import signal.

  8. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  9. Property.

    Science.gov (United States)

    Piele, Philip K.

    Numerous cases in this year's chapter dealt with the same topics of previous years--contracts and bids for building construction, and detachment and annexation of a portion of a school district. The courts continued to attribute board discretionary authority to school boards in school property matters. Intergovernmental disputes over ownership or…

  10. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  11. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  12. iNR-PhysChem: a sequence-based predictor for identifying nuclear receptors and their subfamilies via physical-chemical property matrix.

    Directory of Open Access Journals (Sweden)

    Xuan Xiao

    Full Text Available Nuclear receptors (NRs form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1--thyroid hormone like, NR2--HNF4-like, NR3--estrogen like, NR4--nerve growth factor IB-like, NR5--fushi tarazu-F1 like, NR6--germ cell nuclear factor like, and NR0--knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has ≥60% pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either http://www.jci-bioinfo.cn/iNR-PhysChem or http://icpr.jci.edu.cn/bioinfo/iNR-PhysChem. Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may

  13. Importance Sampling for Stochastic Timed Automata

    DEFF Research Database (Denmark)

    Jegourel, Cyrille; Larsen, Kim Guldstrand; Legay, Axel

    2016-01-01

    We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state-wise cha......We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state...

  14. The importance of industrial property rights, legal monopolies for fair competition; La importancia de los derechos de propiedad industrial. Monopolios legales para una competneica leal

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez Rodriguez, J. A.

    2011-07-01

    Industrial property rights are an exception, perhaps the main, for freedom competition and entrepreneurial freedom. Those rights give the holder an exclusive right, and the existence of these legal monopolies is essential for the development of fair competition. Industrial property rights are national and, therefore, to obtain registration and exclusive rights in several countries, they must register on each of them. However, in recent years are emerging industrial property rights with impact on a number of countries (Community marks and designs). (Author)

  15. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  16. Electron Beam Lithography of HSQ and PMMA Resists and Importance of their Properties to Link the Nano World to the Micro World

    NARCIS (Netherlands)

    Kaleli, B.; Aarnink, Antonius A.I.; Smits, Sander M.; Hueting, Raymond Josephus Engelbart; Wolters, Robertus A.M.; Schmitz, Jurriaan

    2010-01-01

    In this work we investigated the properties of HSQ and PMMA resists focusing on contrast and line width for ebeam lithography (EBL) application. HSQ was found to be a good candidate to have desired line widths but the contrast we obtained was less than it was for PMMA. Since the fluorine based

  17. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  18. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  19. Importance of the alignment of polar π conjugated molecules inside carbon nanotubes in determining second-order non-linear optical properties.

    Science.gov (United States)

    Yumura, Takashi; Yamamoto, Wataru

    2017-09-20

    We employed density functional theory (DFT) calculations with dispersion corrections to investigate energetically preferred alignments of certain p,p'-dimethylaminonitrostilbene (DANS) molecules inside an armchair (m,m) carbon nanotube (n × DANS@(m,m)), where the number of inner molecules (n) is no greater than 3. Here, three types of alignments of DANS are considered: a linear alignment in a parallel fashion and stacking alignments in parallel and antiparallel fashions. According to DFT calculations, a threshold tube diameter for containing DANS molecules in linear or stacking alignments was found to be approximately 1.0 nm. Nanotubes with diameters smaller than 1.0 nm result in the selective formation of linearly aligned DANS molecules due to strong confinement effects within the nanotubes. By contrast, larger diameter nanotubes allow DANS molecules to align in a stacking and linear fashion. The type of alignment adopted by the DANS molecules inside a nanotube is responsible for their second-order non-linear optical properties represented by their static hyperpolarizability (β 0 values). In fact, we computed β 0 values of DANS assemblies taken from optimized n × DANS@(m,m) structures, and their values were compared with those of a single DANS molecule. DFT calculations showed that β 0 values of DANS molecules depend on their alignment, which decrease in the following order: linear alignment > parallel stacking alignment > antiparallel stacking alignment. In particular, a linear alignment has a β 0 value more significant than that of the same number of isolated molecules. Therefore, the linear alignment of DANS molecules, which is only allowed inside smaller diameter nanotubes, can strongly enhance their second-order non-linear optical properties. Since the nanotube confinement determines the alignment of DANS molecules, a restricted nanospace can be utilized to control their second-order non-linear optical properties. These DFT findings can assist in the

  20. The psychometric properties of the Chinese version-reintegration to normal living index (C-RNLI) for identifying participation restriction among community-dwelling frail older people.

    Science.gov (United States)

    Liu, Justina Yat-Wa; Ma, Ka Wai

    2017-01-31

    The Reintegration to Normal Living Index (RNLI) was developed to measure reintegration to normal living after major traumas/illnesses. Its psychometric properties remain unknown when used to measure participation restriction under the World Health Organization's International Classification of Functioning, Disability, and Health (WHO-ICF) framework. This study examines the psychometric properties of the Chinese version-RNLI to measure WHO-ICF participation restriction among community-dwelling pre-frail and frail older people. A cross-sectional study was conducted in community and day-care centres in Hong Kong between May 2015 and January 2016. Through face-to-face interviews, information was collected on the participants' demographic background, medical history, frailty status, depressive mood, functional performance in daily activities, and participation restriction. The internal consistency, test-retest reliability, and construct and convergent validity of the C-RNLI were assessed. Two hundred and ninety-nine pre-frail or frail community-dwelling older people with a mean age of 79.53 were recruited. A confirmatory factor analysis showed that the C-RNLI has a two-factor structure comprised of "participation in physical activities" and "participation in social events". The test-retest coefficient was 0.71. The Cronbach's alpha of the total C-RNLI score, and those of the factors "participation in physical activities" and "participation in social events" were 0.88, 0.82 and 0.84, respectively. Pre-frail older people had significantly higher scores for the factors "participation in physical activities" (z = -5.05, older people. Older people from community centres had significantly higher scores for the factors "participation in physical activities" (z = -4.48, older people from day-care centres. The factors "participation in physical activities" and "participation in social events" of the C-RNLI were significantly convergent with depressive mood (r s  = -0

  1. The importance of ash for the favourable properties of sewage sludge in co-firing; Askans betydelse foer roetslams goda samfoerbraenningsegenskaper

    Energy Technology Data Exchange (ETDEWEB)

    Davidsson, K.; Jones, F.; Niklasson, F.; Ryde, D. [SP Sveriges Tekniska Forskningsinstitut, Boraas, (Sweden); Gustafsson, G. [Boraas Energi och Miljoe, Boraas (Sweden); Herstad Svaerd, S. [WSP Kraft and Vaerme, Goeteborg (Sweden)

    2012-11-01

    Sewage sludge has been shown to have positive properties during cofiring with difficult fuels. The sludge mitigates deposition and corrosion which occur because of the fuels content of chlorine and alkali. The reason for the positive properties of sludge are its content of sulphur, phosphorus and aluminium silicates. Its high content of ash has also been discussed because the fly ash would constitute a large surface for alkali chlorides to condensate on and thereby avoid condensation on e.g. superheater surfaces. The ash could also blast the surface and thereby keeping them clean. The present project aims at testing the hypothesis that the ash in the sludge mitigates the deposition. Tests have been performed with synthetically produced waste pellets of which some were doped with inert particles in form of aluminium oxide. The tests were done in a lab-scale bubbling fluidised bed. Deposit probes collected deposits during the combustion of doped and un-doped waste pellets, and the deposits were chemically analysed. The result shows that the inert particles do not have any effect on the amount of hard attached deposits. The particles ended up on the lee side of the probe where they deposited because of gravitation, but they could be easily removed. The remaining deposit was analysed and the effect of inert particles was a small decrease of the content of chlorine. Tests were also performed with pellets doped with sludge. In this case the amount of deposit and its content of chlorine decreased significantly. Different sewage sludges have different properties. The present results show that sludge for cofiring should not be chosen for its amount of ash but rather for its content of sulphur, phosphorous and aluminium.

  2. The importance of ash for the favourable properties of sewage sludge in co-firing; Askans betydelse foer roetslams goda samfoerbraenningsegenskaper

    Energy Technology Data Exchange (ETDEWEB)

    Davidsson, K.; Jones, F.; Niklasson, F.; Ryde, D. [SP Sveriges Tekniska Forskningsinstitut, Boraas (Sweden); Gustafsson, G. [Boraas Energi och Miljoe, Boraas (Sweden); Herstad Svaerd, S. [WSP Kraft and Vaerme, Stockholm (Sweden)

    2012-07-01

    Sewage sludge has been shown to have positive properties during cofiring with difficult fuels. The sludge mitigates deposition and corrosion which occur because of the fuels content of chlorine and alkali. The reason for the positive properties of sludge are its content of sulphur, phosphorus and aluminium silicates. Its high content of ash has also been discussed because the fly ash would constitute a large surface for alkali chlorides to condensate on and thereby avoid condensation on e.g. superheater surfaces. The ash could also blast the surface and thereby keeping them clean. The present project aims at testing the hypothesis that the ash in the sludge mitigates the deposition. Tests have been performed with synthetically produced waste pellets of which some were doped with inert particles in form of aluminium oxide. The tests were done in a lab-scale bubbling fluidised bed. Deposit probes collected deposits during the combustion of doped and un-doped waste pellets, and the deposits were chemically analysed. The result shows that the inert particles do not have any effect on the amount of hard attached deposits. The particles ended up on the lee side of the probe where they deposited because of gravitation, but they could be easily removed. The remaining deposit was analysed and the effect of inert particles was a small decrease of the content of chlorine. Tests were also performed with pellets doped with sludge. In this case the amount of deposit and its content of chlorine decreased significantly. Different sewage sludges have different properties. The present results show that sludge for cofiring should not be chosen for its amount of ash but rather for its content of sulphur, phosphorous and aluminium.

  3. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  4. Land Suitability Evaluation for Blueberry Crop by Determining the Qualitative Properties of the Identified Soil Type Related with the Antioxidant Capacity of Fruits

    Directory of Open Access Journals (Sweden)

    Amalia Ioana BOT

    2017-12-01

    Full Text Available Organic and inorganic forms of nitrogen and carbon were measured in order to determine soil fertility. The amount of total nitrogen ranged between 0.849 g/kg and 1.755 g/kg in the samples gathered from soil in modified state and between 0.961 k/kg and 2.427 g/kg in the samples collected from the soil in natural state. Based on these results it could be concluded that in comparing with the previous year, plants used the soil nutrients for their development. The activities of different enzymes were measured as well. Nitrate reductase activity was also higher in samples collected from soil in modified state (from bilon than in the samples collected near plantations (control samples and the values ranged between 0.055 ± 0.012 μmol⋅h-1⋅g-1 and 1.018 ± 0.117 μmol⋅h-1⋅g-1 in samples from soil in natural state and between 0.013 ± 0.002 μmol⋅h-1⋅g-1 and 0.447 ± 0.083 μmol⋅h-1⋅g-1 in bilons. Using GIS techniques of spatial analysis to determine the exact type of soil from each studied blueberry plantation from the Northwest Region of Development and also based on the soil bio-chemical analyses, it was possible to achieve a qualitative characterization of the territory, taking into account the requirements of blueberries for cultivation and to achieve a land suitability for blueberry crop. Combining laboratory approach, consisting from soil bio-chemical and physico-chemical analyses and chemical analyses of blueberry fruits, with the techniques used in order to determine the soil type and land suitability, the study conducted in the Northwest Region of Development identified the best conditions for blueberry crop, based on the qualitative characterization of land.

  5. Identifying Structure-Property Relationships Through DREAM.3D Representative Volume Elements and DAMASK Crystal Plasticity Simulations: An Integrated Computational Materials Engineering Approach

    Science.gov (United States)

    Diehl, Martin; Groeber, Michael; Haase, Christian; Molodov, Dmitri A.; Roters, Franz; Raabe, Dierk

    2017-05-01

    Predicting, understanding, and controlling the mechanical behavior is the most important task when designing structural materials. Modern alloy systems—in which multiple deformation mechanisms, phases, and defects are introduced to overcome the inverse strength-ductility relationship—give raise to multiple possibilities for modifying the deformation behavior, rendering traditional, exclusively experimentally-based alloy development workflows inappropriate. For fast and efficient alloy design, it is therefore desirable to predict the mechanical performance of candidate alloys by simulation studies to replace time- and resource-consuming mechanical tests. Simulation tools suitable for this task need to correctly predict the mechanical behavior in dependence of alloy composition, microstructure, texture, phase fractions, and processing history. Here, an integrated computational materials engineering approach based on the open source software packages DREAM.3D and DAMASK (Düsseldorf Advanced Materials Simulation Kit) that enables such virtual material development is presented. More specific, our approach consists of the following three steps: (1) acquire statistical quantities that describe a microstructure, (2) build a representative volume element based on these quantities employing DREAM.3D, and (3) evaluate the representative volume using a predictive crystal plasticity material model provided by DAMASK. Exemplarily, these steps are here conducted for a high-manganese steel.

  6. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  7. The Importance Of Surface Topography For The Biological Properties Of Nitrided Diffusion Layers Produced On Ti6Al4V Titanium Alloy

    Directory of Open Access Journals (Sweden)

    Wierzchoń T.

    2015-09-01

    Full Text Available Diffusion nitrided layers produced on titanium and its alloys are widely studied in terms of their application for cardiac and bone implants. The influence of the structure, the phase composition, topography and surface morphology on their biological properties is being investigated. The article presents the results of a study of the topography (nanotopography of the surface of TiN+Ti2N+αTi(N nitrided layers produced in low-temperature plasma on Ti6Al4V titanium alloy and their influence on the adhesion of blood platelets and their aggregates. The TEM microstructure of the produced layers have been examined and it was demonstrated that the interaction between platelets and the surface of the titanium implants subjected to glow-discharge nitriding can be shaped via modification of the roughness parameters of the external layer of the TiN titanium nitride nanocrystalline zone.

  8. Anticancer Properties of an Important Drug Lead Podophyllotoxin Can Be Efficiently Mimicked by Diverse Heterocyclic Scaffolds Accessible via One-Step Synthesis

    Science.gov (United States)

    Magedov, Igor V.; Frolova, Liliya; Manpadi, Madhuri; Bhoga, Uma devi; Tang, Hong; Evdokimov, Nikolai M.; George, Olivia; Georgiou, Kathy Hadje; Renner, Steffen; Getlic, Matthäus; Kinnibrugh, Tiffany L.; Fernandes, Manuel A.; Van slambrouck, Severine; Steelant, Wim F. A.; Shuster, Charles B.; Rogelj, Snezna; van Otterlo, Willem A. L.; Kornienko, Alexander

    2011-01-01

    Structural simplification of an antimitotic natural product podophyllotoxin with mimetic heterocyclic scaffolds constructed using multicomponent reactions led to the identification of compounds exhibiting low nanomolar antiproliferative and apoptosis-inducing properties. The most potent compounds were found in the dihydropyridopyrazole, dihydropyridonaphthalene, dihydropyridoindole and dihydropyridopyrimidine scaffold series. Biochemical mechanistic studies performed with dihydropyridopyrazole compounds showed that these heterocycles inhibit in vitro tubulin polymerization and disrupt the formation of mitotic spindles in dividing cells at low nanomolar concentrations, in a manner similar to podophyllotoxin itself. Separation of a racemic dihydropyridonaphthalene into individual enantiomers demonstrated that only the optical antipode matching the absolute configuration of podophyllotoxin possessed potent anticancer activity. Computer modeling, performed using the podophyllotoxin binding site on beta-tubulin, provided a theoretical understanding of these successful experimental findings. PMID:21615090

  9. Isolation, characterization, spectroscopic properties and quantum chemical computations of an important phytoalexin resveratrol as antioxidant component from Vitis labrusca L. and their chemical compositions

    Science.gov (United States)

    Güder, Aytaç; Korkmaz, Halil; Gökce, Halil; Alpaslan, Yelda Bingöl; Alpaslan, Gökhan

    2014-12-01

    In this study, isolation and characterization of trans-resveratrol (RES) as an antioxidant compound were carried out from VLE, VLG and VLS. Furthermore, antioxidant activities were evaluated by using six different methods. Finally, total phenolic, flavonoid, ascorbic acid, anthocyanin, lycopene, β-carotene and vitamin E contents were carried out. In addition, the FT-IR, 13C and 1H NMR chemical shifts and UV-vis. spectra of trans-resveratrol were experimentally recorded. Quantum chemical computations such as the molecular geometry, vibrational frequencies, UV-vis. spectroscopic parameters, HOMOs-LUMOs energies, molecular electrostatic potential (MEP), natural bond orbitals (NBO) and nonlinear optics (NLO) properties of title molecule have been calculated by using DFT/B3PW91 method with 6-311++G(d,p) basis set in ground state for the first time. The obtained results show that the calculated spectroscopic data are in a good agreement with experimental data.

  10. Functional Properties of a Newly Identified C-terminal Splice Variant of Cav1.3 L-type Ca2+ Channels*

    Science.gov (United States)

    Bock, Gabriella; Gebhart, Mathias; Scharinger, Anja; Jangsangthong, Wanchana; Busquet, Perrine; Poggiani, Chiara; Sartori, Simone; Mangoni, Matteo E.; Sinnegger-Brauns, Martina J.; Herzig, Stefan; Striessnig, Jörg; Koschak, Alexandra

    2011-01-01

    An intramolecular interaction between a distal (DCRD) and a proximal regulatory domain (PCRD) within the C terminus of long Cav1.3 L-type Ca2+ channels (Cav1.3L) is a major determinant of their voltage- and Ca2+-dependent gating kinetics. Removal of these regulatory domains by alternative splicing generates Cav1.342A channels that activate at a more negative voltage range and exhibit more pronounced Ca2+-dependent inactivation. Here we describe the discovery of a novel short splice variant (Cav1.343S) that is expressed at high levels in the brain but not in the heart. It lacks the DCRD but, in contrast to Cav1.342A, still contains PCRD. When expressed together with α2δ1 and β3 subunits in tsA-201 cells, Cav1.343S also activated at more negative voltages like Cav1.342A but Ca2+-dependent inactivation was less pronounced. Single channel recordings revealed much higher channel open probabilities for both short splice variants as compared with Cav1.3L. The presence of the proximal C terminus in Cav1.343S channels preserved their modulation by distal C terminus-containing Cav1.3- and Cav1.2-derived C-terminal peptides. Removal of the C-terminal modulation by alternative splicing also induced a faster decay of Ca2+ influx during electrical activities mimicking trains of neuronal action potentials. Our findings extend the spectrum of functionally diverse Cav1.3 L-type channels produced by tissue-specific alternative splicing. This diversity may help to fine tune Ca2+ channel signaling and, in the case of short variants lacking a functional C-terminal modulation, prevent excessive Ca2+ accumulation during burst firing in neurons. This may be especially important in neurons that are affected by Ca2+-induced neurodegenerative processes. PMID:21998310

  11. Normative data set identifying properties of the macula across age groups: integration of visual function and retinal structure with microperimetry and spectral-domain optical coherence tomography.

    Science.gov (United States)

    Sabates, Felix N; Vincent, Ryan D; Koulen, Peter; Sabates, Nelson R; Gallimore, Gary

    2011-01-01

    A normative database of functional and structural parameters of the macula from normal subjects was established to identify reference points for the diagnosis of patients with macular disease using microperimetry and scanning laser ophthalmoscope/spectral-domain optical coherence tomography (SD-OCT). This was a community-based, prospective, cross-sectional study of 169 eyes from subjects aged 21 years to 85 years with best-corrected visual acuity of 20/25 or better and without any ocular disease. Full-threshold macular microperimetry combined with the acquisition of structural parameters of the macula with scanning laser ophthalmoscope/SD-OCT was recorded (SD-OCT/scanning laser ophthalmoscope with add-on Microperimetry module; OPKO). Fixation, central, subfield, and mean retinal thickness were acquired together with macular sensitivity function. Thickness and sensitivity as primary outcome measures were mapped and superimposed correlating topographically differentiated macular thickness with sensitivity. Statistical evaluation was performed with age, gender, and ethnicity as covariates. Subfield and mean retinal thickness and sensitivity were measured with macular microperimetry combined with SD-OCT and differentiated by macular topography and subjects' age, gender, and ethnicity. Mean retinal sensitivity and thickness were calculated for 169 healthy eyes (mean age, 48 ± 17 years). A statistically significant decrease in sensitivity was found only in the age group of participants ≥ 70 years and in peripheral portions of the macula in individuals aged ≥60 years and was more pronounced in the area surrounding the fovea than in the center of the macula, while retinal thickness did not change with age. No statistically significant differences in the primary outcome measures or their correlations were found when using gender or ethnicity as a covariate. A database for normal macular thickness and sensitivity was generated with a combined microperimetry SD

  12. The Importance of Short- and Long-Range Exchange on Various Excited State Properties of DNA Monomers, Stacked Complexes, and Watson-Crick Pairs.

    Science.gov (United States)

    Raeber, Alexandra E; Wong, Bryan M

    2015-05-12

    We present a detailed analysis of several time-dependent DFT (TD-DFT) methods, including conventional hybrid functionals and two types of nonempirically tuned range-separated functionals, for predicting a diverse set of electronic excitations in DNA nucleobase monomers and dimers. This large and extensive set of excitations comprises a total of 50 different transitions (for each tested DFT functional) that includes several n → π and π → π* valence excitations, long-range charge-transfer excitations, and extended Rydberg transitions (complete with benchmark calculations from high-level EOM-CCSD(T) methods). The presence of localized valence excitations as well as extreme long-range charge-transfer excitations in these systems poses a serious challenge for TD-DFT methods that allows us to assess the importance of both short- and long-range exchange contributions for simultaneously predicting all of these various transitions. In particular, we find that functionals that do not have both short- and full long-range exchange components are unable to predict the different types of nucleobase excitations with the same accuracy. Most importantly, the current study highlights the importance of both short-range exchange and a nonempirically tuned contribution of long-range exchange for accurately predicting the diverse excitations in these challenging nucleobase systems.

  13. Functional properties of a newly identified C-terminal splice variant of Cav1.3 L-type Ca2+ channels.

    Science.gov (United States)

    Bock, Gabriella; Gebhart, Mathias; Scharinger, Anja; Jangsangthong, Wanchana; Busquet, Perrine; Poggiani, Chiara; Sartori, Simone; Mangoni, Matteo E; Sinnegger-Brauns, Martina J; Herzig, Stefan; Striessnig, Jörg; Koschak, Alexandra

    2011-12-09

    An intramolecular interaction between a distal (DCRD) and a proximal regulatory domain (PCRD) within the C terminus of long Ca(v)1.3 L-type Ca(2+) channels (Ca(v)1.3(L)) is a major determinant of their voltage- and Ca(2+)-dependent gating kinetics. Removal of these regulatory domains by alternative splicing generates Ca(v)1.3(42A) channels that activate at a more negative voltage range and exhibit more pronounced Ca(2+)-dependent inactivation. Here we describe the discovery of a novel short splice variant (Ca(v)1.3(43S)) that is expressed at high levels in the brain but not in the heart. It lacks the DCRD but, in contrast to Ca(v)1.3(42A), still contains PCRD. When expressed together with α2δ1 and β3 subunits in tsA-201 cells, Ca(v)1.3(43S) also activated at more negative voltages like Ca(v)1.3(42A) but Ca(2+)-dependent inactivation was less pronounced. Single channel recordings revealed much higher channel open probabilities for both short splice variants as compared with Ca(v)1.3(L). The presence of the proximal C terminus in Ca(v)1.3(43S) channels preserved their modulation by distal C terminus-containing Ca(v)1.3- and Ca(v)1.2-derived C-terminal peptides. Removal of the C-terminal modulation by alternative splicing also induced a faster decay of Ca(2+) influx during electrical activities mimicking trains of neuronal action potentials. Our findings extend the spectrum of functionally diverse Ca(v)1.3 L-type channels produced by tissue-specific alternative splicing. This diversity may help to fine tune Ca(2+) channel signaling and, in the case of short variants lacking a functional C-terminal modulation, prevent excessive Ca(2+) accumulation during burst firing in neurons. This may be especially important in neurons that are affected by Ca(2+)-induced neurodegenerative processes.

  14. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  15. Some technological properties of phenotypically identified ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-12-15

    Dec 15, 2009 ... found in dairy products, where they may contribute to ripening of the cheese ... tellurite and resistance to heat (60°C for 15 and 30 min) (Holt et al.,. 1994; Manero and .... proteinaceous nature and were eliminated by treatment.

  16. Investigation of some important phytochemical, nutritional properties ...

    African Journals Online (AJOL)

    DELL

    2013-09-02

    Sep 2, 2013 ... Development and Conservation Programme (BDCP) Research. Centre, Nsukka, Enugu State. .... restoration of normal histological structure of the liver and kidney with few .... Cotonou markets (Benin). Indian J. Sci. Technol.

  17. Properties and CAPE

    DEFF Research Database (Denmark)

    Gani, Rafiqul; O'Connell, J.P.

    2001-01-01

    The role of properties in the solution of Computer Aided Process Engineering (CAPE) problems is described in terms of current trend, future challenges and important issues. Three distinct roles of properties in CAFE have been identified - a service role, a service plus advice role and a service......, advice plus solve role. The CAFE problems solved under each of these roles are described together with simple illustrative examples. Finally, the paper describes how some of the future problems related to integration of synthesis, design and control might be dealt with efficiently and reliably through co......-operative CAFE and properties methodologies. (C) 2001 Elsevier Science Ltd. All rights reserved....

  18. Identifying Phase Space Boundaries with Voronoi Tessellations

    CERN Document Server

    Debnath, Dipsikha; Kilic, Can; Kim, Doojin; Matchev, Konstantin T.; Yang, Yuan-Pao

    2016-11-24

    Determining the masses of new physics particles appearing in decay chains is an important and longstanding problem in high energy phenomenology. Recently it has been shown that these mass measurements can be improved by utilizing the boundary of the allowed region in the fully differentiable phase space in its full dimensionality. Here we show that the practical challenge of identifying this boundary can be solved using techniques based on the geometric properties of the cells resulting from Voronoi tessellations of the relevant data. The robust detection of such phase space boundaries in the data could also be used to corroborate a new physics discovery based on a cut-and-count analysis.

  19. Importancia de las propiedades de los suelos en la determinación del riesgo de contaminación de acuíferos Importance of soil properties in the risk of groundwater contamination

    Directory of Open Access Journals (Sweden)

    Olga S Heredia

    2008-12-01

    Full Text Available La vulnerabilidad de acuíferos es usualmente estimada por metodologías que no tienen en cuenta los principales parámetros físico-químicos de los suelos. Se determinaron las características de suelos en una zona periurbana de Buenos Aires con actividades mixtas. Se propuso un índice de atenuación (IA para estimar el riesgo de contaminación química de acuíferos, que tuvo en cuenta el Cox, pH, CIC y contenido de arcillas, profundidad de la capa freática y la posición del suelo en el paisaje. Los suelos de Escobar son Molisoles y Entisoles con gran variabilidad en su composición química. Los contenidos de P, Mn, Zn en las aguas subterráneas fueron utilizados para validar el IA, encontrando relación entre este índice y los mencionados elementos. El contenido de arcillas es una propiedad muy importante en la sorción de P, debido a que su incremento está directamente relacionado con el aumento en la retención del ion. Existió una relación significativa entre los parámetros edáficos Cox, CIC y P extractable y las propiedades químicas del agua con el IA.Aquifer vulnerability is frequently estimated through methodologies that do not consider the main physical and chemical soil parameters. Soil characteristics were determined at a semiurban region with mixed activities at the surroundings of Buenos Aires city. A soil attenuation index (AI was proposed to estimate groundwater chemical pollution risk, that takes into account organic carbon content, pH, cation exchange capacity, clay content, phreatic depth and landscape position. Escobar soils were Mollisols and Entisols with a high variation in soil properties. Phosphorus, Mn and Zn concentrations in groundwater samples taken from selected places were used to validate the proposed index. Clay content was a very important property for adsorption, as clay increased, the soil P retention capacity increased simultaneously. A relationship was found between CEC, Cox and extractable P and

  20. Identifying lubricant options for compressor bearing designs

    Science.gov (United States)

    Karnaz, J.; Seeton, C.; Dixon, L.

    2017-08-01

    Today’s refrigeration and air conditioning market is not only driven by the environmental aspects of the refrigerants, but also by the energy efficiency and reliability of system operation. Numerous types of compressor designs are used in refrigeration and air conditioning applications which means that different bearings are used; and in some cases, multiple bearing types within a single compressor. Since only one lubricant is used, it is important to try to optimize the lubricant to meet the various demands and requirements for operation. This optimization entails investigating different types of lubricant chemistries, viscosities, and various formulation options. What makes evaluating these options more challenging is the refrigerant which changes the properties of the lubricant delivered to the bearing. Once the lubricant and refrigerant interaction are understood, through various test methods, then work can start on collaborating with compressor engineers on identifying the lubricant chemistry and formulation options. These interaction properties are important to the design engineer to make decisions on the adequacy of the lubricant before compressor tests are started. This paper will discuss the process to evaluate lubricants for various types of compressors and bearing design with focus on what’s needed for current refrigerant trends. In addition, the paper will show how the lubricant chemistry choice can be manipulated through understanding of the bearing design and knowledge of interaction with the refrigerant to maximize performance. Emphasis will be placed on evaluation of synthetic lubricants for both natural and synthetic low GWP refrigerants.

  1. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  2. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  3. Leaf structural characteristics are less important than leaf chemical properties in determining the response of leaf mass per area and photosynthesis of Eucalyptus saligna to industrial-age changes in [CO2] and temperature.

    Science.gov (United States)

    Xu, Cheng-Yuan; Salih, Anya; Ghannoum, Oula; Tissue, David T

    2012-10-01

    The rise in atmospheric [CO(2)] is associated with increasing air temperature. However, studies on plant responses to interactive effects of [CO(2)] and temperature are limited, particularly for leaf structural attributes. In this study, Eucalyptus saligna plants were grown in sun-lit glasshouses differing in [CO(2)] (290, 400, and 650 µmol mol(-1)) and temperature (26 °C and 30 °C). Leaf anatomy and chloroplast parameters were assessed with three-dimensional confocal microscopy, and the interactive effects of [CO(2)] and temperature were quantified. The relative influence of leaf structural attributes and chemical properties on the variation of leaf mass per area (LMA) and photosynthesis within these climate regimes was also determined. Leaf thickness and mesophyll size increased in higher [CO(2)] but decreased at the warmer temperature; no treatment interaction was observed. In pre-industrial [CO(2)], warming reduced chloroplast diameter without altering chloroplast number per cell, but the opposite pattern (reduced chloroplast number per cell and unchanged chloroplast diameter) was observed in both current and projected [CO(2)]. The variation of LMA was primarily explained by total non-structural carbohydrate (TNC) concentration rather than leaf thickness. Leaf photosynthetic capacity (light- and [CO(2)]-saturated rate at 28 °C) and light-saturated photosynthesis (under growth [CO(2)] and temperature) were primarily determined by leaf nitrogen contents, while secondarily affected by chloroplast gas exchange surface area and chloroplast number per cell, respectively. In conclusion, leaf structural attributes are less important than TNC and nitrogen in affecting LMA and photosynthesis responses to the studied climate regimes, indicating that leaf structural attributes have limited capacity to adjust these functional traits in a changing climate.

  4. Machine Learning Identification of Protein Properties Useful for Specific Applications

    KAUST Repository

    Khamis, Abdullah M.

