WorldWideScience

Sample records for identify important predictors

  1. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  2. Determining Predictor Importance in Hierarchical Linear Models Using Dominance Analysis

    Science.gov (United States)

    Luo, Wen; Azen, Razia

    2013-01-01

    Dominance analysis (DA) is a method used to evaluate the relative importance of predictors that was originally proposed for linear regression models. This article proposes an extension of DA that allows researchers to determine the relative importance of predictors in hierarchical linear models (HLM). Commonly used measures of model adequacy in…

  3. Identifying predictors of work engagement: An example from a management consultancy company

    OpenAIRE

    Persson, Andreas

    2010-01-01

    Empirical evidence suggests work engagement to be of crucial importance for business critical aspects such as work performance and employee retention. When building a strategy for enhancing engagement in the workplace, identifying its predictors becomes important. Therefore, the aim of this study was to identify predictors related to work engagement. The study was conducted in a management consultancy company, through analyzing their employee survey. Results indicated satisfaction with leader...

  4. Importance of predictor variables for models of chemical function

    Data.gov (United States)

    U.S. Environmental Protection Agency — Importance of random forest predictors for all classification models of chemical function. This dataset is associated with the following publication: Isaacs , K., M....

  5. Identifying cognitive predictors of reactive and proactive aggression

    NARCIS (Netherlands)

    Brugman, S.; Lobbestael, J.; Arntz, A.R.; Cima, M.; Schumann, T.; Dambacher, F.

    2015-01-01

    The aim of this study was to identify implicit cognitive predictors of aggressive behavior. Specifically, the predictive value of an attentional bias for aggressive stimuli and automatic association of the self and aggression was examined for reactive and proactive aggressive behavior in a

  6. Identifying predictors of physics item difficulty: A linear regression approach

    Science.gov (United States)

    Mesic, Vanes; Muratovic, Hasnija

    2011-06-01

    Large-scale assessments of student achievement in physics are often approached with an intention to discriminate students based on the attained level of their physics competencies. Therefore, for purposes of test design, it is important that items display an acceptable discriminatory behavior. To that end, it is recommended to avoid extraordinary difficult and very easy items. Knowing the factors that influence physics item difficulty makes it possible to model the item difficulty even before the first pilot study is conducted. Thus, by identifying predictors of physics item difficulty, we can improve the test-design process. Furthermore, we get additional qualitative feedback regarding the basic aspects of student cognitive achievement in physics that are directly responsible for the obtained, quantitative test results. In this study, we conducted a secondary analysis of data that came from two large-scale assessments of student physics achievement at the end of compulsory education in Bosnia and Herzegovina. Foremost, we explored the concept of “physics competence” and performed a content analysis of 123 physics items that were included within the above-mentioned assessments. Thereafter, an item database was created. Items were described by variables which reflect some basic cognitive aspects of physics competence. For each of the assessments, Rasch item difficulties were calculated in separate analyses. In order to make the item difficulties from different assessments comparable, a virtual test equating procedure had to be implemented. Finally, a regression model of physics item difficulty was created. It has been shown that 61.2% of item difficulty variance can be explained by factors which reflect the automaticity, complexity, and modality of the knowledge structure that is relevant for generating the most probable correct solution, as well as by the divergence of required thinking and interference effects between intuitive and formal physics knowledge

  7. Identifying predictors of physics item difficulty: A linear regression approach

    Directory of Open Access Journals (Sweden)

    Hasnija Muratovic

    2011-06-01

    Full Text Available Large-scale assessments of student achievement in physics are often approached with an intention to discriminate students based on the attained level of their physics competencies. Therefore, for purposes of test design, it is important that items display an acceptable discriminatory behavior. To that end, it is recommended to avoid extraordinary difficult and very easy items. Knowing the factors that influence physics item difficulty makes it possible to model the item difficulty even before the first pilot study is conducted. Thus, by identifying predictors of physics item difficulty, we can improve the test-design process. Furthermore, we get additional qualitative feedback regarding the basic aspects of student cognitive achievement in physics that are directly responsible for the obtained, quantitative test results. In this study, we conducted a secondary analysis of data that came from two large-scale assessments of student physics achievement at the end of compulsory education in Bosnia and Herzegovina. Foremost, we explored the concept of “physics competence” and performed a content analysis of 123 physics items that were included within the above-mentioned assessments. Thereafter, an item database was created. Items were described by variables which reflect some basic cognitive aspects of physics competence. For each of the assessments, Rasch item difficulties were calculated in separate analyses. In order to make the item difficulties from different assessments comparable, a virtual test equating procedure had to be implemented. Finally, a regression model of physics item difficulty was created. It has been shown that 61.2% of item difficulty variance can be explained by factors which reflect the automaticity, complexity, and modality of the knowledge structure that is relevant for generating the most probable correct solution, as well as by the divergence of required thinking and interference effects between intuitive and formal

  8. Using Dominance Analysis to Determine Predictor Importance in Logistic Regression

    Science.gov (United States)

    Azen, Razia; Traxel, Nicole

    2009-01-01

    This article proposes an extension of dominance analysis that allows researchers to determine the relative importance of predictors in logistic regression models. Criteria for choosing logistic regression R[superscript 2] analogues were determined and measures were selected that can be used to perform dominance analysis in logistic regression. A…

  9. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  10. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  11. Identifying predictors, moderators, and mediators of antidepressant response in major depressive disorder: neuroimaging approaches.

    Science.gov (United States)

    Phillips, Mary L; Chase, Henry W; Sheline, Yvette I; Etkin, Amit; Almeida, Jorge R C; Deckersbach, Thilo; Trivedi, Madhukar H

    2015-02-01

    Despite significant advances in neuroscience and treatment development, no widely accepted biomarkers are available to inform diagnostics or identify preferred treatments for individuals with major depressive disorder. In this critical review, the authors examine the extent to which multimodal neuroimaging techniques can identify biomarkers reflecting key pathophysiologic processes in depression and whether such biomarkers may act as predictors, moderators, and mediators of treatment response that might facilitate development of personalized treatments based on a better understanding of these processes. The authors first highlight the most consistent findings from neuroimaging studies using different techniques in depression, including structural and functional abnormalities in two parallel neural circuits: serotonergically modulated implicit emotion regulation circuitry, centered on the amygdala and different regions in the medial prefrontal cortex; and dopaminergically modulated reward neural circuitry, centered on the ventral striatum and medial prefrontal cortex. They then describe key findings from the relatively small number of studies indicating that specific measures of regional function and, to a lesser extent, structure in these neural circuits predict treatment response in depression. Limitations of existing studies include small sample sizes, use of only one neuroimaging modality, and a focus on identifying predictors rather than moderators and mediators of differential treatment response. By addressing these limitations and, most importantly, capitalizing on the benefits of multimodal neuroimaging, future studies can yield moderators and mediators of treatment response in depression to facilitate significant improvements in shorter- and longer-term clinical and functional outcomes.

  12. Identifying Predictors, Moderators, and Mediators of Antidepressant Response in Major Depressive Disorder: Neuroimaging Approaches

    Science.gov (United States)

    Phillips, Mary L.; Chase, Henry W.; Sheline, Yvette I.; Etkin, Amit; Almeida, Jorge R.C.; Deckersbach, Thilo; Trivedi, Madhukar H.

    2015-01-01

    Objective Despite significant advances in neuroscience and treatment development, no widely accepted biomarkers are available to inform diagnostics or identify preferred treatments for individuals with major depressive disorder. Method In this critical review, the authors examine the extent to which multimodal neuroimaging techniques can identify biomarkers reflecting key pathophysiologic processes in depression and whether such biomarkers may act as predictors, moderators, and mediators of treatment response that might facilitate development of personalized treatments based on a better understanding of these processes. Results The authors first highlight the most consistent findings from neuroimaging studies using different techniques in depression, including structural and functional abnormalities in two parallel neural circuits: serotonergically modulated implicit emotion regulation circuitry, centered on the amygdala and different regions in the medial prefrontal cortex; and dopaminergically modulated reward neural circuitry, centered on the ventral striatum and medial prefrontal cortex. They then describe key findings from the relatively small number of studies indicating that specific measures of regional function and, to a lesser extent, structure in these neural circuits predict treatment response in depression. Conclusions Limitations of existing studies include small sample sizes, use of only one neuroimaging modality, and a focus on identifying predictors rather than moderators and mediators of differential treatment response. By addressing these limitations and, most importantly, capitalizing on the benefits of multimodal neuroimaging, future studies can yield moderators and mediators of treatment response in depression to facilitate significant improvements in shorter- and longer-term clinical and functional outcomes. PMID:25640931

  13. Exploratory regression analysis: a tool for selecting models and determining predictor importance.

    Science.gov (United States)

    Braun, Michael T; Oswald, Frederick L

    2011-06-01

    Linear regression analysis is one of the most important tools in a researcher's toolbox for creating and testing predictive models. Although linear regression analysis indicates how strongly a set of predictor variables, taken together, will predict a relevant criterion (i.e., the multiple R), the analysis cannot indicate which predictors are the most important. Although there is no definitive or unambiguous method for establishing predictor variable importance, there are several accepted methods. This article reviews those methods for establishing predictor importance and provides a program (in Excel) for implementing them (available for direct download at http://dl.dropbox.com/u/2480715/ERA.xlsm?dl=1) . The program investigates all 2(p) - 1 submodels and produces several indices of predictor importance. This exploratory approach to linear regression, similar to other exploratory data analysis techniques, has the potential to yield both theoretical and practical benefits.

  14. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  15. The behaviour of random forest permutation-based variable importance measures under predictor correlation.

    Science.gov (United States)

    Nicodemus, Kristin K; Malley, James D; Strobl, Carolin; Ziegler, Andreas

    2010-02-27

    Random forests (RF) have been increasingly used in applications such as genome-wide association and microarray studies where predictor correlation is frequently observed. Recent works on permutation-based variable importance measures (VIMs) used in RF have come to apparently contradictory conclusions. We present an extended simulation study to synthesize results. In the case when both predictor correlation was present and predictors were associated with the outcome (HA), the unconditional RF VIM attributed a higher share of importance to correlated predictors, while under the null hypothesis that no predictors are associated with the outcome (H0) the unconditional RF VIM was unbiased. Conditional VIMs showed a decrease in VIM values for correlated predictors versus the unconditional VIMs under HA and was unbiased under H0. Scaled VIMs were clearly biased under HA and H0. Unconditional unscaled VIMs are a computationally tractable choice for large datasets and are unbiased under the null hypothesis. Whether the observed increased VIMs for correlated predictors may be considered a "bias" - because they do not directly reflect the coefficients in the generating model - or if it is a beneficial attribute of these VIMs is dependent on the application. For example, in genetic association studies, where correlation between markers may help to localize the functionally relevant variant, the increased importance of correlated predictors may be an advantage. On the other hand, we show examples where this increased importance may result in spurious signals.

  16. Identifying rural-urban differences in the predictors of emergency ambulance service demand and misuse.

    Science.gov (United States)

    Wong, Ho Ting; Lin, Teng-Kang; Lin, Jen-Jia

    2018-06-13

    This study aims to assess rural-urban differences in the predictors of emergency ambulance service (EAS) demand and misuse in New Taipei City. Identifying the predictors of EAS demand will help the EAS service managing authority in formulating focused policies to maintain service quality. Over 160,000 electronic EAS usage records were used with a negative binomial regression model to assess rural-urban differences in the predictors of EAS demand and misuse. The factors of 1) ln-transformed population density, 2) percentage of residents who completed up to junior high school education, 3) accessibility of hospitals without an emergency room, and 4) accessibility of EAS were found to be predictors of EAS demand in rural areas, whereas only the factor of percentage of people aged above 65 was found to predict EAS demand in urban areas. For EAS misuse, only the factor of percentage of low-income households was found to be a predictor in rural areas, whereas no predictor was found in the urban areas. Results showed that the factors predicting EAS demand and misuse in rural areas were more complicated compared to urban areas and, therefore, formulating EAS policies for rural areas based on the results of urban studies may not be appropriate. Copyright © 2018. Published by Elsevier B.V.

  17. Using Proactivity, Time Discounting, and the Theory of Planned Behavior to Identify Predictors of Retirement Planning

    Science.gov (United States)

    Griffin, Barbara; Loe, David; Hesketh, Beryl

    2012-01-01

    This study developed and tested a model to identify the predictors of retirement planning based on an extension of the theory of planned behavior ([TPB], Ajzen, 1991) that included individual differences in proactivity and time discounting. The results showed that personal attitudes, sense of control, social influence, and stable traits have a…

  18. Identifying important nodes by adaptive LeaderRank

    Science.gov (United States)

    Xu, Shuang; Wang, Pei

    2017-03-01

    Spreading process is a common phenomenon in complex networks. Identifying important nodes in complex networks is of great significance in real-world applications. Based on the spreading process on networks, a lot of measures have been proposed to evaluate the importance of nodes. However, most of the existing measures are appropriate to static networks, which are fragile to topological perturbations. Many real-world complex networks are dynamic rather than static, meaning that the nodes and edges of such networks may change with time, which challenge numerous existing centrality measures. Based on a new weighted mechanism and the newly proposed H-index and LeaderRank (LR), this paper introduces a variant of the LR measure, called adaptive LeaderRank (ALR), which is a new member of the LR-family. Simulations on six real-world networks reveal that the new measure can well balance between prediction accuracy and robustness. More interestingly, the new measure can better adapt to the adjustment or local perturbations of network topologies, as compared with the existing measures. By discussing the detailed properties of the measures from the LR-family, we illustrate that the ALR has its competitive advantages over the other measures. The proposed algorithm enriches the measures to understand complex networks, and may have potential applications in social networks and biological systems.

  19. Identifying important motivational factors for professionals in Greek hospitals

    Science.gov (United States)

    Kontodimopoulos, Nick; Paleologou, Victoria; Niakas, Dimitris

    2009-01-01

    Background The purpose of this study was to identify important motivational factors according to the views of health-care professionals in Greek hospitals and particularly to determine if these might differ in the public and private sectors. Methods A previously developed -and validated- instrument addressing four work-related motivators (job attributes, remuneration, co-workers and achievements) was used. Three categories of health care professionals, doctors (N = 354), nurses (N = 581) and office workers (N = 418), working in public and private hospitals, participated and motivation was compared across socio-demographic and occupational variables. Results The range of reported motivational factors was mixed and Maslow's conclusions that lower level motivational factors must be met before ascending to the next level were not confirmed. The highest ranked motivator for the entire sample, and by professional subgroup, was achievements (P motivators were similar, and only one significant difference was observed, namely between doctors and nurses in respect to co-workers (P motivated by all factors significantly more than their public-hospital counterparts. Conclusion The results are in agreement with the literature which focuses attention to management approaches employing both monetary and non-monetary incentives to motivate health care workers. This study showed that intrinsic factors are particularly important and should become a target for effective employee motivation. PMID:19754968

  20. The importance of epidemiological predictors for healthcare costs for chronic patients

    DEFF Research Database (Denmark)

    Hansen, Louise

    SUMMARY Healthcare systems around the world continue to see their expenditures increase, measured as a percentage of gross domestic product. Within health economics, the need for models that can predict healthcare costs is of substantial importance, as decisions to introduce as well as to decommi......SUMMARY Healthcare systems around the world continue to see their expenditures increase, measured as a percentage of gross domestic product. Within health economics, the need for models that can predict healthcare costs is of substantial importance, as decisions to introduce as well...... to consider, and lastly choosing the most appropriate statistical model. This framework was developed as a result of five quantitative studies, of which four were based on patient specific data from registers, and one on cost of illness theory. The framework was applied for predicting the cost for all...... which these patients are treated, as different resources were affected differently by the clinical and behavioural predictors included. In conclusion, the results from this dissertation highlight the importance being familiar with the population of interest, identifying the relevant resources, including...

  1. Sexual violence, HSV-2 and HIV are important predictors for infertility in Rwanda

    NARCIS (Netherlands)

    Dhont, N.; van de Wijgert, J.; Luchters, S.; Muvunyi, C.; Vyankandondera, J.; Temmerman, M.

    2010-01-01

    In order to formulate cost-effective health interventions aimed at preventing infertility it is necessary to identify modifiable risk factors for infertility in sub-Saharan Africa. This case-control study examined potential predictors and their population attributable fraction (PAF%) for various

  2. A systematic review of studies identifying predictors of poor return to work outcomes following workplace injury.

    Science.gov (United States)

    Street, Tamara D; Lacey, Sarah J

    2015-06-05

    Injuries occurring in the workplace can have serious implications for the health of the individual, the productivity of the employer and the overall economic community. The objective of this paper is to increase the current state of understanding of individual demographic and psychosocial characteristics associated with extended absenteeism from the workforce due to a workplace injury. Studies included in this systematic literature review tracked participants' return to work status over a minimum of three months, identified either demographic, psychosocial or general injury predictors of poor return to work outcomes and included a heterogeneous sample of workplace injuries. Identified predictors of poor return to work outcomes included older age, female gender, divorced marital status, two or more dependent family members, lower education levels, employment variables associated with reduced labour market desirability, severity or sensitive injury locations, negative attitudes and outcome perceptions of the participant. There is a need for clear and consistent definition and measurement of return to work outcomes and a holistic theoretical model integrating injury, psychosocial and demographic predictors of return to work. Through greater understanding of the nature of factors affecting return to work, improved outcomes could be achieved.

  3. Identifying important parameters for a continuous bioscouring process

    NARCIS (Netherlands)

    Lenting, H.B.M.; Lenting, H.B.M.; Zwier, E.; Nierstrasz, Vincent

    2002-01-01

    Compared to a bioscouring process in the batch mode, a continuously operating process requires relatively short processing steps. This study focusses on minimizing the required enzymatic incubation time. It is clear that the presence of a sufficient level of surfactant is of major importance in

  4. A landscape ecology approach identifies important drivers of urban biodiversity.

    Science.gov (United States)

    Turrini, Tabea; Knop, Eva

    2015-04-01

    Cities are growing rapidly worldwide, yet a mechanistic understanding of the impact of urbanization on biodiversity is lacking. We assessed the impact of urbanization on arthropod diversity (species richness and evenness) and abundance in a study of six cities and nearby intensively managed agricultural areas. Within the urban ecosystem, we disentangled the relative importance of two key landscape factors affecting biodiversity, namely the amount of vegetated area and patch isolation. To do so, we a priori selected sites that independently varied in the amount of vegetated area in the surrounding landscape at the 500-m scale and patch isolation at the 100-m scale, and we hold local patch characteristics constant. As indicator groups, we used bugs, beetles, leafhoppers, and spiders. Compared to intensively managed agricultural ecosystems, urban ecosystems supported a higher abundance of most indicator groups, a higher number of bug species, and a lower evenness of bug and beetle species. Within cities, a high amount of vegetated area increased species richness and abundance of most arthropod groups, whereas evenness showed no clear pattern. Patch isolation played only a limited role in urban ecosystems, which contrasts findings from agro-ecological studies. Our results show that urban areas can harbor a similar arthropod diversity and abundance compared to intensively managed agricultural ecosystems. Further, negative consequences of urbanization on arthropod diversity can be mitigated by providing sufficient vegetated space in the urban area, while patch connectivity is less important in an urban context. This highlights the need for applying a landscape ecological approach to understand the mechanisms shaping urban biodiversity and underlines the potential of appropriate urban planning for mitigating biodiversity loss. © 2015 John Wiley & Sons Ltd.

  5. Improving the precision of lake ecosystem metabolism estimates by identifying predictors of model uncertainty

    Science.gov (United States)

    Rose, Kevin C.; Winslow, Luke A.; Read, Jordan S.; Read, Emily K.; Solomon, Christopher T.; Adrian, Rita; Hanson, Paul C.

    2014-01-01

    Diel changes in dissolved oxygen are often used to estimate gross primary production (GPP) and ecosystem respiration (ER) in aquatic ecosystems. Despite the widespread use of this approach to understand ecosystem metabolism, we are only beginning to understand the degree and underlying causes of uncertainty for metabolism model parameter estimates. Here, we present a novel approach to improve the precision and accuracy of ecosystem metabolism estimates by identifying physical metrics that indicate when metabolism estimates are highly uncertain. Using datasets from seventeen instrumented GLEON (Global Lake Ecological Observatory Network) lakes, we discovered that many physical characteristics correlated with uncertainty, including PAR (photosynthetically active radiation, 400-700 nm), daily variance in Schmidt stability, and wind speed. Low PAR was a consistent predictor of high variance in GPP model parameters, but also corresponded with low ER model parameter variance. We identified a threshold (30% of clear sky PAR) below which GPP parameter variance increased rapidly and was significantly greater in nearly all lakes compared with variance on days with PAR levels above this threshold. The relationship between daily variance in Schmidt stability and GPP model parameter variance depended on trophic status, whereas daily variance in Schmidt stability was consistently positively related to ER model parameter variance. Wind speeds in the range of ~0.8-3 m s–1 were consistent predictors of high variance for both GPP and ER model parameters, with greater uncertainty in eutrophic lakes. Our findings can be used to reduce ecosystem metabolism model parameter uncertainty and identify potential sources of that uncertainty.

  6. A multicomponent approach to identify predictors of hospital outcomes in older in-patients: a multicentre, observational study.

    Directory of Open Access Journals (Sweden)

    Stefanie L De Buyser

    Full Text Available BACKGROUND: The identification of older patients at risk of poor hospital outcomes (e.g. longer hospital stay, in-hospital mortality, and institutionalisation is important to provide an effective healthcare service. OBJECTIVE: To identify factors related to older patients' clinical, nutritional, functional and socio-demographic profiles at admission to an acute care ward that can predict poor hospital outcomes. DESIGN AND SETTING: The CRiteria to assess appropriate Medication use among Elderly complex patients project was a multicentre, observational study performed in geriatric and internal medicine acute care wards of seven Italian hospitals. SUBJECTS: One thousand one hundred twenty-three consecutively admitted patients aged 65 years or older. METHODS: Hospital outcomes were length of stay, in-hospital mortality, and institutionalisation. RESULTS: Mean age of participants was 81 years, 56% were women. Median length of stay was 10 (7-14 days, 41 patients died during hospital stay and 37 were newly institutionalised. Number of drugs before admission, metastasized cancer, renal failure or dialysis, infection, falls at home during the last year, pain, and walking speed were independent predictors of LoS. Total dependency in activities of daily living and inability to perform grip strength test were independent predictors of in-hospital mortality. Malnutrition and total dependency in activities of daily living were independent predictors of institutionalisation. CONCLUSIONS: Our results confirm that not only diseases, but also multifaceted aspects of ageing such as physical function and malnutrition are strong predictors of hospital outcomes and suggest that these variables should be systematically recorded.

  7. Predictors of perceived importance and acceptance of digital delivery modes in higher education

    Directory of Open Access Journals (Sweden)

    Anne Mertens

    2014-04-01

    Full Text Available Teaching and assessment in higher education institutions are increasingly supported by digital tools and services. Students, however, perceive and value the importance of such e-learning offerings in very diverse ways. The goal of this article is to examine which predictors significantly influence students’ perceptions of the value of digital learning formats. Based on Küpper's acceptance model, we generate hypotheses that are subsequently tested using data from a German student survey. The results show that individual-related characteristics, especially motivation and orientation patterns of students, have a high impact on the perceived importance of digital learning formats. Our analyses indicate that besides individual performance and motivation, the practical orientation of a student is also a key predictor for a high rating of the importance of digital learning formats. An analysis of characteristics regarding the field of study shows that students who major in economic sciences, especially those who frequently work with digital learning formats in their classes, find them significantly more important than students who major in social science. Regarding innovation-based characteristics, students who express a need for flexible course offerings rate the use of digital learning formats as particularly important. The discussion provides an evaluation of the results of the student study based on the hypotheses and presents further implications.

  8. Burnout and Engagement: Relative Importance of Predictors and Outcomes in Two Health Care Worker Samples.

    Science.gov (United States)

    Fragoso, Zachary L; Holcombe, Kyla J; McCluney, Courtney L; Fisher, Gwenith G; McGonagle, Alyssa K; Friebe, Susan J

    2016-06-09

    This study's purpose was twofold: first, to examine the relative importance of job demands and resources as predictors of burnout and engagement, and second, the relative importance of engagement and burnout related to health, depressive symptoms, work ability, organizational commitment, and turnover intentions in two samples of health care workers. Nurse leaders (n = 162) and licensed emergency medical technicians (EMTs; n = 102) completed surveys. In both samples, job demands predicted burnout more strongly than job resources, and job resources predicted engagement more strongly than job demands. Engagement held more weight than burnout for predicting commitment, and burnout held more weight for predicting health outcomes, depressive symptoms, and work ability. Results have implications for the design, evaluation, and effectiveness of workplace interventions to reduce burnout and improve engagement among health care workers. Actionable recommendations for increasing engagement and decreasing burnout in health care organizations are provided. © 2016 The Author(s).

  9. Predictors of English Health Literacy among U.S. Hispanic Immigrants: The importance of language, bilingualism and sociolinguistic environment

    Directory of Open Access Journals (Sweden)

    Holly E. Jacobson

    2016-03-01

    Full Text Available In the United States, data confirm that Spanish-speaking immigrants are particularly affected by the negative health outcomes associated with low health literacy. Although the literature points to variables such as age, educational background and language, only a few studies have investigated the factors that may influence health literacy in this group. Similarly, the role that bilingualism and/or multilingualism play in health literacy assessment continues to be an issue in need of further research. The purpose of this study was to examine the predictors of English health literacy among adult Hispanic immigrants whose self-reported primary language is Spanish, but who live and function in a bilingual community. It also explored issues related to the language of the instrument. An analysis of data collected through a randomized controlled study was conducted. Results identified English proficiency as the strongest predictor of health literacy (p < 0.001. The results further point to the importance of primary and secondary language in the assessment of heath literacy level. This study raises many questions in need of further investigation to clarify how language proficiency and sociolinguistic environment affect health literacy in language minority adults; proposes language approaches that may be more appropriate for measuring health literacy in these populations; and recommends further place-based research to determine whether the connection between language proficiency and health is generalizable to border communities.

  10. Predictors, Prognosis, and Management of New Clinically Important Atrial Fibrillation After Noncardiac Surgery: A Prospective Cohort Study.

    Science.gov (United States)

    Alonso-Coello, Pablo; Cook, Deborah; Xu, Shou Chun; Sigamani, Alben; Berwanger, Otavio; Sivakumaran, Soori; Yang, Homer; Xavier, Denis; Martinez, Luz Ximena; Ibarra, Pedro; Rao-Melacini, Purnima; Pogue, Janice; Zarnke, Kelly; Paniagua, Pilar; Ostrander, Jack; Yusuf, Salim; Devereaux, P J

    2017-07-01

    Despite the frequency of new clinically important atrial fibrillation (AF) after noncardiac surgery and its increased association with the risk of stroke at 30 days, there are limited data informing their prediction, association with outcomes, and management. We used the data from the PeriOperative ISchemic Evaluation trial to determine, in patients undergoing noncardiac surgery, the association of new clinically important AF with 30-day outcomes, and to assess management of these patients. We also aimed to derive a clinical prediction rule for new clinically important AF in this population. We defined new clinically important AF as new AF that resulted in symptoms or required treatment. We recorded an electrocardiogram 6 to 12 hours postoperatively and on the 1st, 2nd, and 30th days after surgery. A total of 211 (2.5% [8351 patients]; 95% confidence interval, 2.2%-2.9%) patients developed new clinically important AF within 30 days of randomization (8140 did not develop new AF). AF was independently associated with an increased length of hospital stay by 6.0 days (95% confidence interval, 3.5-8.5 days) and vascular complications (eg, stroke or congestive heart failure). The usage of an oral anticoagulant at the time of hospital discharge among patients with new AF and a CHADS2 score of 0, 1, 2, 3, and ≥4 was 6.9%, 10.2%, 23.0%, 9.4%, and 33.3%, respectively. Two independent predictors of patients developing new clinically important AF were identified (ie, age and surgery). The prediction rule included the following factors and assigned weights: age ≥85 years (4 points), age 75 to 84 years (3 points), age 65 to 74 years (2 points), intrathoracic surgery (3 points), major vascular surgery (2 points), and intra-abdominal surgery (1 point). The incidence of new AF based on scores of 0 to 1, 2, 3 to 4, and 5 to 6 was 0.5%, 1.0%, 3.1%, and 5.3%, respectively. Age and surgery are independent predictors of new clinically important AF in the perioperative setting. A

  11. Explaining Variance and Identifying Predictors of Children's Communication via a Multilevel Model of Single-Case Design Research: Brief Report

    Science.gov (United States)

    Ottley, Jennifer Riggie; Ferron, John M.; Hanline, Mary Frances

    2016-01-01

    The purpose of this study was to explain the variability in data collected from a single-case design study and to identify predictors of communicative outcomes for children with developmental delays or disabilities (n = 4). Using SAS® University Edition, we fit multilevel models with time nested within children. Children's level of baseline…

  12. Internet and Democracy: Is the Internet an Important Predictor for Physical Education Teacher Candidates' Attitudes towards Democracy?

    Science.gov (United States)

    Ünlü, Hüseyin

    2017-01-01

    Today, in the digital age, the Internet usage is common among university students. The Internet is also an important platform for actively participating in democracy. This study explores physical education (PE) candidate teachers' attitudes toward the Internet and democracy. It also explores whether the Internet is an important predictor for…

  13. Work-home interface stress: an important predictor of emotional exhaustion 15 years into a medical career

    Science.gov (United States)

    HERTZBERG, Tuva Kolstad; RØ, Karin Isaksson; VAGLUM, Per Jørgen Wiggen; MOUM, Torbjørn; RØVIK, Jan Ole; GUDE, Tore; EKEBERG, Øivind; TYSSEN, Reidar

    2015-01-01

    The importance of work-home interface stress can vary throughout a medical career and between genders. We studied changes in work-home interface stress over 5 yr, and their prediction of emotional exhaustion (main dimension of burn-out), controlled for other variables. A nationwide doctor cohort (NORDOC; n=293) completed questionnaires at 10 and 15 yr after graduation. Changes over the period were examined and predictors of emotional exhaustion analyzed using linear regression. Levels of work-home interface stress declined, whereas emotional exhaustion stayed on the same level. Lack of reduction in work-home interface stress was an independent predictor of emotional exhaustion in year 15 (β=−0.21, p=0.001). Additional independent predictors were reduction in support from colleagues (β=0.11, p=0.04) and emotional exhaustion at baseline (β=0.62, pseparate analyses, significant adjusted predictors were lack of reduction in work-home interface stress among women, and reduction of collegial support and lack of reduction in working hours among men. Thus, change in work-home interface stress is a key independent predictor of emotional exhaustion among doctors 15 yr after graduation. Some gender differences in predictors of emotional exhaustion were found. PMID:26538002

  14. Neonatal white matter abnormalities an important predictor of neurocognitive outcome for very preterm children.

    Directory of Open Access Journals (Sweden)

    Lianne J Woodward

    Full Text Available BACKGROUND: Cerebral white matter abnormalities on term MRI are a strong predictor of motor disability in children born very preterm. However, their contribution to cognitive impairment is less certain. OBJECTIVE: Examine relationships between the presence and severity of cerebral white matter abnormalities on neonatal MRI and a range of neurocognitive outcomes assessed at ages 4 and 6 years. DESIGN/METHODS: The study sample consisted of a regionally representative cohort of 104 very preterm (≤32 weeks gestation infants born from 1998-2000 and a comparison group of 107 full-term infants. At term equivalent, all preterm infants underwent a structural MRI scan that was analyzed qualitatively for the presence and severity of cerebral white matter abnormalities, including cysts, signal abnormalities, loss of white matter volume, ventriculomegaly, and corpus callosal thinning/myelination. At corrected ages 4 and 6 years, all children underwent a comprehensive neurodevelopmental assessment that included measures of general intellectual ability, language development, and executive functioning. RESULTS: At 4 and 6 years, very preterm children without cerebral white matter abnormalities showed no apparent neurocognitive impairments relative to their full-term peers on any of the domain specific measures of intelligence, language, and executive functioning. In contrast, children born very preterm with mild and moderate-to-severe white matter abnormalities were characterized by performance impairments across all measures and time points, with more severe cerebral abnormalities being associated with increased risks of cognitive impairment. These associations persisted after adjustment for gender, neonatal medical risk factors, and family social risk. CONCLUSIONS: Findings highlight the importance of cerebral white matter connectivity for later intact cognitive functioning amongst children born very preterm. Preterm born children without cerebral white

  15. One-leg balance is an important predictor of injurious falls in older persons.

    Science.gov (United States)

    Vellas, B J; Wayne, S J; Romero, L; Baumgartner, R N; Rubenstein, L Z; Garry, P J

    1997-06-01

    To test the hypothesis that one-leg balance is a significant predictor of falls and injurious falls. Analysis of data from a longitudinal cohort study. Healthy, community-living volunteers older than age 60 enrolled in the Albuquerque Falls Study and followed for 3 years (N = 316; mean age 73 years). Falls and injurious falls detected via reports every other month. Baseline measures of demographics, history, physical examination, Iowa Self Assessment Inventory, balance and gait assessment, and one-leg balance (ability to stand unassisted for 5 seconds on one leg). At baseline, 84.5% of subjects could perform one-leg balance. (Impairment was associated with older age and gait abnormalities.) Over the 3-year follow-up, 71% experienced a fall and 22% an injurious fall. The only independent significant predictor of all falls using logistic regression was age greater than 73. However, impaired one-leg balance was the only significant independent predictor of injurious falls (relative risk: 2.13; 95% CI: 1.04, 4.34; P = .03). One-leg balance appears to be a significant and easy-to-administer predictor of injurious falls, but not of all falls. In our study, it was the strongest individual predictor. However, no single factor seems to be accurate enough to be relied on as a sole predictor of fall risk or fall injury risk because so many diverse factors are involved in falling.

  16. Using the Theory of Planned Behavior to Identify Predictors of Oral Hygiene: A Collection of Unique Behaviors.

    Science.gov (United States)

    Brein, Daniel J; Fleenor, Thomas J; Kim, Soo-Woo; Krupat, Edward

    2016-03-01

    This study aims to identify predictors of performed oral hygiene behaviors (OHBs) based on the Theory of Planned Behavior (TPB), oral health knowledge, and demographic factors. Using a questionnaire, 381 participants in three general dental offices and one hospital dental department in York, Pennsylvania, were surveyed regarding performed OHB, attitudes, subjective norms, perceived behavioral control, oral health knowledge, income, age, and sex. Three unique elements of OHB were identified for analysis: brushing, interdental cleaning, and tongue cleaning. Regression analysis revealed that attitude was the strongest predictor of brushing behavior, followed by oral health knowledge, perceived behavior control, subjective norms, and income. Perceived behavior control was the strongest predictor of interdental cleaning, followed by increased age and attitude. Female sex was the strongest predictor of tongue cleaning, followed by subjective norms, decreased age, and perceived behavior control. Respectively, these three groups of predictive variables explained 22.5% of brushing behavior, 22.7% of interdental cleaning behavior, and 9.5% of tongue cleaning behavior. The present findings highlight the utility of viewing OHB as a set of unique behaviors with unique predictive variables and provide additional support for use of TPB in predicting OHB. Periodontal practitioners should consider the strong associations of attitude and perceived behavioral control with brushing and interdental cleaning behaviors when designing interventional efforts to improve patient home care.

  17. The Outcome and Predictors of Failed Extubation in Intensive Care Patients—The  Elderly is an Important Predictor

    Directory of Open Access Journals (Sweden)

    Ai-Chin Cheng

    2011-12-01

    Conclusion: Our study indicated that patients with failed extubation experienced significantly increased admission expenditure, increased tracheostomy rate, and higher hospital mortality. Advanced age should be considered an important risk factor for failed extubation and overall mortality when planning extubation in critically ill ICU patients.

  18. Important predictors of response determined by surgical staging prior to triple modality therapy for esophageal cancer

    International Nuclear Information System (INIS)

    Suntharalingam, M.; Vines, E.; Slawson, R.; Doyle, A.; Schuetz, J.; Greenwald, B.; Sonnet, J.; Krasna, M.

    1997-01-01

    Purpose/Objective: Since 1992, the University of Maryland has routinely performed preoperative surgical staging including thoracoscopy and laparoscopy on patients undergoing concurrent chemoradiation followed by surgical resection for esophageal carcinoma. We have performed an analysis of the pathologic pretreatment data in an attempt to identify possible predictors of response and outcome. Materials: Patients underwent thoracoscopy and laparoscopy in order to determine resectability of the primary lesion and pathologic nodal status prior to therapy. To date, 32 patients have completed triple modality therapy (28 men, 4 women, median age 59). Patients received 50.4 Gy in 1.8 Gy fractions in conjunction with two cycles of 5-FU (1 gm/m2) and Cisplatin (100 mg/m2) on days 1 and 28. Radiotherapy fields were determined by the extent of disease discovered at time of surgical staging. Ivor Lewis esophagectomy was performed 4 to 6 weeks after completion of chemo/RT. The median follow up is 24.8 months (range 4-49 mo.) Sixteen patients had squamous cell ca and 16 had adenocarcinoma. Univariate and multivariate analysis was performed in order to determine the influence of age, KPS, T stage, Lymph Nodes status and histology, on the likelihood of achieving a pathologic complete response and disease free survival. Results: Twenty-eight have undergone preoperative staging (2 refused, 2 medical contraindications.) All 32 patients are valuable for response to therapy and are included in the analysis. The three year cause specific and disease free survival is 46% and 41% respectively with a median CSS of 23 months and DFS of 19 months. The overall complete response rate assessed by histologic and immunohistologic evaluation at the time of esophagectomy is 31%. The DFS at 32 months is 72% (median not reached) for these patients versus 24% for those with residual disease at the time of surgery. The most significant predictor for the likelihood of achieving a pathologic CR was the

  19. A target based approach identifies genomic predictors of breast cancer patient response to chemotherapy

    Directory of Open Access Journals (Sweden)

    Hallett Robin M

    2012-05-01

    Full Text Available Abstract Background The efficacy of chemotherapy regimens in breast cancer patients is variable and unpredictable. Whether individual patients either achieve long-term remission or suffer recurrence after therapy may be dictated by intrinsic properties of their breast tumors including genetic lesions and consequent aberrant transcriptional programs. Global gene expression profiling provides a powerful tool to identify such tumor-intrinsic transcriptional programs, whose analyses provide insight into the underlying biology of individual patient tumors. For example, multi-gene expression signatures have been identified that can predict the likelihood of disease reccurrence, and thus guide patient prognosis. Whereas such prognostic signatures are being introduced in the clinical setting, similar signatures that predict sensitivity or resistance to chemotherapy are not currently clinically available. Methods We used gene expression profiling to identify genes that were co-expressed with genes whose transcripts encode the protein targets of commonly used chemotherapeutic agents. Results Here, we present target based expression indices that predict breast tumor response to anthracycline and taxane based chemotherapy. Indeed, these signatures were independently predictive of chemotherapy response after adjusting for standard clinic-pathological variables such as age, grade, and estrogen receptor status in a cohort of 488 breast cancer patients treated with adriamycin and taxotere/taxol. Conclusions Importantly, our findings suggest the practicality of developing target based indices that predict response to therapeutics, as well as highlight the possibility of using gene signatures to guide the use of chemotherapy during treatment of breast cancer patients.

  20. FIRE: an SPSS program for variable selection in multiple linear regression analysis via the relative importance of predictors.

    Science.gov (United States)

    Lorenzo-Seva, Urbano; Ferrando, Pere J

    2011-03-01

    We provide an SPSS program that implements currently recommended techniques and recent developments for selecting variables in multiple linear regression analysis via the relative importance of predictors. The approach consists of: (1) optimally splitting the data for cross-validation, (2) selecting the final set of predictors to be retained in the equation regression, and (3) assessing the behavior of the chosen model using standard indices and procedures. The SPSS syntax, a short manual, and data files related to this article are available as supplemental materials from brm.psychonomic-journals.org/content/supplemental.

  1. Suicidal Ideation in Anxiety-Disordered Youth: Identifying Predictors of Risk

    Science.gov (United States)

    O'Neil Rodriguez, Kelly A.; Kendall, Philip C.

    2014-01-01

    Objective Evidence is mixed regarding an independent association between anxiety and suicidality. Beyond associations with demographic factors and depression, do anxiety disorders increase risk for suicidality in youth? Given that not all anxiety-disordered youth experience suicidal ideation, potential predictors of risk also require investigation. Method The present study examined (a) the independent relationship between anxiety and suicidal ideation and (b) emotion dysregulation and distress intolerance as predictors of risk for suicidal ideation in a sample of anxiety-disordered youth aged 7-17 (N = 86, M = 11.5). Youth and their parents reported on suicidality, emotion dysregulation, and distress intolerance. Distress tolerance was also measured by a computerized behavioral task. Results Results support an independent relationship between anxiety symptomatology and youth-reported suicidal ideation, controlling for depressive symptoms. Youth self-report of emotion dysregulation and distress intolerance predicted higher levels of suicidal ideation in univariate analyses. In a multivariate analysis including all significant predictors, only anxiety symptomatology uniquely predicted suicidal ideation. Conclusions Results provide recommendations for the assessment and treatment of suicidality in anxiety-disordered youth. Suggestions for future research investigating the relationship between anxiety and suicidal ideation are offered. PMID:24156368

  2. Predictors of unprotected sex among young sexually active African American, Hispanic, and White MSM: the importance of ethnicity and culture.

    Science.gov (United States)

    Warren, Jacob C; Fernández, M Isabel; Harper, Gary W; Hidalgo, Marco A; Jamil, Omar B; Torres, Rodrigo Sebastián

    2008-05-01

    Despite the recognized need for culturally tailored HIV prevention interventions for gay, bisexual, and questioning youth, few studies have examined if predictors of unprotected sex vary for youth from different ethnic groups. This study reports on a sample of 189 gay, bisexual, and questioning youth (age 15-22) from three racial/ethnic backgrounds (African American, Hispanic, and White) recruited in Chicago, IL and Miami-Dade and Broward Counties, Florida. For African American youth, being in a long-term relationship, having been kicked out of the home for having sex with men, and younger age at initiation of sexual behavior were associated with unprotected sex. For Hispanic youth, higher ethnic identification and older age at initiation of sexual behavior were associated with unprotected sex. For White youth, no predictors were associated with unprotected sex. Our findings point to the importance of understanding the varying predictors of unprotected sex and integrating them into tailored prevention interventions.

  3. Work-home interface stress: an important predictor of emotional exhaustion 15 years into a medical career.

    Science.gov (United States)

    Hertzberg, Tuva Kolstad; Rø, Karin Isaksson; Vaglum, Per Jørgen Wiggen; Moum, Torbjørn; Røvik, Jan Ole; Gude, Tore; Ekeberg, Øivind; Tyssen, Reidar

    2016-01-01

    The importance of work-home interface stress can vary throughout a medical career and between genders. We studied changes in work-home interface stress over 5 yr, and their prediction of emotional exhaustion (main dimension of burn-out), controlled for other variables. A nationwide doctor cohort (NORDOC; n=293) completed questionnaires at 10 and 15 yr after graduation. Changes over the period were examined and predictors of emotional exhaustion analyzed using linear regression. Levels of work-home interface stress declined, whereas emotional exhaustion stayed on the same level. Lack of reduction in work-home interface stress was an independent predictor of emotional exhaustion in year 15 (β=-0.21, p=0.001). Additional independent predictors were reduction in support from colleagues (β=0.11, p=0.04) and emotional exhaustion at baseline (β=0.62, pwork-home interface stress among women, and reduction of collegial support and lack of reduction in working hours among men. Thus, change in work-home interface stress is a key independent predictor of emotional exhaustion among doctors 15 yr after graduation. Some gender differences in predictors of emotional exhaustion were found.

  4. Identifying predictors of attitudes towards local onshore wind development with reference to an English case study

    International Nuclear Information System (INIS)

    Jones, Christopher R.; Eiser, J. Richard

    2009-01-01

    The threats posed by climate change are placing governments under increasing pressure to meet electricity demand from low-carbon sources. In many countries, including the UK, legislation is in place to ensure the continued expansion of renewable energy capacity. Onshore wind turbines are expected to play a key role in achieving these aims. However, despite high levels of public support for onshore wind development in principle, specific projects often experience local opposition. Traditionally this difference in general and specific attitudes has been attributed to NIMBYism (not in my back yard), but evidence is increasingly calling this assumption into question. This study used multiple regression analysis to identify what factors might predict attitudes towards mooted wind development in Sheffield, England. We report on the attitudes of two groups; one group (target) living close to four sites earmarked for development and an unaffected comparison group (comparison). We found little evidence of NIMBYism amongst members of the target group; instead, differences between general and specific attitudes appeared attributable to uncertainty regarding the proposals. The results are discussed with respect to literature highlighting the importance of early, continued and responsive community involvement in combating local opposition and facilitating the deployment of onshore wind turbines.

  5. Experimental "microcultures" in young children: identifying biographic, cognitive, and social predictors of information transmission.

    Science.gov (United States)

    Flynn, Emma; Whiten, Andrew

    2012-01-01

    In one of the first open diffusion experiments with young children, a tool-use task that afforded multiple methods to extract an enclosed reward and a child model habitually using one of these methods were introduced into different playgroups. Eighty-eight children, ranging in age from 2 years 8 months to 4 years 5 months, participated. Measures were taken of how alternative methods and success in extracting rewards spread across the different groups. Additionally, the biographic, social, cognitive, and temperamental predictors of social learning were investigated. Variations in social learning were related to age, popularity, dominance, impulsivity, and shyness, while other factors such as sex, theory of mind, verbal ability, and even imitativeness showed little association with variance in children's information acquisition. © 2012 The Authors. Child Development © 2012 Society for Research in Child Development, Inc.

  6. Methodology for identifying boundaries of systems important to safety in CANDU nuclear power plants

    International Nuclear Information System (INIS)

    Therrien, S.; Komljenovic, D.; Therrien, P.; Ruest, C.; Prevost, P.; Vaillancourt, R.

    2007-01-01

    This paper presents a methodology developed to identify the boundaries of the systems important to safety (SIS) at the Gentilly-2 Nuclear Power Plant (NPP), Hydro-Quebec. The SIS boundaries identification considers nuclear safety only. Components that are not identified as important to safety are systematically identified as related to safety. A global assessment process such as WANO/INPO AP-913 'Equipment Reliability Process' will be needed to implement adequate changes in the management rules of those components. The paper depicts results in applying the methodology to the Shutdown Systems 1 and 2 (SDS 1, 2), and to the Emergency Core Cooling System (ECCS). This validation process enabled fine tuning the methodology, performing a better estimate of the effort required to evaluate a system, and identifying components important to safety of these systems. (author)

  7. Identifying health insurance predictors and the main reported reasons for being uninsured among US immigrants by legal authorization status.

    Science.gov (United States)

    Vargas Bustamante, Arturo; Chen, Jie; Fang, Hai; Rizzo, John A; Ortega, Alexander N

    2014-01-01

    This study identifies differences in health insurance predictors and investigates the main reported reasons for lacking health insurance coverage between short-stayed (≤ 10 years) and long-stayed (>10 years) US immigrant adults to parse the possible consequences of the Affordable Care Act among immigrants by length of stay and documentation status. Foreign-born adults (18-64 years of age) from the 2009 California Health Interview Survey are the study population. Health insurance coverage predictors and the main reasons for being uninsured are compared across cohorts and by documentation status. A logistic-regression two-part multivariate model is used to adjust for confounding factors. The analyses determine that legal status is a strong health insurance predictor, particularly among long-stayed undocumented immigrants. Immigration status is the main reported reason for lacking health insurance. Although long-stayed documented immigrants are likely to benefit from the Affordable Care Act implementation, undocumented immigrants and short-stayed documented immigrants may encounter difficulties getting health insurance coverage. Copyright © 2013 John Wiley & Sons, Ltd.

  8. Predictors of students' self-esteem: The importance of body self-perception and exercise

    Directory of Open Access Journals (Sweden)

    Lazarević Ljiljana B.

    2017-01-01

    Full Text Available The goal of this study was to explore the predictive validity of physical self-efficacy, social physique anxiety, and physical activity in the self-esteem of students, as well as to investigate potential gender differences. The Rosenberg's Self-Esteem Scale (SES, Physical Self-Efficacy Scale (PSES, Social Physique Anxiety Scale (SPAS, and a short questionnaire about physical activity were administered to a sample of 232 university students. The overall results show that students are moderately physically active (on the average, 2.75 times per week, have moderately high selfesteem and physical self-efficacy and lower social physique anxiety. No gender differences were detected in self-esteem. In other variables, gender differences are significant and mostly in favour of males. The analyses showed that self-esteem correlated positively with physical self-efficacy and physical activity, and negatively with social physique anxiety. The regression analyses indicated that physical selfefficacy, social physique anxiety and female gender were significant predictors of self-esteem. Physical activity was not a significant predictor of self-esteem. Future studies should investigate the relations of body self-perceptions, physical exercise, and domain-specific self-esteem.

  9. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  10. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  11. Reducing uncertainty at minimal cost: a method to identify important input parameters and prioritize data collection

    NARCIS (Netherlands)

    Uwizeye, U.A.; Groen, E.A.; Gerber, P.J.; Schulte, Rogier P.O.; Boer, de I.J.M.

    2016-01-01

    The study aims to illustrate a method to identify important input parameters that explain most of the output variance ofenvironmental assessment models. The method is tested for the computation of life-cycle nitrogen (N) use efficiencyindicators among mixed dairy production systems in Rwanda. We

  12. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Science.gov (United States)

    Thiers, Laurie; Louzao, Maite; Ridoux, Vincent; Le Corre, Matthieu; Jaquemet, Sébastien; Weimerskirch, Henri

    2014-01-01

    In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns) and subsurface predators (e.g., dolphins, tunas). To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs), we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry) and dynamic (e.g. Chlorophyll a concentration and sea surface temperature) factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators).

  13. Combining Methods to Describe Important Marine Habitats for Top Predators: Application to Identify Biological Hotspots in Tropical Waters.

    Directory of Open Access Journals (Sweden)

    Laurie Thiers

    Full Text Available In tropical waters resources are usually scarce and patchy, and predatory species generally show specific adaptations for foraging. Tropical seabirds often forage in association with sub-surface predators that create feeding opportunities by bringing prey close to the surface, and the birds often aggregate in large multispecific flocks. Here we hypothesize that frigatebirds, a tropical seabird adapted to foraging with low energetic costs, could be a good predictor of the distribution of their associated predatory species, including other seabirds (e.g. boobies, terns and subsurface predators (e.g., dolphins, tunas. To test this hypothesis, we compared distribution patterns of marine predators in the Mozambique Channel based on a long-term dataset of both vessel- and aerial surveys, as well as tracking data of frigatebirds. By developing species distribution models (SDMs, we identified key marine areas for tropical predators in relation to contemporaneous oceanographic features to investigate multi-species spatial overlap areas and identify predator hotspots in the Mozambique Channel. SDMs reasonably matched observed patterns and both static (e.g. bathymetry and dynamic (e.g. Chlorophyll a concentration and sea surface temperature factors were important explaining predator distribution patterns. We found that the distribution of frigatebirds included the distributions of the associated species. The central part of the channel appeared to be the best habitat for the four groups of species considered in this study (frigatebirds, brown terns, boobies and sub-surface predators.

  14. An Investigation on Organizational Charlatan Behaviour and Moral Identity as Predictors of Shame: Importance for Education

    Directory of Open Access Journals (Sweden)

    Juneman Abraham

    2015-05-01

    Full Text Available Corruption is one of the biggest problems that progressively undermine the life of Indonesian. At the psychosocial level, the Indonesian people, especially the leaders and public officials, many times have been referred to as “the shameless nation”; a designation that is attributed as the cause of the flourishing of corruption. Research breakthrough is needed in the educational world in order to better understand the roots of corruption and the minimal and even the lack of the shame. This predictive correlational study made the organization charlatan behaviour and moral identity as predictors of shame proneness. This study, which was conducted on 208 civil servants and private employees in Jakarta, the capital of Indonesia (111 males, 97 females; mean of age = 32.19 years old, standard deviation of age = 10.495 years, showed that the organizational charlatan behaviour is unable to predict shame, but the moral identity can predict it. Implications of this study’s results for further advanced researches as well as practices in education are elaborated in the Discussion and Suggestions section.

  15. Importance of sexuality in colorectal cancer: predictors, changes, and response to an intimacy enhancement intervention.

    Science.gov (United States)

    Reese, Jennifer Barsky; Haythornthwaite, Jennifer A

    2016-10-01

    The primary objectives were (1) to examine the importance of sexuality within the self-view and cross-sectional correlates for 120 colorectal cancer patients and (2) to determine whether the importance of sexuality changed for 46 colorectal cancer patients and partners participating in an intimacy enhancement intervention. Two newly developed items assessed importance of sexuality within the self-view (1) currently and (2) before cancer; a calculated change score assessed perceived change. In the cross-sectional sample, associations between importance of sexuality and demographic and medical factors and sexual function status were examined. Intervention participants' importance ratings before and after participation were used to calculate effect sizes. For patients, importance of sexuality before cancer was greater (M = 65.7) than current importance (M = 56.8, p = .001). Greater current importance of sexuality was associated with partnered status, non-metastatic disease, and not being in treatment. Scoring in the sexually functional range was associated with greater current importance of sexuality for men and a smaller perceived change in importance for both men and women (p values Sexual function status also significantly predicted current importance independent of covariates. Small to medium effect sizes for intervention patients (.37) and partners (.60) were found for increases in importance of sexuality. Items showed evidence of test-retest reliability and construct validity. Coping with sexual concerns is important to those affected by colorectal cancer. Findings suggest that the importance of sexuality can decrease through colorectal cancer and associated sexual problems and can increase through participating in an intimacy-focused intervention.

  16. Identifying treatment responders and predictors of improvement after cognitive-behavioral therapy for juvenile fibromyalgia.

    Science.gov (United States)

    Sil, Soumitri; Arnold, Lesley M; Lynch-Jordan, Anne; Ting, Tracy V; Peugh, James; Cunningham, Natoshia; Powers, Scott W; Lovell, Daniel J; Hashkes, Philip J; Passo, Murray; Schikler, Kenneth N; Kashikar-Zuck, Susmita

    2014-07-01

    The primary objective of this study was to estimate a clinically significant and quantifiable change in functional disability to identify treatment responders in a clinical trial of cognitive-behavioral therapy (CBT) for youth with juvenile fibromyalgia (JFM). The second objective was to examine whether baseline functional disability (Functional Disability Inventory), pain intensity, depressive symptoms (Children's Depression Inventory), coping self-efficacy (Pain Coping Questionnaire), and parental pain history predicted treatment response in disability at 6-month follow-up. Participants were 100 adolescents (11-18 years of age) with JFM enrolled in a recently published clinical trial comparing CBT to a fibromyalgia education (FE) intervention. Patients were identified as achieving a clinically significant change in disability (i.e., were considered treatment responders) if they achieved both a reliable magnitude of change (estimated as a > or = 7.8-point reduction on the FDI) using the Reliable Change Index, and a reduction in FDI disability grade based on established clinical reference points. Using this rigorous standard, 40% of patients who received CBT (20 of 50) were identified as treatment responders, compared to 28% who received FE (14 of 50). For CBT, patients with greater initial disability and higher coping efficacy were significantly more likely to achieve a clinically significant improvement in functioning. Pain intensity, depressive symptoms, and parent pain history did not significantly predict treatment response. Estimating clinically significant change for outcome measures in behavioral trials sets a high bar but is a potentially valuable approach to improve the quality of clinical trials, to enhance interpretability of treatment effects, and to challenge researchers to develop more potent and tailored interventions. Copyright © 2014 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  17. Identifying Predictors of Taxane-Induced Peripheral Neuropathy Using Mass Spectrometry-Based Proteomics Technology.

    Directory of Open Access Journals (Sweden)

    Emily I Chen

    Full Text Available Major advances in early detection and therapy have significantly increased the survival of breast cancer patients. Unfortunately, most cancer therapies are known to carry a substantial risk of adverse long-term treatment-related effects. Little is known about patient susceptibility to severe side effects after chemotherapy. Chemotherapy-induced peripheral neuropathy (CIPN is a common side effect of taxanes. Recent advances in genome-wide genotyping and sequencing technologies have supported the discoveries of a number of pharmacogenetic markers that predict response to chemotherapy. However, effectively implementing these pharmacogenetic markers in the clinic remains a major challenge. On the other hand, recent advances in proteomic technologies incorporating mass spectrometry (MS for biomarker discovery show great promise to provide clinically relevant protein biomarkers. In this study, we evaluated the association between protein content in serum exosomes and severity of CIPN. Women with early stage breast cancer receiving adjuvant taxane chemotherapy were assessed with the FACT-Ntx score and serum was collected before and after the taxane treatment. Based on the change in FACT-Ntx score from baseline to 12 month follow-up, we separated patients into two groups: those who had no change (Group 1, N = 9 and those who had a ≥20% worsening (Group 1, N = 8. MS-based proteomics technology was used to identify proteins present in serum exosomes to determine potential biomarkers. Mann-Whitney-Wilcoxon analysis was applied and maximum FDR was controlled at 20%. From the serum exosomes derived from this cohort, we identified over 700 proteins known to be in different subcellular locations and have different functions. Statistical analysis revealed a 12-protein signature that resulted in a distinct separation between baseline serum samples of both groups (q<0.2 suggesting that the baseline samples can predict subsequent neurotoxicity. These toxicity

  18. Hippocampal volumes are important predictors for memory function in elderly women

    Directory of Open Access Journals (Sweden)

    Adolfsdottir Steinunn

    2009-08-01

    Full Text Available Abstract Background Normal aging involves a decline in cognitive function that has been shown to correlate with volumetric change in the hippocampus, and with genetic variability in the APOE-gene. In the present study we utilize 3D MR imaging, genetic analysis and assessment of verbal memory function to investigate relationships between these factors in a sample of 170 healthy volunteers (age range 46–77 years. Methods Brain morphometric analysis was performed with the automated segmentation work-flow implemented in FreeSurfer. Genetic analysis of the APOE genotype was determined with polymerase chain reaction (PCR on DNA from whole-blood. All individuals were subjected to extensive neuropsychological testing, including the California Verbal Learning Test-II (CVLT. To obtain robust and easily interpretable relationships between explanatory variables and verbal memory function we applied the recent method of conditional inference trees in addition to scatterplot matrices and simple pairwise linear least-squares regression analysis. Results APOE genotype had no significant impact on the CVLT results (scores on long delay free recall, CVLT-LD or the ICV-normalized hippocampal volumes. Hippocampal volumes were found to decrease with age and a right-larger-than-left hippocampal asymmetry was also found. These findings are in accordance with previous studies. CVLT-LD score was shown to correlate with hippocampal volume. Multivariate conditional inference analysis showed that gender and left hippocampal volume largely dominated predictive values for CVLT-LD scores in our sample. Left hippocampal volume dominated predictive values for females but not for males. APOE genotype did not alter the model significantly, and age was only partly influencing the results. Conclusion Gender and left hippocampal volumes are main predictors for verbal memory function in normal aging. APOE genotype did not affect the results in any part of our analysis.

  19. Short communication: cheminformatics analysis to identify predictors of antiviral drug penetration into the female genital tract.

    Science.gov (United States)

    Thompson, Corbin G; Sedykh, Alexander; Nicol, Melanie R; Muratov, Eugene; Fourches, Denis; Tropsha, Alexander; Kashuba, Angela D M

    2014-11-01

    The exposure of oral antiretroviral (ARV) drugs in the female genital tract (FGT) is variable and almost unpredictable. Identifying an efficient method to find compounds with high tissue penetration would streamline the development of regimens for both HIV preexposure prophylaxis and viral reservoir targeting. Here we describe the cheminformatics investigation of diverse drugs with known FGT penetration using cluster analysis and quantitative structure-activity relationships (QSAR) modeling. A literature search over the 1950-2012 period identified 58 compounds (including 21 ARVs and representing 13 drug classes) associated with their actual concentration data for cervical or vaginal tissue, or cervicovaginal fluid. Cluster analysis revealed significant trends in the penetrative ability for certain chemotypes. QSAR models to predict genital tract concentrations normalized to blood plasma concentrations were developed with two machine learning techniques utilizing drugs' molecular descriptors and pharmacokinetic parameters as inputs. The QSAR model with the highest predictive accuracy had R(2)test=0.47. High volume of distribution, high MRP1 substrate probability, and low MRP4 substrate probability were associated with FGT concentrations ≥1.5-fold plasma concentrations. However, due to the limited FGT data available, prediction performances of all models were low. Despite this limitation, we were able to support our findings by correctly predicting the penetration class of rilpivirine and dolutegravir. With more data to enrich the models, we believe these methods could potentially enhance the current approach of clinical testing.

  20. Predictors of the Perceived Importance of Food Skills of Home Economics Teachers

    Science.gov (United States)

    Fordyce-Voorham, Sandra P.

    2016-01-01

    Purpose: The purpose of this paper is to test an hypothesis that teachers' personal orientations toward food preparation, nutrition and environmental issues would be related to their perceived importance of food skills. Design/methodology/approach: Little research has been conducted on home economics teachers' views on the importance of the food…

  1. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2014-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in US Nuclear Regulatory Commission (USNRC) licensing of nuclear power plants. The new methodology makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them while it keeps the fundamental concepts of the original PIRT process. Also in this paper, we demonstrate the effectiveness of the new methodology by applying it to a task of extracting research problems for improving an inspection accuracy of ultrasonic testing or eddy current testing in the inspection of objects having cracks due to fatigue or stress corrosion cracking. (author)

  2. Study of a methodology of identifying important research problems by the PIRT process

    International Nuclear Information System (INIS)

    Aoki, Takayuki; Takagi, Toshiyuki; Urayama, Ryoichi; Komura, Ichiro; Furukawa, Takashi; Yusa, Noritaka

    2013-01-01

    In this paper, we propose a new methodology of identifying important research problems to be solved to improve the performance of some specific scientific technologies by the phenomena identification and ranking table (PIRT) process, which has been used as a methodology for demonstrating the validity of the best estimate simulation codes in USNRC licensing of nuclear power plants. It keeps the fundamental concepts of the original PIRT process but makes it possible to identify important factors affecting the performance of the technologies from the viewpoint of the figure of merit and problems associated with them, which need to be solved to improve the performance. Also in this paper, we demonstrate the effectiveness of the developed method by showing a specific example of the application to physical events or phenomena in objects having fatigue or SCC crack(s) under ultrasonic testing and eddy current testing. (author)

  3. Teachers' instructional behaviors as important predictors of academic motivation : Changes and links across the school

    NARCIS (Netherlands)

    Maulana, Ridwan; Opdenakker, Marie-Christine; Bosker, Roel

    2016-01-01

    Learning environments play an important role for students' learning and outcomes. Research indicates that many students show poor academic motivation. Teachers' behavior can function as a protective factor for sustaining students' interest and active engagement in schools. However, the knowledge

  4. Psychosocial Clusters and their Associations with Well-Being and Health: An Empirical Strategy for Identifying Psychosocial Predictors Most Relevant to Racially/Ethnically Diverse Women’s Health

    Science.gov (United States)

    Jabson, Jennifer M.; Bowen, Deborah; Weinberg, Janice; Kroenke, Candyce; Luo, Juhua; Messina, Catherine; Shumaker, Sally; Tindle, Hilary A.

    2016-01-01

    BACKGROUND Strategies for identifying the most relevant psychosocial predictors in studies of racial/ethnic minority women’s health are limited because they largely exclude cultural influences and they assume that psychosocial predictors are independent. This paper proposes and tests an empirical solution. METHODS Hierarchical cluster analysis, conducted with data from 140,652 Women’s Health Initiative participants, identified clusters among individual psychosocial predictors. Multivariable analyses tested associations between clusters and health outcomes. RESULTS A Social Cluster and a Stress Cluster were identified. The Social Cluster was positively associated with well-being and inversely associated with chronic disease index, and the Stress Cluster was inversely associated with well-being and positively associated with chronic disease index. As hypothesized, the magnitude of association between clusters and outcomes differed by race/ethnicity. CONCLUSIONS By identifying psychosocial clusters and their associations with health, we have taken an important step toward understanding how individual psychosocial predictors interrelate and how empirically formed Stress and Social clusters relate to health outcomes. This study has also demonstrated important insight about differences in associations between these psychosocial clusters and health among racial/ethnic minorities. These differences could signal the best pathways for intervention modification and tailoring. PMID:27279761

  5. Predictors of English Health Literacy among U.S. Hispanic Immigrants: The importance of language, bilingualism and sociolinguistic environment

    Science.gov (United States)

    Hund, Lauren; Soto Mas, Francisco

    2016-01-01

    In the United States, data confirm that Spanish-speaking immigrants are particularly affected by the negative health outcomes associated with low health literacy. Although the literature points to variables such as age, educational background and language, only a few studies have investigated the factors that may influence health literacy in this group. Similarly, the role that bilingualism and/or multilingualism play in health literacy assessment continues to be an issue in need of further research. The purpose of this study was to examine the predictors of English health literacy among adult Hispanic immigrants whose self-reported primary language is Spanish, but who live and function in a bilingual community. It also explored issues related to the language of the instrument. An analysis of data collected through a randomized controlled study was conducted. Results identified English proficiency as the strongest predictor of health literacy (p sociolinguistic environment affect health literacy in language minority adults; proposes language approaches that may be more appropriate for measuring health literacy in these populations; and recommends further place-based research to determine whether the connection between language proficiency and health is generalizable to border communities. PMID:27127416

  6. Predictors of English Health Literacy among U.S. Hispanic Immigrants: The importance of language, bilingualism and sociolinguistic environment.

    Science.gov (United States)

    Jacobson, Holly E; Hund, Lauren; Soto Mas, Francisco

    In the United States, data confirm that Spanish-speaking immigrants are particularly affected by the negative health outcomes associated with low health literacy. Although the literature points to variables such as age, educational background and language, only a few studies have investigated the factors that may influence health literacy in this group. Similarly, the role that bilingualism and/or multilingualism play in health literacy assessment continues to be an issue in need of further research. The purpose of this study was to examine the predictors of English health literacy among adult Hispanic immigrants whose self-reported primary language is Spanish, but who live and function in a bilingual community. It also explored issues related to the language of the instrument. An analysis of data collected through a randomized controlled study was conducted. Results identified English proficiency as the strongest predictor of health literacy (p sociolinguistic environment affect health literacy in language minority adults; proposes language approaches that may be more appropriate for measuring health literacy in these populations; and recommends further place-based research to determine whether the connection between language proficiency and health is generalizable to border communities.