    2016-01-01

    Proteins play critical roles in cellular processes of living organisms. It is therefore important to identify and characterize their key properties associated with their functions. Correlating protein’s structural, sequence and physicochemical

  5. Identifying influential spreaders in interconnected networks

    International Nuclear Information System (INIS)

    Zhao, Dawei; Li, Lixiang; Huo, Yujia; Yang, Yixian; Li, Shudong

    2014-01-01

    Identifying the most influential spreaders in spreading dynamics is of the utmost importance for various purposes for understanding or controlling these processes. The existing relevant works are limited to a single network. Most real networks are actually not isolated, but typically coupled and affected by others. The properties of epidemic spreading have recently been found to have some significant differences in interconnected networks from those in a single network. In this paper, we focus on identifying the influential spreaders in interconnected networks. We find that the well-known k-shell index loses effectiveness; some insignificant spreaders in a single network become the influential spreaders in the whole interconnected networks while some influential spreaders become no longer important. The simulation results show that the spreading capabilities of the nodes not only depend on their influence for the network topology, but also are dramatically influenced by the spreading rate. Based on this perception, a novel index is proposed for measuring the influential spreaders in interconnected networks. We then support the efficiency of this index with numerical simulations. (paper)

  6. Identifying structural damage with ground penetrating radar

    CSIR Research Space (South Africa)

    Van Schoor, Abraham M

    2008-07-01

    Full Text Available Ground penetrating radar (GPR) and electrical resistance tomography (ERT) surveys were conducted in an urban environment in an attempt to identify the cause of severe structural damage to a historically significant residential property...

  7. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  8. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  9. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  10. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  11. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  12. Properties of human blood monocytes. I. CD91 expression and log orthogonal light scatter provide a robust method to identify monocytes that is more accurate than CD14 expression.

    Science.gov (United States)

    Hudig, Dorothy; Hunter, Kenneth W; Diamond, W John; Redelman, Doug

    2014-03-01

    This study was designed to improve identification of human blood monocytes by using antibodies to molecules that occur consistently on all stages of monocyte development and differentiation. We examined blood samples from 200 healthy adults without clinically diagnosed immunological abnormalities by flow cytometry (FCM) with multiple combinations of antibodies and with a hematology analyzer (Beckman LH750). CD91 (α2 -macroglobulin receptor) was expressed only by monocytes and to a consistent level among subjects [mean median fluorescence intensity (MFI) = 16.2 ± 3.2]. Notably, only 85.7 ± 5.82% of the CD91(+) monocytes expressed high levels of the classical monocyte marker CD14, with some CD91(+) CD16(+) cells having negligible CD14, indicating that substantial FCM under-counts will occur when monocytes are identified by high CD14. CD33 (receptor for sialyl conjugates) was co-expressed with CD91 on monocytes but CD33 expression varied by nearly ten-fold among subjects (mean MFI = 17.4 ± 7.7). In comparison to FCM analyses, the hematology analyzer systematically over-counted monocytes and eosinophils while lymphocyte and neutrophil differential values generally agreed with FCM methods. CD91 is a better marker to identify monocytes than CD14 or CD33. Furthermore, FCM (with anti-CD91) identifies monocytes better than a currently used clinical CBC instrument. Use of anti-CD91 together with anti-CD14 and anti-CD16 supports the identification of the diagnostically significant monocyte populations with variable expression of CD14 and CD16. Copyright © 2013 Clinical Cytometry Society.

  13. HEDIS Research Identifiable Files

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Healthcare Effectiveness Data and Information Set (HEDIS) is a tool used by more than 90 percent of Americas health plans to measure performance on important...

  14. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  15. Fosfatos de cálcio de interesse biológico: importância como biomateriais, propriedades e métodos de obtenção de recobrimentos Calcium phosphates of biological interest: importance as biomaterials, properties and methods for coatings obtaining

    Directory of Open Access Journals (Sweden)

    Antonio Carlos Guastaldi

    2010-01-01

    Full Text Available For decades the Hydroxyapatite (HA was only bioceramic of calcium phosphate system used for bone replacement and regeneration, due to its similarity to the mineral phase of bones and teeth. Because its slow degradation, other calcium phosphate classified as biodegradable started to awaken interest, such as: amorphous calcium phosphate (ACP, octacalcium phosphate (OCP and tricalcium phosphate (TCP. This work presents the evolution of the use of other calcium phosphates due to their better solubility than the HA, comparing their main physical-chemical and biological properties. Are also presented the main methods used to obtain bioceramic coatings on metal and polymer surfaces.

  16. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  17. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  18. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  19. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  20. Identify alkylation hazards

    International Nuclear Information System (INIS)

    Scott, B.

    1992-01-01

    This paper reports that extensive experience shows that alkylation plants regardless of acid catalyst choice, can be operated safely, and with minimum process risk to employees or neighbors. Both types of plants require a comprehensive and fully supported hazard management program that accounts for differing physical properties of the acids involved. Control and mitigation cost to refiners will vary considerably from plant to plant and location to location. In the author's experience, the order of magnitude costs will be about $1 to $2 million for a sulfuric acid (SA) alkylation plant, and about $10 to $15 million for a hydrofluoric acid (HF) plant. These costs include water supply systems and impoundment facilities for contaminated runoff water. The alkylation process, which chemically reacts isobutane and light olefins in the presence of a strong acid catalyst into a premium gasoline component is described

  1. ORCID: Author Identifiers for Librarians

    Directory of Open Access Journals (Sweden)

    Robyn B. Reed

    2017-10-01

    Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.

  2. Identifying phenomenal consciousness.

    Science.gov (United States)

    Schier, Elizabeth

    2009-03-01

    This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.

  3. Are All Pixels Equally Important?

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    When we look at our environment, we primarily pay attention to visually distinctive objects. We refer to these objects as visually important or salient. For efficient visual processing, the human visual system identifies salients objects and dedicates most of its processing resources to them. An analogous resource allocation can be performed by salient-object detection algorithms, which identify objects of interest in an image. Consequently, thanks to salient-object detection, complex visual computing operations can focus on the important parts of the visual data and can save time and resources. About the speaker Dr. Gokhan Yildirim is a research assistant in the School of Computer and Communication Sciences (IC) at the École Polytechnique Fédérale de Lausanne (EPFL). His research interests include image understanding, multimedia, pattern recognition, machine learning, salient-object detection on images & videos and its applications on image proces...

  4. ECOPHARMACOVIGILANCE: ITS IMPORTANCE AND CHALLENGES

    OpenAIRE

    Dr. Bhavana Srivastava

    2014-01-01

    Active pharmaceutical ingredients represent a group of emerging environmental contamination. Even in trace amounts, they are of great concern due to then continuous introduction into the environment, their impact an ecosystem and human and vetenery health is of great importance. This has given birth to the science of Ecopharmacovigilance (EPV). It aims to ensure that significant environmental issues associated with pharmaceuticals in the environment are identified and managed appropriately. ...

  5. The importance of coughs

    African Journals Online (AJOL)

    2012-03-14

    Mar 14, 2012 ... how important it can be. It is at best ... e. rise of intrathoracic pressure up to 200mm Hg., f. glottic opening and ... The differential diagnosis may be reviewed from knowledge .... cigarette smoking is an important example. 3.

  6. A new uncertainty importance measure

    International Nuclear Information System (INIS)

    Borgonovo, E.

    2007-01-01

    Uncertainty in parameters is present in many risk assessment problems and leads to uncertainty in model predictions. In this work, we introduce a global sensitivity indicator which looks at the influence of input uncertainty on the entire output distribution without reference to a specific moment of the output (moment independence) and which can be defined also in the presence of correlations among the parameters. We discuss its mathematical properties and highlight the differences between the present indicator, variance-based uncertainty importance measures and a moment independent sensitivity indicator previously introduced in the literature. Numerical results are discussed with application to the probabilistic risk assessment model on which Iman [A matrix-based approach to uncertainty and sensitivity analysis for fault trees. Risk Anal 1987;7(1):22-33] first introduced uncertainty importance measures

  7. List identifies threatened ecosystems

    Science.gov (United States)

    Showstack, Randy

    2012-09-01

    The International Union for Conservation of Nature (IUCN) announced on 9 September that it will develop a new Red List of Ecosystems that will identify which ecosystems are vulnerable or endangered. The list, which is modeled on the group's Red List of Threatened Species™, could help to guide conservation activities and influence policy processes such as the Convention on Biological Diversity, according to the group. “We will assess the status of marine, terrestrial, freshwater, and subterranean ecosystems at local, regional, and global levels,” stated Jon Paul Rodriguez, leader of IUCN's Ecosystems Red List Thematic Group. “The assessment can then form the basis for concerted implementation action so that we can manage them sustainably if their risk of collapse is low or restore them if they are threatened and then monitor their recovery.”

  8. Global Microbial Identifier

    DEFF Research Database (Denmark)

    Wielinga, Peter; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2017-01-01

    ) will likely also enable a much better understanding of the pathogenesis of the infection and the molecular basis of the host response to infection. But the full potential of these advances will only transpire if the data in this area become transferable and thereby comparable, preferably in open-source...... of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect outbreaks and emerging pathogens. To harness the full potential of WGS, a shared global database of genomes linked to relevant metadata and the necessary software tools needs to be generated, hence the global...... microbial identifier (GMI) initiative. This tool will ideally be used in amongst others in the diagnosis of infectious diseases in humans and animals, in the identification of microorganisms in food and environment, and to track and trace microbial agents in all arenas globally. This will require...

  9. Thermophysical properties

    Energy Technology Data Exchange (ETDEWEB)

    Kayser, R.F.

    1993-01-01

    Numerous fluids have been identified as promising alternative refrigerants, but much of the information needed to predict their behavior as pure fluids and as components in mixtures does not exist. In particular, reliable thermophysical properties data and models are needed to predict the performance of the new refrigerants in heating and cooling equipment and to design and optimize equipment to be reliable and energy efficient. The objective of this project is to provide highly accurate, selected thermophysical properties data for Refrigerants 32, 123, 124, and 125, and to use these data to fit simple and complex equations of state and detailed transport property models. The new data will fill gaps in the existing data sets and resolve the problems and uncertainties that exist in and between the data sets. This report describes the progress made during the fourth quarter of this fifteen-month project, which was initiated in late January, 1992.

  10. Unravelling the importance of forest age stand and forest structure driving microbiological soil properties, enzymatic activities and soil nutrients content in Mediterranean Spanish black pine(Pinus nigra Ar. ssp. salzmannii) Forest.

    Science.gov (United States)

    Lucas-Borja, M E; Hedo, J; Cerdá, A; Candel-Pérez, D; Viñegla, B

    2016-08-15

    This study aimed to investigate the effects that stand age and forest structure have on microbiological soil properties, enzymatic activities and nutrient content. Thirty forest compartments were randomly selected at the Palancares y Agregados managed forest area (Spain), supporting forest stands of five ages; from 100 to 80years old to compartments with trees that were 19-1years old. Forest area ranging from 80 to 120years old and without forest intervention was selected as the control. We measured different soil enzymatic activities, soil respiration and nutrient content (P, K, Na, Mg, Cr, Mn, Fe, Co, Ni, Cu, Zn, Pb and Ca) in the top cm of 10 mineral soils in each compartment. Results showed that the lowest forest stand age and the forest structure created by management presented lower values of organic matter, soil moisture, water holding capacity and litterfall and higher values of C/N ratio in comparison with the highest forest stand age and the related forest structure, which generated differences in soil respiration and soil enzyme activities. The forest structure created by no forest management (control plot) presented the highest enzymatic activities, soil respiration, NH4(+) and NO3(-). Results did not show a clear trend in nutrient content comparing all the experimental areas. Finally, the multivariate PCA analysis clearly clustered three differentiated groups: Control plot; from 100 to 40years old and from 39 to 1year old. Our results suggest that the control plot has better soil quality and that extreme forest stand ages (100-80 and 19-1years old) and the associated forest structure generates differences in soil parameters but not in soil nutrient content. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Optimising import phytosanitary inspection

    NARCIS (Netherlands)

    Surkov, I.

    2007-01-01

    Keywords: quarantine pest, plant health policy, optimization, import phytosanitary inspection, ‘reduced checks’, optimal allocation of resources, multinomial logistic regression, the Netherlands World trade is a major vector of spread of quarantine plant pests. Border phytosanitary inspection

  12. Radiograph identifying means

    International Nuclear Information System (INIS)

    Sheldon, A.D.

    1983-01-01

    A flexible character-indentable plastics embossing tape is backed by and bonded to a lead strip, not more than 0.025 inches thick, to form a tape suitable for identifying radiographs. The lead strip is itself backed by a relatively thin and flimsy plastics or fabric strip which, when removed, allows the lead plastic tape to be pressure-bonded to the surface to be radiographed. A conventional tape-embossing gun is used to indent the desired characters in succession into the lead-backed tape, without necessarily severing the lead; and then the backing strip is peeled away to expose the layer of adhesive which pressure-bonds the indented tape to the object to be radiographed. X-rays incident on the embossed tape will cause the raised characters to show up dark on the subsequently-developed film, whilst the raised side areas will show up white. Each character will thus stand out on the developed film. (author)

  13. Parameter identifiability and redundancy: theoretical considerations.

    Directory of Open Access Journals (Sweden)

    Mark P Little

    Full Text Available BACKGROUND: Models for complex biological systems may involve a large number of parameters. It may well be that some of these parameters cannot be derived from observed data via regression techniques. Such parameters are said to be unidentifiable, the remaining parameters being identifiable. Closely related to this idea is that of redundancy, that a set of parameters can be expressed in terms of some smaller set. Before data is analysed it is critical to determine which model parameters are identifiable or redundant to avoid ill-defined and poorly convergent regression. METHODOLOGY/PRINCIPAL FINDINGS: In this paper we outline general considerations on parameter identifiability, and introduce the notion of weak local identifiability and gradient weak local identifiability. These are based on local properties of the likelihood, in particular the rank of the Hessian matrix. We relate these to the notions of parameter identifiability and redundancy previously introduced by Rothenberg (Econometrica 39 (1971 577-591 and Catchpole and Morgan (Biometrika 84 (1997 187-196. Within the widely used exponential family, parameter irredundancy, local identifiability, gradient weak local identifiability and weak local identifiability are shown to be largely equivalent. We consider applications to a recently developed class of cancer models of Little and Wright (Math Biosciences 183 (2003 111-134 and Little et al. (J Theoret Biol 254 (2008 229-238 that generalize a large number of other recently used quasi-biological cancer models. CONCLUSIONS/SIGNIFICANCE: We have shown that the previously developed concepts of parameter local identifiability and redundancy are closely related to the apparently weaker properties of weak local identifiability and gradient weak local identifiability--within the widely used exponential family these concepts largely coincide.

  14. Importance of M2-M3 loop in governing properties of genistein at the α7 nicotinic acetylcholine receptor inferred from α7/5-HT3A chimera.

    Science.gov (United States)

    Grønlien, Jens Halvard; Ween, Hilde; Thorin-Hagene, Kirsten; Cassar, Steven; Li, Jinhe; Briggs, Clark A; Gopalakrishnan, Murali; Malysz, John

    2010-11-25

    Genistein and 5-hydroxyindole (5-HI) potentiate the α7 nicotinic acetylcholine receptor current by primarily increasing peak amplitude, a property of type I α7 positive allosteric modulation. In this study, the effects of these two compounds were investigated at two different α7/5-HT(3) chimeras (chimera 1, comprising of extracellular α7 N-terminus fused to the remainder of 5-HT(3A), and chimera 2 containing an additional α7 encoded M2-M3 loop), and wild-type α7 and 5-HT(3A) receptors. Agonist-evoked responses, examined by expression of the chimeras in Xenopus laevis oocytes or HEK-293 cells, revealed that currents decayed slower and compounds {rank order: N-[(3R)-1-azabicyclo[2.2.2]oct-3-yl]-4-chlorobenzamide hydrochloride (PNU-282987)~2-(1,4-diazabicyclo[3.2.2]nonan-4-yl)-5-phenyl-1,3,4-oxadiazole (NS6784)>acetylcholine>choline} were more potent in chimera 2 than chimera 1 or α7 receptors. In chimera 2, genistein and 5-HI potentiated agonist-evoked responses (EC(50): 4-5 μM for genistein and 300-500 μM for 5-HI) and at higher concentrations evoked current directly consistent with ago-allosteric modulation. At chimera 1 and 5-HT(3A) receptors, neither compound directly evoked any current and 5-HI, only at chimera 1, was able to potentiate agonist-evoked responses. Genistein and 5-HI did not inhibit the binding of the α7 agonist [(3)H](1S,4S)-2,2-dimethyl-5-(6-phenylpyridazin-3-yl)-5-aza-2-azoniabicyclo[2.2.1] heptane ([(3)H]A-585539) to rat brain or chimera 2. In summary, this study supports the role of the M2-M3 loop being critical for the positive allosteric effect of genistein, but not 5-HI, and in agonist-evoked response fine-tuning. The identification of distinct α7 receptor modulatory sites offers unique opportunities for developing CNS therapeutics and understanding its pharmacology. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Structural identifiability of polynomial and rational systems

    NARCIS (Netherlands)

    J. Nemcová (Jana)

    2010-01-01

    htmlabstractSince analysis and simulation of biological phenomena require the availability of their fully specified models, one needs to be able to estimate unknown parameter values of the models. In this paper we deal with identifiability of parametrizations which is the property of one-to-one

  16. Identifi cation of Sectarianism

    Directory of Open Access Journals (Sweden)

    Martinovich Vladimir

    2016-03-01

    Full Text Available «New religious movements and society» is traditionally one of the most sophisticated topics in the area of new religions studies. Its problem field is so huge that up to now by far not all important research themes where even touched by scientists from all over the world. The problem of the process of the identification of sectarianism by diff erent societal institutions is one of such untouched themes that is taken as the main subject of this article. This process by itself is an inseparable part of the every societal deliberate reaction to the very existence of unconventional religiosity, its unstructured and mainly structured types. The focal point of the article is step-by-step analysis of the general structure elements of the process of the identification of sectarianism without any reference to the specific time and place of its flow. Special attention is paid to the analysis of the subjects of the identification of sectarianism, to the criteria for religious groups to be qualified as new religious movements, and to the specific features of the process of documents filtration. The causes of selective perception of sectarianism are disclosed. Some main consequences and unpredictable outcomes of the process of the identification of sectarianism are described.

  17. Importance of halogen···halogen contacts for the structural and magnetic properties of CuX2(pyrazine-N,N′-dioxide)(H2O)2 (X = Cl and Br).

    Science.gov (United States)

    Schlueter, John A; Park, Hyunsoo; Halder, Gregory J; Armand, William R; Dunmars, Cortney; Chapman, Karena W; Manson, Jamie L; Singleton, John; McDonald, Ross; Plonczak, Alex; Kang, Jinhee; Lee, Chaghoon; Whangbo, Myung-Hwan; Lancaster, Tom; Steele, Andrew J; Franke, Isabel; Wright, Jack D; Blundell, Stephen J; Pratt, Francis L; deGeorge, Joseph; Turnbull, Mark M; Landee, Christopher P

    2012-02-20

    The structural and magnetic properties of the newly crystallized CuX(2)(pyzO)(H(2)O)(2) (X = Cl, Br; pyzO = pyrazine-N,N'-dioxide) coordination polymers are reported. These isostructural compounds crystallize in the monoclinic space group C2/c with, at 150 K, a = 17.0515(7) Å, b = 5.5560(2) Å, c = 10.4254(5) Å, β = 115.400(2)°, and V = 892.21(7) Å(3) for X = Cl and a = 17.3457(8) Å, b = 5.6766(3) Å, c = 10.6979(5) Å, β = 115.593(2)°, and V = 950.01(8) Å(3) for X = Br. Their crystal structure is characterized by one-dimensional chains of Cu(2+) ions linked through bidentate pyzO ligands. These chains are joined together through OH···O hydrogen bonds between the water ligands and pyzO oxygen atoms and Cu-X···X-Cu contacts. Bulk magnetic susceptibility measurements at ambient pressure show a broad maximum at 7 (Cl) and 28 K (Br) that is indicative of short-range magnetic correlations. The dominant spin exchange is the Cu-X···X-Cu supersuperexchange because the magnetic orbital of the Cu(2+) ion is contained in the CuX(2)(H(2)O)(2) plane and the X···X contact distances are short. The magnetic data were fitted to a Heisenberg 1D uniform antiferromagnetic chain model with J(1D)/k(B) = -11.1(1) (Cl) and -45.9(1) K (Br). Magnetization saturates at fields of 16.1(3) (Cl) and 66.7(5) T (Br), from which J(1D) is determined to be -11.5(2) (Cl) and -46.4(5) K (Br). For the Br analog the pressure dependence of the magnetic susceptibility indicates a gradual increase in the magnitude of J(1D)/k(B) up to -51.2 K at 0.84 GPa, suggesting a shortening of the Br···Br contact distance under pressure. At higher pressure X-ray powder diffraction data indicates a structural phase transition at ∼3.5 GPa. Muon-spin relaxation measurements indicate that CuCl(2)(pyzO)(H(2)O)(2) is magnetically ordered with T(N) = 1.06(1) K, while the signature for long-range magnetic order in CuBr(2)(pyzO)(H(2)O)(2) was much less definitive down to 0.26 K. The results for the Cu

  18. Optimal coal import strategy

    International Nuclear Information System (INIS)

    Chen, C.Y.; Shih, L.H.

    1992-01-01

    Recently, the main power company in Taiwan has shifted the primary energy resource from oil to coal and tried to diversify the coal supply from various sources. The company wants to have the imported coal meet the environmental standards and operation requirements as well as to have high heating value. In order to achieve these objectives, establishment of a coal blending system for Taiwan is necessary. A mathematical model using mixed integer programming technique is used to model the import strategy and the blending system. 6 refs., 1 tab

  19. Seed Potato Production and Its Importance

    OpenAIRE

    Erdoğan ÖZTÜRK; Taşkın POLAT

    2017-01-01

    Our country has different agricultural regions showed different ecological properties in terms of climate and soil characteristics increase the plant variety. Within this variety the potato is one of the most important plants for agriculture and economic of our country, also it is an important food source for human. It is important to use productive and quality seed for healthy agricultural production. With the using of good quality seed, can be obtained about 20% increase in yield. Certified...

  20. Identifiability of Model Properties in Over-Parameterized Model Classes

    DEFF Research Database (Denmark)

    Jaeger, Manfred

    2013-01-01

    Classical learning theory is based on a tight linkage between hypothesis space (a class of function on a domain X), data space (function-value examples (x, f(x))), and the space of queries for the learned model (predicting function values for new examples x). However, in many learning scenarios t...

  1. Psychometric properties of the Portuguese version of the Conflict Tactics Scales: Parent-child Version (CTSPC used to identify child abuse Propriedades psicométricas da versão em português do instrumento Conflict Tactics Scales: Parent-child Version (CTSPC utilizado para identificar violência contra a criança

    Directory of Open Access Journals (Sweden)

    Michael Eduardo Reichenheim

    2006-03-01

    Full Text Available This article follows another, which presented the first phase of the cross-cultural adaptation process examining the psychometric properties of the Conflict Tactics Scales, Parent-child Version (CTSPC, Portuguese version. Fieldwork took place in three public maternity wards in Rio de Janeiro, Brazil, from March to September 2000. Interviews relate to siblings of randomly selected live births. Respondents were mothers. Information on partners was obtained by proxy. Almost all intra-observer reliability kappa estimates were above 0.75. Depending on the scale and type of perpetrator, internal consistency (a estimates ranged from 0.49 to 0.68. Using the same sample, the iterated principal factor analysis identified four dimensions. Although most items performed well, some failed to adequately load in their expected factors. Construct validity involved exploring the relationship between several other theoretical dimensions and a variable encompassing the cumulative pattern of violence severity. All the hypotheses tested were corroborated. The current evaluation indicates that the CTSPC can be recommended for use in Portuguese-speaking contexts. Still, it also identified some important points needing further investigation and discussion.Este artigo segue outro que apresentava a primeira fase do processo de adaptação transcultural, examinando as propriedades psicométricas da versão em português do instrumento Conflict Tactics Scales: Parent-child Version (CTSPC. O trabalho de campo ocorreu de março a setembro de 2000 em três maternidades públicas de grande porte do Rio de Janeiro, Brasil. Irmãos de recém-nascidos foram amostrados aleatoriamente. Entrevistas foram realizadas com mães. Informações sobre parceiros foram obtidas por proxi. A maioria das estimativas de confiabilidade intra-observador (kappa se mostrou acima de 0,75. Consistência interna (a variou de 0,49-0,68, dependendo da escala e tipo de perpetrador. Usando a mesma amostra

  2. The financial importance

    International Nuclear Information System (INIS)

    Diel, R.

    1974-01-01

    The paper discusses the question of how the EURATOM property in special fissionable materials as specified in article 86 of the EURATOM treaty has to be treated by German law and which effects the decisions to be made will then have on the borrowing of money by nuclear power plant operators as well as on the collateral for this borrowed money. It is mandatory for all parties to reach a consensus of opinion regarding these matters in order to guarantee a legally irreproachable collateral for the money to be borrowed. The influencing factors from the fields of civil, public, and international law will have to be coordinated in consideration of the powers of the EURATOM community. (HP/AK) [de

  3. Thermodynamic Properties of Magnesium Chloride Hydroxide Hydrate (Mg3Cl(OH)5:4H2O, Phase 5), and Its importance to Nuclear Waste Isolation in Geological Repositories in Salt Formations

    Science.gov (United States)

    Xiong, Y.; Deng, H.; Nemer, M. B.; Johnsen, S.

    2009-12-01

    MgO (bulk, pure MgO corresponding to the mineral periclase) is the only engineered barrier certified by the Environmental Protection Agency for emplacement in the Waste Isolation Pilot Plant (WIPP) in the US, and an Mg(OH)2-based engineered barrier (bulk, pure Mg(OH)2 corresponding to brucite) is to be employed in the Asse repository in Germany. Both the WIPP and the Asse are located in salt formations. The WIPP is a U.S. Department of Energy geological repository being used for the permanent disposal of defense-related transuranic waste (TRU waste). The repository is 655 m below the surface, and is situated in the Salado Formation, a Permian salt bed mainly composed of halite, and of lesser amounts of polyhalite, anhydrite, gypsum, magnesite, clays and quartz. The WIPP Generic Weep Brine (GWB), a Na-Mg-Cl dominated brine, is associated with the Salado Formation. The previous vendor for MgO for the WIPP was Premier Chemicals and the current vendor is Martin Marietta Materials. Experimental studies of both Premier MgO and Martin Marietta MgO with the GWB at SNL indicate the formation of magnesium chloride hydroxide hydrate, Mg3Cl(OH)5:4H2O, termed as phase 5. However, this important phase is lacking in the existing thermodynamic database. In this study, the solubility constant of phase 5 is determined from a series of solubility experiments in MgCl2-NaCl solutions. The solubility constant at 25 oC for the following reaction, Mg3Cl(OH)5:4H2O + 5H+ = 3Mg2+ + 9H2O(l) + Cl- is recommended as 43.21±0.33 (2σ) based on the Specific Interaction Theory (SIT) model for extrapolation to infinite dilution. The log K obtained via the Pitzer equations is identical to the above value within the quoted uncertainty. The Gibbs free energy and enthalpy of formation for phase 5 at 25 oC are derived as -3384±2 (2σ) kJ mol-1 and -3896±6 (2σ) kJ mol-1, respectively. The standard entropy and heat capacity of phase 5 at 25 oC are estimated as 393±20 J mol-1 K-1 and 374±19 J mol-1 K

  4. [Diagnosing imported helminthiasis].

    Science.gov (United States)

    Pardo, Javier; Pérez-Arellano, José Luis; Galindo, Inmaculada; Belhassen, Moncef; Cordero, Miguel; Muro, Antonio

    2007-05-01

    In recent years, there has been an increase in cases of imported helminthiasis in Spain because of two complementary causes: immigration and international travel. Although the prevalence of helminthiasis is high in the immigrant population, the risk of transmission to the Spanish population is low. In this review, we provide clues to aid in the diagnosis of the helminthiasis, highlighting the geographic characteristics, clinical findings and analytical results of the most frequent types. The low sensitivity of the classic parasitological diagnostic test, mainly in tissue helminthiasis, is described. In addition, the advantages and limitations of the common serological methods for detecting related circulating antigens and antibodies are presented. Certain molecular methods used in the diagnosis of imported helminthiasis and the best strategies for screening of this condition are discussed.

  5. TRIPs Agreement, Important Multilateral WTO Treaty

    Directory of Open Access Journals (Sweden)

    Oana-Maria Florescu

    2006-08-01

    Full Text Available This article aims at presenting the content and the frame of the TRIPs. Agreement. It starts by introducing the reader to the terms that defined the world economical climate by the time of the Agreement negociation. Also, it explains the need of having an Agreement on intellectual property rights with impact on the business world. Moreover, the article reviews the main provisions of the Agreement and the most important intellectual property rights.

  6. Risk communication importance

    Energy Technology Data Exchange (ETDEWEB)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de, E-mail: raqueldalledonesiqueira@gmail.com, E-mail: delvonei@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  7. Risk communication importance

    International Nuclear Information System (INIS)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de

    2013-01-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  8. An introduction to intellectual property licensing for technology companies

    Science.gov (United States)

    Meier, Lawrence H.

    2001-05-01

    Intellectual property licensing is an important issue facing all technology companies. Before entering into license agreements a number of issues need to be addressed, including invention ownership, obtaining and identifying licensable subject matter, and developing a licensing strategy. There are a number of important provisions that are included in most intellectual property license agreements. These provisions include definitions, the license grant, consideration, audit rights confidentiality, warranties, indemnification, and limitation of liability. Special licensing considerations exist relative to each type of intellectual property, and when the other party is a foreign company or a university.

  9. SPARQL-enabled identifier conversion with Identifiers.org

    Science.gov (United States)

    Wimalaratne, Sarala M.; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-01-01

    Motivation: On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. Results: We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. Availability and implementation: The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. Contact: sarala@ebi.ac.uk PMID:25638809

  10. SPARQL-enabled identifier conversion with Identifiers.org.

    Science.gov (United States)

    Wimalaratne, Sarala M; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-06-01

    On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. © The Author 2015. Published by Oxford University Press.

  11. Most important human aluminoses

    Energy Technology Data Exchange (ETDEWEB)

    Avtsyn, A P

    1986-01-01

    Aluminoses are widespread forms of trace element deficiency of various severity. The organism is protected against a possible pathogenic influence of aluminum by a number of physiological mechanisms the most important among which is a regular urine excretion. A complex of pathological symptoms develops if serious homeostasis disturbances take place e. g. when renal deficiency or direct penetration of the trace element occur. The following forms of aluminosis should be distinguished: 1) simple accumulation in central nervous system which occurs in persons over 65 years; 2) aluminum accumulation in Alzheimer disease, in severe form of presenile and senile dementia; 3) dialysis aluminum encephalopathy; 4) non-dialysis infantile encephalopathy; 5) aluminum encephalopathy in total parenteral nutrition; 6) iatrogenic dialysis aluminum osteodystrophy; 7) jatrogenic peritoneal aluminosis; 8) aluminum pneumoconiosis of an occupational origin; 9) bronchospastic syndrome in aluminum smelter workers.

  12. Mexico: Imports or exports?

    International Nuclear Information System (INIS)

    Estrada, J.