  7. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes

    DEFF Research Database (Denmark)

    Xu, Xun; Liu, Xin; Ge, Song

    2012-01-01

    Rice is a staple crop that has undergone substantial phenotypic and physiological changes during domestication. Here we resequenced the genomes of 40 cultivated accessions selected from the major groups of rice and 10 accessions of their wild progenitors (Oryza rufipogon and Oryza nivara) to >15 x...... diversity in cultivated but not wild rice, which represent candidate regions selected during domestication. Some of these variants are associated with important biological features, whereas others have yet to be functionally characterized. The molecular markers we have identified should be valuable...... raw data coverage. We investigated genome-wide variation patterns in rice and obtained 6.5 million high-quality single nucleotide polymorphisms (SNPs) after excluding sites with missing data in any accession. Using these population SNP data, we identified thousands of genes with significantly lower...

  8. On the importance of identifying, characterizing, and predicting fundamental phenomena towards microbial electrochemistry applications.

    Science.gov (United States)

    Torres, César Iván

    2014-06-01

    The development of microbial electrochemistry research toward technological applications has increased significantly in the past years, leading to many process configurations. This short review focuses on the need to identify and characterize the fundamental phenomena that control the performance of microbial electrochemical cells (MXCs). Specifically, it discusses the importance of recent efforts to discover and characterize novel microorganisms for MXC applications, as well as recent developments to understand transport limitations in MXCs. As we increase our understanding of how MXCs operate, it is imperative to continue modeling efforts in order to effectively predict their performance, design efficient MXC technologies, and implement them commercially. Thus, the success of MXC technologies largely depends on the path of identifying, understanding, and predicting fundamental phenomena that determine MXC performance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Integrity of the lateral femoral wall in intertrochanteric hip fractures: an important predictor of a reoperation

    DEFF Research Database (Denmark)

    Palm, Henrik; Jacobsen, Steffen; Sonne-Holm, Stig

    2007-01-01

    BACKGROUND: Reoperations after intertrochanteric fractures are often necessitated by fracture displacement following mobilization of the patient. The biomechanical complexity of the fracture, the position of the implant, and the patient's characteristics are known to influence postoperative outcome....... We investigated the importance of an intact lateral femoral wall as a factor in postoperative fracture displacement after fixation with a sliding compression hip screw. METHODS: Two hundred and fourteen consecutive patients with an intertrochanteric fracture were treated with a 135 degrees sliding...... compression hip screw with a four-hole side-plate between 2002 and 2004. The fractures were classified on preoperative radiographs according to the AO/OTA classification system. The status of the greater and lesser trochanters, the integrity of the lateral femoral wall, and the position of the implant were...

  10. Statistical Analyses of Scatterplots to Identify Important Factors in Large-Scale Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-04-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (1) linear relationships with correlation coefficients, (2) monotonic relationships with rank correlation coefficients, (3) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (4) trends in variability as defined by variances and interquartile ranges, and (5) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (1) Type I errors are unavoidable, (2) Type II errors can occur when inappropriate analysis procedures are used, (3) physical explanations should always be sought for why statistical procedures identify variables as being important, and (4) the identification of important variables tends to be stable for independent Latin hypercube samples.

  11. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  12. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  13. Identifying Domain-General and Domain-Specific Predictors of Low Mathematics Performance: A Classification and Regression Tree Analysis

    Directory of Open Access Journals (Sweden)

    David J. Purpura

    2017-12-01

    Full Text Available Many children struggle to successfully acquire early mathematics skills. Theoretical and empirical evidence has pointed to deficits in domain-specific skills (e.g., non-symbolic mathematics skills or domain-general skills (e.g., executive functioning and language as underlying low mathematical performance. In the current study, we assessed a sample of 113 three- to five-year old preschool children on a battery of domain-specific and domain-general factors in the fall and spring of their preschool year to identify Time 1 (fall factors associated with low performance in mathematics knowledge at Time 2 (spring. We used the exploratory approach of classification and regression tree analyses, a strategy that uses step-wise partitioning to create subgroups from a larger sample using multiple predictors, to identify the factors that were the strongest classifiers of low performance for younger and older preschool children. Results indicated that the most consistent classifier of low mathematics performance at Time 2 was children’s Time 1 mathematical language skills. Further, other distinct classifiers of low performance emerged for younger and older children. These findings suggest that risk classification for low mathematics performance may differ depending on children’s age.

  14. Genome-wide screening identifies a KCNIP1 copy number variant as a genetic predictor for atrial fibrillation

    Science.gov (United States)

    Tsai, Chia-Ti; Hsieh, Chia-Shan; Chang, Sheng-Nan; Chuang, Eric Y.; Ueng, Kwo-Chang; Tsai, Chin-Feng; Lin, Tsung-Hsien; Wu, Cho-Kai; Lee, Jen-Kuang; Lin, Lian-Yu; Wang, Yi-Chih; Yu, Chih-Chieh; Lai, Ling-Ping; Tseng, Chuen-Den; Hwang, Juey-Jen; Chiang, Fu-Tien; Lin, Jiunn-Lee

    2016-01-01

    Atrial fibrillation (AF) is the most common sustained cardiac arrhythmia. Previous genome-wide association studies had identified single-nucleotide polymorphisms in several genomic regions to be associated with AF. In human genome, copy number variations (CNVs) are known to contribute to disease susceptibility. Using a genome-wide multistage approach to identify AF susceptibility CNVs, we here show a common 4,470-bp diallelic CNV in the first intron of potassium interacting channel 1 gene (KCNIP1) is strongly associated with AF in Taiwanese populations (odds ratio=2.27 for insertion allele; P=6.23 × 10−24). KCNIP1 insertion is associated with higher KCNIP1 mRNA expression. KCNIP1-encoded protein potassium interacting channel 1 (KCHIP1) is physically associated with potassium Kv channels and modulates atrial transient outward current in cardiac myocytes. Overexpression of KCNIP1 results in inducible AF in zebrafish. In conclusions, a common CNV in KCNIP1 gene is a genetic predictor of AF risk possibly pointing to a functional pathway. PMID:26831368

  15. Predictors of employment in schizophrenia: The importance of intrinsic and extrinsic motivation.

    Science.gov (United States)

    Reddy, L Felice; Llerena, Katiah; Kern, Robert S

    2016-10-01

    Unemployment is a primary functional deficit for the majority of adults with schizophrenia. Research indicates that over two-thirds of adults living in the community with schizophrenia are unemployed. Despite effective programs to assist with job identification and placement, the ability to attain and maintain employment remains a pressing concern. A contributing factor that may be relevant but has received little attention in the work rehabilitation literature is motivation. People with schizophrenia show marked deficits in both intrinsic and extrinsic motivation but these deficits have not been directly examined in relation to work outcomes. The present study sought to examine the relationship between intrinsic and extrinsic motivation and work outcome among a sample of 65 adults with schizophrenia enrolled in a supported employment program. One-third of the participants in the study obtained work. Intrinsic motivation related to valuing and feeling useful in a work role significantly predicted who would obtain employment. Extrinsic motivation related to gaining rewards and avoiding obstacles showed a non-significant trend-level relationship such that workers had higher extrinsic motivation than nonworkers. These findings highlight the importance of considering both intrinsic and extrinsic motivation in work-related interventions and supported employment for individuals with schizophrenia. The results are discussed in terms of clinical implications for improving rehabilitation and occupational outcomes in schizophrenia. Published by Elsevier B.V.

  16. Identifying psychosocial predictors of medication non-adherence following acute coronary syndrome: A systematic review and meta-analysis.

    Science.gov (United States)

    Crawshaw, Jacob; Auyeung, Vivian; Norton, Sam; Weinman, John

    2016-11-01

    Medication non-adherence following acute coronary syndrome (ACS) is associated with poor clinical outcomes. A systematic review and meta-analysis were undertaken to identify psychosocial factors associated with medication adherence in patients with ACS. A search of electronic databases (Cochrane Library, Medline, EMBASE, PsycINFO, Web of Science, International Pharmaceutical Abstracts, CINAHL, ASSIA, OpenGrey, EthOS and WorldCat) was undertaken to identify relevant articles published in English between 2000 and 2014. Articles were screened against our inclusion criteria and data on study design, sample characteristics, predictors, outcomes, analyses, key findings and study limitations were abstracted. Our search identified 3609 records, of which 17 articles met our inclusion criteria (15 independent studies). Eight out of ten studies found an association between depression and non-adherence. A meta-analysis revealed that depressed patients were twice as likely to be non-adherent compared to patients without depression (OR=2.00, 95% CI 1.57-3.33, p=0.015). Type D personality was found to predict non-adherence in both studies in which it was measured. Three out of three studies reported that treatment beliefs based on the Necessity-Concerns Framework predicted medication non-adherence and there was some evidence that social support was associated with better adherence. There was insufficient data to meta-analyse all other psychosocial factors identified. There was some evidence that psychosocial factors, particularly depression, were associated with medication adherence following ACS. Targeting depressive symptoms, screening for Type D personality, challenging maladaptive treatment beliefs, and providing better social support for patients may be useful strategies to improve medication adherence. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  17. Identify the Important Decision Factors of Online Shopping Adoption in Indonesia

    Directory of Open Access Journals (Sweden)

    Lailatul HIJRAH

    2017-12-01

    Full Text Available The objective of this study is to identify factors encouraging a consumer to engage in online shopping activities. The expected contribution of this study is for online entrepreneurs, in order to develop the most suitable business strategy, so that it will be clearly identified and sorted out which factors are the most important and the main motivation of Indonesian consumers to shop via online by using responses from respondents who usually shop online and offline in 3 cities in Indonesia, Jakarta, Surabaya and Samarinda. The research instruments were developed by conducting FGDs on relevant groups, either academics, online shopping activists, suppliers and courier businessmen in Jakarta, Surabaya and Samarinda Cities in effort to extract any information that encourages consumers to online shopping. After conducting FGD, the researcher produced 48 items proposed for factor analysis and after extracted to form eleven constructs, some items were removed because they had less loading factors. The eleven constructs or dimensions are trust, risk, consumer factors, website factors, price, service quality, convenience, subjective norm, product guarantee, variety of products and lifestyle. The implications of this study provide valuable insights about consumer decisions to online shopping or not online shopping.

  18. Systematic reviews identify important methodological flaws in stroke rehabilitation therapy primary studies: review of reviews.

    Science.gov (United States)

    Santaguida, Pasqualina; Oremus, Mark; Walker, Kathryn; Wishart, Laurie R; Siegel, Karen Lohmann; Raina, Parminder

    2012-04-01

    A "review of reviews" was undertaken to assess methodological issues in studies evaluating nondrug rehabilitation interventions in stroke patients. MEDLINE, CINAHL, PsycINFO, and the Cochrane Database of Systematic Reviews were searched from January 2000 to January 2008 within the stroke rehabilitation setting. Electronic searches were supplemented by reviews of reference lists and citations identified by experts. Eligible studies were systematic reviews; excluded citations were narrative reviews or reviews of reviews. Review characteristics and criteria for assessing methodological quality of primary studies within them were extracted. The search yielded 949 English-language citations. We included a final set of 38 systematic reviews. Cochrane reviews, which have a standardized methodology, were generally of higher methodological quality than non-Cochrane reviews. Most systematic reviews used standardized quality assessment criteria for primary studies, but not all were comprehensive. Reviews showed that primary studies had problems with randomization, allocation concealment, and blinding. Baseline comparability, adverse events, and co-intervention or contamination were not consistently assessed. Blinding of patients and providers was often not feasible and was not evaluated as a source of bias. The eligible systematic reviews identified important methodological flaws in the evaluated primary studies, suggesting the need for improvement of research methods and reporting. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Identifying Predictors of Central Sleep Apnea/Cheyne-Stokes Breathing in Chronic Heart Failure: a Pathophysiological Approach

    Directory of Open Access Journals (Sweden)

    Draganova Aneliya I.

    2016-12-01

    Full Text Available Chronic heart failure (CHF is a major health problem associated with increased mortality, despite modern treatment options. Central sleep apnea (CSA/Cheyne-Stokes breathing (CSB is a common and yet largely under-diagnosed co-morbidity, adding significantly to the poor prognosis in CHF because of a number of acute and chronic effects, including intermittent hypoxia, sympathetic overactivation, disturbed sleep architecture and impaired physical tolerance. It is characterized by repetitive periods of crescendo-decrescendo ventilatory pattern, alternating with central apneas and hypopneas. The pathogenesis of CSA/CSB is based on the concept of loop gain, comprising three major components: controller gain, plant gain and feedback gain. Laboratory polysomnography, being the golden standard for diagnosing sleep-disordered breathing (SDB at present, is a costly and highly specialized procedure unable to meet the vast diagnostic demand. Unlike obstructive sleep apnea, CSA/CSB has a low clinical profile. Therefore, a reliable predictive system is needed for identifying CHF patients who are most likely to suffer from CSA/CSB, optimizing polysomnography use. The candidate predictors should be standardized, easily accessible and low-priced in order to be applied in daily medical routine.

  20. Identifying selectively important amino acid positions associated with alternative habitat environments in fish mitochondrial genomes.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Zhang, Yong; Meng, Zi Ning; Lin, Hao Ran

    2018-05-01

    Fish species inhabitating seawater (SW) or freshwater (FW) habitats have to develop genetic adaptations to alternative environment factors, especially salinity. Functional consequences of the protein variations associated with habitat environments in fish mitochondrial genomes have not yet received much attention. We analyzed 829 complete fish mitochondrial genomes and compared the amino acid differences of 13 mitochondrial protein families between FW and SW fish groups. We identified 47 specificity determining sites (SDS) that associated with FW or SW environments from 12 mitochondrial protein families. Thirty-two (68%) of the SDS sites are hydrophobic, 13 (28%) are neutral, and the remaining sites are acidic or basic. Seven of those SDS from ND1, ND2 and ND5 were scored as probably damaging to the protein structures. Furthermore, phylogenetic tree based Bayes Empirical Bayes analysis also detected 63 positive sites associated with alternative habitat environments across ten mtDNA proteins. These signatures could be important for studying mitochondrial genetic variation relevant to fish physiology and ecology.

  1. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  2. Population pharmacokinetic analysis of oxaliplatin in adults and children identifies important covariates for dosing.

    Science.gov (United States)

    Nikanjam, Mina; Stewart, Clinton F; Takimoto, Chris H; Synold, Timothy W; Beaty, Orren; Fouladi, Maryam; Capparelli, Edmund V

    2015-03-01

    To characterize the determinants of variability for oxaliplatin pharmacokinetics including age, renal function, and hepatic function in children and adults. Oxaliplatin pharmacokinetic data were combined from phase I and II clinical trials: three pediatric trials (Peds1-3) and two adult NCI organ dysfunction studies (Hepatic and Renal). A population pharmacokinetic model was developed utilizing platinum ultrafiltrate concentrations to characterize changes in oxaliplatin disposition with age and organ dysfunction along with other potential sources of oxaliplatin pharmacokinetic variability. A total of 1,508 concentrations from 186 children and adults were used in the study. The data were well described by a three-compartment model. Serum creatinine (SCR) was an independent predictor of clearance (CL) while age was an independent predictor of volume of distribution. Although age was a significant covariate on CL in the univariate analysis, age effects on CL were entirely accounted for by SCR. Gender, hepatic function, and race had no effect on CL or volume of distribution. Median CL values were 0.58 (Hepatic), 0.34 (Renal), 0.78 (Peds1), 0.74 (Peds2), and 0.81 (Peds3) (L/h/kg(0.75)). Monte Carlo simulations of the final model with 130 mg/m(2) yielded median AUC values of: 14.2 (2-6 years), 16.8 (6-12 years), 16.5 (12-18 years), and 17.3 (>18 years) (µg h/mL). Renal function had the greatest effect on CL with a small age effect seen on the distribution of oxaliplatin. Young pediatric patients had higher CL values than adults as a result of better renal function.

  3. Hourly air pollution concentrations and their important predictors over Houston, Texas using deep neural networks: case study of DISCOVER-AQ time period

    Science.gov (United States)

    Eslami, E.; Choi, Y.; Roy, A.

    2017-12-01

    Air quality forecasting carried out by chemical transport models often show significant error. This study uses a deep-learning approach over the Houston-Galveston-Brazoria (HGB) area to overcome this forecasting challenge, for the DISCOVER-AQ period (September 2013). Two approaches, deep neural network (DNN) using a Multi-Layer Perceptron (MLP) and Restricted Boltzmann Machine (RBM) were utilized. The proposed approaches analyzed input data by identifying features abstracted from its previous layer using a stepwise method. The approaches predicted hourly ozone and PM in September 2013 using several predictors of prior three days, including wind fields, temperature, relative humidity, cloud fraction, precipitation along with PM, ozone, and NOx concentrations. Model-measurement comparisons for available monitoring sites reported Indexes of Agreement (IOA) of around 0.95 for both DNN and RBM. A standard artificial neural network (ANN) (IOA=0.90) with similar architecture showed poorer performance than the deep networks, clearly demonstrating the superiority of the deep approaches. Additionally, each network (both deep and standard) performed significantly better than a previous CMAQ study, which showed an IOA of less than 0.80. The most influential input variables were identified using their associated weights, which represented the sensitivity of ozone to input parameters. The results indicate deep learning approaches can achieve more accurate ozone forecasting and identify the important input variables for ozone predictions in metropolitan areas.

  4. Identifying Important Atlantic Areas for the conservation of Balearic shearwaters: Spatial overlap with conservation areas

    Science.gov (United States)

    Pérez-Roda, Amparo; Delord, Karine; Boué, Amélie; Arcos, José Manuel; García, David; Micol, Thierry; Weimerskirch, Henri; Pinaud, David; Louzao, Maite

    2017-07-01

    Marine protected areas (MPAs) are considered one of the main tools in both fisheries and conservation management to protect threatened species and their habitats around the globe. However, MPAs are underrepresented in marine environments compared to terrestrial environments. Within this context, we studied the Atlantic non-breeding distribution of the southern population of Balearic shearwaters (Puffinus mauretanicus) breeding in Eivissa during the 2011-2012 period based on global location sensing (GLS) devices. Our objectives were (1) to identify overall Important Atlantic Areas (IAAs) from a southern population, (2) to describe spatio-temporal patterns of oceanographic habitat use, and (3) to assess whether existing conservation areas (Natura 2000 sites and marine Important Bird Areas (IBAs)) cover the main IAAs of Balearic shearwaters. Our results highlighted that the Atlantic staging (from June to October in 2011) dynamic of the southern population was driven by individual segregation at both spatial and temporal scales. Individuals ranged in the North-East Atlantic over four main IAAs (Bay of Biscay: BoB, Western Iberian shelf: WIS, Gulf of Cadiz: GoC, West of Morocco: WoM). While most individuals spent more time on the WIS or in the GoC, a small number of birds visited IAAs at the extremes of their Atlantic distribution range (i.e., BoB and WoM). The chronology of the arrivals to the IAAs showed a latitudinal gradient with northern areas reached earlier during the Atlantic staging. The IAAs coincided with the most productive areas (higher chlorophyll a values) in the NE Atlantic between July and October. The spatial overlap between IAAs and conservation areas was higher for Natura 2000 sites than marine IBAs (areas with and without legal protection, respectively). Concerning the use of these areas, a slightly higher proportion of estimated positions fell within marine IBAs compared to designated Natura 2000 sites, with Spanish and Portuguese conservation

  5. Identifying cytokine predictors of cognitive functioning in breast cancer survivors up to 10 years post chemotherapy using machine learning.

    Science.gov (United States)

    Henneghan, Ashley M; Palesh, Oxana; Harrison, Michelle; Kesler, Shelli R

    2018-07-15

    The purpose of this study is to explore 13 cytokine predictors of chemotherapy-related cognitive impairment (CRCI) in breast cancer survivors (BCS) 6 months to 10 years after chemotherapy completion using a multivariate, non-parametric approach. Cross sectional data collection included completion of a survey, cognitive testing, and non-fasting blood from 66 participants. Data were analyzed using random forest regression to identify the most significant predictors for each of the cognitive test scores. A different cytokine profile predicted each cognitive test. Adjusted R 2 for each model ranged from 0.71-0.77 (p's < 9.50 -10 ). The relationships between all the cytokine predictors and cognitive test scores were non-linear. Our findings are unique to the field of CRCI and suggest non-linear cytokine specificity to neural networks underlying cognitive functions assessed in this study. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. iNR-PhysChem: a sequence-based predictor for identifying nuclear receptors and their subfamilies via physical-chemical property matrix.

    Directory of Open Access Journals (Sweden)

    Xuan Xiao

    Full Text Available Nuclear receptors (NRs form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1--thyroid hormone like, NR2--HNF4-like, NR3--estrogen like, NR4--nerve growth factor IB-like, NR5--fushi tarazu-F1 like, NR6--germ cell nuclear factor like, and NR0--knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has ≥60% pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either http://www.jci-bioinfo.cn/iNR-PhysChem or http://icpr.jci.edu.cn/bioinfo/iNR-PhysChem. Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may

  7. [Serum uric acid is associated with disease severity and an important predictor for clinical outcome in patients with pulmonary hypertension].

    Science.gov (United States)

    Luo, D L; Zhang, C J; Huang, Y G; Huang, T; Li, H Z

    2017-06-24

    Objective: The growing body of literature showed a link between uric acid and pulmonary hypertension (PH), but the impact of hyperuremia on outcome of patients with PH has not been well defined. Therefore, the present study was performed to analyze the impact of uric acid on outcome of PH patients. Methods: One hundred seventy-three PH patients (112 females, mean age 38 years old), who were hospitalized in our department between January 2010 and December 2015, were included in our study, the PH diagnosis was made based on right heart catheterization examination result (mean pulmonary artery pressure≥25 mmHg(1 mmHg=0.133 kPa)). PH patients were divided into mild to moderate PH group (Rp/Rs≤0.6, n =97) and severe PH group (Rp/Rs>0.6, n =76). Fifty-one patients (33 females, mean age 45 years old) without PH based on right heart catheterization were included as control subjects. All participants were followed up for a median of 24 months(6-71 months). Clinical endpoints were defined as cardiogenic death or heart-and-lung transplantation. Results: Uric acid was positively correlated with pulmonary vascular resistance( r =0.398, P uric acid level was significantly higher in patients with severe PH than in patients with mild-to-moderate PH and the control subjects (both P uric acid level to predict the outcome of PH patients (sensitivity 50%, specificity 72%). During follow-up, patients with higher level of uric acid (>425.5 μmol/L) were linked with poorer clinical outcome compared to patients with uric acid uric acid is associated with the severity of PH and higher uric acid level serves as an important predictor for poor clinical outcome of PH patients.

  8. When is enough, enough? Identifying predictors of capacity estimates for onshore wind-power development in a region of the UK

    International Nuclear Information System (INIS)

    Jones, Christopher R.; Orr, Barry J.; Eiser, J. Richard

    2011-01-01

    The level of 'wind-prospecting' presently occurring in the UK is increasing the likelihood that new wind-power developments will conflict with other existing and/or proposed schemes. This study reports multiple-regression analyses performed on survey data obtained in a region of the UK (i.e. Humberhead Levels, near Doncaster) simultaneously subject to nine wind-farm proposals (September 2008). The aim of the analysis was to identify which survey-items were predictors of respondents' estimates of the number of wind turbines they believed the region could reasonably support (i.e. capacity estimates). The results revealed that the majority of respondents would endorse some local development; however, there was substantial variability in the upper level that was considered acceptable. Prominent predictors included general attitude, perceived knowledge of wind power, community attachment, environmental values, visual attractiveness of wind turbines, and issues relating to perceived fairness and equity. The results have implications for Cumulative Effects Assessment (CEA) - and in particular the assessment of Cumulative Landscape and Visual Impacts (CLVI) - and support calls for greater community involvement in decisions regarding proposed schemes. - Highlights: → Research seeks to identify predictors of the scale of local wind development people will tolerate. → Research conducted in region of the UK subject to nine wind-farm applications (2008). → Predictors found to include issues of perceived fairness and equity. → Results hold implications for cumulative effects assessment and development practices.

  9. When is enough, enough? Identifying predictors of capacity estimates for onshore wind-power development in a region of the UK

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Christopher R., E-mail: c.r.jones@shef.ac.uk [Department of Psychology, University of Sheffield, Western Bank, Sheffield, S10 2TP (United Kingdom); Orr, Barry J.; Eiser, J. Richard [Department of Psychology, University of Sheffield, Western Bank, Sheffield, S10 2TP (United Kingdom)

    2011-08-15

    The level of 'wind-prospecting' presently occurring in the UK is increasing the likelihood that new wind-power developments will conflict with other existing and/or proposed schemes. This study reports multiple-regression analyses performed on survey data obtained in a region of the UK (i.e. Humberhead Levels, near Doncaster) simultaneously subject to nine wind-farm proposals (September 2008). The aim of the analysis was to identify which survey-items were predictors of respondents' estimates of the number of wind turbines they believed the region could reasonably support (i.e. capacity estimates). The results revealed that the majority of respondents would endorse some local development; however, there was substantial variability in the upper level that was considered acceptable. Prominent predictors included general attitude, perceived knowledge of wind power, community attachment, environmental values, visual attractiveness of wind turbines, and issues relating to perceived fairness and equity. The results have implications for Cumulative Effects Assessment (CEA) - and in particular the assessment of Cumulative Landscape and Visual Impacts (CLVI) - and support calls for greater community involvement in decisions regarding proposed schemes. - Highlights: > Research seeks to identify predictors of the scale of local wind development people will tolerate. > Research conducted in region of the UK subject to nine wind-farm applications (2008). > Predictors found to include issues of perceived fairness and equity. > Results hold implications for cumulative effects assessment and development practices.

  10. Competence Description for Personal Recommendations: The Importance of Identifying the Complexity of Learning and Performance Situations

    Science.gov (United States)

    Prins, Frans J.; Nadolski, Rob J.; Berlanga, Adriana J.; Drachsler, Hendrik; Hummel, Hans G. K.; Koper, Rob

    2008-01-01

    For competences development of learners and professionals, target competences and corresponding competence development opportunities have to be identified. Personal Recommender Systems (PRS) provide personal recommendations for learners aimed at finding and selecting learning activities that best match their needs. This article argues that a…

  11. Identifying Important Career Indicators of Undergraduate Geoscience Students Upon Completion of Their Degree

    Science.gov (United States)

    Wilson, C. E.; Keane, C. M.; Houlton, H. R.

    2012-12-01

    The American Geosciences Institute (AGI) decided to create the National Geoscience Student Exit Survey in order to identify the initial pathways into the workforce for these graduating students, as well as assess their preparedness for entering the workforce upon graduation. The creation of this survey stemmed from a combination of experiences with the AGI/AGU Survey of Doctorates and discussions at the following Science Education Research Center (SERC) workshops: "Developing Pathways to Strong Programs for the Future", "Strengthening Your Geoscience Program", and "Assessing Geoscience Programs". These events identified distinct gaps in understanding the experiences and perspectives of geoscience students during one of their most profound professional transitions. Therefore, the idea for the survey arose as a way to evaluate how the discipline is preparing and educating students, as well as identifying the students' desired career paths. The discussions at the workshops solidified the need for this survey and created the initial framework for the first pilot of the survey. The purpose of this assessment tool is to evaluate student preparedness for entering the geosciences workforce; identify student decision points for entering geosciences fields and remaining in the geosciences workforce; identify geosciences fields that students pursue in undergraduate and graduate school; collect information on students' expected career trajectories and geosciences professions; identify geosciences career sectors that are hiring new graduates; collect information about salary projections; overall effectiveness of geosciences departments regionally and nationally; demonstrate the value of geosciences degrees to future students, the institutions, and employers; and establish a benchmark to perform longitudinal studies of geosciences graduates to understand their career pathways and impacts of their educational experiences on these decisions. AGI's Student Exit Survey went through

  12. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Science.gov (United States)

    Ran, Shu; Liu, Yong-Jun; Zhang, Lei; Pei, Yufang; Yang, Tie-Lin; Hai, Rong; Han, Ying-Ying; Lin, Yong; Tian, Qing; Deng, Hong-Wen

    2014-01-01

    Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM), is a heritable trait. Copy number variation (CNV) is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2) and 3.34×10(-3), respectively). In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2) and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1), which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL) gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  13. Genome-wide association study identified copy number variants important for appendicular lean mass.

    Directory of Open Access Journals (Sweden)

    Shu Ran

    Full Text Available Skeletal muscle is a major component of the human body. Age-related loss of muscle mass and function contributes to some public health problems such as sarcopenia and osteoporosis. Skeletal muscle, mainly composed of appendicular lean mass (ALM, is a heritable trait. Copy number variation (CNV is a common type of human genome variant which may play an important role in the etiology of many human diseases. In this study, we performed genome-wide association analyses of CNV for ALM in 2,286 Caucasian subjects. We then replicated the major findings in 1,627 Chinese subjects. Two CNVs, CNV1191 and CNV2580, were detected to be associated with ALM (p = 2.26×10(-2 and 3.34×10(-3, respectively. In the Chinese replication sample, the two CNVs achieved p-values of 3.26×10(-2 and 0.107, respectively. CNV1191 covers a gene, GTPase of the immunity-associated protein family (GIMAP1, which is important for skeletal muscle cell survival/death in humans. CNV2580 is located in the Serine hydrolase-like protein (SERHL gene, which plays an important role in normal peroxisome function and skeletal muscle growth in response to mechanical stimuli. In summary, our study suggested two novel CNVs and the related genes that may contribute to variation in ALM.

  14. Identifying faecal impaction is important for ensuring the timely diagnosis of childhood functional constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Jakobsen, Marianne Skytte

    2015-01-01

    AIM: Most research on functional constipation has been carried out at a tertiary level. We focused this study on a secondary-level hospital outpatients' department, assessing the distribution of diagnostic criteria for childhood functional constipation and evaluating the consequences of current...... diagnostic practice based on current guidelines. METHODS: We enrolled 235 children, aged two to 16 years of age, with functional constipation according to the Rome III criteria and assessed them using medical histories and physical examinations, including rectal examinations and ultrasound measurements...... the timely diagnosis of childhood functional constipation at the secondary care level. Ultrasound examination proved a reliable alternative to rectal examination or abdominal radiography when identifying faecal impaction....

  15. The Importance of the Family: A Longitudinal Study of the Predictors of Depression in HIV Patients in South Africa.

    Science.gov (United States)

    Wouters, Edwin; Masquillier, Caroline; le Roux Booysen, Frederik

    2016-08-01

    As a chronic illness, HIV/AIDS requires life-long treatment adherence and retention-and thus sufficient attention to the psychosocial dimensions of chronic disease care in order to produce favourable antiretroviral treatment (ART) outcomes in a sustainable manner. Given the high prevalence of depression in chronic HIV patients, there is a clear need for further research into the determinants of depression in this population. In order to comprehensively study the predictors of depressive symptoms in HIV patients on ART, the socio-ecological theory postulates to not only incorporate the dominant individual-level and the more recent community-level approaches, but also incorporate the intermediate, but crucial family-level approach. The present study aims to extend the current literature by simultaneously investigating the impact of a wide range individual-level, family-level and community-level determinants of depression in a sample of 435 patients enrolled in the Free State Province of South Africa public-sector ART program. Structural equation modeling is used to explore the relationships between both latent and manifest variables at two time points. Besides a number of individual-level correlates-namely education, internalized and external stigma, and avoidant and seeking social support coping styles-of depressive symptoms in HIV patients on ART, the study also revealed the important role of family functioning in predicting depression. While family attachment emerged as the only factor to continuously and negatively impact depression at both time points, the second dimension of family functioning, changeability, was the only factor to produce a negative cross-lagged effect on depression. The immediate and long-term impact of family functioning on depression draws attention to the role of family dynamics in the mental health of people living with HIV/AIDS. In addition to individual-level and community-based factors, future research activities should also

  16. A retrospective observational analysis to identify patient and treatment-related predictors of outcomes in a community mental health programme.

    Science.gov (United States)

    Green, Stuart A; Honeybourne, Emmi; Chalkley, Sylvia R; Poots, Alan J; Woodcock, Thomas; Price, Geraint; Bell, Derek; Green, John

    2015-05-20

    This study aims to identify patient and treatment factors that affect clinical outcomes of community psychological therapy through the development of a predictive model using historic data from 2 services in London. In addition, the study aims to assess the completeness of data collection, explore how treatment outcomes are discriminated using current criteria for classifying recovery, and assess the feasibility and need for undertaking a future larger population analysis. Observational, retrospective discriminant analysis. 2 London community mental health services that provide psychological therapies for common mental disorders including anxiety and depression. A total of 7388 patients attended the services between February 2009 and May 2012, of which 4393 (59%) completed therapy, or there was an agreement to end therapy, and were included in the study. Different combinations of the clinical outcome scores for anxiety Generalised Anxiety Disorder-7 and depression Patient Health Questionnaire-9 were used to construct different treatment outcomes. The predictive models were able to assign a positive or negative clinical outcome to each patient based on 5 independent pre-treatment variables, with an accuracy of 69.4% and 79.3%, respectively: initial severity of anxiety and depression, ethnicity, deprivation and gender. The number of sessions attended/missed were also important factors identified in recovery. Predicting whether patients are likely to have a positive outcome following treatment at entry might allow suitable modification of scheduled treatment, possibly resulting in improvements in outcomes. The model also highlights factors not only associated with poorer outcomes but inextricably linked to prevalence of common mental disorders, emphasising the importance of social determinants not only in poor health but also poor recovery. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  17. Behavioral control is an important predictor of soy intake in adults in the USA concerned about diabetes.

    Science.gov (United States)

    Li, Suyun; Camp, Shirley; Finck, Jananne; Winter, Martha; Chapman-Novakofski, Karen

    2010-01-01

    The primary objective of this study was to determine the variables associated with intention to consume soy products and identify key variables that could be used as targets in soy nutrition education and consumption promotion. A pre/post-test survey was used during a three session class focused on diabetes that discussed and introduced soy foods. The Theory of Planned Behavior framed the questions and variables examined. Subjective norms and behavioral control were most important in predicting intention to consume soy foods. Specifically, health experts and providers were important subjective norms; accessibility and ability to prepare were key behavioural control determinants. While most participants tried soy during the program, taste and texture perceptions did not impact intention to buy soy in adults concerned about diabetes.

  18. A case study of identify importance of land use planning in road safety, Benidorm

    Energy Technology Data Exchange (ETDEWEB)

    Casares Blanco, J.; Sanchez Galiano, J.C.; Fernandez Aracil, P.; Ortuño Padilla, A.

    2016-07-01

    This research analyses how urban form, land use and urban density, may influence the incidence of traffic-related crashes injuries and deaths. It begins with a theoretical overview of studies which deal with the study of the relationship between urban patterns and road safety. Next, it details the development of a database of crash incidence and urban form at the district level for the city of Benidorm (Alicante, Spain) in 2010. Subsequently, it is developed a negative binomial approach for intra-city motor vehicle crash analysis. One-year crash data for Benidorm (the fourth largest tourism destination of Spain, after Barcelona, Madrid and San Bartolomé de Tirajana, and exclusively tourist-oriented city) are analyzed using a geographic information system (GIS) to generate relevant inputs for the analysis. In general, the study finds that a strong land use mix results on fewer road accidents, whereas accidents are more common but less severe in areas of high urban density. Finally, pedestrian accidents research showed that rural and low density environment is related to an important road accident numbers unlike tourism-oriented zones, much more safe for them. Based on these findings, the paper discusses the implications for urban design practice. (Author)

  19. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Promoting wellbeing in young unemployed adults: the importance of identifying meaningful patterns of time use.

    Science.gov (United States)

    Scanlan, Justin Newton; Bundy, Anita C; Matthews, Lynda R

    2011-04-01

    This study set out to explore the differences in time use between 'unemployed', 'unemployed but in education' and part-time and full-time employed 18- to 25-year-old Australians. Unemployed individuals generally experience poor health and this may be related to the way they use their time. Activity-based interventions may be one health-promoting strategy. This knowledge is important for all occupational therapists, as many service users are likely to be unemployed. Time use of unemployed 18- to 25-year-olds (measured using the Modified Occupational Questionnaire) was compared with the time use of part- and full-time employed 18- to 25-year-olds (from the 2006 Australian Time Use Survey). Individuals in the 'unemployed' groups spent significantly less time engaged in work-related activities than their employed peers. This time was reallocated mainly to recreation and leisure and household work (for both men and women) and child care and sleeping (women only). Recreation and leisure activities were generally passive, home-based activities such as watching television or 'doing nothing'. Individuals in the 'unemployed but in education' groups also spent less time in employment-related activities, but the majority of this time was reallocated to education activities. Individuals in the 'unemployed' groups spent large amounts of time engaged in potentially non-directed use of time (e.g. watching television or 'doing nothing'). Such patterns of time use have previously been associated with poor health. To support the health of unemployed individuals more effectively, occupational therapy interventions must focus on enhancing the quality of time use for this population. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.

  1. Bayesian importance parameter modeling of misaligned predictors: soil metal measures related to residential history and intellectual disability in children.

    Science.gov (United States)

    Onicescu, Georgiana; Lawson, Andrew B; McDermott, Suzanne; Aelion, C Marjorie; Cai, Bo

    2014-09-01

    In this paper, we propose a novel spatial importance parameter hierarchical logistic regression modeling approach that includes measurement error from misalignment. We apply this model to study the relationship between the estimated concentration of soil metals at the residence of mothers and the development of intellectual disability (ID) in their children. The data consist of monthly computerized claims data about the prenatal experience of pregnant women living in nine areas within South Carolina and insured by Medicaid during January 1, 1996 and December 31, 2001 and the outcome of ID in their children during early childhood. We excluded mother-child pairs if the mother moved to an unknown location during pregnancy. We identified an association of the ID outcome with arsenic (As) and mercury (Hg) concentration in soil during pregnancy, controlling for infant sex, maternal race, mother's age, and gestational weeks at delivery. There is some indication that Hg has a slightly higher importance in the third and fourth months of pregnancy, while As has a more uniform effect over all the months with a suggestion of a slight increase in risk in later months.

  2. Meta-Analysis of Microarray Data Identifies GAS6 Expression as an Independent Predictor of Poor Survival in Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Michelle Buehler

    2013-01-01

    Full Text Available Seeking new biomarkers for epithelial ovarian cancer, the fifth most common cause of death from all cancers in women and the leading cause of death from gynaecological malignancies, we performed a meta-analysis of three independent studies and compared the results in regard to clinicopathological parameters. This analysis revealed that GAS6 was highly expressed in ovarian cancer and therefore was selected as our candidate of choice. GAS6 encodes a secreted protein involved in physiological processes including cell proliferation, chemotaxis, and cell survival. We performed immunohistochemistry on various ovarian cancer tissues and found that GAS6 expression was elevated in tumour tissue samples compared to healthy control samples (. In addition, GAS6 expression was also higher in tumours from patients with residual disease compared to those without. Our data propose GAS6 as an independent predictor of poor survival, suggesting GAS6, both on the mRNA and on the protein level, as a potential biomarker for ovarian cancer. In clinical practice, the staining of a tumour biopsy for GAS6 may be useful to assess cancer prognosis and/or to monitor disease progression.

  3. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  4. A biology-driven approach identifies the hypoxia gene signature as a predictor of the outcome of neuroblastoma patients

    Directory of Open Access Journals (Sweden)

    Fardin Paolo

    2010-07-01

    Full Text Available Abstract Background Hypoxia is a condition of low oxygen tension occurring in the tumor microenvironment and it is related to poor prognosis in human cancer. To examine the relationship between hypoxia and neuroblastoma, we generated and tested an in vitro derived hypoxia gene signature for its ability to predict patients' outcome. Results We obtained the gene expression profile of 11 hypoxic neuroblastoma cell lines and we derived a robust 62 probesets signature (NB-hypo taking advantage of the strong discriminating power of the l1-l2 feature selection technique combined with the analysis of differential gene expression. We profiled gene expression of the tumors of 88 neuroblastoma patients and divided them according to the NB-hypo expression values by K-means clustering. The NB-hypo successfully stratifies the neuroblastoma patients into good and poor prognosis groups. Multivariate Cox analysis revealed that the NB-hypo is a significant independent predictor after controlling for commonly used risk factors including the amplification of MYCN oncogene. NB-hypo increases the resolution of the MYCN stratification by dividing patients with MYCN not amplified tumors in good and poor outcome suggesting that hypoxia is associated with the aggressiveness of neuroblastoma tumor independently from MYCN amplification. Conclusions Our results demonstrate that the NB-hypo is a novel and independent prognostic factor for neuroblastoma and support the view that hypoxia is negatively correlated with tumors' outcome. We show the power of the biology-driven approach in defining hypoxia as a critical molecular program in neuroblastoma and the potential for improvement in the current criteria for risk stratification.

  5. The hierarchy-by-interval approach to identifying important models that need improvement in severe-accident simulation codes

    International Nuclear Information System (INIS)

    Heames, T.J.; Khatib-Rahbar, M.; Kelly, J.E.

    1995-01-01

    The hierarchy-by-interval (HBI) methodology was developed to determine an appropriate phenomena identification and ranking table for an independent peer review of severe-accident computer codes. The methodology is described, and the results of a specific code review are presented. Use of this systematic and structured approach ensures that important code models that need improvement are identified and prioritized, which allows code sponsors to more effectively direct limited resources in future code development. In addition, critical phenomenological areas that need more fundamental work, such as experimentation, are identified

  6. Global sensitivity analysis for identifying important parameters of nitrogen nitrification and denitrification under model uncertainty and scenario uncertainty

    Science.gov (United States)

    Chen, Zhuowei; Shi, Liangsheng; Ye, Ming; Zhu, Yan; Yang, Jinzhong

    2018-06-01

    Nitrogen reactive transport modeling is subject to uncertainty in model parameters, structures, and scenarios. By using a new variance-based global sensitivity analysis method, this paper identifies important parameters for nitrogen reactive transport with simultaneous consideration of these three uncertainties. A combination of three scenarios of soil temperature and two scenarios of soil moisture creates a total of six scenarios. Four alternative models describing the effect of soil temperature and moisture content are used to evaluate the reduction functions used for calculating actual reaction rates. The results show that for nitrogen reactive transport problem, parameter importance varies substantially among different models and scenarios. Denitrification and nitrification process is sensitive to soil moisture content status rather than to the moisture function parameter. Nitrification process becomes more important at low moisture content and low temperature. However, the changing importance of nitrification activity with respect to temperature change highly relies on the selected model. Model-averaging is suggested to assess the nitrification (or denitrification) contribution by reducing the possible model error. Despite the introduction of biochemical heterogeneity or not, fairly consistent parameter importance rank is obtained in this study: optimal denitrification rate (Kden) is the most important parameter; reference temperature (Tr) is more important than temperature coefficient (Q10); empirical constant in moisture response function (m) is the least important one. Vertical distribution of soil moisture but not temperature plays predominant role controlling nitrogen reaction. This study provides insight into the nitrogen reactive transport modeling and demonstrates an effective strategy of selecting the important parameters when future temperature and soil moisture carry uncertainties or when modelers face with multiple ways of establishing nitrogen

  7. Population effect model identifies gene expression predictors of survival outcomes in lung adenocarcinoma for both Caucasian and Asian patients.

    Directory of Open Access Journals (Sweden)

    Guoshuai Cai

    Full Text Available We analyzed and integrated transcriptome data from two large studies of lung adenocarcinomas on distinct populations. Our goal was to investigate the variable gene expression alterations between paired tumor-normal tissues and prospectively identify those alterations that can reliably predict lung disease related outcomes across populations.We developed a mixed model that combined the paired tumor-normal RNA-seq from two populations. Alterations in gene expression common to both populations were detected and validated in two independent DNA microarray datasets. A 10-gene prognosis signature was developed through a l1 penalized regression approach and its prognostic value was evaluated in a third independent microarray cohort.Deregulation of apoptosis pathways and increased expression of cell cycle pathways were identified in tumors of both Caucasian and Asian lung adenocarcinoma patients. We demonstrate that a 10-gene biomarker panel can predict prognosis of lung adenocarcinoma in both Caucasians and Asians. Compared to low risk groups, high risk groups showed significantly shorter overall survival time (Caucasian patients data: HR = 3.63, p-value = 0.007; Asian patients data: HR = 3.25, p-value = 0.001.This study uses a statistical framework to detect DEGs between paired tumor and normal tissues that considers variances among patients and ethnicities, which will aid in understanding the common genes and signalling pathways with the largest effect sizes in ethnically diverse cohorts. We propose multifunctional markers for distinguishing tumor from normal tissue and prognosis for both populations studied.

  8. Identifying Keys to Success in Innovative Teaching: Student Engagement and Instructional Practices as Predictors of Student Learning in a Course Using a Team-Based Learning Approach

    Directory of Open Access Journals (Sweden)

    Rosa M. Alvarez-Bell

    2017-09-01

    Full Text Available When implementing innovative teaching techniques, instructors often seek to gauge the success of their methods. Proposing one approach to assessing classroom innovation, this study examines the ability of students’ ratings of engagement and instructional practices to predict their learning in a cooperative (team-based framework. After identifying the factor structures underlying measures of student engagement and instructional practices, these factors were used as predictors of self-reported student learning in a general chemistry course delivered using a team-based learning approach. Exploratory factor analyses showed a four-factor structure of engagement: teamwork involvement, investment in the learning process, feelings about team-based learning, level of academic challenge; and a three-factor structure of instructional practices: instructional guidance, fostering self-directed learning skills, and cognitive level. Multiple linear regression revealed that feelings about team-based learning and perceptions of instructional guidance had significant effects on learning, beyond other predictors, while controlling gender, GPA, class level, number of credit hours, whether students began college at their current institution, expected highest level of education, racial or ethnic identification, and parental level of education. These results yield insight into student perceptions about team-based learning, and how to measure learning in a team-based learning framework, with implications for how to evaluate innovative instructional methods.

  9. Identifying significant predictors of head-on conflicts on two-lane rural roads using inductive loop detectors data.

    Science.gov (United States)

    Shariat-Mohaymany, Afshin; Tavakoli-Kashani, Ali; Nosrati, Hadi; Ranjbari, Andisheh

    2011-12-01

    To identify the significant factors that influence head-on conflicts resulting from dangerous overtaking maneuvers on 2-lane rural roads in Iran. A traffic conflict technique was applied to 12 two-lane rural roads in order to investigate the potential situations for accidents to occur and thus to identify the geometric and traffic factors affecting traffic conflicts. Traffic data were collected via the inductive loop detectors installed on these roads, and geometric characteristics were obtained through field observations. Two groups of data were then analyzed independently by Pearson's chi-square test to evaluate their relationship to traffic conflicts. The independent variables were percentage of time spent following (PTSF), percentage of heavy vehicles, directional distribution of traffic (DDT), mean speed, speed standard deviation, section type, road width, longitudinal slope, holiday or workday, and lighting condition. It was indicated that increasing the PTSF, decreasing the percentage of heavy vehicles, increasing the mean speed (up to 75 km/h), increasing DDT in the range of 0 to 60 percent, and decreasing the standard deviation of speed significantly increased the occurrence of traffic conflicts. It was also revealed that traffic conflicts occur more frequently on curve sections and on workdays. The variables road width, slope, and lighting condition were found to have a minor effect on conflict occurrence. To reduce the number of head-on conflicts on the aforementioned roads, some remedial measures are suggested, such as not constructing long "No Passing" zones and constructing passing lanes where necessary; keeping road width at the standard value; constructing roads with horizontal curves and a high radius and using appropriate road markings and overtaking-forbidden signs where it is impossible to modify the radius; providing enough light and installing caution signs/devices on the roads; and intensifying police control and supervision on workdays

  10. Imaging-Based Screen Identifies Laminin 411 as a Physiologically Relevant Niche Factor with Importance for i-Hep Applications

    Directory of Open Access Journals (Sweden)

    John Ong

    2018-03-01

    Full Text Available Summary: Use of hepatocytes derived from induced pluripotent stem cells (i-Heps is limited by their functional differences in comparison with primary cells. Extracellular niche factors likely play a critical role in bridging this gap. Using image-based characterization (high content analysis; HCA of freshly isolated hepatocytes from 17 human donors, we devised and validated an algorithm (Hepatocyte Likeness Index; HLI for comparing the hepatic properties of cells against a physiological gold standard. The HLI was then applied in a targeted screen of extracellular niche factors to identify substrates driving i-Heps closer to the standard. Laminin 411, the top hit, was validated in two additional induced pluripotent stem cell (iPSC lines, primary tissue, and an in vitro model of α1-antitrypsin deficiency. Cumulatively, these data provide a reference method to control and screen for i-Hep differentiation, identify Laminin 411 as a key niche protein, and underscore the importance of combining substrates, soluble factors, and HCA when developing iPSC applications. : Rashid and colleagues demonstrate the utility of a high-throughput imaging platform for identification of physiologically relevant extracellular niche factors to advance i-Heps closer to their primary tissue counterparts. The extracellular matrix (ECM protein screen identified Laminin 411 as an important niche factor facilitating i-Hep-based disease modeling in vitro. Keywords: iPS hepatocytes, extracellular niche, image-based screening, disease modeling, laminin

  11. NRC Information No. 90-01: Importance of proper response to self-identified violations by licensees

    International Nuclear Information System (INIS)

    Cunningham, R.E.

    1992-01-01

    NRC expects a high standard of compliance by its licensees and requires that licensees provide NRC accurate and complete information and that required records will also be complete and accurate in all material respects. Licensees should be aware of the importance placed by NRC on licensee programs for self detection, correction and reporting of violations or errors related to regulatory requirements. The General Statement of Policy and Procedures for NRC Enforcement Actions in Appendix C to 10 CFR Part 2 underscores the importance of licensees responding promptly and properly to self-identified violations in two ways. It is suggested that when a licensee identifies a violation involving an NRC-required record, the licensee should make a dated notation indicating identification, either on the record itself or other appropriate documentation retrievable for NRC review. The record with the self-identified violation noted should not be altered in any way to mask the correction. The licensee should determine the cause of the violation, correct the root cause of the violation, and document such findings in an appropriate manner. Licensees should also assure that if a report of the violation is required, the report is submitted to NRC in a timely manner. These actions will be considered by NRC in making any enforcement decision, and generally lead to lesser or no civil penalty

  12. Identifying reliable predictors of protein-energy malnutrition in hospitalized frail older adults. A prospective longitudinal study.

    Science.gov (United States)

    Sanson, Gianfranco; Bertocchi, Luca; Dal Bo, Eugenia; Di Pasquale, Carmen Luisa; Zanetti, Michela

    2018-03-07

    Decreased food intake is a risk factor for relevant complications (e.g. infections, pressure ulcers), longer hospital stays, higher readmission rates, greater health care costs and increased patient mortality, particularly in frail hospitalized older adults who are malnourished or at risk of malnutrition. Nurses are called to improve this criticality, starting from accurately identify patients for malnutrition at hospital admission and effectively monitoring their food intake. The primary aim was to identify reliable predictive indicators of reduced food intake at hospital admission. The secondary aims were to assess the adequacy of daily energy and protein intake and the impact of nutrient intake on patient outcomes. Prospective observational longitudinal study. Internal Medicine Ward of an Academic Teaching University Hospital. Acute older adults who were malnourished or at risk of malnutrition (Nutritional Risk Score-2002 ≥ 3, middle-upper arm circumference energy and protein intake was monitored during the first 5 days of hospital stay by a photographic method and compared to the daily energy and protein requirement calculated by specific equations. Data on anthropometry, inflammation/malnutrition laboratory data and body composition (phase angle calculated using bioelectrical impedance analysis) were collected. Eighty-one subjects (age 81.5 ± 11.5 years) were enrolled. Mean energy intake was 669.0 ± 573.9 kcal/day, and mean protein intake was 30.7 ± 25.8 g/day. Over 60% of patients ingested ≤50% of their calculated energy and protein requirements: these patients were older (p = 0.026), had a lower middle-upper arm circumference (p = 0.022) and total arm area (p = 0.038), a higher C-reactive protein/albumin ratio and Instant Nutritional Assessment score (p protein/albumin ratio, and impaired self-feeding at admission were independently associated with critically reduced energy and protein intake. Middle

  13. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 1: Review and comparison of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    Procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses are described and illustrated. These procedures attempt to detect increasingly complex patterns in scatterplots and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. A sequence of example analyses with a large model for two-phase fluid flow illustrates how the individual procedures can differ in the variables that they identify as having effects on particular model outcomes. The example analyses indicate that the use of a sequence of procedures is a good analysis strategy and provides some assurance that an important effect is not overlooked

  14. Statistical analyses of scatterplots to identify important factors in large-scale simulations, 2: robustness of techniques

    International Nuclear Information System (INIS)

    Kleijnen, J.P.C.; Helton, J.C.

    1999-01-01

    The robustness of procedures for identifying patterns in scatterplots generated in Monte Carlo sensitivity analyses is investigated. These procedures are based on attempts to detect increasingly complex patterns in the scatterplots under consideration and involve the identification of (i) linear relationships with correlation coefficients, (ii) monotonic relationships with rank correlation coefficients, (iii) trends in central tendency as defined by means, medians and the Kruskal-Wallis statistic, (iv) trends in variability as defined by variances and interquartile ranges, and (v) deviations from randomness as defined by the chi-square statistic. The following two topics related to the robustness of these procedures are considered for a sequence of example analyses with a large model for two-phase fluid flow: the presence of Type I and Type II errors, and the stability of results obtained with independent Latin hypercube samples. Observations from analysis include: (i) Type I errors are unavoidable, (ii) Type II errors can occur when inappropriate analysis procedures are used, (iii) physical explanations should always be sought for why statistical procedures identify variables as being important, and (iv) the identification of important variables tends to be stable for independent Latin hypercube samples

  15. Crowd-sourced Ontology for Photoleukocoria: Identifying Common Internet Search Terms for a Potentially Important Pediatric Ophthalmic Sign.

    Science.gov (United States)

    Staffieri, Sandra E; Kearns, Lisa S; Sanfilippo, Paul G; Craig, Jamie E; Mackey, David A; Hewitt, Alex W

    2018-02-01

    Leukocoria is the most common presenting sign for pediatric eye disease including retinoblastoma and cataract, with worse outcomes if diagnosis is delayed. We investigated whether individuals could identify leukocoria in photographs (photoleukocoria) and examined their subsequent Internet search behavior. Using a web-based questionnaire, in this cross-sectional study we invited adults aged over 18 years to view two photographs of a child with photoleukocoria, and then search the Internet to determine a possible diagnosis and action plan. The most commonly used search terms and websites accessed were recorded. The questionnaire was completed by 1639 individuals. Facebook advertisement was the most effective recruitment strategy. The mean age of all respondents was 38.95 ± 14.59 years (range, 18-83), 94% were female, and 59.3% had children. An abnormality in the images presented was identified by 1613 (98.4%) participants. The most commonly used search terms were: "white," "pupil," "photo," and "eye" reaching a variety of appropriate websites or links to print or social media articles. Different words or phrases were used to describe the same observation of photoleukocoria leading to a range of websites. Variations in the description of observed signs and search words influenced the sites reached, information obtained, and subsequent help-seeking intentions. Identifying the most commonly used search terms for photoleukocoria is an important step for search engine optimization. Being directed to the most appropriate websites informing of the significance of photoleukocoria and the appropriate actions to take could improve delays in diagnosis of important pediatric eye disease such as retinoblastoma or cataract.

  16. The importance of campaign saliency as a predictor of attitude and behavior change: A pilot evaluation of social marketing campaign Fat Talk Free Week.

    Science.gov (United States)

    Garnett, Bernice Raveche; Buelow, Robert; Franko, Debra L; Becker, Carolyn; Rodgers, Rachel F; Austin, S Bryn

    2014-01-01

    Fat Talk Free Week (FTFW), a social marketing campaign designed to decrease self-disparaging talk about body and weight, has not yet been evaluated. We conducted a theory-informed pilot evaluation of FTFW with two college samples using a pre- and posttest design. Aligned with the central tenets of the Elaboration Likelihood Model (ELM), we investigated the importance of FTFW saliency as a predictor of fat talk behavior change. Our analytic sample consisted of 118 female participants (83% of original sample). Approximately 76% of the sample was non-Hispanic White, 14% Asian, and 8% Hispanic. At baseline, more than 50% of respondents reported engaging in frequent self fat talk; at posttest, this number dropped to 34% of respondents. Multivariable regression models supported campaign saliency as the single strongest predictor of a decrease in self fat talk. Our results support the social diffusion of campaign messages among shared communities, as we found significant decreases in fat talk among campaign attenders and nonattenders. FTFW may be a promising short-term health communication campaign to reduce fat talk, as campaign messages are salient among university women and may encourage interpersonal communication.

  17. Predictors for Long-Term Hip Survivorship Following Acetabular Fracture Surgery: Importance of Gap Compared with Step Displacement.

    Science.gov (United States)

    Verbeek, Diederik O; van der List, Jelle P; Tissue, Camden M; Helfet, David L

    2018-06-06

    Historically, the greatest residual (gap or step) displacement is used to predict clinical outcome following acetabular fracture surgery. Gap and step displacement may, however, impact the outcome to different degrees. We assessed the individual relationship between gap or step displacement and hip survivorship and determined their independent association with conversion to total hip arthroplasty. Patients who had acetabular fracture fixation (from 1992 through 2014), follow-up of ≥2 years (or early conversion to total hip arthroplasty), and postoperative computed tomography (CT) scans were included. Of 227 patients, 55 (24.2%) had conversion to total hip arthroplasty at a mean follow-up (and standard deviation) of 8.7 ± 5.6 years. Residual gap and step displacement were measured using a standardized CT-based method, and assessors were blinded to the outcome. Kaplan-Meier survivorship curves for the hips were plotted and compared (log-rank test) using critical cutoff values for gap and step displacement. These values were identified using receiver operating characteristic curves. Multivariate analysis was performed to identify independent variables associated with conversion to total hip arthroplasty. Subgroup analysis was performed in younger patients (step displacement. Hip survivorship at 10 years was 82.0% for patients with a gap of step of step of ≥1.0 mm (p = 0.012). A gap of ≥5 mm (hazard ratio [HR], 2.3; p = 0.012) and an age of ≥50 years (HR, 4.2; p step of ≥1 mm (HR, 6.4; p = 0.017) was an independent factor for conversion to total hip arthroplasty. Residual gap and step displacement as measured on CT scans are both related to long-term hip survivorship, but step displacement (1 mm) is tolerated less than gap displacement (5 mm). Of the 2 types of displacement, only a large gap displacement (≥5 mm) was independently associated with conversion to total hip arthroplasty. In younger patients who had less articular impaction with smaller residual

  18. Identifying and Characterizing Important Trembling Aspen Competitors with Juvenile Lodgepole Pine in Three South-Central British Columbia Ecosystems

    Directory of Open Access Journals (Sweden)

    Teresa A. Newsome

    2012-01-01

    Full Text Available Critical height ratios for predicting competition between trembling aspen and lodgepole pine were identified in six juvenile stands in three south-central British Columbia ecosystems. We used a series of regression analyses predicting pine stem diameter from the density of neighbouring aspen in successively shorter relative height classes to identify the aspen-pine height ratio that maximized R2. Critical height ratios varied widely among sites when stands were 8–12 years old but, by age 14–19, had converged at 1.25–1.5. Maximum R2 values at age 14–19 ranged from 13.4% to 69.8%, demonstrating that the importance of aspen competition varied widely across a relatively small geographic range. Logistic regression also indicated that the risk of poor pine vigour in the presence of aspen varied between sites. Generally, the degree of competition, risk to pine vigour, and size of individual aspen contributing to the models declined along a gradient of decreasing ecosystem productivity.

  19. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Predictors of chronic pulmonary vein reconnections after contact force-guided ablation: importance of completing electrical isolation with circumferential lines and creating sufficient ablation lesion densities.

    Science.gov (United States)

    Nakamura, Kohki; Naito, Shigeto; Sasaki, Takehito; Minami, Kentaro; Take, Yutaka; Shimizu, Satoru; Yamaguchi, Yoshiaki; Yano, Toshiaki; Senga, Michiharu; Yamashita, Eiji; Sugai, Yoshinao; Kumagai, Koji; Funabashi, Nobusada; Oshima, Shigeru

    2016-12-01

    We aimed to identify the predictors of chronic pulmonary vein reconnections (CPVRs) after contact force (CF)-guided circumferential PV isolation (CPVI) of atrial fibrillation (AF). Forty-nine consecutive patients undergoing second ablation procedures for recurrent AF after CF-guided ablation were retrospectively studied. The CPVI was performed by point-by-point ablation with a target CF of 15-20 g. The incidence of CPVRs was evaluated along the right- and left-sided anterior and posterior CPVI regions (Ant-RPVs, Post-RPVs, Ant-LPVs, and Post-LPVs). CPVRs were observed in 30.6, 22.4, 20.4, and 32.7 % of patients along the Ant-RPVs, Post-RPVs, Ant-LPVs, and Post-LPVs, respectively (P = 0.436). In the multivariate logistic analyses, completing a left atrium-PV conduction block with touch-up ablation inside the initially estimated CPVI lines (Ant-RPVs, Post-RPVs, Ant-LPVs, Post-LPVs; odds ratio [OR] 5.747, 15.000, 207.619, 7.940; P = 0.032, 0.004, 0.034, 0.021) and region length (Post-LPVs; OR 3.183, P = 0.027) were positive predictors of CPVRs, while the mean CF (Ant-RPVs; OR 0.861, P = 0.045) and number of radiofrequency applications per unit length (Ant-LPVs, Post-LPVs; OR 0.038, 0.122; P = 0.034, 0.029) were negative predictors. At optimal cutoffs of 5.8 cm for the region length, 14.2 g for the mean CF, and 1.97/cm (Ant-LPVs) and 2.01/cm (Post-LPVs) for the radiofrequency application density, the sensitivity and specificity were 93.8 and 63.6 %, 60.0 and 76.5 %, 90.0 and 64.1 %, and 75.0 and 63.6 %, respectively. Completing PVI with circumferential lines without touch-up ablation and creating a sufficient density of radiofrequency ablation lesions on the lines with a sufficient CF may be necessary to prevent CPVRs after a CF-guided CPVI.

  1. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    Science.gov (United States)

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  2. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  3. DNA-SIP identifies sulfate-reducing Clostridia as important toluene degraders in tar-oil-contaminated aquifer sediment

    Energy Technology Data Exchange (ETDEWEB)

    Winderl, C.; Penning, H.; von Netzer, F.; Meckenstock, R.U.; Lueders, T. [Helmholtz Zentrum Munchen, Neuherberg (Germany)

    2010-10-15

    Global groundwater resources are constantly challenged by a multitude of contaminants such as aromatic hydrocarbons. Especially in anaerobic habitats, a large diversity of unrecognized microbial populations may be responsible for their degradation. Still, our present understanding of the respective microbiota and their ecophysiology is almost exclusively based on a small number of cultured organisms, mostly within the Proteobacteria. Here, by DNA-based stable isotope probing (SIP), we directly identified the most active sulfate-reducing toluene degraders in a diverse sedimentary microbial community originating from a tar-oil-contaminated aquifer at a former coal gasification plant. On incubation of fresh sediments with {sup 13}C{sub 7}-toluene, the production of both sulfide and (CS{sub 2}){sup 13}CO{sub 2} was clearly coupled to the {sup 13}Clabeling of DNA of microbes related to Desulfosporosinus spp. within the Peptococcaceae (Clostridia). The screening of labeled DNA fractions also suggested a novel benzylsuccinate synthase alpha-subunit (bssA) sequence type previously only detected in the environment to be tentatively affiliated with these degraders. However, carbon flow from the contaminant into degrader DNA was only similar to 50%, pointing toward high ratios of heterotrophic CS{sub 2}-fixation during assimilation of acetyl-CoA originating from the contaminant by these degraders. These findings demonstrate that the importance of non-proteobacterial populations in anaerobic aromatics degradation, as well as their specific ecophysiology in the subsurface may still be largely ungrasped.

  4. Evaluation of bentonite alteration due to interactions with iron. Sensitivity analyses to identify the important factors for the bentonite alteration

    International Nuclear Information System (INIS)

    Sasamoto, Hiroshi; Wilson, James; Sato, Tsutomu

    2013-01-01

    Performance assessment of geological disposal systems for high-level radioactive waste requires a consideration of long-term systems behaviour. It is possible that the alteration of swelling clay present in bentonite buffers might have an impact on buffer functions. In the present study, iron (as a candidate overpack material)-bentonite (I-B) interactions were evaluated as the main buffer alteration scenario. Existing knowledge on alteration of bentonite during I-B interactions was first reviewed, then the evaluation methodology was developed considering modeling techniques previously used overseas. A conceptual model for smectite alteration during I-B interactions was produced. The following reactions and processes were selected: 1) release of Fe 2+ due to overpack corrosion; 2) diffusion of Fe 2+ in compacted bentonite; 3) sorption of Fe 2+ on smectite edge and ion exchange in interlayers; 4) dissolution of primary phases and formation of alteration products. Sensitivity analyses were performed to identify the most important factors for the alteration of bentonite by I-B interactions. (author)

  5. Identifying Predictors of Student Satisfaction and Student Motivation in the Framework of Assuring Quality in the Delivery of Higher Education Services

    Directory of Open Access Journals (Sweden)

    Yulia Stukalina

    2014-06-01

    Full Text Available Nowadays, the quality of educational services provided by a university is a crucial aspect of the education managers’ strategy in the customer-driven education context, quality assurance in education being an essential issue to be promoted in European higher education institutions. Students’ evaluation of the educational services (that is consumer-oriented assessment can be regarded as one of the most significant educational management tools used for stimulating quality enhancement in a university. It is vital for supporting decision-making process. A special emphasis may be put on monitoring student satisfaction with the educational services and student motivation toward studies. Understanding the central factors that are supposed to influence and predict student satisfaction and student motivation may provide education managers with best possible solutions to improve quality of the educational services in a higher education institution. This paper presents the results of an empirical study performed in Riga Technical University. The study was aimed at identifying the basic determinants (predictors of student satisfaction and motivation in the framework of the ESP (English for Specific Purposes course.

  6. Identifying important and feasible policies and actions for health at community sports clubs: a consensus-generating approach.

    Science.gov (United States)

    Kelly, Bridget; King, Lesley; Bauman, Adrian E; Baur, Louise A; Macniven, Rona; Chapman, Kathy; Smith, Ben J

    2014-01-01

    Children's high participation in organised sport in Australia makes sport an ideal setting for health promotion. This study aimed to generate consensus on priority health promotion objectives for community sports clubs, based on informed expert judgements. Delphi survey using three structured questionnaires. Forty-six health promotion, nutrition, physical activity and sport management/delivery professionals were approached to participate in the survey. Questionnaires used an iterative process to determine aspects of sports clubs deemed necessary for developing healthy sporting environments for children. Initially, participants were provided with a list of potential standards for a range of health promotion areas and asked to rate standards based on their importance and feasibility, and any barriers to implementation. Subsequently, participants were provided with information that summarised ratings for each standard to indicate convergence of the group, and asked to review and potentially revise their responses where they diverged. In a third round, participants ranked confirmed standards by priority. 26 professionals completed round 1, 21 completed round 2, and 18 completed round 3. The highest ranked standards related to responsible alcohol practices, availability of healthy food and drinks at sports canteens, smoke-free club facilities, restricting the sale and consumption of alcohol during junior sporting activities, and restricting unhealthy food and beverage company sponsorship. Identifying and prioritising health promotion areas that are relevant to children's sports clubs assists in focusing public health efforts and may guide future engagement of sports clubs. Approaches for providing informational and financial support to clubs to operationalise these standards are proposed. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  7. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions.

    Science.gov (United States)

    Frølich, Anne

    2012-02-01

    effect of financial incentives and public performance reporting on the behaviour of professionals and quality of care. Using secondary data, KP and the Danish health care system were compared in terms of six central dimensions: population, health care professionals, health care organisations, utilization patterns, quality measurements, and costs. Differences existed between the two systems on all dimensions, complicating the interpretation of findings. For instance, observed differences might be due to similar tendencies in the two health care systems that were observed at different times, rather than true structural differences. The expenses in the two health care systems were corrected for differences in the populations served and the purchasing power of currencies. However, no validated methods existed to correct for observed differences in case-mixes of chronic conditions. Data from a population of about half a million patients with diabetes in a large U.S. integrated health care delivery system affiliated with 41 medical centers employing 15 different CCM management practices was the basis for identifying effective management practices. Through the use of statistical modelling, the management practice of provider alerts was identified as most effective for promoting screening for hemoglobin A1c and lipid profile. The CCM was used as a framework for implementing four rehabilitation programs. The model promoted continuity of care and quality of health care services. New management practices were developed in the study, and known practices were further developed. However, the observational nature of the study limited the generalisability of the findings. In a structured literature survey focusing on the effect of financial incentives and public performance reporting on the quality of health care services, few studies documenting an effect were identified. The results varied, and important program aspects or contextual variables were often omitted. A model describing

  8. Hospital process intervals, not EMS time intervals, are the most important predictors of rapid reperfusion in EMS Patients with ST-segment elevation myocardial infarction.

    Science.gov (United States)

    Clark, Carol Lynn; Berman, Aaron D; McHugh, Ann; Roe, Edward Jedd; Boura, Judith; Swor, Robert A

    2012-01-01

    To assess the relationship of emergency medical services (EMS) intervals and internal hospital intervals to the rapid reperfusion of patients with ST-segment elevation myocardial infarction (STEMI). We performed a secondary analysis of a prospectively collected database of STEMI patients transported to a large academic community hospital between January 1, 2004, and December 31, 2009. EMS and hospital data intervals included EMS scene time, transport time, hospital arrival to myocardial infarction (MI) team activation (D2Page), page to catheterization laboratory arrival (P2Lab), and catheterization laboratory arrival to reperfusion (L2B). We used two outcomes: EMS scene arrival to reperfusion (S2B) ≤90 minutes and hospital arrival to reperfusion (D2B) ≤90 minutes. Means and proportions are reported. Pearson chi-square and multivariate regression were used for analysis. During the study period, we included 313 EMS-transported STEMI patients with 298 (95.2%) MI team activations. Of these STEMI patients, 295 (94.2%) were taken to the cardiac catheterization laboratory and 244 (78.0%) underwent percutaneous coronary intervention (PCI). For the patients who underwent PCI, 127 (52.5%) had prehospital EMS activation, 202 (82.8%) had D2B ≤90 minutes, and 72 (39%) had S2B ≤90 minutes. In a multivariate analysis, hospital processes EMS activation (OR 7.1, 95% CI 2.7, 18.4], Page to Lab [6.7, 95% CI 2.3, 19.2] and Lab arrival to Reperfusion [18.5, 95% CI 6.1, 55.6]) were the most important predictors of Scene to Balloon ≤ 90 minutes. EMS scene and transport intervals also had a modest association with rapid reperfusion (OR 0.85, 95% CI 0.78, 0.93 and OR 0.89, 95% CI 0.83, 0.95, respectively). In a secondary analysis, Hospital processes (Door to Page [OR 44.8, 95% CI 8.6, 234.4], Page 2 Lab [OR 5.4, 95% CI 1.9, 15.3], and Lab arrival to Reperfusion [OR 14.6 95% CI 2.5, 84.3]), but not EMS scene and transport intervals were the most important predictors D2B ≤90

  9. Identifying Important Gaps in Randomized Controlled Trials of Adult Cardiac Arrest Treatments: A Systematic Review of the Published Literature

    Science.gov (United States)

    Sinha, Shashank S.; Sukul, Devraj; Lazarus, John J.; Polavarapu, Vivek; Chan, Paul S.; Neumar, Robert W.; Nallamothu, Brahmajee K.

    2016-01-01

    Background Cardiac arrests are a major public health concern worldwide. The extent and types of randomized controlled trials (RCTs) – our most reliable source of clinical evidence – conducted in these high-risk patients over recent years are largely unknown. Methods and Results We performed a systematic review, identifying all RCTs published in PubMed, EMBASE, Scopus, Web of Science, and the Cochrane Library from 1995 to 2014 that focused on acute treatment of non-traumatic cardiac arrest in adults. We then extracted data on the setting of study populations, types and timing of interventions studied, risk of bias, outcomes reported and how these factors have changed over time. Over this twenty-year period, 92 RCTs were published containing 64,309 patients (median, 225.5 per trial). Of these, 81 RCTs (88.0%) involved out-of-hospital cardiac arrest whereas 4 (4.3%) involved in-hospital cardiac arrest and 7 (7.6%) included both. Eighteen RCTs (19.6%) were performed in the U.S., 68 (73.9%) were performed outside the U.S., and 6 (6.5%) were performed in both settings. Thirty-eight RCTs (41.3%) evaluated drug therapy, 39 (42.4%) evaluated device therapy, and 15 (16.3%) evaluated protocol improvements. Seventy-four RCTs (80.4%) examined interventions during the cardiac arrest, 15 (16.3%) examined post-cardiac arrest treatment, and 3 (3.3%) studied both. Overall, reporting of risk of bias was limited. The most common outcome reported was ROSC: 86 (93.5%) with only 22 (23.9%) reporting survival beyond 6 months. Fifty-three RCTs (57.6%) reported global ordinal outcomes whereas 15 (16.3%) reported quality-of-life. RCTs in the last 5 years were more likely to be focused on protocol improvement and post-cardiac arrest care. Conclusions Important gaps in RCTs of cardiac arrest treatments exist, especially those examining in-hospital cardiac arrest, protocol improvement, post-cardiac arrest care, and long-term or quality-of-life outcomes. PMID:27756794

  10. Diagnostic stability of autism spectrum disorder in toddlers prospectively identified in a community-based setting: Behavioural characteristics and predictors of change over time.

    Science.gov (United States)

    Barbaro, Josephine; Dissanayake, Cheryl

    2017-10-01

    Autism spectrum disorder diagnoses in toddlers have been established as accurate and stable across time in high-risk siblings and clinic-referred samples. Few studies have investigated diagnostic stability in children prospective identified in community-based settings. Furthermore, there is a dearth of evidence on the individual behaviours that predict diagnostic change over time. The stability and change of autism spectrum disorder diagnoses were investigated from 24 to 48 months in 77 children drawn from the Social Attention and Communication Study. Diagnostic stability was high, with 88.3% overall stability and 85.5% autism spectrum disorder stability. The behavioural markers at 24 months that contributed to diagnostic shift off the autism spectrum by 48 months included better eye contact, more directed vocalisations, the integration of gaze and directed vocalisations/gestures and higher non-verbal developmental quotient. These four variables correctly predicted 88.7% of children into the autism spectrum disorder-stable and autism spectrum disorder-crossover groups overall, with excellent prediction for the stable group (96.2%) and modest prediction for the crossover group (44.4%). Furthermore, non-verbal developmental quotient at 24 months accounted for the significant improvement across time in 'Social Affect' scores on the Autism Diagnostic Observation Schedule for both groups and was the only unique predictor of diagnostic crossover. These findings contribute to the body of evidence on the feasibility of diagnoses at earlier ages to facilitate children's access to interventions to promote positive developmental outcomes.

  11. Primary Tumor Volume Is an Important Predictor of Clinical Outcomes Among Patients With Locally Advanced Squamous Cell Cancer of the Head and Neck Treated With Definitive Chemoradiotherapy

    International Nuclear Information System (INIS)

    Strongin, Anna; Yovino, Susannah; Taylor, Rodney; Wolf, Jeffrey; Cullen, Kevin; Zimrin, Ann; Strome, Scott; Regine, William; Suntharalingam, Mohan

    2012-01-01

    Purpose: The tumor volume has been established as a significant predictor of outcomes among patients with head-and-neck cancer undergoing radiotherapy alone. The present study attempted to add to the existing data on tumor volume as a prognostic factor among patients undergoing chemoradiotherapy. Methods and Materials: A total of 78 patients who had undergone definitive chemoradiotherapy for Stage III-IV squamous cell cancer of the hypopharynx, oropharynx, and larynx were identified. The primary tumor volumes were calculated from the treatment planning computed tomography scans, and these were correlated to the survival and tumor control data obtained from the retrospective analysis. Results: The interval to progression correlated with the primary tumor volume (p = .007). The critical cutoff point for the tumor volume was identified as 35 cm 3 , and patients with a tumor volume 3 had a significantly better prognosis than those with a tumor volume >35 cm 3 at 5 years (43% vs. 71%, p = .010). Longer survival was also correlated with smaller primary tumor volumes (p = .022). Similarly, patients with a primary tumor volume 3 had a better prognosis in terms of both progression-free survival (61% vs. 33%, p = .004) and overall survival (84% vs. 41%, p = 3 larger than tumors without locoregional failure (p = .028) and 27.1-cm 3 larger than tumors that recurred as distant metastases (p = .020). Conclusion: The results of our study have shown that the primary tumor volume is a significant prognostic factor in patients with advanced cancer of the head and neck undergoing definitive chemoradiotherapy and correlated with the treatment outcomes better than the T or N stage.

  12. Identifying organisational principles and management practices important to the quality of health care services for chronic conditions

    DEFF Research Database (Denmark)

    Frølich, Anne

    2012-01-01

    are limited, it is necessary to identify efficient methods to improve the quality of care. Comparing health care systems is a well-known method for identifying new knowledge regarding, for instance, organisational methods and principles. Kaiser Permanente (KP), an integrated health care delivery system...... in the U.S., is recognized as providing high-quality chronic care; to some extent, this is due to KP's implementation of the chronic care model (CCM). This model recommends a range of evidence-based management practices that support the implementation of evidence-based medicine. However, it is not clear...... which management practices in the CCM are most efficient and in what combinations. In addition, financial incentives and public reporting of performance are often considered effective at improving the quality of health care services, but this has not yet been definitively proved....

  13. Modelling of OGTT curve identifies 1 h plasma glucose level as a strong predictor of incident type 2 diabetes: results from two prospective cohorts.

    Science.gov (United States)

    Alyass, Akram; Almgren, Peter; Akerlund, Mikael; Dushoff, Jonathan; Isomaa, Bo; Nilsson, Peter; Tuomi, Tiinamaija; Lyssenko, Valeriya; Groop, Leif; Meyre, David

    2015-01-01

    The relevance of the OGTT in predicting type 2 diabetes is unclear. We assessed the performance of 14 OGTT glucose traits in type 2 diabetes prediction. We studied 2,603 and 2,386 Europeans from the Botnia study and Malmö Prevention Project (MPP) cohorts with baseline OGTT data. Over a follow-up period of 4.94 years and 23.5 years, 155 (5.95%) and 467 (19.57%) participants, respectively, developed type 2 diabetes. The main outcome was incident type 2 diabetes. One-hour plasma glucose (1h-PG) was a fair/good predictor of incident type 2 diabetes in the Botnia study and MPP (AUC for receiver operating characteristic [AUCROC] 0.80 [0.77, 0.84] and 0.70 [0.68, 0.73]). 1h-PG alone outperformed the prediction model of multiple clinical risk factors (age, sex, BMI, family history of type 2 diabetes) in the Botnia study and MPP (AUCROC 0.75 [0.72, 0.79] and 0.67 [0.64, 0.70]). The same clinical risk factors added to 1h-PG modestly increased prediction for incident type 2 diabetes (Botnia, AUCROC 0.83 [0.80, 0.86]; MPP, AUCROC 0.74 [0.72, 0.77]). 1h-PG also outperformed HbA1c in predicting type 2 diabetes in the Botnia cohort. A 1h-PG value of 8.9 mmol/l and 8.4 mmol/l was the optimal cut-point for initial screening and selection of high-risk individuals in the Botnia study and MPP, respectively, and represented 30% and 37% of all participants in these cohorts. High-risk individuals had a substantially increased risk of incident type 2 diabetes (OR 8.0 [5.5, 11.6] and 3.8 [3.1, 4.7]) and captured 75% and 62% of all incident type 2 diabetes in the Botnia study and MPP. 1h-PG is a valuable prediction tool for identifying adults at risk for future type 2 diabetes.

  14. Identifying the Value of the ACT Score as a Predictor of Student Success in Respiratory Care, Radiography, and Nursing at Southeast Kentucky Community and Technical College

    Science.gov (United States)

    Parrott-Robbins, Rebecca Jon

    2010-01-01

    The purpose of this study was to investigate--by utilizing data obtained from the Kentucky Community and Technical College System (KCTCS) PeopleSoft database-- whether the American College Testing (ACT) assessment was a predictor of student success for students who had graduated from respiratory, radiography, and nursing programs at Southeast…

  15. Identifying diabetes-related important protein targets with few interacting partners with the PageRank algorithm.

    Science.gov (United States)

    Grolmusz, Vince I

    2015-04-01

    Diabetes is a growing concern for the developed nations worldwide. New genomic, metagenomic and gene-technologic approaches may yield considerable results in the next several years in its early diagnosis, or in advances in therapy and management. In this work, we highlight some human proteins that may serve as new targets in the early diagnosis and therapy. With the help of a very successful mathematical tool for network analysis that formed the basis of the early successes of Google(TM), Inc., we analyse the human protein-protein interaction network gained from the IntAct database with a mathematical algorithm. The novelty of our approach is that the new protein targets suggested do not have many interacting partners (so, they are not hubs or super-hubs), so their inhibition or promotion probably will not have serious side effects. We have identified numerous possible protein targets for diabetes therapy and/or management; some of these have been well known for a long time (these validate our method), some of them appeared in the literature in the last 12 months (these show the cutting edge of the algorithm), and the remainder are still unknown to be connected with diabetes, witnessing completely new hits of the method.

  16. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  17. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    Energy Technology Data Exchange (ETDEWEB)

    Rundle-Thiele, Dayle [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Day, Bryan; Stringer, Brett [Brain Cancer Research Unit, Queensland Institute of Medical Research, Brisbane, Queensland (Australia); Fay, Michael [Department of Radiation Oncology, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Martin, Jennifer [Discipline of Clinical Pharmacology, School of Medicine and Public Health, University of Newcastle, Newcastle, New South Wales (Australia); Jeffree, Rosalind L [Department of Neurosurgery, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Thomas, Paul [Queensland PET Service, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Bell, Christopher [Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia); Salvado, Olivier [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Gal, Yaniv [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Coulthard, Alan [Discipline of Medical Imaging, University of Queensland, St Lucia, Queensland (Australia); Department of Medical Imaging, Royal Brisbane and Women' s Hospital, Brisbane, Queensland (Australia); Crozier, Stuart [Centre for Medical Diagnostic Technologies in Queensland, University of Queensland, Brisbane, Queensland (Australia); Rose, Stephen, E-mail: stephen.rose@csiro.au [CSIRO Digital Productivity Flagship, CSIRO, Herston, Queensland (Australia); Centre for Clinical Research, University of Queensland, Brisbane, Queensland (Australia)

    2015-06-15

    Accurate knowledge of O{sup 6}-methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling.

  18. Using the apparent diffusion coefficient to identifying MGMT promoter methylation status early in glioblastoma: importance of analytical method

    International Nuclear Information System (INIS)

    Rundle-Thiele, Dayle; Day, Bryan; Stringer, Brett; Fay, Michael; Martin, Jennifer; Jeffree, Rosalind L; Thomas, Paul; Bell, Christopher; Salvado, Olivier; Gal, Yaniv; Coulthard, Alan; Crozier, Stuart; Rose, Stephen

    2015-01-01

    Accurate knowledge of O 6 -methylguanine methyltransferase (MGMT) gene promoter subtype in patients with glioblastoma (GBM) is important for treatment. However, this test is not always available. Pre-operative diffusion MRI (dMRI) can be used to probe tumour biology using the apparent diffusion coefficient (ADC); however, its ability to act as a surrogate to predict MGMT status has shown mixed results. We investigated whether this was due to variations in the method used to analyse ADC. We undertook a retrospective study of 32 patients with GBM who had MGMT status measured. Matching pre-operative MRI data were used to calculate the ADC within contrast enhancing regions of tumour. The relationship between ADC and MGMT was examined using two published ADC methods. A strong trend between a measure of ‘minimum ADC’ and methylation status was seen. An elevated minimum ADC was more likely in the methylated compared to the unmethylated MGMT group (U = 56, P = 0.0561). In contrast, utilising a two-mixture model histogram approach, a significant reduction in mean measure of the ‘low ADC’ component within the histogram was associated with an MGMT promoter methylation subtype (P < 0.0246). This study shows that within the same patient cohort, the method selected to analyse ADC measures has a significant bearing on the use of that metric as a surrogate marker of MGMT status. Thus for dMRI data to be clinically useful, consistent methods of data analysis need to be established prior to establishing any relationship with genetic or epigenetic profiling

  19. The importance of neck circumference to thyromental distance ratio (NC/TM) as a predictor of difficult intubation in obstructive sleep apnea (OSA) patients

    OpenAIRE

    Hala Ezzat Abdel Naim; Sabah Abdel Raouf Mohamed; Sherif Mohamed Soaida; Haitham Hassan Awad Eltrabily

    2014-01-01

    Background: The trial to find a bedside examination that is helpful for foreseeing difficult intubation is quite inspiring. It was reported that thyromental distance (TM), body mass index (BMI), neck circumference (NC) and a Mallampati score >3 were the only helpful bedside test predictors. By using magnetic resonance imaging, it was established that more fat was present in areas around the collapsible parts of the pharynx in OSA patients. So distribution of fat may provide a better suggestio...

  20. Prevalence and Predictors of Neoadjuvant Therapy for Stage IIIA Non-Small Cell Lung Cancer in the National Cancer Database: Importance of Socioeconomic Status and Treating Institution

    Energy Technology Data Exchange (ETDEWEB)

    Sher, David J., E-mail: david_sher@rush.edu [Department of Radiation Oncology, Rush University Medical Center, Chicago, Illinois (United States); Liptay, Michael J. [Department of Cardiothoracic Surgery, Rush University Medical Center, Chicago, Illinois (United States); Fidler, Mary Jo [Section of Medical Oncology, Rush University Medical Center, Chicago, Illinois (United States)

    2014-06-01

    Purpose: The optimal locoregional therapy for stage IIIA non-small cell lung cancer (NSCLC) is controversial, with definitive chemoradiation therapy (CRT) and neoadjuvant therapy followed by surgery (NT-S) serving as competing strategies. In this study, we used the National Cancer Database to determine the prevalence and predictors of NT in a large, modern cohort of patients. Methods and Materials: Patients with stage IIIA NSCLC treated with CRT or NT-S between 2003 and 2010 at programs accredited by the Commission on Cancer were included. Predictors were categorized as clinical, time/geographic, socioeconomic, and institutional. In accord with the National Cancer Database, institutions were classified as academic/research program and as comprehensive and noncomprehensive community cancer centers. Logistic regression and random effects multilevel logistic regression were performed for univariable and multivariable analyses, respectively. Results: The cohort consisted of 18,581 patients, 3,087 (16.6%) of whom underwent NT-S (10.6% induction CRT, 6% induction chemotherapy). The prevalence of NT-S was constant over time, but there were significant relative 31% and 30% decreases in pneumonectomy and right-sided pneumonectomy, respectively, over time (P trend <.02). In addition to younger age, lower T stage, and favorable comorbidity score, indicators of higher socioeconomic status were strong independent predictors of NT-S, including white race, higher income, and private/managed insurance. The type of institution (academic/research program vs comprehensive or noncomprehensive community cancer centers, odds ratio 1.54 and 2.08, respectively) strongly predicted NT-S, but treatment volume did not. Conclusions: Neoadjuvant therapy followed by surgery was an uncommon treatment approach in Commission on Cancer programs, and the prevalence of postinduction pneumonectomy decreased over time. Higher socioeconomic status and treatment at academic institutions were significant

  1. Prevalence and Predictors of Neoadjuvant Therapy for Stage IIIA Non-Small Cell Lung Cancer in the National Cancer Database: Importance of Socioeconomic Status and Treating Institution

    International Nuclear Information System (INIS)

    Sher, David J.; Liptay, Michael J.; Fidler, Mary Jo

    2014-01-01

    Purpose: The optimal locoregional therapy for stage IIIA non-small cell lung cancer (NSCLC) is controversial, with definitive chemoradiation therapy (CRT) and neoadjuvant therapy followed by surgery (NT-S) serving as competing strategies. In this study, we used the National Cancer Database to determine the prevalence and predictors of NT in a large, modern cohort of patients. Methods and Materials: Patients with stage IIIA NSCLC treated with CRT or NT-S between 2003 and 2010 at programs accredited by the Commission on Cancer were included. Predictors were categorized as clinical, time/geographic, socioeconomic, and institutional. In accord with the National Cancer Database, institutions were classified as academic/research program and as comprehensive and noncomprehensive community cancer centers. Logistic regression and random effects multilevel logistic regression were performed for univariable and multivariable analyses, respectively. Results: The cohort consisted of 18,581 patients, 3,087 (16.6%) of whom underwent NT-S (10.6% induction CRT, 6% induction chemotherapy). The prevalence of NT-S was constant over time, but there were significant relative 31% and 30% decreases in pneumonectomy and right-sided pneumonectomy, respectively, over time (P trend <.02). In addition to younger age, lower T stage, and favorable comorbidity score, indicators of higher socioeconomic status were strong independent predictors of NT-S, including white race, higher income, and private/managed insurance. The type of institution (academic/research program vs comprehensive or noncomprehensive community cancer centers, odds ratio 1.54 and 2.08, respectively) strongly predicted NT-S, but treatment volume did not. Conclusions: Neoadjuvant therapy followed by surgery was an uncommon treatment approach in Commission on Cancer programs, and the prevalence of postinduction pneumonectomy decreased over time. Higher socioeconomic status and treatment at academic institutions were significant

  2. Clinical predictors of the leading pathogens in human immunodeficiency virus-infected adults with community-onset bacteremia in the emergency department: The importance of transmission routes

    Directory of Open Access Journals (Sweden)

    Ching-Chi Lee

    2018-06-01

    Conclusion: Focusing on the two key pathogens in HIV-infected adults with community-onset bacteremia, IDU was one of independent predictors associated with S. aureus infection, whereas MSM was the leading risk factor of S. enterica infection. Although the proposed predictive model of these pathogens has been not established, a scoring system involving the transmission risk of HIV may be of use for the early identification of these patients for clinicians.

  3. Predictors of Ramadan fasting during pregnancy

    NARCIS (Netherlands)

    van Bilsen, Lily A.; Savitri, Ary I.; Amelia, Dwirani; Baharuddin, Mohammad; Grobbee, Diederick E.; Uiterwaal, Cuno S P M

    2016-01-01

    Although the health effects of Ramadan fasting during pregnancy are still unclear, it is important to identify the predictors and motivational factors involved in women's decision to observe the fast. We investigated these factors in a cross sectional study of 187 pregnant Muslim women who attended

  4. Triangulating Principal Effectiveness: How Perspectives of Parents, Teachers, and Assistant Principals Identify the Central Importance of Managerial Skills. Working Paper 35

    Science.gov (United States)

    Grissom, Jason A.; Loeb, Susanna

    2009-01-01

    While the importance of effective principals is undisputed, few studies have addressed what specific skills principals need to promote school success. This study draws on unique data combining survey responses from principals, assistant principals, teachers and parents with rich administrative data to identify which principal skills matter most…

  5. Identifying Predictors of Interferon-γ Release Assay Results in Pediatric Latent Tuberculosis: A Protective Role of Bacillus Calmette-Guérin?

    Science.gov (United States)

    Sotgiu, Giovanni; Altet-Gómez, Neus; Tsolia, Maria; Ruga, Ezia; Velizarova, Svetlana; Kampmann, Beate

    2012-01-01

    Rationale: Interferon-γ (IFN-γ) release assays are widely used to diagnose latent infection with Mycobacterium tuberculosis in adults, but their performance in children remains incompletely evaluated to date. Objectives: To investigate factors influencing results of IFN-γ release assays in children using a large European data set. Methods: The Pediatric Tuberculosis Network European Trials group pooled and analyzed data from five sites across Europe comprising 1,128 children who were all investigated for latent tuberculosis infection by tuberculin skin test and at least one IFN-γ release assay. Multivariate analyses examined age, bacillus Calmette-Guérin (BCG) vaccination status, and sex as predictor variables of results. Subgroup analyses included children who were household contacts. Measurements and Main Results: A total of 1,093 children had a QuantiFERON-TB Gold In-Tube assay and 382 had a T-SPOT.TB IFN-γ release assay. Age was positively correlated with a positive blood result (QuantiFERON-TB Gold In-Tube: odds ratio [OR], 1.08 per year increasing age [P 5 yr). Conclusions: Our data show that BCG vaccination may be effective in protecting children against Mycobacterium tuberculosis infection. To restrict use of IFN-γ release assays to children with positive skin tests risks underestimating latent infection. PMID:22700862

  6. Preoperative motor strength and time to surgery are the most important predictors of improvement in foot drop due to degenerative lumbar disease.

    Science.gov (United States)

    Macki, Mohamed; Syeda, Sbaa; Kerezoudis, Panagiotis; Gokaslan, Ziya L; Bydon, Ali; Bydon, Mohamad

    2016-02-15

    Palsy of dorsiflexion, or foot drop, may be due to degenerative lumbar disease and amenable to posterior spinal decompression. The objective of this study is to measure prognostic factors of and time to foot drop improvement after posterior lumbar decompression. We retrospectively reviewed 71 patients undergoing first-time, posterior lumbar decompression for foot drop due to degenerative spinal disease. Patient sex, age, comorbidities (Charlson Comorbidity Index), preoperative anterior tibialis strength (manual muscle testing, MMT), and duration of foot drop were ascertained from clinical notes. Prognostic factors affecting foot drop improvement were calculated with a discrete time proportional hazards model, in which follow-up times and outcome measures were binned into six time intervals: 1 week, 6 weeks, 3 months, 6 months, 1 year, and ≥ 1 year. Of the 71 patients, the mean age was 54.6 ± 16.0 years, and 66.2% (n=47) were males. The mean Charlson Comorbidity Index was 2.42. During a mean follow-up of 30.4 months, dorsiflexion function improved postoperatively in 73.2% (n=52) of patients. The median time to surgery from onset of foot drop was within 6 weeks, and the median preoperative MMT strength of patients with foot drop improvement was 3. Following a discrete-time proportional hazards model, duration of anterior tibialis palsy (HR=0.67, P=0.004) and preoperative muscle strength (HR=1.10, P=0.010) were significant predictors of foot drop improvement. Following an adjusted Kaplan-Meier analysis, the median time to foot drop improvement was within 6 weeks of surgical intervention. Preoperative muscle strength and palsy duration were statistically significant predictors of foot drop improvement. Furthermore, the median time to improvement was 6 weeks. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. The time since last menstrual period is important as a clinical predictor for non-steroidal aromatase inhibitor-related arthralgia.

    Science.gov (United States)

    Kanematsu, Miyuki; Morimoto, Masami; Honda, Junko; Nagao, Taeko; Nakagawa, Misako; Takahashi, Masako; Tangoku, Akira; Sasa, Mitsunori

    2011-10-10

    The clinical predictors of aromatase inhibitor-related arthralgia (AIA), a drug-related adverse reaction of aromatase inhibitors (AIs), remain unclear. AIA was prospectively surveyed every 4 months in 328 postmenopausal breast cancer patients administered a non-steroidal AI (anastrozole). Various clinicopathological parameters were recorded and analyzed (chi-square test, Fisher's exact test and logistic regression analysis). The mean observation period was 39.9 months. AIA manifested in 114 patients (34.8%), with peaks of onset at 4 (33.7%) and 8 months (11.4%) after starting AI administration. Some cases manifested even after 13 months. AIA tended to occur in younger patients (incidences of 46.3%, 37.4% and 28.0% for ages of 65 years, respectively (p = 0.063)) and decreased significantly with the age at menarche (53.3%, 35.3% and 15.4% for 15 years, respectively (p = 0.036)). The incidences were 45.1%, 46.3 and 25.1% for the time since the last menstrual period (LMP) 10 years, being significantly lower at > 10 years (p time since LMP > 10-year group versus the time since LMP became shorter ( 10 years since LMP. When the time since LMP was short, the onset of AIA was significantly earlier after starting AI administration.

  8. Point Topography and Within-Session Learning Are Important Predictors of Pet Dogs’ (Canis lupus familiaris Performance on Human Guided Tasks

    Directory of Open Access Journals (Sweden)

    Dorey, Nicole R.

    2013-07-01

    Full Text Available Pet domestic dogs (Canis lupus familiaris are generally considered successful on object choice tasks, reliably following human points to a target. However, defining the specific topography of the point types utilized and assessing the potential for dogs to generalize their responses across similar point types has received little attention. In Experiment 1, we assessed pet dogs’ performance on an object choice task utilizing nine different point types that varied across the dimensions of movement, duration, and distance. These dimensions reliably predicted the performance of pet dogs on this task. In Experiment 2, pet dogs presented with nine different point types in the order of increasing difficulty performed better on more difficult point types than both naive dogs and dogs experiencing the nine points in the order of decreasing difficulty. In Experiment 3, we manipulated the attentional state of the experimenter (as in perspective taking studies and found that human orientation was not a strong predictor of performance on pointing tasks. The results of this study indicate that dogs do not reliably follow all point types without additional training or experience. Furthermore, dogs appear to continuously learn about the dimensions of human points, adjusting their behavior accordingly, even over the course of experimental testing. These findings bring claims of pet dogs’ spontaneous success on pointing tasks into question. The ability to learn about, and respond flexibly to, human gestures may benefit pet dogs living in human homes more than a spontaneous responsiveness to specific gesture types.

  9. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

    Science.gov (United States)

    Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

    2017-01-01

    Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  10. Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L. Using SLAF-seq

    Directory of Open Access Journals (Sweden)

    Dongwei Xie

    2018-01-01

    Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

  11. The time since last menstrual period is important as a clinical predictor for non-steroidal aromatase inhibitor-related arthralgia

    International Nuclear Information System (INIS)

    Kanematsu, Miyuki; Morimoto, Masami; Honda, Junko; Nagao, Taeko; Nakagawa, Misako; Takahashi, Masako; Tangoku, Akira; Sasa, Mitsunori

    2011-01-01

    The clinical predictors of aromatase inhibitor-related arthralgia (AIA), a drug-related adverse reaction of aromatase inhibitors (AIs), remain unclear. AIA was prospectively surveyed every 4 months in 328 postmenopausal breast cancer patients administered a non-steroidal AI (anastrozole). Various clinicopathological parameters were recorded and analyzed (chi-square test, Fisher's exact test and logistic regression analysis). The mean observation period was 39.9 months. AIA manifested in 114 patients (34.8%), with peaks of onset at 4 (33.7%) and 8 months (11.4%) after starting AI administration. Some cases manifested even after 13 months. AIA tended to occur in younger patients (incidences of 46.3%, 37.4% and 28.0% for ages of < 55, 55-65 and > 65 years, respectively (p = 0.063)) and decreased significantly with the age at menarche (53.3%, 35.3% and 15.4% for < 12, 12-15 and > 15 years, respectively (p = 0.036)). The incidences were 45.1%, 46.3 and 25.1% for the time since the last menstrual period (LMP) < 5 years, 5-10 years and > 10 years, being significantly lower at > 10 years (p < 0.001). In logistic regression analysis, the AIA incidence was significantly lower in the time since LMP > 10-year group versus the < 5-year group (odds ratio 0.44, p = 0.002), but the age at menarche showed no association. AIA manifested significantly earlier (≤ 6 months) as the time since LMP became shorter (< 5 years). AIA tends to manifest early after starting AI, but some cases show delayed onset. The incidence was significantly lower in patients with a duration of > 10 years since LMP. When the time since LMP was short, the onset of AIA was significantly earlier after starting AI administration

  12. Data Mining Identifies Digit Symbol Substitution Test Score and Serum Cystatin C as Dominant Predictors of Mortality in Older Men and Women

    DEFF Research Database (Denmark)

    Swindell, W. R.; Cummings, S. R.; Sanders, J. L.

    2012-01-01

    Background: Characterization of long-term health trajectory in older individuals is important for proactive health management. However, the relative prognostic value of information contained in clinical profiles of nonfrail older adults is often unclear. Methods: We screened 825 phenotypic and ge...

  13. The strategic importance of identifying knowledge-based and intangible assets for generating value, competitiveness and innovation in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nicoline Ondari-Okemwa

    2011-01-01

    Full Text Available This article discusses the strategic importance of identifying intangible assets for creating value and enhancing competitiveness and innovation in science and technology in a knowledge economy with particular reference to the sub- Saharan Africa region. It has always been difficult to gather the prerequisite information to manage such assets and create value from them. The paper discusses the nature of intangible assets, the characteristics of a knowledge economy and the role of knowledge workers in a knowledge economy. The paper also discusses the importance of identifying intangible assets in relation to capturing the value of such assets, the transfer of intangible assets to other owners and the challenges of managing organizational intangible assets. Objectives of the article include: underscoring the strategic importance of identifying intangible assets in sub-Saharan Africa; examining the performance of intangible assets in a knowledge economy; how intangible assets may generate competitiveness, economic growth and innovation; and assess how knowledge workers are becoming a dominant factor in the knowledge economy. An extensive literature review was employed to collect data for this article. It is concluded in the article that organizations and governments in sub-Saharan Africa should look at knowledge-based assets as strategic resources, even though the traditional accounting systems may still be having problems in determining the exact book value of such assets. It is recommended that organizations and government departments in sub-Saharan Africa should implement a system of the reporting of the value of intangible organizational assets just like the reporting of the value of tangible assets; and that organizations in sub-Saharan Africa should use knowledge to produce “smart products and services” which command premium prices.

  14. Baseline predictors of sputum culture conversion in pulmonary tuberculosis: importance of cavities, smoking, time to detection and W-Beijing genotype.

    Directory of Open Access Journals (Sweden)

    Marianne E Visser

    Full Text Available Time to detection (TTD on automated liquid mycobacterial cultures is an emerging biomarker of tuberculosis outcomes. The M. tuberculosis W-Beijing genotype is spreading globally, indicating a selective advantage. There is a paucity of data on the association between baseline TTD and W-Beijing genotype and tuberculosis outcomes.To assess baseline predictors of failure of sputum culture conversion, within the first 2 months of antitubercular therapy, in participants with pulmonary tuberculosis.Between May 2005 and August 2008 we conducted a prospective cohort study of time to sputum culture conversion in ambulatory participants with first episodes of smear and culture positive pulmonary tuberculosis attending two primary care clinics in Cape Town, South Africa. Rifampicin resistance (diagnosed on phenotypic susceptibility testing was an exclusion criterion. Sputum was collected weekly for 8 weeks for mycobacterial culture on liquid media (BACTEC MGIT 960. Due to missing data, multiple imputation was performed. Time to sputum culture conversion was analysed using a Cox-proportional hazards model. Bayesian model averaging determined the posterior effect probability for each variable.113 participants were enrolled (30.1% female, 10.5% HIV-infected, 44.2% W-Beijing genotype, and 89% cavities. On Kaplan Meier analysis 50.4% of participants underwent sputum culture conversion by 8 weeks. The following baseline factors were associated with slower sputum culture conversion: TTD (adjusted hazard ratio (aHR = 1.11, 95% CI 1.02; 1.2, lung cavities (aHR = 0.13, 95% CI 0.02; 0.95, ever smoking (aHR = 0.32, 95% CI 0.1; 1.02 and the W-Beijing genotype (aHR = 0.51, 95% CI 0.25; 1.07. On Bayesian model averaging, posterior probability effects were strong for TTD, lung cavitation and smoking and moderate for W-Beijing genotype.We found that baseline TTD, smoking, cavities and W-Beijing genotype were associated with delayed 2 month sputum culture

  15. Baseline predictors of sputum culture conversion in pulmonary tuberculosis: importance of cavities, smoking, time to detection and W-Beijing genotype.

    Science.gov (United States)

    Visser, Marianne E; Stead, Michael C; Walzl, Gerhard; Warren, Rob; Schomaker, Michael; Grewal, Harleen M S; Swart, Elizabeth C; Maartens, Gary

    2012-01-01

    Time to detection (TTD) on automated liquid mycobacterial cultures is an emerging biomarker of tuberculosis outcomes. The M. tuberculosis W-Beijing genotype is spreading globally, indicating a selective advantage. There is a paucity of data on the association between baseline TTD and W-Beijing genotype and tuberculosis outcomes. To assess baseline predictors of failure of sputum culture conversion, within the first 2 months of antitubercular therapy, in participants with pulmonary tuberculosis. Between May 2005 and August 2008 we conducted a prospective cohort study of time to sputum culture conversion in ambulatory participants with first episodes of smear and culture positive pulmonary tuberculosis attending two primary care clinics in Cape Town, South Africa. Rifampicin resistance (diagnosed on phenotypic susceptibility testing) was an exclusion criterion. Sputum was collected weekly for 8 weeks for mycobacterial culture on liquid media (BACTEC MGIT 960). Due to missing data, multiple imputation was performed. Time to sputum culture conversion was analysed using a Cox-proportional hazards model. Bayesian model averaging determined the posterior effect probability for each variable. 113 participants were enrolled (30.1% female, 10.5% HIV-infected, 44.2% W-Beijing genotype, and 89% cavities). On Kaplan Meier analysis 50.4% of participants underwent sputum culture conversion by 8 weeks. The following baseline factors were associated with slower sputum culture conversion: TTD (adjusted hazard ratio (aHR) = 1.11, 95% CI 1.02; 1.2), lung cavities (aHR = 0.13, 95% CI 0.02; 0.95), ever smoking (aHR = 0.32, 95% CI 0.1; 1.02) and the W-Beijing genotype (aHR = 0.51, 95% CI 0.25; 1.07). On Bayesian model averaging, posterior probability effects were strong for TTD, lung cavitation and smoking and moderate for W-Beijing genotype. We found that baseline TTD, smoking, cavities and W-Beijing genotype were associated with delayed 2 month sputum culture. Larger

  16. Identifying obstacles and ranking common biological control research priorities for Europe to manage most economically important pests in arable, vegetable and perennial crops.

    Science.gov (United States)

    Lamichhane, Jay Ram; Bischoff-Schaefer, Monika; Bluemel, Sylvia; Dachbrodt-Saaydeh, Silke; Dreux, Laure; Jansen, Jean-Pierre; Kiss, Jozsef; Köhl, Jürgen; Kudsk, Per; Malausa, Thibaut; Messéan, Antoine; Nicot, Philippe C; Ricci, Pierre; Thibierge, Jérôme; Villeneuve, François

    2017-01-01

    EU agriculture is currently in transition from conventional crop protection to integrated pest management (IPM). Because biocontrol is a key component of IPM, many European countries recently have intensified their national efforts on biocontrol research and innovation (R&I), although such initiatives are often fragmented. The operational outputs of national efforts would benefit from closer collaboration among stakeholders via transnationally coordinated approaches, as most economically important pests are similar across Europe. This paper proposes a common European framework on biocontrol R&I. It identifies generic R&I bottlenecks and needs as well as priorities for three crop types (arable, vegetable and perennial crops). The existing gap between the market offers of biocontrol solutions and the demand of growers, the lengthy and expensive registration process for biocontrol solutions and their varying effectiveness due to variable climatic conditions and site-specific factors across Europe are key obstacles hindering the development and adoption of biocontrol solutions in Europe. Considering arable, vegetable and perennial crops, a dozen common target pests are identified for each type of crop and ranked by order of importance at European level. Such a ranked list indicates numerous topics on which future joint transnational efforts would be justified. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  17. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  18. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    Science.gov (United States)

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  19. Talent predictors

    Directory of Open Access Journals (Sweden)

    Raquel Lorenzo

    2007-07-01

    Full Text Available The knowledge of talent predictors is the initial point for building diagnosis and encouragement procedures in this field. The meaning of word predictor is to anticipate the future, to divine. Early prediction of high performance is complex problem no resolute by the science yet. There are many discrepancies about what measure and how to do. The article analyze the art state in this problematic because the excellence is determined by the interaction between internal and environmental factors.

  20. Gene-based association identifies SPATA13-AS1 as a pharmacogenomic predictor of inhaled short-acting beta-agonist response in multiple population groups.

    Science.gov (United States)

    Padhukasahasram, B; Yang, J J; Levin, A M; Yang, M; Burchard, E G; Kumar, R; Kwok, P-Y; Seibold, M A; Lanfear, D E; Williams, L K

    2014-08-01

    Inhaled short-acting beta-agonist (SABA) medication is commonly used in asthma patients to rapidly reverse airway obstruction and improve acute symptoms. We performed a genome-wide association study of SABA medication response using gene-based association tests. A linear mixed model approach was first used for single-nucleotide polymorphism associations, and the results were later combined using GATES to generate gene-based associations. Our results identified SPATA13-AS1 as being significantly associated with SABA bronchodilator response in 328 healthy African Americans. In replication, this gene was associated with SABA response among the two separate groups of African Americans with asthma (n=1073, P=0.011 and n=1968, P=0.014), 149 healthy African Americans (P=0.003) and 556 European Americans with asthma (P=0.041). SPATA13-AS1 was also associated with longitudinal SABA medication usage in the two separate groups of African Americans with asthma (n=658, P=0.047 and n=1968, P=0.025). Future studies are needed to delineate the precise mechanism by which SPATA13-AS1 may influence SABA response.

  1. Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

    Science.gov (United States)

    Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

    2013-01-01

    To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (PCIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  2. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  3. Relative Importance of History of Heart Failure Hospitalization and N-Terminal Pro-B-Type Natriuretic Peptide Level as Predictors of Outcomes in Patients With Heart Failure and Preserved Ejection Fraction

    DEFF Research Database (Denmark)

    Kristensen, Søren L; Jhund, Pardeep S; Køber, Lars

    2015-01-01

    of NT-proBNP (n = 1468) (HR: 3.19; 95% CI: 2.68 to 3.80). In patients with no recent HF hospitalization and NT-proBNP ≤360 pg/ml (n = 1,187), the event rate was 2.43 (95% CI: 2.03 to 2.90) compared with 17.79 (95% CI: 15.77 to 20.07) per 100 person-years when both risk predictors were present (n = 523......; HR: 6.18; 95% CI: 4.96 to 7.69). CONCLUSIONS: Recent hospitalization for HF or an elevated level of NT-proBNP identified patients at higher risk for cardiovascular events, and this risk was increased further when both factors were present.......OBJECTIVES: The aim of this study was to investigate N-terminal pro-B-type natriuretic peptide (NT-proBNP) levels and recent heart failure (HF) hospitalization as predictors of future events in heart failure - preserved ejection fraction (HF-PEF). BACKGROUND: Recently, doubt has been expressed...

  4. High throughput phenotypic selection of Mycobacterium tuberculosis mutants with impaired resistance to reactive oxygen species identifies genes important for intracellular growth.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.

  5. Predictors of Posttraumatic Stress Symptoms Among Adolescent and Young Adult Survivors of Childhood Cancer: Importance of Monitoring Survivors' Experiences of Family Functioning.

    Science.gov (United States)

    Kamibeppu, Kiyoko; Murayama, Shiho; Ozono, Shuichi; Sakamoto, Naoko; Iwai, Tsuyako; Asami, Keiko; Maeda, Naoko; Inada, Hiroko; Kakee, Naoko; Okamura, Jun; Horibe, Keizo; Ishida, Yasushi

    2015-11-01

    The purpose of this study was to identify factors associated with posttraumatic stress symptoms (PTSS) among Japanese long-term childhood cancer survivors (CCSs). Subjects comprised 185 adolescent and young adult (AYA) CCSs who completed anonymous self-report questionnaires. Attending physicians also completed an anonymous disease/treatment data sheet. Mean age of survivors was approximately 8 years at diagnosis and 23 years at participation. Multiple regression analysis showed that family functioning, satisfaction with social support, being female, and interactions between family functioning and gender and age at the time of diagnosis were associated with PTSS among survivors. This study revealed family functioning as the most predictive factor of PTSS among AYA CCSs in Japan. Even when the survivor may have unchangeable risk factors, family functioning can potentially moderate the effects on PTSS. Thus, it is crucial for health professionals to carefully monitor and attend to survivors' experiences of family functioning to mitigate PTSS. © The Author(s) 2015.

  6. IDENTIFYING ROOF FALL PREDICTORS USING FUZZY CLASSIFICATION

    International Nuclear Information System (INIS)

    Bertoncini, C. A.; Hinders, M. K.

    2010-01-01

    Microseismic monitoring involves placing geophones on the rock surfaces of a mine to record seismic activity. Classification of microseismic mine data can be used to predict seismic events in a mine to mitigate mining hazards, such as roof falls, where properly bolting and bracing the roof is often an insufficient method of preventing weak roofs from destabilizing. In this study, six months of recorded acoustic waveforms from microseismic monitoring in a Pennsylvania limestone mine were analyzed using classification techniques to predict roof falls. Fuzzy classification using features selected for computational ease was applied on the mine data. Both large roof fall events could be predicted using a Roof Fall Index (RFI) metric calculated from the results of the fuzzy classification. RFI was successfully used to resolve the two significant roof fall events and predicted both events by at least 15 hours before visual signs of the roof falls were evident.

  7. Systemic analysis of different colorectal cancer cell lines and TCGA datasets identified IGF-1R/EGFR-PPAR-CASPASE axis as important indicator for radiotherapy sensitivity.

    Science.gov (United States)

    Chen, Lin; Zhu, Zhe; Gao, Wei; Jiang, Qixin; Yu, Jiangming; Fu, Chuangang

    2017-09-05

    Insulin-like growth factor 1 receptor (IGF-1R) is proved to contribute the development of many types of cancers. But, little is known about its roles in radio-resistance of colorectal cancer (CRC). Here, we demonstrated that low IGF-1R expression value was associated with the better radiotherapy sensitivity of CRC. Besides, through Quantitative Real-time PCR (qRT-PCR), the elevated expression value of epidermal growth factor receptor (EGFR) was observed in CRC cell lines (HT29, RKO) with high radio-sensitivity compared with those with low sensitivity (SW480, LOVO). The irradiation induced apoptosis rates of wild type and EGFR agonist (EGF) or IGF-1R inhibitor (NVP-ADW742) treated HT29 and SW480 cells were quantified by flow cytometry. As a result, the apoptosis rate of EGF and NVP-ADW742 treated HT29 cells was significantly higher than that of those wild type ones, which indicated that high EGFR and low IGF-1R expression level in CRC was associated with the high sensitivity to radiotherapy. We next conducted systemic bioinformatics analysis of genome-wide expression profiles of CRC samples from the Cancer Genome Atlas (TCGA). Differential expression analysis between IGF-1R and EGFR abnormal CRC samples, i.e. CRC samples with higher IGF-1R and lower EGFR expression levels based on their median expression values, and the rest of CRC samples identified potential genes contribute to radiotherapy sensitivity. Functional enrichment of analysis of those differential expression genes (DEGs) in the Database for Annotation, Visualization and Integrated Discovery (DAVID) indicated PPAR signaling pathway as an important pathway for the radio-resistance of CRC. Our study identified the potential biomarkers for the rational selection of radiotherapy for CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Whole-exome sequencing of muscle-invasive bladder cancer identifies recurrent mutations of UNC5C and prognostic importance of DNA repair gene mutations on survival.

    Science.gov (United States)

    Yap, Kai Lee; Kiyotani, Kazuma; Tamura, Kenji; Antic, Tatjana; Jang, Miran; Montoya, Magdeline; Campanile, Alexa; Yew, Poh Yin; Ganshert, Cory; Fujioka, Tomoaki; Steinberg, Gary D; O'Donnell, Peter H; Nakamura, Yusuke

    2014-12-15

    Because of suboptimal outcomes in muscle-invasive bladder cancer even with multimodality therapy, determination of potential genetic drivers offers the possibility of improving therapeutic approaches and discovering novel prognostic indicators. Using pTN staging, we case-matched 81 patients with resected ≥pT2 bladder cancers for whom perioperative chemotherapy use and disease recurrence status were known. Whole-exome sequencing was conducted in 43 cases to identify recurrent somatic mutations and targeted sequencing of 10 genes selected from the initial screening in an additional 38 cases was completed. Mutational profiles along with clinicopathologic information were correlated with recurrence-free survival (RFS) in the patients. We identified recurrent novel somatic mutations in the gene UNC5C (9.9%), in addition to TP53 (40.7%), KDM6A (21.0%), and TSC1 (12.3%). Patients who were carriers of somatic mutations in DNA repair genes (one or more of ATM, ERCC2, FANCD2, PALB2, BRCA1, or BRCA2) had a higher overall number of somatic mutations (P = 0.011). Importantly, after a median follow-up of 40.4 months, carriers of somatic mutations (n = 25) in any of these six DNA repair genes had significantly enhanced RFS compared with noncarriers [median, 32.4 vs. 14.8 months; hazard ratio of 0.46, 95% confidence interval (CI), 0.22-0.98; P = 0.0435], after adjustment for pathologic pTN staging and independent of adjuvant chemotherapy usage. Better prognostic outcomes of individuals carrying somatic mutations in DNA repair genes suggest these mutations as favorable prognostic events in muscle-invasive bladder cancer. Additional mechanistic investigation into the previously undiscovered role of UNC5C in bladder cancer is warranted. ©2014 American Association for Cancer Research.

  9. Integrated physiological, biochemical and molecular analysis identifies important traits and mechanisms associated with differential response of rice genotypes to elevated temperature

    Directory of Open Access Journals (Sweden)

    Boghireddy eSailaja

    2015-11-01

    Full Text Available In changing climate, heat stress caused by high temperature poses a serious threat to rice cultivation. A multiple organizational analysis at physiological, biochemical and molecular level is required to fully understand the impact of elevated temperature in rice. This study was aimed at deciphering the elevated temperature response in eleven popular and mega rice cultivars widely grown in India. Physiological and biochemical traits specifically membrane thermostability (MTS, antioxidants, and photosynthesis were studied at vegetative and reproductive phases which were used to establish a correlation with grain yield under stress. Several useful traits in different genotypes were identified which will be important resource to develop high temperature tolerant rice cultivars. Interestingly, Nagina22 emerged as best performer in terms of yield as well as expression of physiological and biochemical traits at elevated temperature. It showed lesser relative injury, lesser reduction in chlorophyll content, increased super oxide dismutase, catalase and peroxidase activity, lesser reduction in net photosynthetic rate (PN, high transpiration rate (E and other photosynthetic/ fluorescence parameters contributing to least reduction in spikelet fertility and grain yield at elevated temperature. Further, expression of 14 genes including heat shock transcription factors and heat shock proteins was analyzed in Nagina22 (tolerant and Vandana (susceptible at flowering phase, strengthening the fact that N22 performs better at molecular level also during elevated temperature. This study shows that elevated temperature response is complex and involves multiple biological processes which are needed to be characterized to address the challenges of future climate extreme conditions.

  10. Machine Learning Analysis Identifies Drosophila Grunge/Atrophin as an Important Learning and Memory Gene Required for Memory Retention and Social Learning.

    Science.gov (United States)

    Kacsoh, Balint Z; Greene, Casey S; Bosco, Giovanni

    2017-11-06

    High-throughput experiments are becoming increasingly common, and scientists must balance hypothesis-driven experiments with genome-wide data acquisition. We sought to predict novel genes involved in Drosophila learning and long-term memory from existing public high-throughput data. We performed an analysis using PILGRM, which analyzes public gene expression compendia using machine learning. We evaluated the top prediction alongside genes involved in learning and memory in IMP, an interface for functional relationship networks. We identified Grunge/Atrophin ( Gug/Atro ), a transcriptional repressor, histone deacetylase, as our top candidate. We find, through multiple, distinct assays, that Gug has an active role as a modulator of memory retention in the fly and its function is required in the adult mushroom body. Depletion of Gug specifically in neurons of the adult mushroom body, after cell division and neuronal development is complete, suggests that Gug function is important for memory retention through regulation of neuronal activity, and not by altering neurodevelopment. Our study provides a previously uncharacterized role for Gug as a possible regulator of neuronal plasticity at the interface of memory retention and memory extinction. Copyright © 2017 Kacsoh et al.

  11. Relative Importance of History of Heart Failure Hospitalization and N-Terminal Pro-B-Type Natriuretic Peptide Level as Predictors of Outcomes in Patients With Heart Failure and Preserved Ejection Fraction.

    Science.gov (United States)

    Kristensen, Søren L; Jhund, Pardeep S; Køber, Lars; McKelvie, Robert S; Zile, Michael R; Anand, Inder S; Komajda, Michel; Cleland, John G F; Carson, Peter E; McMurray, John J V

    2015-06-01

    The aim of this study was to investigate N-terminal pro-B-type natriuretic peptide (NT-proBNP) levels and recent heart failure (HF) hospitalization as predictors of future events in heart failure - preserved ejection fraction (HF-PEF). Recently, doubt has been expressed about the value of a history of HF hospitalization as a predictor of adverse cardiovascular outcomes in patients with HF and HF-PEF. We estimated rates and adjusted hazard ratios (HRs) for the composite endpoint of cardiovascular death or HF hospitalization, according to history of recent HF hospitalization and baseline NT-proBNP level in the I-PRESERVE (Irbesartan in Heart Failure with Preserved systolic function) trial. Rates of composite endpoints in patients with (n = 804) and without (n = 1,963) a recent HF hospitalization were 12.78 (95% confidence interval [CI]: 11.47 to 14.24) and 4.49 (95% CI: 4.04 to 4.99) per 100 person-years, respectively (HR: 2.71; 95% CI: 2.33 to 3.16). For patients with NT-proBNP concentrations >360 pg/ml (n = 1,299), the event rate was 11.51 (95% CI: 10.54 to 12.58) compared to 3.04 (95% CI: 2.63 to 3.52) per 100 person-years in those with a lower level of NT-proBNP (n = 1468) (HR: 3.19; 95% CI: 2.68 to 3.80). In patients with no recent HF hospitalization and NT-proBNP ≤360 pg/ml (n = 1,187), the event rate was 2.43 (95% CI: 2.03 to 2.90) compared with 17.79 (95% CI: 15.77 to 20.07) per 100 person-years when both risk predictors were present (n = 523; HR: 6.18; 95% CI: 4.96 to 7.69). Recent hospitalization for HF or an elevated level of NT-proBNP identified patients at higher risk for cardiovascular events, and this risk was increased further when both factors were present. Copyright © 2015 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  12. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Directory of Open Access Journals (Sweden)

    Su Zhen

    2011-07-01

    Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.

  13. A method to identify important dynamical states in Boolean models of regulatory networks: application to regulation of stomata closure by ABA in A. thaliana.

    Science.gov (United States)

    Bugs, Cristhian A; Librelotto, Giovani R; Mombach, José C M

    2011-12-22

    We introduce a method to analyze the states of regulatory Boolean models that identifies important network states and their biological influence on the global network dynamics. It consists in (1) finding the states of the network that are most frequently visited and (2) the identification of variable and frozen nodes of the network. The method, along with a simulation that includes random features, is applied to the study of stomata closure by abscisic acid (ABA) in A. thaliana proposed by Albert and coworkers. We find that for the case of study, that the dynamics of wild and mutant networks have just two states that are highly visited in their space of states and about a third of all nodes of the wild network are variable while the rest remain frozen in True or False states. This high number of frozen elements explains the low cardinality of the space of states of the wild network. Similar results are observed in the mutant networks. The application of the method allowed us to explain how wild and mutants behave dynamically in the SS and determined an essential feature of the activation of the closure node (representing stomata closure), i.e. its synchronization with the AnionEm node (representing anion efflux at the plasma membrane). The dynamics of this synchronization explains the efficiency reached by the wild and each of the mutant networks. For the biological problem analyzed, our method allows determining how wild and mutant networks differ 'phenotypically'. It shows that the different efficiencies of stomata closure reached among the simulated wild and mutant networks follow from a dynamical behavior of two nodes that are always synchronized. Additionally, we predict that the involvement of the anion efflux at the plasma membrane is crucial for the plant response to ABA. The algorithm used in the simulations is available upon request.

  14. Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses

    Science.gov (United States)

    2011-01-01

    Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548

  15. Predictors of depression stigma

    Directory of Open Access Journals (Sweden)

    Jorm Anthony F

    2008-04-01

    Full Text Available Abstract Background To investigate and compare the predictors of personal and perceived stigma associated with depression. Method Three samples were surveyed to investigate the predictors: a national sample of 1,001 Australian adults; a local community sample of 5,572 residents of the Australian Capital Territory and Queanbeyan aged 18 to 50 years; and a psychologically distressed subset (n = 487 of the latter sample. Personal and Perceived Stigma were measured using the two subscales of the Depression Stigma Scale. Potential predictors included demographic variables (age, gender, education, country of birth, remoteness of residence, psychological distress, awareness of Australia's national depression initiative beyondblue, depression literacy and level of exposure to depression. Not all predictors were used for all samples. Results Personal stigma was consistently higher among men, those with less education and those born overseas. It was also associated with greater current psychological distress, lower prior contact with depression, not having heard of a national awareness raising initiative, and lower depression literacy. These findings differed from those for perceived stigma except for psychological distress which was associated with both higher personal and higher perceived stigma. Remoteness of residence was not associated with either type of stigma. Conclusion The findings highlight the importance of treating the concepts of personal and perceived stigma separately in designing measures of stigma, in interpreting the pattern of findings in studies of the predictors of stigma, and in designing, interpreting the impact of and disseminating interventions for stigma.

  16. Atrial Fibrillation Predictors: Importance of the Electrocardiogram.

    Science.gov (United States)

    German, David M; Kabir, Muammar M; Dewland, Thomas A; Henrikson, Charles A; Tereshchenko, Larisa G

    2016-01-01

    Atrial fibrillation (AF) is the most common arrhythmia in adults and is associated with significant morbidity and mortality. Substantial interest has developed in the primary prevention of AF, and thus the identification of individuals at risk for developing AF. The electrocardiogram (ECG) provides a wealth of information, which is of value in predicting incident AF. The PR interval and P wave indices (including P wave duration, P wave terminal force, P wave axis, and other measures of P wave morphology) are discussed with regard to their ability to predict and characterize AF risk in the general population. The predictive value of the QT interval, ECG criteria for left ventricular hypertrophy, and findings of atrial and ventricular ectopy are also discussed. Efforts are underway to develop models that predict AF incidence in the general population; however, at present, little information from the ECG is included in these models. The ECG provides a great deal of information on AF risk and has the potential to contribute substantially to AF risk estimation, but more research is needed. © 2015 Wiley Periodicals, Inc.

  17. Predictors of Racial Prejudice in White American Counseling Students

    Science.gov (United States)

    Castillo, Linda G.; Conoley, Collie W.; King, Jennifer; Rollins, Dahl; Rivera, Saori; Veve, Mia

    2006-01-01

    This study extends the research on racial prejudice by combining previously identified predictors into 1 study to determine their relative importance in contributing to racial prejudice. Results revealed that White racial identity significantly predicted racial prejudice when demographic variables were controlled. Implications of reducing racial…

  18. Measures for Predictors of Innovation Adoption

    Science.gov (United States)

    Chor, Ka Ho Brian; Wisdom, Jennifer P.; Olin, Su-Chin Serene; Hoagwood, Kimberly E.; Horwitz, Sarah M.

    2014-01-01

    Building on a narrative synthesis of adoption theories by Wisdom et al. (2013), this review identifies 118 measures associated with the 27 adoption predictors in the synthesis. The distribution of measures is uneven across the predictors and predictors vary in modifiability. Multiple dimensions and definitions of predictors further complicate measurement efforts. For state policymakers and researchers, more effective and integrated measurement can advance the adoption of complex innovations such as evidence-based practices. PMID:24740175

  19. The effect of a non-steroidal anti-inflammatory drug on two important predictors for accidental falls: postural balance and manual reaction time. A randomized, controlled pilot study.

    Science.gov (United States)

    Hegeman, Judith; Nienhuis, Bart; van den Bemt, Bart; Weerdesteyn, Vivian; van Limbeek, Jacques; Duysens, Jacques

    2011-04-01

    Accidental falls in older individuals are a major health and research topic. Increased reaction time and impaired postural balance have been determined as reliable predictors for those at risk of falling and are important functions of the central nervous system (CNS). An essential risk factor for falls is medication exposure. Amongst the medications related to accidental falls are the non-steroidal anti-inflammatory drugs (NSAIDs). About 1-10% of all users experience CNS side effects. These side effects, such as dizziness, headaches, drowsiness, mood alteration, and confusion, seem to be more common during treatment with indomethacin. Hence, it is possible that maintenance of (static) postural balance and swift reactions to stimuli are affected by exposure to NSAIDs, indomethacin in particular, consequently putting older individuals at a greater risk for accidental falls. The present study investigated the effect of a high indomethacin dose in healthy middle-aged individuals on two important predictors of falls: postural balance and reaction time. Twenty-two healthy middle-aged individuals (59.5 ± 4.7 years) participated in this double-blind, placebo-controlled, randomized crossover trial. Three measurements were conducted with a week interval each. A measurement consisted of postural balance as a single task and while concurrently performing a secondary cognitive task and reaction time tasks. For the first measurement indomethacin 75 mg (slow-release) or a visually identical placebo was randomly assigned. In total, five capsules were taken orally in the 2.5 days preceding assessment. The second measurement was without intervention, for the final one the first placebo group got indomethacin and vice versa. Repeated measures GLM revealed no significant differences between indomethacin, placebo, and baseline in any of the balance tasks. No differences in postural balance were found between the single and dual task conditions, or on the performance of the dual task

  20. The importance of Foxp3 antibody and fixation/permeabilization buffer combinations in identifying CD4+CD25+Foxp3+ regulatory T cells.

    Science.gov (United States)

    Law, Jacqueline P; Hirschkorn, Dale F; Owen, Rachel E; Biswas, Hope H; Norris, Philip J; Lanteri, Marion C

    2009-12-01

    Foxp3 is a key marker for CD4(+) regulatory T cells (T(regs)) and was used in developing a multiparameter flow cytometric panel to identify T(regs). Achieving reproducible staining and analysis first required optimization of Foxp3 staining. We present a comparative study of PCH101, 236A/E7, 3G3, 206D, 150D, and 259D/C7 clones of anti-human-Foxp3 antibodies used in combination with five different fixation/permeabilization buffers. Staining for CD25, CD152, and CD127 was also compared between fixation/permeabilization treatments. Promising antibody/buffer combinations were tested in a panel of peripheral blood mononuclear cells from 10 individuals, and then on fresh versus frozen cells from four individuals. Finally, different fluorochromes coupled to two representative antibodies were compared to optimize separation of Foxp3(+) from Foxp3(-) events. Foxp3 gates were set using two gating strategies based on CD127(+)CD25(-) "non-T(regs)" or based on isotype controls. For Foxp3 staining, the best conditions for fixation/permeabilization were obtained using the eBioscience Foxp3, Imgenex, BioLegend, and BD Foxp3 buffers. Comparing results from 10 subjects, 259D/C7, PCH101, 236A/E7, and 206D antibodies yielded statistically higher levels of Foxp3 cells than those by 150D and 3G3 antibodies (mean = 6.9, 5.1, 4.7, and 3.7% compared with 1.7, and 0.3% of CD25(+)Foxp3(+) events within CD4(+) cells, respectively). Importantly, the "nonspecificity" of some antibodies observed with a Foxp3 gate based on isotype controls could be eliminated by setting the Foxp3 gate on "non-T(regs)". Better separation of Foxp3(+) and Foxp3(-) populations was observed using the PCH101 clone coupled to Alexa647 compared with FITC or the 259D/C7 clone coupled to PE compared with Alexa488 fluorochrome. Foxp3 staining can be highly variable and depends on the choice of antibody/buffer pair and the fluorochrome used. Selecting the correct population for setting the Foxp3 gate is critical to avoid

  1. Multivariate analysis identifies the estradiol level at ovulation triggering as an independent predictor of the first trimester pregnancy-associated plasma protein-A level in IVF/ICSI pregnancies.

    Science.gov (United States)

    Giorgetti, C; Vanden Meerschaut, F; De Roo, C; Saunier, O; Quarello, E; Hairion, D; Penaranda, G; Chabert-Orsini, V; De Sutter, P

    2013-10-01

    Can independent predictors of pregnancy-associated plasma protein-A (PAPP-A) levels be identified in a group of women who conceived following IVF/ICSI? The significantly decreased PAPP-A level in IVF and ICSI pregnancies compared with non-IVF/ICSI pregnancies was correlated strongly with the serum estradiol (E2) level at ovulation triggering. The first trimester prenatal combined screening test for fetal aneuploidies in pregnancies conceived following assisted reproduction techniques (ART) is complicated by an alteration of the maternal biomarkers free β-hCG and PAPP-A, causing a higher false-positive rate compared with pregnancies which are conceived naturally. The use of controlled ovarian stimulation prior to IVF/ICSI is suggested to be the principle reason for these alterations of biomarkers in ART pregnancies. Between January 2010 and December 2011, 1474 women who conceived naturally and 374 women who conceived following IVF (n = 89), ICSI (n = 204) or intrauterine insemination (IUI, n = 81) were included in this retrospective study. Only singleton pregnancies were eligible for this study. For all women, serum analysis was performed in the same clinical laboratory. Measurement of nuchal translucency (NT) thickness was performed by four physicians belonging to the same infertility centre. First-trimester combined screening test of aneuploidy parameters (maternal age, PAPP-A and free β-hCG, NT thickness) were compared between non-ART and ART (IVF, ICSI and IUI) singleton pregnancies. Next, a minimal threshold E2 level at ovulation triggering was suggested for IVF/ICSI pregnancies above which the PAPP-A levels were significantly decreased compared with non-ART pregnancies. Finally, a multivariate analysis was performed to reveal independent predictors of PAPP-A level in IVF/ICSI pregnancies. We showed a decrease of the multiple of the median (MoM) PAPP-A level in IVF and ICSI singleton pregnancies compared with non-ART singleton pregnancies (P IVF and ICSI

  2. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; van den Hondel, C.A.M.J.J.; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative

  3. A novel screening method for cell wall mutants in Aspergillus niger identifies UDP-galactopyranose mutase as an important protein in fungal cell wall biosynthesis

    NARCIS (Netherlands)

    Damveld, R.A.; Franken, A.; Arentshorst, M.; Punt, P.J.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2008-01-01

    To identify cell wall biosynthetic genes in filamentous fungi and thus potential targets for the discovery of new antifungals, we developed a novel screening method for cell wall mutants. It is based on our earlier observation that the Aspergillus niger agsA gene, which encodes a putative a-glucan

  4. Prevalence and Clinical Import of Thoracic Injury Identified by Chest Computed Tomography but Not Chest Radiography in Blunt Trauma: Multicenter Prospective Cohort Study.