    2002-01-01

    This presentation provides an overview of Mexico's energy sector. Proven oil reserves place Mexico in ninth position in the world and fourth largest in natural gas reserves. Energy is one of the most important economic activities of the country, representing 3 per cent of Gross Domestic Product (GDP). Oil exports represent 8.4 per cent of total exports. Approximately 40 per cent of total public investment is earmarked for energy projects. The author discusses energy resources and energy sector limitations. The energy sector plan for the period 2001-2006 is discussed. Its goals are to ensure energy supply, to develop the energy sector, to stimulate participation of Mexican enterprises, to promote renewable energy sources, and to strengthen international energy cooperation. The regulatory framework is being adapted to increase private investment. Some graphs are presented, displaying the primary energy production and primary energy consumption. Energy sector reforms are reviewed, as are electricity and natural gas reforms. The energy sector demand for 2000-2010 and investment requirements are reviewed, as well as fuel consumption for power generation. The author discusses the National Pipeline System (SNG) and the bottlenecks caused by pressure efficiency in the northeast, flow restriction on several pipeline segments, variability of the Petroleos Mexicanos (PEMEX) own use, and pressure drop on central regions. The entire prospect for natural gas in the country is reviewed, along with the Strategic Gas Program (PEG) consisting of 20 projects, including 4 non-associated natural gas, 9 exploration and 7 optimization. A section dealing with multiple service contracts is included in the presentation. The authors conclude by stating that the priority is a national energy policy to address Mexico's energy security requirements, to increase natural gas production while promoting the diversification of imports, and a regulatory framework to be updated in light of current

  13. Technologically important properties of lactic acid bacteria isolated ...

    African Journals Online (AJOL)

    SERVER

    2007-07-18

    Jul 18, 2007 ... fast acidifying strains are good candidate in the dairy fer- ..... predicting the lytic behavior and proteolytic activity of lactococcal ... Food Flavour: Generation Analysis and Process Influence. ... Preparation and consumer.

  14. Screening important inputs in models with strong interaction properties

    International Nuclear Information System (INIS)

    Saltelli, Andrea; Campolongo, Francesca; Cariboni, Jessica

    2009-01-01

    We introduce a new method for screening inputs in mathematical or computational models with large numbers of inputs. The method proposed here represents an improvement over the best available practice for this setting when dealing with models having strong interaction effects. When the sample size is sufficiently high the same design can also be used to obtain accurate quantitative estimates of the variance-based sensitivity measures: the same simulations can be used to obtain estimates of the variance-based measures according to the Sobol' and the Jansen formulas. Results demonstrate that Sobol' is more efficient for the computation of the first-order indices, while Jansen performs better for the computation of the total indices.

  15. Screening important inputs in models with strong interaction properties

    Energy Technology Data Exchange (ETDEWEB)

    Saltelli, Andrea [European Commission, Joint Research Centre, 21020 Ispra, Varese (Italy); Campolongo, Francesca [European Commission, Joint Research Centre, 21020 Ispra, Varese (Italy)], E-mail: francesca.campolongo@jrc.it; Cariboni, Jessica [European Commission, Joint Research Centre, 21020 Ispra, Varese (Italy)

    2009-07-15

    We introduce a new method for screening inputs in mathematical or computational models with large numbers of inputs. The method proposed here represents an improvement over the best available practice for this setting when dealing with models having strong interaction effects. When the sample size is sufficiently high the same design can also be used to obtain accurate quantitative estimates of the variance-based sensitivity measures: the same simulations can be used to obtain estimates of the variance-based measures according to the Sobol' and the Jansen formulas. Results demonstrate that Sobol' is more efficient for the computation of the first-order indices, while Jansen performs better for the computation of the total indices.

  16. Gardner's commercially important chemicals: synonyms, trade names, and properties

    National Research Council Canada - National Science Library

    Milne, George W. A

    2005-01-01

    ... provided for individual chemical compounds. Book In the preparation of this an effort has been made to include useful information on chemicals that play a significant role in commerce. The US Environmental Protection Agency (EPA), in cooperation with industry, maintains a list of "High Production Volume" (HPV) chemicals whose productio...

  17. shales: a review of their classifications, properties and importance to ...

    African Journals Online (AJOL)

    DJFLEX

    In the Niger Delta petroleum province, the source rocks and seal rocks are the marine/deltaic, plastic and over-pressured shales of Akata and Agbada Formations. KEY WORDS: Shales, Classification, Strength, Composition, Petroleum Industry, Niger Delta. INTRODUCTION. Shales are fine-grained laminated or fissile.

  18. Measures of risk importance and their applications

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.; Denning, R.S.; Saltos, N.

    1983-07-01

    This work is part of a project being conducted for the Division of Risk Analysis (DRA) of the Nuclear Regulatory Commission (NRC). The objectives of the project are to evaluate the importances of containment, the different safety functions, and other various contributers as assessed in probabilistic risk analyses and to identify generic conclusions regarding the importances. Effective display of the importances is an important part of these objectives. To address these objectives, measures of risk importance need to be first identified and then they need to be evaluated for the different risk analyses which have been performed. This report describes the risk importance measures that were defined and were applied to the risk analyses which were performed as part of the Reactor Safety Study Methodology Applications Program (RSSMAP). The risk importance measures defined in this report measure the importance of features not only with regard to risk reduction but also with regard to reliability assurance, or risk maintenance. The goal of this report is not to identify new mathematical formulas for risk importance but to show how importance measures can be interpreted and can be applied

  19. Imported coenurosis in sheep

    International Nuclear Information System (INIS)

    Schweizer, G.; Grünenfelder, F.; Sydler, T.; Rademacher, N.; Braun, U.; Deplazes, P.

    2006-01-01

    Thirteen sheep from a milk producing farm in the Canton of Grisons that presented chronic coenurosis were examined and subjected to treatment trials at the veterinary hospital in Zurich. Symptoms were first observed around two months after the import of two dogs from Italy (Abruzza) of which one was infected with Taenia multiceps and Echinococcus granulosus. The most frequently observed clinical symptoms of the sheep were reduced general condition, circling, reduced menace reflex, apathy, unsteady gait and head tilt. Analyses of cerebrospinal fluid revealed an increased leucocyte count in 3 sheep and eosinophilia in 4 sheep. In 4 animals that underwent computertomography, one or more hypodense, definable lesions were found in the brain. In 2 sheep surgical treatment and in 10 animals medical treatment with either Praziquantel (n=8) or Oxfendazol (n=2) was attempted. Only one animal treated with Praziquantel needed not to be euthanized. At necropsy, one or two coenurus cysts could be found either in a side ventricle (n=2), in the cerebellum (n=3) or in the cerebrum (n=7). The locations corresponded with the clinical findings. Despite Praziquantel or Oxfendazol treatment, living protoscoleces could be found in the parasite cysts [de

  20. Buying Imported Products Online : A quantitative study about Chinese Online consumer behavior towards imported products

    OpenAIRE

    Chen, Qianqian; Wang, Yuren

    2015-01-01

    With the fast growing Chinese online marketplace and the increasing popularity of shopping imported products online in China, more and more practitioners and researchers are interested in understanding the cues that Chinese consumers use to evaluate imported products consumption online. Our quantitative study aims to identify what factors affect the behavior of Chinese online consumers towards imported products and the relationships between the identified factors and purchase intention, and t...

  1. Five important advances in hematopathology.

    Science.gov (United States)

    Shi, Min; Xiao, Ruobing; Woda, Bruce A; Yu, Hongbo

    2014-03-01

    Hematopathology is a dynamic field that has always been on the frontier of clinical research within the scope of pathology. Several recent developments in hematopathology will likely affect its practice clinically. To review 5 important recent advances in hematopathology: (1) detection and prognostic implication of MYC in diffuse large B-cell lymphomas, (2) determining origin and prognosis through immunoglobulin gene usage in mature B-cell neoplasms, (3)detecting minimal residual disease in multiple myeloma, (4) using genome-wide analysis in myelodysplastic syndromes, and (5) employing whole-genome sequencing in acute myeloid leukemias. Literature review and the authors' experiences in an academic center. These advances will bring hematopathology into a new molecular era and help us to better understand the molecular, pathologic mechanisms of lymphomas, leukemias, myelomas, and myelodysplastic syndromes. They will help us to identify diagnostic and prognostic markers and eventually provide new therapeutic targets and treatments for these diseases.

  2. 27 CFR 478.92 - How must licensed manufacturers and licensed importers identify firearms, armor piercing...

    Science.gov (United States)

    2010-04-01

    ... section will be measured as the distance between the latitudinal ends of the character impression bottoms... the effective administration of this part. (Approved by the Office of Management and Budget under...

  3. Development of a framework identifying domains and elements of importance for arthritis rehabilitation

    DEFF Research Database (Denmark)

    Klokkerud, Mari; Hagen, Kåre Birger; Kjeken, Ingvild

    2012-01-01

    Rehabilitation is effective and beneficial for patients with arthritis. The lack of a common structure for describing the content of rehabilitation makes it difficult to compare, transfer and implement research evidence into clinical practice....

  4. Pattern check of TLD disc readings - an important tool to identify abnormal conditions in workplace

    International Nuclear Information System (INIS)

    Pradhan, S.M.; Sneha, C.; Bhattacharya, M.; Sahai, M.K.; Pradeep, Ratna; Datta, D.; Bhatnagar, Amit

    2016-01-01

    Personnel monitoring for external radiation using CaSO 4 :Dy based TLD badge is well established in Indian radiation protection program. TLD badge enables evaluation of occupational dose based on the pattern and values of the three disc readings. Different patterns of disc readings are obtained depending on the type and energy of radiation in the workplace. Pattern not conforming to the radiation in the workplace also called as improper pattern can be a useful tool for investigation of any deviation / abnormality in workplace or monitoring practices. The paper presents different examples of improper pattern observed in monitoring that has helped to find out the deviations in the workplace or monitoring practices. Results of the experiments conducted to simulate some of the observed pattern are also presented in the paper

  5. Mechanical and mechanobiological influences on bone fracture repair : identifying important cellular characteristics

    NARCIS (Netherlands)

    Isaksson, H.E.

    2007-01-01

    Fracture repair is a complex and multifactorial process, which involves a well-programmed series of cellular and molecular events that result in a combination of intramembranous and endochondral bone formation. The vast majority of fractures is treated successfully. They heal through ‘secondary

  6. Population pharmacokinetic analysis of oxaliplatin in adults and children identifies important covariates for dosing.

    Science.gov (United States)

    Nikanjam, Mina; Stewart, Clinton F; Takimoto, Chris H; Synold, Timothy W; Beaty, Orren; Fouladi, Maryam; Capparelli, Edmund V

    2015-03-01

    To characterize the determinants of variability for oxaliplatin pharmacokinetics including age, renal function, and hepatic function in children and adults. Oxaliplatin pharmacokinetic data were combined from phase I and II clinical trials: three pediatric trials (Peds1-3) and two adult NCI organ dysfunction studies (Hepatic and Renal). A population pharmacokinetic model was developed utilizing platinum ultrafiltrate concentrations to characterize changes in oxaliplatin disposition with age and organ dysfunction along with other potential sources of oxaliplatin pharmacokinetic variability. A total of 1,508 concentrations from 186 children and adults were used in the study. The data were well described by a three-compartment model. Serum creatinine (SCR) was an independent predictor of clearance (CL) while age was an independent predictor of volume of distribution. Although age was a significant covariate on CL in the univariate analysis, age effects on CL were entirely accounted for by SCR. Gender, hepatic function, and race had no effect on CL or volume of distribution. Median CL values were 0.58 (Hepatic), 0.34 (Renal), 0.78 (Peds1), 0.74 (Peds2), and 0.81 (Peds3) (L/h/kg(0.75)). Monte Carlo simulations of the final model with 130 mg/m(2) yielded median AUC values of: 14.2 (2-6 years), 16.8 (6-12 years), 16.5 (12-18 years), and 17.3 (>18 years) (µg h/mL). Renal function had the greatest effect on CL with a small age effect seen on the distribution of oxaliplatin. Young pediatric patients had higher CL values than adults as a result of better renal function.

  7. Identifying Computer-Generated Portraits: The Importance of Training and Incentives.

    Science.gov (United States)

    Mader, Brandon; Banks, Martin S; Farid, Hany

    2017-09-01

    The past two decades have seen remarkable advances in photo-realistic rendering of everything from inanimate objects to landscapes, animals, and humans. We previously showed that despite these tremendous advances, human observers remain fairly good at distinguishing computer-generated from photographic images. Building on these results, we describe a series of follow-up experiments that reveal how to improve observer performance. Of general interest to anyone performing psychophysical studies on Mechanical Turk or similar platforms, we find that observer performance can be significantly improved with the proper incentives.

  8. Overfat Adults and Children in Developed Countries: The Public Health Importance of Identifying Excess Body Fat

    Directory of Open Access Journals (Sweden)

    Philip B. Maffetone

    2017-07-01

    Full Text Available The global overfat pandemic is a serious public health crisis that places a substantial burden on economic resources in developed countries. The term overfat refers to the presence of excess body fat that can impair health, even for normal weight non-obese individuals. Excess body fat is associated with cardiometabolic dysfunction, a clinical situation that can progressively worsen, potentially leading to various common disease risk factors, chronic diseases, increased morbidity and mortality, and reduced quality of life. The prevalence of overfat populations in 30 of the world’s most developed countries is substantially higher than recent global estimations, with the largest growth due to a relatively recent increased number of people with excess abdominal fat. Abdominal overfat is the most unhealthful form of this condition, so it is concerning that average waist circumference measures, generally indicative of abdominal overfat, have increased. Despite a leveling off appearance of being overweight and/or obese in some developed countries, the overfat pandemic continues to grow.

  9. Identifying phase-space boundaries with Voronoi tessellations

    International Nuclear Information System (INIS)

    Debnath, Dipsikha; Matchev, Konstantin T.; Gainer, James S.; Kilic, Can; Yang, Yuan-Pao; Kim, Doojin

    2016-01-01

    Determining the masses of new physics particles appearing in decay chains is an important and longstanding problem in high energy phenomenology. Recently it has been shown that these mass measurements can be improved by utilizing the boundary of the allowed region in the fully differentiable phase space in its full dimensionality. Here we show that the practical challenge of identifying this boundary can be solved using techniques based on the geometric properties of the cells resulting from Voronoi tessellations of the relevant data. The robust detection of such phase-space boundaries in the data could also be used to corroborate a new physics discovery based on a cut-and-count analysis. (orig.)

  10. Identifying phase-space boundaries with Voronoi tessellations

    Energy Technology Data Exchange (ETDEWEB)

    Debnath, Dipsikha; Matchev, Konstantin T. [University of Florida, Physics Department, Gainesville, FL (United States); Gainer, James S. [University of Hawaii, Department of Physics and Astronomy, Honolulu, HI (United States); Kilic, Can; Yang, Yuan-Pao [The University of Texas at Austin, Theory Group, Department of Physics and Texas Cosmology Center, Austin, TX (United States); Kim, Doojin [University of Florida, Physics Department, Gainesville, FL (United States); CERN, Theory Division, Geneva 23 (Switzerland)

    2016-11-15

    Determining the masses of new physics particles appearing in decay chains is an important and longstanding problem in high energy phenomenology. Recently it has been shown that these mass measurements can be improved by utilizing the boundary of the allowed region in the fully differentiable phase space in its full dimensionality. Here we show that the practical challenge of identifying this boundary can be solved using techniques based on the geometric properties of the cells resulting from Voronoi tessellations of the relevant data. The robust detection of such phase-space boundaries in the data could also be used to corroborate a new physics discovery based on a cut-and-count analysis. (orig.)

  11. Identifying 8-hydroxynaringenin as a suicide substrate of mushroom tyrosinase.

    Science.gov (United States)

    Chang, Te-Sheng; Lin, Meng-Yi; Lin, Hsuan-Jung

    2010-01-01

    A biotransformed metabolite of naringenin was isolated from the fermentation broth of Aspergillus oryzae, fed with naringenin, and identified as 8-hydroxynaringenin based on the mass and (1)H- and (13)C-NMR spectral data. The compound showed characteristics of both an irreversible inhibitor and a substrate of mushroom tyrosinase in preincubation and HPLC analysis. These results demonstrate that 8-hydroxynaringenin belongs to a suicide substrate of mushroom tyrosinase. The partition ratio between the compound's molecules in the formation of product and in the inactivation of the enzyme was determined to be 283 +/- 21. The present study's results, together with our previous findings, which proved that both 8-hydroxydaidzein and 8-hydroxygenistein are suicide substrates of mushroom tyrosinase, show that 7,8,4'-trihydroxyl functional groups on flavonoids' skeletons play important roles in producing suicide substrate properties toward mushroom tyrosinase.

  12. Perceived cultural importance and actual self-importance of values in cultural identification.

    Science.gov (United States)

    Wan, Ching; Chiu, Chi-yue; Tam, Kim-pong; Lee, Sau-lai; Lau, Ivy Yee-man; Peng, Siqing

    2007-02-01

    Cross-cultural psychologists assume that core cultural values define to a large extent what a culture is. Typically, core values are identified through an actual self-importance approach, in which core values are those that members of the culture as a group strongly endorse. In this article, the authors propose a perceived cultural importance approach to identifying core values, in which core values are values that members of the culture as a group generally believe to be important in the culture. In 5 studies, the authors examine the utility of the perceived cultural importance approach. Results consistently showed that, compared with values of high actual self-importance, values of high perceived cultural importance play a more important role in cultural identification. These findings have important implications for conceptualizing and measuring cultures. ((c) 2007 APA, all rights reserved).

  13. Selection of components based on their importance

    International Nuclear Information System (INIS)

    Stvan, F.

    2004-12-01

    A proposal is presented for sorting components of the Dukovany nuclear power plant with respect to their importance. The classification scheme includes property priority, property criticality and property structure. Each area has its criteria with weight coefficients to calculate the importance of each component by the Risk Priority Number method. The aim of the process is to generate a list of components in order of operating and safety importance, which will help spend funds to ensure operation and safety in an optimal manner. This proposal is linked to a proposal for a simple database which should serve to enter information and perform assessments. The present stage focused on a safety assessment of components categorized in safety classes BT1, BT2 and BT3 pursuant to Decree No. 76. Assessment was performed based ona PSE study for Level 1. The database includes inputs for entering financial data, which are represented by a potential damage resulting from the given failure and by the loss of MWh in financial terms. In a next input, the failure incidence intensity and time of correction can be entered. Information regarding the property structure, represented by the degree of backup and reparability of the component, is the last input available

  14. Intellectual property

    Directory of Open Access Journals (Sweden)

    MSc. Shpresa Ibrahimi

    2012-06-01

    Full Text Available Montenue, a distinct French scholar of intellectual property, has suggested that IP is a “tool which surprisingly helps a lot”, and this definition on science, arts, culture, since the 16th century. Now, what would be the definition of intellectual property for the 21st century? Apparently not a “strange” tool, but a necessary tool, primary for enriching human knowledge, and for the new world order, especially in the global market sphere. Intellectual property is an integral part of international trade, and its importance keeps increasing, since effective use of knowledge is increasingly influencing the economic prosperity of peoples. One may say that there is little originality in the creative sphere. Naturally, this originality can only be reflected by individuality and human identity in intellectual creativity The author rights in the Kosovo legislation is a novelty, a necessity of developing a creative environment in the fields of science, arts and industrial property. First and foremost, the individual benefit, which is secured by the author as the creator of the work, is a moral and material right. Secondly, there is a need for harmonization, not only of values for the creator, but also for the development of science, culture, increased competitive advantage, and the public sphere, as a benefit for the public health and security, and the fiscal policy. The deficiency one must record is with the Office for Copy Rights, which is to play a strong role in implementing and protecting copy rights and other related rights by licensing collective management agencies, imposing administrative fines, awareness raising, provision of information, and other capacity building and educative measures. Naturally, the enactment of good legislation is a system without any meaning or sense if not associated with the court practice. Any establishment of a legal system not pursued with enforcement mechanisms remains only in legal frameworks.

  15. Identifying ELIXIR Core Data Resources.

    Science.gov (United States)

    Durinx, Christine; McEntyre, Jo; Appel, Ron; Apweiler, Rolf; Barlow, Mary; Blomberg, Niklas; Cook, Chuck; Gasteiger, Elisabeth; Kim, Jee-Hyub; Lopez, Rodrigo; Redaschi, Nicole; Stockinger, Heinz; Teixeira, Daniel; Valencia, Alfonso

    2016-01-01

    The core mission of ELIXIR is to build a stable and sustainable infrastructure for biological information across Europe. At the heart of this are the data resources, tools and services that ELIXIR offers to the life-sciences community, providing stable and sustainable access to biological data. ELIXIR aims to ensure that these resources are available long-term and that the life-cycles of these resources are managed such that they support the scientific needs of the life-sciences, including biological research. ELIXIR Core Data Resources are defined as a set of European data resources that are of fundamental importance to the wider life-science community and the long-term preservation of biological data. They are complete collections of generic value to life-science, are considered an authority in their field with respect to one or more characteristics, and show high levels of scientific quality and service. Thus, ELIXIR Core Data Resources are of wide applicability and usage. This paper describes the structures, governance and processes that support the identification and evaluation of ELIXIR Core Data Resources. It identifies key indicators which reflect the essence of the definition of an ELIXIR Core Data Resource and support the promotion of excellence in resource development and operation. It describes the specific indicators in more detail and explains their application within ELIXIR's sustainability strategy and science policy actions, and in capacity building, life-cycle management and technical actions. The identification process is currently being implemented and tested for the first time. The findings and outcome will be evaluated by the ELIXIR Scientific Advisory Board in March 2017. Establishing the portfolio of ELIXIR Core Data Resources and ELIXIR Services is a key priority for ELIXIR and publicly marks the transition towards a cohesive infrastructure.

  16. Identifying Bitcoin users by transaction behavior

    Science.gov (United States)

    Monaco, John V.

    2015-05-01

    Digital currencies, such as Bitcoin, offer convenience and security to criminals operating in the black marketplace. Some Bitcoin marketplaces, such as Silk Road, even claim anonymity. This claim contradicts the findings in this work, where long term transactional behavior is used to identify and verify account holders. Transaction timestamps and network properties observed over time contribute to this finding. The timestamp of each transaction is the result of many factors: the desire purchase an item, daily schedule and activities, as well as hardware and network latency. Dynamic network properties of the transaction, such as coin flow and the number of edge outputs and inputs, contribute further to reveal account identity. In this paper, we propose a novel methodology for identifying and verifying Bitcoin users based on the observation of Bitcoin transactions over time. The behavior we attempt to quantify roughly occurs in the social band of Newell's time scale. A subset of the Blockchain 230686 is taken, selecting users that initiated between 100 and 1000 unique transactions per month for at least 6 different months. This dataset shows evidence of being nonrandom and nonlinear, thus a dynamical systems approach is taken. Classification and authentication accuracies are obtained under various representations of the monthly Bitcoin samples: outgoing transactions, as well as both outgoing and incoming transactions are considered, along with the timing and dynamic network properties of transaction sequences. The most appropriate representations of monthly Bitcoin samples are proposed. Results show an inherent lack of anonymity by exploiting patterns in long-term transactional behavior.

  17. The trespasses of property law.

    Science.gov (United States)

    Wall, Jesse

    2014-01-01

    The purpose of this article is to identify a limit to the appropriate application of property law to the use and storage of bodily material. I argue here that property law ought to be limited to protecting 'contingent rights' and that recent cases where property rights have been recognised in semen represent the application of property law beyond this limit. I also suggest how the law ought to develop in order to avoid the overextensive use of property law.

  18. AND/OR Importance Sampling

    OpenAIRE

    Gogate, Vibhav; Dechter, Rina

    2012-01-01

    The paper introduces AND/OR importance sampling for probabilistic graphical models. In contrast to importance sampling, AND/OR importance sampling caches samples in the AND/OR space and then extracts a new sample mean from the stored samples. We prove that AND/OR importance sampling may have lower variance than importance sampling; thereby providing a theoretical justification for preferring it over importance sampling. Our empirical evaluation demonstrates that AND/OR importance sampling is ...

  19. Evaluations and utilizations of risk importances

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.

    1985-08-01

    This report presents approaches for utilizing Probabilistic Risk Analyses (PRA's) to determine risk importances. Risk importances are determined for design features, plant operations, and other factors that can affect risk. PRA's can be used to identify the importances of risk contributors or proposed changes to designs or operations. The objective of this report is to serve as a handbook and guide in evaluating and applying risk importances. The utilization of both qualitative risk importances and quantitative risk importances is described in this report. Qualitative risk importances are based on the logic models in the PRA, while quantitative risk importances are based on the quantitative results of the PRA. Both types of importances are among the most robust and meaningful information a PRA can provide. A wide variety of risk importance evaluations are described including evaluations of the importances of design changes, testing, maintenance, degrading environments, and aging. Specific utilizations are described in inspection and in reliability assurance programs, however the general approaches have widespread applicability. The role of personal computers and decision support programs in applying risk importance evaluations is also described

  20. Near Identifiability of Dynamical Systems

    Science.gov (United States)

    Hadaegh, F. Y.; Bekey, G. A.

    1987-01-01

    Concepts regarding approximate mathematical models treated rigorously. Paper presents new results in analysis of structural identifiability, equivalence, and near equivalence between mathematical models and physical processes they represent. Helps establish rigorous mathematical basis for concepts related to structural identifiability and equivalence revealing fundamental requirements, tacit assumptions, and sources of error. "Structural identifiability," as used by workers in this field, loosely translates as meaning ability to specify unique mathematical model and set of model parameters that accurately predict behavior of corresponding physical system.

  1. Dynamics in microbial communities: Unraveling mechanisms to identify principles

    Energy Technology Data Exchange (ETDEWEB)

    Konopka, Allan; Lindemann, Stephen R.; Fredrickson, Jim K.

    2015-07-01

    Diversity begets higher order properties such as functional stability and robustness in microbial communities, but principles that inform conceptual (and eventually predictive) models of community dynamics are lacking. Recent work has shown that selection as well as dispersal and drift shape communities, but the mechanistic bases for assembly of communities and the forces that maintain their function in the face of environmental perturbation are not well understood. Conceptually, some interactions among community members could generate endogenous dynamics in composition, even in the absence of environmental changes. These endogenous dynamics are further perturbed by exogenous forcing factors to produce a richer network of community interactions, and it is this “system” that is the basis for higher order community properties. Elucidation of principles that follow from this conceptual model requires identifying the mechanisms that (a) optimize diversity within a community and (b) impart community stability. The network of interactions between organisms can be an important element by providing a buffer against disturbance beyond the effect of functional redundancy, as alternative pathways with different combinations of microbes can be recruited to fulfill specific functions.

  2. Long-term properties of bituminized waste products

    International Nuclear Information System (INIS)

    Snellman, M.; Valkiainen, M.

    1985-10-01

    This study is a survey of the factors of importance for the long term behaviour of bituminized ion exchange resins. Phenomena occurring in bituminized waste products affected by the treatment, storage and disposal are identified. Test methods have been developed for characterizing product properties, which are important for the long-term behaviour. The long-term properties of bituminized ion-exchange resins are studied in a repository environment with access of water equilibrated with concrete. In these circumstances the most important properties are related to the interactions of bituminized waste with the surrounding barriers. The most important phenomena are water uptake due to rehydration of the resins and subsequent swelling of the product

  3. Long-term properties of bituminized waste products

    International Nuclear Information System (INIS)

    Snellman, M.; Valkiainen, M.

    1985-10-01

    This study is a survey of the factors of importance for long term behaviour of bituminized ion exchange resins. Phenomena occurring in bituminized waste products affected by the treatment, storage and disposal are identified. Test methods have been developed for characterizing product properties, which are important for the long-term behaviour. The long-term properties of bituminized ion-exchange resins are studied in a repository environment with access of water equilibrated with concrete. In these circumstances the most important properties are ralated to the interactions of bituminized waste with the surrounding barriers. The most important phenomena are water uptake due to rehydration of the resins and subsequent swelling of the product. (author)

  4. Radiative Importance of Aerosol-Cloud Interaction

    Science.gov (United States)

    Tsay, Si-Chee

    1999-01-01

    even greater consequences. Presently we know that through the use of fossil fuel and land-use changes we have increased the concentration of greenhouse gases in the atmosphere. In parallel, we have seen a modest increase of global temperature in the last century. These two observations have been linked as cause and effect by climate models, but this connection is still experimentally not verified. The spatial and seasonal distribution of aerosol forcing is different from that of greenhouse gases, thus generating a different spatial fingerprint of climate change. This fingerprint was suggested as a method to identify the response of the climate system to anthropogenic forcing of greenhouse gases and aerosol. The aerosol fingerprint may be the only way to firmly establish the presence (or absence) of human impact on climate. Aerosol-cloud interaction through the indirect effect will be an important component of establishing this fingerprint.

  5. How important is importance for prospective memory? A review

    OpenAIRE

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover...

  6. Critically Important Object Security System Element Model

    Directory of Open Access Journals (Sweden)

    I. V. Khomyackov

    2012-03-01

    Full Text Available A stochastic model of critically important object security system element has been developed. The model includes mathematical description of the security system element properties and external influences. The state evolution of the security system element is described by the semi-Markov process with finite states number, the semi-Markov matrix and the initial semi-Markov process states probabilities distribution. External influences are set with the intensity of the Poisson thread.

  7. Leading change: 1--identifying the issue.

    Science.gov (United States)

    Kerridge, Joanna

    To enable sustainable change, nurses need to take the lead in managing it. Recent national initiatives have emphasised the importance of frontline staff in service improvement. The ability to influence and manage change has been identified as an essential skill for delivering new models of care. This article is the first in a three-part series designed to help nurses at all levels develop the knowledge and skills they will need to initiate and manage change. This article focuses on identifying what needs to be changed and why.

  8. The NOAA Dataset Identifier Project

    Science.gov (United States)

    de la Beaujardiere, J.; Mccullough, H.; Casey, K. S.

    2013-12-01

    The US National Oceanic and Atmospheric Administration (NOAA) initiated a project in 2013 to assign persistent identifiers to datasets archived at NOAA and to create informational landing pages about those datasets. The goals of this project are to enable the citation of datasets used in products and results in order to help provide credit to data producers, to support traceability and reproducibility, and to enable tracking of data usage and impact. A secondary goal is to encourage the submission of datasets for long-term preservation, because only archived datasets will be eligible for a NOAA-issued identifier. A team was formed with representatives from the National Geophysical, Oceanographic, and Climatic Data Centers (NGDC, NODC, NCDC) to resolve questions including which identifier scheme to use (answer: Digital Object Identifier - DOI), whether or not to embed semantics in identifiers (no), the level of granularity at which to assign identifiers (as coarsely as reasonable), how to handle ongoing time-series data (do not break into chunks), creation mechanism for the landing page (stylesheet from formal metadata record preferred), and others. Decisions made and implementation experience gained will inform the writing of a Data Citation Procedural Directive to be issued by the Environmental Data Management Committee in 2014. Several identifiers have been issued as of July 2013, with more on the way. NOAA is now reporting the number as a metric to federal Open Government initiatives. This paper will provide further details and status of the project.

  9. Identifying variables that influence manufacturing product quality

    Directory of Open Access Journals (Sweden)

    Marek Krynke

    2014-10-01

    Full Text Available In the article a risk analysis of the production process of selected products in a plant producing votive candles was conducted. The Pareto-Lorenz diagram and FMEA method were used which indicated the most important areas affecting the production of selected elements of candles. The synthesis of intangible factors affecting production in the audited company was also carried out with particular emphasis on the operation of the production system. The factors determining the validity of studies was examined, describing the principle of BOST 14 Toyota management. The most important areas of the company were identified, positively affecting the production process.