    Science.gov (United States)

    Langdorf, Mark I; Medak, Anthony J; Hendey, Gregory W; Nishijima, Daniel K; Mower, William R; Raja, Ali S; Baumann, Brigitte M; Anglin, Deirdre R; Anderson, Craig L; Lotfipour, Shahram; Reed, Karin E; Zuabi, Nadia; Khan, Nooreen A; Bithell, Chelsey A; Rowther, Armaan A; Villar, Julian; Rodriguez, Robert M

    2015-12-01

    Chest computed tomography (CT) diagnoses more injuries than chest radiography, so-called occult injuries. Wide availability of chest CT has driven substantial increase in emergency department use, although the incidence and clinical significance of chest CT findings have not been fully described. We determine the frequency, severity, and clinical import of occult injury, as determined by changes in management. These data will better inform clinical decisions, need for chest CT, and odds of intervention. Our sample included prospective data (2009 to 2013) on 5,912 patients at 10 Level I trauma center EDs with both chest radiography and chest CT at physician discretion. These patients were 40.6% of 14,553 enrolled in the parent study who had either chest radiography or chest CT. Occult injuries were pneumothorax, hemothorax, sternal or greater than 2 rib fractures, pulmonary contusion, thoracic spine or scapula fracture, and diaphragm or great vessel injury found on chest CT but not on preceding chest radiography. A priori, we categorized thoracic injuries as major (having invasive procedures), minor (observation or inpatient pain control >24 hours), or of no clinical significance. Primary outcome was prevalence and proportion of occult injury with major interventions of chest tube, mechanical ventilation, or surgery. Secondary outcome was minor interventions of admission rate or observation hours because of occult injury. Two thousand forty-eight patients (34.6%) had chest injury on chest radiography or chest CT, whereas 1,454 of these patients (71.0%, 24.6% of all patients) had occult injury. Of these, in 954 patients (46.6% of injured, 16.1% of total), chest CT found injuries not observed on immediately preceding chest radiography. In 500 more patients (24.4% of injured patients, 8.5% of all patients), chest radiography found some injury, but chest CT found occult injury. Chest radiography found all injuries in only 29.0% of injured patients. Two hundred and two

  5. What Does It Take to Change an Editor's Mind? Identifying Minimally Important Difference Thresholds for Peer Reviewer Rating Scores of Scientific Articles.

    Science.gov (United States)

    Callaham, Michael; John, Leslie K

    2018-01-05

    We define a minimally important difference for the Likert-type scores frequently used in scientific peer review (similar to existing minimally important differences for scores in clinical medicine). The magnitude of score change required to change editorial decisions has not been studied, to our knowledge. Experienced editors at a journal in the top 6% by impact factor were asked how large a change of rating in "overall desirability for publication" was required to trigger a change in their initial decision on an article. Minimally important differences were assessed twice for each editor: once assessing the rating change required to shift the editor away from an initial decision to accept, and the other assessing the magnitude required to shift away from an initial rejection decision. Forty-one editors completed the survey (89% response rate). In the acceptance frame, the median minimally important difference was 0.4 points on a scale of 1 to 5. Editors required a greater rating change to shift from an initial rejection decision; in the rejection frame, the median minimally important difference was 1.2 points. Within each frame, there was considerable heterogeneity: in the acceptance frame, 38% of editors did not change their decision within the maximum available range; in the rejection frame, 51% did not. To our knowledge, this is the first study to determine the minimally important difference for Likert-type ratings of research article quality, or in fact any nonclinical scientific assessment variable. Our findings may be useful for future research assessing whether changes to the peer review process produce clinically meaningful differences in editorial decisionmaking. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  6. Comparison of Spot Urine Protein to Creatinine Ratio to 24-Hour Proteinuria to Identify Important Change Over Time in Proteinuria in Lupus.

    Science.gov (United States)

    Medina-Rosas, Jorge; Su, Jiandong; Cook, Richard J; Sabapathy, Arthy; Touma, Zahi

    2017-09-01

    The aim of this study was to determine whether spot urine protein-to-creatinine ratio (PCR) accurately measures the change in proteinuria compared with 24-hour proteinuria (24H-P). This was a retrospective analysis on patients' paired visits and paired urine samples for PCR and 24H-P. Patients with both abnormal 24H-P (>0.5 g/d) and PCR (>0.05 g/mmol) or both normal 24H-P (≤0.5 g/d) and PCR (≤0.05 g/mmol) at baseline visit were identified.The first follow-up visit with partial recovery (50% decrease in proteinuria) or complete recovery (≤0.5 g/d) was identified for those with abnormal baseline 24H-P, and new proteinuria (>0.5 g/d) was identified for those with normal 24H-P. Twenty-four-hour urine collection and PCR end-point frequencies were compared. Twenty-four-hour urine collection results were converted to 24H-PCR. Twenty-four-hour PCR and PCR were utilized to measure the magnitude of change (by standardized response mean [SRM]) in patients who achieved the end points. Of 230 patients, at baseline, 95 patients had abnormal and 109 had normal 24H-P and PCR. On follow-up, 57 achieved partial recovery, and 53 achieved complete recovery by 24H-P. Standardized response mean was -1.03 and -1.10 for 24H-PCR and PCR, respectively. By PCR, 53 patients had partial recovery, and 27 had complete recovery. Standardized response mean was -1.25 and -0.86 by 24H-PCR and PCR, respectively.For new proteinuria, 28 patients were identified by 24H-P and 21 by PCR. Twenty-four-hour PCR SRM was 0.80, and PCR SRM was 0.68. Protein-to-creatinine ratio does not have sufficient accuracy compared with 24H-P for improvement and worsening to be used in lieu of 24H-P.

  7. Crowdsourcing novel childhood predictors of adult obesity.

    Science.gov (United States)

    Bevelander, Kirsten E; Kaipainen, Kirsikka; Swain, Robert; Dohle, Simone; Bongard, Josh C; Hines, Paul D H; Wansink, Brian

    2014-01-01

    Effective and simple screening tools are needed to detect behaviors that are established early in life and have a significant influence on weight gain later in life. Crowdsourcing could be a novel and potentially useful tool to assess childhood predictors of adult obesity. This exploratory study examined whether crowdsourcing could generate well-documented predictors in obesity research and, moreover, whether new directions for future research could be uncovered. Participants were recruited through social media to a question-generation website, on which they answered questions and were able to pose new questions that they thought could predict obesity. During the two weeks of data collection, 532 participants (62% female; age  =  26.5±6.7; BMI  =  29.0±7.0) registered on the website and suggested a total of 56 unique questions. Nineteen of these questions correlated with body mass index (BMI) and covered several themes identified by prior research, such as parenting styles and healthy lifestyle. More importantly, participants were able to identify potential determinants that were related to a lower BMI, but have not been the subject of extensive research, such as parents packing their children's lunch to school or talking to them about nutrition. The findings indicate that crowdsourcing can reproduce already existing hypotheses and also generate ideas that are less well documented. The crowdsourced predictors discovered in this study emphasize the importance of family interventions to fight obesity. The questions generated by participants also suggest new ways to express known predictors.

  8. Crowdsourcing novel childhood predictors of adult obesity.

    Directory of Open Access Journals (Sweden)

    Kirsten E Bevelander

    Full Text Available Effective and simple screening tools are needed to detect behaviors that are established early in life and have a significant influence on weight gain later in life. Crowdsourcing could be a novel and potentially useful tool to assess childhood predictors of adult obesity. This exploratory study examined whether crowdsourcing could generate well-documented predictors in obesity research and, moreover, whether new directions for future research could be uncovered. Participants were recruited through social media to a question-generation website, on which they answered questions and were able to pose new questions that they thought could predict obesity. During the two weeks of data collection, 532 participants (62% female; age  =  26.5±6.7; BMI  =  29.0±7.0 registered on the website and suggested a total of 56 unique questions. Nineteen of these questions correlated with body mass index (BMI and covered several themes identified by prior research, such as parenting styles and healthy lifestyle. More importantly, participants were able to identify potential determinants that were related to a lower BMI, but have not been the subject of extensive research, such as parents packing their children's lunch to school or talking to them about nutrition. The findings indicate that crowdsourcing can reproduce already existing hypotheses and also generate ideas that are less well documented. The crowdsourced predictors discovered in this study emphasize the importance of family interventions to fight obesity. The questions generated by participants also suggest new ways to express known predictors.

  9. Identifying most important skills for PhD students in Food Science and Technology: a comparison between industry and academic stakeholders

    Directory of Open Access Journals (Sweden)

    Chelo González-Martínez

    2015-10-01

    Full Text Available Nowadays, there is an increasing need of new skills for PhD students to face the future labour market prospects. PhD graduates must have qualities attractive not only in academia but also outside, in both manufacture and service-oriented enterprises, in small innovative companies, and in the civil services and public administration, among others. To know what the needs of these future employees are, is of great importance to be able to improve their personal and academic formation. The aim of this work was, in the framework of the EC-funded ISEKI_Food 4 network, to evaluate the most desirable specific and soft skills that PhD students should acquire by the end of their doctoral studies. To this aim, several surveys were conducted and sent to the different stakeholders (academia and food industry partners in order to collect the information needed. Results showed that competences related to research skills and techniques, research management, personal effectiveness and communication skills were considered to be the most valuable skills to be acquired by our PhD students to meet the future needs of the labour market.  The importance of these skills was appreciated differently, depending on the stakeholder. To sum up, some recommendations to integrate such valuable skills into the curricula of the PhD student are given.

  10. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Raina

    2016-01-01

    Full Text Available Background: Mini-mental state examination (MMSE scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Methodology: Principal component analysis (PCA was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Results: Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. Discussion: The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  11. Post-hoc principal component analysis on a largely illiterate elderly population from North-west India to identify important elements of mini-mental state examination.

    Science.gov (United States)

    Raina, Sunil Kumar; Chander, Vishav; Raina, Sujeet; Grover, Ashoo

    2016-01-01

    Mini-mental state examination (MMSE) scale measures cognition using specific elements that can be isolated, defined, and subsequently measured. This study was conducted with the aim to analyze the factorial structure of MMSE in a largely, illiterate, elderly population in India and to reduce the number of variables to a few meaningful and interpretable combinations. Principal component analysis (PCA) was performed post-hoc on the data generated by a research project conducted to estimate the prevalence of dementia in four geographically defined habitations in Himachal Pradesh state of India. Questions on orientation and registration account for high percentage of cumulative variance in comparison to other questions. The PCA conducted on the data derived from a largely, illiterate population reveals that the most important components to consider for the estimation of cognitive impairment in illiterate Indian population are temporal orientation, spatial orientation, and immediate memory.

  12. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 1: An analysis of potential prognostic factors.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Prognostic factors of bipolar disorder must be identified to assist in staging and treatment, and this may be done primarily during the initial psychiatric assessment. In fact, most of the prognostic factors, which determine disease outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic visit. We collected data from the clinical notes of 70 bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) outpatients; a psychiatric comorbidity was noted in 26 patients (37.1%). 60.9% (42 patients) reported anxiety features and 12 patients (17.6%) were noted to have obsessive-compulsive characteristics. Percentages reported in our results are of the sample for which the data was available. Anhedonia is a depressive feature that was present in most of the population where this data was available (92.2%, 59 patients) and 81.8% (54 patients) reported suicidal thoughts during a depressive episode. 74.6% (47 patients) had a family history of bipolar disorder, depression, suicide or psychosis. 27 patients (39.7%) reported current alcohol use and 14 patients (22.6%) current illicit drug use. A comparison between 10 prognostic factors found that only the correlations between current illicit drug use/previous illicit drug use (χ(2)=11.471, Palcohol use/previous alcohol use (χ(2)=31.510, Palcohol use (χ(2)=5.071, P=0.023) and previous alcohol use/family history (χ(2)=4.309, P=0.037) were almost statistically significant. 17 patients (24.3%) of the 70 bipolar patients were assigned to a care coordinator; we have evaluated the possible differences between the patients with or without a care coordinator on the basis of the presence of 10 possible prognostic factors and found no statistically significant differences between

  13. Improving a full-text search engine: the importance of negation detection and family history context to identify cases in a biomedical data warehouse.

    Science.gov (United States)

    Garcelon, Nicolas; Neuraz, Antoine; Benoit, Vincent; Salomon, Rémi; Burgun, Anita

    2017-05-01

    The repurposing of electronic health records (EHRs) can improve clinical and genetic research for rare diseases. However, significant information in rare disease EHRs is embedded in the narrative reports, which contain many negated clinical signs and family medical history. This paper presents a method to detect family history and negation in narrative reports and evaluates its impact on selecting populations from a clinical data warehouse (CDW). We developed a pipeline to process 1.6 million reports from multiple sources. This pipeline is part of the load process of the Necker Hospital CDW. We identified patients with "Lupus and diarrhea," "Crohn's and diabetes," and "NPHP1" from the CDW. The overall precision, recall, specificity, and F-measure were 0.85, 0.98, 0.93, and 0.91, respectively. The proposed method generates a highly accurate identification of cases from a CDW of rare disease EHRs. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  14. Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

    Directory of Open Access Journals (Sweden)

    Akihiro Yoshida

    Full Text Available Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE. After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

  15. Proteome Analysis Identifies the Dpr Protein of Streptococcus mutans as an Important Factor in the Presence of Early Streptococcal Colonizers of Tooth Surfaces

    Science.gov (United States)

    Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro

    2015-01-01

    Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242

  16. Foxtail millet NF-Y families: genome-wide survey and evolution analyses identified two functional genes important in abiotic stresses

    Directory of Open Access Journals (Sweden)

    Zhi-Juan eFeng

    2015-12-01

    Full Text Available It was reported that Nuclear Factor Y (NF-Y genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica, an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam NtERD10, NtLEA5, NtCAT, NtSOD or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC and contents of chlorophyll, superoxide dismutase (SOD, peroxidase (POD, catalase (CAT and malondialdehyde (MDA in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5 and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies.

  17. Dose to the Bladder Neck Is the Most Important Predictor for Acute and Late Toxicity After Low-Dose-Rate Prostate Brachytherapy: Implications for Establishing New Dose Constraints for Treatment Planning

    Energy Technology Data Exchange (ETDEWEB)

    Hathout, Lara; Folkert, Michael R.; Kollmeier, Marisa A.; Yamada, Yoshiya [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Cohen, Gil' ad N. [Department of Medical Physics, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Zelefsky, Michael J., E-mail: zelefskm@mskcc.org [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, New York (United States)

    2014-10-01

    Purpose: To identify an anatomic structure predictive for acute (AUT) and late (LUT) urinary toxicity in patients with prostate cancer treated with low-dose-rate brachytherapy (LDR) with or without external beam radiation therapy (EBRT). Methods and Materials: From July 2002 to January 2013, 927 patients with prostate cancer (median age, 66 years) underwent LDR brachytherapy with Iodine 125 (n=753) or Palladium 103 (n=174) as definitive treatment (n=478) and as a boost (n=449) followed by supplemental EBRT (median dose, 50.4 Gy). Structures contoured on the computed tomographic (CT) scan on day 0 after implantation included prostate, urethra, bladder, and the bladder neck, defined as 5 mm around the urethra between the catheter balloon and the prostatic urethra. AUT and LUT were assessed with the Common Terminology Criteria for Adverse Events, version4. Clinical and dosimetric factors associated with AUT and LUT were analyzed with Cox regression and receiver operating characteristic analysis to calculate area under the receiver operator curve (ROC) (AUC). Results: Grade ≥2 AUT and grade ≥2 LUT occurred in 520 patients (56%) and 154 patients (20%), respectively. No grade 4 toxicities were observed. Bladder neck D2cc retained a significant association with AUT (hazard ratio [HR], 1.03; 95% confidence interval [CI], 1.03-1.04; P<.0001) and LUT (HR, 1.01; 95% CI, 1.00-1.03; P=.014) on multivariable analysis. In a comparison of bladder neck with the standard dosimetric variables by use of ROC analysis (prostate V100 >90%, D90 >100%, V150 >60%, urethra D20 >130%), bladder neck D2cc >50% was shown to have the strongest prognostic power for AUT (AUC, 0.697; P<.0001) and LUT (AUC, 0.620; P<.001). Conclusions: Bladder neck D2cc >50% was the strongest predictor for grade ≥2 AUT and LUT in patients treated with LDR brachytherapy. These data support inclusion of bladder neck constraints into brachytherapy planning to decrease urinary toxicity.

  18. Identifying talented young soccer players: conditional, anthropometrical and physiological characteristics as predictors of performance. [Identificación de jóvenes talentos en fútbol: características condicionales, antropométricas y fisiológicas como predictores del rendimiento].

    Directory of Open Access Journals (Sweden)

    Iraia Bidaurrazaga-Letona

    2015-01-01

    Full Text Available he aim of this study was to provide a complete profile of elite young soccer players. Fifty-five players of the Under-14 category of Athletic Club Bilbao participated in this study. Players were classified into 4 playing positions: forwards (n=30, midfielders (n=15, defenders (n=37 and goalkeepers (n=15. Complete anthropometry, chronological age (CA, age at peak height velocity, 15-m sprint test, agility test, Yo-Yo IT level 1 (Yo-Yo IR1, counter-movement jump and hand dynamometry were measured. Results were transformed into z-scores and summed up to make two performance composites (SCORE and SCOREHG. One-way analysis of variance and a Bonferroni post-hoc test were used to examine the differences between playing positions. Multiple linear regression analysis was performed to estimate the contribution of independent variables to performance indicators. The level of significance was set at P<0.05. Significant differences were observed between playing positions in body mass and height (P<0.05; CA, maturity offset and muscle % (P<0.01; sum of skinfolds, fat %, endomorphy, sprint and agility tests (P<0.001. Stepwise regression analysis revealed that CA and sum of skinfolds were the most important predictors of performance. Collectively, playing positions were characterised by specific anthropometrical characteristics whereas no significant positional differences were observed in performance. This study provides further insight concerning coaches’ practice of selecting young soccer players because of anthropometrical characteristics rather than for performance advantages. Resumen El objetivo de este estudio fue analizar el perfil antropométrico y fisiológico de los futbolistas jóvenes del Athletic Club Bilbao. Cincuenta y cinco jugadores de la categoría Sub-14 participaron en el estudio. Los jugadores se clasificaron en 4 posiciones de juego: delanteros (n=30, centrocampistas (n=15, defensas (n=37 y porteros (n=15. Se realizaron las siguientes

  19. Predictors of Transience among Homeless Emerging Adults

    Science.gov (United States)

    Ferguson, Kristin M.; Bender, Kimberly; Thompson, Sanna J.

    2014-01-01

    This study identified predictors of transience among homeless emerging adults in three cities. A total of 601 homeless emerging adults from Los Angeles, Austin, and Denver were recruited using purposive sampling. Ordinary least squares regression results revealed that significant predictors of greater transience include White ethnicity, high…

  20. Predictors of posttreatment drinking outcomes in patients with alcohol dependence.

    Science.gov (United States)

    Flórez, Gerardo; Saiz, Pilar A; García-Portilla, Paz; De Cos, Francisco J; Dapía, Sonia; Alvarez, Sandra; Nogueiras, Luis; Bobes, Julio

    2015-01-01

    This cohort study examined how predictors of alcohol dependence treatment outcomes work together over time by comparing pretreatment and posttreatment predictors. A sample of 274 alcohol-dependent patients was recruited and assessed at baseline, 6 months after treatment initiation (end of the active intervention phase), and 18 months after treatment initiation (end of the 12-month research follow-up phase). At each assessment point, the participants completed a battery of standardized tests [European Addiction Severity Index (EuropASI), Obsessive Compulsive Drinking Scale (OCDS), Alcohol Timeline Followback (TLFB), Fagerström, and International Personality Disorder Examination (IPDE)] that measured symptom severity and consequences; biological markers of alcohol consumption were also tested at each assessment point. A sequential strategy with univariate and multivariate analyses was used to identify how pretreatment and posttreatment predictors influence outcomes up to 1 year after treatment. Pretreatment variables had less predictive power than posttreatment ones. OCDS scores and biological markers of alcohol consumption were the most significant variables for the prediction of posttreatment outcomes. Prior pharmacotherapy treatment and relapse prevention interventions were also associated with posttreatment outcomes. The findings highlight the positive impact of pharmacotherapy during the first 6 months after treatment initiation and of relapse prevention during the first year after treatment and how posttreatment predictors are more important than pretreatment predictors.

  1. Psychosocial predictors of musculoskeletal symptoms: the relevance of mediated and moderated relationships / Preditores psicossociais de sintomas osteomusculares: a importância das relações de mediação e moderação

    Directory of Open Access Journals (Sweden)

    Fernanda Amaral Pinheiro

    2006-01-01

    Full Text Available This study aimed to develop a theoretical model that associates psychosocial variables in occupational settings to musculoskeletal symptoms, looking for possible relationships of mediation and moderation. A sample of 494 government workers of a bank (owned and administered by the government responded to a questionnaire that included psychosocial variable measurements of the occupational setting, stress reactivity (emotional exhaustion, coping styles and a scale of musculoskeletal symptoms frequency, besides questions on habits and lifestyle. The results showed that emotional exhaustion was the most powerful predictor of symptoms report, which indicates the stress reaction is a path by which psychosocial aspects may affect musculoskeletal health.

  2. Physician Rating Websites: What Aspects Are Important to Identify a Good Doctor, and Are Patients Capable of Assessing Them? A Mixed-Methods Approach Including Physicians' and Health Care Consumers' Perspectives.

    Science.gov (United States)

    Rothenfluh, Fabia; Schulz, Peter J

    2017-05-01

    Physician rating websites (PRWs) offer health care consumers the opportunity to evaluate their doctor anonymously. However, physicians' professional training and experience create a vast knowledge gap in medical matters between physicians and patients. This raises ethical concerns about the relevance and significance of health care consumers' evaluation of physicians' performance. To identify the aspects physician rating websites should offer for evaluation, this study investigated the aspects of physicians and their practice relevant for identifying a good doctor, and whether health care consumers are capable of evaluating these aspects. In a first step, a Delphi study with physicians from 4 specializations was conducted, testing various indicators to identify a good physician. These indicators were theoretically derived from Donabedian, who classifies quality in health care into pillars of structure, process, and outcome. In a second step, a cross-sectional survey with health care consumers in Switzerland (N=211) was launched based on the indicators developed in the Delphi study. Participants were asked to rate the importance of these indicators to identify a good physician and whether they would feel capable to evaluate those aspects after the first visit to a physician. All indicators were ordered into a 4×4 grid based on evaluation and importance, as judged by the physicians and health care consumers. Agreement between the physicians and health care consumers was calculated applying Holsti's method. In the majority of aspects, physicians and health care consumers agreed on what facets of care were important and not important to identify a good physician and whether patients were able to evaluate them, yielding a level of agreement of 74.3%. The two parties agreed that the infrastructure, staff, organization, and interpersonal skills are both important for a good physician and can be evaluated by health care consumers. Technical skills of a doctor and outcomes

  3. Discrimination, acculturation and other predictors of depression among pregnant Hispanic women.

    Science.gov (United States)

    Walker, Janiece L; Ruiz, R Jeanne; Chinn, Juanita J; Marti, Nathan; Ricks, Tiffany N

    2012-01-01

    The purpose of our study was to examine the effects of socioeconomic status, acculturative stress, discrimination, and marginalization as predictors of depression in pregnant Hispanic women. A prospective observational design was used. Central and Gulf coast areas of Texas in obstetrical offices. A convenience sample of 515 pregnant, low income, low medical risk, and self-identified Hispanic women who were between 22-24 weeks gestation was used to collect data. The predictor variables were socioeconomic status, discrimination, acculturative stress, and marginalization. The outcome variable was depression. Education, frequency of discrimination, age, and Anglo marginality were significant predictors of depressive symptoms in a linear regression model, F (6, 458) = 8.36, Pdiscrimination was the strongest positive predictor of increased depressive symptoms. It is important that health care providers further understand the impact that age and experiences of discrimination throughout the life course have on depressive symptoms during pregnancy.

  4. Bagging Weak Predictors

    DEFF Research Database (Denmark)

    Lukas, Manuel; Hillebrand, Eric

    Relations between economic variables can often not be exploited for forecasting, suggesting that predictors are weak in the sense that estimation uncertainty is larger than bias from ignoring the relation. In this paper, we propose a novel bagging predictor designed for such weak predictor variab...

  5. Facebook Addiction: Onset Predictors.

    Science.gov (United States)

    Biolcati, Roberta; Mancini, Giacomo; Pupi, Virginia; Mugheddu, Valeria

    2018-05-23

    Worldwide, Facebook is becoming increasingly widespread as a communication platform. Young people especially use this social networking site daily to maintain and establish relationships. Despite the Facebook expansion in the last few years and the widespread acceptance of this social network, research into Facebook Addiction (FA) is still in its infancy. Hence, the potential predictors of Facebook overuse represent an important matter for investigation. This study aimed to deepen the understanding of the relationship between personality traits, social and emotional loneliness, life satisfaction, and Facebook addiction. A total of 755 participants (80.3% female; n = 606) aged between 18 and 40 (mean = 25.17; SD = 4.18) completed the questionnaire packet including the Bergen Facebook Addiction Scale, the Big Five, the short version of Social and Emotional Loneliness Scale for Adults, and the Satisfaction with Life Scale. A regression analysis was used with personality traits, social, family, romantic loneliness, and life satisfaction as independent variables to explain variance in Facebook addiction. The findings showed that Conscientiousness, Extraversion, Neuroticism, and Loneliness (Social, Family, and Romantic) were strong significant predictors of FA. Age, Openness, Agreeableness, and Life Satisfaction, although FA-related variables, were not significant in predicting Facebook overuse. The risk profile of this peculiar behavioral addiction is also discussed.

  6. Predictors of Suicidal Ideation among High School Students by Gender in South Korea

    Science.gov (United States)

    Park, Hyun Sook; Schepp, Karen G.; Jang, Eun Hee; Koo, Hyun Young

    2006-01-01

    The purpose of this study was to examine the evidence to determine if there are gender differences in suicidal ideation of adolescents. This study examined the main effect of risk factors from 5 domains and protective factors from 1 domain in relation to suicidal ideation by gender and identified the most important predictors of suicidal ideation…

  7. HIV and other predictors of serum folate, serum ferritin, and hemoglobin in pregnancy

    DEFF Research Database (Denmark)

    Friis, Henrik; Gomo, E; Kæstel, Pernille

    2001-01-01

    BACKGROUND: Folate and iron status and hemoglobin concentrations are important to maternal and infant health. OBJECTIVE: Our goal was to identify predictors of serum folate, serum ferritin, and hemoglobin. DESIGN: This was a cross-sectional study of 1669 pregnant women (22-35 wk of gestation) in ...

  8. Back/joint pain, illness perceptions and coping are important predictors of quality of life and work productivity in patients with inflammatory bowel disease: a 12-month longitudinal study.

    Science.gov (United States)

    van der Have, Mike; Brakenhoff, Lianne K P M; van Erp, Sanne J H; Kaptein, Ad A; Leenders, Max; Scharloo, Margreet; Veenendaal, Roeland A; van der Heijde, Désirée M F M; van der Meulen-de Jong, Andrea E; Hommes, Daan W; Fidder, Herma H

    2015-03-01

    Back and joint pain are the most common extraintestinal symptoms reported by patients with inflammatory bowel disease (IBD). We assessed the impact of back/joint pain, illness perceptions, and coping on quality of life (QOL) and work productivity in patients with IBD. Our cohort included 155 IBD patients with and 100 without arthropathy. Arthropathy was defined as daily back pain for ≥3 months and/or peripheral joint pain and/or joint swelling over the last year. At baseline and at 12 months, patients completed questionnaires on the extent of back/joint pain, IBD disease activity, illness perceptions, coping, QOL, and work productivity. The impact of back/joint pain, illness perceptions and coping on QOL and work productivity was determined, using linear mixed models. In total, 204 IBD patients (72% Crohn's disease, 40% male, mean age 44 ± 14 years) completed questionnaires at both time points. At both time points, IBD patients with back/joint pain reported a significantly lower QOL and work productivity compared with IBD patients without back/joint pain. Predictors of low QOL were back/joint pain (β = -1.04, 95% confidence interval [CI] -1.40, -0.68), stronger beliefs about the illness consequences (β = -0.39, 95% CI -0.59, -0.18) and emotional impact of IBD (β = -0.47, 95% CI -0.66, -0.28), and the coping strategy 'decreasing activity' (β = -0.26, 95% CI -0.48, -0.03). Predictors of work productivity were back/joint pain (β = 0.22, 95% CI 0.07, 0.37) and illness consequences (β = 0.14, 95% CI 0.06, 0.22). Back/joint pain, illness perceptions, and coping are significant predictors of QOL and work productivity, after controlling for disease activity. Copyright © 2015 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  9. Predictors of nurse manager stress: a dominance analysis of potential work environment stressors.

    Science.gov (United States)

    Kath, Lisa M; Stichler, Jaynelle F; Ehrhart, Mark G; Sievers, Andree

    2013-11-01

    Nurse managers have important but stressful jobs. Clinical or bedside nurse predictors of stress have been studied more frequently, but less has been done on work environment predictors for those in this first-line leadership role. Understanding the relative importance of those work environment predictors could be used to help identify the most fruitful areas for intervention, potentially improving recruitment and retention for nurse managers. Using Role Stress Theory and the Job Demands-Resources Theory, a model was tested examining the relative importance of five potential predictors of nurse manager stress (i.e., stressors). The work environment stressors included role ambiguity, role overload, role conflict, organizational constraints, and interpersonal conflict. A quantitative, cross-sectional survey study was conducted with a convenience sample of 36 hospitals in the Southwestern United States. All nurse managers working in these 36 hospitals were invited to participate. Of the 636 nurse managers invited, 480 responded, for a response rate of 75.5%. Questionnaires were distributed during nursing leadership meetings and were returned in person (in sealed envelopes) or by mail. Because work environment stressors were correlated, dominance analysis was conducted to examine which stressors were the most important predictors of nurse manager stress. Role overload was the most important predictor of stress, with an average of 13% increase in variance explained. The second- and third-most important predictors were organizational constraints and role conflict, with an average of 7% and 6% increase in variance explained, respectively. Because other research has shown deleterious effects of nurse manager stress, organizational leaders are encouraged to help nurse managers reduce their actual and/or perceived role overload and organizational constraints. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Predictors of physical activity change among adults using observational designs.

    Science.gov (United States)

    Rhodes, Ryan E; Quinlan, Alison

    2015-03-01

    Regular physical activity (PA) is foundational to human health, yet most people are inactive. A sound understanding of the determinants of PA may be instructive for building interventions and/or identifying critical target groups to promote PA. Most research on PA correlates has been biased by cross-sectional or passive prospective designs that fail to examine within-person analysis of PA change. The purpose of this review was to collect and appraise the available literature on the predictors of PA change conceived broadly in terms of increases/decreases from baseline assessment as well as specifically in terms of adoption and maintenance. Eligible studies were from English, peer-reviewed published articles that examined predictors of natural change of PA over 3 months + using observational (non-experimental) data in adult samples. Searches were performed from June 2012 to January 2014 in eight databases. Sixty-seven independent data-sets, from 12 countries, primarily of medium quality/risk of bias, were identified with 26 correlates spanning demographic, behavioral, intra-individual, inter-individual, and environmental categories. Only intention and the onset of motherhood could reliably predict overall PA change. Among datasets configured to predict PA adoption, affective judgments and behavioral processes of change were the only reliable predictors, although both only have a small number of available studies. There were no reliable predictors of maintenance when compared to PA relapse. The results underscore the importance of individual-level motivation and behavioral regulation in PA change, but also denote critical social variables. These findings, however, are constrained by PA measurement bias and limited studies that employed time-varying covariation between predictor variables and PA.

  11. Non-alcoholic fatty liver disease and impaired proinsulin conversion as newly identified predictors of the long-term non-response to a lifestyle intervention for diabetes prevention: results from the TULIP study.

    Science.gov (United States)

    Schmid, Vera; Wagner, Robert; Sailer, Corinna; Fritsche, Louise; Kantartzis, Konstantinos; Peter, Andreas; Heni, Martin; Häring, Hans-Ulrich; Stefan, Norbert; Fritsche, Andreas

    2017-12-01

    Lifestyle intervention is effective to prevent type 2 diabetes. However, a considerable long-term non-response occurs to a standard lifestyle intervention. We investigated which risk phenotypes at baseline and their changes during the lifestyle intervention predict long-term glycaemic non-response to the intervention. Of 300 participants at high risk for type 2 diabetes who participated in a 24 month lifestyle intervention with diet modification and increased physical activity, 190 participants could be re-examined after 8.7 ± 1.6 years. All individuals underwent a five-point 75 g OGTT and measurements of body fat compartments and liver fat content with MRI and spectroscopy at baseline, 9 and 24 months during the lifestyle intervention, and at long-term follow-up. Fasting proinsulin to insulin conversion (PI/I ratio) and insulin sensitivity and secretion were calculated from the OGTT. Non-response to lifestyle intervention was defined as no decrease in glycaemia, i.e. no decrease in AUC for glucose at 0-120 min during OGTT (AUCglucose 0-120 min ). Before the lifestyle intervention, 56% of participants had normal glucose regulation and 44% individuals had impaired fasting glucose and/or impaired glucose tolerance. At long-term follow-up, 11% had developed diabetes. Multivariable regression analysis with adjustment for age, sex, BMI and change in BMI during the lifestyle intervention revealed that baseline insulin secretion and insulin sensitivity, as well as change in insulin sensitivity during the lifestyle intervention, predicted long-term glycaemic control after 9 years. In addition, increased hepatic lipid content as well as impaired fasting proinsulin conversion at baseline were newly detected phenotypes that independently predicted long-term glycaemic control. Increased hepatic lipid content and impaired proinsulin conversion are new predictors, independent of change in body weight, for non-response to lifestyle intervention in addition to the

  12. Predictors of BMI Vary along the BMI Range of German Adults – Results of the German National Nutrition Survey II

    Science.gov (United States)

    Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid

    2017-01-01

    Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069

  13. Principal component analysis of normalized full spectrum mass spectrometry data in multiMS-toolbox: An effective tool to identify important factors for classification of different metabolic patterns and bacterial strains.

    Science.gov (United States)

    Cejnar, Pavel; Kuckova, Stepanka; Prochazka, Ales; Karamonova, Ludmila; Svobodova, Barbora

    2018-06-15

    Explorative statistical analysis of mass spectrometry data is still a time-consuming step. We analyzed critical factors for application of principal component analysis (PCA) in mass spectrometry and focused on two whole spectrum based normalization techniques and their application in the analysis of registered peak data and, in comparison, in full spectrum data analysis. We used this technique to identify different metabolic patterns in the bacterial culture of Cronobacter sakazakii, an important foodborne pathogen. Two software utilities, the ms-alone, a python-based utility for mass spectrometry data preprocessing and peak extraction, and the multiMS-toolbox, an R software tool for advanced peak registration and detailed explorative statistical analysis, were implemented. The bacterial culture of Cronobacter sakazakii was cultivated on Enterobacter sakazakii Isolation Agar, Blood Agar Base and Tryptone Soya Agar for 24 h and 48 h and applied by the smear method on an Autoflex speed MALDI-TOF mass spectrometer. For three tested cultivation media only two different metabolic patterns of Cronobacter sakazakii were identified using PCA applied on data normalized by two different normalization techniques. Results from matched peak data and subsequent detailed full spectrum analysis identified only two different metabolic patterns - a cultivation on Enterobacter sakazakii Isolation Agar showed significant differences to the cultivation on the other two tested media. The metabolic patterns for all tested cultivation media also proved the dependence on cultivation time. Both whole spectrum based normalization techniques together with the full spectrum PCA allow identification of important discriminative factors in experiments with several variable condition factors avoiding any problems with improper identification of peaks or emphasis on bellow threshold peak data. The amounts of processed data remain still manageable. Both implemented software utilities are available

  14. Formal consensus to identify clinically important changes in management resulting from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway.

    Science.gov (United States)

    Pufulete, Maria; Brierley, Rachel C; Bucciarelli-Ducci, Chiara; Greenwood, John P; Dorman, Stephen; Anderson, Richard A; Harris, Jessica; McAlindon, Elisa; Rogers, Chris A; Reeves, Barnaby C

    2017-06-22

    To define important changes in management arising from the use of cardiovascular magnetic resonance (CMR) in patients who activate the primary percutaneous coronary intervention (PPCI) pathway. Formal consensus study using literature review and cardiologist expert opinion to formulate consensus statements and setting up a consensus panel to review the statements (by completing a web-based survey, attending a face-to-face meeting to discuss survey results and modify the survey to reflect group discussion and completing the modified survey to determine which statements were in consensus). Formulation of consensus statements: four cardiologists (two CMR and two interventional) and six non-clinical researchers. Formal consensus: seven cardiologists (two CMR and three interventional, one echocardiography and one heart failure). Forty-nine additional cardiologists completed the modified survey. Thirty-seven draft statements describing changes in management following CMR were generated; these were condensed into 12 statements and reviewed through the formal consensus process. Three of 12 statements were classified in consensus in the first survey; these related to the role of CMR in identifying the cause of out-of-hospital cardiac arrest, providing a definitive diagnosis in patients found to have unobstructed arteries on angiography and identifying patients with left ventricular thrombus. Two additional statements were in consensus in the modified survey, relating to the ability of CMR to identify patients who have a poor prognosis after PPCI and assess ischaemia and viability in patients with multivessel disease. There was consensus that CMR leads to clinically important changes in management in five subgroups of patients who activate the PPCI pathway. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  15. MicroRNAs regulate T-cell production of interleukin-9 and identify hypoxia-inducible factor-2α as an important regulator of T helper 9 and regulatory T-cell differentiation.

    Science.gov (United States)

    Singh, Yogesh; Garden, Oliver A; Lang, Florian; Cobb, Bradley S

    2016-09-01

    MicroRNAs (miRNAs) regulate many aspects of helper T cell (Th) development and function. Here we found that they are required for the suppression of interleukin-9 (IL-9) expression in Th9 cells and other Th subsets. Two highly related miRNAs (miR-15b and miR-16) that we previously found to play an important role in regulatory T (Treg) cell differentiation were capable of suppressing IL-9 expression when they were over-expressed in Th9 cells. We used these miRNAs as tools to identify novel regulators of IL-9 expression and found that they could regulate the expression of Epas1, which encodes hypoxia-inducible factor (HIF)-2α. HIF proteins regulate metabolic pathway usage that is important in determining appropriate Th differentiation. The related protein, HIF-1α enhances Th17 differentiation and inhibits Treg cell differentiation. Here we found that HIF-2α was required for IL-9 expression in Th9 cells, but its expression was not sufficient in other Th subsets. Furthermore, HIF-2α suppressed Treg cell differentiation like HIF-1α, demonstrating both similar and distinct roles of the HIF proteins in Th differentiation and adding a further dimension to their function. Ironically, even though miR-15b and miR-16 suppressed HIF-2α expression in Treg cells, inhibiting their function in Treg cells did not lead to an increase in IL-9 expression. Therefore, the physiologically relevant miRNAs that regulate IL-9 expression in Treg cells and other subsets remain unknown. Nevertheless, the analysis of miR-15b and miR-16 function led to the discovery of the importance of HIF-2α so this work demonstrated the utility of studying miRNA function to identify novel regulatory pathways in helper T-cell development. © 2016 John Wiley & Sons Ltd.

  16. Predictors of Contraceptive Use in Ghana: Role of Religion, Region of Residence, Ethnicity and Education

    Directory of Open Access Journals (Sweden)

    Daniel Adjei

    2014-10-01

    Full Text Available Effective contraceptive use prevents most reproductive health challenges. The aim of this study is to identify the demographic predictors of contraceptive usage in Ghana. Using a logistic regression analysis, a sample size of 4916 women of the Ghana Demographic and Health Survey (GDHS 2008 were selected. Results showed that religion is the most important predictor among the demographic factors. Ethnicity of the women, level of education and region of residence were also found to be statistically significantly. Contraceptive health promotion should be intensified as the best option for preventing unintended pregnancies in the respective variables.

  17. RS-WebPredictor

    DEFF Research Database (Denmark)

    Zaretzki, J.; Bergeron, C.; Huang, T.-W.

    2013-01-01

    Regioselectivity-WebPredictor (RS-WebPredictor) is a server that predicts isozyme-specific cytochrome P450 (CYP)-mediated sites of metabolism (SOMs) on drug-like molecules. Predictions may be made for the promiscuous 2C9, 2D6 and 3A4 CYP isozymes, as well as CYPs 1A2, 2A6, 2B6, 2C8, 2C19 and 2E1....... RS-WebPredictor is the first freely accessible server that predicts the regioselectivity of the last six isozymes. Server execution time is fast, taking on average 2s to encode a submitted molecule and 1s to apply a given model, allowing for high-throughput use in lead optimization projects.......Availability: RS-WebPredictor is accessible for free use at http://reccr.chem.rpi.edu/ Software/RS-WebPredictor....

  18. Early Predictors of High School Mathematics Achievement

    Science.gov (United States)

    Siegler, Robert S.; Duncan, Greg J.; Davis-Kean, Pamela E.; Duckworth, Kathryn; Claessens, Amy; Engel, Mimi; Susperreguy, Maria Ines; Meichu, Chen

    2012-01-01

    Identifying the types of mathematics content knowledge that are most predictive of students' long-term learning is essential for improving both theories of mathematical development and mathematics education. To identify these types of knowledge, we examined long-term predictors of high school students' knowledge of algebra and overall mathematics…

  19. Predictors of long-term effect from education and exercise in patients with knee and hip pain

    DEFF Research Database (Denmark)

    Skou, Søren Thorgaard; Simonsen, Mikkel Elstrup; Odgaard, Anders

    2014-01-01

    in pain (p self-efficacy at three months (Beta = 0.304) was a predictor of one-year improvement in EQ-5D (p = 0.01). CONCLUSION: The identified predictors highlight the importance of combining education and exercise. This study indicates that good long-term treatment results...... baseline to one year were dependent variables in regression analyses, while changes from baseline to 3 months and absolute results at three months in physical performance (30-second chair stand test) and self-efficacy were predictor variables. RESULTS: A total of 79/82 patients completed the one......-year follow-up. Improvements in pain and EQ-5D at three months were maintained at one year (p self-efficacy from baseline to three months (Beta = -0.369) and 30-second chair stand test (Beta = -0.251) and self-efficacy at three months (Beta = -0.492) were predictors of one-year improvement...

  20. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  1. Meta-Analyses of Predictors of Hope in Adolescents.

    Science.gov (United States)

    Yarcheski, Adela; Mahon, Noreen E

    2016-03-01

    The purposes of this study were to identify predictors of hope in the literature reviewed, to use meta-analysis to determine the mean effect size (ES) across studies between each predictor and hope, and to examine four moderators on each predictor-hope relationship. Using preferred reporting items for systematic reviews and meta-analyses (PRISMA) guidelines for the literature reviewed, 77 published studies or doctoral dissertations completed between 1990 and 2012 met the inclusion criteria. Eleven predictors of hope were identified and each predictor in relation to hope was subjected to meta-analysis. Five predictors (positive affect, life satisfaction, optimism, self-esteem, and social support) of hope had large mean ESs, 1 predictor (depression) had a medium ES, 4 predictors (negative affect, stress, academic achievement, and violence) had small ESs, and 1 predictor (gender) had a trivial ES. Findings are interpreted for the 11 predictors in relation to hope. Limitations and conclusions are addressed; future studies are recommended. © The Author(s) 2014.

  2. Some predictors of life goals in Slovenia and Croatia

    Directory of Open Access Journals (Sweden)

    Olga Poljšak Škraban

    2008-04-01

    Full Text Available Personal goals and interests play an important role in human development because they orient people's life planning, decision-making and also, therefore, their future life course. The article presents the findings of a research which explores the eventual differences between Slovenian and Croatian sample in agency-oriented and communion-oriented life goals and the analysis of significant predictors of above mentioned life goals on both samples. The research included 924 adults of both genders, aged between 21 and 70 years from Slovenia and Croatia. In the study we used the scale of Goals (Pohlman and Brunstein, 1997 and a set of questions regarding various participant's life domains and their perceived importance. The results show significant differences on agency- oriented and communion-oriented life goals between the Slovenian and Croatian sample; in both cases croatian participants reach higher results than those from slovenina sample. As significant predictors in both samples were identified (a age and importance of effective use of free time for agency-oriented goals, and (b and gender, parenthood, importance of parenthood and importance of effective use of free time for communion-oriented life goals. The differences in results are explained by respective levels of social modernisation and social welfare, given the fact the Slovenian respondents are embedded in the social environment that offers more possibilities for fullfilment of their life goals, and are closer to postmaterialism and individualism.a

  3. A putative biomarker signature for clinically effective AKT inhibition: correlation of in vitro, in vivo and clinical data identifies the importance of modulation of the mTORC1 pathway.

    Science.gov (United States)

    Cheraghchi-Bashi, Azadeh; Parker, Christine A; Curry, Ed; Salazar, Jean-Frederic; Gungor, Hatice; Saleem, Azeem; Cunnea, Paula; Rama, Nona; Salinas, Cristian; Mills, Gordon B; Morris, Shannon R; Kumar, Rakesh; Gabra, Hani; Stronach, Euan A

    2015-12-08

    Our identification of dysregulation of the AKT pathway in ovarian cancer as a platinum resistance specific event led to a comprehensive analysis of in vitro, in vivo and clinical behaviour of the AKT inhibitor GSK2141795. Proteomic biomarker signatures correlating with effects of GSK2141795 were developed using in vitro and in vivo models, well characterised for related molecular, phenotypic and imaging endpoints. Signatures were validated in temporally paired biopsies from patients treated with GSK2141795 in a clinical study. GSK2141795 caused growth-arrest as single agent in vitro, enhanced cisplatin-induced apoptosis in vitro and reduced tumour volume in combination with platinum in vivo. GSK2141795 treatment in vitro and in vivo resulted in ~50-90% decrease in phospho-PRAS40 and 20-80% decrease in fluoro-deoxyglucose (FDG) uptake. Proteomic analysis of GSK2141795 in vitro and in vivo identified a signature of pathway inhibition including changes in AKT and p38 phosphorylation and total Bim, IGF1R, AR and YB1 levels. In patient biopsies, prior to treatment with GSK2141795 in a phase 1 clinical trial, this signature was predictive of post-treatment changes in the response marker CA125. Development of this signature represents an opportunity to demonstrate the clinical importance of AKT inhibition for re-sensitisation of platinum resistant ovarian cancer to platinum.

  4. Bipolar disorder: The importance of clinical assessment in identifying prognostic factors - An Audit. Part 3: A comparison between Italian and English mental health services and a survey of bipolar disorder.

    Science.gov (United States)

    Verdolini, Norma; Dean, Jonathon; Massucci, Giampaolo; Elisei, Sandro; Quartesan, Roberto; Zaman, Rashid; Agius, Mark

    2014-11-01

    Most of the prognostic factors of bipolar disorder, which determine disease course and outcome, could be detected from simple but often-unrecorded questions asked during the psychiatric clinic assessments. In previous parts of this research, we analysed various prognostic factors and focused on mixed states and rapid cycling subsets. We now compare our sample in England with a small sample from Italy to demonstrate the utility of focused prognostic questioning and of international comparison. We collected data from the clinical notes of 70 English bipolar and 8 Italian bipolar outpatients seen at the initial psychiatric assessment clinic about socio-demographic and clinical factors to determine whether various factors had relevance to prevalence, prognosis, or outcome. The sample comprised 16 bipolar I (22.9%) and 54 bipolar II (77.1%) English outpatients and 7 bipolar I (87.5%) and 1 bipolar II (12.5%) Italian outpatients. Differences between the groups are seen mainly in terms of age of onset, duration of both depressive and hypomanic episodes, presence of psychiatric family history, incidence of mixed state features and rapid cycling, presence of elated mood in response to past antidepressant treatment, and misuse of illicit drugs and alcohol. In order to promote improved mental health primary care, mental health systems in all countries should develop standardized epidemiological tools that are shared between countries. We recommend the use of a questionnaire that reminds clinicians of potentially prognostic information and suggest that this might identify important components of a potential standardized diagnostic and prognostic tool.

  5. VKORC1-1639G>A, CYP2C9, EPHX1691A>G genotype, body weight, and age are important predictors for warfarin maintenance doses in patients with mechanical heart valve prostheses in southwest China.

    Science.gov (United States)

    Gu, Qiang; Kong, Yan; Schneede, Jörn; Xiao, Ying-Bin; Chen, Lin; Zhong, Qian-Jin; Wang, Xue-Feng; Hao, Jia; Chen, Bai-Cheng; Chen, Jing-Jin

    2010-12-01

    To investigate the contribution of genetic polymorphisms of vitamin K epoxide reductase complex subunit 1 gene VKORC1-1639G>A, cytochrome P450 2C9 gene (CYP2C9), EPHXI, and clinical factors to warfarin sensitivity in southwest Chinese Han patients with mechanical heart valve prostheses. A total of 127 patients with mechanical heart valve prostheses who have been followed up at our department during the past 23 years were enrolled in this study and compared to a control group that consisted of 133 randomly selected healthy blood donors. These Chinese patients met stable warfarin dosage requirements and had reached the target international normalized ratio (INR) of 1.5-2.0. PCR and direct sequencing were carried out to identify the polymorphisms of VKORC1-1639G>A (rs9923231), CYP2C9*3 (rs1057910), CYP2C9 IVS3-65G>C (rs9332127), and EPHX1691A>G (rs4653436). In addition, total and free (non-protein-bound) warfarin concentrations were analyzed. There were great interindividual differences in warfarin maintenance dosage (ranging from 0.6 to 8.4 mg/day) among the 127 patients with mechanical heart valve prostheses. VKORC1-1639G>A, CYP2C9, EPHX1691A>G polymorphism, body weight, and age were found to affect the dose demands. Multiple linear regression models incorporating genetic polymorphisms of VKORC1, CYP2C9, EPHX1691A>G, and the nongenetic factors of age and body weight were developed, and explained up to 76.8% of the total variation (adjusted R (2) of 0.743) in warfarin maintenance doses in southwest Chinese patients with mechanical heart valve prostheses.

  6. Predictors of insubordinate aggression among captive female rhesus macaques.

    Science.gov (United States)

    Seil, Shannon K; Hannibal, Darcy L; Beisner, Brianne A; McCowan, Brenda

    2017-11-01

    Cercopithicine primates tend to have nepotistic hierarchies characterized by predictable, kinship-based dominance. Although aggression is typically directed down the hierarchy, insubordinate aggression does occur. Insubordination is important to understand because it can precipitate social upheaval and undermine group stability; however, the factors underlying it are not well understood. We test whether key social and demographic variables predict insubordination among captive female rhesus macaques. To identify factors influencing insubordination, multivariate analyses of 10,821 dyadic conflicts among rhesus macaque females were conducted, using data from six captive groups. A segmented regression analysis was used to identify dyads with insubordination. Negative binomial regression analyses and an information theoretic approach were used to assess predictors of insubordination among dyads. In the best models, weight difference (w = 1.0; IRR = 0.930), age (dominant: w = 1.0, IRR = 0.681; subordinate: w = 1.0, IRR = 1.069), the subordinate's total number of allies (w = 0.727, IRR = 1.060) or non-kin allies (w = 0.273, IRR = 1.165), the interaction of the dominant's kin allies and weight difference (w = 0.938, IRR = 1.046), violation of youngest ascendancy (w = 1.0; IRR = 2.727), and the subordinate's maternal support (w = 1.0; IRR = 2.928), are important predictors of insubordination. These results show that both intrinsic and social factors influence insubordinate behavior. This adds to evidence of the importance of intrinsic factors and flexibility in a social structure thought to be rigid and predetermined by external factors. Further, because insubordination can precipitate social overthrow, determining predictors of insubordination will shed light on mechanisms underlying stability in nepotistic societies. © 2017 Wiley Periodicals, Inc.

  7. Nurse moral distress: A survey identifying predictors and potential interventions.

    Science.gov (United States)

    Rathert, Cheryl; May, Douglas R; Chung, Hye Sook

    2016-01-01

    Ethical dilemmas and conflicts are inherent in today's health care organizations and may lead to moral distress, which is often associated with physical and psychological symptoms. Although the existence of moral distress has been observed by scholars for decades, most of the research has been descriptive and has examined what types of health care conflicts lead to distress. This study tested a comprehensive model, underpinned by Social Cognitive Theory, that examined work environment and intrapersonal variables that may influence moral distress. We surveyed nursing staff employed in a U.S. acute care hospital (response rate=45%; n=290). More than half of the respondents reported they experience ethical dilemmas and conflicts from several times a month to daily, and nearly half reported they experience moral distress at least several times a month. Structural equation modeling analysis simultaneously examined the effects of five independent variables on moral distress and moral voice: (a) frequency of ethical dilemmas and conflicts; (b) moral efficacy; (c) ethics communication; (d) ethical environment; and (e) organizational ethics support. Results revealed significant independent effects of the frequency of ethics issues and organizational ethics support on moral distress. Bootstrapping analysis indicated that voice fully mediated the relationship between moral efficacy and moral distress, and partially mediated the relationship between organizational ethics support and distress. Supplemental analysis revealed that organizational ethics support moderated the moral efficacy-voice-moral distress relationship such that when organizational support was low, moral efficacy was negatively related to moral distress via voice. Although it may be impossible to eliminate all ethical dilemmas and conflicts, leaders and organizations may wish to help improve nurses' moral efficacy, which appears to give rise to voice, and reduced moral distress. Increasing organizational ethics support may be a key approach. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Predictors of excellent early outcome after total hip arthroplasty

    Directory of Open Access Journals (Sweden)

    Smith George H

    2012-03-01

    Full Text Available Abstract Background Not all patients gain the same degree of improvement from total hip replacement and the reasons for this are not clear. Many investigators have assessed predictors of general outcome after hip surgery. This study is unique in its quest for the predictors of the best possible early outcome. Methods We prospectively collected data on 1318 total hip replacements. Prior to surgery patient characteristics, demographics and co-morbidities were documented. Hip function and general health was assessed using the Harris Hip score (HHS and the Short-Form 36 respectively. The HHS was repeated at three years. We took a maximal HHS of 100 to represent an excellent outcome (102 patients. Multiple logistic regression analysis was used to identify independent predictors of excellent outcome. Results The two strongest predictive factors in achieving an excellent result were young age and a high pre-operative HHS (p = 0.001. Conclusions It was the young and those less disabled from their arthritis that excelled at three years. When making a decision about the timing of hip arthroplasty surgery it is important to take into account the age and pre-operative function of the patient. Whether these patients continue to excel however will be the basis of future research.

  9. Childhood Depression: Relation to Adaptive, Clinical and Predictor Variables

    Directory of Open Access Journals (Sweden)

    Maite Garaigordobil

    2017-05-01

    Full Text Available The study had two goals: (1 to explore the relations between self-assessed childhood depression and other adaptive and clinical variables (2 to identify predictor variables of childhood depression. Participants were 420 students aged 7–10 years old (53.3% boys, 46.7% girls. Results revealed: (1 positive correlations between depression and clinical maladjustment, school maladjustment, emotional symptoms, internalizing and externalizing problems, problem behaviors, emotional reactivity, and childhood stress; and (2 negative correlations between depression and personal adaptation, global self-concept, social skills, and resilience (sense of competence and affiliation. Linear regression analysis including the global dimensions revealed 4 predictors of childhood depression that explained 50.6% of the variance: high clinical maladjustment, low global self-concept, high level of stress, and poor social skills. However, upon introducing the sub-dimensions, 9 predictor variables emerged that explained 56.4% of the variance: many internalizing problems, low family self-concept, high anxiety, low responsibility, low personal self-assessment, high social stress, few aggressive behaviors toward peers, many health/psychosomatic problems, and external locus of control. The discussion addresses the importance of implementing prevention programs for childhood depression at early ages.

  10. Frequency and clinical predictors of coronary artery disease in chronic renal failure renal transplant candidates.

    Science.gov (United States)

    de Albuquerque Seixas, Emerson; Carmello, Beatriz Leone; Kojima, Christiane Akemi; Contti, Mariana Moraes; Modeli de Andrade, Luiz Gustavo; Maiello, José Roberto; Almeida, Fernando Antonio; Martin, Luis Cuadrado

    2015-05-01

    Cardiovascular diseases are major causes of mortality in chronic renal failure patients before and after renal transplantation. Among them, coronary disease presents a particular risk; however, risk predictors have been used to diagnose coronary heart disease. This study evaluated the frequency and importance of clinical predictors of coronary artery disease in chronic renal failure patients undergoing dialysis who were renal transplant candidates, and assessed a previously developed scoring system. Coronary angiographies conducted between March 2008 and April 2013 from 99 candidates for renal transplantation from two transplant centers in São Paulo state were analyzed for associations between significant coronary artery diseases (≥70% stenosis in one or more epicardial coronary arteries or ≥50% in the left main coronary artery) and clinical parameters. Univariate logistic regression analysis identified diabetes, angina, and/or previous infarction, clinical peripheral arterial disease and dyslipidemia as predictors of coronary artery disease. Multiple logistic regression analysis identified only diabetes and angina and/or previous infarction as independent predictors. The results corroborate previous studies demonstrating the importance of these factors when selecting patients for coronary angiography in clinical pretransplant evaluation.

  11. Predictors of treatment success in smoking cessation with ...

    African Journals Online (AJOL)

    Background. Identification of the predictors of treatment success in smoking cessation may help healthcare workers to improve the effectiveness of attempts at quitting. Objective. To identify the predictors of success in a randomised controlled trial comparing varenicline alone or in combination with nicotine replacement ...

  12. Predictors of fibromyalgia: a population-based twin cohort study

    OpenAIRE

    Markkula, Ritva A; Kalso, Eija A; Kaprio, Jaakko A

    2016-01-01

    Abstract Background Fibromyalgia (FM) is a pain syndrome, the mechanisms and predictors of which are still unclear. We have earlier validated a set of FM-symptom questions for detecting possible FM in an epidemiological survey and thereby identified a cluster with “possible FM”. This study explores prospectively predictors for membership of that FM-symptom cluster. Methods ...

  13. Predictor variable resolution governs modeled soil types

    Science.gov (United States)

    Soil mapping identifies different soil types by compressing a unique suite of spatial patterns and processes across multiple spatial scales. It can be quite difficult to quantify spatial patterns of soil properties with remotely sensed predictor variables. More specifically, matching the right scale...

  14. Strategic predictors of performance in a divided attention task

    Science.gov (United States)

    Faragó, Kinga Bettina; Lőrincz, András

    2018-01-01

    In this study we investigate the strategies of subjects in a complex divided attention task. We conducted a series of experiments with ten participants and evaluated their performance. After an extensive analysis, we identified four strategic measures that justify the achievement of the participants, by highlighting the individual differences and predicting performance in a regression analysis using generalized estimating equations. Selecting the more urgent task and user action between multiple simultaneous possibilities form two of the strategic decisions, respectively. The third one refers to choosing a response within the same task when the opportunity is present. The fourth and most important measure of strategy involves thinking ahead and executing an action before a situation would become critical. This latter one has the effect of reducing later cognitive load or timing constraints and it is shown to explain almost as much variance in performance as the other three, more straightforward predictors together. In addition to determining these strategic predictors, we also show how manipulating task difficulty induces a shift in strategy, thus impairing human performance in the rehearsed task. The results of this study indicate that considerable differences in the divided attention ability of normal subjects can be identified early and with simple measurements. The importance of describing and analyzing strategies is also emphasized, which can substantially influence performance in complex tasks and may serve training needs. PMID:29621292

  15. Strategic predictors of performance in a divided attention task.

    Directory of Open Access Journals (Sweden)

    Róbert Adrian Rill

    Full Text Available In this study we investigate the strategies of subjects in a complex divided attention task. We conducted a series of experiments with ten participants and evaluated their performance. After an extensive analysis, we identified four strategic measures that justify the achievement of the participants, by highlighting the individual differences and predicting performance in a regression analysis using generalized estimating equations. Selecting the more urgent task and user action between multiple simultaneous possibilities form two of the strategic decisions, respectively. The third one refers to choosing a response within the same task when the opportunity is present. The fourth and most important measure of strategy involves thinking ahead and executing an action before a situation would become critical. This latter one has the effect of reducing later cognitive load or timing constraints and it is shown to explain almost as much variance in performance as the other three, more straightforward predictors together. In addition to determining these strategic predictors, we also show how manipulating task difficulty induces a shift in strategy, thus impairing human performance in the rehearsed task. The results of this study indicate that considerable differences in the divided attention ability of normal subjects can be identified early and with simple measurements. The importance of describing and analyzing strategies is also emphasized, which can substantially influence performance in complex tasks and may serve training needs.

  16. Strategic predictors of performance in a divided attention task.

    Science.gov (United States)

    Rill, Róbert Adrian; Faragó, Kinga Bettina; Lőrincz, András

    2018-01-01

    In this study we investigate the strategies of subjects in a complex divided attention task. We conducted a series of experiments with ten participants and evaluated their performance. After an extensive analysis, we identified four strategic measures that justify the achievement of the participants, by highlighting the individual differences and predicting performance in a regression analysis using generalized estimating equations. Selecting the more urgent task and user action between multiple simultaneous possibilities form two of the strategic decisions, respectively. The third one refers to choosing a response within the same task when the opportunity is present. The fourth and most important measure of strategy involves thinking ahead and executing an action before a situation would become critical. This latter one has the effect of reducing later cognitive load or timing constraints and it is shown to explain almost as much variance in performance as the other three, more straightforward predictors together. In addition to determining these strategic predictors, we also show how manipulating task difficulty induces a shift in strategy, thus impairing human performance in the rehearsed task. The results of this study indicate that considerable differences in the divided attention ability of normal subjects can be identified early and with simple measurements. The importance of describing and analyzing strategies is also emphasized, which can substantially influence performance in complex tasks and may serve training needs.

  17. Predictors of third and Higher order births in India

    Directory of Open Access Journals (Sweden)

    Payal Singh

    2015-12-01

    Full Text Available Background: Total fertility rate (TFR reflecting population growth is closely related to higher order parity progression. Many Indian states reached replacement level of TFR, but still states constituting nearly 40% population are with TFR ≥ 3. The predictors are the desire of son’s, poor contraceptives practices, younger age at marriage, child loss and shorter birth spacing. Objective: This analysis assessed the degree of relation of 3rd and higher order parity progression with the above mentioned predictors. Material and Methods: State/Union Territories wise proportions of women: progressing to ≥3 births, more sons desire, birth spacing <24 months, adopting modern contraception and median marriage age <18 years along with infant mortality rate (IMR were taken from NFHS-III report. Correlation matrix and stepwise forward multiple regression carried. Significance was seen at 5%. Results: Hindi speaking states constituting 38.92% nation population recorded TFR ≥3. Positive correlation of mothers progressing ≥ 3 births was highest (0.746 with those desiring more sons followed by IMR (0.445; while maximum negative correlation with those practicing modern contraceptives (-0.565 followed by median age at marriage (-0.391. Multiple regression analysis in order identified desire of more sons, practicing modern contraception and shorter birth spacing as the significant predictors and jointly explained 77.9% of the total variation with gain of 15.5% by adding modern contraceptive practice and 8.3% by adding shorter birth spacing. Conclusions: Desire of more sons appeared the most important predictor to progress ≥3 births that is governed by society culture and educational attainment, require attitudinal change. Further, mothers need motivation to practice both spacing and terminal methods once family is complete.

  18. The Importance of Motivation as a Predictor of School Achievement

    Science.gov (United States)

    Steinmayr, Ricarda; Spinath, Birgit

    2009-01-01

    The present study examined to which extent different motivational concepts contribute to the prediction of school achievement among adolescent students independently from intelligence. A sample of 342 11th and 12th graders (age M = 16.94; SD = .71) was investigated. Students gave self-reports on domain-specific values, ability self-perceptions,…

  19. Preliminary study: Predictors for success in an important premedical ...

    African Journals Online (AJOL)

    SAS Institute Inc., USA) (p-values ≤0.05 are significant) using the t-test, Fisher's exact test and the simple linear regression test. Results. These indicated that a good Matric symbol (≥5) in English and life science and a good performance in the ...

  20. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  1. Longitudinal predictors of colorectal cancer screening among participants in a randomized controlled trial.

    Science.gov (United States)

    Murphy, Caitlin C; Vernon, Sally W; Haddock, Nicole M; Anderson, Melissa L; Chubak, Jessica; Green, Beverly B

    2014-09-01

    Few studies use longitudinal data to identify predictors of colorectal cancer screening (CRCS). We examined predictors of (1) initial CRCS during the first year of a randomized trial, and (2) repeat CRCS during the second year of the trial among those that completed FOBT in Year 1. The sample comprised 1247 participants of the Systems of Support to Increase Colorectal Cancer Screening (SOS) Trial (Group Health Cooperative, August 2008 to November 2011). Potential predictors of CRCS were identified with logistic regression and included sociodemographics, health history, and validated scales of psychosocial constructs. Prior CRCS (OR 2.64, 95% CI 1.99-3.52) and intervention group (Automated: OR 2.06 95% CI 1.43-2.95; Assisted: OR 4.03, 95% CI 2.69-6.03; Navigated: OR 5.64, 95% CI 3.74-8.49) were predictors of CRCS completion at Year 1. For repeat CRCS at Year 2, prior CRCS at baseline (OR 1.97, 95% CI 1.25-3.11), intervention group (Automated: OR 9.27, 95% CI 4.56-18.82; Assisted: OR 11.17, 95% CI 5.44-22.94; Navigated: OR 13.10, 95% CI 6.33-27.08), and self-efficacy (OR 1.32, 95% CI 1.00-1.73) were significant predictors. Self-efficacy and prior CRCS are important predictors of future screening behavior. CRCS completion increased when access barriers were removed through interventions. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Predictors of Homophobia in Female College Students.

    Science.gov (United States)

    Basow, Susan A.; Johnson, Kelly

    2000-01-01

    Investigated how self-esteem, self-discrepancy, and gender-attribute importance related to homophobia in predominantly white college women, noting sex role attitudes, authoritarian attitudes, and extent of contact with homosexuals. The only significant predictor of homophobia was authoritarian attitudes. Other correlations included belief in sex…

  3. Predictors of monoterpene exposure in the Danish furniture industry.

    Science.gov (United States)

    Hagström, Katja; Jacobsen, Gitte; Sigsgaard, Torben; Schaumburg, Inger; Erlandsen, Mogens; Schlunssen, Vivi

    2012-04-01

    Individuals who work with pine in the furniture industry may be exposed to monoterpenes, the most abundant of which are α-pinene, β-pinene, and Δ(3)-carene. Monoterpenes are suspected to cause dermatitis and to harm the respiratory system. An understanding of the predictors of monoterpene exposure is therefore important in preventing these adverse effects. These predictors may include general characteristics of the work environment and specific work operations. We sought to assess the extent to which workers are exposed to monoterpenes and to identify possible predictors of monoterpene exposure in the pine furniture industry in Denmark. Passive measurements of the levels of selected monoterpenes (α-pinene, β-pinene, and Δ(3)-carene) were performed on 161 subjects from 17 pine furniture factories in Viborg County, Denmark; one sample was acquired from each worker. Additionally, wood dust samples were collected from 145 workers. Data on potential predictors of exposure were acquired over the course of the day on which the exposure measurements were recorded and could be assigned to one of four hierarchic ordered levels: worker, machine, department, and factory. In addition to univariate analyses, a mixed model was used to account for imbalances within the data and random variation with each of the hierarchically ordered levels. The geometric mean (GM) monoterpene content observed over the 161 measurements was 7.8 mg m(-3) [geometric standard deviation (GSD): 2.4]; the GM wood dust level over 145 measurements was 0.58 mg m(-3) (GSD: 1.49). None of the measured samples exceeded the occupational exposure limit for terpenes in Denmark (25 ppm, 150 mg m(-3)). In the univariate analyses, half of the predictors tested were found to be significant; the multivariate model indicated that only three of the potential predictors were significant. These were the recirculation of air in rooms used for the processing of wood (a factory level predictor), the presence of a

  4. Predictors of recurrence in pheochromocytoma.

    Science.gov (United States)

    Press, Danielle; Akyuz, Muhammet; Dural, Cem; Aliyev, Shamil; Monteiro, Rosebel; Mino, Jeff; Mitchell, Jamie; Hamrahian, Amir; Siperstein, Allan; Berber, Eren

    2014-12-01

    The recurrence rate of pheochromocytoma after adrenalectomy is 6.5-16.5%. This study aims to identify predictors of recurrence and optimal biochemical testing and imaging for detecting the recurrence of pheochromocytoma. In this retrospective study we reviewed all patients who underwent adrenalectomy for pheochromocytoma during a 14-year period at a single institution. One hundred thirty-five patients had adrenalectomy for pheochromocytoma. Eight patients (6%) developed recurrent disease. The median time from initial operation to diagnosis of recurrence was 35 months. On multivariate analysis, tumor size >5 cm was an independent predictor of recurrence. One patient with recurrence died, 4 had stable disease, 2 had progression of disease, and 1 was cured. Recurrence was diagnosed by increases in plasma and/or urinary metanephrines and positive imaging in 6 patients (75%), and by positive imaging and normal biochemical levels in 2 patients (25%). Patients with large tumors (>5 cm) should be followed vigilantly for recurrence. Because 25% of patients with recurrence had normal biochemical levels, we recommend routine imaging and testing of plasma or urinary metanephrines for prompt diagnosis of recurrence. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Distillation Column Flooding Predictor

    Energy Technology Data Exchange (ETDEWEB)

    George E. Dzyacky

    2010-11-23

    The Flooding Predictor™ is a patented advanced control technology proven in research at the Separations Research Program, University of Texas at Austin, to increase distillation column throughput by over 6%, while also increasing energy efficiency by 10%. The research was conducted under a U. S. Department of Energy Cooperative Agreement awarded to George Dzyacky of 2ndpoint, LLC. The Flooding Predictor™ works by detecting the incipient flood point and controlling the column closer to its actual hydraulic limit than historical practices have allowed. Further, the technology uses existing column instrumentation, meaning no additional refining infrastructure is required. Refiners often push distillation columns to maximize throughput, improve separation, or simply to achieve day-to-day optimization. Attempting to achieve such operating objectives is a tricky undertaking that can result in flooding. Operators and advanced control strategies alike rely on the conventional use of delta-pressure instrumentation to approximate the column’s approach to flood. But column delta-pressure is more an inference of the column’s approach to flood than it is an actual measurement of it. As a consequence, delta pressure limits are established conservatively in order to operate in a regime where the column is never expected to flood. As a result, there is much “left on the table” when operating in such a regime, i.e. the capacity difference between controlling the column to an upper delta-pressure limit and controlling it to the actual hydraulic limit. The Flooding Predictor™, an innovative pattern recognition technology, controls columns at their actual hydraulic limit, which research shows leads to a throughput increase of over 6%. Controlling closer to the hydraulic limit also permits operation in a sweet spot of increased energy-efficiency. In this region of increased column loading, the Flooding Predictor is able to exploit the benefits of higher liquid

  6. Parameterization of disorder predictors for large-scale applications requiring high specificity by using an extended benchmark dataset

    Directory of Open Access Journals (Sweden)

    Eisenhaber Frank

    2010-02-01

    Full Text Available Abstract Background Algorithms designed to predict protein disorder play an important role in structural and functional genomics, as disordered regions have been reported to participate in important cellular processes. Consequently, several methods with different underlying principles for disorder prediction have been independently developed by various groups. For assessing their usability in automated workflows, we are interested in identifying parameter settings and threshold selections, under which the performance of these predictors becomes directly comparable. Results First, we derived a new benchmark set that accounts for different flavours of disorder complemented with a similar amount of order annotation derived for the same protein set. We show that, using the recommended default parameters, the programs tested are producing a wide range of predictions at different levels of specificity and sensitivity. We identify settings, in which the different predictors have the same false positive rate. We assess conditions when sets of predictors can be run together to derive consensus or complementary predictions. This is useful in the framework of proteome-wide applications where high specificity is required such as in our in-house sequence analysis pipeline and the ANNIE webserver. Conclusions This work identifies parameter settings and thresholds for a selection of disorder predictors to produce comparable results at a desired level of specificity over a newly derived benchmark dataset that accounts equally for ordered and disordered regions of different lengths.

  7. Early predictors of first-year academic success at university : Pre-university effort, pre-university self-efficacy, and pre-university reasons for attending university

    NARCIS (Netherlands)

    van Herpen, Sanne G.A.; Meeuwisse, Marieke; Hofman, W. H.Adriaan; Severiens, Sabine E.; Arends, Lidia R.

    Given the large number of dropouts in the 1st year at university, it is important to identify early predictors of 1st-year academic success. The present study (n = 453 first-year students) contributes to literature on the transition from secondary to higher education by investigating how the

  8. Early Predictors of First-Year Academic Success at University: Pre-University Effort, Pre-University Self-Efficacy, and Pre-University Reasons for Attending University

    Science.gov (United States)

    van Herpen, Sanne G. A.; Meeuwisse, Marieke; Hofman, W. H. Adriaan; Severiens, Sabine E.; Arends, Lidia R.

    2017-01-01

    Given the large number of dropouts in the 1st year at university, it is important to identify early predictors of 1st-year academic success. The present study (n = 453 first-year students) contributes to literature on the transition from secondary to higher education by investigating how the non-cognitive factors "pre-university" effort…

  9. Predictors of weight maintenance

    NARCIS (Netherlands)

    Pasman, W.J.; Saris, W.H.M.; Westerterp-Plantenga, M.S.

    1999-01-01

    Objective: To obtain predictors of weight maintenance after a weight-loss intervention. Research Methods and Procedures: An overall analysis of data from two-long intervention studies [n = 67 women; age: 37.9±1.0 years; body weight (BW): 87.0±1.2 kg; body mass index: 32.1±0.5 kg·m-2; % body fat:

  10. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  11. Predictors of mental health in female teachers.

    Science.gov (United States)

    Seibt, Reingard; Spitzer, Silvia; Druschke, Diana; Scheuch, Klaus; Hinz, Andreas

    2013-12-01

    Teaching profession is characterised by an above-average rate of psychosomatic and mental health impairment due to work-related stress. The aim of the study was to identify predictors of mental health in female teachers. A sample of 630 female teachers (average age 47 ± 7 years) participated in a screening diagnostic inventory. Mental health was surveyed with the General Health Questionnaire GHQ-12. The following parameters were measured: specific work conditions (teacher-specific occupational history), scales of the Effort-Reward-Imbalance (ERI) Questionnaire as well as cardiovascular risk factors, physical complaints (BFB) and personal factors such as inability to recover (FABA), sense of coherence (SOC) and health behaviour. First, mentally fit (MH(+)) and mentally impaired teachers (MH(-)) were differentiated based on the GHQ-12 sum score (MH(+): teachers showed evidence of mental impairment. There were no differences concerning work-related and cardiovascular risk factors as well as health behaviour between MH(+) and MH(-). Binary logistic regressions identified 4 predictors that showed a significant effect on mental health. The effort-reward-ratio proved to be the most relevant predictor, while physical complaints as well as inability to recover and sense of coherence were identified as advanced predictors (explanation of variance: 23%). Contrary to the expectations, classic work-related factors can hardly contribute to the explanation of mental health. Additionally, cardiovascular risk factors and health behaviour have no relevant influence. However, effort-reward-ratio, physical complaints and personal factors are of considerable influence on mental health in teachers. These relevant predictors should become a part of preventive arrangements for the conservation of teachers' health in the future.

  12. Predictors of mental health in female teachers

    Directory of Open Access Journals (Sweden)

    Reingard Seibt

    2013-12-01

    Full Text Available Objective: Teaching profession is characterised by an above-average rate of psychosomatic and mental health impairment due to work-related stress. The aim of the study was to identify predictors of mental health in female teachers. Material and Methods: A sample of 630 female teachers (average age 47±7 years participated in a screening diagnostic inventory. Mental health was surveyed with the General Health Questionnaire GHQ-12. The following parameters were measured: specific work conditions (teacher-specific occupational history, scales of the Effort-Reward-Imbalance (ERI Questionnaire as well as cardiovascular risk factors, physical complaints (BFB and personal factors such as inability to recover (FABA, sense of coherence (SOC and health behaviour. Results: First, mentally fit (MH+ and mentally impaired teachers (MH- were differentiated based on the GHQ-12 sum score (MH+: < 5; MH-: ≥ 5; 18% of the teachers showed evidence of mental impairment. There were no differences concerning work-related and cardiovascular risk factors as well as health behaviour between MH+ and MH-. Binary logistic regressions identified 4 predictors that showed a significant effect on mental health. The effort-reward-ratio proved to be the most relevant predictor, while physical complaints as well as inability to recover and sense of coherence were identified as advanced predictors (explanation of variance: 23%. Conclusion: Contrary to the expectations, classic work-related factors can hardly contribute to the explanation of mental health. Additionally, cardiovascular risk factors and health behaviour have no relevant influence. However, effort-reward-ratio, physical complaints and personal factors are of considerable influence on mental health in teachers. These relevant predictors should become a part of preventive arrangements for the conservation of teachers' health in the future.

  13. Two-year predictors of runaway and homeless episodes following shelter services among substance abusing adolescents.

    Science.gov (United States)

    Slesnick, Natasha; Guo, Xiamei; Brakenhoff, Brittany; Feng, Xin

    2013-10-01

    Given high levels of health and psychological costs associated with the family disruption of homelessness, identifying predictors of runaway and homeless episodes is an important goal. The current study followed 179 substance abusing, shelter-recruited adolescents who participated in a randomized clinical trial. Predictors of runaway and homeless episodes were examined over a two year period. Results from the hierarchical linear modeling analysis showed that family cohesion and substance use, but not family conflict or depressive symptoms, delinquency, or school enrollment predicted future runaway and homeless episodes. Findings suggest that increasing family support, care and connection and reducing substance use are important targets of intervention efforts in preventing future runaway and homeless episodes amongst a high risk sample of adolescents. Copyright © 2013 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  14. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  15. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  16. Predictors of maternal vaccination in the United States: An integrative review of the literature.

    Science.gov (United States)

    Myers, Kristen L

    2016-07-25

    The purpose of this literature review was to identify, analyze, and synthesize existing research related to patient, provider, and health system predictors of maternal vaccination in the United States, strategies used to increase maternal vaccination rates, and major theoretical frameworks used to guide maternal vaccination research. A search for evidence was conducted in CINAHL, PubMed, PsychINFO, Cochrane Systematic Reviews, and Google Scholar. Twenty-two articles were identified as best evidence for inclusion in this review: five randomized control trials, one cluster randomized trial, one mixed methods study, 12 observational studies, and three qualitative studies. Patient-focused predictors of maternal vaccination included provider recommendation; knowledge, attitudes, and beliefs; cues to action; and race and ethnicity. Provider-focused predictors included knowledge, attitudes, and beliefs; and multi-component intervention packages. Health system predictors included standing order protocols and practice site logistics. The major theoretical frameworks that emerged were the Health Belief Model, Theory of Reasoned Action/Theory of Planned Behavior, and Message Framing/Prospect Theory. Provider recommendation was the single most important predictor of vaccine acceptance among pregnant women. An abundance of theoretically-supported, patient-focused research was found in the literature. A minimal number of U.S.-based, provider-focused research was found and none of these used a theoretical framework. Minimal research examining health system barriers to maternal vaccination was found. Additional research into the logistical barriers to maternal vaccination programs within obstetrical practice locations in other geographical locations within the U.S. is warranted. Future provider- and health system-focused research needs to be grounded in theory. The field of implementation science may offer the theoretical guidance necessary to better understand problems in

  17. Predictors of academic performance for applicants to an international dental studies program in the United States.

    Science.gov (United States)

    Pitigoi-Aron, Gabriela; King, Patricia A; Chambers, David W

    2011-12-01

    The number of U.S. and Canadian dental schools offering programs for dentists with degrees from other countries leading to the D.D.S. or D.M.D. degree has increased recently. This fact, along with the diversity of educational systems represented by candidates for these programs, increases the importance of identifying valid admissions predictors of success in international dental student programs. Data from 148 students accepted into the international dental studies program at the University of the Pacific from 1994 through 2004 were analyzed. Dependent variables were comprehensive cumulative GPA at the end of both the first and second years of the two-year program. The Test of English as a Foreign Language (TOEFL) and both Parts I and II of the National Board Dental Examination (NBDE) were significant positive predictors of success. Performance on laboratory tests of clinical skill in operative dentistry and in fixed prosthodontics and ratings from interviewers were not predictive of overall success in the program. Although this study confirms the predictive value of written tests such as the TOEFL and NBDE, it also contributes to the literature documenting inconsistent results regarding other types of predictors. It may be the case that characteristics of individual programs or features of the applicant pools for each may require use of admissions predictors that are unique to schools.

  18. Time perspective as a predictor of acute postsurgical pain and coping with pain following abdominal surgery.

    Science.gov (United States)

    Sobol-Kwapinska, M; Plotek, W; Bąbel, P; Cybulski, M; Kluzik, A; Krystianc, J; Mandecki, M

    2017-04-01

    The aim of this study was to predict acute postsurgical pain and coping with pain following surgery based on preoperative time perspectives. Time perspective is a basic dimension of psychological time. It is a tendency to focus on a particular time area: the past, the present and the future. Seventy-six patients completed measures of time perspective and pain 24 h before abdominal surgery. During the 3 days after surgery, measures of pain and coping with pain were completed. We performed hierarchical regression analyses to identify predictors of acute postsurgical pain and how patients cope with it. These analyses suggested that a preoperative past-negative time perspective can be a predictor of postoperative pain level and catastrophizing after surgery. The findings of our study indicate the importance of time perspective, especially the past perspective, in dealing with postoperative pain. Our research indicates that a preoperative past-negative time perspective is a significant predictor of acute postsurgical pain intensity and the strongest predictor of pain catastrophizing. © 2016 European Pain Federation - EFIC®.

  19. Psychological predictors of weight loss after bariatric surgery: a review of the recent research.

    Science.gov (United States)

    Wimmelmann, Cathrine L; Dela, Flemming; Mortensen, Erik L

    2014-01-01

    Morbid obesity is the fastest growing BMI group in the U.S. and the prevalence of morbid obesity worldwide has never been higher. Bariatric surgery is the most effective treatment for severe forms of obesity especially with regard to a sustained long-term weight loss. Psychological factors are thought to play an important role for maintaining the surgical weight loss. However, results from prior research examining preoperative psychological predictors of weight loss outcome are inconsistent. The aim of this article was to review more recent literature on psychological predictors of surgical weight loss. We searched PubMed, PsycInfo and Web of Science, for original prospective studies with a sample size >30 and at least one year follow-up, using a combination of search terms such as 'bariatric surgery', 'morbid obesity', 'psychological predictors', and 'weight loss'. Only studies published after 2003 were included. 19 eligible studies were identified. Psychological predictors of surgical weight loss investigated in the reviewed studies include cognitive function, personality, psychiatric disorder, and eating behaviour. In general, recent research remains inconsistent, but the findings suggest that pre-surgical cognitive function, personality, mental health, composite psychological variables and binge eating may predict post-surgical weight loss to the extent that these factors influence post-operative eating behaviour. Copyright © 2013 Asian Oceanian Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

  20. Predictors for oral cancer in Brazil

    OpenAIRE

    Isabella Lima Arrais RIBEIRO; Johnys Berton Medeiros da NÓBREGA; Ana Maria Gondim VALENÇA; Ricardo Dias de CASTRO

    2017-01-01

    Abstract Introduction The incidence of lip, oral cavity and oropharynx cancer in Brazil is one of the highest worldwide. Objective This study aimed to identify predictors for oral cancer in Brazil between 2010 and 2013. Method Through a time series study in which 14,959 primary head and neck cancer diagnoses were evaluated. The variables of interest were gender, age, race, education level, family history of cancer, alcohol consumption, smoking, and previous cancer diagnosis. The outcome va...

  1. Self-Perceptions of Sexual Attractiveness: Satisfaction With Physical Appearance is Not of Primary Importance Across Gender and Sexual Orientation.

    Science.gov (United States)

    Amos, Natalie; McCabe, Marita P

    2016-01-01

    Research on self-perceived sexual attractiveness has predominantly focused on the importance of physical appearance, overlooking nonphysical traits that may contribute to these self-perceptions. The present study examined and compared the importance of a variety of traits for self-perceived sexual attractiveness. Self-identified heterosexual, gay, and bisexual men (N = 1,801) and heterosexual, lesbian, and bisexual women (N = 1,092) completed an online questionnaire examining self-perceived sexual attractiveness, body esteem, sexual esteem, adherence to gender norms, and sexual experience. Body esteem and sexual esteem were significant predictors of self-perceived sexual attractiveness, regardless of gender and sexual orientation. Adhering to a masculine gender norm was a significant predictor among all groups (to varying extents) but heterosexual women. Adhering to a feminine gender norm was a significant predictor among heterosexual men and bisexual women. Finally, sexual experience was a significant predictor for all men and bisexual women. Furthermore, while body esteem was a predictor across all groups, for most individuals it did not appear to be of primary importance, with either sexual esteem or masculinity proving to be of greater importance. These findings suggest the need to consider traits related to both physical and nonphysical factors for improving an individual's self-perceived sexual attractiveness.

  2. Predictors of neonatal sepsis in developing countries.

    Science.gov (United States)

    Weber, Martin W; Carlin, John B; Gatchalian, Salvacion; Lehmann, Deborah; Muhe, Lulu; Mulholland, E Kim

    2003-08-01

    Neonatal infections are a major cause of death worldwide. Simple procedures for identifying infants with infection that need referral for treatment are therefore of major public health importance. We investigated 3303 infants Ethiopia, The Gambia, Papua New Guinea and The Philippines, using a standardized approach. Historical factors and clinical signs predicting sepsis, meningitis, hypoxemia, deaths and an ordinal scale indicating severe disease were investigated by logistic regression, and the performance of simple combination rules was explored. In multivariable analysis, reduced feeding ability, no spontaneous movement, temperature >38 degrees C, being drowsy/unconscious, a history of a feeding problem, history of change in activity, being agitated, the presence of lower chest wall indrawing, respiratory rate >60 breaths/min, grunting, cyanosis, a history of convulsions, a bulging fontanel and slow digital capillary refill were independent predictors of severe disease. The presence of any 1 of these 14 signs had a sensitivity for severe disease (defined as sepsis, meningitis, hypoxemia, or radiologically proven pneumonia) of 87% and a specificity of 54%. More stringent combinations, such as demanding 2 signs from the list, resulted in a considerable loss of sensitivity. By contrast only slight loss of sensitivity and considerable gain of specificity resulted from reducing the list to 9 signs. Requiring the presence of fever and any other sign produced a diagnostic rule with extremely low sensitivity (25%). Physical signs can be used to identify young infants at risk of severe disease, however with limited specificity, resulting in large numbers of unnecessary referrals. Further studies are required to validate and refine the prediction of severe disease, especially in the first week of life, but there appear to be limits on the accuracy of prediction that is achievable.

  3. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  4. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  5. Predictors of chest drainage complications in trauma patients

    Directory of Open Access Journals (Sweden)

    CECÍLIA ARAÚJO MENDES

    2018-04-01

    Full Text Available ABSTRACT Objective: to identify predictors of chest drainage complications in trauma patients attended at a University Hospital. Methods: we conducted a retrospective study of 68 patients submitted to thoracic drainage after trauma, in a one-year period. We analyzed gender, age, trauma mechanism, trauma indices, thoracic and associated lesions, environment in which the procedure was performed, drainage time, experience of the performer, complications and evolution. Results: the mean age of the patients was 35 years and the male gender was the most prevalent (89%. Blunt trauma was the most frequent, with 67% of cases, and of these, 50% were due to traffic accidents. The mean TRISS (Trauma and Injury Severity Score was 98, with a mortality rate of 1.4%. The most frequent thoracic and associated lesions were, respectively, rib fractures (51% and abdominal trauma (32%. The mean drainage time was 6.93 days, being higher in patients under mechanical ventilation (p=0.0163. The complication rate was 26.5%, mainly poor drain positioning (11.77%. Hospital drainage was performed in 89% of cases by doctors in the first year of specialization. Thoracic drainage performed in prehospital care presented nine times more chances of complications (p=0.0015. Conclusion: the predictors of post-trauma complications for chest drainage were a procedure performed in an adverse site and mechanical ventilation. The high rate of complications demonstrates the importance of protocols of care with the thoracic drainage.

  6. Sociodemographic predictors of elderly's psychological well-being in Malaysia.

    Science.gov (United States)

    Momtaz, Yadollah A; Ibrahim, Rahimah; Hamid, Tengku A; Yahaya, Nurizan

    2011-05-01

    Psychological well-being as one of the most important indicators of successful aging has received substantial attention in the gerontological literature. Prior studies show that sociodemographic factors influencing elderly's psychological well-being are multiple and differ across cultures. The aim of this study was to identify significant sociodemographic predictors of psychological well-being among Malay elders. The study included 1415 older Malays (60-100 years, 722 women), randomly selected through a multistage stratified random method from Peninsular Malaysia. WHO-Five well-being index was used to measure psychological well-being. Data analysis was conducted using the Statistical Package for Social Sciences (SPSS) version 13.0. Using multiple regression analysis a significant model emerged (F(7, 1407) = 20.14, p ≤ 0.001), where age, sex, marital status, and household income were significant predictor variables of psychological well-being among Malay elders. However, level of education, employment status, and place of residence failed to predict psychological well-being. This study showed that the oldest old, elderly women, unmarried, and the poor elderly people are at risk for experiencing low psychological well-being. Therefore, they need special attention from family, policy makers, and those who work with elderly people.

  7. Fall predictors in older cancer patients: a multicenter prospective study

    OpenAIRE

    Vande Walle, Nathalie; Kenis, Cindy; Heeren, Pieter; Van Puyvelde, Katrien; Decoster, Lore; Beyer, Ingo; Conings, Godelieve; Flamaing, Johan; Lobelle, Jean-Pierre; Wildiers, Hans; Milisen, Koen

    2014-01-01

    Background In the older population falls are a common problem and a major cause of morbidity, mortality and functional decline. The etiology is often multifactorial making the identification of fall predictors essential for preventive measures. Despite this knowledge, data on falls within the older cancer population are limited. The objective of this study was to evaluate the occurrence of falls within 2 to 3?months after cancer treatment decision and to identify predictors of falls (?1 fall)...

  8. Predictors of agitation in critically ill adults.

    Science.gov (United States)

    Burk, Ruth S; Grap, Mary Jo; Munro, Cindy L; Schubert, Christine M; Sessler, Curtis N

    2014-09-01

    Agitation in critically ill adults is a frequent complication of hospitalization and results in multiple adverse outcomes. Potential causes of agitation are numerous; however, data on factors predictive of agitation are limited. To identify predictors of agitation by examining demographic and clinical characteristics of critically ill patients. A medical record review was performed. Documentation of agitation was indicated by scores on the Richmond Agitation-Sedation Scale or the use of an agitation keyword. Records of 200 patients from 1 medical and 1 surgical intensive care unit were used for the study. Risk factors were determined for 2 points in time: admission to the intensive care unit and within 24 hours before the first episode of agitation. Data on baseline demographics, preadmission risk factors, and clinical data were collected and were evaluated by using logistic multivariable regression to determine predictors of agitation. Predictors of agitation on admission to intensive care were history of use of illicit substances, height, respiratory and central nervous system subscores on the Sequential Organ Failure Assessment, and use of restraints. Predictors of agitation within 24 hours before the onset of agitation were history of psychiatric diagnosis, height, score on the Sequential Organ Failure Assessment, ratio of Pao2 to fraction of inspired oxygen less than 200, serum pH, percentage of hours with restraints, percentage of hours of mechanical ventilation, pain, and presence of genitourinary catheters. Predictors of agitation on admission and within 24 hours before the onset of agitation were primarily clinical variables. ©2014 American Association of Critical-Care Nurses.

  9. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  10. Sarcopenia and Predictors of Skeletal Muscle Mass in Elderly Men With and Without Obesity

    Directory of Open Access Journals (Sweden)

    Katja Stoever MA

    2017-06-01

    Full Text Available Objectives: The aim of this study was to determine the variables which show the highest association with muscle mass and to identify the most important predictors for muscle mass in elderly men with and without sarcopenia. Methods: A total of 71 men participated, aged ≥65 years. Sarcopenia was assessed using the definition of the European Working Group on Sarcopenia in Older People with determining skeletal muscle index (SMI, hand-grip strength (HGS, and Short Physical Performance Battery. In addition, maximum strength at upper and lower extremities and physical activity were measured. Results: Strong correlations existed between SMI and gait speed, HGS, maximum isometric strength at leg and chest press. Physical activity showed low correlations with muscle strength. Regression analysis revealed HGS and gait speed as key predictors for SMI. Discussion: The recommendation is measuring gait speed and HGS in clinical practice at first followed by measuring muscle mass for determining sarcopenia.

  11. Psychological predictors of mental health and health-related quality of life after bariatric surgery

    DEFF Research Database (Denmark)

    Wimmelmann, Cathrine Lawaetz; Dela, Flemming; Mortensen, Erik Lykke

    2014-01-01

    of pre-surgical psychological factors on mental wellbeing after surgery is unclear. The aim of the current article therefore is to review recent research investigating psychological predictors of mental health and HRQOL outcome. METHODS: We searched PubMed, PsycInfo and Web of Science for studies...... investigating psychological predictors of either mental health or HRQOL after bariatric surgery. Original prospective studies published between 2003 and 2012 with a sample size >30 and a minimum of 1 year follow-up were included. RESULTS: Only 10 eligible studies were identified. The findings suggest......BACKGROUND: Improvement of mental health and health-related quality of life (HRQOL) is an important success criterion for bariatric surgery. In general, mental health and HRQOL improve after surgery, but some patients experience negative psychological reactions postoperatively and the influence...

  12. Predictors of Attitudes Toward Non-Technical Skills in Farming.

    Science.gov (United States)

    Irwin, Amy; Poots, Jill

    2018-01-01

    Farming is a high-risk sector with up to 170,000 worldwide fatalities reported per year; it is therefore vital to identify methods of mitigating the dangers of this industry. Research within high-risk industries, such as aviation, shipping, and agriculture, has identified the importance of non-technical skills (NTS) in maintaining effective, safe performance and reducing error and injury. However, there is a lack of research evaluating factors that may contribute to NTS attitudes and behaviors. As a first step to address this literature gap, the current study evaluated a range of individual and environmental factors as potential predictors of attitudes toward NTS in agriculture. A sample of 170 farmers from within the United Kingdom and Ireland were surveyed using an online questionnaire. The questionnaire included measures of personality, stress, attitudes toward safety (safety climate, motivation, and risk), environmental stressors (workload, work-life imbalance), and non-technical skills (team and lone worker). Attitudes toward safety climate, compliance, and motivation showed a significant association with both team-based and lone worker NTS. Conscientiousness correlated positively with the majority of the NTS elements. Multiple regression analysis indicated neuroticism and conscientiousness demonstrated capacity to predict NTS attitudes. Concerns about costs and equipment, attitudes toward safety climate, and safety motivation were also found to be significant predictors of NTS attitudes. The results indicate the utility of individual characteristics and environmental factors when predicting farming NTS attitudes. As a result, these elements could be important when evaluating engagement with NTS and developing NTS training initiatives in agriculture.

  13. Predictors of postpartum depression.

    Science.gov (United States)

    Katon, Wayne; Russo, Joan; Gavin, Amelia

    2014-09-01

    To examine sociodemographic factors, pregnancy-associated psychosocial stress and depression, health risk behaviors, prepregnancy medical and psychiatric illness, pregnancy-related illnesses, and birth outcomes as risk factors for post-partum depression (PPD). A prospective cohort study screened women at 4 and 8 months of pregnancy and used hierarchical logistic regression analyses to examine predictors of PPD. The study sample include 1,423 pregnant women at a university-based high risk obstetrics clinic. A score of ≥10 on the Patient Health Questionnaire-9 (PHQ-9) indicated clinically significant depressive symptoms. Compared with women without significant postpartum depressive symptoms, women with PPD were significantly younger (pdepressive symptoms (pdepression case finding for pregnant women.

  14. Predictors of Sunburn Risk Among Florida Residents.

    Science.gov (United States)

    Arutyunyan, Sergey; Alfonso, Sarah V; Hernandez, Nilda; Favreau, Tracy; Fernández, M Isabel

    2017-03-01

    The incidence of skin cancer, the most common type of cancer in the United States, is increasing. Sunburn is a major modifiable risk factor for skin cancer, and its prevalence among the US population is high. To identify predictors of having had a red or painful sunburn in the past 12 months among people living in Florida. Florida residents were recruited from public places and online. They were asked to complete an anonymous cross-sectional survey that assessed demographic information, dermatologic history, as well as knowledge, attitude, and behavior factors associated with sunburn. A total of 437 participants whose data were complete for all variables were included in the multivariate analysis. In multivariate logistic regression, younger age (18-29 years) was the most significant predictor of sunburn (OR, 15.26; 95% CI, 5.97-38.98; PSunburn prevention programs that osteopathic physicians can readily implement in clinical practice are urgently needed, particularly for young adult patients. This study identified 7 predictors of sunburn in Florida residents. With additional research findings, promoting attitude change toward sun protection may be a viable strategy.

  15. Seasonal variation and predictors of epistaxis.

    Science.gov (United States)

    Purkey, Matthew R; Seeskin, Zachary; Chandra, Rakesh

    2014-09-01

    To examine the incidence of epistaxis as a function of season and age and to determine predictors of episodes within the epistaxis patient population presenting to a tertiary hospital system. Retrospective cohort study. Electronic medical record charts of patients presenting to the Northwestern Emergency Department, admitted to an inpatient ward, or seen in an outpatient setting between 2008 and 2012 were reviewed and selected for an International Classifications of Disease-Ninth Revision epistaxis code of 784.7. Season of presentation, demographic factors (age, race, gender, insurance status), medication use (including anticoagulants and topical nasal steroid administration), and several comorbidities were analyzed as potential predictors of episodes. A total of 2,405 patients were identified with a total of 3,666 individual epistaxis episodes over 5 years. Multivariate analysis identified allergic rhinitis (AR), chronic sinusitis (CRS), coagulopathy, hereditary hemorrhagic telangiectasia (HHT), hematologic malignancy, and hypertension (HTN) as predictors of a higher number of cases. Epistaxis occurred more frequently during colder months and in older patients. Epistaxis occurs more commonly during the winter and in older patients. AR, CRS, coagulopathy, HHT, hematologic malignancy, and HTN are associated with increased epistaxis incidence. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

  16. Assessing the relative importance of correlates of loneliness in later life: Gaining insight using recursive partitioning

    DEFF Research Database (Denmark)

    Ejlskov, Linda; Wulff, Jesper; Bøggild, Henrik

    2017-01-01

    and demographic correlates were poor identifiers of loneliness. The regression tree suggested that loneliness was not raised among those with poor mental wellbeing if they identified their partner as closest confidante and had frequent social contact. CONCLUSION: Recursive partitioning can identify which......OBJECTIVES: Improving the design and targeting of interventions is important for alleviating loneliness among older adults. This requires identifying which correlates are the most important predictors of loneliness. This study demonstrates the use of recursive partitioning in exploring...... the characteristics and assessing the relative importance of correlates of loneliness in older adults. METHOD: Using exploratory regression trees and random forests, we examined combinations and the relative importance of 42 correlates in relation to loneliness at age 68 among 2453 participants from the birth cohort...

  17. Predictors of physical independence at discharge after stroke rehabilitation in a Dutch population

    NARCIS (Netherlands)

    Ten Brink, Antonia F.; Hajos, Tibor R.S.; Van Bennekom, Coen; Nachtegaal, Janneke; Meulenbelt, Henk E.J.; Fleuren, Judith F.M.; Kouwenhoven, Mirjam; Luijkx, Marscha M.; Wijffels, Markus P.; Post, Marcel W. M.

    2017-01-01

    The aim of this study was to identify predictors, available at admission, of physical independence at discharge from inpatient rehabilitation. Secondary aims were to identify predictors of functional gain and length of stay (LOS). We included 1310 adult stroke patients who were admitted for

  18. Hand hygiene of medical students and resident physicians: predictors of attitudes and behaviour.

    Science.gov (United States)

    Barroso, Violeta; Caceres, Wendy; Loftus, Pooja; Evans, Kambria H; Shieh, Lisa

    2016-09-01

    We measured medical students' and resident trainees' hand hygiene behaviour, knowledge and attitudes in order to identify important predictors of hand hygiene behaviour in this population. An anonymous, web-based questionnaire was distributed to medical students and residents at Stanford University School of Medicine in August of 2012. The questionnaire included questions regarding participants' behaviour, knowledge, attitude and experiences about hand hygiene. Behaviour, knowledge and attitude indices were scaled from 0 to 1, with 1 representing superior responses. Using multivariate regression, we identified positive and negative predictors of superior hand hygiene behaviour. We investigated effectiveness of interventions, barriers and comfort reminding others. 280 participants (111 students and 169 residents) completed the questionnaire (response rate 27.8%). Residents and medical students reported hand hygiene behaviour compliance of 0.45 and 0.55, respectively (p=0.02). Resident and medical student knowledge was 0.80 and 0.73, respectively (p=0.001). The attitude index for residents was 0.56 and 0.55 for medical students. Regression analysis identified experiences as predictors of hand hygiene behaviour (both positive and negative influence). Knowledge was not a significant predictor of behaviour, but a working gel dispenser and observing attending physicians with good hand hygiene practices were reported by both groups as the most effective strategy in influencing trainees. Medical students and residents have similar attitudes about hand hygiene, but differ in their level of knowledge and compliance. Concerns about hierarchy may have a significant negative impact on hand hygiene advocacy. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  19. MRI predictors of treatment response for perianal fistulizing Crohn disease in children and young adults

    Energy Technology Data Exchange (ETDEWEB)

    Shenoy-Bhangle, Anuradha; Nimkin, Katherine; Gee, Michael S. [Massachusetts General Hospital for Children, Harvard Medical School, Department of Radiology, Boston, MA (United States); Goldner, Dana; Israel, Esther J. [Massachusetts General Hospital for Children, Harvard Medical School, Department of Pediatrics, Boston, MA (United States); Bradley, William F. [Analog Devices, Lyric Labs, Cambridge, MA (United States)

    2014-01-15

    Magnetic resonance imaging (MRI) is considered the imaging standard for diagnosis and characterization of perianal complications associated with Crohn disease in children and adults. To define MRI criteria that could act as potential predictors of treatment response in fistulizing Crohn disease in children, in order to guide more informed study interpretation. We performed a retrospective database query to identify all children and young adults with Crohn disease who underwent serial MRI studies for assessment of perianal symptoms between 2003 and 2010. We examined imaging features of perianal disease including fistula number, type and length, presence and size of associated abscess, and disease response/progression on follow-up MRI. We reviewed imaging studies and electronic medical records. Statistical analysis, including logistic regression, was performed to associate MR imaging features with treatment response and disease progression. We included 36 patients (22 male, 14 female; age range 8-21 years). Of these, 32 had a second MRI exam and 4 had clinical evidence of complete response, obviating the need for repeat imaging. Of the parameters analyzed, presence of abscess, type of fistula according to the Parks classification, and multiplicity were not predictors of treatment outcome. Maximum length of the dominant fistula and aggregate fistula length in the case of multiple fistulae were the best predictors of treatment outcome. Maximum fistula length <2.5 cm was a predictor of treatment response, while aggregate fistula length ≥2.5 cm was a predictor of disease progression. Perianal fistula length is an important imaging feature to assess on MRI of fistulizing Crohn disease. (orig.)

  20. MRI predictors of treatment response for perianal fistulizing Crohn disease in children and young adults

    International Nuclear Information System (INIS)

    Shenoy-Bhangle, Anuradha; Nimkin, Katherine; Gee, Michael S.; Goldner, Dana; Israel, Esther J.; Bradley, William F.

    2014-01-01

    Magnetic resonance imaging (MRI) is considered the imaging standard for diagnosis and characterization of perianal complications associated with Crohn disease in children and adults. To define MRI criteria that could act as potential predictors of treatment response in fistulizing Crohn disease in children, in order to guide more informed study interpretation. We performed a retrospective database query to identify all children and young adults with Crohn disease who underwent serial MRI studies for assessment of perianal symptoms between 2003 and 2010. We examined imaging features of perianal disease including fistula number, type and length, presence and size of associated abscess, and disease response/progression on follow-up MRI. We reviewed imaging studies and electronic medical records. Statistical analysis, including logistic regression, was performed to associate MR imaging features with treatment response and disease progression. We included 36 patients (22 male, 14 female; age range 8-21 years). Of these, 32 had a second MRI exam and 4 had clinical evidence of complete response, obviating the need for repeat imaging. Of the parameters analyzed, presence of abscess, type of fistula according to the Parks classification, and multiplicity were not predictors of treatment outcome. Maximum length of the dominant fistula and aggregate fistula length in the case of multiple fistulae were the best predictors of treatment outcome. Maximum fistula length <2.5 cm was a predictor of treatment response, while aggregate fistula length ≥2.5 cm was a predictor of disease progression. Perianal fistula length is an important imaging feature to assess on MRI of fistulizing Crohn disease. (orig.)

  1. What variables are important in predicting bovine viral diarrhea virus? A random forest approach.

    Science.gov (United States)

    Machado, Gustavo; Mendoza, Mariana Recamonde; Corbellini, Luis Gustavo

    2015-07-24

    Bovine viral diarrhea virus (BVDV) causes one of the most economically important diseases in cattle, and the virus is found worldwide. A better understanding of the disease associated factors is a crucial step towards the definition of strategies for control and eradication. In this study we trained a random forest (RF) prediction model and performed variable importance analysis to identify factors associated with BVDV occurrence. In addition, we assessed the influence of features selection on RF performance and evaluated its predictive power relative to other popular classifiers and to logistic regression. We found that RF classification model resulted in an average error rate of 32.03% for the negative class (negative for BVDV) and 36.78% for the positive class (positive for BVDV).The RF model presented area under the ROC curve equal to 0.702. Variable importance analysis revealed that important predictors of BVDV occurrence were: a) who inseminates the animals, b) number of neighboring farms that have cattle and c) rectal palpation performed routinely. Our results suggest that the use of machine learning algorithms, especially RF, is a promising methodology for the analysis of cross-sectional studies, presenting a satisfactory predictive power and the ability to identify predictors that represent potential risk factors for BVDV investigation. We examined classical predictors and found some new and hard to control practices that may lead to the spread of this disease within and among farms, mainly regarding poor or neglected reproduction management, which should be considered for disease control and eradication.

  2. Profile and predictors of global distress: can the DT guide nursing practice in prostate cancer?

    Science.gov (United States)

    Lotfi-Jam, Kerryann; Gough, Karla; Schofield, Penelope; Aranda, Sanchia

    2014-02-01

    This study examines the ability of the distress thermometer to accurately identify patients with higher symptoms, unmet needs and psychological morbidity. Baseline data collected as part of a randomized controlled trial evaluating a nurse-led supportive care intervention for men with prostate cancer commencing radiotherapy at a specialist cancer hospital in Melbourne, Australia. Measures assessed global distress (DT), anxious and depressive symptomatology (HADS), prostate-cancer specific quality of life (EPIC-26), unmet supportive care needs (SCNS-SF34R) and cancer treatment-related concerns (CATS). Following descriptive and correlational analysis, hierarchical multiple regression was employed to examine the contribution of variable sets to explaining variance in DT scores. Less than 20% of men reported DT scores of 4 or higher, indicating overall low distress. The DT accurately identified almost all men reporting HADS score indicative of anxious or depressive symptomatology, suggesting it accurately identifies psychological morbidity. Importantly, the DT identified a further group of distressed men, not identified by HADS, whose distress related to unmet needs and prostate cancer-specific issues, indicating the DT is superior in identifying other forms of distress. While the hierarchical multiple regression confirmed anxious and depressive symptomatology as the best predictor of distress score, many other scales are also good predictors of DT scores, supporting the argument that distress is multi-determined. Nurses can be confident that the DT accurately identifies patients with psychological morbidity and importantly identifies other patients with distress who may require intervention. A distress score of 4 or higher identified participants with higher physical symptomatology, higher unmet needs, more concerns about treatment and poorer quality of life. The low prevalence of distress reaching cut off scores suggests nurses would not be overwhelmed by the outcomes

  3. Long-term incidence of depression and predictors of depressive symptoms in older stroke survivors.

    Science.gov (United States)

    Allan, Louise M; Rowan, Elise N; Thomas, Alan J; Polvikoski, Tuomo M; O'Brien, John T; Kalaria, Raj N

    2013-12-01

    Depression is common and an important consequence of stroke but there is limited information on the longer-term relationship between these conditions. To identify the prevalence, incidence and predictors of depression in a secondary-care-based cohort of stroke survivors aged over 75 years, from 3 months to up to 10 years post-stroke. Depression was assessed annually by three methods: major depression by DSM-IV criteria, the self-rated Geriatric Depression Scale (GDS) and the observer-rated Cornell scale. We found the highest rates, 31.7% baseline prevalence, of depressive symptoms with the GDS compared with 9.7% using the Cornell scale and 1.2% using DSM-IV criteria. Incidence rates were 36.9, 5.90 and 4.18 episodes per 100 person years respectively. Baseline GDS score was the most consistent predictor of depressive symptoms at all time points in both univariate and multivariate analyses. Other predictors included cognitive impairment, impaired activities of daily living and in the early period, vascular risk factor burden and dementia. Our results emphasise the importance of psychiatric follow-up for those with early-onset post-stroke depression and long-term monitoring of mood in people who have had a stroke and remain at high risk of depression.

  4. Predicting the importance of current papers.

    Energy Technology Data Exchange (ETDEWEB)

    Klavans, Richard (SciTech Strategies, Inc., Berwyn, PA); Boyack, Kevin W.

    2005-01-01

    This article examines how well one can predict the importance of a current paper (a paper that is recently published in the literature). We look at three factors--journal importance, reference importance and author reputation. Citation-based measures of importance are used for all variables. We find that journal importance is the best predictor (explaining 22.3% out of a potential 29.1% of the variance in the data), and that this correlation value varies significantly by discipline. Journal importance is a better predictor of citation in Computer Science than in any other discipline. While the finding supports the present policy of using journal impact statistics as a surrogate for the importance of current papers, it calls into question the present policy of equally weighting current documents in text-based analyses. We suggest that future researchers take into account the expected importance of a document when attempting to describe the cognitive structure of a field.

  5. Predictors of nurses' experience of verbal abuse by nurse colleagues.

    Science.gov (United States)

    Keller, Ronald; Krainovich-Miller, Barbara; Budin, Wendy; Djukic, Maja

    Between 45% and 94% of registered nurses (RNs) experience verbal abuse, which is associated with physical and psychological harm. Although several studies examined predictors of RNs' verbal abuse, none examined predictors of RNs' experiences of verbal abuse by RN colleagues. To examine individual, workplace, dispositional, contextual, and interpersonal predictors of RNs' reported experiences of verbal abuse from RN colleagues. In this secondary analysis, a cross-sectional design with multiple linear regression analysis was used to examine the effect of 23 predictors on verbal abuse by RN colleagues in a sample of 1,208 early career RNs. Selected variables in the empirical intragroup conflict model explained 23.8% of variance in RNs' experiences of verbal abuse by RN colleagues. A number of previously unstudied factors were identified that organizational leaders can monitor and develop or modify policies to prevent early career RNs' experiences of verbal abuse by RN colleagues. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation: long-term results from the Bio-CAPTURE registry.

    Science.gov (United States)

    van den Reek, J M P A; Tummers, M; Zweegers, J; Seyger, M M B; van Lümig, P P M; Driessen, R J B; van de Kerkhof, P C M; Kievit, W; de Jong, E M G J

    2015-03-01

    Drug survival is an indicator for treatment success; insight in predictors associated with drug survival is important. To analyse the long-term drug survival for adalimumab in patients with psoriasis treated in daily practice and (II) to identify predictors of prolonged drug survival for adalimumab split for different reasons of discontinuation. Data were extracted from a prospective psoriasis cohort and analysed using Kaplan-Meier survival curves split for reasons of discontinuation. Baseline predictors associated with longer drug survival were identified using multivariate Cox-regression analysis. One hundred and sixteen patients were included with a total of 208 patient-years. Overall drug survival was 76% after 1 year and 52% after 4.5 years. In patients who stopped due to ineffectiveness, longer drug survival was associated with the absence of specific comorbidities (P = 0.03). In patients who stopped due to side-effects, longer drug survival was associated with male gender (P = 0.02). Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation. Strong, specific predictors can lead to patient-tailored treatment. © 2014 European Academy of Dermatology and Venereology.

  7. Predictors of disability retirement.

    Science.gov (United States)

    Krause, N; Lynch, J; Kaplan, G A; Cohen, R D; Goldberg, D E; Salonen, J T

    1997-12-01

    Disability retirement may increase as the work force ages, but there is little information on factors associated with retirement because of disability. This is the first prospective population-based study of predictors of disability retirement including information on workplace, socioeconomic, behavioral, and health-related factors. The subjects were 1038 Finnish men who were enrolled in the Kuopio Ischemic Heart Disease Risk Factor Study, who were 42, 48, 54, or 60 years of age at the beginning of the study, and who participated in a 4-year follow-up medical examination. Various job characteristics predicted disability retirement. Heavy work, work in uncomfortable positions, long workhours, noise at work, physical job strain, musculoskeletal strain, repetitive or continuous muscle strain, mental job strain, and job dissatisfaction were all significantly associated with the incidence of disability retirement. The ability to communicate with fellow workers and social support from supervisors tended to reduce the risk of disability retirement. The relationships persisted after control for socioeconomic factors, prevalent disease, and health behavior, which were also associated with disability retirement. The strong associations found between workplace factors and the incidence of disability retirement link the problem of disability retirement to the problem of poor work conditions.

  8. Prediction of fruit and vegetable intake: The importance of contextualizing motivation.

    Science.gov (United States)

    Evans, Rachel; Kawabata, Masato; Thomas, Shirley

    2015-09-01

    Motivation is identified as a key antecedent of self-regulated behaviour, such as eating fruit and vegetables. However, inaccurate measurement of this construct may lead to poor prediction of behaviour and inflate the impact of post-motivational factors, such as planning, in models of health behaviour. This study explored the properties of a newly identified measure of motivation, termed behavioural resolve (Rhodes & Horne, 2013, Psychol. Sport Exerc., 14, 455-460), in relation to intention, planning, and fruit and vegetable intake (FVI). Prospective self-report survey. University students living in the United Kingdom completed two online surveys. The first assessed demographic and predictor variables (intention, behavioural resolve, action planning, and coping planning). The second, completed approximately 2 weeks later, measured average daily FVI and perceived experience of obstacles to FVI. At Time 1, there were 195 respondents, with 139 providing follow-up data. All predictor variables were significantly correlated with FVI. Two independent multiple hierarchical regression analyses revealed that both intention and behavioural resolve were significant predictors of FVI, but behavioural resolve explained greater FVI variance (40.1%) than intention (36.4%). Furthermore, action planning showed incremental predictive utility over intention, but not behavioural resolve, in predicting FVI. The results indicated that motivation is an important determinant of FVI for students, with behavioural resolve demonstrating advantages over intention as a measure of this domain and a predictor of FVI behaviour. © 2014 The British Psychological Society.

  9. Predictors of intractable childhood epilepsy

    International Nuclear Information System (INIS)

    Malik, M.A.; Ahmed, T.M.

    2008-01-01

    To determine the prognosis of seizures in epileptic children and identify early predictors of intractable childhood epilepsy. All children (aged 1 month to 16 years) with idiopathic or cryptogenic epilepsy who were treated and followed at the centre during the study period were included. The patients who had marked seizures even after two years of adequate treatment were labeled as intractable epileptics (cases). Children who had no seizure for more than one year at last follow-up visit were the controls. Adequate treatment was described as using at least three anti-epileptic agents either alone or in combination with proper compliance and dosage. Records of these patients were reviewed to identify the variables that may be associated with seizure intractability. Of 442 epileptic children, 325 (74%) intractable and 117 (26%) control epileptics were included in the study. Male gender (OR=3.92), seizures onset in infancy >10 seizures before starting treatment (OR=3.76), myoclonic seizures (OR=1.37), neonatal seizures (OR=3.69), abnormal EEG (OR=7.28) and cryptogenic epilepsy (OR=9.69) and head trauma (OR=4.07) were the factors associated with intractable epilepsy. Seizure onset between 5-7 years of age, idiopathic epilepsy, and absence seizures were associated with favourable prognosis in childhood epilepsy. Intractable childhood epilepsy is expected if certain risk factors such as type, age of onset, gender and cause of epilepsy are found. Early referral of such patients to the specialized centres is recommended for prompt and optimal management. (author)

  10. Predictors of performance on the MMSE and the DRS-2 among American Indian elders.

    Science.gov (United States)

    Jervis, Lori L; Fickenscher, Alexandra; Beals, Janette; Cullum, C Munro; Novins, Douglas K; Manson, Spero M; Arciniegas, David B

    2010-01-01

    Little is known about factors that predict older American Indians' performance on cognitive tests. This study examined 137 American Indian elders' performance on the MMSE and the Dementia Rating Scale-Second Edition (DRS-2). Multivariate regression identified younger age, more education, not receiving Supplemental Security Income, and frequent receipt of needed health care as predictors of better performance on the MMSE. Better performance on the DRS-2 was predicted by more education, boarding school attendance, not receiving Supplemental Security Income, and frequent receipt of needed health care. This study points to the importance of economic and educational factors on cognitive test performance among American Indian elders.

  11. Predictors of meaningful improvement in quality of life after temporal lobe epilepsy surgery: A prospective study.

    Science.gov (United States)

    Pauli, Carla; Schwarzbold, Marcelo Liborio; Diaz, Alexandre Paim; de Oliveira Thais, Maria Emilia Rodrigues; Kondageski, Charles; Linhares, Marcelo Neves; Guarnieri, Ricardo; de Lemos Zingano, Bianca; Ben, Juliana; Nunes, Jean Costa; Markowitsch, Hans Joachim; Wolf, Peter; Wiebe, Samuel; Lin, Katia; Walz, Roger

    2017-05-01

    To investigate prospectively the independent predictors of a minimum clinically important change (MCIC) in quality of life (QOL) after anterior temporal lobectomy (ATL) for drug-resistant mesial temporal lobe epilepsy related to hippocampal sclerosis (MTLE-HS) in Brazilian patients. Multiple binary logistic regression analysis was performed to identify the clinical, demographic, radiologic, and electrophysiologic variables independently associated with MCIC in the Quality of Life in Epilepsy-31 Inventory (QOLIE-31) overall score 1 year after ATL in 77 consecutive patients with unilateral MTLE-HS. The overall QOLIE-31 score and all its subscale scores increased significantly (p Epilepsy.

  12. Acute single channel EEG predictors of cognitive function after stroke.

    Directory of Open Access Journals (Sweden)

    Anna Aminov

    Full Text Available Early and accurate identification of factors that predict post-stroke cognitive outcome is important to set realistic targets for rehabilitation and to guide patients and their families accordingly. However, behavioral measures of cognition are difficult to obtain in the acute phase of recovery due to clinical factors (e.g. fatigue and functional barriers (e.g. language deficits. The aim of the current study was to test whether single channel wireless EEG data obtained acutely following stroke could predict longer-term cognitive function.Resting state Relative Power (RP of delta, theta, alpha, beta, delta/alpha ratio (DAR, and delta/theta ratio (DTR were obtained from a single electrode over FP1 in 24 participants within 72 hours of a first-ever stroke. The Montreal Cognitive Assessment (MoCA was administered at 90-days post-stroke. Correlation and regression analyses were completed to identify relationships between 90-day cognitive function and electrophysiological data, neurological status, and demographic characteristics at admission.Four acute qEEG indices demonstrated moderate to high correlations with 90-day MoCA scores: DTR (r = -0.57, p = 0.01, RP theta (r = 0.50, p = 0.01, RP delta (r = -0.47, p = 0.02, and DAR (r = -0.45, p = 0.03. Acute DTR (b = -0.36, p < 0.05 and stroke severity on admission (b = -0.63, p < 0.01 were the best linear combination of predictors of MoCA scores 90-days post-stroke, accounting for 75% of variance.Data generated by a single pre-frontal electrode support the prognostic value of acute DAR, and identify DTR as a potential marker of post-stroke cognitive outcome. Use of single channel recording in an acute clinical setting may provide an efficient and valid predictor of cognitive function after stroke.

  13. Predictors of fatigue and work ability in cancer survivors.

    Science.gov (United States)

    van Muijen, P; Duijts, S F A; Bonefaas-Groenewoud, K; van der Beek, A J; Anema, J R

    2017-12-30

    Workers diagnosed with cancer are at risk for job loss or work disability. To determine predictors of fatigue and work ability at 36 months after diagnosis in a population of cancer survivors. Individuals diagnosed with cancer and who applied for work disability benefit at 24 months of sick leave were surveyed at the time of application and again 12 months later. Fatigue was measured using the Functional Assessment of Chronic Illness-Fatigue scale questionnaire and work ability was measured using the work ability index. Linear regression analyses were applied to identify predictors. There were 336 participants. Participants who were divorced or widowed had more physical limitations, more depressive symptoms and were more fatigued at baseline, and who worked in health care demonstrated higher levels of fatigue. Lower fatigue was predicted by having received chemotherapy. A higher level of work ability was predicted by having received chemotherapy, better global health and better work ability at baseline. Lower work ability was predicted by being principal wage earner, insecurity about being free of disease, having more physical limitations and having greater wage loss. Socio-demographic, health- and work-related factors were associated with fatigue and work ability in cancer survivors on long-term sick leave. As fatigue and poor work ability are important risk factors for work disability, addressing the identified predictive factors may assist in mitigation of work disability in cancer survivors. © The Author 2017. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  14. Prevalence and predictors of sunburn among beachgoers.

    Science.gov (United States)

    de Troya-Martín, Magdalena; de Gálvez-Aranda, María Victoria; Rivas-Ruiz, Francisco; Blázquez-Sánchez, Nuria; Fernández-Morano, Maria Teresa; Padilla-España, Laura; Herrera-Ceballos, Enrique

    2018-03-01

    Painful sunburns at any age are one of the main risk factors for skin cancer. To determine the prevalence and predictors of sunburn among beachgoers. A cross-sectional health survey was conducted at the beach during the summer. Adults >18 years with an understanding of Spanish were interviewed using a questionnaire about behaviours, attitudes and knowledge related to sun exposure at the beach. A descriptive analysis was performed, and a log-binomial regression model was used to determine predictors of sunburn. The survey was completed by 1054 beachgoers, with a mean age of 43.8 (SD: 18.7) years, 61.2% women, skin phototypes i (13.6%), ii (22.3%), iii (34.0%) and iv (30.2%). 46.9% of responders reported at least one painful sunburn during the previous summer. Age, sex, education, skin phototype, midday sun exposure, sun protection habits, attitudes towards tanning and knowledge about skin cancer were identified as independent predictors of sunburn. It is necessary to develop photoprotection campaigns aimed at beachgoers, particularly in young people, men, those with skin phototypes I-III and secondary or university education. Educational strategies should be aimed at discouraging sun exposure at midday, changing attitudes towards tanning and improving knowledge about skin cancer. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Academic and non-academic predictors of student psychological distress: the role of social identity and loneliness.

    Science.gov (United States)

    McIntyre, Jason C; Worsley, Joanne; Corcoran, Rhiannon; Harrison Woods, Paula; Bentall, Richard P

    2018-06-01

    University students experience high rates of stress and mental illness; however, few studies have comprehensively examined the impact of academic and non-academic stressors on student mental health. Similarly, there has been little focus on the role of social groups in protecting against mental distress in this young adult group. To identify the key social determinants of mental health symptoms in a student population. Using an online survey, we administered measures of social connectedness and mental health symptoms alongside academic and non-academic stressors to a large sample of UK university students. Loneliness was the strongest overall predictor of mental distress, while assessment stress was the most important academic predictor. Strong identification with university friendship groups was most protective against distress relative to other social identities, and the beneficial impact of identification on symptoms was mediated by reduced loneliness. The study highlights the benefits of establishing strong social connections at university and the importance of minimising stress associated with assessment tasks.

  16. Sociodemographic Predictors of Sex Offender Stigma: How Politics Impact Attitudes, Social Distance, and Perceptions of Sex Offender Recidivism.

    Science.gov (United States)

    DeLuca, Joseph S; Vaccaro, John; Rudnik, Amalia; Graham, Nicole; Giannicchi, Anna; Yanos, Philip T

    2017-08-01

    Stigma toward general criminal offenders has been found to be particularly salient among community members who identify as politically conservative; however, less is known about how political identification relates to stigma toward sex offenders. This is a particularly important area of inquiry, given that criminal jurisprudence and politics legitimatize stigmatizing labels attributed to sex offenders through laws and policies that apply specifically to this group. A nonrandom sample ( N = 518) of participants living in the United States was recruited for this survey study. Findings indicated that a specific aspect of conservative political ideology-right-wing authoritarianism (RWA)-significantly predicts negative attitudes and intended social distancing behavior toward sex offenders, even when controlling for other important predictors, such as education and prior contact. RWA was found to be the strongest predictor of negative attitudes and estimations of sex offender recidivism, and also significantly predicted intended social distancing behavior. Implications for addressing stigma toward sex offenders are discussed.

  17. Concurrent sexual partners-A predictor of Chlamydia

    DEFF Research Database (Denmark)

    Jørgensen, Marianne Johansson; Olesen, Frede; Maindal, Helle Terkildsen

    2013-01-01

    , but the significance of this compared with other well-known predictors has only been briefly described. Aim: The aim is to examine if concurrent partners isan independent predictor for C. trachomatis infection in young Danes aged 15-29 years. Methods: Detailed sexual behavior data were collected via a web......:These preliminary results suggest that concurrent sexual partners is an important predictor for C.trachomatis infections among young Danes aged 15-29. A more concise conclusion will be presented at the Ph.D day......Background:Chlamydia trachomatis is the most common sexually transmitted bacterial infection among young Danes and the spread is highly dependent on the population’s sexual behavior. Previous studies have found concurrent partnerships to be a possible predictor for C. trachomatis...

  18. Identifying a borderline personality disorder prodrome: Implications for community screening.

    Science.gov (United States)

    Stepp, Stephanie D; Lazarus, Sophie A

    2017-08-01

    Elucidating early signs and symptoms of borderline personality disorder (BPD) has important implications for screening and identifying youth appropriate for early intervention. The purpose of this study was to identify dimensions of child temperament and psychopathology symptom severity that predict conversion to a positive screen for BPD over a 14-year follow-up period in a large, urban community sample of girls (n = 2 450). Parent and teacher reports of child temperament and psychopathology symptom severity assessed when girls were ages 5-8 years were examined as predictors of new-onset BPD cases when girls were ages 14-22 years. In the final model, parent and teacher ratings of emotionality remained significant predictors of new-onset BPD. Additionally, parent ratings of hyperactivity/impulsivity and depression severity, as well as teacher ratings of inattention severity, were also predictive. Results also revealed that elevations in these dimensions pose a notable increase in risk for conversion to BPD over the follow-up period. Supplementary analyses revealed that with the exception of parent-reported depression severity, these same predictors were associated with increases in BPD symptom severity over the follow-up period. These findings suggest BPD onset in adolescence and early adulthood can be detected from parent and teacher reports of temperament and symptom severity dimensions assessed in childhood. The identification of this prodrome holds promise for advancing early detection of children at risk prior to the development of the full-blown disorder. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  19. Personality as predictor of customer service centre agent performance in the banking industry: An exploratory study

    Directory of Open Access Journals (Sweden)

    Linda Blignaut

    2014-10-01

    Research purpose: The aim of the study was to identify personality traits, as measured by the Occupational Personality Questionnaire 32r (item response theory scored version, including the more parsimonious Big Five personality traits, that may act as job performance predictors for customer service centre (CSC agents in the banking industry. Motivation for the study: This study provides an exploratory investigation of whether specific personality traits differ amongst CSC agents in the banking industry, based on their job performance. No published research in this field could be identified. Research design, approach and method: Purposive sampling was used to collect data from the entire CSC agent base of a particular banking group (N = 89. Responses were analysed by means of quantitative techniques. Main findings and practical/managerial implications: Results indicate that parsimonious traits of personality, expressed as the Big Five personality traits, predict job performance. The importance of carefully selecting suitable job performance criteria for a specific environment, however, emerged as a critical issue in performance prediction. Contribution: The study focuses attention on the importance of CSC agents’ performance as frontline staff in the banking industry and identifying valid criteria for selecting the most suitable agents. Providing a one-contact point of service such as a CSC is a fairly new approach in the South African banking industry and this study provides an initial investigation of personality traits that may serve as job performance predictors in this environment.

  20. Can You Hack It? Validating Predictors for IT Boot Camps

    Science.gov (United States)

    Gear, Courtney C.

    Given the large number of information technology jobs open and lack of qualified individuals to fill them, coding boot camps have sprung up in response to this skill gap by offering a specialized training program in an accelerated format. This fast growth has created a need to measure these training programs and understand their effectiveness. In the present study, a series of analyses examined whether specific or combinations of predictors were valid for training performance in this coding academy. Self-rated, daily efficacy scores were used as outcome variables of training success and correlation results showed a positive relationship with efficacy scores and the logic test score as a predictor. Exploratory analyses indicated a Dunning-Kruger effect where students with lower education levels experience higher overall mood during the training program. Limitations of the study included small sample size, severe range restriction in predictor scores, lack of variance in predictor scores, and low variability in training program success. These limitations made identifying jumps between training stages difficult to identify. By identifying which predictors matter most for each stage of skill acquisition, further research should consider more objective variables such as instructor scores which can serve as a guideline to better asses what stage learners join at and how to design curriculum and assignments accordingly (Honken, 2013).

  1. Assessing the relative importance of correlates of loneliness in later life

    DEFF Research Database (Denmark)

    Ejlskov, Linda; Wulff, Jesper; Bøggild, Henrik

    2017-01-01

    OBJECTIVES: Improving the design and targeting of interventions is important for alleviating loneliness among older adults. This requires identifying which correlates are the most important predictors of loneliness. This study demonstrates the use of recursive partitioning in exploring...... the characteristics and assessing the relative importance of correlates of loneliness in older adults. METHOD: Using exploratory regression trees and random forests, we examined combinations and the relative importance of 42 correlates in relation to loneliness at age 68 among 2453 participants from the birth cohort...... study the MRC National Survey of Health and Development. RESULTS: Positive mental well-being, personal mastery, identifying the spouse as the closest confidant, being extrovert and informal social contact were the most important correlates of lower loneliness levels. Participation in organised groups...

  2. Predictors and risk factors for the intestinal shedding of Escherichia coli O157 among working donkeys (Equus asinus) in Nigeria

    Science.gov (United States)

    Jedial, Jesse T.; Shittu, Aminu; Tambuwal, Faruk M.; Abubakar, Mikail B.; Garba, Muhammed K.; Kwaga, Jacob P.; Fasina, Folorunso O.