  10. Efficiency of different techniques to identify changes in land use

    Science.gov (United States)

    Zornoza, Raúl; Mateix-Solera, Jorge; Gerrero, César

    2013-04-01

    The need for the development of sensitive and efficient methodologies for soil quality evaluation is increasing. The ability to assess soil quality and identify key soil properties that serve as indicators of soil function is complicated by the multiplicity of physical, chemical and biological factors that control soil processes. In the mountain region of the Mediterranean Basin of Spain, almond trees have been cultivated in terraced orchards for centuries. These crops are immersed in the Mediterranean forest scenery, configuring a mosaic landscape where orchards are integrated in the forest masses. In the last decades, almond orchards are being abandoned, leading to an increase in vegetation cover, since abandoned fields are naturally colonized by the surrounded natural vegetation. Soil processes and properties are expected to be associated with vegetation successional dynamics. Thus, the establishment of suitable parameters to monitor soil quality related to land use changes is particularly important to guarantee the regeneration of the mature community. In this study, we selected three land uses, constituted by forest, almond trees orchards, and orchards abandoned between 10 and 15 years previously to sampling. Sampling was carried out in four different locations in SE Spain. The main purpose was to evaluate if changes in management have significantly influenced different sets of soil characteristics. For this purpose, we used a discriminant analysis (DA). The different sets of soil characteristics tested in this study were 1: physical, chemical and biochemical properties; 2: soil near infrared (NIR) spectra; and 3: phospholipid fatty acids (PLFAs). After the DA performed with the sets 1 and 2, the three land uses were clearly separated by the two first discriminant functions, and more than 85 % of the samples were correctly classified (grouped). Using the sets 3 and 4 for DA resulted in a slightly better separation of land uses, being more than 85% of the

  11. Identifying and annotating human bifunctional RNAs reveals their versatile functions.

    Science.gov (United States)

    Chen, Geng; Yang, Juan; Chen, Jiwei; Song, Yunjie; Cao, Ruifang; Shi, Tieliu; Shi, Leming

    2016-10-01

    Bifunctional RNAs that possess both protein-coding and noncoding functional properties were less explored and poorly understood. Here we systematically explored the characteristics and functions of such human bifunctional RNAs by integrating tandem mass spectrometry and RNA-seq data. We first constructed a pipeline to identify and annotate bifunctional RNAs, leading to the characterization of 132 high-confidence bifunctional RNAs. Our analyses indicate that bifunctional RNAs may be involved in human embryonic development and can be functional in diverse tissues. Moreover, bifunctional RNAs could interact with multiple miRNAs and RNA-binding proteins to exert their corresponding roles. Bifunctional RNAs may also function as competing endogenous RNAs to regulate the expression of many genes by competing for common targeting miRNAs. Finally, somatic mutations of diverse carcinomas may generate harmful effect on corresponding bifunctional RNAs. Collectively, our study not only provides the pipeline for identifying and annotating bifunctional RNAs but also reveals their important gene-regulatory functions.

  12. IDENTIFYING COLLISIONAL FAMILIES IN THE KUIPER BELT

    International Nuclear Information System (INIS)

    Marcus, Robert A.; Ragozzine, Darin; Murray-Clay, Ruth A.; Holman, Matthew J.

    2011-01-01

    The identification and characterization of numerous collisional families-clusters of bodies with a common collisional origin-in the asteroid belt has added greatly to the understanding of asteroid belt formation and evolution. More recent study has also led to an appreciation of physical processes that had previously been neglected (e.g., the Yarkovsky effect). Collisions have certainly played an important role in the evolution of the Kuiper Belt as well, though only one collisional family has been identified in that region to date, around the dwarf planet Haumea. In this paper, we combine insights into collisional families from numerical simulations with the current observational constraints on the dynamical structure of the Kuiper Belt to investigate the ideal sizes and locations for identifying collisional families. We find that larger progenitors (r ∼ 500 km) result in more easily identifiable families, given the difficulty in identifying fragments of smaller progenitors in magnitude-limited surveys, despite their larger spread and less frequent occurrence. However, even these families do not stand out well from the background. Identifying families as statistical overdensities is much easier than characterizing families by distinguishing individual members from interlopers. Such identification seems promising, provided the background population is well known. In either case, families will also be much easier to study where the background population is small, i.e., at high inclinations. Overall, our results indicate that entirely different techniques for identifying families will be needed for the Kuiper Belt, and we provide some suggestions.

  13. Intellectual Property.

    Science.gov (United States)

    Swinson, John V.

    2000-01-01

    Intellectual property is a term that covers a number of different rights. Considers issues such as what are the basic forms of intellectual property; who owns the intellectual property created by a teacher; who owns intellectual property created by students; and use of downloaded materials from the internet. (Author/LM)

  14. Distributed design approach in persistent identifiers systems

    Science.gov (United States)

    Golodoniuc, Pavel; Car, Nicholas; Klump, Jens

    2017-04-01

    The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID) systems, of which there is a great variety in terms of technical and social implementations, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have catered for identifier uniqueness, integrity, persistence, and trustworthiness, regardless of the identifier's application domain, the scope of which has expanded significantly in the past two decades. Since many PID systems have been largely conceived and developed by small communities, or even a single organisation, they have faced challenges in gaining widespread adoption and, most importantly, the ability to survive change of technology. This has left a legacy of identifiers that still exist and are being used but which have lost their resolution service. We believe that one of the causes of once successful PID systems fading is their reliance on a centralised technical infrastructure or a governing authority. Golodoniuc et al. (2016) proposed an approach to the development of PID systems that combines the use of (a) the Handle system, as a distributed system for the registration and first-degree resolution of persistent identifiers, and (b) the PID Service (Golodoniuc et al., 2015), to enable fine-grained resolution to different information object representations. The proposed approach solved the problem of guaranteed first-degree resolution of identifiers, but left fine-grained resolution and information delivery under the control of a single authoritative source, posing risk to the long-term availability of information resources. Herein, we develop these approaches further and explore the potential of large-scale decentralisation at all levels: (i) persistent identifiers and information resources registration; (ii) identifier resolution; and (iii) data delivery. To achieve large-scale decentralisation

  15. Identifying tier one key suppliers.

    Science.gov (United States)

    Wicks, Steve

    2013-01-01

    In today's global marketplace, businesses are becoming increasingly reliant on suppliers for the provision of key processes, activities, products and services in support of their strategic business goals. The result is that now, more than ever, the failure of a key supplier has potential to damage reputation, productivity, compliance and financial performance seriously. Yet despite this, there is no recognised standard or guidance for identifying a tier one key supplier base and, up to now, there has been little or no research on how to do so effectively. This paper outlines the key findings of a BCI-sponsored research project to investigate good practice in identifying tier one key suppliers, and suggests a scalable framework process model and risk matrix tool to help businesses effectively identify their tier one key supplier base.

  16. Football refereeing: Identifying innovative methods

    Directory of Open Access Journals (Sweden)

    Reza MohammadKazemi

    2014-08-01

    Full Text Available The aim of the present study is to identify the potentials innovation in football industry. Data were collected from 10 national and international referees, assistant referees and referees’ supervisors in Iran. In this study, technological innovations are identified that assist better refereeing performances. The analysis revealed a significant relationship between using new technologies and referees ‘performance. The results indicate that elite referees, assistant referees and supervisors agreed to use new technological innovations during the game. According to their comments, this kind of technology causes the referees’ performance development.

  17. Identifying public expectations of genetic biobanks.

    Science.gov (United States)

    Critchley, Christine; Nicol, Dianne; McWhirter, Rebekah

    2017-08-01

    Understanding public priorities for biobanks is vital for maximising utility and efficiency of genetic research and maintaining respect for donors. This research directly assessed the relative importance the public place on different expectations of biobanks. Quantitative and qualitative results from a national sample of 800 Australians revealed that the majority attributed more importance to protecting privacy and ethical conduct than maximising new healthcare benefits, which was in turn viewed as more important than obtaining specific consent, benefit sharing, collaborating and sharing data. A latent class analysis identified two distinct classes displaying different patterns of expectations. One placed higher priority on behaviours that respect the donor ( n = 623), the other on accelerating science ( n = 278). Additional expectations derived from qualitative data included the need for biobanks to be transparent and to prioritise their research focus, educate the public and address commercialisation.

  18. Importance measures and resource allocation

    International Nuclear Information System (INIS)

    Guey, C.N.; Morgan, T.; Hughes, E.A.

    1987-01-01

    This paper discusses various importance measures and their practical relevance to allocating resources. The characteristics of importance measures are illustrated through simple examples. Important factors associated with effectively allocating resources to improve plant system performance or to prevent system degradation are discussed. It is concluded that importance measures are only indicative of and not equal to the risk significance of a component, system, or event. A decision framework is suggested to provide a comprehensive basis for resource allocation

  19. Import-Export Business Plan

    OpenAIRE

    Asad, Muhammad

    2014-01-01

    Import export businesses, also known as international trading, are one of the hottest commercial trends of this decade. Since the owner of an import export enterprise, can work as a distributor by focusing on exporting and importing goods and services that cannot be obtained on national soil. With a rapidly growing population of about 150 million, Pakistan is a major country, recognized by the international community, and is one of the most important actors in the Islamic world. Based on its ...

  20. Electrochemical Behavior of Biologically Important Indole Derivatives

    Directory of Open Access Journals (Sweden)

    Cigdem Karaaslan

    2011-01-01

    Full Text Available Voltammetric techniques are most suitable to investigate the redox properties of a new drug. Use of electrochemistry is an important approach in drug discovery and research as well as quality control, drug stability, and determination of physiological activity. The indole nucleus is an essential element of a number of natural and synthetic products with significant biological activity. Indole derivatives are the well-known electroactive compounds that are readily oxidized at carbon-based electrodes, and thus analytical procedures, such as electrochemical detection and voltammetry, have been developed for the determination of biologically important indoles. This paper explains some of the relevant and recent achievements in the electrochemistry processes and parameters mainly related to biologically important indole derivatives in view of drug discovery and analysis.

  1. Responsiveness and minimal clinically important change

    DEFF Research Database (Denmark)

    Christiansen, David Høyrup; Frost, Poul; Falla, Deborah

    2015-01-01

    Study Design A prospective cohort study nested in a randomized controlled trial. Objectives To determine and compare responsiveness and minimal clinically important change of the modified Constant score (CS) and the Oxford Shoulder Score (OSS). Background The OSS and the CS are commonly used...... to assess shoulder outcomes. However, few studies have evaluated the measurement properties of the OSS and CS in terms of responsiveness and minimal clinically important change. Methods The study included 126 patients who reported having difficulty returning to usual activities 8 to 12 weeks after...... were observed for the CS and the OSS. Minimal clinically important change ROC values were 6 points for the OSS and 11 points for the CS, with upper 95% cutoff limits of 12 and 22 points, respectively. Conclusion The CS and the OSS were both suitable for assessing improvement after decompression surgery....

  2. Website Policies / Important Links | DOepatents

    Science.gov (United States)

    Links Website Policies / Important Links Javascript Not Enabled OSTI Security Website Policies and first) Publication Date (oldest first) Close Clear All Find DOepatents Website Policies / Important Important Links Some links on this page may take you to non-federal websites. Their policies may differ from

  3. SOCIODEMOGRAPHIC DATA USED FOR IDENTIFYING ...

    Science.gov (United States)

    Due to unique social and demographic characteristics, various segments of the population may experience exposures different from those of the general population, which, in many cases, may be greater. When risk assessments do not characterize subsets of the general population, the populations that may experience the greatest risk remain unidentified. When such populations are not identified, the social and demographic data relevant to these populations is not considered when preparing exposure estimates, which can underestimate exposure and risk estimates for at-risk populations. Thus, it is necessary for risk or exposure assessors characterizing a diverse population, to first identify and then enumerate certain groups within the general population who are at risk for greater contaminant exposures. The document entitled Sociodemographic Data Used for Identifying Potentially Highly Exposed Populations (also referred to as the Highly Exposed Populations document), assists assessors in identifying and enumerating potentially highly exposed populations. This document presents data relating to factors which potentially impact an individual or group's exposure to environmental contaminants based on activity patterns (how time is spent), microenvironments (locations where time is spent), and other socio-demographic data such as age, gender, race and economic status. Populations potentially more exposed to various chemicals of concern, relative to the general population

  4. SNP interaction pattern identifier (SIPI)

    DEFF Research Database (Denmark)

    Lin, Hui Yi; Chen, Dung Tsa; Huang, Po Yu

    2017-01-01

    Motivation: Testing SNP-SNP interactions is considered as a key for overcoming bottlenecks of genetic association studies. However, related statistical methods for testing SNP-SNP interactions are underdeveloped. Results: We propose the SNP Interaction Pattern Identifier (SIPI), which tests 45...

  5. Identifying the Gifted Child Humorist.

    Science.gov (United States)

    Fern, Tami L.

    1991-01-01

    This study attempted to identify gifted child humorists among 1,204 children in grades 3-6. Final identification of 13 gifted child humorists was determined through application of such criteria as funniness, originality, and exemplary performance or product. The influence of intelligence, development, social factors, sex differences, family…

  6. Identifying high-risk medication

    DEFF Research Database (Denmark)

    Sædder, Eva; Brock, Birgitte; Nielsen, Lars Peter

    2014-01-01

    salicylic acid, and beta-blockers; 30 drugs or drug classes caused 82 % of all serious MEs. The top ten drugs involved in fatal events accounted for 73 % of all drugs identified. CONCLUSION: Increasing focus on seven drugs/drug classes can potentially reduce hospitalizations, extended hospitalizations...

  7. Spectral Data Captures Important Variability Between and Among Species and Functional Types

    Science.gov (United States)

    Townsend, P. A.; Serbin, S. P.; Kingdon, C.; Singh, A.; Couture, J. J.; Gamon, J. A.

    2013-12-01

    different genotypes of aspen. A clonal species, aspen is widely recognized for its high genotypic and phenotypic variability, and this variability expresses itself in differences in both functional and spectral traits. We demonstrate that spectral characteristics can be used to identify different genets of aspen and that this spectral variability among genets is also related to differences in traits important to ecosystem processes. Third, we illustrate variability in spectral properties of soybean related to the presence of aphids, and how those spectral properties translate to differences in yield. Finally, we show how short-term variability in milkweed spectra (within hours) is related to changes in cardenolide concentrations associated with induced defensive responses. These results demonstrate the capacity of spectroscopy to not just characterize important plant traits, but also to measure how plants vary naturally and respond dynamically to environmental changes.

  8. Adaptive Importance Sampling with a Rapidly Varying Importance Function

    International Nuclear Information System (INIS)

    Booth, Thomas E.

    2000-01-01

    It is known well that zero-variance Monte Carlo solutions are possible if an exact importance function is available to bias the random walks. Monte Carlo can be used to estimate the importance function. This estimated importance function then can be used to bias a subsequent Monte Carlo calculation that estimates an even better importance function; this iterative process is called adaptive importance sampling.To obtain the importance function, one can expand the importance function in a basis such as the Legendre polynomials and make Monte Carlo estimates of the expansion coefficients. For simple problems, Legendre expansions of order 10 to 15 are able to represent the importance function well enough to reduce the error geometrically by ten orders of magnitude or more. The more complicated problems are addressed in which the importance function cannot be represented well by Legendre expansions of order 10 to 15. In particular, a problem with a cross-section notch and a problem with a discontinuous cross section are considered

  9. A new importance measure for sensitivity analysis

    International Nuclear Information System (INIS)

    Liu, Qiao; Homma, Toshimitsu

    2010-01-01

    Uncertainty is an integral part of risk assessment of complex engineering systems, such as nuclear power plants and space crafts. The aim of sensitivity analysis is to identify the contribution of the uncertainty in model inputs to the uncertainty in the model output. In this study, a new importance measure that characterizes the influence of the entire input distribution on the entire output distribution was proposed. It represents the expected deviation of the cumulative distribution function (CDF) of the model output that would be obtained when one input parameter of interest were known. The applicability of this importance measure was tested with two models, a nonlinear nonmonotonic mathematical model and a risk model. In addition, a comparison of this new importance measure with several other importance measures was carried out and the differences between these measures were explained. (author)

  10. [Mycoviruses and importance in mycology].

    Science.gov (United States)

    Keçeli, Sema Aşkın

    2017-10-01

    Opportunistic fungal infections like invasive candidiasis and aspergillozis have high mortality rate particularly in immunosupressive patients. The rate of therapy success with antifungal agents is usually low. Although immunotherapy methods have been developed to increase the host response against antifungals, there has been a need for new antifungal therapeutic agents in the treatment of invasive aspergillozis and other opportunistic fungal infections. Mycoviruses are the viruses that specifically infect fungi. The use of mycoviruses in the treatment of invasive fungal infections has not been suggested yet. However, as mentioned in this review, the researches about the use of mycoviruses as a therapeutic agent have been still carried on. Mycoviruses have no infectivity as free particules. Many of them have RNA genome. They are classified as: Fungi containing "double stranded (ds) RNA, ds DNA or single stranded RNA". Although most of them are found in plant pathogenic fungi, they are also found in human pathogenic fungi. In most of the mycoviruses identified up to now, dsRNA genome are present. Mycoviruses that can be pathogenic for human and carrying dsRNA genome have been classified as Partitiviridae, Totiviridae, Chrysoviridae, Reoviridae and Hypoviridae. A part of mycoviruses may not cause any sign of infection in fungal host. The other part of mycoviruses causes hypovirulence or lethal effect. When hypovirulence occured in fungi, the observed effects are the decrease in pigmentation, mycelium formation, asexual sporulation, growing rate and the loss of fertility. The transfer of mycovirus to fungi may occur by intracellular or extracellular way. The transfer of genetic content to fungi occurs in two way: transformation and transfection. In both ways, there is a need for a spheroblast that has no cell wall. There are various scenarios about mycoviruses for the their use in the treatment. In the first scenario, the transfer of selective mycovirus is ensured by

  11. [Breastfeeding: the importance of intervening].

    Science.gov (United States)

    Aguiar, Hélder; Silva, Ana Isabel

    2011-12-01

    Breast milk is considered by the WHO the ideal food for the first months of life. Although health professionals are aware of recommendations, high rates of drop-outs have been identified in Portugal. A false notion of hypogalactia is the major factor for early termination, which is allied to the technical difficulties of the feeding. Health professionals, often lacking training in the area, may have difficulty in reassuring mothers in these situations. In Portugal, at the 3rd month, most mothers stop breastfeeding by indication of their medical assistant. Gather evidence about the advantages of breast-feeding compared to artificial milk, and establish useful strategies in clinical practice to avoid early withdrawal. A survey was conducted for articles from the last six years in the major sites of evidence-based medicine and reference sites (Pubmed, Cochrane, National Guideline Clearinghouse, Tripdatabase, WHO). Breast-feeding is clearly associated with benefits to the infant, including significant protective effects for gastrointestinal infections (64%), middle ear (23- 50%), severe respiratory infections (73%) and for acute lymphocytic leukemia (19%) and sudden death syndrome in infants (36%). We also found long-term benefits, such as for obesity (7-24%) and other cardiovascular risk factors in adulthood. The mother also benefits from its protective effect for cancers of the breast and ovary, and diabetes mellitus type 2 as also, proportionate to the duration of breastfeeding. Health professionals have an important role in the initiation and continuation of breastfeeding. The notion of its advantages, the communication prior to delivery, accessibility support and training in technical aspects of correct picks are the proven strategies for evidence explored in the article. Breast milk contains several unique and exclusive elements, orchestrators of its health benefits. Postnatal period is critical to the development of neuro--hypothalamic circuits involved in

  12. Device for identifying fuel assembly

    International Nuclear Information System (INIS)

    Imai, Tetsuo; Miyazawa, Tatsuo.

    1982-01-01

    Purpose: To accurately identify a symbol printed on a hanging tool at the upper part of a fuel assembly. Constitution: Optical fibers are bundled to prepare a detector which is disposed at a predetermined position on a hanging tool. This position is set by a guide. Thus, the light emitted from an illumination lamp arrives at the bottom of a groove printed on the upper surface of the tool, and is divided into a weak light reflected upwardly and a strong light reflected on the surface lower than the groove. When these lights are received by the optical fibers, the fibers corresponding to the grooved position become dark, and the fibers corresponding to the ungrooved position become bright. Since the fuel assembly is identified by the dark and bright of the optical fibers as symbols, different machining can be performed every fuel assembly on the upper surface of the tool. (Yoshihara, H.)

  13. Identifying patient risks during hospitalization

    Directory of Open Access Journals (Sweden)

    Lucélia Ferreira Lima

    2008-12-01

    Full Text Available Objective: To identify the risks reported at a public institution andto know the main patient risks from the nursing staff point of view.Methods: A retrospective, descriptive and exploratory study. Thesurvey was developed at a hospital in the city of Taboão da Serra, SãoPaulo, Brazil. The study included all nurses working in care areas whoagreed to participate in the study. At the same time, sentinel eventsoccurring in the period from July 2006 to July 2007 were identified.Results: There were 440 sentinel events reported, and the main risksincluded patient falls, medication errors and pressure ulcers. Sixty-fivenurses were interviewed. They also reported patient falls, medicationerrors and pressure ulcers as the main risks. Conclusions: Riskassessment and implementation of effective preventive actions arenecessary to ensure patient’s safety. Involvement of a multidisciplinaryteam is one of the steps for a successful process.

  14. Identifying High Performance ERP Projects

    OpenAIRE

    Stensrud, Erik; Myrtveit, Ingunn

    2002-01-01

    Learning from high performance projects is crucial for software process improvement. Therefore, we need to identify outstanding projects that may serve as role models. It is common to measure productivity as an indicator of performance. It is vital that productivity measurements deal correctly with variable returns to scale and multivariate data. Software projects generally exhibit variable returns to scale, and the output from ERP projects is multivariate. We propose to use Data Envelopment ...

  15. Physical properties

    International Nuclear Information System (INIS)

    Anon.

    1976-01-01

    Research activities into the physical properties of metals and ceramics at Lawrence Berkeley Laboratory during 1976 are reported. Topics covered include: high field superconductivity; microstructure and mechanical behavior of ceramics, glass-metal, and ceramic-metal systems; high temperature reactions; relation of microstructure to properties in ceramics; and structure and properties of carbon materials and composite materials

  16. Phenomena and parameters important to burnup credit

    International Nuclear Information System (INIS)

    Parks, C.V.; Dehart, M.D.; Wagner, J.C.

    2001-01-01

    Since the mid-1980s, a significant number of studies have been directed at understanding the phenomena and parameters important to implementation of burnup credit in out-of-reactor applications involving pressurized-water- reactor (PWR) spent fuel. The efforts directed at burnup credit involving boiling-water-reactor (BWR) spent fuel have been more limited. This paper reviews the knowledge and experience gained from work performed in the United States and other countries in the study of burnup credit. Relevant physics and analysis phenomenon are identified, and an assessment of their importance to burnup credit implementation for transport and dry cask storage is given. (author)

  17. Importance analysis for reconfigurable systems

    International Nuclear Information System (INIS)

    Si, Shubin; Levitin, Gregory; Dui, Hongyan; Sun, Shudong

    2014-01-01

    Importance measures are used in reliability engineering to rank the system components according to their contributions to proper functioning of the entire system and to find the most effective ways of reliability enhancement. Traditionally, the importance measures do not consider the possible change of system structure with the improvement of specific component reliability. However, if a component's reliability changes, the optimal system structure/configuration may also change and the importance of the corresponding component will depend on the chosen structure. When the most promising component reliability improvement is determined, the component importance should be taken into account with respect to the possible structure changes. This paper studies the component reliability importance indices with respect to the changes of the optimal component sequencing. This importance measure indicates the critical components in providing the system reliability enhancement by both enhancing the component's reliability and reconfiguring the system. Examples of linear consecutive-k-out-of-n: F and G systems are considered to demonstrate the change of the component Birnbaum importance with the optimal system reconfiguration. The results show that the change of the importance index corresponds to the change of the system optimal configuration and the importance index can change not monotonically with the variation of the component reliability

  18. Functional importance of PAI-1 glycosylation

    DEFF Research Database (Denmark)

    Christensen, Anni; Naessens, Dominik; Skottrup, Peter

    2001-01-01

    Structure-function studies of plasminogen activator inhibitor-1 (PAI-1) have previously been performed mostly with non-glycosylated material expressed in E. coli. We have now studied the importance of PAI-1 glycosylation for its functional properties. PAI-1 has 3 potential sites for N......-glycosylated PAI-1 could be conferred upon PAI-1 expressed in HEK293 cells by mutational inactivation of one or the other glycosylation site. These findings reveal a novel functional role for glycosylation of a serpin. The glycosylation sites are localised between a-helix H and b-strand 2C and b-strand 3C and a...

  19. Cellular signaling identifiability analysis: a case study.

    Science.gov (United States)

    Roper, Ryan T; Pia Saccomani, Maria; Vicini, Paolo

    2010-05-21

    Two primary purposes for mathematical modeling in cell biology are (1) simulation for making predictions of experimental outcomes and (2) parameter estimation for drawing inferences from experimental data about unobserved aspects of biological systems. While the former purpose has become common in the biological sciences, the latter is less common, particularly when studying cellular and subcellular phenomena such as signaling-the focus of the current study. Data are difficult to obtain at this level. Therefore, even models of only modest complexity can contain parameters for which the available data are insufficient for estimation. In the present study, we use a set of published cellular signaling models to address issues related to global parameter identifiability. That is, we address the following question: assuming known time courses for some model variables, which parameters is it theoretically impossible to estimate, even with continuous, noise-free data? Following an introduction to this problem and its relevance, we perform a full identifiability analysis on a set of cellular signaling models using DAISY (Differential Algebra for the Identifiability of SYstems). We use our analysis to bring to light important issues related to parameter identifiability in ordinary differential equation (ODE) models. We contend that this is, as of yet, an under-appreciated issue in biological modeling and, more particularly, cell biology. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  20. Identifying a new particle with jet substructures

    International Nuclear Information System (INIS)

    Han, Chengcheng; Kim, Doojin; Kim, Minho; Postech, Pohang

    2017-01-01

    Here, we investigate a potential of determining properties of a new heavy resonance of mass O(1)TeV which decays to collimated jets via heavy Standard Model intermediary states, exploiting jet substructure techniques. Employing the Z gauge boson as a concrete example for the intermediary state, we utilize a "merged jet" defined by a large jet size to capture the two quarks from its decay. The use of the merged jet bene ts the identification of a Z-induced jet as a single, reconstructed object without any combinatorial ambiguity. We also find that jet substructure procedures may enhance features in some kinematic observables formed with subjet four-momenta extracted from a merged jet. This observation motivates us to feed subjet momenta into the matrix elements associated with plausible hypotheses on the nature of the heavy resonance, which are further processed to construct a matrix element method (MEM)-based observable. For both moderately and highly boosted Z bosons, we demonstrate that the MEM in combination with jet substructure techniques can be a very powerful tool for identifying its physical properties. Finally, we discuss effects from choosing different jet sizes for merged jets and jet-grooming parameters upon the MEM analyses.

  1. Making and Breaking Property Rights

    DEFF Research Database (Denmark)

    Justesen, Mogens Kamp

    2015-01-01

    This paper analyzes why some governments protect property rights while others do not. Although institutional constraints may affect government incentives to protect property rights, the paper emphasizes that different political institutions have dissimilar effects. Coalition institutions that make...... governments accountable to large groups in society are particularly important, whereas division of powers between veto players is hypothesized to have more ambiguous effects on property rights. Empirical analyses of panel data support the proposition that coalition institutions matter for property-rights...

  2. Resistance Training: Identifying Best Practices?

    Science.gov (United States)

    2010-02-18

    were too small to be important. That argument would be particularly powerful when coupled with the knowledge that training effects increase with...interpretation of those facts convert the evidence to reliable scientific knowledge (Ziman, 1978). No single meta-analysis is likely to establish a...Wisloff, U. (1999). Maximal strength training improves work economy in trained female cross-country skiers . Med Sci Sports Exerc, 31, 870- 877

  3. PARALLEL IMPORT: REALITY FOR RUSSIA

    Directory of Open Access Journals (Sweden)

    Т. А. Сухопарова

    2014-01-01

    Full Text Available Problem of parallel import is urgent question at now. Parallel import legalization in Russia is expedient. Such statement based on opposite experts opinion analysis. At the same time it’s necessary to negative consequences consider of this decision and to apply remedies to its minimization.Purchase on Elibrary.ru > Buy now

  4. What's important to a game?

    DEFF Research Database (Denmark)

    Debus, Michael S.; Grabarczyk, Pawel

    2017-01-01

    , as well as visual representation, of the model suggests an equal importance of these three dimensions. We claim that such symmetry is unattainable. Through the exploration of the three dimensions relationships to one another, we will show that the mechanical system has a higher importance to games than...

  5. Sparse Linear Identifiable Multivariate Modeling

    DEFF Research Database (Denmark)

    Henao, Ricardo; Winther, Ole

    2011-01-01

    and bench-marked on artificial and real biological data sets. SLIM is closest in spirit to LiNGAM (Shimizu et al., 2006), but differs substantially in inference, Bayesian network structure learning and model comparison. Experimentally, SLIM performs equally well or better than LiNGAM with comparable......In this paper we consider sparse and identifiable linear latent variable (factor) and linear Bayesian network models for parsimonious analysis of multivariate data. We propose a computationally efficient method for joint parameter and model inference, and model comparison. It consists of a fully...

  6. Identifying flares in rheumatoid arthritis

    DEFF Research Database (Denmark)

    Bykerk, Vivian P; Bingham, Clifton O; Choy, Ernest H

    2016-01-01

    to flare, with escalation planned in 61%. CONCLUSIONS: Flares are common in rheumatoid arthritis (RA) and are often preceded by treatment reductions. Patient/MD/DAS agreement of flare status is highest in patients worsening from R/LDA. OMERACT RA flare questions can discriminate between patients with...... Set. METHODS: Candidate flare questions and legacy measures were administered at consecutive visits to Canadian Early Arthritis Cohort (CATCH) patients between November 2011 and November 2014. The American College of Rheumatology (ACR) core set indicators were recorded. Concordance to identify flares...

  7. Enhancing importance-performance analysis

    DEFF Research Database (Denmark)

    Eskildsen, Jacob Kjær; Kristensen, Kai

    2006-01-01

    Purpose: The interpretation of the importance/performance map is based on an assumption of independence between importance and performance but many studies question the validity of this assumption. The aim of this research is to develop a new typology for job satisfaction attributes as well...... as a new importance/performance map that can be an aid for organizations when they prioritize their improvement actions based on a job satisfaction study. Design/methodology/approach: A typology for possible relationships between importance and performance in job satisfaction studies is developed based...... on theoretical considerations. This typology is then applied and validated on approximately 10,000 responses from the European Employee Index 2002. Ultimately a new importance/performance map for priority setting in job satisfaction studies is developed based on the new typology for possible relationships...

  8. Identifying Relevant Studies in Software Engineering

    DEFF Research Database (Denmark)

    Zhang, He; Ali Babar, Muhammad; Tell, Paolo

    2011-01-01

    Context: Systematic literature review (SLR) has become an important research methodology in software engineering since the introduction of evidence-based software engineering (EBSE) in 2004. One critical step in applying this methodology is to design and execute appropriate and effective search....... Objective: The main objective of the research reported in this paper is to improve the search step of undertaking SLRs in software engineering (SE) by devising and evaluating systematic and practical approaches to identifying relevant studies in SE. Method: We have systematically selected and analytically...