    2015-01-01

    Objectives Escherichia coli are an important group of bacteria in the normal gastrointestinal system but can sometimes cause infections in domestic animals and man. Donkeys are routinely used as multipurpose animal but details of burdens of potentially infectious bacteria associated with it are limited. The prevalence and associations between intestinal shedding of E. coli O157 and animal characteristics and management factors were studied among 240 randomly selected working donkeys in north-western Nigeria. Design Four local government areas, of Sokoto State in north-western Nigeria were recruited in this study. A multistage randomised cluster design was used to select subjects and donkey owners within selected zones. Confirmation of infection was based on bacterial culture, isolation and biochemical test for E. coli O157 from faecal samples. Results Of the total bacteria isolated, 203 of the 329 (61.70 per cent) were E. coli, 76 of which was E. coli serotype O157. A multivariable logistic regression model was used to examine the relation between intestinal shedding of E. coli O157 and selected variables. The analysis yielded five potential predictors of shedding: soft faeces in donkeys, Akaza and Fari ecotypes of donkey were positive predictors while maize straw as feed and sampling during the cold dry period were negative predictors. Conclusions This study concludes that controlling intestinal shedding of E. coli O157 among working donkeys in Nigeria is possible using the identified predictors in planning appropriate interventions to reduced human risk of infection. PMID:26392892

  3. Predictors of perceived togetherness in very old men and women: a 5-year follow-up study.

    Science.gov (United States)

    Tiikkainen, P; Leskinen, E; Heikkinen, R-L

    2008-01-01

    Although a considerable amount of research has been carried out on older adults' social ties, most of it has focused on quantitative aspects and on cross-sectional samples. In this study, the subjective aspect of social interaction is described by the concept of perceived togetherness. The aim of this study was to examine the extent to which different factors predict perceived togetherness in men and women over a 5-year period. It also addresses the question of whether it is possible to identify different subgroups in perceived togetherness. The data were collected with structured interviews and laboratory tests from 225 elderly people at ages 80 and 85. The results showed that the predictors of perceived togetherness partly differed between sexes as well as within the groups of males and females. Predictors common to both genders were contacts with friends, less depressive symptoms, higher education level and better coping with instrumental activities of daily living (IADLs). The findings indicated the importance of friends. Widowhood and self-rated health were predictors in women but not in men. Moreover, there appeared to be two subgroups of women and men in perceived togetherness; these were labeled "socially embedded", "socially isolated", "socially active" and "solitary". The results indicate diversity in perceived togetherness and its predictors. More attention should be paid to individual differences in order to prevent loneliness and to promote older adults' well-being.

  4. Early concern and disregard for others as predictors of antisocial behavior

    Science.gov (United States)

    Rhee, Soo Hyun; Friedman, Naomi P.; Boeldt, Debra L.; Corley, Robin P.; Hewitt, John. K.; Knafo, Ariel; Lahey, Benjamin B.; Robinson, JoAnn; Van Hulle, Carol A.; Waldman, Irwin D.; Young, Susan E.; Zahn-Waxler, Carolyn

    2012-01-01

    Background Prediction of antisocial behavior is important given its adverse impact on both the individuals engaging in antisocial behavior and society. Additional research identifying early predictors of future antisocial behavior, or antisocial propensity, is needed. The present study tested the hypothesis that both concern for others and active disregard for others in distress in toddlers and young children predict antisocial behavior during middle childhood and adolescence. Methods A representative sample of same-sex twins (N = 956) recruited in Colorado was examined. Mother-rated and researcher-observed concern and disregard for others assessed at age 14 to 36 months were examined as predictors of parent- (age 4 to 12), teacher- (age 7 to 12), and self-reported (age 17) antisocial behavior. Results Observed disregard for others predicted antisocial behavior assessed by three different informants (parents, teachers, and self), including antisocial behavior assessed 14 years later. It also predicted a higher-order antisocial behavior factor (β = .58, p concern for others. Mother-rated disregard for others predicted parent-reported antisocial behavior. Contrary to predictions, neither mother-rated nor observed concern for others inversely predicted antisocial behavior. Results of twin analyses suggested that the covariation between observed disregard for others and antisocial behavior was due to shared environmental influences. Conclusions Disregard for others in toddlerhood/early childhood is a strong predictor of antisocial behavior in middle childhood and adolescence. The results suggest the potential need for early assessment of disregard for others and the development of potential interventions. PMID:23320806

  5. Predictors of depressive symptoms in older Japanese primiparas at 1 month post-partum: A risk-stratified analysis.

    Science.gov (United States)

    Iwata, Hiroko; Mori, Emi; Tsuchiya, Miyako; Sakajo, Akiko; Maehara, Kunie; Ozawa, Harumi; Morita, Akiko; Maekawa, Tomoko; Aoki, Kyoko; Tamakoshi, Koji

    2016-01-01

    Older maternal age has become more common in Japan. Studies suggest that older maternal age and primiparity are associated with post-partum depression. The present study aimed to identify predictors of post-partum depression in older Japanese primiparas at 1 month post-partum. Participants were 479 primiparas aged 35 years and over, drawn from a prospective cohort study. Data were collected using self-report questionnaires. Depression was measured with the Japanese version of the Edinburgh Postnatal Depression Scale. Stepwise logistic regression analysis was conducted on binary outcome variables of depression at 1 month post-partum, along with a stratified analysis based on the risk status of depression. Five predictors were identified: (i) the depression score during hospital stay; (ii) financial burden; (iii) dissatisfaction with appraisal support; (iv) physical burden in daily life; and (v) concerns about infant caretaking. Stratified analysis identified dissatisfaction with instrumental support in the low-risk group, and the Child-care Value Scale score as unique predictors in the high-risk group. These results highlight the importance of early assessment of depressive symptoms and the provision of continuous care. © 2015 Japan Academy of Nursing Science.

  6. Predictors of Longitudinal Quality of Life in Juvenile Localized Scleroderma.

    Science.gov (United States)

    Ardalan, Kaveh; Zigler, Christina K; Torok, Kathryn S

    2017-07-01

    Localized scleroderma can negatively affect children's quality of life (QoL), but predictors of impact have not been well described. We sought to identify predictors of QoL impact in juvenile localized scleroderma patients. We analyzed longitudinal data from a single-center cohort of juvenile localized scleroderma patients, using hierarchical generalized linear modeling (HGLM) to identify predictors of QoL impact. HGLM is useful for nested data and allows for evaluation of both time-variant and time-invariant predictors. The number of extracutaneous manifestations (ECMs; e.g., joint contracture and hemifacial atrophy) and female sex predicted negative QoL impact, defined as a Children's Dermatology Life Quality Index score >1 (P = 0.019 for ECMs and P = 0.002 for female sex). As the time since the initial visit increased, the odds of reporting a negative QoL impact decreased (P scleroderma than cutaneous features. Further study is required to determine which ECMs have the most impact on QoL, which factors underlie sex differences in QoL in localized scleroderma, and why increasing the time since the initial visit appears to be protective. An improved understanding of predictors of QoL impact may allow for the identification of patients at risk of poorer outcomes and for the tailoring of treatment and psychosocial support. © 2016, American College of Rheumatology.

  7. Predictors and prognostic value of left atrial remodelling after acute myocardial infarction

    DEFF Research Database (Denmark)

    Kyhl, Kasper; Vejlstrup, Niels; Lønborg, Jacob

    2015-01-01

    PURPOSE: Left atrial (LA) volume is a strong prognostic predictor in patients following ST-segment elevation myocardial infarction (STEMI). However, the change in LA volume over time (LA remodelling) following STEMI has been scarcely studied. We sought to identify predictors for LA remodelling an...

  8. Cognitive predictors of children's development in mathematics achievement : A latent growth modeling approach

    NARCIS (Netherlands)

    Xenidou-Dervou, Iro; Van Luit, Johannes E H; Kroesbergen, Evelyn H; Friso-van den Bos, Ilona; Jonkman, Lisa M; van der Schoot, Menno; van Lieshout, Ernest C D M

    2018-01-01

    Research has identified various domain-general and domain-specific cognitive abilities as predictors of children's individual differences in mathematics achievement. However, research into the predictors of children's individual growth rates, namely between-person differences in within-person change

  9. Salient Predictors of School Dropout among Secondary Students with Learning Disabilities

    Science.gov (United States)

    Doren, Bonnie; Murray, Christopher; Gau, Jeff M.

    2014-01-01

    The purpose of this study was to identify the unique contributions of a comprehensive set of predictors and the most salient predictors of school dropout among a nationally representative sample of students with learning disabilities (LD). A comprehensive set of theoretically and empirically relevant factors was selected for examination. Analyses…

  10. Religiosity and Authoritarianism as Predictors of Attitude toward the Disabled: A Regression Analysis.

    Science.gov (United States)

    Tunick, Roy H.; And Others

    1979-01-01

    This study identifies predictors and correlates of attitudes toward the disabled. Authoritarianism, church attendance, religious orthodoxy, age, and education were significantly related to these attitudes of people in a Rocky Mountain Community. Significant predictors of the criterion were authoritarianism, religiosity, and age. Recommendations…

  11. Community College Faculty Recruitment: Predictors of Applicant Attraction to Faculty Positions.

    Science.gov (United States)

    Winter, Paul A.; Kjorlien, Chad L.

    2000-01-01

    Utilizes MBA students' biographical data and reactions to simulated position ads for community college business faculty positions to identify predictors of applicant decisions. Reveals four significant predictors of participants' ratings of simulated positions: applicant's current job satisfaction, spouse's contribution to household income,…

  12. Predictors and Outcomes of Dysphagia Screening After Acute Ischemic Stroke.

    Science.gov (United States)

    Joundi, Raed A; Martino, Rosemary; Saposnik, Gustavo; Giannakeas, Vasily; Fang, Jiming; Kapral, Moira K

    2017-04-01

    Guidelines advocate screening all acute stroke patients for dysphagia. However, limited data are available regarding how many and which patients are screened and how failing a swallowing screen affects patient outcomes. We sought to evaluate predictors of receiving dysphagia screening after acute ischemic stroke and outcomes after failing a screening test. We used the Ontario Stroke Registry from April 1, 2010, to March 31, 2013, to identify patients hospitalized with acute ischemic stroke and determine predictors of documented dysphagia screening and outcomes after failing the screening test, including pneumonia, disability, and death. Among 7171 patients, 6677 patients were eligible to receive dysphagia screening within 72 hours, yet 1280 (19.2%) patients did not undergo documented screening. Patients with mild strokes were significantly less likely than those with more severe strokes to have documented screening (adjusted odds ratio, 0.51; 95% confidence interval [CI], 0.41-0.64). Failing dysphagia screening was associated with poor outcomes, including pneumonia (adjusted odds ratio, 4.71; 95% CI, 3.43-6.47), severe disability (adjusted odds ratio, 5.19; 95% CI, 4.48-6.02), discharge to long-term care (adjusted odds ratio, 2.79; 95% CI, 2.11-3.79), and 1-year mortality (adjusted hazard ratio, 2.42; 95% CI, 2.09-2.80). Associations were maintained in patients with mild strokes. One in 5 patients with acute ischemic stroke did not have documented dysphagia screening, and patients with mild strokes were substantially less likely to have documented screening. Failing dysphagia screening was associated with poor outcomes, including in patients with mild strokes, highlighting the importance of dysphagia screening for all patients with acute ischemic stroke. © 2017 American Heart Association, Inc.

  13. Predictors of non-participation in cervical screening in Denmark.

    Science.gov (United States)

    Kristensson, Jenny Hansen; Sander, Bente Braad; von Euler-Chelpin, My; Lynge, Elsebeth

    2014-04-01

    The aims of this study were to identify demographic and socio-economic predictors of non-participation in cervical screening in Denmark, and to evaluate the influence of health care use on screening participation. A population based register study was undertaken using data from the Central Population Register, the national Patobank, and Statistics Denmark. The study included women aged 25-54 years on 1st of January 2002, living in Denmark during the next 5 years, and without a history of total hysterectomy, N=1,052,447. Independent variables included age, civil status, nationality, level of education, and use of health care. Associations with non-participation in screening were determined with logistic regression. Main predictors of non-participation were limited or no contact with dental services (odds ratio (OR)=2.36), general practitioners (OR=1.75), and high age (OR=1.98). Other important factors for non-participation were primary school education only (OR=1.53), not being married (OR=1.49), and foreign nationality (OR=1.32). A 2-1.5-fold difference in non-participation in cervical screening in Denmark was found across various population sub-groups. Increased screening compliance among women with primary school education only, and limited or no use of primary health care services in general could potentially diminish the current social inequalities in cervical cancer incidence, and thus decrease the overall high incidence of this disease in Denmark. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Predictors of outcome among patients with obstructive jaundice at ...

    African Journals Online (AJOL)

    Despite recent advances both in preoperative diagnosis and postoperative care, obstructive jaundice still contributes significantly to high morbidity and mortality. A prospective study was undertaken to identify predictors of outcome among patients with obstructive jaundice at Bugando Medical Centre in north-western ...

  15. Adolescent Gambling: A Narrative Review of Behavior and Its Predictors

    Science.gov (United States)

    Ariyabuddhiphongs, Vanchai

    2013-01-01

    This narrative review summarizes current knowledge on adolescent gambling for the period 1990-2010, assesses adolescent gambling behavior and person and environment predictors, and suggests directions for future research. The review includes 99 studies that identified their subjects as adolescents, children, youth, and students, and discusses…

  16. Predictors of Home Deliveries in Rakai District, Uganda | Nuwaha ...

    African Journals Online (AJOL)

    In order to identify independent predictors for home delivery, 211 women from 21 clusters, who had a delivery in the previous one year, were interviewed in Rakai District, Uganda, from June 2 to 30, 1997. Mothers answered questions regarding socio-economic, local, reproductive and self-efficacy variables and whether ...

  17. Predictors of smoking initiation among schoolchildren in Tunisia: a 4 ...

    African Journals Online (AJOL)

    Objective: To identify predictors of smoking initiation among non smoking Tunisian school children; and to propose efficient antismoking strategies in order to prevent smoking initiation. Methods: It was a cohort study surveying prospectively for four years pupils attending schools in Sousse city in Tunisia. 441 non smoking ...

  18. Predictors of Heterosexual College Students' Attitudes toward LGBT People

    Science.gov (United States)

    Woodford, Michael R.; Silverschanz, Perry; Swank, Eric; Scherrer, Kristin S.; Raiz, Lisa

    2012-01-01

    This study identifies the predictors of U.S. heterosexual undergraduate and graduate college students' attitudes toward lesbian, gay, bisexual, and transgender (LGBT) people as a group rather than toward individual identities. Findings suggest that affirming LGBT attitudes are most strongly associated with liberal political ideology and whether…

  19. Predictors of neonatal outcome in early-onset placental dysfunction

    NARCIS (Netherlands)

    Baschat, Ahmet A.; Cosmi, Erich; Bilardo, Catarina M.; Wolf, Hans; Berg, Christoph; Rigano, Serena; Germer, Ute; Moyano, Dolores; Turan, Sifa; Hartung, John; Bhide, Amarnath; Müller, Thomas; Bower, Sarah; Nicolaides, Kypros H.; Thilaganathan, Baskaran; Gembruch, Ulrich; Ferrazzi, Enrico; Hecher, Kurt; Galan, Henry L.; Harman, Chris R.

    2007-01-01

    To identify specific estimates and predictors of neonatal morbidity and mortality in early onset fetal growth restriction due to placental dysfunction. Prospective multicenter study of prenatally diagnosed growth-restricted liveborn neonates of less than 33 weeks of gestational age. Relationships

  20. Predictors of Adolescent Breakfast Consumption: Longitudinal Findings from Project EAT

    Science.gov (United States)

    Bruening, Meg; Larson, Nicole; Story, Mary; Neumark-Sztainer, Dianne; Hannan, Peter

    2011-01-01

    Objective: To identify predictors of breakfast consumption among adolescents. Methods: Five-year longitudinal study Project EAT (Eating Among Teens). Baseline surveys were completed in Minneapolis-St. Paul schools and by mail at follow-up by youth (n = 800) transitioning from middle to high school. Linear regression models examined associations…

  1. Predictors of under-five childhood diarrhea: Mecha District, West ...

    African Journals Online (AJOL)

    admin

    Bivariate and multivariate logistic regression analyses were undertaken to identify predictors of childhood diarrhea. Results: The prevalence of diarrhea among mothers and under-five children was 8.2% and 18.0%, respectively. Maternal education (AOR=5.6, 95% CI: 1.5 - 19.4), maternal history of recent diarrhea (AOR, 5.5 ...

  2. Predictors of the effectiveness of accreditation on hospital performance

    DEFF Research Database (Denmark)

    Bie Bogh, Søren; Falstie-Jensen, Anne Mette; Hollnagel, Erik

    2017-01-01

    Objective: To identify predictors of the effectiveness of hospital accreditation on process performance measures. Design: A multi-level, longitudinal, stepped-wedge, nationwide study. Participants: All patients admitted for acute stroke, heart failure, ulcers, diabetes, breast cancer and lung can...

  3. Predictors and patterns of problematic Internet game use using a decision tree model

    Science.gov (United States)

    Rho, Mi Jung; Jeong, Jo-Eun; Chun, Ji-Won; Cho, Hyun; Jung, Dong Jin; Choi, In Young; Kim, Dai-Jin

    2016-01-01

    Background and aims Problematic Internet game use is an important social issue that increases social expenditures for both individuals and nations. This study identified predictors and patterns of problematic Internet game use. Methods Data were collected from online surveys between November 26 and December 26, 2014. We identified 3,881 Internet game users from a total of 5,003 respondents. A total of 511 participants were assigned to the problematic Internet game user group according to the Diagnostic and Statistical Manual of Mental Disorders Internet gaming disorder criteria. From the remaining 3,370 participants, we used propensity score matching to develop a normal comparison group of 511 participants. In all, 1,022 participants were analyzed using the chi-square automatic interaction detector (CHAID) algorithm. Results According to the CHAID algorithm, six important predictors were found: gaming costs (50%), average weekday gaming time (23%), offline Internet gaming community meeting attendance (13%), average weekend and holiday gaming time (7%), marital status (4%), and self-perceptions of addiction to Internet game use (3%). In addition, three patterns out of six classification rules were explored: cost-consuming, socializing, and solitary gamers. Conclusion This study provides direction for future work on the screening of problematic Internet game use in adults. PMID:27499227

  4. Predictors and patterns of problematic Internet game use using a decision tree model.

    Science.gov (United States)

    Rho, Mi Jung; Jeong, Jo-Eun; Chun, Ji-Won; Cho, Hyun; Jung, Dong Jin; Choi, In Young; Kim, Dai-Jin

    2016-09-01

    Background and aims Problematic Internet game use is an important social issue that increases social expenditures for both individuals and nations. This study identified predictors and patterns of problematic Internet game use. Methods Data were collected from online surveys between November 26 and December 26, 2014. We identified 3,881 Internet game users from a total of 5,003 respondents. A total of 511 participants were assigned to the problematic Internet game user group according to the Diagnostic and Statistical Manual of Mental Disorders Internet gaming disorder criteria. From the remaining 3,370 participants, we used propensity score matching to develop a normal comparison group of 511 participants. In all, 1,022 participants were analyzed using the chi-square automatic interaction detector (CHAID) algorithm. Results According to the CHAID algorithm, six important predictors were found: gaming costs (50%), average weekday gaming time (23%), offline Internet gaming community meeting attendance (13%), average weekend and holiday gaming time (7%), marital status (4%), and self-perceptions of addiction to Internet game use (3%). In addition, three patterns out of six classification rules were explored: cost-consuming, socializing, and solitary gamers. Conclusion This study provides direction for future work on the screening of problematic Internet game use in adults.

  5. Parents' Primary Professional Sources of Parenting Advice Moderate Predictors of Parental Attitudes toward Corporal Punishment.

    Science.gov (United States)

    Taylor, Catherine A; McKasson, Sarah; Hoy, Guenevere; DeJong, William

    2017-02-01

    Despite the risk it poses to children's mental and physical health, approval and use of corporal punishment (CP) remains high in the United States. Informed by the Theory of Planned Behavior, we examined potential predictors of attitudes supportive of CP while assessing the moderating effects of parents' (N=500) chosen primary professional source of advice regarding child discipline: pediatricians (47.8%), religious leaders (20.8%), mental health professionals (MHPs) (n=18.4%), or other identified professionals (13.0%). We conducted a random-digit-dial telephone survey among parents ages 18 and over within New Orleans, LA. The main outcome measure was derived from the Attitudes Toward Spanking scale (ATS). The main "predictors" were: perceived injunctive norms (i.e., perceived approval of CP by professionals; and by family and friends), perceived descriptive norms of family and friends regarding CP, and expected outcomes of CP use. We used multivariate OLS models to regress ATS scores on the predictor variables for each subset of parents based on their chosen professional source of advice. Perceived approval of CP by professionals was the strongest predictor of parental attitudes supportive of CP, except for those seeking advice from MHPs. Perceived injunctive and descriptive norms of family and friends were important, but only for those seeking advice from pediatricians or religious leaders. Positive expected outcomes of CP mattered, but only for those seeking advice from religious leaders or MHPs. In conclusion, the strength and relevance of variables predicting attitudes toward CP varied according to the professional from which the parent was most likely to seek advice.

  6. Prevalence and predictors associated with intestinal infections by protozoa and helminths in southern Brazil.

    Science.gov (United States)

    Casavechia, Maria Teresinha Gomes; Lonardoni, Maria Valdrinez Campana; Venazzi, Eneide Aparecida Sabaini; Campanerut-Sá, Paula Aline Zanetti; da Costa Benalia, Hugo Rafael; Mattiello, Matheus Felipe; Menechini, Pedro Victor Lazaretti; Dos Santos, Carlos Aparecido; Teixeira, Jorge Juarez Vieira

    2016-06-01

    Approximately 2 billion people are infected with soil-transmitted helminths worldwide, mainly in tropical and subtropical areas. This research aimed to investigate the prevalence and predictors associated with parasitic infections in primary health care. A cross-sectional study was performed with a large random sample to identify the prevalence and predictors associated with parasitic infections in primary health care in Marialva, southern Brazil, from April 2011 to September 2013. Stool samples from 775 individuals were analyzed for the presence of protozoan cysts, helminth eggs, and larvae. The overall prevalence of intestinal parasites was 13.94 %, and the prevalence of protozoa and helminths was 15.1 and 2.9 %, respectively. The predictor variables that were associated with intestinal parasites were male gender odds ratio (OR) 1.60, 95 % confidence interval (CI 1.10-2.40) and the absence of a kitchen garden (OR 2.28, 95 % CI, 1.08-4.85). Positive associations were found between Giardia duodenalis and individuals aged ≤18 with high risk (OR 19.0, 95 % CI 2.16-167.52), between Endolimax nana and the absence of a kitchen garden (p < 0.01), and between Trichuris trichiura and the presence of a kitchen garden (p = 0.014). Polyparasitism was present in 27.27 % of infected individuals. Our findings confirmed a relatively low prevalence in primary care, compared to international standards, despite the rare publications in the area. As variables, male gender and the absence of a kitchen garden stood out as important predictors. It is highly relevant that the health conditions of the population comply with consistent standards.

  7. Prevalence, associated factors and predictors of depression among adults in the community of Selangor, Malaysia.

    Directory of Open Access Journals (Sweden)

    Siti Fatimah Kader Maideen

    Full Text Available INTRODUCTION: Depression is one of the most common mental health disorders and is an emerging public health problem. The objectives of this paper were to determine the prevalence of depression, its associated factors and the predictors of depression among adults in the community of Selangor. METHODS: A cross sectional study was conducted in three districts in Selangor, from 11th June to 30th December 2012. The sampling frame was obtained from the Department of Statistics Malaysia (DOS in May 2012, using the National Population and Housing Census 2010. Adults aged 18 years and above, living in the selected living quarters were approached to participate in the study and requested to complete a set of questionnaires. RESULTS: A total of 1,556 out of 2,152 participants participated in this study, giving an overall study response rate of 61.90%. Patient Health Questionnaire 9 (PHQ-9 was used to determine the presence of depression. The prevalence of depression was 10.3%, based on the PHQ-9 cut off point of 10 and above. Based on multiple logistic regression analysis, the predictors of depression were presence of anxiety, serious problems at work, unhappy relationship with children, high perceived stress, domestic violence, unhappy relationship with spouse, low self-esteem, unhappy relationship with family, serious financial constraint and presence of chronic diseases. When reanalyzed after removing anxiety, high perceived stress and low self-esteem, additional predictors of depression were found to be serious marital problems and religiosity. CONCLUSION: The prevalence of depression in this study is similar to that found in other studies. Findings from this study are being used as baseline data to develop an effective program to assist in the management of common mental health disorders in the community, in particular depression. The identification of predictors of depression in the community is important to identify the target population for the

  8. Prevalence, associated factors and predictors of depression among adults in the community of Selangor, Malaysia.

    Science.gov (United States)

    Kader Maideen, Siti Fatimah; Sidik, Sherina Mohd; Rampal, Lekhraj; Mukhtar, Firdaus

    2014-01-01

    Depression is one of the most common mental health disorders and is an emerging public health problem. The objectives of this paper were to determine the prevalence of depression, its associated factors and the predictors of depression among adults in the community of Selangor. A cross sectional study was conducted in three districts in Selangor, from 11th June to 30th December 2012. The sampling frame was obtained from the Department of Statistics Malaysia (DOS) in May 2012, using the National Population and Housing Census 2010. Adults aged 18 years and above, living in the selected living quarters were approached to participate in the study and requested to complete a set of questionnaires. A total of 1,556 out of 2,152 participants participated in this study, giving an overall study response rate of 61.90%. Patient Health Questionnaire 9 (PHQ-9) was used to determine the presence of depression. The prevalence of depression was 10.3%, based on the PHQ-9 cut off point of 10 and above. Based on multiple logistic regression analysis, the predictors of depression were presence of anxiety, serious problems at work, unhappy relationship with children, high perceived stress, domestic violence, unhappy relationship with spouse, low self-esteem, unhappy relationship with family, serious financial constraint and presence of chronic diseases. When reanalyzed after removing anxiety, high perceived stress and low self-esteem, additional predictors of depression were found to be serious marital problems and religiosity. The prevalence of depression in this study is similar to that found in other studies. Findings from this study are being used as baseline data to develop an effective program to assist in the management of common mental health disorders in the community, in particular depression. The identification of predictors of depression in the community is important to identify the target population for the program.

  9. Patterns and predictors of conversion to bipolar disorder in 91 587 individuals diagnosed with unipolar depression.

    Science.gov (United States)

    Musliner, K L; Østergaard, S D

    2018-05-01

    Conversion from unipolar depression (UD) to bipolar disorder (BD) is a clinically important event that should lead to treatment modifications. Unfortunately, recognition of this transition is often delayed. Therefore, the objective of this study was to identify predictors of diagnostic conversion from UD to BD. Historical prospective cohort study based on 91 587 individuals diagnosed with UD in Danish hospital psychiatry between 1995 and 2016. The association between a series of potential predictors and the conversion from UD to BD during follow-up (702 710 person-years) was estimated by means of Cox regression with death as competing risk. During follow-up, 3910 individuals with UD developed BD. The cumulative incidence of conversion was slightly higher in females (8.7%, 95% CI: 8.2-9.3) compared to males (7.7%, 95% CI: 7.0-8.4). The strongest predictor of conversion from UD to BD was parental history of BD (adjusted hazard ratio (aHR) = 2.60, 95% CI: 2.20-3.07)). Other predictors included psychotic depression at the index UD episode (aHR = 1.73, 95% CI: 1.48-2.02), a prior/concomitant non-affective psychosis (aHR = 1.73, 95% CI: 1.51-1.99), and in-patient treatment at the index episode (aHR = 1.76, 95% CI: 1.63-1.91). Diagnostic conversion from UD to BD is predicted by severe depression requiring in-patient treatment, psychotic symptomatology, and parental history of BD. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Early predictors of high school mathematics achievement.

    Science.gov (United States)

    Siegler, Robert S; Duncan, Greg J; Davis-Kean, Pamela E; Duckworth, Kathryn; Claessens, Amy; Engel, Mimi; Susperreguy, Maria Ines; Chen, Meichu

    2012-07-01

    Identifying the types of mathematics content knowledge that are most predictive of students' long-term learning is essential for improving both theories of mathematical development and mathematics education. To identify these types of knowledge, we examined long-term predictors of high school students' knowledge of algebra and overall mathematics achievement. Analyses of large, nationally representative, longitudinal data sets from the United States and the United Kingdom revealed that elementary school students' knowledge of fractions and of division uniquely predicts those students' knowledge of algebra and overall mathematics achievement in high school, 5 or 6 years later, even after statistically controlling for other types of mathematical knowledge, general intellectual ability, working memory, and family income and education. Implications of these findings for understanding and improving mathematics learning are discussed.

  11. Motivational predictors of coping with academic examination.

    Science.gov (United States)

    Doron, Julie; Stephan, Yannick; Maiano, Christophe; Le Scanff, Christine

    2011-01-01

    The present study focused on the motivational predictors of coping with academic examination through the test of the contribution of self-determination for academic studies and achievement goals. Coping strategies, academic motivation and achievement goals were assessed among 199 undergraduate students. Regression analysis revealed that problem-focused coping is positively predicted by identified regulation and negatively by amotivation, whereas emotion-focused coping is positively predicted by introjected regulation and amotivation. Mastery approach goals contributed positively to problem-focused coping. Identified regulation and mastery approach goals made a unique positive contribution to problem-focused coping, and amotivation was negatively related. Students' coping actions may vary according to both the reasons why they engage in academic studies and the goals they pursue in this setting.

  12. Predictors of excellent response to lithium

    DEFF Research Database (Denmark)

    Kessing, Lars Vedel; Hellmund, Gunnar; Andersen, Per Kragh

    2011-01-01

    The aim of this study was to identify sociodemographic and clinical predictors of excellent response, that is, 'cure' of future affective episodes, to lithium in monotherapy. We used nationwide registers to identify all patients with a diagnosis of bipolar disorder in psychiatric hospital settings...... who were prescribed lithium from 1995 to 2006 in Denmark (N=3762). Excellent lithium responders were defined as patients who after a stabilization lithium start-up period of 6 months, continued lithium in monotherapy without getting hospitalized. The rate of excellent response to lithium...... with somatic comorbidity had increased rates of non-response to lithium compared with patients without somatic comorbidity (HR=1.23, 95% CI: 1.00-1.52).It is concluded that the prevalence of excellent response to lithium monotherapy is low and such patients are characterized by few earlier psychiatric...

  13. Predictors of Ramadan fasting during pregnancy

    Directory of Open Access Journals (Sweden)

    Lily A. van Bilsen

    2016-12-01

    Full Text Available Although the health effects of Ramadan fasting during pregnancy are still unclear, it is important to identify the predictors and motivational factors involved in women’s decision to observe the fast. We investigated these factors in a cross sectional study of 187 pregnant Muslim women who attended antenatal care visits in the Budi Kemuliaan Hospital, Jakarta, Indonesia. The odds of adherence to fasting were reduced by 4% for every week increase in gestational age during Ramadan [odds ratio (OR 0.96; 95% confidence interval (CI 0.92, 1.00; p = 0.06] and increased by 10% for every one unit increase of women’s prepregnancy body mass index (BMI (OR 1.10; 95% CI 0.99, 1.23; p = 0.08. Nonparticipation was associated with opposition from husbands (OR 0.34; 95% CI 0.14, 0.82; p = 0.02 and with women’s fear of possible adverse effects of fasting on their own or the baby’s health (OR 0.47; 95% CI 0.22, 1.01; p = 0.05 and OR 0.43; 95% CI 0.21, 0.89; p = 0.02, respectively, although they were attenuated in multivariable analysis. Neither age, income, education, employment, parity, experience of morning sickness, nor fasting during pregnancy outside of Ramadan determined fasting during pregnancy. Linear regression analysis within women who fasted showed that the number of days fasted were inversely associated with women’s gestational age, fear of possible adverse effects of fasting on their own or the fetal health, and with opposition from husbands. In conclusion, earlier gestational age during Ramadan, husband’s opinion and possibly higher prepregnancy BMI, influence women’s adherence to Ramadan fasting during pregnancy. Fear of adverse health effects of Ramadan fasting is common in both fasting and non-fasting pregnant women.

  14. Predictors of resource utilization in transsphenoidal surgery for Cushing disease.

    Science.gov (United States)

    Little, Andrew S; Chapple, Kristina

    2013-08-01

    The short-term cost associated with subspecialized surgical care is an increasingly important metric and economic concern. This study sought to determine factors associated with hospital charges in patients undergoing transsphenoidal surgery for Cushing disease in an effort to identify the drivers of resource utilization. The authors analyzed the Nationwide Inpatient Sample (NIS) hospital discharge database from 2007 to 2009 to determine factors that influenced hospital charges in patients who had undergone transsphenoidal surgery for Cushing disease. The NIS discharge database approximates a 20% sample of all inpatient admissions to nonfederal US hospitals. A multistep regression model was developed that adjusted for patient demographics, acuity measures, comorbidities, hospital characteristics, and complications. In 116 hospitals, 454 transsphenoidal operations were performed. The mean hospital charge was $48,272 ± $32,060. A multivariate regression model suggested that the primary driver of resource utilization was length of stay (LOS), followed by surgeon volume, hospital characteristics, and postoperative complications. A 1% increase in LOS increased hospital charges by 0.60%. Patient charges were 13% lower when performed by high-volume surgeons compared with low-volume surgeons and 22% lower in large hospitals compared with small hospitals. Hospital charges were 12% lower in cases with no postoperative neurological complications. The proposed model accounted for 46% of hospital charge variance. This analysis of hospital charges in transsphenoidal surgery for Cushing disease suggested that LOS, hospital characteristics, surgeon volume, and postoperative complications are important predictors of resource utilization. These findings may suggest opportunities for improvement.

  15. Technological Capability's Predictor Variables

    Directory of Open Access Journals (Sweden)

    Fernanda Maciel Reichert

    2011-03-01

    Full Text Available The aim of this study was to identify the factors that influence in configuration of the technological capability of companies in sectors with medium-low technological intensity. To achieve the goal proposed in this article a survey was carried out. Based on the framework developed by Lall (1992 which classifies firms in basic, intermediate and advanced level of technological capability; it was found that the predominant technological capability is intermediate, with 83.7% of respondent companies (plastics companies in Brazil. It is believed that the main contribution of this study is the finding that the dependent variable named “Technological Capability” can be explained at a rate of 65% by six variables: development of new processes; selection of the best equipment supplier; sales of internally developed new technology to third parties; design and manufacture of equipment; study of the work methods and perform inventory control; and improvement of product quality.

  16. Benchmark data for identifying N6-methyladenosine sites in the Saccharomyces cerevisiae genome

    Directory of Open Access Journals (Sweden)

    Wei Chen

    2015-12-01

    Full Text Available This data article contains the benchmark dataset for training and testing iRNA-Methyl, a web-server predictor for identifying N6-methyladenosine sites in RNA (Chen et al., 2015 [15]. It can also be used to develop other predictors for identifying N6-methyladenosine sites in the Saccharomyces cerevisiae genome.

  17. Changes in Situational and Dispositional Factors as Predictors of Job Satisfaction

    Science.gov (United States)

    Keller, Anita C.; Semmer, Norbert K.

    2013-01-01

    Arguably, job satisfaction is one of the most important variables with regard to work. When explaining job satisfaction, research usually focuses on predictor variables in terms of levels but neglects growth rates. Therefore it remains unclear how potential predictors evolve over time and how their development affects job satisfaction. Using…

  18. Bayesian modeling of measurement error in predictor variables using item response theory

    NARCIS (Netherlands)

    Fox, Gerardus J.A.; Glas, Cornelis A.W.

    2000-01-01

    This paper focuses on handling measurement error in predictor variables using item response theory (IRT). Measurement error is of great important in assessment of theoretical constructs, such as intelligence or the school climate. Measurement error is modeled by treating the predictors as unobserved

  19. Predictors of Readmission after Inpatient Plastic Surgery

    Directory of Open Access Journals (Sweden)

    Umang Jain

    2014-03-01

    Full Text Available Background Understanding risk factors that increase readmission rates may help enhance patient education and set system-wide expectations. We aimed to provide benchmark data on causes and predictors of readmission following inpatient plastic surgery. Methods The 2011 National Surgical Quality Improvement Program dataset was reviewed for patients with both "Plastics" as their recorded surgical specialty and inpatient status. Readmission was tracked through the "Unplanned Readmission" variable. Patient characteristics and outcomes were compared using chi-squared analysis and Student's t-tests for categorical and continuous variables, respectively. Multivariate regression analysis was used for identifying predictors of readmission. Results A total of 3,671 inpatient plastic surgery patients were included. The unplanned readmission rate was 7.11%. Multivariate regression analysis revealed a history of chronic obstructive pulmonary disease (COPD (odds ratio [OR], 2.01; confidence interval [CI], 1.12-3.60; P=0.020, previous percutaneous coronary intervention (PCI (OR, 2.69; CI, 1.21-5.97; P=0.015, hypertension requiring medication (OR, 1.65; CI, 1.22-2.24; P<0.001, bleeding disorders (OR, 1.70; CI, 1.01-2.87; P=0.046, American Society of Anesthesiologists (ASA class 3 or 4 (OR, 1.57; CI, 1.15-2.15; P=0.004, and obesity (body mass index ≥30 (OR, 1.43; CI, 1.09-1.88, P=0.011 to be significant predictors of readmission. Conclusions Inpatient plastic surgery has an associated 7.11% unplanned readmission rate. History of COPD, previous PCI, hypertension, ASA class 3 or 4, bleeding disorders, and obesity all proved to be significant risk factors for readmission. These findings will help to benchmark inpatient readmission rates and manage patient and hospital system expectations.

  20. Predictors of subjective health status 10 years post-PCI

    NARCIS (Netherlands)

    van den Berge, Jan C.; Dulfer, Karolijn; Utens, Elisabeth M. W. J.; Hartman, Eline M. J.; Daemen, Joost; van Geuns, Robert J.; van Domburg, Ron T.

    2016-01-01

    Subjective health status is an increasingly important parameter to assess the effect of percutaneous coronary intervention (PCI) in clinical practice. Aim of this study was to determine medical and psychosocial predictors of poor subjective health status over a 10 years' post-PCI period. We included

  1. Predictors of health-related quality of life in type II diabetic patients in Greece

    Directory of Open Access Journals (Sweden)

    Frydas Aristidis

    2007-07-01

    Full Text Available Abstract Background Diabetes Mellitus (DM is a major cause of morbidity and mortality affecting millions of people worldwide, while placing a noteworthy strain on public health funding. The aim of this study was to assess health-related quality of life (HRQOL of Greek Type II DM patients and to identify significant predictors of the disease in this patient population. Methods The sample (N = 229, 52.8% female, 70.0 years mean age lived in a rural community of Lesvos, an island in the northeast of the Aegean Archipelagos. The generic SF-36 instrument, administered by trainee physicians, was used to measure HRQOL. Scale scores were compared with non-parametric Mann-Whitney and Kruskal-Wallis tests and multivariate stepwise linear regression analyses were used to investigate the effect of sociodemographic and diabetes-related variables on HRQOL. Results The most important predictors of impaired HRQOL were female gender, diabetic complications, non-diabetic comorbidity and years with diabetes. Older age, lower education, being unmarried, obesity, hypertension and hyperlipidaemia were also associated with impaired HRQOL in at least one SF-36 subscale. Multivariate regression analyses produced models explaining significant portions of the variance in SF-36 subscales, especially physical functioning (R2 = 42%, and also showed that diabetes-related indicators were more important disease predictors, compared to sociodemographic variables. Conclusion The findings could have implications for health promotion in rural medical practice in Greece. In order to preserve a good HRQOL, it is obviously important to prevent diabetes complications and properly manage concomitant chronic diseases. Furthermore, the gender difference is interesting and requires further elucidation. Modifying screening methods and medical interventions or formulating educational programs for the local population appear to be steps in the correct direction.

  2. Characteristic Equation of the Modified Smith predictor to MIMO Systems

    Directory of Open Access Journals (Sweden)

    Jorge A. Herrera-Cuartas

    2013-11-01

    Full Text Available The delay in control systems is a feature frequently in real systems due to the transport of objects or information, a series connection of multiple systems or own processing and sensors delay, among others. Recently there have been several studies to identify the external delay MIMO systems, these works are focused on identification and on-line control of MIMO systems and use a multimodel structure based on modified Smith predictor using different search method. It is clear that for the implementation of the algorithm, and to obtain the convergence and stability analysis, it is necessary to have closed-loop equations of modified Smith predictor. However, in these works is not presented the analytical procedure, not be the main object, displaying only the closed loop equations without the procedure for obtaining it. Therefore, to respond, in this paper, we present an analytical way to derive the closed-loop equations of a modified Smith predictor.  

  3. Psychological predictors of weight loss after bariatric surgery

    DEFF Research Database (Denmark)

    Wimmelmann, Cathrine Lawaetz; Dela, Flemming; Mortensen, Erik Lykke

    2014-01-01

    factors are thought to play animportant role for maintaining the surgical weight loss. However, results from priorresearch examining preoperative psychological predictors of weight loss outcomeare inconsistent. The aim of this article was to review more recent literature onpsychological predictors...... studies published after 2003 were included.Results: 19 eligible studies were identified. Psychological predictors of surgicalweight loss investigated in the reviewed studies include cognitive function, per-sonality, psychiatric disorder, and eating behaviour.......Background: Morbid obesity is the fastest growing BMI group in the U.S. and the prevalence of morbid obesity worldwide has never been higher. Bariatric surgery is the most effective treatment for severe forms of obesity especially with regardto a sustained long-term weight loss. Psychological...

  4. Breastfeeding status as a predictor of mortality among refugee children in an emergency situation in Guinea-Bissau

    DEFF Research Database (Denmark)

    Jakobsen, Marianne; Sodemann, Morten; Nylén, Gunnar

    2003-01-01

    To identify the population risk factors in emergency situations, we studied breastfeeding status as a predictor for child mortality during a war in Guinea-Bissau.......To identify the population risk factors in emergency situations, we studied breastfeeding status as a predictor for child mortality during a war in Guinea-Bissau....

  5. Epigenetic predictor of age.

    Directory of Open Access Journals (Sweden)

    Sven Bocklandt

    Full Text Available From the moment of conception, we begin to age. A decay of cellular structures, gene regulation, and DNA sequence ages cells and organisms. DNA methylation patterns change with increasing age and contribute to age related disease. Here we identify 88 sites in or near 80 genes for which the degree of cytosine methylation is significantly correlated with age in saliva of 34 male identical twin pairs between 21 and 55 years of age. Furthermore, we validated sites in the promoters of three genes and replicated our results in a general population sample of 31 males and 29 females between 18 and 70 years of age. The methylation of three sites--in the promoters of the EDARADD, TOM1L1, and NPTX2 genes--is linear with age over a range of five decades. Using just two cytosines from these loci, we built a regression model that explained 73% of the variance in age, and is able to predict the age of an individual with an average accuracy of 5.2 years. In forensic science, such a model could estimate the age of a person, based on a biological sample alone. Furthermore, a measurement of relevant sites in the genome could be a tool in routine medical screening to predict the risk of age-related diseases and to tailor interventions based on the epigenetic bio-age instead of the chronological age.

  6. Predictors of undiagnosed prevalent type 2 diabetes

    DEFF Research Database (Denmark)

    Heltberg, Andreas Søndergaard; Andersen, John Sahl; Sandholdt, Håkon

    2018-01-01

    AIMS: To investigate how self-reported risk factors (including socioeconomic status) predict undiagnosed, prevalent type 2 diabetes mellitus (T2DM). To externally validate Leicester Risk Assessment Score (LRAS), Finnish Diabetes Risk Score (FINDRISC) and Danish Diabetes Risk Score (DDRS......), and to investigate how these predict a European Heart SCORE≥5% in a Danish population study. METHODS: We included 21,205 adults from the Danish General Suburban Population Study. We used relative importance calculations of self-reported variables in prediction of undiagnosed T2DM. We externally validated established...... prediction models reporting ROC-curves for undiagnosed T2DM, pre-diabetes and SCORE. RESULTS: More than 20% of people with T2DM were undiagnosed. The 7 most important self-rated predictors in sequential order were high BMI, antihypertensive-therapy, age, cardiovascular disease, waist-circumference, fitness...

  7. Predictors of long-term benzodiazepine abstinence in participants of a randomized controlled benzodiazepine withdrawal program.

    NARCIS (Netherlands)

    Oude Voshaar, R.C.; Gorgels, W.J.M.J.; Mol, A.J.J.; Balkom, A.J.L.M. van; Mulder, J.; Lisdonk, E.H. van de; Breteler, M.H.M.; Zitman, F.G.

    2006-01-01

    OBJECTIVE: To identify predictors of resumed benzodiazepine use after participation in a benzodiazepine discontinuation trial. METHOD: We performed multiple Cox regression analyses to predict the long-term outcome of a 3-condition, randomized, controlled benzodiazepine discontinuation trial in

  8. Predictors of long-term benzodiazepine abstinence in participants of a randomized controlled benzodiazepine withdrawal program

    NARCIS (Netherlands)

    Oude Voshaar, R.C.; Gorgels, W.J.M.J.; Mol, A.J.J.; Balkom, A.J.L.M. van; Mulder, J.; Lisdonk, E.H. van de; Breteler, M.H.M.; Zitman, F.G.

    2006-01-01

    Objective: To identify predictors of resumed benzodiazepine use after participation in a benzodiazepine discontinuation trial. Method: We performed multiple Cox regression analyses to predict the long-term outcome of a 3-condition, randomized, controlled benzodiazepine discontinuation trial in

  9. Predictors of adherence to exercise interventions during and after cancer treatment : A systematic review

    NARCIS (Netherlands)

    Ormel, H L; van der Schoot, G G F; Sluiter, W J; Jalving, M; Gietema, J A; Walenkamp, A M E

    Objective: Exercise interventions benefit cancer patients. However, only low numbers of patients adhere to these interventions. This review aimed to identify predictors of exercise intervention adherence in patients with cancer, during and after multimodality cancer treatment. Methods: A literature

  10. Educational level and decreases in leisure time physical activity: predictors from the longitudinal GLOBE study

    NARCIS (Netherlands)

    M. Droomers (Mariël); C.Th.M. Schrijvers (Carola); J.P. Mackenbach (Johan)

    2001-01-01

    textabstractSTUDY OBJECTIVE: This study describes educational differences in decreases in leisure time physical activity among an adult, physically active population and additionally attempts to identify predictors of these differences from information on health status

  11. Trajectories in the Course of Life Satisfaction After Spinal Cord Injury : Identification and Predictors

    NARCIS (Netherlands)

    van Leeuwen, Christel M.; Post, Marcel W.; Hoekstra, Trynke; van der Woude, Lucas H.; de Groot, Sonja; Snoek, Govert J.; Mulder, Dineke G.; Lindeman, Eline

    Objective: To identify different life satisfaction trajectories in the period between the start of active spinal cord injury (SCI) rehabilitation and 5 years after discharge, and to find predictors for distinguishing between trajectories. The hypotheses were that different life satisfaction

  12. RS-Predictor models augmented with SMARTCyp reactivities

    DEFF Research Database (Denmark)

    Zaretzki, Jed; Rydberg, Patrik; Bergeron, Charles

    2012-01-01

    (82.3%) and merged(86.0%). Comprehensive datamining of each substrate set and careful statistical analyses of the predictions made by the different models revealed new insights into molecular features that control metabolic regioselectivity and enable accurate prospective prediction of likely SOMs.......RS-Predictor is a tool for creating pathway-independent, isozyme-specific site of metabolism (SOM) prediction models using any set of known cytochrome P450 substrates and metabolites. Until now, the RS-Predictor method was only trained and validated on CYP 3A4 data, but in the present study we...... report on the versatility the RS-Predictor modeling paradigm by creating and testing regioselectivity models for substrates of the nine most important CYP isozymes. Through curation of source literature, we have assembled 680 substrates distributed among CYPs 1A2, 2A6, 2B6, 2C19, 2C8, 2C9, 2D6, 2E1 and 3...

  13. Predictors of Home Care Expenditures and Death at Home for Cancer Patients in an Integrated Comprehensive Palliative Home Care Pilot Program

    Science.gov (United States)

    Howell, Doris M.; Abernathy, Tom; Cockerill, Rhonda; Brazil, Kevin; Wagner, Frank; Librach, Larry

    2011-01-01

    Purpose: Empirical understanding of predictors for home care service use and death at home is important for healthcare planning. Few studies have examined these predictors in the context of the publicly funded Canadian home care system. This study examined predictors for home care use and home death in the context of a “gold standard” comprehensive palliative home care program pilot in Ontario where patients had equal access to home care services. Methods: Secondary clinical and administrative data sources were linked using a unique identifier to examine multivariate factors (predisposing, enabling, need) on total home care expenditures and home death for a cohort of cancer patients enrolled in the HPCNet pilot. Results: Subjects with gastrointestinal symptoms (OR: 1.64; p=0.03) and those with higher income had increased odds of dying at home (OR: 1.14; phome care expenditures. Conclusions: Predictors of home death found in earlier studies appeared less important in this comprehensive palliative home care pilot. An income effect for home death observed in this study requires examination in future controlled studies. Relevance: Access to palliative home care that is adequately resourced and organized to address the multiple domains of issues that patients/families experience at the end of life has the potential to enable home death and shift care appropriately from limited acute care resources. PMID:22294993

  14. Comparing Self-Regulatory and Early Academic Skills as Predictors of Later Math, Reading, and Science Elementary School Achievement

    Science.gov (United States)

    Murrah, William M., III

    The achievement score gaps between advantaged and disadvantaged children at school entry is a major problem in education today. Identifying the skills critical for school readiness is an important step in developing interventions aimed at addressing these score gaps. The purpose of this study is to compare a number of school readiness skills with an eye toward finding out which are the best predictors of later academic achievement in math, reading, and science. The predictors were early reading, math, general knowledge, socioemotional skills, and motor skills. Data were obtained from the Early Childhood Longitudinal Study of 1998 (NCES, 1998) database. While controlling for an extensive set of family characteristics, predictions were made across five years - from the end of kindergarten to the end of fifth grade. Consistent with current findings, reading and math skills predicted later achievement. Interestingly, general knowledge, attention, and fine motor skills also proved to be important predictors of later academic achievement, but socioemotional skills were not. The findings were interpreted from a neurobiological perspective involving the development of self-regulation. These school entry skills are used to predict later achievement in reading, math, and science. I argued that in addition to acquiring early academic knowledge, children need to regulate the use of this knowledge to meet academic goals.

  15. Cognitive predictors of children's development in mathematics achievement: A latent growth modeling approach.

    Science.gov (United States)

    Xenidou-Dervou, Iro; Van Luit, Johannes E H; Kroesbergen, Evelyn H; Friso-van den Bos, Ilona; Jonkman, Lisa M; van der Schoot, Menno; van Lieshout, Ernest C D M

    2018-04-24

    Research has identified various domain-general and domain-specific cognitive abilities as predictors of children's individual differences in mathematics achievement. However, research into the predictors of children's individual growth rates, namely between-person differences in within-person change in mathematics achievement is scarce. We assessed 334 children's domain-general and mathematics-specific early cognitive abilities and their general mathematics achievement longitudinally across four time-points within the first and second grades of primary school. As expected, a constellation of multiple cognitive abilities contributed to the children's starting level of mathematical success. Specifically, latent growth modeling revealed that WM abilities, IQ, counting skills, nonsymbolic and symbolic approximate arithmetic and comparison skills explained individual differences in the children's initial status on a curriculum-based general mathematics achievement test. Surprisingly, however, only one out of all the assessed cognitive abilities was a unique predictor of the children's individual growth rates in mathematics achievement: their performance in the symbolic approximate addition task. In this task, children were asked to estimate the sum of two large numbers and decide if this estimated sum was smaller or larger compared to a third number. Our findings demonstrate the importance of multiple domain-general and mathematics-specific cognitive skills for identifying children at risk of struggling with mathematics and highlight the significance of early approximate arithmetic skills for the development of one's mathematical success. We argue the need for more research focus on explaining children's individual growth rates in mathematics achievement. © 2018 John Wiley & Sons Ltd.

  16. Prevalence and Predictors of Functional Vitamin K Insufficiency in Mothers and Newborns in Uganda

    Directory of Open Access Journals (Sweden)

    Data Santorino

    2015-10-01

    Full Text Available Vitamin K deficiency bleeding (VKDB in infancy is a serious but preventable cause of mortality or permanent disability. Lack of epidemiologic data for VKDB in sub-Saharan Africa hinders development and implementation of effective prevention strategies. We used convenience sampling to consecutively enroll mothers delivering in a southwestern Uganda Hospital. We collected socio-demographic and dietary information, and paired samples of maternal venous and neonatal cord blood for the immunoassay of undercarboxylated prothrombin (PIVKA-II, a sensitive marker of functional vitamin K (VK insufficiency. We used univariable and multivariable logistic regression models to identify predictors of VK insufficiency. We detected PIVKA-II of ≥0.2 AU (Arbitrary Units per mL/mL (indicative of VK insufficiency in 33.3% (47/141 of mothers and 66% (93/141 of newborns. Importantly, 22% of babies had PIVKA-II concentrations ≥5.0 AU/mL, likely to be associated with abnormal coagulation indices. We found no significant predictors of newborn VK insufficiency, including infant weight (AOR (adjusted odds ratio 1.85, 95% CI (confidence interval 0.15–22.49, gender (AOR 0.54, 95% CI 0.26–1.11, term birth (AOR 0.72, 95% CI 0.20–2.62, maternal VK-rich diet (AOR 1.13, 95% CI 0.55–2.35 or maternal VK insufficiency (AOR 0.99, 95% CI 0.47–2.10. VK insufficiency is common among mothers and newborn babies in southwestern Uganda, which in one fifth of babies nears overt deficiency. Lack of identifiable predictors of newborn VK insufficiency support strategies for universal VK prophylaxis to newborns to prevent VKDB.

  17. Predictors of needle exchange program utilization during its implementation and expansion in Tijuana, Mexico.

    Science.gov (United States)

    Smith, Danielle M; Werb, Dan; Abramovitz, Daniela; Magis-Rodriguez, Carlos; Vera, Alicia; Patterson, Thomas L; Strathdee, Steffanie A

    2016-03-01

    Until the early 2000s, there was only one needle exchange program (NEP) offered in Mexico. In 2004, the second Mexican NEP opened in Tijuana, but its utilization has not been studied. We studied predictors of initiating NEP during its early expansion in Tijuana, Mexico. From April 2006 to April 2007, people who inject drugs (PWID) residing in Tijuana who had injected within the last month were recruited using respondent-driven sampling. Weighted Poisson regression incorporating generalized estimating equations was used to identify predictors of initiating NEP, while accounting for correlation between recruiter and recruits. NEP uptake increased from 20% at baseline to 59% after 6 months. Among a subsample of PWID not accessing NEP at baseline (n = 480), 83% were male and median age was 37 years (Interquartile Range: 32-43). At baseline, 4.4% were HIV-infected and 5.9% had syphilis titers >1:8. In multivariate models, factors associated with NEP initiation (p 2500 pesos/month (ARR: .66); and reporting needle sharing (ARR: .71). Uptake of NEP expansion in Tijuana was vigorous among PWID. We identified a range of factors that influenced the likelihood of NEP initiation, including police interaction. These findings have important implications for the scale-up of NEP in Mexico. © American Academy of Addiction Psychiatry.

  18. Reporting of adverse drug reactions: predictors of under-reporting in Malaysia.

    Science.gov (United States)

    Aziz, Zoriah; Siang, Tan Ching; Badarudin, Nurul Suhaida

    2007-02-01

    Malaysia like many other countries worldwide uses spontaneous reporting systems as a mean of collecting data on suspected adverse drug reaction (ADR). However, compared to other countries, which use the system, the reporting rate in Malaysia is very low. Why some physicians do not report ADRs is not well understood. To identify factors, which would predict physicians' failure to send ADR reports. Face-to-face interview using a structured questionnaire involving physicians working at the University of Malaya Medical Centre, Malaysia. About a third of the physicians in the Centre participated. Sixty-five of the 415 approached refused to participate. A high proportion of the respondents (81.4%) indicated that they had suspected an ADR but did not report it, while about 40% of the respondents were not aware of the existence of the national reporting system in Malaysia. Logistic regression modelling identified the variable 'ADR considered to be too trivial or too well known to report' as the strongest predictor of not reporting, followed by physicians' category and uncertainty that the reaction had been definitely caused by a drug. Important predictor variables, which limit physicians from reporting ADR in Malaysia, were related to uncertainty of types of reaction to report, lack of awareness about the existence, function and purpose of national ADR reporting. The findings could be useful for planning strategies to improve the reporting rate.

  19. [Hepatobiliary System Diseases as the Predictors of Psoriasis Progression].

    Science.gov (United States)

    Smirnova, S V; Barilo, A A; Smolnikova, M V

    2016-01-01

    To assess the state of the hepatobiliary system in psoriasis andpsoriatic arthritis in order to establish a causal relationship and to identify clinical and functional predictors of psoriatic disease progression. The study includedpatients with extensive psoriasis vulgaris (n = 175) aged 18 to 66 years old and healthy donors (n = 30), matched by sex and age: Group 1--patients with psoriasis (PS, n = 77), group 2--patients with psoriatic arthritis (PsA, n = 98), group 3--control. The evaluation of functional state of the hepatobiliary system was performed by the analysis of the clinical and anamnestic data and by the laboratory-instrumental methods. We identified predictors of psoriasis: triggers (stress and nutritionalfactor), increased total bilirubin, aspartate aminotransferase, alkaline phosphatase, gamma-glutamyl transferase, eosinophilia, giardiasis, carriers of hepatitis C virus, ductal changes andfocal leisons in the liver, thickening of the walls of the gallbladder detected by ultrasound. Predictors ofpsoriatic arthritis: age over 50 years, dyspeptic complaints, the presence of hepatobiliary system diseases, the positive right hypochondrium syndrome, the clinical symptoms of chronic cholecystitis, excess body weight, high levels of bilirubin, cholesterol and low density lipoprotein, hepatomegaly, non-alcoholic fatty liver disease. High activity of hepatocytes cytolysis, cholestasis, inflammation, metabolic disorders let us considerpsoriatic arthritis as a severe clinical stage psoriatic disease when the hepatobiliary system, in turn, is one of the main target organs in systemic psoriatic process. Non-alcoholic fatty liver disease and chronic cholecystitis are predictors of psoriatic disease progression.

  20. Optimal Trading with Alpha Predictors

    OpenAIRE

    Filippo Passerini; Samuel E. Vazquez

    2015-01-01

    We study the problem of optimal trading using general alpha predictors with linear costs and temporary impact. We do this within the framework of stochastic optimization with finite horizon using both limit and market orders. Consistently with other studies, we find that the presence of linear costs induces a no-trading zone when using market orders, and a corresponding market-making zone when using limit orders. We show that, when combining both market and limit orders, the problem is furthe...

  1. Gratifications, collective self-esteem, online emotional openness, and traitlike communication apprehension as predictors of Facebook uses.

    Science.gov (United States)

    Zhang, Yin; Tang, Leo Shing-Tung; Leung, Louis

    2011-12-01

    This study explores whether and how gratifications and psychological traits impact people's Facebook use. First, a factor analysis of an online survey (N= 437) outlined a unique set of gratifications obtained from the use of Facebook. Six aspects of gratifications (i.e., social surveillance, entertainment, recognition, emotional support, network extension, and maintenance) were identified. Results from regression analyses showed that psychological traits (i.e., collective self-esteem, online emotional openness, and traitlike communication apprehension) were strong predictors of most Facebook gratifications. Additionally, gratifications and, to a lesser extent, psychological traits significantly predicted Facebook usage, both in perceived importance and different indicators in the level of Facebook use.

  2. Predictors of abdominal injuries in blunt trauma.

    Science.gov (United States)

    Farrath, Samiris; Parreira, José Gustavo; Perlingeiro, Jacqueline A G; Solda, Silvia C; Assef, José Cesar

    2012-01-01

    To identify predictors of abdominal injuries in victims of blunt trauma. retrospective analysis of trauma protocols (collected prospectively) of adult victims of blunt trauma in a period of 15 months. Variables were compared between patients with abdominal injuries (AIS>0) detected by computed tomography or/and laparotomy (group I) and others (AIS=0, group II). Student's t, Fisher and qui-square tests were used for statistical analysis, considering p3) in head (18.5% vs. 7.9%), thorax (29.2% vs. 2.4%) and extremities (40.0% vs. 13.7%). The highest odds ratios for the diagnosis of abdominal injuries were associated flail chest (21.8) and pelvic fractures (21.0). Abdominal injuries were more frequently observed in patients with hemodynamic instability, changes in Glasgow coma scale and severe lesions to the head, chest and extremities.

  3. Psychological predictors of problem mobile phone use.

    Science.gov (United States)

    Bianchi, Adriana; Phillips, James G

    2005-02-01

    Mobile phone use is banned or illegal under certain circumstances and in some jurisdictions. Nevertheless, some people still use their mobile phones despite recognized safety concerns, legislation, and informal bans. Drawing potential predictors from the addiction literature, this study sought to predict usage and, specifically, problematic mobile phone use from extraversion, self-esteem, neuroticism, gender, and age. To measure problem use, the Mobile Phone Problem Use Scale was devised and validated as a reliable self-report instrument, against the Addiction Potential Scale and overall mobile phone usage levels. Problem use was a function of age, extraversion, and low self-esteem, but not neuroticism. As extraverts are more likely to take risks, and young drivers feature prominently in automobile accidents, this study supports community concerns about mobile phone use, and identifies groups that should be targeted in any intervention campaigns.

  4. Differences in Psychosocial Predictors of Obesity Among LGBT Subgroups.

    Science.gov (United States)

    Warren, Jacob C; Smalley, K Bryant; Barefoot, K Nikki

    2016-08-01

    The purpose of the current study was to examine the overall presence of and differences in rates of overweight/obesity among a large, nationally diverse sample of lesbian, gay, bisexual, transgender (LGBT)-identified individuals (i.e., cisgender lesbians, cisgender gay men, cisgender bisexual women, cisgender bisexual men, transgender women, and transgender men) and to identify specific psychosocial predictors of obesity within each of the six LGBT subgroups. A total of 2702 LGBT-identified participants participated in the online study. Participants completed a series of demographic questions (including weight and height) and the Depression Anxiety Stress Scale 21. The percentage of participants who were overweight/obese did not differ significantly across LGBT subgroups, with 61.1% of the total sample being overweight/obese. However, the percentage of participants who self-reported body mass indexes in the obese range differed significantly across the six LGBT subgroups, with the highest prevalence in transgender men (46.0%). In addition, the predictors of obesity varied by subgroup, with age a significant predictor for cisgender lesbians, cisgender gay men, and cisgender bisexual women, relationship status for cisgender bisexual women, employment status for both cisgender gay men and cisgender bisexual women, education level for cisgender lesbians, and depression, anxiety, and stress for cisgender gay men. None of the examined psychosocial factors emerged as predictors of obesity for cisgender bisexual men, transgender women, or transgender men. These findings suggest that there are substantial variations in the presence and predictors of obesity across LGBT subgroups that support the need for culturally tailored healthy weight promotion efforts within the LGBT community.

  5. Predictors of suicidal ideation in older people: a decision tree analysis.

    Science.gov (United States)

    Handley, Tonelle E; Hiles, Sarah A; Inder, Kerry J; Kay-Lambkin, Frances J; Kelly, Brian J; Lewin, Terry J; McEvoy, Mark; Peel, Roseanne; Attia, John R

    2014-11-01

    Suicide among older adults is a major public health issue worldwide. Although studies have identified psychological, physical, and social contributors to suicidal thoughts in older adults, few have explored the specific interactions between these factors. This article used a novel statistical approach to explore predictors of suicidal ideation in a community-based sample of older adults. Prospective cohort study. Participants aged 55-85 years were randomly selected from the Hunter Region, a large regional center in New South Wales, Australia. Baseline psychological, physical, and social factors, including psychological distress, physical functioning, and social support, were used to predict suicidal ideation at the 5-year follow-up. Classification and regression tree modeling was used to determine specific risk profiles for participants depending on their individual well-being in each of these key areas. Psychological distress was the strongest predictor, with 25% of people with high distress reporting suicidal ideation. Within high psychological distress, lower physical functioning significantly increased the likelihood of suicidal ideation, with high distress and low functioning being associated with ideation in 50% of cases. A substantial subgroup reported suicidal ideation in the absence of psychological distress; dissatisfaction with social support was the most important predictor among this group. The performance of the model was high (area under the curve: 0.81). Decision tree modeling enabled individualized "risk" profiles for suicidal ideation to be determined. Although psychological factors are important for predicting suicidal ideation, both physical and social factors significantly improved the predictive ability of the model. Assessing these factors may enhance identification of older people at risk of suicidal ideation. Copyright © 2014. Published by Elsevier Inc.

  6. Predictors of Language Gains Among School-Age Children With Language Impairment in the Public Schools.

    Science.gov (United States)

    Justice, Laura M; Jiang, Hui; Logan, Jessica A; Schmitt, Mary Beth

    2017-06-10

    This study aimed to identify child-level characteristics that predict gains in language skills for children with language impairment who were receiving therapy within the public schools. The therapy provided represented business-as-usual speech/language treatment provided by speech-language pathologists in the public schools. The sample included 272 kindergartners and first-graders with language impairment who participated in a larger study titled "Speech-Therapy Experiences in the Public Schools." Multilevel regression analyses were applied to examine the extent to which select child-level characteristics, including age, nonverbal cognition, memory, phonological awareness, vocabulary, behavior problems, and self-regulation, predicted children's language gains over an academic year. Pratt indices were computed to establish the relative importance of the predictors of interest. Phonological awareness and vocabulary skill related to greater gains in language skills, and together they accounted for nearly 70% of the explained variance, or 10% of total variance at child level. Externalizing behavior, nonverbal cognition, and age were also potentially important predictors of language gains. This study significantly advances our understanding of the characteristics of children that may contribute to their language gains while receiving therapy in the public schools. Researchers can explore how these characteristics may serve to moderate treatment outcomes, whereas clinicians can assess how these characteristics may factor into understanding treatment responses.

  7. Exploring the key predictors of retention in emergency nurses.

    Science.gov (United States)

    Sawatzky, Jo-Ann V; Enns, Carol L

    2012-07-01

    To explore the factors that predict the retention of nurses working in emergency departments. The escalating shortage of nurses is one of the most critical issues facing specialty areas, such as the emergency department. Therefore, it is important to identify the key influencing and intermediary factors that affect emergency department nurses' intention to leave. As part of a larger study, a cross-sectional survey was completed by 261 registered nurses working in the 12 designated emergency departments within rural, urban community and tertiary hospitals in Manitoba, Canada. Twenty-six per cent of the respondents will probably/definitely leave their current emergency department jobs within the next year. Engagement was the key predictor of intention to leave (P burnout (P nursing management, professional practice, collaboration with physicians, staffing resources and shift work emerged as significant influencing factors for engagement. Engagement plays a central role in emergency department nurses intention to leave. Addressing the factors that influence engagement may reduce emergency department nurses' intention to leave. This study highlights the value of research-based evidence as the foundation for developing innovative strategies for the retention of emergency department nurses. © 2012 Blackwell Publishing Ltd.