  9. Subject Matter Expert Workshop to Identify Cybersecurity ...

    Science.gov (United States)

    Report In recognition of the growing need to better address cyber risk and cyber management, the U.S. Environmental Protection Agency’s (EPA) National Homeland Security Research Center (NHSRC) held a Subject Matter Expert Workshop to Identify Cybersecurity Research Gaps and Needs of the Nation’s Water and Wastewater Systems Sector on March 30th and 31st, 2016, at the Ronald Reagan Building in Washington, D.C. The workshop was designed to create a forum for subject matter experts (SMEs) to exchange ideas and address important cybersecurity challenges facing the water sector.

  10. Persistent Identifiers as Boundary Objects

    Science.gov (United States)

    Parsons, M. A.; Fox, P. A.

    2017-12-01

    In 1989, Leigh Star and Jim Griesemer defined the seminal concept of `boundary objects'. These `objects' are what Latour calls `immutable mobiles' that enable communication and collaboration across difference by helping meaning to be understood in different contexts. As Star notes, they are a sort of arrangement that allow different groups to work together without (a priori) consensus. Part of the idea is to recognize and allow for the `interpretive flexibility' that is central to much of the `constructivist' approach in the sociology of science. Persistent Identifiers (PIDs) can clearly act as boundary objects, but people do not usually assume that they enable interpretive flexibility. After all, they are meant to be unambiguous, machine-interpretable identifiers of defined artifacts. In this paper, we argue that PIDs can fill at least two roles: 1) That of the standardized form, where there is strong agreement on what is being represented and how and 2) that of the idealized type, a more conceptual concept that allows many different representations. We further argue that these seemingly abstract conceptions actually help us implement PIDs more effectively to link data, publications, various other artifacts, and especially people. Considering PIDs as boundary objects can help us address issues such as what level of granularity is necessary for PIDs, what metadata should be directly associated with PIDs, and what purpose is the PID serving (reference, provenance, credit, etc.). In short, sociological theory can improve data sharing standards and their implementation in a way that enables broad interdisciplinary data sharing and reuse. We will illustrate this with several specific examples of Earth science data.

  11. Identifying future directions for subsurface hydrocarbon migration research

    Science.gov (United States)

    Leifer, I.; Clark, J. F.; Luyendyk, B.; Valentine, D.

    Subsurface hydrocarbon migration is important for understanding the input and impacts of natural hydrocarbon seepage on the environment. Great uncertainties remain in most aspects of hydrocarbon migration, including some basic mechanisms of this four-phase flow of tar, oil, water, and gas through the complex fracture-network geometry particularly since the phases span a wide range of properties. Academic, government, and industry representatives recently attended a workshop to identify the areas of greatest need for future research in shallow hydrocarbon migration.Novel approaches such as studying temporal and spatial seepage variations and analogous geofluid systems (e.g., geysers and trickle beds) allow deductions of subsurface processes and structures that remain largely unclear. Unique complexities exist in hydrocarbon migration due to its multiphase flow and complex geometry, including in-situ biological weathering. Furthermore, many aspects of the role of hydrocarbons (positive and negative) in the environment are poorly understood, including how they enter the food chain (respiration, consumption, etc.) and “percolate” to higher trophic levels. But understanding these ecological impacts requires knowledge of the emissions' temporal and spatial variability and trajectories.

  12. User-identified gel characteristics: a qualitative exploration of perceived product efficacy of topical vaginal microbicides.

    Science.gov (United States)

    Morrow, Kathleen M; Underhill, Kristen; van den Berg, Jacob J; Vargas, Sara; Rosen, Rochelle K; Katz, David F

    2014-10-01

    Research has demonstrated that certain vaginal gel products--microbicides containing antiretroviral drugs--may reduce HIV infection risk among women. But for vaginal gels to avert HIV and other sexually transmitted infections (STIs), at-risk women must be willing to use them as directed. These products must therefore be "acceptable" to women and an important component of acceptability is users' perception that the product will work to prevent infection. We sought to understand how women's perceptions of vaginal gel properties may shape their understanding of product efficacy for HIV and STI prevention. Sixteen women completed two in-depth qualitative interviews (k = 32) to identify the range and types of sensory perceptions they experienced when using two vaginal gels. We identified emergent themes and linkages between users' sensory perceptions and their beliefs about product efficacy. Users' predictions about product efficacy for preventing infection corresponded to measurable physical properties, including gel volume, location in the vagina, coating behavior, sensation of the gel in the vagina, leakage, and gel changes during coital acts. Although the women described similar sensory experiences (e.g., gel leaked from the vagina), they interpreted these experiences to have varying implications for product efficacy (e.g., leakage was predicted to increase or decrease efficacy). To improve microbicide acceptability, gel developers should investigate and deliberately incorporate properties that influence users' perceptions of efficacy. When a microbicide is approved for use, providers should educate users to anticipate and understand their sensory experiences; improving users' experience can maximize adherence and product effectiveness.

  13. Elastic properties

    International Nuclear Information System (INIS)

    Ledbetter, H.M.

    1983-01-01

    This chapter investigates the following five aspects of engineering-material solid-state elastic constants: general properties, interrelationships, relationships to other physical properties, changes during cooling from ambient to near-zero temperature, and near-zero-temperature behavior. Topics considered include compressibility, bulk modulus, Young's modulus, shear modulus, Poisson's ratio, Hooke's law, elastic-constant measuring methods, thermodynamic potentials, higher-order energy terms, specific heat, thermal expansivity, magnetic materials, structural phase transitions, polymers, composites, textured aggregates, and other-phenomena correlations. Some of the conclusions concerning polycrystalline elastic properties and their temperature dependence are: elastic constants are physical, not mechanical, properties which relate thermodynamically to other physical properties such as specific heat and thermal expansivity; elastic constants at low temperatures are nearly temperature independent, as required by the third law of thermodynamics; and elastic constants can be used to study directional properties of materials, such as textured aggregates and composites

  14. Importance of individual events in temporal networks

    International Nuclear Information System (INIS)

    Takaguchi, Taro; Masuda, Naoki; Sato, Nobuo; Yano, Kazuo

    2012-01-01

    Records of time-stamped social interactions between pairs of individuals (e.g. face-to-face conversations, e-mail exchanges and phone calls) constitute a so-called temporal network. A remarkable difference between temporal networks and conventional static networks is that time-stamped events rather than links are the unit elements generating the collective behavior of nodes. We propose an importance measure for single interaction events. By generalizing the concept of the advance of events proposed by Kossinets et al (2008 Proc. 14th ACM SIGKDD Int. Conf. on Knowledge Discovery and Data Mining p 435), we propose that an event is central when it carries new information about others to the two nodes involved in the event. We find that the proposed measure properly quantifies the importance of events in connecting nodes along time-ordered paths. Because of strong heterogeneity in the importance of events present in real data, a small fraction of highly important events is necessary and sufficient to sustain the connectivity of temporal networks. Nevertheless, in contrast to the behavior of scale-free networks against link removal, this property mainly results from bursty activity patterns and not heterogeneous degree distributions. (paper)

  15. Identifying Key Attributes for Protein Beverages.

    Science.gov (United States)

    Oltman, A E; Lopetcharat, K; Bastian, E; Drake, M A

    2015-06-01

    This study identified key attributes of protein beverages and evaluated effects of priming on liking of protein beverages. An adaptive choice-based conjoint study was conducted along with Kano analysis to gain insight on protein beverage consumers (n = 432). Attributes evaluated included label claim, protein type, amount of protein, carbohydrates, sweeteners, and metabolic benefits. Utility scores for levels and importance scores for attributes were determined. Subsequently, two pairs of clear acidic whey protein beverages were manufactured that differed by age of protein source or the amount of whey protein per serving. Beverages were evaluated by 151 consumers on two occasions with or without priming statements. One priming statement declared "great flavor," the other priming statement declared 20 g protein per serving. A two way analysis of variance was applied to discern the role of each priming statement. The most important attribute for protein beverages was sweetener type, followed by amount of protein, followed by type of protein followed by label claim. Beverages with whey protein, naturally sweetened, reduced sugar and ≥15 g protein per serving were most desired. Three consumer clusters were identified, differentiated by their preferences for protein type, sweetener and amount of protein. Priming statements positively impacted concept liking (P 0.05). Consistent with trained panel profiles of increased cardboard flavor with higher protein content, consumers liked beverages with 10 g protein more than beverages with 20 g protein (6.8 compared with 5.7, P appeal. © 2015 Institute of Food Technologists®

  16. Anesthesiology leadership rounding: identifying opportunities for improvement.

    Science.gov (United States)

    Gravenstein, Dietrich; Ford, Susan; Enneking, F Kayser

    2012-01-01

    Rounding that includes participation of individuals with authority to implement changes has been advocated as important to the transformation of an institution into a high-quality and safe organization. We describe a Department of Anesthesiology's experience with leadership rounding. The Department Chair or other senior faculty designate, a quality coordinator, up to four residents, the ward charge nurse, and patient nurses participated in rounds at bedsides. During a 23-month period, 14 significant opportunities to improve care were identified. Nurses identified 5 of these opportunities, primary team physicians 2, the rounding team 4, and patients or their family members another 3. The anesthesiology service had sole or shared responsibility for 10 improvements. A variety of organizations track specific measures across all phases of the patient experience to gauge quality of care. Chart auditing tools for detecting threats to safety are often used. These measures and tools missed opportunities for improvement that were discovered only through rounding. We conclude that the introduction of leadership rounding by an anesthesiology service can identify opportunities for improving quality that are not captured by conventional efforts.

  17. Targeted Lipidomics in Drosophila melanogaster Identifies Novel 2-Monoacylglycerols and N-acyl Amides

    Science.gov (United States)

    Takacs, Sara M.; Stuart, Jordyn M.; Basnet, Arjun; Raboune, Siham; Widlanski, Theodore S.; Doherty, Patrick; Bradshaw, Heather B.

    2013-01-01

    Lipid metabolism is critical to coordinate organ development and physiology in response to tissue-autonomous signals and environmental cues. Changes to the availability and signaling of lipid mediators can limit competitiveness, adaptation to environmental stressors, and augment pathological processes. Two classes of lipids, the N-acyl amides and the 2-acyl glycerols, have emerged as important signaling molecules in a wide range of species with important signaling properties, though most of what is known about their cellular functions is from mammalian models. Therefore, expanding available knowledge on the repertoire of these lipids in invertebrates will provide additional avenues of research aimed at elucidating biosynthetic, metabolic, and signaling properties of these molecules. Drosophila melanogaster is a commonly used organism to study intercellular communication, including the functions of bioactive lipids. However, limited information is available on the molecular identity of lipids with putative biological activities in Drosophila. Here, we used a targeted lipidomics approach to identify putative signaling lipids in third instar Drosophila larvae, possessing particularly large lipid mass in their fat body. We identified 2-linoleoyl glycerol, 2-oleoyl glycerol, and 45 N-acyl amides in larval tissues, and validated our findings by the comparative analysis of Oregon-RS, Canton-S and w1118 strains. Data here suggest that Drosophila represent another model system to use for the study of 2-acyl glycerol and N-acyl amide signaling. PMID:23874457

  18. Hotspots of missense mutation identify novel neurodevelopmental disorder genes and functional domains

    Science.gov (United States)

    Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.

    2017-01-01

    Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100

  19. Inhibition of Orobanche crenata seed germination and radicle growth by allelochemicals identified in cereals.

    Science.gov (United States)

    Fernández-Aparicio, Mónica; Cimmino, Alessio; Evidente, Antonio; Rubiales, Diego

    2013-10-16

    Orobanche crenata is a parasitic weed that causes severe yield losses in important grain and forage legume crops. Cereals have been reported to inhibit O. crenata parasitism when grown intercropped with susceptible legumes, but the responsible metabolites have not been identified. A number of metabolites have been reported in cereals that have allelopathic properties against weeds, pests, and pathogens. We tested the effect of several allelochemicals identified in cereals on O. crenata seed germination and radicle development. We found that 2-benzoxazolinone, its derivative 6-chloroacetyl-2-benzoxazolinone, and scopoletin significantly inhibited O. crenata seed germination. Benzoxazolinones, l-tryptophan, and coumalic acid caused the stronger inhibition of radicle growth. Also, other metabolites reduced radicle length, this inhibition being dose-dependent. Only scopoletin caused cell necrotic-like darkening in the young radicles. Prospects for their application to parasitic weed management are discussed.

  20. RECOVIR Software for Identifying Viruses

    Science.gov (United States)

    Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

    2013-01-01

    Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

  1. Uses of risk importance measures

    International Nuclear Information System (INIS)

    Mankamo, T.; Poern, K.; Holmberg, J.

    1991-05-01

    Risk importance measures provide an understandable and practical way of presenting probabilistic safety analysis results which too often tend to remain abstract numbers without real insight into the content. The report clarifies the definitions, relationships and interpretations of the three most basic measures: Risk increase factor, risk decrease factor, and fractional contribution. The above three measures already cover the main types of risk importance measures. Many other importance measures presented in literature are close variants to some of these three measures. They are related in many cases so that, for a technical system considered, the two other measures can be derived from the one calculated first. However, the practical interpretations are different, and hence each three measures have their own uses and rights to existence. The fundamental aspect of importance measures is, that they express some specific influence of a basic event on the total risk. The basic failure or error events are the elements from which the reliability and risk models are constituted. The importance measures are relative, which is an advantage compared to absolute risk numbers, due to insensitivity with respect to quantification uncertainties. Therefore they are particularly adapted to give first hand guidance where to focus main interest from the system's risk and reliability point of view and wherefrom to continue the analysis with more sophisticated methods requiring more effort

  2. Dynamically consistent oil import tariffs

    International Nuclear Information System (INIS)

    Karp, L.; Newbery, D.M.

    1992-01-01

    The standard theory of optimal tariffs considers tariffs on perishable goods produced abroad under static conditions, in which tariffs affect prices only in that period. Oil and other exhaustable resources do not fit this model, for current tariffs affect the amount of oil imported, which will affect the remaining stock and hence its future price. The problem of choosing a dynamically consistent oil import tariff when suppliers are competitive but importers have market power is considered. The open-loop Nash tariff is solved for the standard competitive case in which the oil price is arbitraged, and it was found that the resulting tariff rises at the rate of interest. This tariff was found to have an equilibrium that in general is dynamically inconsistent. Nevertheless, it is shown that necessary and sufficient conditions exist under which the tariff satisfies the weaker condition of time consistency. A dynamically consistent tariff is obtained by assuming that all agents condition their current decisions on the remaining stock of the resource, in contrast to open-loop strategies. For the natural case in which all agents choose their actions simultaneously in each period, the dynamically consistent tariff was characterized, and found to differ markedly from the time-inconsistent open-loop tariff. It was shown that if importers do not have overwhelming market power, then the time path of the world price is insensitive to the ability to commit, as is the level of wealth achieved by the importer. 26 refs., 4 figs

  3. An Efficient Metric of Automatic Weight Generation for Properties in Instance Matching Technique

    OpenAIRE

    Seddiqui, Md. Hanif; Nath, Rudra Pratap Deb; Aono, Masaki

    2015-01-01

    The proliferation of heterogeneous data sources of semantic knowledge base intensifies the need of an automatic instance matching technique. However, the efficiency of instance matching is often influenced by the weight of a property associated to instances. Automatic weight generation is a non-trivial, however an important task in instance matching technique. Therefore, identifying an appropriate metric for generating weight for a property automatically is nevertheless a formidab...

  4. Towards Mining Latent Client Identifiers from Network Traffic

    Directory of Open Access Journals (Sweden)

    Jain Sakshi

    2016-04-01

    Full Text Available Websites extensively track users via identifiers that uniquely map to client machines or user accounts. Although such tracking has desirable properties like enabling personalization and website analytics, it also raises serious concerns about online user privacy, and can potentially enable illicit surveillance by adversaries who broadly monitor network traffic.

  5. Spectroscopic properties of rare earths in optical materials

    CERN Document Server

    Parisi, Jürgen; Osgood, R; Warlimont, Hans; Liu, Guokui; Jacquier, Bernard

    2005-01-01

    Aimed at researchers and graduate students, this book provides up-to-date information for understanding electronic interactions that impact the optical properties of rare earth ions in solids. Its goal is to establish a connection between fundamental principles and the materials properties of rare-earth activated luminescent and laser optical materials. The theoretical survey and introduction to spectroscopic properties include electronic energy level structure, intensities of optical transitions, ion-phonon interactions, line broadening, and energy transfer and up-conversion. An important aspect of the book lies in its deep and detailed discussions on materials properties and the potential of new applications such as optical storage, information processing, nanophotonics, and molecular probes that have been identified in recent experimental studies. This volume will be a valuable reference book on advanced topics of rare earth spectroscopy and materials science.

  6. Electromechanical actuation of buckypaper actuator: Material properties and performance relationships

    International Nuclear Information System (INIS)

    Cottinet, P.-J.; Souders, C.; Tsai, S.-Y.; Liang, R.; Wang, B.; Zhang, C.

    2012-01-01

    Carbon nanotubes can be assembled into macroscopic thin film materials called buckypapers. To incorporate buckypaper actuators into engineering systems, it is of high importance to understand their material property-actuation performance relationships in order to model and predict the behavior of these actuators. The electromechanical actuation of macroscopic buckypaper structures and their actuators, including single and multi-walled carbon nanotube buckypapers and aligned single-walled nanotube buckypapers, were analyzed and compared. From the experimental evidence, this Letter discusses the effects of the fundamental material properties, including Young modulus and electrical double layer properties, on actuation performance of the resultant actuators. -- Highlights: ► In this study we identified the figure of merit of the electromechanical conversion. ► Different type of buckypaper was realized and characterized for actuation properties. ► The results demonstrated the potential of Buckypapers/Nafion for actuation

  7. DIA-datasnooping and identifiability

    Science.gov (United States)

    Zaminpardaz, S.; Teunissen, P. J. G.

    2018-04-01

    In this contribution, we present and analyze datasnooping in the context of the DIA method. As the DIA method for the detection, identification and adaptation of mismodelling errors is concerned with estimation and testing, it is the combination of both that needs to be considered. This combination is rigorously captured by the DIA estimator. We discuss and analyze the DIA-datasnooping decision probabilities and the construction of the corresponding partitioning of misclosure space. We also investigate the circumstances under which two or more hypotheses are nonseparable in the identification step. By means of a theorem on the equivalence between the nonseparability of hypotheses and the inestimability of parameters, we demonstrate that one can forget about adapting the parameter vector for hypotheses that are nonseparable. However, as this concerns the complete vector and not necessarily functions of it, we also show that parameter functions may exist for which adaptation is still possible. It is shown how this adaptation looks like and how it changes the structure of the DIA estimator. To demonstrate the performance of the various elements of DIA-datasnooping, we apply the theory to some selected examples. We analyze how geometry changes in the measurement setup affect the testing procedure, by studying their partitioning of misclosure space, the decision probabilities and the minimal detectable and identifiable biases. The difference between these two minimal biases is highlighted by showing the difference between their corresponding contributing factors. We also show that if two alternative hypotheses, say Hi and Hj , are nonseparable, the testing procedure may have different levels of sensitivity to Hi -biases compared to the same Hj -biases.

  8. The importance of trust in computer security

    DEFF Research Database (Denmark)

    Jensen, Christian D.

    2014-01-01

    The computer security community has traditionally regarded security as a “hard” property that can be modelled and formally proven under certain simplifying assumptions. Traditional security technologies assume that computer users are either malicious, e.g. hackers or spies, or benevolent, competent...... and well informed about the security policies. Over the past two decades, however, computing has proliferated into all aspects of modern society and the spread of malicious software (malware) like worms, viruses and botnets have become an increasing threat. This development indicates a failure in some...... of the fundamental assumptions that underpin existing computer security technologies and that a new view of computer security is long overdue. In this paper, we examine traditionalmodels, policies and mechanisms of computer security in order to identify areas where the fundamental assumptions may fail. In particular...

  9. Identifying Core Concepts of Cybersecurity: Results of Two Delphi Processes

    Science.gov (United States)

    Parekh, Geet; DeLatte, David; Herman, Geoffrey L.; Oliva, Linda; Phatak, Dhananjay; Scheponik, Travis; Sherman, Alan T.

    2018-01-01

    This paper presents and analyzes results of two Delphi processes that polled cybersecurity experts to rate cybersecurity topics based on importance, difficulty, and timelessness. These ratings can be used to identify core concepts--cross-cutting ideas that connect knowledge in the discipline. The first Delphi process identified core concepts that…

  10. The Signal Importance of Noise

    Science.gov (United States)

    Macy, Michael; Tsvetkova, Milena

    2015-01-01

    Noise is widely regarded as a residual category--the unexplained variance in a linear model or the random disturbance of a predictable pattern. Accordingly, formal models often impose the simplifying assumption that the world is noise-free and social dynamics are deterministic. Where noise is assigned causal importance, it is often assumed to be a…

  11. Observing Two Important Teaching Variables.

    Science.gov (United States)

    Gustafson, John A.

    1986-01-01

    Two behaviors essential to good teaching, teacher expectation and teacher flexibility, have been incorporated into the observation system used in the student teacher program at the University of New Mexico. The importance of these behaviors in teaching and in evaluating student teachers is discussed. (MT)

  12. The importance of board independence

    NARCIS (Netherlands)

    Zijl, N.J.M.

    2012-01-01

    Although the attributed importance of board independence is high, a clear definition of independence does not exist. Furthermore, the aim and consequences of independence are the subject of discussion and empirical evidence about the impact of independence is weak and disputable. Despite this lack

  13. Hydrogen peroxide: importance and determination

    OpenAIRE

    Mattos, Ivanildo Luiz de; Shiraishi, Karina Antonelli; Braz, Alexandre Delphini; Fernandes, João Roberto

    2003-01-01

    A brief discussion about the hydrogen peroxide importance and its determination is presented. It was emphasized some consideration of the H2O2 as reagent (separated or combined), uses and methods of analysis (techniques, detection limits, linear response intervals, sensor specifications). Moreover, it was presented several applications, such as in environmental, pharmaceutical, medicine and food samples.

  14. The Importance of Prior Knowledge.

    Science.gov (United States)

    Cleary, Linda Miller

    1989-01-01

    Recounts a college English teacher's experience of reading and rereading Noam Chomsky, building up a greater store of prior knowledge. Argues that Frank Smith provides a theory for the importance of prior knowledge and Chomsky's work provided a personal example with which to interpret and integrate that theory. (RS)

  15. Important projects of the Division

    International Nuclear Information System (INIS)

    2008-01-01

    In this chapter important projects of the Division for Radiation Safety, NPP Decommissioning and Radwaste Management of the VUJE, a. s. are presented. Division for Radiation Safety, NPP Decommissioning and Radwaste Management has successfully carried out variety of significant projects. The most significant projects that were realised, are implemented and possible future projects are introduced in the following part of presentation.

  16. Import market penetration in services

    OpenAIRE

    Langhammer, Rolf J.

    1991-01-01

    The EC-1992 programme foresees the complete liberalization of trade in services among member countries. To what extent has import market penetration in the Community already begun in selected service industries? Which EC member countries have been the forerunners to date? The following paper uses a new data base released recently by EUROSTAT in an attempt to answer these and other related questions.

  17. The Strategic Importance of Balochistan

    Science.gov (United States)

    2011-06-01

    projects require augmentation from skilled Punjabi labor. Militarily, it is important from a logistical standpoint as it provides a...Balochistan to a newly independent Greater Balochistan, but also their Pashtun regions need to join Afghanistan, leaving the Punjabi and Sindhi regions to

  18. Environmental certification for more sustainable imports

    International Nuclear Information System (INIS)

    Henry, Lucile; Monnoyer-Smith, Laurence; Demeulenaere, Laurence

    2017-12-01

    As France imports high quantities of products which have environmental impacts abroad due to extraction, transformations, and transports of used materials, and which are not visible for consumers, environmental certification could be a mean to reduce these impacts as it would allow consumers to identify the less polluting products, and incite producers to put such products on the market. After having discussed these issues, the author outlines key factors of success for such a certification, briefly identifies required adjustments at the technical level (requirement level, cost anticipation), and at the social and political level. She also evokes accompanying measures, and outlines that environmental certification is only a tool among others such as partnership agreements currently being negotiated between the European Union and other countries, or a combination of certification and cooperation with extracting countries (as practiced by Germany)

  19. Atomistic Properties of Solids

    CERN Document Server

    Sirdeshmukh, Dinker B; Subhadra, K G

    2011-01-01

    The book deals with atomistic properties of solids which are determined by the crystal structure, interatomic forces and atomic displacements influenced by the effects of temperature, stress and electric fields. The book gives equal importance to experimental details and theory. There are full chapters dedicated to the tensor nature of physical properties, mechanical properties, lattice vibrations, crystal structure determination and ferroelectricity. The other crystalline states like nano-, poly-, liquid- and quasi crystals are discussed. Several new topics like nonlinear optics and the Rietveld method are presented in the book. The book lays emphasis on the role of symmetry in crystal properties. Comprehensiveness is the strength of the book; this allows users at different levels a choice of chapters according to their requirements.

  20. Biologically important radiation damage in DNA

    International Nuclear Information System (INIS)

    Ward, J.F.

    1994-01-01

    Most DNA damage by the hydroxyl radical is confined to the bases, and this base damage represents an important component of locally multiply demanded sites (LMOS). The yields of the major damaged bases have been determined by gas chromatography mass spectrometry. For our propose, it was necessary to convert a known fraction of these damaged bases to strand breaks and then assay these labile sites as the increase in strand break yield over the normally observed level. Three potential agents by which this strategy of conversion of base damage to strand break could be implemented were identified in the original application: 1, Sl nuclease; 2, piperidine; and 3, base damage specific enzymes

  1. Identifying crucial parameter correlations maintaining bursting activity.

    Directory of Open Access Journals (Sweden)

    Anca Doloc-Mihu

    2014-06-01

    Full Text Available Recent experimental and computational studies suggest that linearly correlated sets of parameters (intrinsic and synaptic properties of neurons allow central pattern-generating networks to produce and maintain their rhythmic activity regardless of changing internal and external conditions. To determine the role of correlated conductances in the robust maintenance of functional bursting activity, we used our existing database of half-center oscillator (HCO model instances of the leech heartbeat CPG. From the database, we identified functional activity groups of burster (isolated neuron and half-center oscillator model instances and realistic subgroups of each that showed burst characteristics (principally period and spike frequency similar to the animal. To find linear correlations among the conductance parameters maintaining functional leech bursting activity, we applied Principal Component Analysis (PCA to each of these four groups. PCA identified a set of three maximal conductances (leak current, [Formula: see text]Leak; a persistent K current, [Formula: see text]K2; and of a persistent Na+ current, [Formula: see text]P that correlate linearly for the two groups of burster instances but not for the HCO groups. Visualizations of HCO instances in a reduced space suggested that there might be non-linear relationships between these parameters for these instances. Experimental studies have shown that period is a key attribute influenced by modulatory inputs and temperature variations in heart interneurons. Thus, we explored the sensitivity of period to changes in maximal conductances of [Formula: see text]Leak, [Formula: see text]K2, and [Formula: see text]P, and we found that for our realistic bursters the effect of these parameters on period could not be assessed because when varied individually bursting activity was not maintained.

  2. Importing HOL Light into Coq

    OpenAIRE

    Keller , Chantal; Werner , Benjamin

    2010-01-01

    International audience; We present a new scheme to translate mathematical developments from HOL Light to Coq, where they can be re-used and re-checked. By relying on a carefully chosen embedding of Higher-Order Logic into Type Theory, we try to avoid some pitfalls of inter-operation between proof systems. In particular, our translation keeps the mathematical statements intelligible. This translation has been implemented and allows the importation of the HOL Light basic library into Coq.

  3. Importance Profiles for Water Vapor

    Science.gov (United States)

    Mapes, Brian; Chandra, Arunchandra S.; Kuang, Zhiming; Zuidema, Paquita

    2017-11-01

    Motivated by the scientific desire to align observations with quantities of physical interest, we survey how scalar importance functions depend on vertically resolved water vapor. Definitions of importance begin from familiar examples of water mass I m and TOA clear-sky outgoing longwave flux I OLR, in order to establish notation and illustrate graphically how the sensitivity profile or "kernel" depends on whether specific humidity S, relative humidity R, or ln( R) are used as measures of vapor. Then, new results on the sensitivity of convective activity I con to vapor (with implied knock-on effects such as weather prediction skill) are presented. In radiative-convective equilibrium, organized (line-like) convection is much more sensitive to moisture than scattered isotropic convection, but it exists in a drier mean state. The lesson for natural convection may be that organized convection is less susceptible to dryness and can survive and propagate into regions unfavorable for disorganized convection. This counterintuitive interpretive conclusion, with respect to the narrow numerical result behind it, highlights the importance of clarity about what is held constant at what values in sensitivity or susceptibility kernels. Finally, the sensitivities of observable radiance signals I sig for passive remote sensing are considered. While the accuracy of R in the lower free troposphere is crucial for the physical importance scalars, this layer is unfortunately the most difficult to isolate with passive remote sensing: In high emissivity channels, water vapor signals come from too high in the atmosphere (for satellites) or too low (for surface radiometers), while low emissivity channels have poor altitude discrimination and (in the case of satellites) are contaminated by surface emissions. For these reasons, active ranging (LiDAR) is the preferred observing strategy.

  4. Importance of Engineering History Education

    Science.gov (United States)

    Arakawa, Fumio

    It is needless to cite the importance of education for succeed of engineering. IEEJ called for the establishment of ICEE in 1994, where the education is thought highly of, though its discussion has not been well working. Generally speaking, education has been one of the most important national strategies particularly at a time of its political and economical development. The science and technology education is, of course, not the exemption. But in these days around 2000 it seems that the public pays little attention on the science and technology, as they are quite day to day matters. As the results, for instance, such engineering as power systems and electric heavy machines are referred to as “endangered”. So fur, many engineers have tried not to be involved in social issues. But currently they can not help facing with risks of social issues like patent rights, troubles and accidents due to application of high technology, information security in the use of computers and engineering ethics. One of the most appropriate ways for the risk management is to learn lessons in the past, that is, history, so that the idea suggested in it could be made full use for the risk management. The author cited the global importance of education, particularly of engineering history education for engineering ethics, in the ICEE 2010 held in Bussan, Korea, as the 16th anniversary.

  5. Important plasma problems in astrophysics

    International Nuclear Information System (INIS)

    Kulsrud, R.M.

    1995-01-01

    In astrophysics, plasmas occur under very extreme conditions. For example, there are ultrastrong magnetic fields in neutron stars, relativistic plasmas around black holes and in jets, extremely energetic particles such as cosmic rays in the interstellar medium, extremely dense plasmas in accretion disks, and extremely large magnetic Reynolds numbers in the interstellar medium. These extreme limits for astrophysical plasmas make plasma phenomena much simpler to analyze in astrophysics than in the laboratory. An understanding of such phenomena often results in an interesting way, by simply taking the extreme limiting case of a known plasma theory. The author will describe one of the more exciting examples and will attempt to convey the excitement he felt when he was first exposed to it. However, not all plasma astrophysical phenomena are so simple. There are certain important plasma phenomena in astrophysics that have not been so easily resolved. In fact, a resolution of them is blocking significant progress in astrophysical research. They have not yet yielded to attacks by theoretical astrophysicists nor to extensive numerical simulation. The author will attempt to describe one of the more important of these plasma--astrophysical problems, and discuss why its resolution is so important to astrophysics. This significant example is fast, magnetic reconnection. Another significant example is the large-magnetic-Reynolds number magnetohydrodynamics (MHD) dynamos

  6. Importance of being topologically excited

    International Nuclear Information System (INIS)

    Caldi, D.G.