  8. Predictors of employer satisfaction: technical and non-technical skills.

    Science.gov (United States)

    Danielson, Jared A; Wu, Tsui-Feng; Fales-Williams, Amanda J; Kirk, Ryan A; Preast, Vanessa A

    2012-01-01

    Employers of 2007-2009 graduates from Iowa State University College of Veterinary Medicine were asked to respond to a survey regarding their overall satisfaction with their new employees as well as their new employees' preparation in several technical and non-technical skill areas. Seventy-five responses contained complete data and were used in the analysis. Four technical skill areas (data collection, data interpretation, planning, and taking action) and five non-technical skill areas (interpersonal skills, ability to deal with legal issues, business skills, making referrals, and problem solving) were identified. All of the skill area subscales listed above had appropriate reliability (Cronbach's alpha>0.70) and were positively and significantly correlated with overall employer satisfaction. Results of two simultaneous regression analyses indicated that of the four technical skill areas, taking action is the most salient predictor of employer satisfaction. Of the five non-technical skill areas, interpersonal skills, business skills, making referrals, and problem solving were the most important skills in predicting employer satisfaction. Hierarchical regression analysis revealed that all technical skills explained 25% of the variation in employer satisfaction; non-technical skills explained an additional 42% of the variation in employer satisfaction.

  9. Fitness and adiposity as predictors of functional limitation in adults.

    Science.gov (United States)

    Maslow, Andréa L; Price, Anna E; Sui, Xuemei; Lee, Duck-chul; Vuori, Ikka; Blair, Steven N

    2011-01-01

    This study examined the associations of body mass index (BMI), waist circumference (WC), and cardiorespiratory fitness (CRF) with incident functional limitation (IFL) in adults. Patients (n = 2400), 30+ years [mean age, 45.2 (SD, 8.3); 12% women], completed a baseline health examination during 1979 to 1995. CRF was quantified by age-and sex-specific thirds for maximal treadmill exercise test duration. Adiposity was assessed by BMI and WC (grouped for analysis according to clinical guidelines). Incident IFL was identified from mail-back surveys during 1995, 1999, and 2004. After adjusting for potential confounders and either BMI or WC, CRF was inversely related to IFL (P trend < .001). The association between BMI and IFL was significant after adjusting for all confounders (P trend = .002), but not after additional adjustment for CRF (P trend = .23). After controlling for all confounders and CRF, high WC was associated with greater odds of IFL in those aged 30 to 49; normal WC was associated with greater odds of IFL in those aged 50+. CRF was a significant predictor of IFL in middle aged and older adults, independent of overall or abdominal adiposity. Clinicians should consider the importance of preserving functional capacity by recommending regular physical activity for normal-weight and overweight individuals. ©2011 Human Kinetics, Inc.

  10. Predictors of Psychological Distress Trajectories in the First Year After a Breast Cancer Diagnosis

    Directory of Open Access Journals (Sweden)

    Jin-Hee Park, RN, Ph.D.

    2017-12-01

    Full Text Available Purpose: Psychological distress is a significant and ongoing problem for breast cancer. These mental health problems are often neglected as they are not always properly understood. This study was performed to explore the trajectory of psychological distress over 1 year since breast cancer surgery and to identify the associated factors for the trajectory. Methods: One hundred seventeen women who underwent surgery for breast cancer completed the psychological distress thermometer and problem lists from after surgery to 12 months after surgery. Information on their sociodemographic and clinical characteristics was also obtained. Group-based trajectory modeling was performed to identify the distinct trajectories of psychological distress. Chi-square test and logistic regression analysis were performed to determine predictors of psychological distress trajectories. Results: A two-group linear trajectory model was optimal for modeling psychological distress (Bayesian information criterion = −777.41. Group-based trajectory modeling identified consistently high-distress (19.4% and low-decreasing distress (80.6% trajectories. Old age, depression, nervousness, and pain were significant predictors of consistently high-distress trajectory. Conclusion: Our results indicate that distinct trajectory groups can be used as a screening tool to identify patients who may be at an increased risk of psychological distress over time. Screening for psychological distress during disease diagnosis is important and necessary to identify patients who are at an increased risk of elevated distress or at risk of experiencing psychological distress over time. Keywords: anxiety, breast neoplasms, depression, pain, psychological stress

  11. Predictors of discontinuation of antipsychotic medication and subsequent outcomes in the European First Episode Schizophrenia Trial (EUFEST).

    Science.gov (United States)

    Landolt, Karin; Rössler, Wulf; Ajdacic-Gross, Vladeta; Derks, Eske M; Libiger, Jan; Kahn, René S; Fleischhacker, W Wolfgang

    2016-04-01

    This study had two aims: to describe patients suffering from first-episode schizophrenia who had stopped taking any antipsychotic medication, and to gain information on the predictors of successful discontinuation. We investigated data from the European First Episode Schizophrenia Trial (EUFEST). From the 325 patients included, 15.7% discontinued all antipsychotic medication. In a first analysis, clinical and sociodemographical predictors of discontinuing any antipsychotic medication were identified, using Cox regression. In the second analysis, logistic regression was used to determine variables associated with those patients who had stopped taking antipsychotic medication and had a favourable outcome, i.e., successful discontinuation. A good outcome was defined as a) having had no relapse within the whole observation period (80.6%), and b) having had no relapse and symptomatic remission at 12-month-follow-up (37.2%). Cox regression revealed that a higher proportion of patients from Western European countries and Israel stopped antipsychotic medication than from Central and Eastern European countries, that relapse was associated with discontinuation, and that discontinuers had lower compliance and higher quality of life. Predictors of successful discontinuation differed with the outcome definition used. Using definition b), successful discontinuers had a better baseline prognosis and better baseline social integration. Using definition a), successful discontinuers more often were from Western European countries. Region and clinical factors were associated with discontinuation. Prognosis and social integration played an important role in predicting successful discontinuation. As this study had several limitations, for example the observational design regarding discontinuation, further studies are needed to identify predictors of successful discontinuation. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Clinical and Dosimetric Predictors of Acute Severe Lymphopenia During Radiation Therapy and Concurrent Temozolomide for High-Grade Glioma

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Jiayi, E-mail: jhuang@radonc.wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St Louis, Missouri (United States); DeWees, Todd A.; Badiyan, Shahed N.; Speirs, Christina K.; Mullen, Daniel F.; Fergus, Sandra [Department of Radiation Oncology, Washington University School of Medicine, St Louis, Missouri (United States); Tran, David D.; Linette, Gerry; Campian, Jian L. [Division of Medical Oncology, Department of Medicine, Washington University School of Medicine, St Louis, Missouri (United States); Chicoine, Michael R.; Kim, Albert H.; Dunn, Gavin [Department of Neurosurgery, Washington University School of Medicine, St Louis, Missouri (United States); Simpson, Joseph R.; Robinson, Clifford G. [Department of Radiation Oncology, Washington University School of Medicine, St Louis, Missouri (United States)

    2015-08-01

    Purpose: Acute severe lymphopenia (ASL) frequently develops during radiation therapy (RT) and concurrent temozolomide (TMZ) for high-grade glioma (HGG) and is associated with decreased survival. The current study was designed to identify potential predictors of ASL, with a focus on actionable RT-specific dosimetric parameters. Methods and Materials: From January 2007 to December 2012, 183 patients with HGG were treated with RT+TMZ and had available data including total lymphocyte count (TLC) and radiation dose-volume histogram parameters. ASL was defined as TLC of <500/μL within the first 3 months from the start of RT. Stepwise logistic regression analysis was used to determine the most important predictors of ASL. Results: Fifty-three patients (29%) developed ASL. Patients with ASL had significantly worse overall survival than those without (median: 12.5 vs 20.2 months, respectively, P<.001). Stepwise logistic regression analysis identified female sex (odds ratio [OR]: 5.30; 95% confidence interval [CI]: 2.46-11.41), older age (OR: 1.05; 95% CI: 1.02-1.09), lower baseline TLC (OR: 0.92; 95% CI: 0.87-0.98), and higher brain volume receiving 25 Gy (V{sub 25Gy}) (OR: 1.03; 95% CI: 1.003-1.05) as the most significant predictors for ASL. Brain V{sub 25Gy} <56% appeared to be the optimal threshold (OR: 2.36; 95% CI: 1.11-5.01), with an ASL rate of 38% versus 20% above and below this threshold, respectively (P=.006). Conclusions: Female sex, older age, lower baseline TLC, and higher brain V{sub 25Gy} are significant predictors of ASL during RT+TMZ therapy for HGG. Maintaining the V{sub 25Gy} of brain below 56% may reduce the risk of ASL.

  13. Predictors of fibromyalgia: a population-based twin cohort study.

    Science.gov (United States)

    Markkula, Ritva A; Kalso, Eija A; Kaprio, Jaakko A

    2016-01-15

    Fibromyalgia (FM) is a pain syndrome, the mechanisms and predictors of which are still unclear. We have earlier validated a set of FM-symptom questions for detecting possible FM in an epidemiological survey and thereby identified a cluster with "possible FM". This study explores prospectively predictors for membership of that FM-symptom cluster. A population-based sample of 8343 subjects of the older Finnish Twin Cohort replied to health questionnaires in 1975, 1981, and 1990. Their answers to the set of FM-symptom questions in 1990 classified them in three latent classes (LC): LC1 with no or few symptoms, LC2 with some symptoms, and LC3 with many FM symptoms. We analysed putative predictors for these symptom classes using baseline (1975 and 1981) data on regional pain, headache, migraine, sleeping, body mass index (BMI), physical activity, smoking, and zygosity, adjusted for age, gender, and education. Those with a high likelihood of having fibromyalgia at baseline were excluded from the analysis. In the final multivariate regression model, regional pain, sleeping problems, and overweight were all predictors for membership in the class with many FM symptoms. The strongest non-genetic predictor was frequent headache (OR 8.6, CI 95% 3.8-19.2), followed by persistent back pain (OR 4.7, CI 95% 3.3-6.7) and persistent neck pain (OR 3.3, CI 95% 1.8-6.0). Regional pain, frequent headache, and persistent back or neck pain, sleeping problems, and overweight are predictors for having a cluster of symptoms consistent with fibromyalgia.

  14. Information needs and risk perception as predictors of risk information seeking

    NARCIS (Netherlands)

    ter Huurne, E.F.J.; Gutteling, Jan M.

    2008-01-01

    This paper introduces a theoretical framework that describes the importance of public's information sufficiency, risk perception, and self-efficacy as predictors of intended risk information seeking behaviour. Based on theoretical assumptions, measurement instruments for relevant concepts were

  15. Sports concussion: management and predictors of outcome.

    Science.gov (United States)

    Reddy, Cara Camiolo; Collins, Michael W

    2009-01-01

    Interest in sports concussion has grown widely in the last two decades among laypersons and medical professionals. Significant contributions of evidence-based research have led to a better understanding of this multifaceted, but still often elusive, injury. This information has transformed all aspects of concussion management, from on-field evaluation through return-to-play guidelines. The aim of this article is to highlight important research regarding predictors of outcome and treatment protocols. This research has been the basis of the paradigm shift from traditional concussion grading scales to individualized care. Today, concussion management requires a patient-centered approach with individualized assessment, including risk factor analysis, neurocognitive testing, and a thorough symptom evaluation.

  16. Joint Bayesian variable and graph selection for regression models with network-structured predictors

    Science.gov (United States)

    Peterson, C. B.; Stingo, F. C.; Vannucci, M.

    2015-01-01

    In this work, we develop a Bayesian approach to perform selection of predictors that are linked within a network. We achieve this by combining a sparse regression model relating the predictors to a response variable with a graphical model describing conditional dependencies among the predictors. The proposed method is well-suited for genomic applications since it allows the identification of pathways of functionally related genes or proteins which impact an outcome of interest. In contrast to previous approaches for network-guided variable selection, we infer the network among predictors using a Gaussian graphical model and do not assume that network information is available a priori. We demonstrate that our method outperforms existing methods in identifying network-structured predictors in simulation settings, and illustrate our proposed model with an application to inference of proteins relevant to glioblastoma survival. PMID:26514925

  17. Clinical predictors of challenging atrioventricular node ablation procedure for rate control in patients with atrial fibrillation.

    Science.gov (United States)

    Polin, Baptiste; Behar, Nathalie; Galand, Vincent; Auffret, Vincent; Behaghel, Albin; Pavin, Dominique; Daubert, Jean-Claude; Mabo, Philippe; Leclercq, Christophe; Martins, Raphael P

    2017-10-15

    Atrioventricular node (AVN) ablation is usually a simple procedure but may sometimes be challenging. We aimed at identifying pre-procedural clinical predictors of challenging AVN ablation. Patients referred for AVN ablation from 2009 to 2015 were retrospectively included. Baseline clinical data, procedural variables and outcomes of AVN ablation were collected. A "challenging procedure" was defined 1) total radiofrequency delivery to get persistent AVN block≥400s, 2) need for left-sided arterial approach or 3) failure to obtain AVN ablation. 200 patients were included (71±10years). A total of 37 (18.5%) patients had "challenging" procedures (including 9 failures, 4.5%), while 163 (81.5%) had "non-challenging" ablations. In multivariable analysis, male sex (Odds ratio (OR)=4.66, 95% confidence interval (CI): 1.74-12.46), body mass index (BMI, OR=1.08 per 1kg/m 2 , 95%CI 1.01-1.16), operator experience (OR=0.40, 95%CI 0.17-0.94), and moderate-to-severe tricuspid regurgitation (TR, OR=3.65, 95%CI 1.63-8.15) were significant predictors of "challenging" ablations. The proportion as a function of number of predictors was analyzed (from 0 to 4, including male sex, operator inexperience, a BMI>23.5kg/m 2 and moderate-to-severe TR). There was a gradual increase in the risk of "challenging" procedure with the number of predictors by patient (No predictor: 0%; 1 predictor: 6.3%; 2 predictors: 16.5%; 3 predictors: 32.5%; 4 predictors: 77.8%). Operator experience, male sex, higher BMI and the degree of TR were independent predictors of "challenging" AVN ablation procedure. The risk increases with the number of predictors by patient. Copyright © 2017. Published by Elsevier B.V.

  18. Predictors of hand hygiene practice among Saudi nursing students: A cross-sectional self-reported study.

    Science.gov (United States)

    Cruz, Jonas P; Bashtawi, Meshrif A

    2016-01-01

    Hand hygiene is an important component of infection control, which is critical to ensuring patients' safety in hospitals. Nursing students are regarded as healthcare workers in training and can also be vehicles of cross-contamination within the hospital. Thus, this study aimed to identify the predictors of hand hygiene practice among Saudi nursing students. A descriptive, cross-sectional, self-reported study was conducted among 198 Saudi nursing students. Knowledge, attitude, and practice of hand hygiene were assessed using the WHO Hand Hygiene Knowledge Questionnaire for Health-Care Workers and its adopted scales. A regression analysis was performed to identify the predictors of hand hygiene practice. The respondents demonstrated moderate knowledge of hand hygiene (mean 13.20±2.80). The majority displayed a moderate attitude toward hand hygiene (52.1%), while only a few reported a poor attitude (13.1%). Approximately 68.7%, 29.8%, and 1.5% of the respondents reported moderate, good, and poor practice of hand hygiene, respectively. Having a good attitude toward hand hygiene, being male, being aware that hand hygiene is an effective intervention in preventing healthcare-associated infections (HAIs), attendance at hand hygiene trainings and seminars, and being in the lower academic level of nursing education were identified as predictors of better hand hygiene practice. The importance of ensuring a positive attitude toward hand hygiene and improving awareness of hand hygiene is emphasized, as are educational interventions. Educational interventions should be implemented to reinforce knowledge and instill a positive attitude toward hand hygiene. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  19. Use of Postpartum Care: Predictors and Barriers

    Directory of Open Access Journals (Sweden)

    Jessica N. DiBari

    2014-01-01

    Full Text Available This study aimed to identify actual and perceived barriers to postpartum care among a probability sample of women who gave birth in Los Angeles County, California in 2007. Survey data from the 2007 Los Angeles Mommy and Baby (LAMB study (N = 4,075 were used to identify predictors and barriers to postpartum care use. The LAMB study was a cross-sectional, population-based study that examined maternal and child health outcomes during the preconception, prenatal, and postpartum periods. Multivariable analyses identified low income, being separated/divorced and never married, trying hard to get pregnant or trying to prevent pregnancy, Medi-Cal insurance holders, and lack of prenatal care to be risk factors of postpartum care nonuse, while Hispanic ethnicity was protective. The most commonly reported barriers to postpartum care use were feeling fine, being too busy with the baby, having other things going on, and a lack of need. Findings from this study can inform the development of interventions targeting subgroups at risk for not obtaining postpartum care. Community education and improved access to care can further increase the acceptability of postpartum visits and contribute to improvements in women’s health. Postpartum care can serve as a gateway to engage underserved populations in the continuum of women’s health care.

  20. Reflex Cough and Disease Duration as Predictors of Swallowing Dysfunction in Parkinson's Disease.

    Science.gov (United States)

    Troche, Michelle S; Schumann, Beate; Brandimore, Alexandra E; Okun, Michael S; Hegland, Karen W

    2016-12-01

    Patients with Parkinson's disease (PD) have progressive and pervasive disorders of airway protection. Recent work has highlighted the relationship between reflex and voluntary cough and swallowing safety. The goal of this study was to test the sensitivity and specificity of several airway protective and disease-specific factors for predicting swallowing safety outcomes in PD. Sixty-four participants (44 males) completed measures of voluntary and reflex cough, and swallowing safety. Clinical predictors included disease severity and duration, and cough airflow and sensitivity measures. ROC and Chi-square analyses identified predictors of swallowing safety (penetration-aspiration score) in PD. Disease duration significantly discriminated between patients with normal and abnormal swallowing safety (p = 0.027, sensitivity: 71 %, specificity: 55.4 %). Cough reflex sensitivity significantly discriminated between patients who penetrated above the level of the vocal folds and those with more severe penetration/aspiration (p = 0.021, sensitivity: 71.0 %, specificity 57.6 %). Urge-to-cough sensitivity (log-log linear slope) was the only variable which significantly discriminated between patients with penetration versus aspiration (p = 0.017, sensitivity: 85.7 %, specificity 73.2 %). It is important to identify the factors which influence airway protective outcomes in PD especially given that aspiration pneumonia is a leading cause of death. Results from this study highlight the ecological validity of reflex cough in the study of airway protection and this study further identifies important factors to consider in the screening of airway protective deficits in PD.

  1. Modified Smith-predictor multirate control utilizing secondary process measurements

    Directory of Open Access Journals (Sweden)

    Rolf Ergon

    2007-01-01

    Full Text Available The Smith-predictor is a well-known control structure for industrial time delay systems, where the basic idea is to estimate the non-delayed process output by use of a process model, and to use this estimate in an inner feedback control loop combined with an outer feedback loop based on the delayed estimation error. The model used may be either mechanistic or identified from input-output data. The paper discusses improvements of the Smith-predictor for systems where also secondary process measurements without time delay are available as a basis for the primary output estimation. The estimator may then be identified also in the common case with primary outputs sampled at a lower rate than the secondary outputs. A simulation example demonstrates the feasibility and advantages of the suggested control structure.

  2. Poststroke epilepsy in the Copenhagen stroke study: incidence and predictors

    DEFF Research Database (Denmark)

    Kammersgaard, Lars Peter; Olsen, Tom Skyhøj

    2005-01-01

    Poststroke epilepsy (PSE) is a feared complication after stroke and is reported in 3% to 5% of stroke survivors. In this study we sought to identify incidence and predictors of PSE in an unselected stroke population with a follow-up period of 7 years. The study was community-based and comprises...... a cohort of 1197 consecutively and prospectively admitted patients with stroke. Patients were followed up for 7 years. We defined PSE as recurrent epileptic seizures with onset after stroke and requiring antiepileptic prophylaxis. PSE was related to clinical factors (age, sex, onset stroke severity, lesion...... size on computed tomography scans, stroke subtype, localization, stroke risk factor profile, and early seizures) in univariate analyses. Independent predictors of PSE were identified through multiple logistic regression analyses. Overall, 38 patients (3.2%) developed PSE. Univariately, PSE...

  3. Perceived role legitimacy and role importance of Australian school staff in addressing student cannabis use.

    Science.gov (United States)

    Gates, Peter J; Norberg, Melissa M; Dillon, Paul; Manocha, Ramesh

    2013-01-01

    The high prevalence of cannabis use by Australian secondary school students makes schools an ideal setting for the delivery of substance use prevention programs. Although efficacious school-based cannabis prevention programs exist, there is scant research investigating the perceived role legitimacy and role importance of school staff. As such, this study surveyed a sample of 1691 Australian school staff by utilizing Generation Next seminars which are attended by professionals working with young people. The self-completed survey identified that, despite elevated contact with students relative to other school staff, teachers reported the least role importance and legitimacy of all school staff. Further, teachers reported the lowest level of staff drug education training, which was an important predictor of an increased feeling of role importance and legitimacy among school staff.

  4. Latinos in science: Identifying factors that influence the low percentage of Latino representation in the sciences

    Science.gov (United States)

    Miranda, Susan Jennifer

    A mixed methods approach was used to identify factors that influence the underrepresentation of Latinos in the domain of science. The researcher investigated the role of family influences, academic preparation, and personal motivations to determine science-related career choices by Latinos. Binary logistic regression analyses were conducted using information from Latinos gathered from the National Education Longitudinal Study of 1988 (NELS: 88) administered by the National Center for Education Statistics. For the present study, data were analyzed using participants' responses as high school seniors, college students, and post-baccalaureates. Students responded to questions on school, work, parental academic influences, personal aspirations, and self-perception. To provide more insight into the experiences of Latinos in science and support the statistical analyses, nine students majoring in science in a private, urban university located in the northeastern part of the country were interviewed. Eleven variables related to parents' academic support and students' perceptions of parental support were taken together as predictors for two separate criteria from the survey. These results identified parents' level of education and the importance of academics to parents in their teen's college choice as significant predictors in determining college major in science. When the criterion was degree in science, the significant predictor was the frequency parents contacted high school as volunteers. Student interviews supported this information, demonstrating the importance of parental support in attaining a degree in science. Academic preparation was also analyzed. Students' reasons for taking science classes in high school was a significant predictor for science major; significant predictors for science degree were the emphasis placed on objectives in math and science classes and number of courses in biology and physics. Student interviews supported this information and

  5. Incidence and predictors of oral feeding intolerance in acute pancreatitis: A systematic review, meta-analysis, and meta-regression.

    Science.gov (United States)

    Bevan, Melody G; Asrani, Varsha M; Bharmal, Sakina; Wu, Landy M; Windsor, John A; Petrov, Maxim S

    2017-06-01

    Tolerance of oral food is an important criterion for hospital discharge in patients with acute pancreatitis. Patients who develop oral feeding intolerance have prolonged hospitalisation, use additional healthcare resources, and have impaired quality of life. This study aimed to quantify the incidence of oral feeding intolerance, the effect of confounders, and determine the best predictors of oral feeding intolerance. Clinical studies indexed in three electronic databases (EMBASE, MEDLINE, and the Cochrane Central Register of Controlled Trials) were reviewed. Incidence and predictor data were meta-analysed and possible confounders were investigated by meta-regression analysis. A total of 22 studies with 2024 patients met the inclusion criteria, 17 of which (with 1550 patients) were suitable for meta-analysis. The incidence of oral feeding intolerance was 16.3%, and was not affected by WHO region, age, sex, or aetiology of acute pancreatitis. Nine of the 22 studies investigated a total of 62 different predictors of oral feeding intolerance. Serum lipase level prior to refeeding, pleural effusions, (peri)pancreatic collections, Ranson score, and Balthazar score were found to be statistically significant in meta-analyses. Oral feeding intolerance affects approximately 1 in 6 patients with acute pancreatitis. Serum lipase levels of more than 2.5 times the upper limit of normal prior to refeeding is a potentially useful threshold to identify patients at high risk of developing oral feeding intolerance. Copyright © 2016 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  6. Prevalence and predictors of unsupervised walking and physical activity in a community population of women with fibromyalgia.

    Science.gov (United States)

    López-Roig, Sofía; Pastor, María-Ángeles; Peñacoba, Cecilia; Lledó, Ana; Sanz, Yolanda; Velasco, Lilian

    2016-08-01

    Physical exercise is recognized as a component of the evidence-based guidelines for treatment of fibromyalgia. Walking is a low-moderate intensity exercise easily adaptable to a fibromyalgia patient's situation. The present study aims to estimate the prevalence of unsupervised walking for exercise in women with fibromyalgia, to describe their level of physical activity and to identify their predictors among socio-demographic, symptom perception and medical advice to walk. A cross-sectional survey with 920 women (all members of fibromyalgia associations) completed the International Physical Activity Questionnaire-Short Form and self-reported scales to assess symptom perception, walking, medical advice to walk and physical comorbidity. The prevalence of reported walking regularly as physical exercise was 30.8 % and it was predicted by medical advice (odds ratio, OR 1.876), age (OR 1.021) and fatigue intensity (OR 0.912). The prevalence of physical activity was 16 % for high-intensity activity, 40 % for moderate activity and 44 % for low activity. Predictors of low versus moderate and high physical activity were pain intensity (OR 1.171) and fatigue impact perception (OR 1.076). Evidence shows a low percentage of women with fibromyalgia walking regularly for physical exercise. Most reported low or moderate physical activity. The results indicate the importance of doctors' advice in promoting walking. Symptom perception and socio-demographic characteristics were weak predictors. Further work is required to examine other determinants of these low levels.

  7. Predictors of needs for community and financial resources for families of pre-school children with cerebral palsy

    Directory of Open Access Journals (Sweden)

    Bertule D.

    2016-01-01

    Full Text Available An understanding of predictors of family needs for the families of preschool children with cerebral palsy (CP is important for provision of efficient and cost-effective services. The aim of this study was to identify the characteristics of children, families and services that are risk factors to meeting family needs for community and financial resources. 234 parents of pre-school children with CP completed a modified version of the Family Needs Survey (FNS, the Measure of Processes of Care (MPOC-20, and a demographic questionnaire. The gross motor function level and communication function level of children were classified on the basis of the Gross Motor Function Classification System (GMFCS and the Communication Function Classification System (CFCS respectively. Two hierarchical multiple regression models were generated to determine the predictors of unmet family needs. The socialisation and communication skills of children, as well as caregiver employment and family income levels were significant predictors of family needs for community resources (adjusted R2=0.44. Significant risk factors in terms of family needs for financial resources included the child's gross motor limitations, caregiver employment, low levels of family income and no ability to receive services on the basis of enabling and partnership principles (adjusted R2=0.51. A child's limitations in terms of communication, gross motor functions and socialisation, as well as the socioeconomic status of the child's family, must be taken into account when planning services for families with preschool children with CP.

  8. Childhood Depression: Relation to Adaptive, Clinical and Predictor Variables

    OpenAIRE

    Garaigordobil, Maite; Bernar?s, Elena; Jaureguizar, Joana; Machimbarrena, Juan M.

    2017-01-01

    The study had two goals: (1) to explore the relations between self-assessed childhood depression and other adaptive and clinical variables (2) to identify predictor variables of childhood depression. Participants were 420 students aged 7–10 years old (53.3% boys, 46.7% girls). Results revealed: (1) positive correlations between depression and clinical maladjustment, school maladjustment, emotional symptoms, internalizing and externalizing problems, problem behaviors, emotional reactivity, and...

  9. Predictors for total medical costs for acute hemorrhagic stroke patients transferred to the rehabilitation ward at a regional hospital in Taiwan.

    Science.gov (United States)

    Chen, Chien-Min; Ke, Yen-Liang

    2016-02-01

    One-third of the acute stroke patients in Taiwan receive rehabilitation. It is imperative for clinicians who care for acute stroke patients undergoing inpatient rehabilitation to identify which medical factors could be the predictors of the total medical costs. The aim of this study was to identify the most important predictors of the total medical costs for first-time hemorrhagic stroke patients transferred to inpatient rehabilitation using a retrospective design. All data were retrospectively collected from July 2002 to June 2012 from a regional hospital in Taiwan. A stepwise multivariate linear regression analysis was used to identify the most important predictors for the total medical costs. The medical records of 237 patients (137 males and 100 females) were reviewed. The mean total medical cost per patient was United States dollar (USD) 5939.5 ± 3578.5.The following were the significant predictors for the total medical costs: impaired consciousness [coefficient (B), 1075.7; 95% confidence interval (CI) = 138.5-2012.9], dysphagia [coefficient (B), 1025.8; 95% CI = 193.9-1857.8], number of surgeries [coefficient (B), 796.4; 95% CI = 316.0-1276.7], pneumonia in the neurosurgery ward [coefficient (B), 2330.1; 95% CI = 1339.5-3320.7], symptomatic urinary tract infection (UTI) in the rehabilitation ward [coefficient (B), 1138.7; 95% CI = 221.6-2055.7], and rehabilitation ward stay [coefficient (B), 64.9; 95% CI = 31.2-98.7] (R(2) = 0.387). Our findings could help clinicians to understand that cost reduction may be achieved by minimizing complications (pneumonia and UTI) in these patients.

  10. Predictors of institutionalization in patients with dementia in Korea.

    Science.gov (United States)

    Kim, Jae-Min; Shin, Il-Seon; Jeong, Seong-Joo; Gormley, Niall; Yoon, Jin-Sang

    2002-02-01

    Many studies have sought to determine the predictors of institutionalization of patients with dementia. Such studies, performed in developed western societies, have come to various conclusions which may not be supported in an East Asian culture such as that found in Korea. This study aimed to determine the factors that predict institutionalization of patients in Korea diagnosed with dementia. Seventy-nine cases (37 institutionalized, 42 community-dwelling) in the Kwangju area were evaluated for patient characteristics, severity of dementia symptoms, caregiver characteristics, burden and distress. Logistic regression was performed to determine predictors of actual institutionalization. Six predictors of institutionalization were identified. Of these, three were patient-related factors: higher score on the Clinical Dementia Rating, higher score on the Brief Psychiatric Rating Scale, and shorter duration of dementia. The other three were caregiver-related factors: younger age, higher education (formal schooling), and higher cost of home care. As seen in previous western studies, institutionalization of dementia sufferers was influenced by both patient and caregiver factors. But, the specific predictors and their relative influences might be explained best by the particular social, cultural and economic situation in Korea. This study was the first of its kind in Korea and, as such, could serve as a reference for future intra-cultural and cross-cultural comparisons. Copyright 2002 John Wiley & Sons, Ltd.

  11. Clinical predictors for the prognosis of myasthenia gravis.

    Science.gov (United States)

    Wang, Lili; Zhang, Yun; He, Maolin

    2017-04-19

    Clinical predictors for myasthenia gravis relapse and ocular myasthenia gravis secondary generalization during the first two years after disease onset remain incompletely identified. This study attempts to investigate the clinical predictors for the prognosis of Myasthenia Gravis. Eighty three patients with myasthenia gravis were concluded in this study. Baseline characteristics were analyzed as predictors. Relapse of myasthenia gravis developed in 26 patients (34%). Generalization developed in 34 ocular myasthenia gravis patients (85%). Other autoimmune diseases were observed more commonly in relapsed myasthenia gravis (P = 0.012). Second generalization group contained more late onset patients (P = 0.021). Ocular myasthenia gravis patients with thymus hyperplasia progressed more rapidly than those with other thymus pathology (P = 0.027). Single onset symptom of ocular myasthenia gravis such as ptosis or diplopia predicted early progression than concurrence of ptosis and diplopia (P = 0.027). Treatment effect including glucocorticoid, pyridostigmine, thymectomy, IVIG, immunosuppressive drugs did not show significant difference between the relapsed and non-relapsed groups. The treatment outcome also showed no difference between the single OMG and second generalized groups. Occurrence of associated autoimmune disease can serve as a potential predictor for myasthenia gravis relapse. Either ptosis or diplopia, as well as thymic hyperplasia can predict generalization in the first six months.

  12. Predictors of hyperparathyroidism in renal transplant recipients

    International Nuclear Information System (INIS)

    Houssaini, T.S.; Arrayahani, M.; Rhou, H.; Amar, Y.; Benamar, L.; Ouzeddoun, N.; Bayahia, R.

    2008-01-01

    The changes in parathyroid hormone secretion after successful renal transplantation remain to be clearly elucidated. Our study was aimed at identifying the predictors of hyperparathyroidism in renal transplant recipients. A retrospective single center study involving 37 renal transplant recipients, with a follow-up of at least one year, was performed. All transplants were performed using kidneys from living related donors. The average age of study patients was 30+-10 years, with a male-female ratio of 1.31. The mean duration on hemodialysis (HD) prior to transplantation was 25+-18 months. All the grafts but one were functional after a mean follow-up of 41+-21 months. We noted a rapid reduction of the mean parathyroid hormone (iPTH) level from 383+-265 pg/ml before transplantation to 125+-67 pg/ml at one year and 108+-66 pg/ml at two years after transplantation (p=0.01). Bivariate analysis revealed that the level of iPTH obtained during follow-up correlated with the duration on HD (p=0.03), the serum creatinine at 24-months (p=0.013), and to the level of iPTH in the first year post transplantation (P=<0.001). Other clinical or laboratory parameters were not predictive of hyperparathyroidism after kidney transplantation. Liner regression showed that only the serum creatinine at 24-months independently correlated with the level of iPTH at last follow-up (p=0.02). Our study suggests that short duration on HD and a functional graft are the main predictors of correction of hyperparathyroidism after renal transplantation. (author)

  13. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  14. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  15. Measurement error and timing of predictor values for multivariable risk prediction models are poorly reported.

    Science.gov (United States)

    Whittle, Rebecca; Peat, George; Belcher, John; Collins, Gary S; Riley, Richard D

    2018-05-18

    Measurement error in predictor variables may threaten the validity of clinical prediction models. We sought to evaluate the possible extent of the problem. A secondary objective was to examine whether predictors are measured at the intended moment of model use. A systematic search of Medline was used to identify a sample of articles reporting the development of a clinical prediction model published in 2015. After screening according to a predefined inclusion criteria, information on predictors, strategies to control for measurement error and intended moment of model use were extracted. Susceptibility to measurement error for each predictor was classified into low and high risk. Thirty-three studies were reviewed, including 151 different predictors in the final prediction models. Fifty-one (33.7%) predictors were categorised as high risk of error, however this was not accounted for in the model development. Only 8 (24.2%) studies explicitly stated the intended moment of model use and when the predictors were measured. Reporting of measurement error and intended moment of model use is poor in prediction model studies. There is a need to identify circumstances where ignoring measurement error in prediction models is consequential and whether accounting for the error will improve the predictions. Copyright © 2018. Published by Elsevier Inc.

  16. Clinical predictors of outcome in patients with inflammatory dilated cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Konstantinos Karatolios

    Full Text Available The study objectives were to identify predictors of outcome in patients with inflammatory dilated cardiomyopathy (DCMi.From 2004 to 2008, 55 patients with biopsy-proven DCMi were identified and followed up for 58.2±19.8 months. Predictors of outcome were identified in a multivariable analysis with a Cox proportional hazards analysis. The primary endpoint was a composite of death, heart transplantation and hospitalization for heart failure or ventricular arrhythmias.For the primary endpoint, a QTc interval >440msec (HR 2.84; 95% CI 1.03-7.87; p = 0.044, a glomerular filtration rate (GFR 440msec, a GFR<60ml/min/1.73m2 and worsening of NYHA classification during follow-up were univariate predictors of adverse prognosis. In contrast, NYHA classification at baseline, left ventricular ejection fraction, atrial fibrillation, treatment with digitalis or viral genome detection were not related to outcome. After multivariable analysis, a GFR <60ml/min/1.73m2 remained independently associated with adverse outcome.

  17. Predictors of Thrombolysis Administration in Mild Stroke: Florida-Puerto Rico Collaboration to Reduce Stroke Disparities.

    Science.gov (United States)

    Asdaghi, Negar; Wang, Kefeng; Ciliberti-Vargas, Maria A; Gutierrez, Carolina Marinovic; Koch, Sebastian; Gardener, Hannah; Dong, Chuanhui; Rose, David Z; Garcia, Enid J; Burgin, W Scott; Zevallos, Juan Carlos; Rundek, Tatjana; Sacco, Ralph L; Romano, Jose G

    2018-03-01

    Mild stroke is the most common cause for thrombolysis exclusion in patients acutely presenting to the hospital. Thrombolysis administration in this subgroup is highly variable among different clinicians and institutions. We aim to study the predictors of thrombolysis in patients with mild ischemic stroke in the FL-PR CReSD registry (Florida-Puerto Rico Collaboration to Reduce Stroke Disparities). Among 73 712 prospectively enrolled patients with a final diagnosis of ischemic stroke or TIA from January 2010 to April 2015, we identified 7746 cases with persistent neurological symptoms and National Institutes of Health Stroke Scale ≤5 who arrived within 4 hours of symptom onset. Multilevel logistic regression analysis with generalized estimating equations was used to identify independent predictors of thrombolytic administration in the subgroup of patients without contraindications to thrombolysis. We included 6826 cases (final diagnosis mild stroke, 74.6% and TIA, 25.4%). Median age was 72 (interquartile range, 21); 52.7% men, 70.3% white, 12.9% black, 16.8% Hispanic; and median National Institutes of Health Stroke Scale, 2 (interquartile range, 3). Patients who received thrombolysis (n=1281, 18.7%) were younger (68 versus 72 years), had less vascular risk factors (hypertension, diabetes mellitus, and dyslipidemia), had lower risk of prior vascular disease (myocardial infarction, peripheral vascular disease, and previous stroke), and had a higher presenting median National Institutes of Health Stroke Scale (4 versus 2). In the multilevel multivariable model, early hospital arrival (arrive by 0-2 hours versus ≥3.5 hours; odds ratio [OR], 8.16; 95% confidence interval [CI], 4.76-13.98), higher National Institutes of Health Stroke Scale (OR, 1.87; 95% CI, 1.77-1.98), aphasia at presentation (OR, 1.35; 95% CI, 1.12-1.62), faster door-to-computed tomography time (OR, 1.81; 95% CI, 1.53-2.15), and presenting to an academic hospital (OR, 2.02; 95% CI, 1.39-2.95) were

  18. Case-Mix Variables and Predictors for Outcomes of Laparoscopic Hysterectomy: A Systematic Review.

    Science.gov (United States)

    Driessen, Sara R C; Sandberg, Evelien M; la Chapelle, Claire F; Twijnstra, Andries R H; Rhemrev, Johann P T; Jansen, Frank Willem

    2016-01-01

    The assessment of surgical quality is complex, and an adequate case-mix correction is missing in currently applied quality indicators. The purpose of this study is to give an overview of all studies mentioning statistically significant associations between patient characteristics and surgical outcomes for laparoscopic hysterectomy (LH). Additionally, we identified a set of potential case-mix characteristics for LH. This systematic review was conducted according to the Meta-Analysis of Observational Studies in Epidemiology guidelines. We searched PubMed and EMBASE from January 1, 2000 to August 1, 2015. All articles describing statistically significant associations between patient characteristics and adverse outcomes of LH for benign indications were included. Primary outcomes were blood loss, operative time, conversion, and complications. The methodologic quality of the included studies was assessed using the Newcastle-Ottawa Quality Assessment Scale. The included articles were summed per predictor and surgical outcome. Three sets of case-mix characteristics were determined, stratified by different levels of evidence. Eighty-five of 1549 identified studies were considered eligible. Uterine weight and body mass index (BMI) were the most mentioned predictors (described, respectively, 83 and 45 times) in high quality studies. For longer operative time and higher blood loss, uterine weight ≥ 250 to 300 g and ≥500 g and BMI ≥ 30 kg/m(2) dominated as predictors. Previous operations, adhesions, and higher age were also considered as predictors for longer operative time. For complications and conversions, the patient characteristics varied widely, and uterine weight, BMI, previous operations, adhesions, and age predominated. Studies of high methodologic quality indicated uterine weight and BMI as relevant case-mix characteristics for all surgical outcomes. For future development of quality indicators of LH and to compare surgical outcomes adequately, a case

  19. Predictors of business return in New Orleans after Hurricane Katrina.

    Directory of Open Access Journals (Sweden)

    Nina S N Lam

    Full Text Available We analyzed the business reopening process in New Orleans after Hurricane Katrina, which hit the region on August 29, 2005, to better understand what the major predictors were and how their impacts changed through time. A telephone survey of businesses in New Orleans was conducted in October 2007, 26 months after Hurricane Katrina. The data were analyzed using a modified spatial probit regression model to evaluate the importance of each predictor variable through time. The results suggest that the two most important reopening predictors throughout all time periods were the flood depth at the business location and business size as represented by its wages in a logarithmic form. Flood depth was a significant negative predictor and had the largest marginal effects on the reopening probabilities. Smaller businesses had lower reopening probabilities than larger ones. However, the nonlinear response of business size to the reopening probability suggests that recovery aid would be most effective for smaller businesses than for larger ones. The spatial spillovers effect was a significant positive predictor but only for the first nine months. The findings show clearly that flood protection is the overarching issue for New Orleans. A flood protection plan that reduces the vulnerability and length of flooding would be the first and foremost step to mitigate the negative effects from climate-related hazards and enable speedy recovery. The findings cast doubt on the current coastal protection efforts and add to the current debate of whether coastal Louisiana will be sustainable or too costly to protect from further land loss and flooding given the threat of sea-level rise. Finally, a plan to help small businesses to return would also be an effective strategy for recovery, and the temporal window of opportunity that generates the greatest impacts would be the first 6∼9 months after the disaster.

  20. Predictors of business return in New Orleans after Hurricane Katrina.

    Science.gov (United States)

    Lam, Nina S N; Arenas, Helbert; Pace, Kelley; LeSage, James; Campanella, Richard

    2012-01-01

    We analyzed the business reopening process in New Orleans after Hurricane Katrina, which hit the region on August 29, 2005, to better understand what the major predictors were and how their impacts changed through time. A telephone survey of businesses in New Orleans was conducted in October 2007, 26 months after Hurricane Katrina. The data were analyzed using a modified spatial probit regression model to evaluate the importance of each predictor variable through time. The results suggest that the two most important reopening predictors throughout all time periods were the flood depth at the business location and business size as represented by its wages in a logarithmic form. Flood depth was a significant negative predictor and had the largest marginal effects on the reopening probabilities. Smaller businesses had lower reopening probabilities than larger ones. However, the nonlinear response of business size to the reopening probability suggests that recovery aid would be most effective for smaller businesses than for larger ones. The spatial spillovers effect was a significant positive predictor but only for the first nine months. The findings show clearly that flood protection is the overarching issue for New Orleans. A flood protection plan that reduces the vulnerability and length of flooding would be the first and foremost step to mitigate the negative effects from climate-related hazards and enable speedy recovery. The findings cast doubt on the current coastal protection efforts and add to the current debate of whether coastal Louisiana will be sustainable or too costly to protect from further land loss and flooding given the threat of sea-level rise. Finally, a plan to help small businesses to return would also be an effective strategy for recovery, and the temporal window of opportunity that generates the greatest impacts would be the first 6∼9 months after the disaster.

  1. Preschool Predictors of Kindergarten Language Outcomes

    Directory of Open Access Journals (Sweden)

    Anne Walk

    2015-01-01

    Full Text Available The aim of the present study is to explore a variety of cognitive and social variables which are most relevant to children’s linguistic success in an educational setting. The study examines kindergarten English language outcomes in classrooms containing monolingual English speaking children and bilingual children who speak English and one other language. Data from the National Center for Early Development and Learning Multistate Study of Pre-Kindergarten (2001-2003 regarding classroom and student characteristics were used for bilingual (N = 120 and monolingual (N = 534 children. Hierarchical regression analysis (Study 1 and path analysis (Study 2 were conducted to determine the cognitive and social variables present in preschool that are most predictive of English skills in kindergarten. The results of the studies demonstrate that social variables were important for both monolingual and bilingual children. Personality variables were more predictive for monolingual children, whereas teacher relationship variables were more important for bilingual children. Simple and routine adult interaction was predictive of English skills in both groups, which may indicate the importance of implicit learning over explicit instruction in early language acquisition. The present studies found different predictors of English language skills for monolingual and bilingual kindergarteners.

  2. Predictors of Blood Trihalomethane Concentrations in NHANES 1999–2006

    Science.gov (United States)

    Dhingra, Radhika; Blount, Benjamin C.; Steenland, Kyle

    2014-01-01

    Background: Trihalomethanes (THMs) are water disinfection by-products that have been associated with bladder cancer and adverse birth outcomes. Four THMs (bromoform, chloroform, bromodichloromethane, dibromochloromethane) were measured in blood and tap water of U.S. adults in the National Health and Nutrition Examination Survey (NHANES) 1999–2006. THMs are metabolized to potentially toxic/mutagenic intermediates by cytochrome p450 (CYP) 2D6 and CYP2E1 enzymes. Objectives: We conducted exploratory analyses of blood THMs, including factors affecting CYP2D6 and CYP2E1 activity. Methods: We used weighted multivariable regressions to evaluate associations between blood THMs and water concentrations, survey year, and other factors potentially affecting THM exposure or metabolism (e.g., prescription medications, cruciferous vegetables, diabetes, fasting, pregnancy, swimming). Results: From 1999 to 2006, geometric mean blood and water THM levels dropped in parallel, with decreases of 32%–76% in blood and 38%–52% in water, likely resulting, in part, from the lowering of the total THM drinking water standard in 2002–2004. The strongest predictors of blood THM levels were survey year and water concentration (n = 4,232 total THM; n = 4,080 bromoform; n = 4,582 chloroform; n = 4,374 bromodichloromethane; n = 4,464 dibromochloromethane). We detected statistically significant inverse associations with diabetes and eating cruciferous vegetables in all but the bromoform model. Medications did not consistently predict blood levels. Afternoon/evening blood samples had lower THM concentrations than morning samples. In a subsample (n = 230), air chloroform better predicted blood chloroform than water chloroform, suggesting showering/bathing was a more important source than drinking. Conclusions: We identified several factors associated with blood THMs that may affect their metabolism. The potential health implications require further study. Citation: Riederer AM, Dhingra R

  3. Parents’ Primary Professional Sources of Parenting Advice Moderate Predictors of Parental Attitudes toward Corporal Punishment

    Science.gov (United States)

    Taylor, Catherine A.; McKasson, Sarah; Hoy, Guenevere; DeJong, William

    2016-01-01

    Despite the risk it poses to children’s mental and physical health, approval and use of corporal punishment (CP) remains high in the United States. Informed by the Theory of Planned Behavior, we examined potential predictors of attitudes supportive of CP while assessing the moderating effects of parents’ (N=500) chosen primary professional source of advice regarding child discipline: pediatricians (47.8%), religious leaders (20.8%), mental health professionals (MHPs) (n=18.4%), or other identified professionals (13.0%). We conducted a random-digit-dial telephone survey among parents ages 18 and over within New Orleans, LA. The main outcome measure was derived from the Attitudes Toward Spanking scale (ATS). The main “predictors” were: perceived injunctive norms (i.e., perceived approval of CP by professionals; and by family and friends), perceived descriptive norms of family and friends regarding CP, and expected outcomes of CP use. We used multivariate OLS models to regress ATS scores on the predictor variables for each subset of parents based on their chosen professional source of advice. Perceived approval of CP by professionals was the strongest predictor of parental attitudes supportive of CP, except for those seeking advice from MHPs. Perceived injunctive and descriptive norms of family and friends were important, but only for those seeking advice from pediatricians or religious leaders. Positive expected outcomes of CP mattered, but only for those seeking advice from religious leaders or MHPs. In conclusion, the strength and relevance of variables predicting attitudes toward CP varied according to the professional from which the parent was most likely to seek advice. PMID:28529440

  4. Levers for Language Growth: Characteristics and Predictors of Language Trajectories between 4 and 7 Years.

    Directory of Open Access Journals (Sweden)

    Cristina McKean

    Full Text Available Evidence is required as to when and where to focus resources to achieve the greatest gains for children's language development. Key to these decisions is the understanding of individual differences in children's language trajectories and the predictors of those differences. To determine optimal timing we must understand if and when children's relative language abilities become fixed. To determine where to focus effort we must identify mutable factors, that is those with the potential to be changed through interventions, which are associated with significant differences in children's language scores and rate of progress.Uniquely this study examined individual differences in language growth trajectories in a population sample of children between 4 and 7 years using the multilevel model for change. The influence of predictors, grouped with respect to their mutability and their proximity to the child (least-mutable, mutable-distal, mutable-proximal, were estimated.A significant degree of variability in rate of progress between 4 and 7 years was evident, much of which was systematically associated with mutable-proximal factors, that is, those factors with evidence that they are modifiable through interventions with the child or family, such as shared book reading, TV viewing and number of books in the home. Mutable-distal factors, such as family income, family literacy and neighbourhood disadvantage, hypothesised to be modifiable through social policy, were important predictors of language abilities at 4 years.Potential levers for language interventions lie in the child's home learning environment from birth to age 4. However, the role of a family's material and cultural capital must not be ignored, nor should the potential for growth into the school years. Early Years services should acknowledge the effects of multiple, cascading and cumulative risks and seek to promote child language development through the aggregation of marginal gains in the pre

  5. Predictors of risky alcohol consumption in schoolchildren and their implications for preventing alcohol-related harm

    Directory of Open Access Journals (Sweden)

    Allen Tony

    2007-05-01

    Full Text Available Abstract Background While alcohol-related health and social problems amongst youths are increasing internationally, both consumption and associated harms are particularly high in British youth. Youth drinking patterns, including bingeing, frequent drinking and drinking in public spaces, are associated with increased risks of acute (e.g. violence and long-term (e.g. alcohol-dependence health problems. Here we examine economic, behavioural and demographic factors that predict these risky drinking behaviours among 15–16 year old schoolchildren who consume alcohol. A cross-sectional survey was conducted among schoolchildren in North West England (n = 10,271 using an anonymous questionnaire delivered in school settings. Analysis utilised logistic regression to identify independent predictors of risky drinking behaviour. Results Of all respondents, 87.9% drank alcohol. Of drinkers, 38.0% usually binged when drinking, 24.4% were frequent drinkers and 49.8% drank in public spaces. Binge, frequent and public drinking were strongly related to expendable income and to individuals buying their own alcohol. Obtaining alcohol from friends, older siblings and adults outside shops were also predictors of risky drinking amongst drinkers. However, being bought alcohol by parents was associated with both lower bingeing and drinking in public places. Membership of youth groups/teams was in general protective despite some association with bingeing. Conclusion Although previous studies have examined predictors of risky drinking, our analyses of access to alcohol and youth income have highlighted eradicating underage alcohol sales and increased understanding of children's spending as key considerations in reducing risky alcohol use. Parental provision of alcohol to children in a family environment may also be important in establishing child-parent dialogues on alcohol and moderating youth consumption. However, this will require supporting parents to ensure they

  6. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  7. Early concern and disregard for others as predictors of antisocial behavior.

    Science.gov (United States)

    Rhee, Soo Hyun; Friedman, Naomi P; Boeldt, Debra L; Corley, Robin P; Hewitt, John K; Knafo, Ariel; Lahey, Benjamin B; Robinson, JoAnn; Van Hulle, Carol A; Waldman, Irwin D; Young, Susan E; Zahn-Waxler, Carolyn

    2013-02-01

    Prediction of antisocial behavior is important, given its adverse impact on both the individuals engaging in antisocial behavior and society. Additional research identifying early predictors of future antisocial behavior, or antisocial propensity, is needed. The present study tested the hypothesis that both concern for others and active disregard for others in distress in toddlers and young children predict antisocial behavior during middle childhood and adolescence. A representative sample of same-sex twins (N=956) recruited in Colorado was examined. Mother-rated and researcher-observed concern and disregard for others assessed at age 14-36 months were examined as predictors of parent- (age 4-12), teacher- (age 7-12), and self-reported (age 17) antisocial behavior.   Observed disregard for others predicted antisocial behavior assessed by three different informants (parents, teachers, and self), including antisocial behavior assessed 14 years later. It also predicted a higher order antisocial behavior factor (β=.58, pconcern for others. Mother-rated disregard for others predicted parent-reported antisocial behavior. Contrary to predictions, neither mother-rated nor observed concern for others inversely predicted antisocial behavior. RESULTS of twin analyses suggested that the covariation between observed disregard for others and antisocial behavior was due to shared environmental influences. Disregard for others in toddlerhood/early childhood is a strong predictor of antisocial behavior in middle childhood and adolescence. The results suggest the potential need for early assessment of disregard for others and the development of potential interventions. © 2012 The Author. Journal of Child Psychology and Psychiatry © 2012 Association for Child and Adolescent Mental Health.

  8. Distribution and predictors of wing shape and size variability in three sister species of solitary bees.

    Directory of Open Access Journals (Sweden)

    Simon Dellicour

    Full Text Available Morphological traits can be highly variable over time in a particular geographical area. Different selective pressures shape those traits, which is crucial in evolutionary biology. Among these traits, insect wing morphometry has already been widely used to describe phenotypic variability at the inter-specific level. On the contrary, fewer studies have focused on intra-specific wing morphometric variability. Yet, such investigations are relevant to study potential convergences of variation that could highlight micro-evolutionary processes. The recent sampling and sequencing of three solitary bees of the genus Melitta across their entire species range provides an excellent opportunity to jointly analyse genetic and morphometric variability. In the present study, we first aim to analyse the spatial distribution of the wing shape and centroid size (used as a proxy for body size variability. Secondly, we aim to test different potential predictors of this variability at both the intra- and inter-population levels, which includes genetic variability, but also geographic locations and distances, elevation, annual mean temperature and precipitation. The comparison of spatial distribution of intra-population morphometric diversity does not reveal any convergent pattern between species, thus undermining the assumption of a potential local and selective adaptation at the population level. Regarding intra-specific wing shape differentiation, our results reveal that some tested predictors, such as geographic and genetic distances, are associated with a significant correlation for some species. However, none of these predictors are systematically identified for the three species as an important factor that could explain the intra-specific morphometric variability. As a conclusion, for the three solitary bee species and at the scale of this study, our results clearly tend to discard the assumption of the existence of a common pattern of intra-specific signal

  9. Distribution and predictors of wing shape and size variability in three sister species of solitary bees.

    Science.gov (United States)

    Dellicour, Simon; Gerard, Maxence; Prunier, Jérôme G; Dewulf, Alexandre; Kuhlmann, Michael; Michez, Denis

    2017-01-01

    Morphological traits can be highly variable over time in a particular geographical area. Different selective pressures shape those traits, which is crucial in evolutionary biology. Among these traits, insect wing morphometry has already been widely used to describe phenotypic variability at the inter-specific level. On the contrary, fewer studies have focused on intra-specific wing morphometric variability. Yet, such investigations are relevant to study potential convergences of variation that could highlight micro-evolutionary processes. The recent sampling and sequencing of three solitary bees of the genus Melitta across their entire species range provides an excellent opportunity to jointly analyse genetic and morphometric variability. In the present study, we first aim to analyse the spatial distribution of the wing shape and centroid size (used as a proxy for body size) variability. Secondly, we aim to test different potential predictors of this variability at both the intra- and inter-population levels, which includes genetic variability, but also geographic locations and distances, elevation, annual mean temperature and precipitation. The comparison of spatial distribution of intra-population morphometric diversity does not reveal any convergent pattern between species, thus undermining the assumption of a potential local and selective adaptation at the population level. Regarding intra-specific wing shape differentiation, our results reveal that some tested predictors, such as geographic and genetic distances, are associated with a significant correlation for some species. However, none of these predictors are systematically identified for the three species as an important factor that could explain the intra-specific morphometric variability. As a conclusion, for the three solitary bee species and at the scale of this study, our results clearly tend to discard the assumption of the existence of a common pattern of intra-specific signal/structure within the

  10. Predictors of early change in bulimia nervosa after a brief psychoeducational therapy.

    Science.gov (United States)

    Fernàndez-Aranda, Fernando; Álvarez-Moya, Eva M; Martínez-Viana, Cristina; Sànchez, Isabel; Granero, Roser; Penelo, Eva; Forcano, Laura; Peñas-Lledó, Eva

    2009-06-01

    We aimed to examine baseline predictors of treatment response in bulimic patients. 241 seeking-treatment females with bulimia nervosa completed an exhaustive assessment and were referred to a six-session psychoeducational group. Regression analyses of treatment response were performed. Childhood obesity, lower frequency of eating symptomatology, lower body mass index, older age, and lower family's and patient's concern about the disorder were predictors of poor abstinence. Suicidal ideation, alcohol abuse, higher maximum BMI, higher novelty seeking and lower baseline purging frequency predicted dropouts. Predictors of early symptom changes and dropouts were similar to those identified in longer CBT interventions.

  11. Predictors of Stenosing Tenosynovitis in the Hand and Hand-Related Activity Limitations in Patients With Rheumatoid Arthritis

    NARCIS (Netherlands)

    Ursum, J.; Horsten, N.C.; Hoeksma, A.F.; Dijkmans, B.A.C.; Knol, D.L.; van Schaardenburg, D.; Dekker, J.; Roorda, L.D.

    2011-01-01

    Ursum J, Horsten NC, Hoeksma AF, Dijkmans BA, Knol DL, van Schaardenburg D, Dekker J, Roorda LD. Predictors of stenosing tenosynovitis in the hand and hand-related activity limitations in patients with rheumatoid arthritis. Objectives To identify early predictors of stenosing tenosynovitis in the

  12. Predictors of cardiac morbidity in diabetic, new-onset diabetic and non-diabetic high-risk hypertensive patients: The Valsartan Antihypertensive Long-term Use Evaluation (VALUE) trial.

    Science.gov (United States)

    Aksnes, Tonje A; Kjeldsen, Sverre E; Rostrup, Morten; Holzhauer, Björn; Hua, Tsushung A; Julius, Stevo

    2016-08-01

    Diabetic and new-onset diabetic patients with hypertension have higher cardiac morbidity than patients without diabetes. We aimed to investigate whether baseline predictors of cardiac morbidity, the major constituent of the primary endpoint in the Valsartan Antihypertensive Long-term Use Evaluation (VALUE) trial, were different in patients with diabetes and new-onset diabetes compared to patients without diabetes. In total, 15,245 high-risk hypertensive patients in the VALUE trial were followed for an average of 4.2 years. At baseline, 5250 patients were diabetic by the 1999 World Health Organization criteria, 1298 patients developed new-onset diabetes and 8697 patients stayed non-diabetic during follow-up. Cardiac morbidity was defined as a composite of myocardial infarction and heart failure requiring hospitalization, and baseline predictors were identified by univariate and multivariate stepwise Cox regression analyses. History of coronary heart disease (CHD) and age were the most important predictors of cardiac morbidity in both diabetic and non-diabetic patients. History of CHD, history of stroke and age were the only significant predictors of cardiac morbidity in patients with new-onset diabetes. Predictors of cardiac morbidity, in particular history of CHD and age, were essentially the same in high-risk hypertensive patients with diabetes, new-onset diabetes and without diabetes who participated in the VALUE trial.

  13. Predictors of relationship satisfaction for men and women

    Directory of Open Access Journals (Sweden)

    Gaja Zager Kocjan

    2014-06-01

    Full Text Available The present study was designed to examine the differences between genders in the perception of romantic relationship as well as in aspects of the relationship that are important for their relationship satisfaction. However, previous studies rarely report significant differences between genders in various predictors of the relationship satisfaction. In our study, similar conclusions were obtained. Relationship satisfaction was predicted with attachment, self-esteem, and partner's social support. The study included 200 participants (63.5% of women who completed the following questionnaires: Experience in Close Relationships – Revised Short ECR-RS, Quality of Relationship Inventory QRI, Relationship Satisfaction Scale RSS, and a single-item self-esteem measure. For both genders, significant positive predictor of their relationship satisfaction was self-esteem, while avoidance, anxiety, and conflict in the relationship were significant negative predictors. There were no significant differences between genders. These findings are consistent with the findings of previous studies, which rarely report significant gender differences in the various predictors.

  14. Predictors of Outcome in Ulcerative Colitis.

    Science.gov (United States)

    Waterman, Matti; Knight, Jo; Dinani, Amreen; Xu, Wei; Stempak, Joanne M; Croitoru, Kenneth; Nguyen, Geoffrey C; Cohen, Zane; McLeod, Robin S; Greenberg, Gordon R; Steinhart, A Hillary; Silverberg, Mark S

    2015-09-01

    Approximately 80% of patients with ulcerative colitis (UC) have intermittently active disease and up to 20% will require a colectomy, but little data available on predictors of poor disease course. The aim of this study was to identify clinical and genetic markers that can predict prognosis. Medical records of patients with UC with ≥5 years of follow-up and available DNA and serum were retrospectively assessed. Immunochip was used to genotype loci associated with immune mediated inflammatory disorders (IMIDs), inflammatory bowel diseases, and other single nucleotide polypmorphisms previously associated with disease severity. Serum levels of pANCA, ASCA, CBir1, and OmpC were also evaluated. Requirement for colectomy, medication, and hospitalization were used to group patients into 3 prognostic groups. Six hundred one patients with UC were classified as mild (n = 78), moderate (n = 273), or severe disease (n = 250). Proximal disease location frequencies at diagnosis were 13%, 21%, and 30% for mild, moderate, and severe UC, respectively (P = 0.001). Disease severity was associated with greater proximal extension rates on follow-up (P 40 and proximal disease location were associated with severe UC (odds ratios = 1.94 and 2.12, respectively). None of the single nucleotide polypmorphisms or serum markers tested was associated with severe UC, proximal disease extension or colectomy. Older age and proximal disease location at diagnosis, but not genetic and serum markers, were associated with a more severe course. Further work is required to identify biomarkers that will predict outcomes in UC.

  15. Elderly outpatient profile and predictors of falls.

    Science.gov (United States)

    Gomes, Grace Angélica de Oliveira; Cintra, Fernanda Aparecida; Batista, Fernanda Sotelo; Neri, Anita Liberalesso; Guariento, Maria Elena; Sousa, Maria da Luz Rosario de; D'Elboux, Maria José

    2013-01-01

    CONTEXT AND OBJECTIVES Falls are a serious public health problem and are one of the biggest reasons for hospitalization, morbidity and mortality among elderly people. Moreover, few studies on predictors of falls have been conducted in low and middle income countries. The aim here was to identify elderly outpatient profiles according to sociodemographic, clinical, physical and functional variables and correlate them with occurrences of falls among these subjects. DESIGN AND SETTING Cross-sectional descriptive study forming part of the project "Quality of Life of Frail Elderly People", carried out in Campinas, Brazil. METHODS The subjects were 145 elderly individuals (76.3 ± 7.8 years old), of whom 65% were women, who were living in the city of Campinas or nearby and were attended at the geriatric outpatient clinic of a University Hospital. Sociodemographic, clinical, physical and functional data, as well as fall occurrence data, were gathered. Cluster analyses and comparisons between groups were carried out. RESULTS Cluster analysis identified two distinct groups related to the study variables, and the determinants for this distinction were: gender, marital status, physical performance, handgrip strength and functional independence. These groups were compared according to occurrences of falls over the last year, and significant differences between them were found. CONCLUSIONS The results showed that greater occurrences of falls were associated with a profile of elderly people comprising female gender, single status, lower muscle strength and physical performance regarding balance and gait, and lower independence in motor tasks for activities of daily living.

  16. Elderly outpatient profile and predictors of falls

    Directory of Open Access Journals (Sweden)

    Grace Angélica de Oliveira Gomes

    Full Text Available CONTEXT AND OBJECTIVESFalls are a serious public health problem and are one of the biggest reasons for hospitalization, morbidity and mortality among elderly people. Moreover, few studies on predictors of falls have been conducted in low and middle income countries. The aim here was to identify elderly outpatient profiles according to sociodemographic, clinical, physical and functional variables and correlate them with occurrences of falls among these subjects.DESIGN AND SETTINGCross-sectional descriptive study forming part of the project “Quality of Life of Frail Elderly People”, carried out in Campinas, Brazil.METHODSThe subjects were 145 elderly individuals (76.3 ± 7.8 years old, of whom 65% were women, who were living in the city of Campinas or nearby and were attended at the geriatric outpatient clinic of a University Hospital. Sociodemographic, clinical, physical and functional data, as well as fall occurrence data, were gathered. Cluster analyses and comparisons between groups were carried out.RESULTSCluster analysis identified two distinct groups related to the study variables, and the determinants for this distinction were: gender, marital status, physical performance, handgrip strength and functional independence. These groups were compared according to occurrences of falls over the last year, and significant differences between them were found.CONCLUSIONSThe results showed that greater occurrences of falls were associated with a profile of elderly people comprising female gender, single status, lower muscle strength and physical performance regarding balance and gait, and lower independence in motor tasks for activities of daily living.

  17. Family Functioning and Predictors of Runaway Behavior Among At-Risk Youth.

    Science.gov (United States)

    Holliday, Stephanie Brooks; Edelen, Maria Orlando; Tucker, Joan S

    2017-06-01

    Adolescent runaway behavior is associated with a host of negative outcomes in young adulthood. Therefore, it is important to understand the factors that predict running away in youth. Longitudinal data from 111 at-risk families were used to identify proximal predictors of runaway behavior over a 12-week period. On average, youth were 14.96 years old, and 45% were female. Ten percent of youth ran away during the 12-week follow-up period. In bivariate analyses, running away was predicted by poorer youth- and parent-rated family functioning, past runaway behavior, and other problem behaviors (e.g., substance use, delinquency), but not poorer perceived academic functioning. Results of a hierarchical logistic regression revealed a relationship between youth-rated family functioning and runaway behavior. However, this effect became non-significant after accounting for past runaway behavior and other problem behaviors, both of which remained significant predictors in the multivariable model. These findings suggest that youth who run away may be engaged in a more pervasive pattern of problematic behavior, and that screening and prevention programs need to address the cycle of adolescent defiant behavior associated with running away. Recommendations for clinical practice with this at-risk population are discussed.

  18. Predictors of health-related quality of life among industrial workers: A descriptive correlational study.

    Science.gov (United States)

    Malak, Malakeh Z

    2017-06-01

    Assessment and evaluation of the health-related quality of life of industrial workers is an important research focus. This descriptive correlational study identifies the predictors of health-related quality of life using a random sampling of industrial workers (n = 640) from construction factories in Amman Governorate in Jordan using demographic characteristics, a health and work-related factors questionnaire, and the World Health Organization Quality of Life-Brief scale. Results showed that industrial workers had good physical health but a poor working environment. There was a statistically significant relationship between educational level, conflict between work and individual life and work and social life, working hours, and workload, and all domains of health-related quality of life. Overall, educational level was the main predictor for all domains of health-related quality of life. Such results confirm the need to develop appropriate interventions and strategies to improve workers' health-related quality of life. Furthermore, developing an integrated approach among policymakers, employers, and work organizations to enhance industrial workers' occupational health programs could be effective. © 2017 John Wiley & Sons Australia, Ltd.