    1980-08-01

    A class of Euclidean configurations that appear to be dominant in the functional integral of the CP/sup N-1/ models is identified. These configurations are point-like topological excitations, and they may be viewed as constituents of instantons, although they are defined independently of instantons through a continuum duality transformation. Not only do these configurations survive as N → infinity, but in the plasma phase they are responsible for the effects encountered within the 1/N expansion - confinement, theta dependence, and dynamical mass generation

  7. A Preliminary Study of the Application of Electromagnetic Conductivity Meter on Soil Properties of Paddy Cultivation Areas at Wue Village, Jantho, Aceh Besar District, Indonesia

    OpenAIRE

    Marwan,

    2015-01-01

    Conventional soil sampling is time consuming and requires meticulous laboratory analysis. Hence, mapping of soil apparent in respect to electrical conductivity (ECa) has been developed to identify areas of contrasting soil properties. Such ECa values are represent measures of soil properties. The sensor system, GF Instrument model CMD-4 were used to analyze soil physical properties. This system consists of three important parts, ECa sensor, data logger and Global Positioning System (DGPS) rec...

  8. Identifying people from gait pattern with accelerometers

    Science.gov (United States)

    Ailisto, Heikki J.; Lindholm, Mikko; Mantyjarvi, Jani; Vildjiounaite, Elena; Makela, Satu-Marja

    2005-03-01

    Protecting portable devices is becoming more important, not only because of the value of the devices themselves, but for the value of the data in them and their capability for transactions, including m-commerce and m-banking. An unobtrusive and natural method for identifying the carrier of portable devices is presented. The method uses acceleration signals produced by sensors embedded in the portable device. When the user carries the device, the acceleration signal is compared with the stored template signal. The method consists of finding individual steps, normalizing and averaging them, aligning them with the template and computing cross-correlation, which is used as a measure of similarity. Equal Error Rate of 6.4% is achieved in tentative experiments with 36 test subjects.

  9. Identifying Reaction Pathways and their Environments

    DEFF Research Database (Denmark)

    Maronsson, Jon Bergmann

    Finding the mechanisms and estimating the rate of chemical reactions is an essential part of modern research of atomic scale systems. In this thesis, the application of well established methods for reaction rates and paths to important systems for hydrogen storage is considered before developing...... extensions to further identify the reaction environment for a more accurate rate. Complex borohydrides are materials of high hydrogen storage capacity and high thermodynamic stability (too high for hydrogen storage). In an effort to gain insight into the structural transitions of two such materials, Ca(BH4......-interstitial defects. In good agreement with the experiments, C3-type rotations activate at lower temperature than C2-type rotations. In order to investigate the environment of reaction pathways, a method for finding the ridge between first order saddle points on a multidimensional surface was developed...

  10. The importance of habitat resistance for movement decisions in the common lizard, Lacerta vivipara

    Directory of Open Access Journals (Sweden)

    Zajitschek Susanne RK

    2012-07-01

    Full Text Available Abstract Background Movement behaviour can be influenced by a multitude of biotic and abiotic factors. Here, we investigate the speed of movement in relation to environmental and individual phenotypic properties in subadult common lizards (Lacerta vivipara. We aim to disentangle the importance of substrate, cover, humidity, basking opportunity and individual phenotype on moving tendencies in 12 treatment combinations, at which each lizard was tested. Results We find that movement behaviour depends on the starting conditions, the physical properties of the dispersal corridor, and on the individuals’ phenotype. Specifically, the presence of cover and substrate providing suitable traction in the corridor had positive effects on individual movement decisions. Additionally, we find high phenotypic variation in the propensity to move dependent on the presence of cover. Individual back patterns also strongly affected movement decisions in interaction with the physical properties of the dispersal corridor. Conclusions Our results highlight the importance of understanding the habitat resistance for movement patterns, with humid habitats with covering vegetation providing the best conditions to initiate movement in the common lizard. In addition, population effects, differences in back pattern phenotype and individual plasticity were identified as key parameters influencing movement behaviour.

  11. Functional importance of PAI-1 glycosylation

    DEFF Research Database (Denmark)

    Christensen, Anni; Naessens, Dominik; Skottrup, Peter

    susceptible PAI-1 variant was not necessarily the one used when raising the antibody. This and other observations indicated that the carbohydrate moieties or the glycosylation sites are unlikely to be part of the epitopes for these antibodies. The antibody susceptibility characteristic for non......Structure-function studies of plasminogen activator inhibitor-1 (PAI-1) have previously been performed mostly with non-glycosylated material expressed in E. coli. We have now studied the importance of PAI-1 glycosylation for its functional properties. PAI-1 has 3 potential sites for N......-linked glycosylation. Biochemical analysis of PAI-1 variants with substitutions of the Asn residues in each of these sites and expression in human embryonic kidney 293 (HEK293) cells showed that only Asn211 and Asn 267, but not Asn331 are glycosylated, and revealed a differential composition of the carbohydrate...

  12. Soil properties associated with net nitrification following watershed conversion with Appalachian hardwoods to Norway spruce

    Science.gov (United States)

    Charlene N. Kelly; Stephen H. Schoenholtz; Mary Beth Adams

    2011-01-01

    Nitrate (NO3-N) in soil solution and streamwater can be an important vector of nitrogen (N) loss from forested watersheds, and nitrification is associated with negative consequences of soil acidification and eutrophication of aquatic ecosystems. The purpose of this study was to identify vegetation-mediated soil properties that may control...

  13. Body linear traits for identifying prolific goats

    Directory of Open Access Journals (Sweden)

    Avijit Haldar

    2014-12-01

    Full Text Available Aim: The present study was conducted on prolific goat breed to identify body linear type traits that might be associated with prolificacy trait in goats. Materials and Methods: Two-stage stratified random sample survey based data were collected from 1427 non-pregnant goats with the history of single, twin and triplet litter sizes (LZ between January 2008 to February 2011 for 3 years in 68 villages located in East and North East India. Data on sixteen body linear traits were analyzed using logistic regression model to do the step-wise selection for identifying the body linear traits that could determine LZ. An average value for each identified body linear trait was determined for classifying the goats into three categories: Goats having the history of single LZ, goats having the history of twin LZ and goats having the history of triplet LZ. Results: The LZ proportions for single, twin and triplet, were 29.50, 59.14 and 11.36%, respectively, with the prolificacy rate of 181.85% in Indian Black Bengal goats. A total of eight body linear traits that could determine LZ in prolific goats were identified. Heart girth (HG measurement (>60.90 cm, paunch girth (PG (>70.22 cm, wither height (WH (>49.75 cm, neck length (>21.45 cm, ear length (>12.80 cm and distance between trochanter major (DTM bones (>12.28 cm, pelvic triangle area (PTA (>572.25 cm2 and clearance at udder (CU (>23.16 cm showed an increase likelihood of multiple LZ when compared to single LZ. Further, HG measurement (>62.29 cm, WH (>50.54 cm, PG (>71.85 cm and ear length (>13.00 cm, neck length (>22.01 cm, PTA (>589.64 cm2, CU (>23.20 cm and DTM bones (>12.47 cm were associated with increased likelihood of triplet LZ, when compared with that of twin LZ. Conclusion: HG measurement was the best discriminating factor, while PG, neck length, DTM bones, CU, PTA, WH and ear length measurements were other important factors that could be used for identifying prolific goats to achieve economic

  14. Identifying sources of aeolian mineral dust: Present and past

    Science.gov (United States)

    Muhs, Daniel R; Prospero, Joseph M; Baddock, Matthew C; Gill, Thomas E

    2014-01-01

    Aeolian mineral dust is an important component of the Earth’s environmental systems, playing roles in the planetary radiation balance, as a source of fertilizer for biota in both terrestrial and marine realms and as an archive for understanding atmospheric circulation and paleoclimate in the geologic past. Crucial to understanding all of these roles of dust is the identification of dust sources. Here we review the methods used to identify dust sources active at present and in the past. Contemporary dust sources, produced by both glaciogenic and non-glaciogenic processes, can be readily identified by the use of Earth-orbiting satellites. These data show that present dust sources are concentrated in a global dust belt that encompasses large topographic basins in low-latitude arid and semiarid regions. Geomorphic studies indicate that specific point sources for dust in this zone include dry or ephemeral lakes, intermittent stream courses, dune fields, and some bedrock surfaces. Back-trajectory analyses are also used to identify dust sources, through modeling of wind fields and the movement of air parcels over periods of several days. Identification of dust sources from the past requires novel approaches that are part of the geologic toolbox of provenance studies. Identification of most dust sources of the past requires the use of physical, mineralogical, geochemical, and isotopic analyses of dust deposits. Physical properties include systematic spatial changes in dust deposit thickness and particle size away from a source. Mineralogy and geochemistry can pinpoint dust sources by clay mineral ratios and Sc-Th-La abundances, respectively. The most commonly used isotopic methods utilize isotopes of Nd, Sr, and Pb and have been applied extensively in dust archives of deep-sea cores, ice cores, and loess. All these methods have shown that dust sources have changed over time, with far more abundant dust supplies existing during glacial periods. Greater dust supplies in

  15. Analytical methods to identify irradiated food

    International Nuclear Information System (INIS)

    Helle, N.; Schreiber, G.A.; Boegl, K.W.

    1992-01-01

    During the last years, three promising techniques for the identification of irradiated food were developed: - Studies of luminescence, mainly thermoluminescence measurements, of food containing mineral impurities like spices, dried vegetables: and fresh fuit and vegetables. This technique can probably be applied also to food with crystalline components like shells or bones. - Gaschromatographic/mass-spectrometric investigation of radiation-induced lipid changes. - Electron-spin-resonance measurements of dried products or of products containing dry components like bones, fish bones, shells or seeds. The thermoluminescence technique has been routinely applied for more than one year by several German Food Inspection Laboratories. The results suggest that there are scarcely any irradiated spices and dried vegetables in the German market. Gaschromatography/mass spectrometry of lipid components and electron-spin-resonance spectroscopy will be established in routine food inspections in Germany in the next two years. Further possibilities to identify irradiated food are the analysis of specific changes in amino acids, DNA and carbohydrates. Radiation-induced viscosity changes, and changes in electric properties (impedance) may be helpful in identifiying at least some irradiated products. Also microbiological and biological techniques as e.g. microbial flora shift or embryo development tests in citrus fruit have been considered. All activities concerning the development of identification techniques are now coordinated by the European Communities and by IAEA. (orig.) [de

  16. The Fermi LAT Very Important Project (VIP) List of Active Galactic Nuclei

    Science.gov (United States)

    Thompson, David J.; Fermi Large Area Telescope Collaboration

    2018-01-01

    Using nine years of Fermi Gamma-ray Space Telescope Large Area Telescope (LAT) observations, we have identified 30 projects for Active Galactic Nuclei (AGN) that appear to provide strong prospects for significant scientific advances. This Very Important Project (VIP) AGN list includes AGNs that have good multiwavelength coverage, are regularly detected by the Fermi LAT, and offer scientifically interesting timing or spectral properties. Each project has one or more LAT scientists identified who are actively monitoring the source. They will be regularly updating the LAT results for these VIP AGNs, working together with multiwavelength observers and theorists to maximize the scientific return during the coming years of the Fermi mission. See https://confluence.slac.stanford.edu/display/GLAMCOG/VIP+List+of+AGNs+for+Continued+Study

  17. Trustworthy persistent identifier systems of the future

    Science.gov (United States)

    Golodoniuc, Pavel; Klump, Jens; Car, Nicholas

    2016-04-01

    Over the last two decades, persistent identifier (PID) systems have seen some significant changes in their governance policies, system capabilities, and technology. The development of most systems was driven by two main application areas, namely archives and libraries. Guidelines and criteria for trustworthy PID systems have been clearly devised (Bütikofer, 2009) and many PID system implementations for the identification of static digital objects have been built (e.g., PURL). However systems delivering persistent identifiers for dynamic datasets are not yet mature. There has been a rapid proliferation of different PID systems caused by the specific technical or organisational requirements of various communities that could not be met by existing systems such as DOI, ISBN, and EAN. Many of these different systems were limited by their inability to provide native means of persistent identifier resolution. This has prompted a decoupling of PID-associated data from the resolution service and this is where the Handle system has played a significant role. The Handle allowed to build a distributed system of independently managed resolver services. A trustworthy PID system must be designed to outlive the objects it provides persistent identifiers for, which may cease to exist or otherwise be deprecated, and the technology used to implement it, which will certainly need to change with time. We propose that such a system should rest on four pillars of agreements - (i) definitions, (ii) policies, (iii) services, and (iv) data services, to ensure longevity. While we believe all four pillars are equally important, we intentionally leave regulating aspects of issuing of identifiers and their registration out of the scope of this paper and focus on the agreements that have to be established between PID resolver services and the data sources indicated by the persistent identifiers. We propose an approach to development of PID systems that combines the use of (a) the Handle system

  18. Identifying Factors for Worker Motivation in Zambia's Rural Health Facilities.

    Science.gov (United States)

    Cross, Samuel S; Baernholdt, Dr Marianne

    2017-01-01

    Within Zambia there is a shortage of health workers in rural areas. This study aims to identify motivating factors for retaining rural health workers. Sixty rural health workers completed surveys and 46 were interviewed. They rated the importance of six motivating factors and discussed these and other factors in interviews. An interview was conducted with a Government Human Resources Manager (HR Manager) to elicit contextual information. All six factors were identified as being very important motivators, as were two additional factors. Additional career training was identified by many as the most important factor. Comparison of results and the HR Manager interview revealed that workers lacked knowledge about opportunities and that the HR manager was aware of barriers to career development. The Zambian government might better motivate and retain rural health workers by offering them any combination of identified factors, and by addressing the barriers to career development.

  19. Thermochemical properties

    International Nuclear Information System (INIS)

    Brewer, L.; Lamoreaux, R.H.; California Univ., Berkeley

    1980-01-01

    A critical review of thermodynamic properties of Mo-compounds is presented. Binary Mo-compounds, elemental Mo and binary Mo-alloys are considered. The thermodynamic properties include heat capacity enthalpy, gibbs free energy, entropy, vapor pressure, partial free energy of solution. Many values are given in the table form and some values are given in the text. The data used and the procedures applied to test the data are indicated in the text

  20. Identifying suitable sites for Florida panther reintroduction

    Science.gov (United States)

    Thatcher, Cindy A.; van Manen, Frank T.; Clark, Joseph D.

    2006-01-01

    A major objective of the 1995 Florida Panther (Puma concolor cory) Recovery Plan is the establishment of 2 additional panther populations within the historic range. Our goal was to identify prospective sites for Florida panther reintroduction within the historic range based on quantitative landscape assessments. First, we delineated 86 panther home ranges using telemetry data collected from 1981 to 2001 in south Florida to develop a Mahalanobis distance (D2) habitat model, using 4 anthropogenic variables and 3 landscape variables mapped at a 500-m resolution. From that analysis, we identified 9 potential reintroduction sites of sufficient size to support a panther population. We then developed a similar D2 model at a higher spatial resolution to quantify the area of favorable panther habitat at each site. To address potential for the population to expand, we calculated the amount of favorable habitat adjacent to each prospective reintroduction site within a range of dispersal distances of female panthers. We then added those totals to the contiguous patches to estimate the total amount of effective panther habitat at each site. Finally, we developed an expert-assisted model to rank and incorporate potentially important habitat variables that were not appropriate for our empirical analysis (e.g., area of public lands, livestock density). Anthropogenic factors heavily influenced both the landscape and the expert-assisted models. Of the 9 areas we identified, the Okefenokee National Wildlife Refuge, Ozark National Forest, and Felsenthal National Wildlife Refuge regions had the highest combination of effective habitat area and expert opinion scores. Sensitivity analyses indicated that variability among key model parameters did not affect the high ranking of those sites. Those sites should be considered as starting points for the field evaluation of potential reintroduction sites.

  1. Importance of Grid Center Arrangement

    Science.gov (United States)

    Pasaogullari, O.; Usul, N.

    2012-12-01

    In Digital Elevation Modeling, grid size is accepted to be the most important parameter. Despite the point density and/or scale of the source data, it is freely decided by the user. Most of the time, arrangement of the grid centers are ignored, even most GIS packages omit the choice of grid center coordinate selection. In our study; importance of the arrangement of grid centers is investigated. Using the analogy between "Raster Grid DEM" and "Bitmap Image", importance of placement of grid centers in DEMs are measured. The study has been conducted on four different grid DEMs obtained from a half ellipsoid. These grid DEMs are obtained in such a way that they are half grid size apart from each other. Resulting grid DEMs are investigated through similarity measures. Image processing scientists use different measures to investigate the dis/similarity between the images and the amount of different information they carry. Grid DEMs are projected to a finer grid in order to co-center. Similarity measures are then applied to each grid DEM pairs. These similarity measures are adapted to DEM with band reduction and real number operation. One of the measures gives function graph and the others give measure matrices. Application of similarity measures to six grid DEM pairs shows interesting results. These four different grid DEMs are created with the same method for the same area, surprisingly; thirteen out of 14 measures state that, the half grid size apart grid DEMs are different from each other. The results indicated that although grid DEMs carry mutual information, they have also additional individual information. In other words, half grid size apart constructed grid DEMs have non-redundant information.; Joint Probability Distributions Function Graphs

  2. The Importance of Pilot Studies

    OpenAIRE

    Van Teijlingen, Edwin; Hundley, Vanora

    2001-01-01

    The term 'pilot studies' refers to mini versions of a full-scale study (also called 'feasibility' studies), as well as the specific pre-testing of a particular research instrument such as a questionnaire or interview schedule. \\ud Pilot studies are a crucial element of a good study design. Conducting a pilot study does not guarantee success in the main study, but it does increase the likelihood. \\ud Pilot studies fulfil a range of important functions and can provide valuable insights for othe...

  3. Exercise: A vitally important prescription.

    Science.gov (United States)

    Hechanova, Rachel L; Wegler, Jennifer L; Forest, Christopher P

    2017-04-01

    Sedentary lifestyles and low physical activity have led to rising health concerns and increasing mortality risks. With the growing concern of the inactivity of adult Americans, it is important that physical activity be promoted to prevent disease and reduce health risks. This article reviews the benefits of physical activity and the steps that primary care providers should take to evaluate physical activity as the fifth vital sign in every patient encounter. The 5A's (assess, advise, agree, assist, and arrange) should be applied in order to implement an exercise prescription into the practice of medicine.

  4. PFGE: importance in food quality.

    Science.gov (United States)

    Vernile, Anna; Giammanco, Giovanni; Massa, Salvatore

    2009-11-01

    In late 19 century, great interest has arisen for food quality. This is referred as absence of pathogens in food (safety for consumers) and as nutritional quality of food (organoleptic characteristics). Pulsed-field gel electrophoresis (PFGE) is, among the molecular techniques developed in the last years, one of the most reliable, discriminative and reproducible technique. It can be used in clinical field for the identification of pathogens and the origin of outbreaks, and in food microbiology for the identification of pathogens (food borne disease surveillance) or of microorganisms responsible for the organoleptic characteristics of food. The present article shows some useful patents related to PFGE and importance in food quality.

  5. Pelagic fish, particularly clupeoids, form the basis of many important ...

    African Journals Online (AJOL)

    spamer

    identified and related to anchovy recruitment by way of an expert system approach. These two ... mental and biological variables thought to be important in controlling ... and environmental variables/processes in the spawning, transport and ...

  6. Biologically Important Areas for Cetaceans within U.S. Waters

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Cetacean Density and Distribution Mapping Working Group identified Biologically Important Areas (BIAs) for 24 cetacean species, stocks, or populations in seven...

  7. Important motivators for buying green products

    Directory of Open Access Journals (Sweden)

    Kamyar Kianpour

    2014-12-01

    Full Text Available Purpose: To addresses the main motivators that influence customers to buy green products as well as well as profiling the decisions that shape their behavior. Design/methodology/approach: The authors have conducted a review of the major research related to consumers to identify motivational factors, to draw conclusions about their impact on buying green products.   Factor analysis is conducted on the collected data to find the underlying factors that motivate consumers to buy green products and most importantly motivational factors were identified by T test. Findings: Results show that 1 Environmental Concern, Perceived Consumer Effectiveness, Consumer Knowledge 2 Laws and regulation and 3 Promotional Tools’ were the most important of motivators. Practical implications: The results could help companies, authorities, governments, producers, sellers to know what motivate customers to buy green products and persuade the customers for buying them. Social implications: Furthermore this research will indirectly contribute to increase the customers and public intention for buying green products which in turn will help to solve some of environmental issues and make less environmental side effect caused by products. It is notable that motivated consumers for buying green product will finally expect to have healthy life and clean environment which leads to a healthy and clean society. Originality/value: This article contributes to the literature on the customers’ intention for buying green products by filling the gap in the concrete issues of the customers’ motivation.

  8. Radioactive contamination in imported foods

    International Nuclear Information System (INIS)

    Kan, Kimiko; Maki, Toshio; Nagayama, Toshihiro; Hashimoto, Hideki; Kawai, Yuka; Kobayashi, Maki; Shioda, Hiroko; Nishima, Taichiro

    1990-01-01

    On April 26, 1986, explosion occurred in Chernobyl nuclear power station in USSR, and radioactivity contamination was brought about in almost all countries in the world. In European countries, crops were contaminated directly with radioactive fallout to high concentration. Also in Japan, after one week the radioactivity higher than usual was detected in environment, and also in vegetables, milk, tea leaves and others. Thereafter, in order to cope with the import of contaminated foods, inspection and watch system was strengthened by deciding the interim limit of radioactive concentration. However the cases of exceeding the interim limit were often reported. In order to remove the harmful foods due to radioactive contamination and to meet the fear of consumers, the authors measured the radioactive concentration in foods distributed in Tokyo and investigated the actual state of contamination. The samples were 920 imported foods. The experimental method, the preparation of samples, the method of analysis and the results are reported. The samples in which the radioactive concentration exceeding 50 Bq/kg was detected were 25 cases. The food having the high frequency of detection was flavors. (K.I.)

  9. When is protein binding important?

    Science.gov (United States)

    Heuberger, Jules; Schmidt, Stephan; Derendorf, Hartmut

    2013-09-01

    The present paper is an ode to a classic citation by Benet and Hoener (2002. Clin Pharm Ther 71(3):115-121). The now classic paper had a huge impact on drug development and the way the issue of protein binding is perceived and interpreted. Although the authors very clearly pointed out the limitations and underlying assumptions for their delineations, these are too often overlooked and the classic paper's message is misinterpreted by broadening to cases that were not intended. Some members of the scientific community concluded from the paper that protein binding is not important. This was clearly not intended by the authors, as they finished their paper with a paragraph entitled: "When is protein binding important?" Misinterpretation of the underlying assumptions in the classic work can result in major pitfalls in drug development. Therefore, we revisit the topic of protein binding with the intention of clarifying when clinically relevant changes should be considered during drug development. Copyright © 2013 Wiley Periodicals, Inc.

  10. Machine Learning Identification of Protein Properties Useful for Specific Applications

    KAUST Repository

    Khamis, Abdullah

    2016-03-31

    Proteins play critical roles in cellular processes of living organisms. It is therefore important to identify and characterize their key properties associated with their functions. Correlating protein’s structural, sequence and physicochemical properties of its amino acids (aa) with protein functions could identify some of the critical factors governing the specific functionality. We point out that not all functions of even well studied proteins are known. This, complemented by the huge increase in the number of newly discovered and predicted proteins, makes challenging the experimental characterization of the whole spectrum of possible protein functions for all proteins of interest. Consequently, the use of computational methods has become more attractive. Here we address two questions. The first one is how to use protein aa sequence and physicochemical properties to characterize a family of proteins. The second one focuses on how to use transcription factor (TF) protein’s domains to enhance accuracy of predicting TF DNA binding sites (TFBSs). To address the first question, we developed a novel method using computational representation of proteins based on characteristics of different protein regions (N-terminal, M-region and C-terminal) and combined these with the properties of protein aa sequences. We show that this description provides important biological insight about characterization of the protein functional groups. Using feature selection techniques, we identified key properties of proteins that allow for very accurate characterization of different protein families. We demonstrated efficiency of our method in application to a number of antimicrobial peptide families. To address the second question we developed another novel method that uses a combination of aa properties of DNA binding domains of TFs and their TFBS properties to develop machine learning models for predicting TFBSs. Feature selection is used to identify the most relevant characteristics

  11. Property impacts on Carbon Capture and Storage (CCS) processes: A review

    International Nuclear Information System (INIS)

    Tan, Yuting; Nookuea, Worrada; Li, Hailong; Thorin, Eva; Yan, Jinyue

    2016-01-01

    Highlights: • Property impacts on CCS processes have been reviewed. • Properties were ranked and priority of properties in model development was analyzed. • Relevant properties in the design and operation of CCS processes have been identified. • The studied CCS processes include CO_2 capture, conditioning, transport and storage. - Abstract: The knowledge of thermodynamic and transport properties of CO_2-mixtures is important for designing and operating different processes in carbon capture and storage systems. A literature survey was conducted to review the impact of uncertainty in thermos-physical properties on the design and operation of components and processes involved in CO_2 capture, conditioning, transport and storage. According to the existing studies on property impacts, liquid phase viscosity and diffusivity as well as gas phase diffusivity significantly impact the process simulation and absorber design for chemical absorption. Moreover, the phase equilibrium is important for regenerating energy estimation. For CO_2 compression and pumping processes, thermos-physical properties have more obvious impacts on pumps than on compressors. Heat capacity, density, enthalpy and entropy are the most important properties in the pumping process, whereas the compression process is more sensitive to heat capacity and compressibility. In the condensation and liquefaction process, the impacts of density, enthalpy and entropy are low on heat exchangers. For the transport process, existing studies mainly focused on property impacts on the performance of pipeline steady flow processes. Among the properties, density and heat capacity are most important. In the storage process, density and viscosity have received the most attention in property impact studies and were regarded as the most important properties in terms of storage capacity and enhanced oil recovery rate. However, for physical absorption, physical adsorption and membrane separation, there has been a

  12. The Importance of Landfill Gas Policy Measures

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-07-01

    The purpose of this document is to identify and examine global policies, measures, and incentives that appear to be stimulating LFG use. As certain countries have made great advances in LFGE development through effective policies, the intention of this report is to use information from the IEA's Global Renewable Energy and Energy Efficiency Measures and Policies Databases to identify and discuss policies. By consolidating this information and categorising it according to policy type, the attributes that are most appealing or applicable to the circumstances of a particular country or area -- technology demonstration, financial incentives, awareness campaigns, etc. -- are more easily identified. The report begins with background information on LFG and sanitary landfill practices, including a discussion of regional disparities, followed by a description of LFG mitigation technologies. Barriers to LFGE projects are then outlined. An explanation of the importance and effectiveness of policy measures leads into a discussion of types and examples of measures that are being used to overcome these barriers and encourage LFGE development. The report concludes with lessons learned, recommendations for further study, and resources where more information can be found.

  13. Identifying misbehaving models using baseline climate variance

    Science.gov (United States)

    Schultz, Colin

    2011-06-01

    The majority of projections made using general circulation models (GCMs) are conducted to help tease out the effects on a region, or on the climate system as a whole, of changing climate dynamics. Sun et al., however, used model runs from 20 different coupled atmosphere-ocean GCMs to try to understand a different aspect of climate projections: how bias correction, model selection, and other statistical techniques might affect the estimated outcomes. As a case study, the authors focused on predicting the potential change in precipitation for the Murray-Darling Basin (MDB), a 1-million- square- kilometer area in southeastern Australia that suffered a recent decade of drought that left many wondering about the potential impacts of climate change on this important agricultural region. The authors first compared the precipitation predictions made by the models with 107 years of observations, and they then made bias corrections to adjust the model projections to have the same statistical properties as the observations. They found that while the spread of the projected values was reduced, the average precipitation projection for the end of the 21st century barely changed. Further, the authors determined that interannual variations in precipitation for the MDB could be explained by random chance, where the precipitation in a given year was independent of that in previous years.

  14. Identifying the Molecular Origin of Global Warming

    Science.gov (United States)

    Bera, Partha P.; Francisco, Joseph S.; Lee, Timothy J.

    2009-01-01

    We have investigated the physical characteristics of greenhouse gases (GHGs) to assess which properties are most important in determining the efficiency of a GHG. Chlorofluorcarbons (CFCs), hydrofluorocarbons (HFCs), perfluorocarbons (PFCs), nitrogen fluorides, and various other known atmospheric trace molecules have been included in this study. Compounds containing the halogens F or Cl have in common very polar X-F or X-Cl bonds, particularly the X-F bonds. It is shown that as more F atoms bond to the same central atom, the bond dipoles become larger as a result of the central atom becoming more positive. This leads to a linear increase in the total or integrated XF bond dipole derivatives for the molecule, which leads to a non-linear (quadratic) increase in infrared (IR) intensity. Moreover, virtually all of the X-F bond stretches occur in the atmospheric IR window as opposed to X-H stretches, which do not occur in the atmospheric window. It is concluded that molecules possessing several F atoms will always have a large radiative forcing parameter in the calculation of their global warming potential. Some of the implications for global warming and climate change are discussed.

  15. Material properties in complement activation

    DEFF Research Database (Denmark)

    Moghimi, S. Moein; Andersen, Alina Joukainen; Ahmadvand, Davoud

    2011-01-01

    activation differently and through different sensing molecules and initiation pathways. The importance of material properties in triggering complement is considered and mechanistic aspects discussed. Mechanistic understanding of complement events could provide rational approaches for improved material design...

  16. Testing properties of generic functions

    NARCIS (Netherlands)

    Jansson, P.; Jeuring, J.T.; Cabenda, L.; Engels, G.; Kleerekoper, J.; Mak, S.; Overeem, M.; Visser, Kees

    2006-01-01

    Software testing is an important part of the software devel- opment process. Testing comes in many flavours: unit testing, property testing, regression testing, contract checking, etc. QuickCheck is proba- bly one of the most advanced tools for testing properties of functional programs. It

  17. Import of metal scrap - risks associated with radioactivity

    International Nuclear Information System (INIS)

    Elert, M.

    1992-11-01

    There is a growing concern in Sweden for the possibility that imported metal scrap is radioactive. The recent political and economical changes in eastern Europe and the increased cooperation with the CEC has affected Swedens import. In the last years, the import of metal scrap from the former USSR has increased considerably. In view of recent incidents, when radioactive materials have been found, the Swedish Radiation Protection Institute has detected a need for identifying the potential risk sources and evaluating the magnitude of the risk associated with the import of metal scrap. The purpose of this report is to provide some background material concerning import statistics, use of metal scrap in Sweden and to identify potential sources of radioactive metal scrap. In addition, the radionuclides of most concern has been identified and the possibility of detecting them in metal scrap shipments is analyzed

  18. Buying Local or Imported Goods?

    DEFF Research Database (Denmark)

    Ayob, Abu H.; Hussain, Wan Mohd Hirwani Wan

    2016-01-01

    ’ purchasing decisions. Data was collected on 296 university students in Malaysia and analyzed through probit regression analysis. The findings reveal that foreign products from advanced countries are preferred by male students because of the superior quality and brand image. On the other hand, family members......This study attempts to profile non-income consumers by examining their decisions to buy local or imported products. Hypotheses were drawn from discussions on the comparative advantages of advanced and developing countries, as well as the effects of a product’s country-of-origin on customers...... encourage students to buy local products because they are perceived as being less expensive. Also, students who receive scholarships are more likely to buy local products than self-sponsored students. This research offers insights into ex-ante purchasing behavior in developing countries particularly among...