  19. Longitudinal predictors of psychological distress and self-esteem in people with ALS.

    Science.gov (United States)

    Goldstein, L H; Atkins, L; Landau, S; Brown, R G; Leigh, P N

    2006-11-14

    To identify predictors of psychological distress (measured by anxiety and depression) and low self-esteem and to determine whether these change over time in people with ALS. We interviewed 50 patients with ALS living with a spouse/partner; further interviews were held at median intervals of 6 and then 5 months. Although carers were interviewed, we report the patients' data. Patients completed measures about their social support and marital relationship; the functional impact of ALS; everyday cognitive, emotional, and behavioral changes; symptoms of anxiety and depression; and self-esteem. The ALS Severity Scale was also completed. From the initial sample of 50, 26 patients were interviewed on all three occasions. At the first interview, negative social support and bulbar impairment were most predictive of psychological distress; pre-illness marital intimacy was the best predictor of patients' self-esteem. Over time, negative social support and pre-illness marital intimacy retained an ability to predict patients' affective state and self-esteem. Social factors are important in determining longer-term psychological well-being in people with ALS who are in the relatively early stages of the disease.

  20. Distribution and Predictors of Pesticides in the Umbilical Cord Blood of Chinese Newborns

    Directory of Open Access Journals (Sweden)

    Monica K. Silver

    2015-12-01

    Full Text Available Rates of pesticide use in Chinese agriculture are five times greater than the global average, leading to high exposure via the diet. Many are neurotoxic, making prenatal pesticide exposure a concern. Previous studies of prenatal exposure in China focused almost entirely on organochlorines. Here the study goals were to characterize the exposure of Chinese newborns to all classes of pesticides and identify predictors of those exposures. Eighty-four pesticides and 12 metabolites were measured in the umbilical cord plasma of 336 infants. Composite variables were created for totals detected overall and by class. Individual pesticides were analyzed as dichotomous or continuous, based on detection rates. Relationships between demographic characteristics and pesticides were evaluated using generalized linear regression. Seventy-five pesticides were detected. The mean number of detects per sample was 15.3. Increased pesticide detects were found in the cord blood of infants born in the summer (β = 2.2, p = 0.01, particularly in July (β = 4.0, p = 0.03. Similar trends were observed for individual insecticide classes. Thus, a summer birth was the strongest predictor of pesticide evidence in cord blood. Associations were more striking for overall pesticide exposure than for individual pesticides, highlighting the importance of considering exposure to mixtures of pesticides, rather than individual agents or classes.

  1. Prevalence and predictors of posttraumatic stress disorder among victims of violence applying for state compensation.

    Science.gov (United States)

    Kunst, Maarten; Winkel, Frans Willem; Bogaerts, Stefan

    2010-09-01

    Many studies have focused on the predictive value of victims' emotions experienced shortly after violence exposure to identify those vulnerable for development of posttraumatic stress disorder (PTSD). However, many victims remain unidentified during the initial recovery phase, yet may still be highly in need of psychological help after substantial time since victimization has passed. Professionals involved in the settlement of civil damage claims filed by victims of violence may play an important role in referring victims with current psychological problems to appropriate treatment services, as they are likely to maintain relations with victims until all compensation possibilities have been exhausted. As an exploratory examination of this topic, the current study investigates the potential utility of file characteristics as predictors of chronic PTSD among 686 victims of violence who had applied for state compensation with the Dutch Victim Compensation Fund (DVCF) in 2006. Identification of significant predictors is preceded by estimating prevalence rates of PTSD. Results indicate that approximately 1 of 2 victims applying for state compensation in the Netherlands still have PTSD many years after victimization and claim settlement. Age, female sex, time since victimization, acquaintance with the perpetrator, violence-related hospitalization, and compensation for immaterial damage prove to be predictive of PTSD, although female sex and immaterial damage compensation fail to reach significance after adjusting for recalled peritraumatic distress severity. Implications for policy practice as well as strengths and limitations of the study are discussed.

  2. Predictors of effects of lifestyle intervention on diabetes mellitus type 2 patients.

    Science.gov (United States)

    Jacobsen, Ramune; Vadstrup, Eva; Røder, Michael; Frølich, Anne

    2012-01-01

    The main aim of the study was to identify predictors of the effects of lifestyle intervention on diabetes mellitus type 2 patients by means of multivariate analysis. Data from a previously published randomised clinical trial, which compared the effects of a rehabilitation programme including standardised education and physical training sessions in the municipality's health care centre with the same duration of individual counseling in the diabetes outpatient clinic, were used. Data from 143 diabetes patients were analysed. The merged lifestyle intervention resulted in statistically significant improvements in patients' systolic blood pressure, waist circumference, exercise capacity, glycaemic control, and some aspects of general health-related quality of life. The linear multivariate regression models explained 45% to 80% of the variance in these improvements. The baseline outcomes in accordance to the logic of the regression to the mean phenomenon were the only statistically significant and robust predictors in all regression models. These results are important from a clinical point of view as they highlight the more urgent need for and better outcomes following lifestyle intervention for those patients who have worse general and disease-specific health.

  3. Dragon polya spotter: Predictor of poly(A) motifs within human genomic DNA sequences

    KAUST Repository

    Kalkatawi, Manal M.

    2011-11-15

    Motivation: Recognition of poly(A) signals in mRNA is relatively straightforward due to the presence of easily recognizable polyadenylic acid tail. However, the task of identifying poly(A) motifs in the primary genomic DNA sequence that correspond to poly(A) signals in mRNA is a far more challenging problem. Recognition of poly(A) signals is important for better gene annotation and understanding of the gene regulation mechanisms. In this work, we present one such poly(A) motif prediction method based on properties of human genomic DNA sequence surrounding a poly(A) motif. These properties include thermodynamic, physico-chemical and statistical characteristics. For predictions, we developed Artificial Neural Network and Random Forest models. These models are trained to recognize 12 most common poly(A) motifs in human DNA. Our predictors are available as a free web-based tool accessible at http://cbrc.kaust.edu.sa/dps. Compared with other reported predictors, our models achieve higher sensitivity and specificity and furthermore provide a consistent level of accuracy for 12 poly(A) motif variants. The Author(s) 2011. Published by Oxford University Press. All rights reserved.

  4. Predictors of Visual Response to Intravitreal Bevacizumab for Treatment of Neovascular Age-Related Macular Degeneration

    Directory of Open Access Journals (Sweden)

    Kai Fang

    2013-01-01

    Full Text Available Purpose. To identify the predictors of visual response to the bevacizumab treatment of neovascular age-related macular degeneration (AMD. Design. A cohort study within the Neovascular AMD Treatment Trial Using Bevacizumab (NATTB. Methods. This was a multicenter trial including 144 participants from the NATTB study. Visual outcomes measured by change in visual acuity (VA score, proportion gaining ≥15 letters, and change in central retinal thickness (CRT were compared among groups according to the baseline, demographic, and ocular characteristics and genotypes. Results. Mean change in the VA score was 9.2 ± 2.3 SD letters with a total of 46 participants (31.9% gaining ≥15 letters. Change in median CRT was −81.5 μm. Younger age, lower baseline VA score, shorter duration of neovascular AMD, and TT genotype in rs10490924 were significantly associated with greater VA score improvement (P=0.028, P<0.001, P=0.02, and P=0.039, resp.. Lower baseline VA score and TT genotype in rs10490924 were significantly associated with a higher likelihood of gaining ≥15 letters (P=0.028, and P=0.021, resp.. Conclusions. Baseline VA and genotype of rs10490924 were both important predictors for visual response to bevacizumab at 6 months. This trial is registered with the Registration no. NCT01306591.

  5. Prevalence, predictors, and clinical consequences of medical adherence in IBD: how to improve it?

    Science.gov (United States)

    Lakatos, Peter Laszlo

    2009-09-14

    Inflammatory bowel diseases (IBD) are chronic diseases with a relapsing-remitting disease course necessitating lifelong treatment. However, non-adherence has been reported in over 40% of patients, especially those in remission taking maintenance therapies for IBD. The economical impact of non-adherence to medical therapy including absenteeism, hospitalization risk, and the health care costs in chronic conditions, is enormous. The causes of medication non-adherence are complex, where the patient-doctor relationship, treatment regimen, and other disease-related factors play key roles. Moreover, subjective assessment might underestimate adherence. Poor adherence may result in more frequent relapses, a disabling disease course, in ulcerative colitis, and an increased risk for colorectal cancer. Improving medication adherence in patients is an important challenge for physicians. Understanding the different patient types, the reasons given by patients for non-adherence, simpler and more convenient dosage regimens, dynamic communication within the health care team, a self-management package incorporating enhanced patient education and physician-patient interaction, and identifying the predictors of non-adherence will help devise suitable plans to optimize patient adherence. This editorial summarizes the available literature on frequency, predictors, clinical consequences, and strategies for improving medical adherence in patients with IBD.

  6. Psychological predictors of mental health and health-related quality of life after bariatric surgery: a review of the recent research.

    Science.gov (United States)

    Wimmelmann, Cathrine L; Dela, Flemming; Mortensen, Erik L

    2014-01-01

    Improvement of mental health and health-related quality of life (HRQOL) is an important success criterion for bariatric surgery. In general, mental health and HRQOL improve after surgery, but some patients experience negative psychological reactions postoperatively and the influence of pre-surgical psychological factors on mental wellbeing after surgery is unclear. The aim of the current article therefore is to review recent research investigating psychological predictors of mental health and HRQOL outcome. We searched PubMed, PsycInfo and Web of Science for studies investigating psychological predictors of either mental health or HRQOL after bariatric surgery. Original prospective studies published between 2003 and 2012 with a sample size >30 and a minimum of 1 year follow-up were included. Only 10 eligible studies were identified. The findings suggest that preoperative psychological factors including psychiatric symptoms, body image and self-esteem may be important for mental health postoperatively. Predictors of postoperative HRQOL seem to include personality, severe psychiatric disorder at baseline and improvement of depressive symptoms. In addition, psychiatric symptoms that persist after surgery and inappropriate eating behaviour postoperatively are likely to contribute to poor health-related quality of life outcome. Certain psychological factors appear to be important for mental health and HRQOL after bariatric surgery. However, the literature is extremely sparse and further research is highly needed. Copyright © 2013 Asian Oceanian Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

  7. Predictors and moderators of response to enhanced cognitive behaviour therapy and interpersonal psychotherapy for the treatment of eating disorders.

    Science.gov (United States)

    Cooper, Zafra; Allen, Elizabeth; Bailey-Straebler, Suzanne; Basden, Shawnee; Murphy, Rebecca; O'Connor, Marianne E; Fairburn, Christopher G

    2016-09-01

    Consistent predictors, and more especially moderators, of response to psychological treatments for eating disorders have not been identified. The present exploratory study examined predictors and moderators of outcome in adult patients who took part in a randomised clinical trial comparing two leading treatments for these disorders, enhanced cognitive behavioural therapy (CBT-E) and interpersonal psychotherapy (IPT). Four potentially important findings emerged. Firstly, patients with a longer duration of disorder were less likely to benefit from either treatment. Second, across the two treatments the presence, at baseline, of higher levels of over-evaluation of the importance of shape predicted a less good treatment outcome. Third DSM-IV diagnosis did not predict treatment outcome. Fourth, with the exception of patients with baseline low self-esteem who achieved a better outcome with CBT-E, it was generally not possible to identify a subgroup of patients who would differentially benefit from one or other treatment. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Euro area Inflation as a Predictor of National Inflation Rates

    OpenAIRE

    Antonella Cavallo; Antonio Ribba

    2013-01-01

    The stability of inflation differentials is an important condition for the smooth working of a currency area, such as the European Economic and Monetary Union. In the presence of stability, changes in national inflation rates, while holding Euro-area inflation fixed contemporaneously, should be only transitory. If this is the case, the rate of inflation of the whole area can also be interpreted as a predictor, at least in the long run, of the different national inflation rates. However, in th...

  9. Predictors of burnout and engagement of university students / Olwage D.

    OpenAIRE

    Olwage, Danél.

    2012-01-01

    Student burnout and engagement have become more evident as a problem among students in higher education institutions. It is therefore very important to determine the various predictors that could cause students to experience burnout and engagement. The aim of this study is to establish whether core self–evaluation traits, career decision–making difficulty and social support have an impact on burnout and engagement of students. A limited number of research has been done on student burnout and ...

  10. Clinical and biological predictors of Alzheimer's disease in patients with amnestic mild cognitive impairment

    OpenAIRE

    Forlenza,Orestes V.; Diniz,Breno S.; Talib,Leda L.; Radanovic,Marcia; Yassuda,Monica S.; Ojopi,Elida B.; Gattaz,Wagner F.

    2010-01-01

    OBJECTIVE: To identify predictors of the progression from pre-dementia stages of cognitive impairment in Alzheimer's disease is relevant to clinical management and to substantiate the decision of prescribing antidementia drugs. METHOD: Longitudinal study of a cohort of elderly adults with amnestic mild cognitive impairment and healthy controls, carried out to estimate the risk and characterize predictors of the progression to Alzheimer's disease. RESULTS: Patients with amnestic mild cognitive...

  11. Predictors of social anxiety in an opioid dependent sample and a control sample

    OpenAIRE

    Shand, Fiona L.; Degenhardt, Louisa; Nelson, Elliot C.; Mattick, Richard P.

    2010-01-01

    Compared to other mental health problems, social anxiety is under-acknowledged amongst opioid dependent populations. This study aimed to assess levels of social anxiety and identify its predictors in an opioid dependent sample and a matched control group. Opioid dependent participants (n = 1385) and controls (n = 417) completed the Social Interaction Anxiety Scale (SIAS), the Social Phobia Scale (SPS) and a diagnostic interview. Regression analyses were used to test a range of predictors of s...

  12. Predictors for early diagnosis of cerebral palsy from national registry data

    DEFF Research Database (Denmark)

    Granild-Jensen, Jakob Bie; Rackauskaite, Gija; Flachs, Esben Meulengracht

    2015-01-01

    AIM: As early intervention is important in cerebral palsy (CP), an early diagnosis is desirable. The aim of this study was to establish the median diagnostic age of CP and to identify predictors of an early diagnosis in a population-based cohort. METHOD: Using the Danish National Cerebral Palsy...... of motor disability, cerebral ultrasonography results, epilepsy, gestational age, and degree of cognitive impairment. RESULTS: We found the overall median corrected diagnostic age of CP to be 11 months. Early diagnosis was associated with the type of CP, presence of epilepsy, a high degree of motor...... disability, and abnormalities in the cerebral ultrasonography. The gestational age was not associated with the diagnostic age. INTERPRETATION: The median diagnostic age implies that half of the Danish children with CP will be able to enter an early intervention program before 1 year of age. A late diagnosis...

  13. Predictors of suicide ideation among older adults with bipolar disorder.

    Science.gov (United States)

    O'Rourke, Norm; Heisel, Marnin J; Canham, Sarah L; Sixsmith, Andrew

    2017-01-01

    Bipolar disorder (BD) carries the greatest risk of death by suicide of all psychiatric conditions as 25%-50% of those with BD will make one or more suicide attempt, and about 15% will intentionally end their lives. Among young adults with BD, substance misuse, medication non-adherence, age at onset, and comorbid psychiatric conditions each predict self-harm. It is currently unclear if these same factors or others predict suicide ideation among older adults with BD. We recruited a global sample of 220 older adults with BD over 19 days using socio-demographically targeted, social media advertising and online data collection (Mean = 58.50, SD = 5.42; range 50 to 81 years). Path analyses allowed us to identify direct and indirect predictors of suicide ideation among older adults with BD. Cognitive failures (perception, memory, and motor function), depressive symptoms, alcohol misuse, and dissatisfaction with life as direct predictors of suicide ideation; duration of BD symptoms and medication non-adherence emerged as indirect predictors. Of note, the significant impact of sleep on suicide ideation is indirect via depressive symptoms, cognitive failures, medication non-adherence and life dissatisfaction. As with young adults with BD, alcohol misuse and medication non-adherence emerged as significant predictors of suicide ideation. In addition, cognitive failures directly and indirectly predict suicide ideation in this sample of older adults with BD. Population aging and treatment efficacy are leading to ever growing numbers of older adults with BD. Both direct and indirect predictors of suicide ideation need to be considered in future BD research and treatment planning.

  14. Detection of major climatic and environmental predictors of liver fluke exposure risk in Ireland using spatial cluster analysis.

    Science.gov (United States)

    Selemetas, Nikolaos; de Waal, Theo

    2015-04-30

    Fasciolosis caused by Fasciola hepatica (liver fluke) can cause significant economic and production losses in dairy cow farms. The aim of the current study was to identify important weather and environmental predictors of the exposure risk to liver fluke by detecting clusters of fasciolosis in Ireland. During autumn 2012, bulk-tank milk samples from 4365 dairy farms were collected throughout Ireland. Using an in-house antibody-detection ELISA, the analysis of BTM samples showed that 83% (n=3602) of dairy farms had been exposed to liver fluke. The Getis-Ord Gi* statistic identified 74 high-risk and 130 low-risk significant (Pclimatic variables (monthly and seasonal mean rainfall and temperatures, total wet days and rain days) and environmental datasets (soil types, enhanced vegetation index and normalised difference vegetation index) were used to investigate dissimilarities in the exposure to liver fluke between clusters. Rainfall, total wet days and rain days, and soil type were the significant classes of climatic and environmental variables explaining the differences between significant clusters. A discriminant function analysis was used to predict the exposure risk to liver fluke using 80% of data for modelling and the remaining subset of 20% for post hoc model validation. The most significant predictors of the model risk function were total rainfall in August and September and total wet days. The risk model presented 100% sensitivity and 91% specificity and an accuracy of 95% correctly classified cases. A risk map of exposure to liver fluke was constructed with higher probability of exposure in western and north-western regions. The results of this study identified differences between clusters of fasciolosis in Ireland regarding climatic and environmental variables and detected significant predictors of the exposure risk to liver fluke. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Patient Characteristics and Patient Behavior as Predictors of Outcome in Cognitive Therapy and Exposure Therapy for Hypochondriasis.

    Science.gov (United States)

    Richtberg, Samantha; Jakob, Marion; Höfling, Volkmar; Weck, Florian

    2017-06-01

    Psychotherapy for hypochondriasis has greatly improved over the last decades and cognitive-behavioral treatments are most promising. However, research on predictors of treatment outcome for hypochondriasis is rare. Possible predictors of treatment outcome in cognitive therapy (CT) and exposure therapy (ET) for hypochondriasis were investigated. Characteristics and behaviors of 75 patients were considered as possible predictors: sociodemographic variables (sex, age, and cohabitation); psychopathology (pretreatment hypochondriacal symptoms, comorbid mental disorders, and levels of depression, anxiety, and somatic symptoms); and patient in-session interpersonal behavior. Severity of pretreatment hypochondriacal symptoms, comorbid mental disorders, and patient in-session interpersonal behavior were significant predictors in multiple hierarchical regression analyses. Interactions between the predictors and the treatment (CT or ET) were not found. In-session interpersonal behavior is an important predictor of outcome. Furthermore, there are no specific contraindications to treating hypochondriasis with CT or ET. © 2016 Wiley Periodicals, Inc.

  16. Early predictors of outcome after mild traumatic brain injury (UPFRONT): an observational cohort study.

    Science.gov (United States)

    van der Naalt, Joukje; Timmerman, Marieke E; de Koning, Myrthe E; van der Horn, Harm J; Scheenen, Myrthe E; Jacobs, Bram; Hageman, Gerard; Yilmaz, Tansel; Roks, Gerwin; Spikman, Jacoba M

    2017-07-01

    date for 6-month follow-up was July 6, 2015. Of these patients, 764 (84%) had post-traumatic complaints and 414 (45%) showed emotional distress. At 6 months after injury, outcome data were available for 671 patients; complete recovery (GOSE=8) was observed in 373 (56%) patients and incomplete recovery (GOSE ≤7) in 298 (44%) patients. Logistic regression analyses identified several predictors for 6-month outcome, including education and age, with a clear surplus value of indicators of emotional distress and coping obtained at 2 weeks (area under the curve [AUC]=0·79, optimism 0·02; Nagelkerke R 2 =0·32, optimism 0·05) than only emergency department predictors at the time of admission (AUC=0·72, optimism 0·03; Nagelkerke R 2 =0·19, optimism 0·05). Psychological factors (ie, emotional distress and maladaptive coping experienced early after injury) in combination with pre-injury mental health problems, education, and age are important predictors for recovery at 6 months following mTBI. These findings provide targets for early interventions to improve outcome in a subgroup of patients at risk of incomplete recovery from mTBI, and warrant validation. Dutch Brain Foundation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. A Study of Clinical Predictors Associated With Intrinsic Sphincter Deficiency in Women With Stress Urinary Incontinence

    Directory of Open Access Journals (Sweden)

    Kyung Kgi Park

    2017-06-01

    Full Text Available Purpose Recently, intrinsic sphincter deficiency (ISD has been identified as one important factor in the outcome of stress urinary incontinence (SUI related surgery. Clinical factors that can predict ISD are uncommon. The aim of this study was to determine predictive clinical factors for ISD in female patients with SUI. Methods The patients were classified into 3 groups according to the value of Valsalva leak point pressure (VLPP>90 cm H2O (anatomical incontinence, AI, between 61 and 90 cm H2O (equivocal, EV, and <60 cm H2O (ISD. All groups underwent a full examination, history evaluation, physical examination, uroflowmetry, and complete urodynamic study. Univariate analysis was performed by chi-square or t-test for categorical variables, respectively. A multivariate study was performed by Pearson correlation analysis in order to get clinical predictors of VLPP<60 cm H2O. Statistical significance was set at P<0.05. Results There were 3 groups with a total of 189 patients: 56 patients (AI, 29.7%, 64 patients (EV, 33.8%, and 69 patients (ISD, 36.5%. The univariate analysis revealed a significant difference associated with maximal urethral closing pressure (P=0.03 and Stamey classification (P=0.006 between ISD and AI. The more severe the urinary symptom grade, the higher the frequency of ISD. However, the multivariate analysis showed the independent predictor of ISD is only present in grades II and III symptoms in the Stamey classification (P=0.001. Conclusions It was found that the more severe the symptoms of urinary incontinence, the higher the possibility of ISD. In other words, the degree of urinary incontinence was found to be one relevant clinical factor in predicting ISD. This finding may help in evaluating and identifying the appropriate surgical technique for EV. Currently, absolute cutoff value to diagnose ISD has not yet been determined. More research is needed to identify clinical factors that can predict ISD.

  18. Sociodemographic predictors of latent class membership of problematic and disordered gamblers

    Directory of Open Access Journals (Sweden)

    Richard J.E. James

    2016-06-01

    Full Text Available This paper reports a series of analyses examining the predictors of gambling subtypes identified from a latent class analysis of problem gambling assessment data, pooled from four health and gambling surveys conducted in Britain between 2007 and 2012. Previous analyses have indicated that gambling assessments have a consistent three class structure showing quantitative and potentially qualitative differences. Bringing this data together is useful for studying more severe problem gamblers, where the small number of respondents has been a chronic limitation of gambling prevalence research. Predictors were drawn from sociodemographic indicators and engagement with other legal addictive behaviours, namely smoking and alcohol consumption. The pooled data was entered into a multinomial logistic regression model in which class membership was regressed along a series of demographic variables and survey year, based on previous analyses of gambling prevalence data. The results identified multiple demographic differences (age, general health, SES, being single, membership of ethnic minority groups between the non-problem and two classes endorsing some problem gambling indicators. Although these two groups tended to share a sociodemographic profile, the odds of being male, British Asian and a smoker increased between the three groups in line with problem gambling severity. Being widowed was also found to be associated with the most severe gambling class. A number of associations were also observed with other addictive behaviours. However these should be taken as indicative as these were limited subsamples of a single dataset. These findings identify specific groups in which gambling problems are more prevalent, and highlight the importance of the interaction between acute and determinant aspects of impulsivity, suggesting that a more complex account of impulsivity should be considered than is currently present in the gambling literature.

  19. Electrical Signs predictors of malignant ventricular arrhythmias

    International Nuclear Information System (INIS)

    Aleman Fernandez, Ailema Amelia; Dorantes Sanchez, Margarita

    2012-01-01

    Recurrence of malignant ventricular arrhythmia is frequent in cardioverter-defibrillators related patients. The risk stratification is difficult, there are numerous electrocardiographic predictors but his sensibility and specificity are not absolute. The limit between normal and pathological is not defined, besides the complexity of ventricular arrhythmias. We expose different electrocardiographic predictors that can help to better individual risk stratification

  20. Predictors of treatment failure among pulmonary tuberculosis ...

    African Journals Online (AJOL)

    Introduction: Early identification of Tuberculosis (TB) treatment failure using cost effective means is urgently needed in developing nations. The study set out to describe affordable predictors of TB treatment failure in an African setting. Objective: To determine the predictors of treatment failure among patients with sputum ...

  1. A smart predictor for material property testing

    International Nuclear Information System (INIS)

    Wang, Wilson; Kanneg, Derek

    2008-01-01

    A reliable predictor is very useful for real-world industrial applications to forecast the future behavior of dynamic systems. A smart predictor, based on a novel recurrent neural fuzzy (RNF) scheme, is developed in this paper for multi-step-ahead prediction of material properties. A systematic investigation based on two benchmark data sets is conducted in terms of performance and efficiency. Analysis results reveal that, of the data-driven forecasting schemes, predictors based on step input patterns outperform those based on sequential input patterns; the RNF predictor outperforms those based on recurrent neural networks and ANFIS schemes in multi-step-ahead prediction of nonlinear time series. An adaptive Levenberg–Marquardt training technique is adopted to improve the robustness and convergence of the RNF predictor. Furthermore, the proposed smart predictor is implemented for material property testing. Investigation results show that the developed RNF predictor is a reliable forecasting tool for material property testing; it can capture and track the system's dynamic characteristics quickly and accurately. It is also a robust predictor to accommodate different system conditions

  2. Incidence and predictors of coronary stent thrombosis

    DEFF Research Database (Denmark)

    D'Ascenzo, Fabrizio; Bollati, Mario; Clementi, Fabrizio

    2013-01-01

    Stent thrombosis remains among the most feared complications of percutaneous coronary intervention (PCI) with stenting. However, data on its incidence and predictors are sparse and conflicting. We thus aimed to perform a collaborative systematic review on incidence and predictors of stent...

  3. On the Identification of Associations between Five World Health Organization Water, Sanitation and Hygiene Phenotypes and Six Predictors in Low and Middle-Income Countries.

    Science.gov (United States)

    Ellis, Hugh; Schoenberger, Erica

    2017-01-01

    According to the most recent estimates, 842,000 deaths in low- to middle-income countries were attributable to inadequate water, sanitation and hygiene in 2012. Despite billions of dollars and decades of effort, we still lack a sound understanding of which kinds of WASH interventions are most effective in improving public health outcomes, and an important corollary-whether the right things are being measured. The World Health Organization (WHO) has made a concerted effort to compile comprehensive data on drinking water quality and sanitation in the developing world. A recent 2014 report provides information on three phenotypes (responses): Unsafe Water Deaths, Unsafe Sanitation Deaths, Unsafe Hygiene Deaths; two grouped phenotypes: Unsafe Water and Sanitation Deaths and Unsafe Water, Sanitation and Hygiene Deaths; and six explanatory variables (predictors): Improved Sanitation, Unimproved Water Source, Piped Water To Premises, Other Improved Water Source, Filtered and Bottled Water in the Household and Handwashing. Regression analyses were performed to identify statistically significant associations between these mortality responses and predictors. Good fitted-model performance required: (1) the use of population-normalized death fractions as opposed to number of deaths; (2) transformed response (logit or power); and (3) square-root predictor transformation. Given the complexity and heterogeneity of the relationships and countries being studied, these models exhibited remarkable performance and explained, for example, about 85% of the observed variance in population-normalized Unsafe Sanitation Death fraction, with a high F-statistic and highly statistically significant predictor p-values. Similar performance was found for all other responses, which was an unexpected result (the expected associations between responses and predictors-i.e., water-related with water-related, etc. did not occur). The set of statistically significant predictors remains the same across

  4. On the Identification of Associations between Five World Health Organization Water, Sanitation and Hygiene Phenotypes and Six Predictors in Low and Middle-Income Countries.

    Directory of Open Access Journals (Sweden)

    Hugh Ellis

    Full Text Available According to the most recent estimates, 842,000 deaths in low- to middle-income countries were attributable to inadequate water, sanitation and hygiene in 2012. Despite billions of dollars and decades of effort, we still lack a sound understanding of which kinds of WASH interventions are most effective in improving public health outcomes, and an important corollary-whether the right things are being measured. The World Health Organization (WHO has made a concerted effort to compile comprehensive data on drinking water quality and sanitation in the developing world. A recent 2014 report provides information on three phenotypes (responses: Unsafe Water Deaths, Unsafe Sanitation Deaths, Unsafe Hygiene Deaths; two grouped phenotypes: Unsafe Water and Sanitation Deaths and Unsafe Water, Sanitation and Hygiene Deaths; and six explanatory variables (predictors: Improved Sanitation, Unimproved Water Source, Piped Water To Premises, Other Improved Water Source, Filtered and Bottled Water in the Household and Handwashing.Regression analyses were performed to identify statistically significant associations between these mortality responses and predictors. Good fitted-model performance required: (1 the use of population-normalized death fractions as opposed to number of deaths; (2 transformed response (logit or power; and (3 square-root predictor transformation. Given the complexity and heterogeneity of the relationships and countries being studied, these models exhibited remarkable performance and explained, for example, about 85% of the observed variance in population-normalized Unsafe Sanitation Death fraction, with a high F-statistic and highly statistically significant predictor p-values. Similar performance was found for all other responses, which was an unexpected result (the expected associations between responses and predictors-i.e., water-related with water-related, etc. did not occur. The set of statistically significant predictors remains the

  5. Predictors of smoking among male college students in Saudi Arabia.

    Science.gov (United States)

    Almogbel, Y S; Abughosh, S M; Almogbel, F S; Alhaidar, I A; Sansgiry, S S

    2013-11-01

    Identifying the predictors of smoking in one of the top cigarette-consuming countries in the world is a vital step in smoking prevention. A cross-sectional study assessed the predictors of smoking in a cohort of male students in 3 universities in Saudi Arabia. A pre-tested, validated questionnaire was used to determine sociodemographic characteristics, academic performance, peers' smoking, and presence of a smoker within the family. Of the 337 participants, 30.9% were current smokers (smoked 1 or more cigarettes within the last 30 days). Lower academic performance (OR = 2.29, 95% CI: 1.02-5.17), peer smoking (OR = 4.14, 95% CI: 1.53-11.3) and presence of other smokers in the family (OR = 2.77, 95% CI: 1.37-5.64) were the significant predictors of smoking status identified using multiple logistic regression analysis. These findings highlight the influence of family and peer pressure in initiating cigarette use among the youth of Saudi Arabia.

  6. Predictors of avoiding medical care and reasons for avoidance behavior.

    Science.gov (United States)

    Kannan, Viji Diane; Veazie, Peter J

    2014-04-01

    Delayed medical care has negative health and economic consequences; interventions have focused on appraising symptoms, with limited success in reducing delay. To identify predictors of care avoidance and reasons for avoiding care. Using the Health Information National Trends Survey (2007), we conducted logistic regressions to identify predictors of avoiding medical visits deemed necessary by the respondents; and, we then conducted similar analyses on reasons given for avoidance behavior. Independent variables included geographic, demographic, socioeconomic, personal health, health behavior, health care system, and cognitive characteristics. Approximately one third of adults avoided doctor visits they had deemed necessary. Although unadjusted associations existed, avoiding needed care was not independently associated with geographic, demographic, and socioeconomic characteristics. Avoidance behavior is characterized by low health self-efficacy, less experience with both quality care and getting help with uncertainty about health, having your feelings attended to by your provider, no usual source of care, negative affect, smoking daily, and fatalistic attitude toward cancer. Reasons elicited for avoidance include preference for self-care or alternative care, dislike or distrust of doctors, fear or dislike of medical treatments, time, and money; respondents also endorsed discomfort with body examinations, fear of having a serious illness, and thoughts of dying. Distinct predictors distinguish each of these reasons. Interventions to reduce patient delay could be improved by addressing the health-related behavioral, belief, experiential, and emotional traits associated with delay. Attention should also be directed toward the interpersonal communications between patients and providers.

  7. Metformin in gestational diabetes mellitus: predictors of poor response.

    Science.gov (United States)

    Gante, Inês; Melo, Luís; Dores, Jorge; Ruas, Luísa; Almeida, Maria do Céu

    2018-01-01

    Metformin can be regarded as a first-line treatment in gestational diabetes mellitus (GDM) due to its safety and effectiveness. However, a proportion of women do not achieve adequate glycemic control with metformin alone. We aim to identify predictors of this poor response to metformin. Retrospective multicentre cohort study of women with GDM who started metformin as first-line treatment. The assessed cohort was divided into a metformin group and metformin plus insulin group. Biometric and demographic characteristics, glycemic control data, obstetric, neonatal and postpartum outcomes were compared between groups and analysed in order to identify predictors of poor response to metformin. Data were analysed using STATA, version 13.1. Of the 388 women enrolled in the study, 135 (34.8%) required additional insulin therapy to achieve the glycemic targets. Higher age (aOR: 1.08 (1.03-1.13), P  = 0.003), higher pre-pregnancy body mass index (BMI) (1.06 (1.02-1.10), P  = 0.003) and earlier introduction of metformin (0.89 (0.85-0.94), P  metformin, insulin supplementation was not associated with poor neonatal outcomes. Higher age, higher pre-pregnancy BMI and earlier introduction of metformin could be used as predictors of poor response to metformin. © 2018 European Society of Endocrinology.

  8. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  9. Predictors of Burnout Syndrome Among Healthcare Workers in Hospitals

    Directory of Open Access Journals (Sweden)

    Janine Kieling Monteiro

    2016-06-01

    Full Text Available This research aims at identifying sociodemographic and laboral predictors of burnout syndrome in 182 health workers in the hospital setting. It uses a questionnaire, Maslach Burnout Inventory, and a working context scale. In the analysis of the data a multiple regression analysis was employed. Interviewees' considering their profession as stressful was the most revealing variable with regards to the Emotional Exhaustion dimension and the low level of Professional Efficacy. As predictor variables to Cynicism the research points to negative working environments, stress upon dealing with male patients. The risk profile for burnout syndrome includes higher schooled professionals, old-timers and those who perceive their job, work scale, type and quantity of patients as stressing factors.

  10. The Predictors of Graduation: Social Skills, Mental Health, Academic Characteristics

    Directory of Open Access Journals (Sweden)

    Alessandra Salina Brandão

    Full Text Available Abstract: Not completing the undergraduate course in the time expected in the curricula can put the universities and students at a disadvantage, with a delay to enter the labor market. The aim was to identify predictors of graduation, considering social skills, mental health, initial academic performance and socio-demographic and academic characteristics. In total, 287 students participated, of both genders and fromthe humanities, exact and biological areas, who answered the instruments: Social Skills, Behaviors and Context Assessment Questionnaire for University Students, Short version of the Social Phobia Inventory, Beck Depression Inventory, and Structured Clinical Interview for DSM-IV. Predictors were: female, humanities area and average or above-average initial academic performance. The social skills and mental health differentiated the groups in the univariate analyses. This data suggests a need for attention to academic performance in the initial stages of the course, and preventive measures for male students of the exact and biological areas.

  11. Searching for Psychological Predictors of Suicidal Ideation in University Students

    Directory of Open Access Journals (Sweden)

    Adelino António Gonçalves Pereira

    2018-01-01

    Full Text Available ABSTRACT The present study aims to identify psychological predictors of suicidal ideation in university students. We collected a sample of 366 participants, representing a population of 7102 students from a university in northern Portugal (95% CI. Both in the whole sample and in the intra-gender analysis, students with suicidal ideation revealed higher levels of depressive symptoms, loneliness, social anxiety and fears of abandonment, and lower levels of comfort with intimacy and trust in others. Loneliness and depression are significant predictors of suicidal ideation, with an odds ratio of 1.095 and 1.108, respectively. The results were consistent with those found in the literature, and call for more research and implementation of intervention protocols in university populations.

  12. Predictors of successful closure of patent ductus arteriosus with indomethacin.

    Science.gov (United States)

    Ahamed, M F; Verma, P; Lee, S; Vega, M; Wang, D; Kim, M; Fuloria, M

    2015-09-01

    To determine whether platelet counts can predict the likelihood of successful closure of patent ductus arteriosus (PDA) with indomethacin. This was a retrospective cohort study of infants closure with indomethacin and those who failed were compared. Multivariable logistic regression was used to identify predictors of successful ductal closure. In infants with hemodynamically significant PDA, older GA (odds ratio=1.54; 95% confidence interval: 1.12 to 2.13), male gender (odds ratio=3.02; 95% confidence interval: 1.08 to 8.49) and higher platelet count (odds ratio=1.5; 95% confidence interval: 1.04 to 2.17) prior to indomethacin treatment were associated with successful ductal closure with indomethacin. Older GA, male gender and higher platelet count at time of treatment of hemodynamically significant PDA are predictors of successful ductal closure with indomethacin.

  13. Predictors of utilisation of dental care services in a nationally representative sample of adults.

    Science.gov (United States)

    Guiney, H; Woods, N; Whelton, H; Morgan, K

    2011-12-01

    The objective of this study was to identify the predictors of utilisation of dental care services in Ireland. The 2007 Irish Survey of Lifestyle, Attitudes and Nutrition is a cross-sectional study, conducted in 2006/2007 (n = 10,364), by interviews at home to a representative sample of adults aged 18 years or over. Multivariate logistic regression was used to investigate the influence of socioeconomic, predisposing and enabling factors on the odds of males and females having a dental visit in the past year. The significant predictors of visiting the dentist in the past year were for males: having 3rd level education, employment status, earning 50,000 euros or more, location of residence, use of a car, brushing frequently, and dentition status. For females, the predictors were being between 25-34 or 55-64 years-old, education level, earning 50,000 euros or more, location of residence, use of a car, brushing frequently and dentition status. Predictors of the use of dental services vary by gender. Predictors common to both genders were education level, higher income, location of residence, use of a car, brushing frequently and dentition status. Many of the predictors of dental visiting in the past year are also related to social inequalities in health. These predictors may be useful markers of impact for policies designed to address inequalities in access to oral health services.

  14. Autonomous and controlled motivation for eating disorders treatment: baseline predictors and relationship to treatment outcome.

    Science.gov (United States)

    Carter, Jacqueline C; Kelly, Allison C

    2015-03-01

    This study aimed to identify baseline predictors of autonomous and controlled motivation for treatment (ACMT) in a transdiagnostic eating disorder sample, and to examine whether ACMT at baseline predicted change in eating disorder psychopathology during treatment. Participants were 97 individuals who met DSM-IV-TR criteria for an eating disorder and were admitted to a specialized intensive treatment programme. Self-report measures of eating disorder psychopathology, ACMT, and various psychosocial variables were completed at the start of treatment. A subset of these measures was completed again after 3, 6, 9, and 12 weeks of treatment. Multiple regression analyses showed that baseline autonomous motivation was higher among patients who reported more self-compassion and more received social support, whereas the only baseline predictor of controlled motivation was shame. Multilevel modelling revealed that higher baseline autonomous motivation predicted faster decreases in global eating disorder psychopathology, whereas the level of controlled motivation at baseline did not. The current findings suggest that developing interventions designed to foster autonomous motivation specifically and employing autonomy supportive strategies may be important to improving eating disorders treatment outcome. The findings of this study suggest that developing motivational interventions that focus specifically on enhancing autonomous motivation for change may be important for promoting eating disorder recovery. Our results lend support for the use of autonomy supportive strategies to strengthen personally meaningful reasons to achieve freely chosen change goals in order to enhance treatment for eating disorders. One study limitation is that there were no follow-up assessments beyond the 12-week study and we therefore do not know whether the relationships that we observed persisted after treatment. Another limitation is that this was a correlational study and it is therefore important

  15. Socioeconomic predictors of human papillomavirus vaccination among girls in the Danish childhood immunization program

    DEFF Research Database (Denmark)

    Slåttelid Schreiber, Selma Marie; Juul, Kirsten Egebjerg; Dehlendorff, Christian

    2015-01-01

    to identify socioeconomic predictors of initiation and completion of HPV vaccination. METHODS: Girls born in 1996-1997 and their guardians were identified through the Danish Civil Registration System. Information on socioeconomic variables and HPV vaccination status was obtained by linkage to Statistics...

  16. Predictors of blood trihalomethane concentrations in NHANES 1999-2006.

    Science.gov (United States)

    Riederer, Anne M; Dhingra, Radhika; Blount, Benjamin C; Steenland, Kyle

    2014-07-01

    Trihalomethanes (THMs) are water disinfection by-products that have been associated with bladder cancer and adverse birth outcomes. Four THMs (bromoform, chloroform, bromodichloromethane, dibromochloromethane) were measured in blood and tap water of U.S. adults in the National Health and Nutrition Examination Survey (NHANES) 1999-2006. THMs are metabolized to potentially toxic/mutagenic intermediates by cytochrome p450 (CYP) 2D6 and CYP2E1 enzymes. We conducted exploratory analyses of blood THMs, including factors affecting CYP2D6 and CYP2E1 activity. We used weighted multivariable regressions to evaluate associations between blood THMs and water concentrations, survey year, and other factors potentially affecting THM exposure or metabolism (e.g., prescription medications, cruciferous vegetables, diabetes, fasting, pregnancy, swimming). From 1999 to 2006, geometric mean blood and water THM levels dropped in parallel, with decreases of 32%-76% in blood and 38%-52% in water, likely resulting, in part, from the lowering of the total THM drinking water standard in 2002-2004. The strongest predictors of blood THM levels were survey year and water concentration (n = 4,232 total THM; n = 4,080 bromoform; n = 4,582 chloroform; n = 4,374 bromodichloromethane; n = 4,464 dibromochloromethane). We detected statistically significant inverse associations with diabetes and eating cruciferous vegetables in all but the bromoform model. Medications did not consistently predict blood levels. Afternoon/evening blood samples had lower THM concentrations than morning samples. In a subsample (n = 230), air chloroform better predicted blood chloroform than water chloroform, suggesting showering/bathing was a more important source than drinking. We identified several factors associated with blood THMs that may affect their metabolism. The potential health implications require further study.

  17. Multilevel predictors of adolescent physical activity: a longitudinal analysis

    Directory of Open Access Journals (Sweden)

    Hearst Mary O

    2012-02-01

    Full Text Available Abstract Background To examine how factors from a social ecologic model predict physical activity (PA among adolescents using a longitudinal analysis. Methods Participants in this longitudinal study were adolescents (ages 10-16 at baseline and one parent enrolled in the Transdisciplinary Research on Energetics and Cancer-Identifying Determinants of Eating and Activity (TREC-IDEA and the Etiology of Childhood Obesity (ECHO. Both studies were designed to assess a socio-ecologic model of adolescent obesity risk. PA was collected using ActiGraph activity monitors at two time points 24 months apart. Other measures included objective height and weight, adolescent and parent questionnaires on multilevel psychological, behavioral and social determinants of PA, and a home PA equipment inventory. Analysis was conducted using SAS, including descriptive characteristics, bivariate and stepped multivariate mixed models, using baseline adjustment. Models were stratified by gender. Results There were 578 adolescents with complete data. Results suggest few statistically significant longitudinal associations with physical activity measured as minutes of MVPA or total counts from accelerometers. For boys, greater self-efficacy (B = 0.75, p = 0.01 and baseline MVPA (B = 0.55, p p = 0.01 and barriers (B = -0.32, p = 0.05 significantly predicted MVPA at follow-up in the full model. The full multilevel model explained 30% of the variance in PA among boys and 24% among girls. Conclusions PA change in adolescents is a complex issue that is not easily understood. Our findings suggest early PA habits are the most important predictor of PA levels in adolescence. Intervention may be necessary prior to middle school to maintain PA through adolescence.

  18. Psychosocial predictors of coronary artery calcification progression in postmenopausal women.

    Science.gov (United States)

    Low, Carissa A; Matthews, Karen A; Kuller, Lewis H; Edmundowicz, Daniel

    2011-01-01

    Coronary artery calcification (CAC) has been associated with psychosocial factors in some but not all cross-sectional analyses. The goal of this study was to determine whether positive and negative psychosocial factors prospectively predict CAC progression in postmenopausal women. Participants from the Healthy Women Study who also participated in the Pittsburgh Mind-Body Center protocol (n = 149) completed self-report psychosocial measures before two electron beam computed tomographic scans of CAC separated by an average of 3.3 years. Results of exploratory factor analysis were used to create aggregate psychosocial indices: psychological risk (depressive symptoms, perceived stress, cynicism, and anger-in) and psychosocial resources (optimism, purpose in life, mastery, self-esteem, and social support). The psychological risk index predicted significantly greater CAC progression over 3 years (β = 0.16, p = .035, ΔR(2) = 0.03), whereas the psychosocial resources index was not predictive of CAC progression (β = -0.08, p = .30, ΔR(2) = 0.01). On individual scales, higher scores on cynicism emerged as a significant predictor of CAC progression, along with a trend linking anger-in to atherosclerosis progression. A post hoc analysis showed a significant interaction between cynicism and anger-in (β = 0.20, p = .01, ΔR(2) = 0.03), such that women reporting high levels of both cynicism and anger suppression exhibited the most CAC progression. These findings highlight psychosocial risk factors that may accelerate the progression of subclinical atherosclerosis in older women, suggest the potential importance of examining combinations of psychosocial risk factors, and identify potential targets for psychological interventions to reduce cardiovascular risk.

  19. Predictors and moderators of response to internet-delivered Interpersonal Psychotherapy and Cognitive Behaviour Therapy for depression.

    NARCIS (Netherlands)

    Donker, T.; Batterham, P.J.; Warmerdam, L.; Bennett, K.; Bennett, A.; Cuijpers, P.; Griffiths, K.M.

    2013-01-01

    Background: By identifying which predictors and moderators lead to beneficial outcomes, accurate selection of the best initial treatment will have significant benefits for depressed individuals. Method: An automated, fully self-guided randomized controlled internet-delivered noninferiority trial was

  20. Socioeconomic factors as predictors of organ donation.

    Science.gov (United States)

    Shah, Malay B; Vilchez, Valery; Goble, Adam; Daily, Michael F; Berger, Jonathan C; Gedaly, Roberto; DuBay, Derek A

    2018-01-01

    Despite numerous initiatives to increase solid organs for transplant, the gap between donors and recipients widens. There is little in the literature identifying socioeconomic predictors for donation. We evaluate the correlation between socioeconomic factors and familial authorization for donation. A retrospective analysis of adult potential donor referrals between 2007 and 2012 to our organ procurement organization (OPO) was performed. Potential donor information was obtained from the OPO database, death certificates, and the US Census Report. Data on demographics, education, residence, income, registry status, cause and manner of death, as well as OPO assessments and approach for donation were collected. End point was familial authorization for donation. A total of 1059 potential donors were included, with an overall authorization rate of 47%. The majority was not on the donor registry (73%). Younger donors (18-39 y: odds ratio [OR] = 4.9, P donation first mentioned by the local health care provider (OR = 1.8, P = 0.01) were also independently associated with higher authorization rates. Donor registration correlated most strongly with the highest authorization rates. These results indicate that public educational efforts in populations with unfavorable socioeconomic considerations may be beneficial in improving donor registration. Collaborations with local providers as well as OPO in-hospital assessments and approach techniques can help with improving authorization rates. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Predictors of restraint use among child occupants.

    Science.gov (United States)

    Benedetti, Marco; Klinich, Kathleen D; Manary, Miriam A; Flannagan, Carol A

    2017-11-17

    The objective of this study was to identify factors that predict restraint use and optimal restraint use among children aged 0 to 13 years. The data set is a national sample of police-reported crashes for years 2010-2014 in which type of child restraint is recorded. The data set was supplemented with demographic census data linked by driver ZIP code, as well as a score for the state child restraint law during the year of the crash relative to best practice recommendations for protecting child occupants. Analysis used linear regression techniques. The main predictor of unrestrained child occupants was the presence of an unrestrained driver. Among restrained children, children had 1.66 (95% confidence interval, 1.27, 2.17) times higher odds of using the recommended type of restraint system if the state law at the time of the crash included requirements based on best practice recommendations. Children are more likely to ride in the recommended type of child restraint when their state's child restraint law includes wording that follows best practice recommendations for child occupant protection. However, state child restraint law requirements do not influence when caregivers fail to use an occupant restraint for their child passengers.

  2. Illicit substance use among adolescents: a matrix of prospective predictors.

    Science.gov (United States)

    Petraitis, J; Flay, B R; Miller, T Q; Torpy, E J; Greiner, B

    1998-11-01

    This paper reviews findings from 58 prospective studies of illicit substance use (ISU) among adolescents. It arranges 384 findings according to three types of influence (viz., social, attitudinal, and intrapersonal) and four levels of influence (viz., ultimate, distal, proximal, and immediate). The bulk of evidence reconfirms the importance of several predictors of ISU (e.g., intentions and prior substance-related behavior, friendship patterns and peer behaviors, absence of supportive parents, psychological temperament), reveals that a few variables thought to be well-established predictors may not be (e.g., parental behaviors, parental permissiveness, depression, low self-esteem), and uncovers several variables where findings were either sparse or inconsistent (e.g., the role of public policies concerning ISU, mass media depictions of ISU, certain parenting styles, affective states, perceptions of parental disapproval for ISU, and substance-specific refusal skills). Directions for future research are discussed.

  3. Media and Life Dissatisfaction as Predictors of Body Dissatisfaction

    Directory of Open Access Journals (Sweden)

    Melissa Bittencourt Jaeger

    2015-08-01

    Full Text Available Body dissatisfaction can contribute to social, occupational and recreational losses, constituting a risk factor to health. This study aimed to evaluate the predictors of body dissatisfaction regarding demographic variables, media and life satisfaction among university students. The sample consisted of 321 participants older than 18 years. Body dissatisfaction, life dissatisfaction and media messages internalization were evaluated by Escala de Silhuetas para Adultos Brasileiros, Subjective Well-Being Scale and Sociocultural Attitudes Towards Appearance Questionnaire-3, respectively. Data were collected by an online survey tool (SurveyMonkey® and were analyzed using multiple linear regression. It was found that body dissatisfaction was positively related to inaccuracy in the perception of body size, Body Mass Index, life dissatisfaction, media messages internalization and television exposure. These findings evidence the importance of these predictors in the dynamics of body dissatisfaction, which support the development of preventive and treatment interventions.

  4. Cognitive and emotional predictors of episodic and dispositional forgiveness

    Directory of Open Access Journals (Sweden)

    Mróz Justyna

    2017-06-01

    Full Text Available The study examined the importance of cognitive (positive orientation, basic hope and emotional (positive and negative affectivity, emotional control variables for state and trait forgiveness. One hundred and thirty nine participants completed six inventories in Polish version: HFS (Thompson et al., 2005, TRIM (McCullough et al., 1998, P-Scale (Caprara et al., 2012, BHI-12 (Trzebiński & Zięba, 2003a, SUPIN (Polish version of PANAS; Watson, Clark, & Tellegen, 1988, CECS (Watson & Greer, 1983. Results showed that dispositional forgiveness (general and positive was associated with cognitive and emotional predictors, whereas episodic forgiveness primarily with certain emotional variables. In addition, the results indicated that emotional predictors merely participate in the process of reducing unforgiveness, whereas cognitive and emotional variables were shown to be necessary for full forgiveness.

  5. Predictors of the accuracy of quotation of references in peer-reviewed orthopaedic literature in relation to publications on the scaphoid.

    Science.gov (United States)

    Buijze, G A; Weening, A A; Poolman, R W; Bhandari, M; Ring, D

    2012-02-01

    Using inaccurate quotations can propagate misleading information, which might affect the management of patients. The aim of this study was to determine the predictors of quotation inaccuracy in the peer-reviewed orthopaedic literature related to the scaphoid. We randomly selected 100 papers from ten orthopaedic journals. All references were retrieved in full text when available or otherwise excluded. Two observers independently rated all quotations from the selected papers by comparing the claims made by the authors with the data and expressed opinions of the reference source. A statistical analysis determined which article-related factors were predictors of quotation inaccuracy. The mean total inaccuracy rate of the 3840 verified quotes was 7.6%. There was no correlation between the rate of inaccuracy and the impact factor of the journal. Multivariable analysis identified the journal and the type of study (clinical, biomechanical, methodological, case report or review) as important predictors of the total quotation inaccuracy rate. We concluded that inaccurate quotations in the peer-reviewed orthopaedic literature related to the scaphoid were common and slightly more so for certain journals and certain study types. Authors, reviewers and editorial staff play an important role in reducing this inaccuracy.

  6. Predictors of response to combined wake and light therapy in treatment-resistant inpatients with depression

    DEFF Research Database (Denmark)

    Kragh, Mette; Roj Larsen, Erik; Martiny, Klaus

    2018-01-01

    There is growing evidence for combined chronotherapeutic interventions as adjunctive treatments for major depression. However, as the treatments can be demanding, we need to identify predictors of response. This study aimed to describe predictors of response, remission and deterioration in the sh......There is growing evidence for combined chronotherapeutic interventions as adjunctive treatments for major depression. However, as the treatments can be demanding, we need to identify predictors of response. This study aimed to describe predictors of response, remission and deterioration...... in the short-term phase, as well as predictors of long-term response. The predictors investigated were gender, type of depression, severity of depression, treatment resistance, quetiapine use, general self-efficacy, educational level and positive diurnal variation. Follow-up data from 27 inpatients...... with moderate-to-severe depression participating in a chronotherapeutic intervention were analysed. As a supplement to standard treatment, they completed 3 wake therapy sessions in the first week, 30 min daily light treatment and sleep-time stabilisation in the entire 9-week study period. Patients had...

  7. Predictors of abnormal chest CT after blunt trauma: a critical appraisal of the literature

    International Nuclear Information System (INIS)

    Brink, M.; Kool, D.R.; Dekker, H.M.; Deunk, J.; Jager, G.J.; Kuijk, C. van; Edwards, M.J.R.; Blickman, J.G.

    2009-01-01

    Aim: To identify and to evaluate predictors that determine whether chest computed tomography (CT) is likely to reveal relevant injuries in adult blunt trauma patients. Methods: After a comprehensive literature search for original studies on blunt chest injury diagnosis, two independent observers included studies on the accuracy of parameters derived from history, physical examination, or diagnostic imaging that might predict injuries at (multidetector row) CT in adults and that allowed construction of 2 x 2 contingency tables. For each article, methodological quality was scored and relevant predictors for injuries at CT were extracted. For each predictor, sensitivity, specificity, positive and negative likelihood ratio and diagnostic odds ratio (DOR) including 95% confidence intervals were calculated. Results: Of 147 articles initially identified, the observers included 10 original studies in consensus. Abnormalities at physical examination (abnormal respiratory effort, need for assisted ventilation, reduced airentry, coma, chest wall tenderness) and pelvic fractures were significant predictors (DOR: 2.1-6.7). The presence of any injuries at conventional radiography of the chest (eight articles) was a more powerful significant predictor (DOR: 2.2-37). Abnormal chest ultrasonography (four articles) was the most accurate predictor for chest injury at CT (DOR: 491-infinite). Conclusion: The current literature indicates that in blunt trauma patients with abnormal physical examination, abnormal conventional radiography, or abnormal ultrasonography of the chest, CT was likely to reveal relevant chest injuries. However, there was no strong evidence to suggest that CT could be omitted in patients without these criteria, or whether these findings are beneficial for patients

  8. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  9. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  10. Predictors for Recurrence of Chronic Subdural Hematoma.

    Science.gov (United States)

    Hammer, Alexander; Tregubow, Alexander; Kerry, Ghassan; Schrey, Michael; Hammer, Christian; Steiner, Hans-Herbert

    2017-01-01

    This prospective study was designed to analyze the dependence of different factors on the recurrence rate of chronic subdural hematoma (cSDH) after surgical treatment. Seventy-three consecutive patients, who were surgically treated at our department due to cSDH between 2009 and 2012, were included. The following parameters were analyzed: patient age and gender, occurrence of trauma, time between trauma and admission, neurological symptoms, presence of minor diseases, intake of anticoagulation medication. We classified the results of diagnostic imaging and determined the space-consuming effect via the cerebral midline shift. In addition, we scrutinized intraoperative findings and the dependence of the position of subdural drainage on the recurrence rate of cSDH. In our patient group, cSDH recurrence was significantly associated with aphasia (p=0.008). Moreover an increased cSDH recurrence rate was observed in the patient group that had a separated manifestation of the cSDH in the preoperative diagnostic imaging (p=0.048) and received no drainage implant (p=0.016). Homogeneous isodense cSDH was associated with no apparent recurrence (p=0.037). Within the scope of this study, we detected aphasia and separated cSDH as predictors of cSDH recurrence. Homogeneous isodense cSDH seems to be a good prognostic sign regarding the risk of recurrence development. Furthermore, our data clearly emphasize the importance of surgically applied drainage implants to prevent a recurrence of cSDH.

  11. Predictors of Stress in College Students.

    Science.gov (United States)

    Saleh, Dalia; Camart, Nathalie; Romo, Lucia

    2017-01-01

    University students often face different stressful situations and preoccupations: the first contact with the university, the freedom of schedule organization, the selection of their master's degree, very selective fields, etc. The purpose of this study is to evaluate a model of vulnerability to stress in French college students. Stress factors were evaluated by a battery of six scales that was accessible online during 3 months. A total of 483 students, aged between 18 and 24 years (Mean = 20.23, standard deviation = 1.99), was included in the study. The results showed that 72.9, 86.3, and 79.3% of them were suffering from psychological distress, anxiety and depressive symptoms, respectively. More than half the sample was also suffering from low self-esteem (57.6%), little optimism (56.7%), and a low sense of self-efficacy (62.7%). Regression analyses revealed that life satisfaction, self-esteem, optimism, self-efficacy and psychological distress were the most important predictors of stress. These findings allow us to better understand stress-vulnerability factors in students and drive us to substantially consider them in prevention programs.

  12. Predictors of Patient Satisfaction in Pediatric Oncology.

    Science.gov (United States)

    Davis, Josh; Burrows, James F; Ben Khallouq, Bertha; Rosen, Paul

    To understand key drivers of patient satisfaction in pediatric hematology/oncology. The "top-box" scores of patient satisfaction surveys from 4 pediatric hematology/oncology practices were collected from 2012 to 2014 at an integrated Children's Health Network. One item, "Likelihood of recommending practice," was used as the surrogate for overall patient satisfaction, and all other items were correlated to this item. A total of 1244 satisfaction surveys were included in this analysis. The most important predictors of overall patient satisfaction were cheerfulness of practice ( r = .69), wait time ( r = .60), and staff working together ( r = .60). The lowest scoring items were getting clinic on phone, information about delays, and wait time at clinic. Families bringing their children for outpatient care in a hematology/oncology practice want to experience a cheerful and collaborative medical team. Wait time at clinic may be a key driver in the overall experience for families with children with cancer. Future work should be directed at using this evidence to drive patient experience improvement processes in pediatric hematology/oncology.

  13. Prevalence, predictors, and patient outcomes associated with physician co-management: findings from the Los Angeles Women's Health Study.

    Science.gov (United States)

    Rose, Danielle E; Tisnado, Diana M; Tao, May L; Malin, Jennifer L; Adams, John L; Ganz, Patricia A; Kahn, Katherine L

    2012-06-01

    Physician co-management, representing joint participation in the planning, decision-making, and delivery of care, is often cited in association with coordination of care. Yet little is known about how physicians manage tasks and how their management style impacts patient outcomes. To describe physician practice style using breast cancer as a model. We characterize correlates and predictors of physician practice style for 10 clinical tasks, and then test for associations between physician practice style and patient ratings of care. We queried 347 breast cancer physicians identified by a population-based cohort of women with incident breast cancer regarding care using a clinical vignette about a hypothetical 65-year-old diabetic woman with incident breast cancer. To test the association between physician practice style and patient outcomes, we linked medical oncologists' responses to patient ratings of care (physician n=111; patient n=411). After adjusting for physician and practice setting characteristics, physician practice style varied by physician specialty, practice setting, financial incentives, and barriers to referrals. Patients with medical oncologists who co-managed tasks had higher patient ratings of care. Physician practice style for breast cancer is influenced by provider and practice setting characteristics, and it is an important predictor of patient ratings. We identify physician and practice setting factors associated with physician practice style and found associations between physician co-management and patient outcomes (e.g., patient ratings of care). © Health Research and Educational Trust.

  14. Factors associated with risk of depression and relevant predictors of screening for depression in clinical practice: a cross-sectional study among HIV-infected individuals in Denmark

    DEFF Research Database (Denmark)

    Slot, Maria; Sodemann, Morten; Gabel, Charlotte

    2015-01-01

    importance that may be used to identify patients at risk of depression. METHODS: In 2013, 212 HIV-infected patients were included in a questionnaire study. We used the Beck Depression Inventory II (BDI-II) to assess the prevalence and severity of depressive symptoms. Patients with a BDI-II score ≥ 20 were...... offered a clinical evaluation by a consultant psychiatrist. Logistic regression was used to determine predictors associated with risk of depression. RESULTS: Symptoms of depression (BDI-II score ≥ 14) were observed in 75 patients (35%), and symptoms of moderate to major depression (BDI-II score ≥ 20...

  15. Rate and Predictors of the Conversion of Abstracts Presented at the Canadian Cardiovascular Congress Scientific Meetings to Full Peer-Reviewed Publications

    DEFF Research Database (Denmark)

    Abuzeid, Wael; Fosbøl, Emil Loldrup; Fosbøl, Philip Loldrup

    2013-01-01

    The rate of conversion of abstracts presented at scientific meetings into peer-reviewed published manuscripts is an important metric for medical societies, because it facilitates translation of scientific knowledge into practice. We determined the rate and predictors of conversion of scientific...... abstracts presented at the Canadian Cardiovascular Congress (CCC) from 2006 to 2010 into peer-reviewed article publications within 2 years of their initial presentation. Using a previously validated computer algorithm, we searched the International Statistical Institute Web of Science to identify peer...

  16. Duration and predictors of emergency surgical operations - basis for medical management of mass casualty incidents

    Directory of Open Access Journals (Sweden)

    Huber-Wagner S

    2009-12-01

    Full Text Available Abstract Background Hospitals have a critically important role in the management of mass causality incidents (MCI, yet there is little information to assist emergency planners. A significantly limiting factor of a hospital's capability to treat those affected is its surgical capacity. We therefore intended to provide data about the duration and predictors of life saving operations. Methods The data of 20,815 predominantly blunt trauma patients recorded in the Trauma Registry of the German-Trauma-Society was retrospectively analyzed to calculate the duration of life-saving operations as well as their predictors. Inclusion criteria were an ISS ≥ 16 and the performance of relevant ICPM-coded procedures within 6 h of admission. Results From 1,228 patients fulfilling the inclusion criteria 1,793 operations could be identified as life-saving operations. Acute injuries to the abdomen accounted for 54.1% followed by head injuries (26.3%, pelvic injuries (11.5%, thoracic injuries (5.0% and major amputations (3.1%. The mean cut to suture time was 130 min (IQR 65-165 min. Logistic regression revealed 8 variables associated with an emergency operation: AIS of abdomen ≥ 3 (OR 4,00, ISS ≥ 35 (OR 2,94, hemoglobin level ≤ 8 mg/dL (OR 1,40, pulse rate on hospital admission 120/min (OR 1,39, blood pressure on hospital admission Conclusions The mean operation time of 130 min calculated for emergency life-saving surgical operations provides a realistic guideline for the prospective treatment capacity which can be estimated and projected into an actual incident admission capacity. Knowledge of predictive factors for life-saving emergency operations helps to identify those patients that need most urgent operative treatment in case of blunt MCI.

  17. Predictors of injecting cessation among a cohort of people who inject drugs in Tijuana, Mexico.

    Science.gov (United States)

    Horyniak, Danielle; Strathdee, Steffanie A; West, Brooke S; Meacham, Meredith; Rangel, Gudelia; Gaines, Tommi L

    2018-04-01

    Little is known about the cessation of injecting drug use (IDU) among people who inject drugs (PWID) in low and middle-income settings, where access to effective interventions for reducing drug use (e.g., opioid substitution treatment; OST), may be limited. We measured the incidence and identified predictors of IDU cessation among a cohort of PWID in Tijuana, Mexico. Data were drawn from 621 participants in Proyecto El Cuete IV, a prospective cohort of PWID recruited in 2011 and interviewed biannually to 2016. A multivariable Extended Cox model was constructed to identify socio-demographic, drug use, risk environment and health-related predictors of IDU cessation (no IDU for ≥six months). 141 participants (23%) reported at least one IDU cessation event during follow-up. The crude IDU cessation rate was 7.3 per 100 person-years (95% Confidence Interval [CI]: 6.2-8.7). IDU cessation was negatively associated with injecting at least daily on average and heroin/methamphetamine co-injection in the past six months, and positively associated with testing HIV positive at baseline, being on methadone maintenance therapy in the past six months, and recent arrest. Concern for personal safety was also independently associated with IDU cessation. The rate of IDU cessation among PWID in Tijuana was low. These findings underscore the importance of expansion of services including OST to help reduce drug use and facilitate IDU cessation for those who wish to do so. In this setting, interventions addressing individual-level economic barriers as well as broader social and structural barriers to harm reduction services are integral. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Clinical predictors of facial nerve outcome after translabyrinthine resection of acoustic neuromas.

    Science.gov (United States)

    Shamji, Mohammed F; Schramm, David R; Benoit, Brien G

    2007-01-01

    The translabyrinthine approach to acoustic neuroma resection offers excellent exposure for facial nerve dissection with 95% preservation of anatomic continuity. Acceptable outcome in facial asymptomatic patients is reported at 64-90%, but transient postoperative deterioration often occurs. The objective of this study was to identify preoperative clinical presentation and intraoperative surgical findings that predispose patients to facial nerve dysfunction after acoustic neuroma surgery. The charts of 128 consecutive translabyrinthine patients were examined retrospectively to identify new clinical and intraoperative predictors of facial nerve outcome. Postoperative evaluation of patients to normal function or mild asymmetry upon close inspection (House-Brackmann grades of I or II) was defined as an acceptable outcome, with obvious asymmetry to no movement (grades III to VI) defined as unacceptable. Intraoperative nerve stimulation was performed in all cases, and clinical grading was performed by a single neurosurgeon in all cases. Among patients with no preoperative facial nerve deficit, 87% had an acceptable result. Small size (P mA (P< 0.01) were reaffirmed as predictive of functional nerve preservation. Additionally, preoperative tinnitus (P = 0.03), short duration of hearing loss (P< 0. 01), and lack of subjective tumour adherence to the facial nerve (P = 0.02) were independently correlated with positive outcome. Our experience with the translabyrinthine approach reveals the previously unestablished associations of facial nerve outcome to include presence of tinnitus and duration of hypoacusis. Independent predictors of tumour size and nerve stimulation thresholds were reaffirmed, and the subjective description of tumour adherence to the facial nerve making dissection more difficult appears to be important.