  19. The Most Important Maglev Applications

    Directory of Open Access Journals (Sweden)

    Hamid Yaghoubi

    2013-01-01

    Full Text Available The name maglev is derived from magnetic levitation. Magnetic levitation is a highly advanced technology. It has various uses. The common point in all applications is the lack of contact and thus no wear and friction. This increases efficiency, reduces maintenance costs, and increases the useful life of the system. The magnetic levitation technology can be used as an efficient technology in the various industries. There are already many countries that are attracted to maglev systems. Many systems have been proposed in different parts of the worlds. This paper tries to study the most important uses of magnetic levitation technology. The results clearly reflect that the maglev can be conveniently considered as a solution for the future engineering needs of the world.

  20. The importance of contact quality

    DEFF Research Database (Denmark)

    van Bakel, Marian; Gerritsen, Marinel; van Oudenhoven, Jan Pieter

    Establishing contact between expatriates and a local host has been found to reap benefits with regard to Interaction Adjustment, Host National Social Support, Open-mindedness, and Social Initiative. This longitudinal study examines the role of the quality of contact for these four aspects....... Expatriates in the Netherlands were randomly divided into an experimental group (n = 33) of which 21 developed high-quality contact with their host, and a control group (n = 32) without host. The results show that contact quality plays an important role and suggest that the higher the quality of the contact......, the more benefit the expatriate experienced. Moreover, expatriates with low-quality contact did not experience a detrimental effect....

  1. Terminology, the importance of defining.

    Science.gov (United States)

    van Mil, J W Foppe; Henman, Martin

    2016-06-01

    Multiple terms and definitions exist to describe specific aspects of pharmacy practice and service provision. This commentary explores the reasons for different interpretations of words and concepts in pharmaceutical care and pharmacy practice research. Reasons for this variation can be found in language, culture, profession and may also depend on developments over time. A list of words is provided where the authors think that currently multiple interpretations are possible. To make sure that the reader understands the essence, it seems imperative that authors include a definition of the topics that they actually study in their papers, and that they clearly cite existing definitions or refer to collections of definitions such as existing glossaries. It is important that presenters, authors and reviewers of pharmacy practice papers pay more attention to this aspect of describing studies.

  2. Conflict management: importance and implications.

    Science.gov (United States)

    McKibben, Laurie

    2017-01-26

    Conflict is a consistent and unavoidable issue within healthcare teams. Despite training of nurse leaders and managers around areas of conflict resolution, the problem of staff relations, stress, sickness and retention remain. Conflict arises from issues with interpersonal relationships, change and poor leadership. New members of staff entering an already established healthcare team should be supported and integrated, to encourage mutual role respect between all team members and establish positive working relationships, in order to maximise patient care. This paper explores the concept of conflict, the importance of addressing causes of conflict, effective management, and the relevance of positive approaches to conflict resolution. Good leadership, nurturing positive team dynamics and communication, encourages shared problem solving and acceptance of change. Furthermore mutual respect fosters a more positive working environment for those in healthcare teams. As conflict has direct implications for patients, positive resolution is essential, to promote safe and effective delivery of care, whilst encouraging therapeutic relationships between colleagues and managers.

  3. Clinical importance of electromagnetic fields

    International Nuclear Information System (INIS)

    Ruppe, I.

    1993-01-01

    The clinical importance of most of the electromagnetic fields is not highly. Mostly they only have thermal effects, produced by energy-absorption. About 1 C increase of whole-body-temperature is valid for tolerable limit. For measuring is used the SAR-Value (Specific Absorption Rate) in W/kg body mass. SAR = 0,8W/kg for the whole body is valid to be safety. For the evaluation of possible other effects of electromagnetic fields the scientific knowledges are till now not sufficient to allow a final statement. That could be impacts of electromagnetic fields to conduction or switch processes in the nerves or brains, in the framwork of cellular regulations, in the genetic reactions are occurig is little, but if is necessary to find it out in scinentific investigations. (orig.) [de

  4. Economic importance and GIS mapping of medicinal plants in Iran ...

    African Journals Online (AJOL)

    This study identified the economic importance of medicinal plants and evaluated with Geographical Information System (GIS) tool to develop spatial maps covering medicinal plants prevalent in Darkesh area, Northern Khorasan, Iran. Then provide the coordinates of the identified area as your results. 10 medicinal plants ...

  5. Important projects are being implemented jointly

    International Nuclear Information System (INIS)

    Medeliene, D.

    1998-01-01

    Full text: Sweden is continuing its support to Lithuania in the field of nuclear safety. The major current projects include the testing of gap between graphite and pressure tube measuring device, the pressure tube investigation of material properties, content of hydrogen, microstructure, etc., ALS Structure verification using non-destructive testing, Conceptual study on Leak Before Break, Management seminars for VATESI, Multimedia System for the Ignalina NPP's Information Center and Waste management projects. Some of the projects are partially financed by Ignalina NPP. Sweden and Norway provide financing for the extremely important and expensive project - Physical protection: perimeter around the plant. Two new EC projects, Continuation of support to VATESI: licensing, inservice and decommissioning, and Phare TSO project to help building up TSO competence in Lithuania are no less important. In the beginning of September a functional exercise was organised with the Ignalina NPP emergency preparedness Information unit. This exercise was the second one of the two to prepare the personnel for the problems they have to solve in communication with public and media in the case of an accident at the Ignalina NPP

  6. Optical adhesive property study

    Energy Technology Data Exchange (ETDEWEB)

    Sundvold, P.D.

    1996-01-01

    Tests were performed to characterize the mechanical and thermal properties of selected optical adhesives to identify the most likely candidate which could survive the operating environment of the Direct Optical Initiation (DOI) program. The DOI system consists of a high power laser and an optical module used to split the beam into a number of channels to initiate the system. The DOI requirements are for a high shock environment which current military optical systems do not operate. Five candidate adhesives were selected and evaluated using standardized test methods to determine the adhesives` physical properties. EC2216, manufactured by 3M, was selected as the baseline candidate adhesive based on the test results of the physical properties.

  7. Stem Properties of Autobacteria

    Directory of Open Access Journals (Sweden)

    Boris A. Berdichevskyy

    2014-03-01

    Full Text Available This paper discusses the stem properties of the autobacteria as part of the activation syndrome and persistence of the endogenous microflora in the adaptation process of the macroorganism to stress, as well as the ability of the bacteria to stimulate the cells of the macroorganism to manifest stem properties. The essence of this syndrome involves testing the tissue with the autobacteria of their "host" body to identify the foci of cellular insolvency with the subsequent inclusion of the autostrains in the implementation phase of the catabolic and anabolic inflammations. Considering the genetic tropism of the microbes to the organ-specific tissue of the area affected, the existence of the stem properties of the autobacteria is assumed to be realized in the process of reparative regeneration. The great clinical significance of further study of this phenomenon is not excluded.

  8. Basic properties of semiconductors

    CERN Document Server

    Landsberg, PT

    2013-01-01

    Since Volume 1 was published in 1982, the centres of interest in the basic physics of semiconductors have shifted. Volume 1 was called Band Theory and Transport Properties in the first edition, but the subject has broadened to such an extent that Basic Properties is now a more suitable title. Seven chapters have been rewritten by the original authors. However, twelve chapters are essentially new, with the bulk of this work being devoted to important current topics which give this volume an almost encyclopaedic form. The first three chapters discuss various aspects of modern band theory and the

  9. Optical properties of solids

    CERN Document Server

    Wooten, Frederick

    1972-01-01

    Optical Properties of Solids covers the important concepts of intrinsic optical properties and photoelectric emission. The book starts by providing an introduction to the fundamental optical spectra of solids. The text then discusses Maxwell's equations and the dielectric function; absorption and dispersion; and the theory of free-electron metals. The quantum mechanical theory of direct and indirect transitions between bands; the applications of dispersion relations; and the derivation of an expression for the dielectric function in the self-consistent field approximation are also encompassed.

  10. Identifying an outcome measure to assess the impact of Mobility Dogs.

    Science.gov (United States)

    Mudge, Suzie; Rewi, Dallas; Channon, Alexis

    2017-01-01

    Mobility Dogs® trains dogs to work with people with physical disabilities to increase independence, confidence, self-esteem and participation. Mobility Dogs® seeks to critically evaluate and improve its services as it grows. This study aimed to identify and implement a standardised outcome measure into practice at Mobility Dogs®. Based on the Consolidated Framework for Implementation Research and guided by a steering group of key stakeholders, a three-phase approach was developed to identify and assess an outcome measure. The steering group highlighted the organisation's specific needs, selected participation as the assessment domain and identified core utility requirements of the measure. A comprehensive review of evidence was undertaken to identify and rank potential measures according to the specified needs. Of the seven participation outcome measures that met inclusion criteria, the three highest ranked measures were critically evaluated by the steering group to determine suitability against the organisation's needs. The Impact on Participation and Autonomy (IPA) was selected for implementation into practice at Mobility Dogs®. Use of the IPA is an important first step for Mobility Dogs® to test the benefits of trained service dogs. This process could be replicated by other service dog organisations to identify outcome measures to assess their own services. Implications for Rehabilitation Service dogs (such as Mobility Dogs® in New Zealand) assist people living with physical impairments by performing tasks, however there is limited evidence on outcomes. The process for selecting an appropriate outcome measure for Mobility Dogs® involving partnership between Mobility Dogs® personnel and academics was an effective way to steer the project by determining important properties of the measure, before a search of the literature was undertaken. While the IPA was selected as the most appropriate outcome measure for use at Mobility Dogs®, it was the process that

  11. The importance of being informed

    Science.gov (United States)

    Draganova, Tamara

    2013-04-01

    "Science needs a lot of inspiration and that is why it is very important to draw the students` inspiration because it is the inspiration that is the future of science." For 10 years on students, teachers, parents and citizens harmonize knowledge and skills, competencies and energy, renewable ideas and shared experience on the topic "Climate change" at our High School of Humanitarian "St. st. Cyril and Methodius". During the last 3 years we have been doing our utmost to encourage the students from our school to participate actively in different eco projects such as: 8 workshops and 2 conferences, 63 multimedia lessons in ecology, geography, world and personality; 15 interactive art lessons through the Forum-theatre, 7 photo exhibitions and 29 exhibitions on the topic "The Archives of the Planet Speak", 5 roundtable workshops, 19 eco-races, 7 scenarios of decision taking, 12 open lessons, 26 discussions, 5 scientific lectures given by professors from V. Tarnovo University, Department Geography, 9 questionnaires, 17 practical lessons and experiments held in the classroom, 13 training and 11 ecological campaigns named - "It depends on You", "Striped Rug - Colourful Beans", "Let`s Plant Life", "Saving Energy between Nations", "Save Today to Have Tomorrow", "Grey Is Not Fashionable" etc. Numerous meetings were held with representatives of NGOs, the Regional Inspectorate of Education, the Regional Inspectorate of Environment and Water Safety, V. Tarnovo University, Department Geography, V. Tarnovo Municipality and other communities. Students and university students were organized around the core activity of renewable energy sources, presenting scientific and creative activities such as models, presentations, poems, essays, drawing posters and more. Students under the guidance of a teacher in geography studied history, current treatment processes and phenomena, the signs of expression, the similarities and differences between different parts of the country and other parts

  12. Statistical Evaluation of the Identified Structural Parameters of an idling Offshore Wind Turbine

    International Nuclear Information System (INIS)

    Kramers, Hendrik C.; Van der Valk, Paul L.C.; Van Wingerden, Jan-Willem

    2016-01-01

    With the increased need for renewable energy, new offshore wind farms are being developed at an unprecedented scale. However, as the costs of offshore wind energy are still too high, design optimization and new innovations are required for lowering its cost. The design of modern day offshore wind turbines relies on numerical models for estimating ultimate and fatigue loads of the turbines. The dynamic behavior and the resulting structural loading of the turbines is determined for a large part by its structural properties, such as the natural frequencies and damping ratios. Hence, it is important to obtain accurate estimates of these modal properties. For this purpose stochastic subspace identification (SSI), in combination with clustering and statistical evaluation methods, is used to obtain the variance of the identified modal properties of an installed 3.6MW offshore wind turbine in idling conditions. It is found that one is able to obtain confidence intervals for the means of eigenfrequencies and damping ratios of the fore-aft and side-side modes of the wind turbine. (paper)

  13. The Importance of Water for Life

    Science.gov (United States)

    Westall, Frances; Brack, André

    2018-03-01

    Liquid water is essential for life as we know it, i.e. carbon-based life. Although other compound-solvent pairs that could exist in very specific physical environments could be envisaged, the elements essential to carbon and water-based life are among the most common in the universe. Carbon molecules and liquid water have physical and chemical properties that make them optimised compound-solvent pairs. Liquid water is essential for important prebiotic reactions. But equally important for the emergence of life is the contact of carbon molecules in liquid water with hot rocks and minerals. We here review the environmental conditions of the early Earth, as soon as it had liquid water at its surface and was habitable. Basing our approach to life as a "cosmic phenomenon" (de Duve 1995), i.e. a chemical continuum, we briefly address the various hypotheses for the origin of life, noting their relevance with respect to early environmental conditions. It appears that hydrothermal environments were important in this respect. We continue with the record of early life noting that, by 3.5 Ga, when the sedimentary environment started being well-preserved, anaerobic life forms had colonised all habitable microenvironments from the sea floor to exposed beach environments and, possibly, in the photic planktonic zone of the sea. Life on Earth had also evolved to the relatively sophisticated stage of anoxygenic photosynthesis. We conclude with an evaluation of the potential for habitability and colonisation of other planets and satellites in the Solar System, noting that the most common life forms in the Solar System and probably in the Universe would be similar to terrestrial chemotrophs whose carbon source is either reduced carbon or CO2 dissolved in water and whose energy would be sourced from oxidized carbon, H2, or other transition elements.

  14. Chronic alcohol abuse in men alters bone mechanical properties by affecting both tissue mechanical properties and microarchitectural parameters.

    Science.gov (United States)

    Cruel, M; Granke, M; Bosser, C; Audran, M; Hoc, T

    2017-06-01

    Alcohol-induced secondary osteoporosis in men has been characterized by higher fracture prevalence and a modification of bone microarchitecture. Chronic alcohol consumption impairs bone cell activity and results in an increased fragility. A few studies highlighted effects of heavy alcohol consumption on some microarchitectural parameters of trabecular bone. But to date and to our knowledge, micro- and macro-mechanical properties of bone of alcoholic subjects have not been investigated. In the present study, mechanical properties and microarchitecture of trabecular bone samples from the iliac crest of alcoholic male patients (n=15) were analyzed and compared to a control group (n=8). Nanoindentation tests were performed to determine the tissue's micromechanical properties, micro-computed tomography was used to measure microarchitectural parameters, and numerical simulations provided the apparent mechanical properties of the samples. Compared to controls, bone tissue from alcoholic patients exhibited an increase of micromechanical properties at tissue scale, a significant decrease of apparent mechanical properties at sample scale, and significant changes in several microarchitectural parameters. In particular, a crucial role of structure model index (SMI) on mechanical properties was identified. 3D microarchitectural parameters are at least as important as bone volume fraction to predict bone fracture risk in the case of alcoholic patients. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. The importance of Clinical Research

    Directory of Open Access Journals (Sweden)

    Frank Lizaraso Caparó

    2016-01-01

    Full Text Available Objetives: to describe the clinical and epidemiological characteristics, evolution and to identify mortality factors associated in patients with snp.Material and methods: descriptive study of a serie of cases of the intensive care unit (icu of a general hospital. medical records of patients which received medical attention and who meet the selection criteria were reviewed. Results: forty-one clinical records were evaluated. the average age was 69 old, predominantly male (68,3%. snp was the reason of admission in 60.9% and 95.1% required mechanical ventilation. hospital stay prior to diagnosis was 10 days, 65% of patients had some risk factor for multi resistence organisms, cpis of entry was 9.3, cultures were positive in 39% of the cases and of these, 48.8% received proper antibiotic according to culture results. the days of stay in icu were 20.6 days and 20 of the 41 medical records were for death patients. the clinical and epidemiological characteristics were similar between death and alive patients. an analysis of factors that could be associated with mortality snp was made and it was found that for an age ≥ 70 years, the presence of any risk factor for multidrug resistence organism and control cpis ≥ 6 were associated with higher mortality; while acquisition of the icu was associated to lower mortality. Conclusions: the clinical, epidemiological characteristics and evolution of patients with snp in our icu were similar to those describe in the literature. three factors associated with mortality in the icu were identified.

  16. Toxoplasmosis: An Important Protozoan Zoonosis

    Directory of Open Access Journals (Sweden)

    Sonar S. S. and Brahmbhatt M.N.

    Full Text Available Toxoplasmosis is an important infection caused by single celled parasite Toxoplasma gondii which is one of the world's most common parasites. Toxoplasmosis is considered to be the third leading cause of death attributed to food-borne illness in the United States. Most people affected never develop signs and symptoms. But for infants born to infected mothers and for people with compromised immune systems, toxoplasmosis can cause extremely serious complications. Toxoplasmosis was first described in 1908 from a small rodent. The parasite infects almost all worm blooded animals and serological evidence indicates that it is one of the most common of humans’ infections throughout the world. The disease is transmitted mainly by ingestion of infective stage of the parasite, organ transplant as well as blood transfusion in addition to the transplacental transmission which is very common. Toxoplasmosis can be presented in various forms of clinical manifestations depending on the immune status of the patient causing life threatening disease in AIDS patient. Pregnant women, cat owners, veterinarians, abattoir workers, children, cooks, butchers are considered as high risk group. Timely treatment of man and animals with proper antibiotic, hygienic measures, proper disinfection, mass education and vaccination are the measures to curtail the disease. [Veterinary World 2010; 3(9.000: 436-439

  17. Reinsurance: Substance, range and importance

    Directory of Open Access Journals (Sweden)

    Petrović-Tomić Nataša

    2015-01-01

    Full Text Available Reinsurance - at least in Serbian law - represents one of the institutes of Insurance Law of whom a little is known. It should not be surprising as the contract of reinsurance traditionally is not regulated in civil codes or laws on contract of insurance. Questionable are all features of the contract of reinsurance: from the definition through the essentialia negotii to the principle of utmost good faith. That is why the paper is structured so that firstly gives definition of contract of reinsurance and explains position of reinsurance in the system of insurance. It is high­lighted that the contract of reinsurance builds on the contract of insurance; which enables the further transfer of risk. It is business-to-business contract (B-2-B, concluded between insurance law experts; frequently of international character; mostly contract of adhesion, aleatory and synallagmatic contract, contract with subsequent execution, etc. The importance of reinsurance in the system of insurance is divided on three components: increase of capacity of insurance market, guarantee of acomplishment of obligations of insurer and regulatory effect on insurance. The author concludes that the contract of reinsurance is a specific business insurance contract, concluded by the insurance law experts and that represents community of interests of reinsurer and reinsured. The mentioned contract may perform its function only if the contracting parties act in a responsible manner, lege artis and respecting the principle of utmost good faith.

  18. Thiosemicarbazones: preparation methods, synthetic applications and biological importance

    International Nuclear Information System (INIS)

    Tenorio, Romulo P.; Goes, Alexandre J.S.; Lima, Jose G. de; Faria, Antonio R. de; Alves, Antonio J.; Aquino, Thiago M. de

    2005-01-01

    Thiosemicarbazones are a class of compounds known by their chemical and biological properties, such as antitumor, antibacterial, antiviral and antiprotozoal activity. Their ability to form chelates with metals has great importance in their biological activities. Their synthesis is very simple, versatile and clean, usually giving high yields. They are largely employed as intermediates, in the synthesis of others compounds. This article is a survey of some of these characteristics showing their great importance to organic and medicinal chemistry. (author)

  19. Importance of Cross-Cultural Counseling in Rehabilitation Counseling Curricula.

    Science.gov (United States)

    Watson, Albert L.

    1988-01-01

    Ninety-one members of the National Council on Rehabilitation Education were surveyed concerning the level of importance placed on cross-cultural content in rehabilitation counselor education curricula. Respondents rated 27 of 32 cross-cultural educational offerings as important, and identified seven additional offerings. Respondents' demographic…

  20. IMPORTANT PROTOZOAN PARASITES IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Srisasi Gandahusada

    2012-09-01

    Full Text Available The most important protozoan parasites in Indonesia are the malaria parasites, Toxoplasma gondii and Entamoeba histolytica. After the second world war the residual insecticides and effective antimalarial drugs were used in the control of malaria. After development of resistance among mosquitoes to insecticides, the Malaria Control Programme was switched over to the Malaria Eradication Programme. Malaria incidence dropped heavily. However, due to the quick development of vector resistance and financial limitations, malaria came back and so did the Malaria Control Programme. P. falciparum and P.vivax are the most common species in Indonesia. Important vectors are An. sundaicus, An. aconitus, An. maculatus, An. hyrcanus group, An. balabacensis, An. farauti etc. An. sundaicus and An. aconitus have developed resistance to DDT and Dieldrin in Java. In 1959 the Malaria Eradication Programme was started in Java, Bali and Lampung. In 1965 the API dropped to 0,15 per thousand. From 1966 onwards malaria transmission was on the increase, because spraying activities were slowed down, but dropped again from 1974 onwards by occasional residual house spraying with DDT or Fenitrothion, malaria surveillance and treatment of malaria cases, resulting in an API of 0.18 per thousand in 1987. At present malaria is not transmitted in Jakarta and in capitals of the provinces and kabupatens, except in Irian Jaya, Nusa Tenggara Timur and one or two other provinces, but it still exists in rural areas. The distribution of chloroquine resistant P.falciparum is patchy. Resistance is at the RI, RII and RUT levels. The main problems of malaria control are : the increasing development of resistance of the vector to insecticides, the change of An.aconitus from zoophili to anthropophili and from indoor to outdoor biting, the increasing resistance of P.falciparum to chloroquine, the shortage of skilled manpower and limitation of budget. In Indonesia many newborns with congenital

  1. Zirconium - an imported mineral commodity

    International Nuclear Information System (INIS)

    1983-10-01

    This report examines Canada's position in regard to the principal zirconium materials: zircon; fusion-cast zirconium-bearing refractory products; zirconium-bearing chemicals; and zirconium metal, master alloys, and alloys. None of these is produced in Canada except fused alumina-zirconia and certain magnesium-zirconium alloys and zirconium-bearing steels. Most of the 3 000-4 000 tonnes of the various forms of zircon believed to be consumed in Canada each year is for foundry applications. Other minerals, notably chromite, olivine and silica sand are also used for these purposes and, if necessary, could be substituted for zircon. Zirconium's key role in Canada is in CANDU nuclear power reactors, where zirconium alloys are essential in the cladding for fuel bundles and in capital equipment such as pressure tubes, calandria tubes and reactivity control mechanisms. If zirconium alloys were to become unavailable, the Canadian nuclear power industry would collapse. As a contingency measure, Ontario Hydro maintains at least nine months' stocks of nuclear fuel bundles. Canada's vulnerability to short-term disruptions to supplies of nuclear fuel is diminished further by the availability of more expensive electricity from non-nuclear sources and, given time, from mothballed thermal plants. Zirconium minerals are present in many countries, notably Australia, the Republic of South Africa and the United States. Australia is Canada's principal source of zircon imports; South Africa is its sole source of baddeleyite. At this time, there are no shortages of either material. Canada has untapped zirconium resources in the Athabasca Oil Sands (zircon) and at Strange Lake along the ill-defined border between Quebec and Newfoundland (gittinsite). Adequate metal and alloy production facilities exist in France, Japan and the United States. No action by the federal government in regard to zirconium supplies is called for at this time

  2. Importance of weak minerals on earthquake mechanics

    Science.gov (United States)

    Kaneki, S.; Hirono, T.

    2017-12-01

    The role of weak minerals such as smectite and talc on earthquake mechanics is one of the important issues, and has been debated for recent several decades. Traditionally weak minerals in fault have been reported to weaken fault strength causing from its low frictional resistance. Furthermore, velocity-strengthening behavior of such weak mineral (talc) is considered to responsible for fault creep (aseismic slip) in the San Andreas fault. In contrast, recent studies reported that large amount of weak smectite in the Japan Trench could facilitate gigantic seismic slip during the 2011 Tohoku-oki earthquake. To investigate the role of weak minerals on rupture propagation process and magnitude of slip, we focus on the frictional properties of carbonaceous materials (CMs), which is the representative weak materials widely distributed in and around the convergent boundaries. Field observation and geochemical analyses revealed that graphitized CMs-layer is distributed along the slip surface of a fossil plate-subduction fault. Laboratory friction experiments demonstrated that pure quartz, bulk mixtures with bituminous coal (1 wt.%), and quartz with layered coal samples exhibited almost similar frictional properties (initial, yield, and dynamic friction). However, mixtures of quartz (99 wt.%) and layered graphite (1 wt.%) showed significantly lower initial and yield friction coefficient (0.31 and 0.50, respectively). Furthermore, the stress ratio S, defined as (yield stress-initial stress)/(initial stress-dynamic stress), increased in layered graphite samples (1.97) compared to quartz samples (0.14). Similar trend was observed in smectite-rich fault gouge. By referring the reported results of dynamic rupture propagation simulation using S ratio of 1.4 (typical value for the Japan Trench) and 2.0 (this study), we confirmed that higher S ratio results in smaller slip distance by approximately 20 %. On the basis of these results, we could conclude that weak minerals have lower

  3. Intellectual Property.

    Science.gov (United States)

    St. Clair, Gloriana

    1992-01-01

    Discusses issues of copyright and the transfer or use of intellectual property as they relate to librarians. Topics addressed include the purpose of copyright laws, financial losses to publishers from pirating, cultural views of pirating, the fair use doctrine, concerns of authors of scholarly materials, impact of increasing library automation and…

  4. luminescence properties

    Indian Academy of Sciences (India)

    1Faculty of Science and Arts, Department of Chemistry, Bozok University, Yozgat 66900, Turkey. 2Faculty of Science, Department of Chemistry, Erciyes ... synthesized by the conventional solid-state reaction method, their crystal structures and luminescence properties were investigated. X-ray diffraction patterns (XRD) ...

  5. School Property.

    Science.gov (United States)

    Piele, Philip K.; Forsberg, James R.

    The 1973 court cases relating to school property continued a trend toward litigating constitutional issues. For instance, a larger number of cases dealt with the relationship between the location and construction of school buildings and school desegregation plans. This chapter reviews the status and development of case law relating to school…

  6. The importance of fire simulation in fire prediction

    Directory of Open Access Journals (Sweden)

    Jevtić Radoje B.

    2014-01-01

    Full Text Available The appearance of fire in objects with lot of humans inside represents very possible real situation that could be very danger and could cause destructive consequences on human lives and material properties. Very important influence in fire prediction, fire protection, human and material properties safety could be a fire simulation in object. This simulation could give many useful information of possible fire propagation; possible and existed evacuation routes; possible and exited placing of fire, smoke, temperature conditions in object and many other information of crucial importance for human lives and material properties, such as the best places for sensors position, optimal number of sensors, projection of possible evacuation routes etc. There are many different programs for fire simulation. This paper presents complete fire simulation in Electrotechnical school Nikola Tesla in Niš in FDS.

  7. Thermal Properties Measurement Report

    Energy Technology Data Exchange (ETDEWEB)

    Carmack, Jon [Idaho National Lab. (INL), Idaho Falls, ID (United States); Braase, Lori [Idaho National Lab. (INL), Idaho Falls, ID (United States); Papesch, Cynthia [Idaho National Lab. (INL), Idaho Falls, ID (United States); Hurley, David [Idaho National Lab. (INL), Idaho Falls, ID (United States); Tonks, Michael [Idaho National Lab. (INL), Idaho Falls, ID (United States); Zhang, Yongfeng [Idaho National Lab. (INL), Idaho Falls, ID (United States); Gofryk, Krzysztof [Idaho National Lab. (INL), Idaho Falls, ID (United States); Harp, Jason [Idaho National Lab. (INL), Idaho Falls, ID (United States); Fielding, Randy [Idaho National Lab. (INL), Idaho Falls, ID (United States); Knight, Collin [Idaho National Lab. (INL), Idaho Falls, ID (United States); Meyer, Mitch [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-08-01

    The Thermal Properties Measurement Report summarizes the research, development, installation, and initial use of significant experimental thermal property characterization capabilities at the INL in FY 2015. These new capabilities were used to characterize a U3Si2 (candidate Accident Tolerant) fuel sample fabricated at the INL. The ability to perform measurements at various length scales is important and provides additional data that is not currently in the literature. However, the real value of the data will be in accomplishing a phenomenological understanding of the thermal conductivity in fuels and the ties to predictive modeling. Thus, the MARMOT advanced modeling and simulation capability was utilized to illustrate how the microstructural data can be modeled and compared with bulk characterization data. A scientific method was established for thermal property measurement capability on irradiated nuclear fuel samples, which will be installed in the Irradiated Material Characterization Laboratory (IMCL).

  8. Process Architecture for Managing Digital Object Identifiers

    Science.gov (United States)

    Wanchoo, L.; James, N.; Stolte, E.

    2014-12-01

    In 2010, NASA's Earth Science Data and Information System (ESDIS) Project implemented a process for registering Digital Object Identifiers (DOIs) for data products distributed by Earth Observing System Data and Information System (EOSDIS). For the first 3 years, ESDIS evolved the process involving the data provider community in the development of processes for creating and assigning DOIs, and guidelines for the landing page. To accomplish this, ESDIS established two DOI User Working Groups: one for reviewing the DOI process whose recommendations were submitted to ESDIS in February 2014; and the other recently tasked to review and further develop DOI landing page guidelines for ESDIS approval by end of 2014. ESDIS has recently upgraded the DOI system from a manually-driven system to one that largely automates the DOI process. The new automated feature include: a) reviewing the DOI metadata, b) assigning of opaque DOI name if data provider chooses, and c) reserving, registering, and updating the DOIs. The flexibility of reserving the DOI allows data providers to embed and test the DOI in the data product metadata before formally registering with EZID. The DOI update process allows the changing of any DOI metadata except the DOI name unless the name has not been registered. Currently, ESDIS has processed a total of 557 DOIs of which 379 DOIs are registered with EZID and 178 are reserved with ESDIS. The DOI incorporates several metadata elements that effectively identify the data product and the source of availability. Of these elements, the Uniform Resource Locator (URL) attribute has the very important function of identifying the landing page which describes the data product. ESDIS in consultation with data providers in the Earth Science community is currently developing landing page guidelines that specify the key data product descriptive elements to be included on each data product's landing page. This poster will describe in detail the unique automated process and

  9. Identifying enabling management practices for employee engagement

    Directory of Open Access Journals (Sweden)

    Marius Joubert

    2011-12-01

    Full Text Available Orientation: A currently emerging viewpoint is that today's management practices no longer add value to organisations. The focus of this article is to conduct a systematic review of the scholarly literature on management practices that could be related to employee engagement. Research purpose: This study searched for evidence in support of the notion of a management value chain, and enabling management practices within each value chain component that could relate to employee engagement. Motivation for the study: An alternative management value chain model could contribute towards a better understanding of which management practices may potentially impact employee engagement. Research design, approach, and method: This is a non-empirical (theoretical study, based on a systematic, in-depth literature review to identify the key management components and enabling practices within this proposed management value chain. Scholarly research databases were sourced for relevant peer reviewed research conducted since 1990, not excluding important contributions prior to 1990. The literature was systematically searched, selected, studied, and contextualized within this study. Main findings: Support was found for the notion of a management value chain, for enabling management practices within each proposed management value chain component, and it was also established these management practices indeed have an impact on employee engagement. Practical/managerial/implications: The possibility that management work can be presented as a generic management value chain allows managers to approach engaging management practices more systematically. Contribution/value-add: This study highlights the importance of some management practices that have never been seen as part of management work.

  10. Subcellular neuropharmacology: the importance of intracellular targeting.

    Science.gov (United States)

    Miyashiro, Kevin Y; Bell, Thomas J; Sul, Jai-Yoon; Eberwine, James

    2009-04-01

    Few cell types are more adapted for cell-cell signaling than neurons. Their responsiveness lies in the formation of highly specialized compartments composed of unique repertoires of selectively distributed protein complexes generated, in part, by the local translation of mRNAs and regulated by their RNA-binding proteins. Utilizing the selective distribution of these neuronal proteins and the underlying mechanisms that generate the differential patterns of expression as central facets of drug design promises to enhance the therapeutic ratio of a drug. It is in this context that we discuss the unique arrangement of mRNAs, RNA-binding proteins and the protein macromolecular complexes at the dendrite, which is the postsynaptic site of synaptic transmission. Recent advances in identifying the function of dendritic components of the mechanisms of protein and RNA transport, non-nuclear RNA splicing and localized translation underscore their importance as targets of neuropharmacology.

  11. The importance of partnerships, mergers and acquisitions

    Energy Technology Data Exchange (ETDEWEB)

    Trabandt, C.A. [Merrill Lynch, New York, NY (United States)

    1998-09-01

    An overview of the electric utility industry was presented. The main factors driving mergers and acquisitions in the industry were identified as being consolidation, disaggregation, convergence and international expansion. To prove the point, statistics from recent merger and acquisition transactions in the U.S. were presented. The importance of disaggregation of the utility business and convergence as the major themes of the electricity and natural gas industries were demonstrated. They are driven by a new competitive marketplace and fewer regulations. The driving forces behind them were explained, buttressing the arguments with recent statistics reflecting an upsurge in convergence transactions. Significant opportunities abroad and recent foreign acquisitions by U. S. utilities were also reviewed. With regard to convergence, it was shown to be occurring in both the generation/wholesale and distribution/retail marketing segment of the electric power industry. 3 figs.

  12. Geoscience is Important? Show Me Why

    Science.gov (United States)

    Boland, M. A.

    2017-12-01

    "The public" is not homogenous and no single message or form of messaging will connect the entire public with the geosciences. One approach to promoting trust in, and engagement with, the geosciences is to identify specific sectors of the public and then develop interactions and communication products that are immediately relevant to that sector's interests. If the content and delivery are appropriate, this approach empowers people to connect with the geosciences on their own terms and to understand the relevance of the geosciences to their own situation. Federal policy makers are a distinct and influential subgroup of the general public. In preparation for the 2016 presidential election, the American Geosciences Institute (AGI) in collaboration with its 51 member societies prepared Geoscience for America's Critical Needs: Invitation to a National Dialogue, a document that identified major geoscience policy issues that should be addressed in a national policy platform. Following the election, AGI worked with eight other geoscience societies to develop Geoscience Policy Recommendations for the New Administration and the 115th Congress, which outlines specific policy actions to address national issues. State and local decision makers are another important subgroup of the public. AGI has developed online content, factsheets, and case studies with different levels of technical complexity so people can explore societally-relevant geoscience topics at their level of technical proficiency. A related webinar series is attracting a growing worldwide audience from many employment sectors. Partnering with government agencies and other scientific and professional societies has increased the visibility and credibility of these information products with our target audience. Surveys and other feedback show that these products are raising awareness of the geosciences and helping to build reciprocal relationships between geoscientists and decision makers. The core message of all

  13. Postradiation sarcomas: importance of surgery

    International Nuclear Information System (INIS)

    Lagrange, J.L.; Ramaioli, A.; Chateau, M.C.; Pignol, J.P.; Marchal, C.; Resbeut, M.; Richaud, P.; Rambert, P.; Tortechaux, J.; Seng, S.H.; La Fontan, B. de; Reme-Saumon, M.; Roullet, B.; Bof, J.; Coindre, J.M.

    1997-01-01

    ) and 31 mo for Surgery+chemotherapy. The differences of survival for the 3 groups are highly significant (p=0,0001, Mantel-Cox). There was no difference between Surgery or Surgery + Chemotherapy (p=0.56). The quality of surgery is known for 57 patients (complete 44p, partial 13 p). The survival was 43 mo VS 16 mo (p=0.08, Mantle-Cox, p=0.036, Breslow) Conclusion. This series confirmed the poor prognosis of post radiation sarcomas even though some have long survived for long periods but Surgery play a very important role in the survival of the patients

  14. Evaluation of factors important to enhance productivity

    Directory of Open Access Journals (Sweden)

    Sanjay Kumar

    2016-12-01

    Full Text Available Productivity as a measure for output is important to industry and academia. In this research, factors to enhance productivity have been identified from the literature by reviewing various international and national sources to explore this evergreen field of research that is “productivity,” which has always been an increasingly interesting area of research for researchers over decades or perhaps over centuries. In total, 15 number of factors have been identified to enhance productivity. Analytic hierarchy process approach has been appropriately chosen to rank these factors because of its simplicity and effectiveness. The tool has been used by taking perception of experts from the Indian manufacturing industry. Positive attitude and involvement of management, proactive employees, and good working conditions have been ranked as top three factors as per the experts’ opinion. The ranking of factors to enhance productivity, categorization of the factors into four perspectives, and hierarchy of perspective and action plan as a final outcome of the paper may help academia and operations managers toward effective management of “operations and production activities of firms/supply chains.”

  15. Identifying influential neighbors in animal flocking.

    Directory of Open Access Journals (Sweden)

    Li Jiang

    2017-11-01

    Full Text Available Schools of fish and flocks of birds can move together in synchrony and decide on new directions of movement in a seamless way. This is possible because group members constantly share directional information with their neighbors. Although detecting the directionality of other group members is known to be important to maintain cohesion, it is not clear how many neighbors each individual can simultaneously track and pay attention to, and what the spatial distribution of these influential neighbors is. Here, we address these questions on shoals of Hemigrammus rhodostomus, a species of fish exhibiting strong schooling behavior. We adopt a data-driven analysis technique based on the study of short-term directional correlations to identify which neighbors have the strongest influence over the participation of an individual in a collective U-turn event. We find that fish mainly react to one or two neighbors at a time. Moreover, we find no correlation between the distance rank of a neighbor and its likelihood to be influential. We interpret our results in terms of fish allocating sequential and selective attention to their neighbors.

  16. Identifying ambassador species for conservation marketing

    Directory of Open Access Journals (Sweden)

    E.A. Macdonald

    2017-10-01

    Full Text Available Conservation relies heavily on external funding, much of it from a supportive public. Therefore it is important to know which species are most likely to catalyse such funding. Whilst previous work has looked at the physical attributes that contribute to a species' appeal, no previous studies have tried to examine the extent to which a species' sympatriots might contribute to it's potential as flagship for wider conservation. Therefore, here we estimate ‘flexibility’ and ‘appeal’ scores for all terrestrial mammals (n = 4320 and identify which of these might serve as ambassadors (defined as both highly appealing and flexible. Relatively few mammals (between 240 and 331 emerged as ambassadors, with carnivores featuring heavily in this group (representing 5% of terrestrial mammals but 39% of ambassadors. ‘Top ambassadors’ were defined as those with both flexibility and appeal scores greater than 1 standard deviation above the mean. Less than a quarter of the 20 most endangered and evolutionary distinct species in this study were classed as ambassadors, highlighting the need for surrogate species to catalyse conservation effort in areas with such priority species. This is the first global analysis bringing together flexibility and appeal for all terrestrial mammals, and demonstrates an approach for determining how best to market species in order to achieve maximal conservation gain in a world with urgent conservation need but limited resources.

  17. Identifying pathways affected by cancer mutations.

    Science.gov (United States)

    Iengar, Prathima

    2017-12-16

    Mutations in 15 cancers, sourced from the COSMIC Whole Genomes database, and 297 human pathways, arranged into pathway groups based on the processes they orchestrate, and sourced from the KEGG pathway database, have together been used to identify pathways affected by cancer mutations. Genes studied in ≥15, and mutated in ≥10 samples of a cancer have been considered recurrently mutated, and pathways with recurrently mutated genes have been considered affected in the cancer. Novel doughnut plots have been presented which enable visualization of the extent to which pathways and genes, in each pathway group, are targeted, in each cancer. The 'organismal systems' pathway group (including organism-level pathways; e.g., nervous system) is the most targeted, more than even the well-recognized signal transduction, cell-cycle and apoptosis, and DNA repair pathway groups. The important, yet poorly-recognized, role played by the group merits attention. Pathways affected in ≥7 cancers yielded insights into processes affected. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Identifying influential neighbors in animal flocking.

    Science.gov (United States)

    Jiang, Li; Giuggioli, Luca; Perna, Andrea; Escobedo, Ramón; Lecheval, Valentin; Sire, Clément; Han, Zhangang; Theraulaz, Guy

    2017-11-01

    Schools of fish and flocks of birds can move together in synchrony and decide on new directions of movement in a seamless way. This is possible because group members constantly share directional information with their neighbors. Although detecting the directionality of other group members is known to be important to maintain cohesion, it is not clear how many neighbors each individual can simultaneously track and pay attention to, and what the spatial distribution of these influential neighbors is. Here, we address these questions on shoals of Hemigrammus rhodostomus, a species of fish exhibiting strong schooling behavior. We adopt a data-driven analysis technique based on the study of short-term directional correlations to identify which neighbors have the strongest influence over the participation of an individual in a collective U-turn event. We find that fish mainly react to one or two neighbors at a time. Moreover, we find no correlation between the distance rank of a neighbor and its likelihood to be influential. We interpret our results in terms of fish allocating sequential and selective attention to their neighbors.

  19. Supercapacitors: Properties and applications

    OpenAIRE

    Libich, Jiří; Máca, Josef; Vondrák, Jiří; Čech, Ondřej; Sedlaříková, Marie

    2018-01-01

    Energy accumulation and storage is one of the most important topics in our times. This paper presents the topic of supercapacitors (SC) as energy storage devices. Supercapacitors represent the alternative to common electrochemical batteries, mainly to widely spread lithium-ion batteries. By physical mechanism and operation principle, supercapacitors are closer to batteries than to capacitors. Their properties are somewhere between batteries and capacitors. They are able to quickly ac...

  20. Quantitative proteomics of the tobacco pollen tube secretome identifies novel pollen tube guidance proteins important for fertilization

    Czech Academy of Sciences Publication Activity Database

    Hafidh, Said; Potěšil, D.; Fíla, Jan; Čapková, Věra; Zdráhal, Z.; Honys, David

    2016-01-01

    Roč. 17, MAY 3 (2016), č. článku 81. ISSN 1465-6906 R&D Projects: GA ČR GA15-22720S; GA ČR(CZ) GA14-32292S; GA ČR(CZ) GA15-16050S; GA MŠk(CZ) LD14109; GA MŠk(CZ) LM2015043; GA MŠk(CZ) ED1.1.00/02.0068; GA MŠk(CZ) LQ1601 Institutional support: RVO:61389030 Keywords : Protein secretion * Pollen tube guidance * Cell-cell signaling Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 11.313, year: 2015

  1. Safe storage of pesticides in Sri Lanka - identifying important design features influencing community acceptance and use of safe storage devices

    DEFF Research Database (Denmark)

    Weerasinghe, Manjula; Pieris, Ravi; Eddleston, Michael

    2008-01-01

    BACKGROUND: Self-poisoning with pesticides is the cause of an estimated 300,000 deaths annually in rural Asia. The great majority of these deaths are from impulsive acts of self-harm using pesticides that are readily available in the home. The secure storage of pesticides under lock has been...

  2. In vitro and in vivo studies identify important features of dengue virus pr-E protein interactions.

    Directory of Open Access Journals (Sweden)

    Aihua Zheng

    2010-10-01

    Full Text Available Flaviviruses bud into the endoplasmic reticulum and are transported through the secretory pathway, where the mildly acidic environment triggers particle rearrangement and allows furin processing of the prM protein to pr and M. The peripheral pr peptide remains bound to virus at low pH and inhibits virus-membrane interaction. Upon exocytosis, the release of pr at neutral pH completes virus maturation to an infectious particle. Together this evidence suggests that pr may shield the flavivirus fusion protein E from the low pH environment of the exocytic pathway. Here we developed an in vitro system to reconstitute the interaction of dengue virus (DENV pr with soluble truncated E proteins. At low pH recombinant pr bound to both monomeric and dimeric forms of E and blocked their membrane insertion. Exogenous pr interacted with mature infectious DENV and specifically inhibited virus fusion and infection. Alanine substitution of E H244, a highly conserved histidine residue in the pr-E interface, blocked pr-E interaction and reduced release of DENV virus-like particles. Folding, membrane insertion and trimerization of the H244A mutant E protein were preserved, and particle release could be partially rescued by neutralization of the low pH of the secretory pathway. Thus, pr acts to silence flavivirus fusion activity during virus secretion, and this function can be separated from the chaperone activity of prM. The sequence conservation of key residues involved in the flavivirus pr-E interaction suggests that this protein-protein interface may be a useful target for broad-spectrum inhibitors.

  3. Missed opportunities in primary care: the importance of identifying depression through screening, family history, and chronic disease management.

    Science.gov (United States)

    Maradiegue, Ann H; Khan, Fakiha

    2013-02-01

    This study explored the adequacy of depression screening in a community health center. The medical charts of individuals (N = 90) enrolled at a community health center were randomly selected, reviewed, and compared to current standard-of-care guidelines for four elements: family history, screening for depression, control of chronic illnesses, and missed opportunities for preventive care. Family history documentation collected by the providers was limited and 44.4% had no family history. There was no routine depression screening process, although 48.9% of the clients had red flags (warning signals) for depression. Laboratory values used for screening control of chronic disease in the medical records were: fasting glucose levels ⩽100 mg/dL (46%), total cholesterol levels ⩽200 mg/dL (38%), and blood pressure ⩽120/80 mmHg (23%). The results highlight the need to focus on depression screening as part of preventive care and the management of chronic disease in the primary care setting. Copyright 2013, SLACK Incorporated.

  4. What's Important to Me: Identifying At-Risk and Resilient Students through Narrative Writing about Personal Values

    Science.gov (United States)

    Stepney, Cesalie T.; Elias, Maurice J.; Epstein, Yakov M.

    2015-01-01

    The study explored whether aspects of elementary students' writing about their personal values could predict if students were considered more at risk or more resilient. Essays from 176 fifth-grade students (79.54% African American, 20.46% Hispanic) from a low-income, urban district in New Jersey were analyzed using the Linguistic Inquiry and Word…

  5. Mango (Mangifera indica L.) cv. Kent fruit mesocarp de novo transcriptome assembly identifies gene families important for ripening

    Science.gov (United States)

    Fruit ripening is a physiological and biochemical process genetically programmed to regulate fruit quality parameters like firmness, flavor, odor and color, as well as production of ethylene in climacteric fruit. In this study, a transcriptomic analysis of mango (Mangifera indica L.) mesocarp cv. "K...

  6. Investing in What It Takes to Move from Good to Great: Exemplary Educators Identify Their Most Important Learning Experiences

    Science.gov (United States)

    Jacques, Catherine; Behrstock-Sherratt, Ellen; Parker, Amber; Bassett, Katherine; Allen, Megan; Bosso, David; Olson, Derek

    2017-01-01

    For the last 4 years, 10 leading education organizations have collaborated on a study series that includes teacher voice in conversations and research about educator effectiveness. Initially conceptualized by teacher leaders from the National Network of State Teachers of the Year (NNSTOY) and with their continued input, the "From Good to…

  7. A dissipation based method for identifying hererogeneous material properties using full-field measurements [Une approche en dissipation pour l'identification de proprié tés matériaux hétérogènes à partir de mesures de champs

    KAUST Repository

    Lubineau, Gilles; Florentin, É ric; Moussawi, Ali; Blaysat, Benoî t

    2012-01-01

    The full field measurement technique has become a popular technique for the quick identification of complex and/or heterogeneous-in-space material behaviors. Based on the rich available corpus of information, this technique makes possible to identify complex evolution laws using few highly heterogeneous testing. Multiple techniques have been proposed up to now. Here, we detail the application of the constitutive error relation to the identification of linear elastic material models.Then, the natural extension of the constitutive equation gap method through a dissipation gap method is discussed for the identification of material behaviors involving dissipation. 2D reference examples are provided for each method. © 2012 EDP Sciences.

  8. Level of importance attached to competitive intelligence at a mass import retail organization

    Directory of Open Access Journals (Sweden)

    M. Begg

    2007-12-01

    Full Text Available The purpose of this research was to establish the level of importance attached to competitive intelligence (CI at a mass import retail organization in South Africa. The rationale of CI is to alert an organization about the current situation as it relates to its business environment and competitors, and how these aspects affect the competitive situation. In this article, the value and significance that CI presents to organizations upon implementation are discussed by focusing upon the need for a competitive strategy, the significance of institutionalizing CI, various organizational structure options and the establishment of a CI culture. A survey was conducted at a mass import retail organization to determine the level of importance attached to CI. A total of 107 employees were randomly selected to participate in the completion of a questionnaire. Based on the results, it was found that this organization practised CI, albeit in an informal manner, and it was concluded that there was a relatively high level of importance attached to CI within this organization. However, areas for improvement were identified and a recommendation was made of implementing a formal CI function within the organization.

  9. Level of importance attached to competitive intelligence at a mass import retail organization

    Directory of Open Access Journals (Sweden)

    M. Begg

    2008-01-01

    Full Text Available The purpose of this research was to establish the level of importance attached to competitive intelligence (CI at a mass import retail organization in South Africa. The rationale of CI is to alert an organization about the current situation as it relates to its business environment and competitors, and how these aspects affect the competitive situation. In this article, the value and significance that CI presents to organizations upon implementation are discussed by focusing upon the need for a competitive strategy, the significance of institutionalizing CI, various organizational structure options and the establishment of a CI culture. A survey was conducted at a mass import retail organization to determine the level of importance attached to CI. A total of 107 employees were randomly selected to participate in the completion of a questionnaire. Based on the results, it was found that this organization practised CI, albeit in an informal manner, and it was concluded that there was a relatively high level of importance attached to CI within this organization. However, areas for improvement were identified and a recommendation was made of implementing a formal CI function within the organization.

  10. Thermophysical Properties Program

    Science.gov (United States)

    1997-01-01

    This is a computer generated model of a ground based casting. The objective of the therophysical properties program is to measure thermal physical properties of commercial casting alloys for use in computer programs that predict soldification behavior. This could reduce trial and error in casting design and promote less scrap, sounder castings, and less weight. In order for the computer models to reliably simulate the details of industrial alloy solidification, the input thermophysical property data must be absolutely reliable. Recently Auburn University and TPRL Inc. formed a teaming relationship to establish reliable measurement techniques for the most critical properties of commercially important alloys: transformation temperatures, thermal conductivity, electrical conductivity, specific heat, latent heat, density, solid fraction evolution, surface tension, and viscosity. A new initiative with the American Foundrymens Society has been started to measure the thermophysical properties of commercial ferrous and non-ferrous casting alloys and make the thermophysical property data widely available. Development of casting processes for the new gamma titanium aluminide alloys as well as existing titanium alloys will remain a trial-and-error procedure until accurate thermophysical properties can be obtained. These molten alloys react with their containers on earth and change their composition - invalidating the measurements even while the data are being acquired in terrestrial laboratories. However, measurements on the molten alloys can be accomplished in space using freely floating droplets which are completely untouched by any container. These data are expected to be exceptionally precise because of the absence of impurity contamination and buoyancy convection effects. Although long duration orbital experiments will be required for the large scale industrial alloy measurement program that results from this research, short duration experiments on NASA's KC-135 low

  11. MOLECULAR CHARACTERIAZATION OF CHINESE IMPORTED FISH (ICEFISH

    Directory of Open Access Journals (Sweden)

    A. Armani

    2011-01-01

    Full Text Available Neosalanx spp and Protosalanx spp are two genuses belonging to the fish family of Salangidae that are caught in China and commercialised abroad with the name of Ice fish or silver fish. Because of their morphological resemblance to some valuable fish products sold on our national market (know as Bianchetto and Rossetto, the Icefish is sometimes involved in commercial frauds. The number of species of the aforesaid genuses are several and sometimes difficult to identify. However, the deep exploitation of the Salangids in China brought to a sharp prevalence of the specie Neosalanx taihuensis on the others, which should be the main if not the only specie imported in Italy. In this work, we analysed the DNA sequences of the cytochrome b of a number of Icefish samples collected both in Italy and in China, to evaluate the species which are actually imported, in order to develop, in the future, a single step molecular analysis for the identification of substitution frauds."

  12. Survey of Forensically Important Calliphoridae in Samsun

    Directory of Open Access Journals (Sweden)

    Meltem Kökdener

    2016-08-01

    Full Text Available Objective: This study was conducted from June 2009 to 2010 in north of Turkey, province Samsun. The objective was to determine forensically important Calliphoridae (Diptera species and their seasonal distribution on dog carrcass during one year, this studies were carried out in a three different area of Samsun. Material and Methods: Three dogs carcass (Canis lupus familiaris L., weighing approximately 15-20 kg each, were used as models for studying decomposition and insect succession in each experiments. Ambient daily temperature (maximum and minimum, relative humidity (RH were recorded and existing keys were used for identification of different species. Results: Lucillia sericata (Meigen, Chrysomya albiceps (Wiedemann, Calliphora vomitoria (Linnaeus and Calliphora vicina (Robineau-Desvoidy species were encountered. It was shown that the seasonal distribution of the collected species was different from each other. Chrysomya albiceps was observed in summer, auntumn and spring. In the spring and winter, the dominant fly species were Calliphora vicina. The rate of carcass's decomposition was faster in summer and autumn as compared to spring and winter. Results indicated that ambient temperature is the chief factor determining the seasonal variations in decay rate. Conclusion: This report also identified some of the Calliphoridae that occur in north of Turkey. The importance of regional faunistic studies of the calliphoridous community, the results of which may be applied to forensic practice in the future. Keywords: Forensic entomology, insect succession, corpse, postmortem interval, decomposition.

  13. Identifying the influence of the intrinsic defects in Gd-doped ZnO thin-films

    KAUST Repository

    Flemban, Tahani H.; Sequeira, M. C.; Zhang, Z.; Venkatesh, S.; Alves, E.; Lorenz, K.; Roqan, Iman S.

    2016-01-01

    Gd-doped ZnO thin films were prepared using pulsed laser deposition at different oxygen pressures and varied Gd concentrations. The effects of oxygen deficiency-related defects on the Gd incorporation, optical and structural properties, were explored by studying the impact of oxygen pressure during deposition and post-growth thermal annealing in vacuum. Rutherford Backscattering Spectrometry revealed that the Gd concentration increases with increasing oxygen pressure for samples grown with the same Gd-doped ZnO target. Unexpectedly, the c-lattice parameter of the samples tends to decrease with increasing Gd concentration, suggesting that Gd-defect complexes play an important role in the structural properties. Using low-temperature photoluminescence(PL), Raman measurements and density functional theory calculations, we identified oxygen vacancies as the dominant intrinsic point defects. PL spectra show a defect band related to oxygen vacancies for samples grown at oxygen deficiency.

  14. Identifying the influence of the intrinsic defects in Gd-doped ZnO thin-films

    KAUST Repository

    Flemban, Tahani H.

    2016-02-08

    Gd-doped ZnO thin films were prepared using pulsed laser deposition at different oxygen pressures and varied Gd concentrations. The effects of oxygen deficiency-related defects on the Gd incorporation, optical and structural properties, were explored by studying the impact of oxygen pressure during deposition and post-growth thermal annealing in vacuum. Rutherford Backscattering Spectrometry revealed that the Gd concentration increases with increasing oxygen pressure for samples grown with the same Gd-doped ZnO target. Unexpectedly, the c-lattice parameter of the samples tends to decrease with increasing Gd concentration, suggesting that Gd-defect complexes play an important role in the structural properties. Using low-temperature photoluminescence(PL), Raman measurements and density functional theory calculations, we identified oxygen vacancies as the dominant intrinsic point defects. PL spectra show a defect band related to oxygen vacancies for samples grown at oxygen deficiency.

  15. A review on phytopharmaceutical importance of asiaticoside

    Institute of Scientific and Technical Information of China (English)

    Kanika Patel; Raghav Mishra; Dinesh Kumar Patel

    2016-01-01

    ABSTRACT Herbal plant materials have huge potential in the field of medicine, nutraceuticals, perfumery, beverages, fragrances, cosmetics and dyeing industry.Centella asiatica (L.) Urban (family: Apiaceae) (C. asiatica) is a very popular medicinal herb in Sri Lanka, Madagascar, India and other parts of Asia. Gotu kola, Brahmi and Mandukparniin are the synonyms ofC. asiatica which is mainly used for improving memory power. The pharmacological importance ofC. asiatica is mainly because of triterpenes such as asiatic acid, asiaticoside, madecassoside and madecassic acid,etc.C. asiatica is mainly used for the treatment of mental fatigue, anxiety, epidermal wound, eczema, leprosy, asthma, psoriasis, ulcers and vein diseases. Asiaticoside is a pentacyclic triterpenoid saponin having anti-depression, anti-tumor, anti-inflammatory, anti-oxidant properties and further it also possesses wound healing, antiulcer and anti-hepatofibrotic activities. It improved cognitive impairment in diabetic condition because of the decreased oxidative stress. Quantification of asiaticoside inC. asiatica has been done by several methods which were mainly based on high performance liquid chromatography methods using different compositions of mobile phase sand detection systems. In these days scientists are trying to discover novel medicine from natural sources for the development of better drugs. In this review we have collected information of asiaticoside in respect to its medicinal values, pharmacological activities, extraction, isolation, and other analytical aspects. So the present review will be supportive to the scientists who are trying to develop some novel medicines from asiaticoside for the better health prospects.

  16. A review on phytopharmaceutical importance of asiaticoside

    Directory of Open Access Journals (Sweden)

    Kanika Patel

    2016-11-01

    Full Text Available Herbal plant materials have huge potential in the field of medicine, nutraceuticals, perfumery, beverages, fragrances, cosmetics and dyeing industry. Centella asiatica (L. Urban (family: Apiaceae (C. asiatica is a very popular medicinal herb in Sri Lanka, Madagascar, India and other parts of Asia. Gotu kola, Brahmi and Mandukparniin are the synonyms of C. asiatica which is mainly used for improving memory power. The pharmacological importance of C. asiatica is mainly because of triterpenes such as asiatic acid, asiaticoside, madecassoside and madecassic acid, etc. C. asiatica is mainly used for the treatment of mental fatigue, anxiety, epidermal wound, eczema, leprosy, asthma, psoriasis, ulcers and vein diseases. Asiaticoside is a pentacyclic triterpenoid saponin having anti-depression, anti-tumor, anti-inflammatory, antioxidant properties and further it also possesses wound healing, antiulcer and anti-hepatofibrotic activities. It improved cognitive impairment in diabetic condition because of the decreased oxidative stress. Quantification of asiaticoside in C. asiatica has been done by several methods which were mainly based on high performance liquid chromatography methods using different compositions of mobile phase sand detection systems. In these days scientists are trying to discover novel medicine from natural sources for the development of better drugs. In this review we have collected information of asiaticoside in respect to its medicinal values, pharmacological activities, extraction, isolation, and other analytical aspects. So the present review will be supportive to the scientists who are trying to develop some novel medicines from asiaticoside for the better health prospects.

  17. NIH Researchers Identify OCD Risk Gene

    Science.gov (United States)

    ... News From NIH NIH Researchers Identify OCD Risk Gene Past Issues / Summer 2006 Table of Contents For ... and Alcoholism (NIAAA) have identified a previously unknown gene variant that doubles an individual's risk for obsessive- ...

  18. Dissection of culture media for embryos: the most important and less important components and characteristics.

    Science.gov (United States)

    Gardner, David K

    2008-01-01

    Improvements in culture media formulations have led to an increase in the ability to maintain the mammalian embryo in culture throughout the preimplantation and pre-attachment period. Amino acids and specific macromolecules have been identified as being key medium components, whereas temporal dynamics have been recognised as important media characteristics. Furthermore, other laboratory factors that directly impact embryo development and viability have been identified. Such factors include the use of a reduced oxygen tension, an appropriate incubation system and an adequate prescreening of all contact supplies. With rigourous quality systems in place, it is possible to obtain in vivo rates of embryo development in vitro using new media formulations while maintaining high levels of embryo viability. The future of embryo culture will likely be based on novel culture chips capable of providing temporal dynamics while facilitating real-time analysis of embryo physiology.

  19. A manual to identify sources of fluvial sediment

    Science.gov (United States)

    Gellis, Allen C.; Fitzpatrick, Faith A.; Schubauer-Berigan, Joseph

    2016-01-01

    Sediment is an important pollutant of concern that can degrade and alter aquatic habitat. A sediment budget is an accounting of the sources, storage, and export of sediment over a defined spatial and temporal scale. This manual focuses on field approaches to estimate a sediment budget. We also highlight the sediment fingerprinting approach to attribute sediment to different watershed sources. Determining the sources and sinks of sediment is important in developing strategies to reduce sediment loads to water bodies impaired by sediment. Therefore, this manual can be used when developing a sediment TMDL requiring identification of sediment sources.The manual takes the user through the seven necessary steps to construct a sediment budget:Decision-making for watershed scale and time period of interestFamiliarization with the watershed by conducting a literature review, compiling background information and maps relevant to study questions, conducting a reconnaissance of the watershedDeveloping partnerships with landowners and jurisdictionsCharacterization of watershed geomorphic settingDevelopment of a sediment budget designData collectionInterpretation and construction of the sediment budgetGenerating products (maps, reports, and presentations) to communicate findings.Sediment budget construction begins with examining the question(s) being asked and whether a sediment budget is necessary to answer these question(s). If undertaking a sediment budget analysis is a viable option, the next step is to define the spatial scale of the watershed and the time scale needed to answer the question(s). Of course, we understand that monetary constraints play a big role in any decision.Early in the sediment budget development process, we suggest getting to know your watershed by conducting a reconnaissance and meeting with local stakeholders. The reconnaissance aids in understanding the geomorphic setting of the watershed and potential sources of sediment. Identifying the potential

  20. Ability of Slovakian Pupils to Identify Birds

    Science.gov (United States)

    Prokop, Pavol; Rodak, Rastislav

    2009-01-01

    A pupil's ability to identify common organisms is necessary for acquiring further knowledge of biology. We investigated how pupils were able to identify 25 bird species following their song, growth habits, or both features presented simultaneously. Just about 19% of birds were successfully identified by song, about 39% by growth habit, and 45% of…